Liu, J; Turnbough, C L
1994-01-01
In Escherichia coli, expression of the pyrC gene is regulated primarily by a translational control mechanism based on nucleotide-sensitive selection of transcriptional start sites at the pyrC promoter. When intracellular levels of CTP are high, pyrC transcripts are initiated predominantly with CTP at a site 7 bases downstream of the Pribnow box. These transcripts form a stable hairpin at their 5' ends that blocks ribosome binding. When the CTP level is low and the GTP level is high, conditions found in pyrimidine-limited cells, transcripts are initiated primarily with GTP at a site 9 bases downstream of the Pribnow box. These shorter transcripts are unable to form a hairpin at their 5' ends and are readily translated. In this study, we examined the effects of nucleotide sequence and position on the selection of transcriptional start sites at the pyrC promoter. We characterized promoter mutations that systematically alter the sequence at position 7 or 9 downstream of the Pribnow box or vary the spacing between the Pribnow box and wild-type transcriptional initiation region. The results reveal preferences for particular initiating nucleotides (ATP > or = GTP > UTP >> CTP) and for starting positions downstream of the Pribnow box (7 >> 6 and 8 > 9 > 10). The results indicate that optimal nucleotide-sensitive start site switching at the wild-type pyrC promoter is the result of competition between the preferred start site (position 7) that uses the poorest initiating nucleotide (CTP) and a weak start site (position 9) that uses a good initiating nucleotide (GTP). The sequence of the pyrC promoter also minimizes the synthesis of untranslatable transcripts and provides for maximum stability of the regulatory transcript hairpin. In addition, the results show that the effects of the mutations on pyrC expression and regulation are consistent with the current model for translational control. Possible effects of preferences for initiating nucleotides and start sites on the expression and regulation of other genes are discussed. Images PMID:7910603
Shaver, Donna J.; Lamont, Margaret M.; Maxwell, Sharon; Walker, Jennifer Shelby; Dillingham, Ted
2016-01-01
A head-started Kemp’s ridley sea turtle (Lepidochelys kempii) was documented nesting on South Walton Beach, Florida on 25 May 2015. This record supports the possibility that exposure to Florida waters after being held in captivity through 1–3 yrs of age during the head-starting process may have influenced future nest site selection of this and perhaps other Kemp’s ridley turtles. Such findings could have important ramifications for marine water experimentation and release site selection for turtles that have been reared in captivity.
Jenks, M Harley; O'Rourke, Thomas W; Reines, Daniel
2008-06-01
The IMD2 gene in Saccharomyces cerevisiae is regulated by intracellular guanine nucleotides. Regulation is exerted through the choice of alternative transcription start sites that results in synthesis of either an unstable short transcript terminating upstream of the start codon or a full-length productive IMD2 mRNA. Start site selection is dictated by the intracellular guanine nucleotide levels. Here we have mapped the polyadenylation sites of the upstream, unstable short transcripts that form a heterogeneous family of RNAs of approximately 200 nucleotides. The switch from the upstream to downstream start sites required the Rpb9 subunit of RNA polymerase II. The enzyme's ability to locate the downstream initiation site decreased exponentially as the start was moved downstream from the TATA box. This suggests that RNA polymerase II's pincer grip is important as it slides on DNA in search of a start site. Exosome degradation of the upstream transcripts was highly dependent upon the distance between the terminator and promoter. Similarly, termination was dependent upon the Sen1 helicase when close to the promoter. These findings extend the emerging concept that distinct modes of termination by RNA polymerase II exist and that the distance of the terminator from the promoter, as well as its sequence, is important for the pathway chosen.
Tsunekawa, Ryuji; Hanaya, Kengo; Higashibayashi, Shuhei; Sugai, Takeshi
2018-04-26
Fisetin and 2',4',6'-trihydroxydihyrochalcone 4'-O-β-neohesperidoside were synthesized from commercially available quercetin and naringin in five steps. The key steps are site-selective deacetylation and subsequent deoxygenation. The target molecules were obtained in 37% and 23% yields from the starting materials, respectively.
Radioactive waste management in Poland status and strategy for the future
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wlodarski, J.
1995-12-01
Site selection for a new radioactive waste repository in Poland has been started. The repository will contain low- and intermediate-level radioactive wastes and spent fuel. Superficial, shallow underground and deep underground disposal options were considered; 39 potential sites have been selected. Issues to be resolved regarding waste management in Poland are also outlined in this paper.
ERIC Educational Resources Information Center
Syracuse Univ., NY. Div. of Special Education and Rehabilitation.
An evaluation of the costs of serving handicapped children in Head Start was based on information collected in conjunction with on-site visits to regular Head Start programs, experimental programs, and specially selected model preschool programs, and from questionnaires completed by 1,353 grantees and delegate agencies of regular Head Start…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jung, Haeryong; Lee, Eunyong; Jeong, YiYeong
Korea Radioactive-waste Management Corporation (KRMC) established in 2009 has started a new project to collect information on long-term stability of deep geological environments on the Korean Peninsula. The information has been built up in the integrated natural barrier database system available on web (www.deepgeodisposal.kr). The database system also includes socially and economically important information, such as land use, mining area, natural conservation area, population density, and industrial complex, because some of this information is used as exclusionary criteria during the site selection process for a deep geological repository for safe and secure containment and isolation of spent nuclear fuel andmore » other long-lived radioactive waste in Korea. Although the official site selection process has not been started yet in Korea, current integrated natural barrier database system and socio-economic database is believed that the database system will be effectively utilized to narrow down the number of sites where future investigation is most promising in the site selection process for a deep geological repository and to enhance public acceptance by providing readily-available relevant scientific information on deep geological environments in Korea. (authors)« less
Two alternative ways of start site selection in human norovirus reinitiation of translation.
Luttermann, Christine; Meyers, Gregor
2014-04-25
The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
1999-03-01
This decision document presents the selected No Further Action decision for the Bennington Landfill Site (the Site), located in Bennington, Vermont. EPA will perform 10 years of additional monitoring of the groundwater, surface water, and sediments starting with the completion of the NTCRA.
Malhotra, Sanandan; Justice, James; Morgan, Robin
2017-01-01
Avian leukosis virus (ALV) is a simple retrovirus that causes a wide range of tumors in chickens, the most common of which are B-cell lymphomas. The viral genome integrates into the host genome and uses its strong promoter and enhancer sequences to alter the expression of nearby genes, frequently inducing tumors. In this study, we compare the preferences for ALV integration sites in cultured cells and in tumors, by analysis of over 87,000 unique integration sites. In tissue culture we observed integration was relatively random with slight preferences for genes, transcription start sites and CpG islands. We also observed a preference for integrations in or near expressed and spliced genes. The integration pattern in cultured cells changed over the course of selection for oncogenic characteristics in tumors. In comparison to tissue culture, ALV integrations are more highly selected for proximity to transcription start sites in tumors. There is also a significant selection of ALV integrations away from CpG islands in the highly clonally expanded cells in tumors. Additionally, we utilized a high throughput method to quantify the magnitude of clonality in different stages of tumorigenesis. An ALV-induced tumor carries between 700 and 3000 unique integrations, with an average of 2.3 to 4 copies of proviral DNA per infected cell. We observed increasing tumor clonality during progression of B-cell lymphomas and identified gene players (especially TERT and MYB) and biological processes involved in tumor progression. PMID:29099869
DOT National Transportation Integrated Search
1978-03-01
This report deals with the selection of a test site, the design of a test installation, equipment selection, the installation and start-up of a pneumatic pipeline system for the transportation of tunnel muck. A review of prior pneumatic applications ...
NASA Astrophysics Data System (ADS)
Goto, J.; Miwa, T.; Tsuchi, H.; Karasaki, K.
2009-12-01
The Nuclear Waste Management Organization of Japan (NUMO), after volunteering municipalities arise, will start a three-staged program for selecting a HLW and TRU waste repository site. It is recognized from experiences from various site characterization programs in the world that the hydrologic property of faults is one of the most important parameters in the early stage of the program. It is expected that numerous faults of interest exist in an investigation area of several tens of square kilometers. It is, however, impossible to characterize all these faults in a limited time and budget. This raises problems in the repository designing and safety assessment that we may have to accept unrealistic or over conservative results by using a single model or parameters for all the faults in the area. We, therefore, seek to develop an efficient and practical methodology to characterize hydrologic property of faults. This project is a five year program started in 2007, and comprises the basic methodology development through literature study and its verification through field investigations. The literature study tries to classify faults by correlating their geological features with hydraulic property, to search for the most efficient technology for fault characterization, and to develop a work flow diagram. The field investigation starts from selection of a site and fault(s), followed by existing site data analyses, surface geophysics, geological mapping, trenching, water sampling, a series of borehole investigations and modeling/analyses. Based on the results of the field investigations, we plan to develop a systematic hydrologic characterization methodology of faults. A classification method that correlates combinations of geological features (rock type, fault displacement, fault type, position in a fault zone, fracture zone width, damage zone width) with widths of high permeability zones around a fault zone was proposed through a survey on available documents of the site characterization programs. The field investigation started in 2008, by selecting the Wildcat Fault that cut across the Laurence Berkeley National Laboratory (LBNL) site as the target. Analyses on site-specific data, surface geophysics, geological mapping and trenching have confirmed the approximate location and characteristics of the fault (see Session H48, Onishi, et al). The plan for the remaining years includes borehole investigations at LBNL, and another series of investigations in the northern part of the Wildcat Fault.
Biocatalytic site- and enantioselective oxidative dearomatization of phenols
NASA Astrophysics Data System (ADS)
Baker Dockrey, Summer A.; Lukowski, April L.; Becker, Marc R.; Narayan, Alison R. H.
2018-02-01
The biocatalytic transformations used by chemists are often restricted to simple functional-group interconversions. In contrast, nature has developed complexity-generating biocatalytic reactions within natural product pathways. These sophisticated catalysts are rarely employed by chemists, because the substrate scope, selectivity and robustness of these catalysts are unknown. Our strategy to bridge the gap between the biosynthesis and synthetic chemistry communities leverages the diversity of catalysts available within natural product pathways. Here we show that, starting from a suite of biosynthetic enzymes, catalysts with complementary substrate scope as well as selectivity can be identified. This strategy has been applied to the oxidative dearomatization of phenols, a chemical transformation that rapidly builds molecular complexity from simple starting materials and cannot be accomplished with high selectivity using existing catalytic methods. Using enzymes from biosynthetic pathways, we have successfully developed a method to produce ortho-quinol products with controlled site- and stereoselectivity. Furthermore, we have capitalized on the scalability and robustness of this method in gram-scale reactions as well as multi-enzyme and chemoenzymatic cascades.
O’Neil, So; Cook, Benjamin; Trebino, Lisa; Walker, Deborah Klein
2009-01-01
To describe the characteristics, access, utilization, satisfaction, and outcomes of Healthy Start participants in eight selected sites, a survey of Healthy Start participants with infants ages 6–12-months-old at time of interview was conducted between October 2006 and January 2007. The response rate was 66% (n = 646), ranging from 37% in one site to >70% in seven sites. Healthy Start participants’ outcomes were compared to two national benchmarks. Healthy Start participants reported that they were satisfied with the program (>90% on five measures). Level of unmet need was 6% or less for most services, except for dental appointments (11%), housing (13%), and child care (11%). Infants had significantly better access to medical care than did their mothers, with higher rates of insurance coverage, medical homes, and checkups, and fewer unmet needs for health care. Healthy Start participants’ rates of ever breastfeeding (72%) and putting infants to sleep on their backs (70%) were at or near the Healthy People 2010 objectives, and considerably higher than rates among low-income mothers in the ECLS. The high rate of health education (>90%) may have contributed to these outcomes. Elimination of smoking among Healthy Start participants (46%) fell short of the Healthy People 2010 objective (99%). The low-birth weight (LBW) rate among Black Healthy Start participants (14%) was three times higher than the rate for Whites and Hispanics (5% each). Overall, the LBW rate in the eight sites (7.5%) was similar to the rate for low-income mothers in the ECLS, but both rates were above the Healthy People 2010 objective (5%). Challenges remain in reducing disparities in maternal and child health outcomes. Further attention to risk factors associated with LBW (especially smoking) may help close the gaps. The life course theory suggests that improved outcomes may require longer-term investments. Healthy Start’s emerging focus on interconception care has the potential to address longer-term needs of participants. PMID:19590941
Bosnidou, Alexandra E; Millán, Alba; Ceballos, Javier; Martínez, Claudio; Muñiz, Kilian
2016-08-05
Defined hypervalent iodine reagents of the general structure PhI[N(SO2R)(SO2R')]2 promote the selective direct C-H-amination of the indole core of various tryptamines. Starting from a general C2-amination strategy, subsequent transformations enable a variety of site-selective functionalizations, which proceed with noteworthy high chemoselectivity and provide an overall access to structurally diversified products.
Site-selective arene C-H amination via photoredox catalysis.
Romero, Nathan A; Margrey, Kaila A; Tay, Nicholas E; Nicewicz, David A
2015-09-18
Over the past several decades, organometallic cross-coupling chemistry has developed into one of the most reliable approaches to assemble complex aromatic compounds from preoxidized starting materials. More recently, transition metal-catalyzed carbon-hydrogen activation has circumvented the need for preoxidized starting materials, but this approach is limited by a lack of practical amination protocols. Here, we present a blueprint for aromatic carbon-hydrogen functionalization via photoredox catalysis and describe the utility of this strategy for arene amination. An organic photoredox-based catalyst system, consisting of an acridinium photooxidant and a nitroxyl radical, promotes site-selective amination of a variety of simple and complex aromatics with heteroaromatic azoles of interest in pharmaceutical research. We also describe the atom-economical use of ammonia to form anilines, without the need for prefunctionalization of the aromatic component. Copyright © 2015, American Association for the Advancement of Science.
Fission yeast retrotransposon Tf1 integration is targeted to 5' ends of open reading frames.
Behrens, R; Hayles, J; Nurse, P
2000-12-01
Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100-420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed.
Fission yeast retrotransposon Tf1 integration is targeted to 5′ ends of open reading frames
Behrens, Ralf; Hayles, Jacky; Nurse, Paul
2000-01-01
Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100–420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed. PMID:11095681
Inter- and intraspecific grafting and breeding of five-needle pines
Clifford E. Ahlgren
1970-01-01
The forest tree improvement work at the Center was started in 1949 with the introduction of some of Dr. Riker's grafted eastern white pine selections. Subsequently a program of selecting, grafting, breeding and testing for resistance was begun. The work was initiated at Basswood Lake (15 miles NE of Ely, Minnesota) rather than elsewhere on a more accessible site...
Preparation of Metal Nanowire Decorated Carbon Allotropes
NASA Technical Reports Server (NTRS)
Southward, Robin E. (Inventor); Ghose, Sayata (Inventor); Connell, John W. (Inventor); Delozier, Donavon Mark (Inventor); Smith, Joseph G. (Inventor); Watson, Kent A. (Inventor)
2014-01-01
In the method of embodiments of the invention, the metal seeded carbon allotropes are reacted in solution forming zero valent metallic nanowires at the seeded sites. A polymeric passivating reagent, which selects for anisotropic growth is also used in the reaction to facilitate nanowire formation. The resulting structure resembles a porcupine, where carbon allotropes have metallic wires of nanometer dimensions that emanate from the seed sites on the carbon allotrope. These sites are populated by nanowires having approximately the same diameter as the starting nanoparticle diameter.
Preparation of Metal Nanowire Decorated Carbon Allotropes
NASA Technical Reports Server (NTRS)
Smith, Jr., Joseph G. (Inventor); Ghose, Sayata (Inventor); Connell, John W. (Inventor); Southward, Robin E. (Inventor); Delozier, Donavon Mark (Inventor); Watson, Kent A. (Inventor)
2016-01-01
In the method of embodiments of the invention, the metal seeded carbon allotropes are reacted in solution forming zero valent metallic nanowires at the seeded sites. A polymeric passivating reagent, which selects for anisotropic growth is also used in the reaction to facilitate nanowire formation. The resulting structure resembles a porcupine, where carbon allotropes have metallic wires of nanometer dimensions that emanate from the seed sites on the carbon allotrope. These sites are populated by nanowires having approximately the same diameter as the starting nanoparticle diameter.
Studtmann, Katrin; Ölschläger-Schütt, Janin; Buck, Friedrich; Richter, Dietmar; Sala, Carlo; Bockmann, Jürgen; Kindler, Stefan; Kreienkamp, Hans-Jürgen
2014-01-01
Local protein synthesis in dendrites enables neurons to selectively change the protein complement of individual postsynaptic sites. Though it is generally assumed that this mechanism requires tight translational control of dendritically transported mRNAs, it is unclear how translation of dendritic mRNAs is regulated. We have analyzed here translational control elements of the dendritically localized mRNA coding for the postsynaptic scaffold protein Shank1. In its 5′ region, the human Shank1 mRNA exhibits two alternative translation initiation sites (AUG+1 and AUG+214), three canonical upstream open reading frames (uORFs1-3) and a high GC content. In reporter assays, fragments of the 5′UTR with high GC content inhibit translation, suggesting a contribution of secondary structures. uORF3 is most relevant to translation control as it overlaps with the first in frame start codon (AUG+1), directing translation initiation to the second in frame start codon (AUG+214). Surprisingly, our analysis points to an additional uORF initiated at a non-canonical ACG start codon. Mutation of this start site leads to an almost complete loss of translation initiation at AUG+1, demonstrating that this unconventional uORF is required for Shank1 synthesis. Our data identify a novel mechanism whereby initiation at a non-canonical site allows for translation of the main Shank1 ORF despite a highly structured 5′UTR. PMID:24533096
Velagapudi, Sai Pradeep; Disney, Matthew D
2013-10-15
RNA is an extremely important target for the development of chemical probes of function or small molecule therapeutics. Aminoglycosides are the most well studied class of small molecules to target RNA. However, the RNA motifs outside of the bacterial rRNA A-site that are likely to be bound by these compounds in biological systems is largely unknown. If such information were known, it could allow for aminoglycosides to be exploited to target other RNAs and, in addition, could provide invaluable insights into potential bystander targets of these clinically used drugs. We utilized two-dimensional combinatorial screening (2DCS), a library-versus-library screening approach, to select the motifs displayed in a 3×3 nucleotide internal loop library and in a 6-nucleotide hairpin library that bind with high affinity and selectivity to six aminoglycoside derivatives. The selected RNA motifs were then analyzed using structure-activity relationships through sequencing (StARTS), a statistical approach that defines the privileged RNA motif space that binds a small molecule. StARTS allowed for the facile annotation of the selected RNA motif-aminoglycoside interactions in terms of affinity and selectivity. The interactions selected by 2DCS generally have nanomolar affinities, which is higher affinity than the binding of aminoglycosides to a mimic of their therapeutic target, the bacterial rRNA A-site. Copyright © 2013 Elsevier Ltd. All rights reserved.
Velagapudi, Sai Pradeep; Disney, Matthew D.
2013-01-01
RNA is an extremely important target for the development of chemical probes of function or small molecule therapeutics. Aminoglycosides are the most well studied class of small molecules to target RNA. However, the RNA motifs outside of the bacterial rRNA A-site that are likely to be bound by these compounds in biological systems is largely unknown. If such information were known, it could allow for aminoglycosides to be exploited to target other RNAs and, in addition, could provide invaluable insights into potential bystander targets of these clinically used drugs. We utilized two-dimensional combinatorial screening (2DCS), a library-versus-library screening approach, to select the motifs displayed in a 3 × 3 nucleotide internal loop library and in a 6-nucleotide hairpin library that bind with high affinity and selectivity to six aminoglycoside derivatives. The selected RNA motifs were then analyzed using structure–activity relationships through sequencing (StARTS), a statistical approach that defines the privileged RNA motif space that binds a small molecule. StARTS allowed for the facile annotation of the selected RNA motif–aminoglycoside interactions in terms of affinity and selectivity. The interactions selected by 2DCS generally have nanomolar affinities, which is higher affinity than the binding of aminoglycosides to a mimic of their therapeutic target, the bacterial rRNA A-site. PMID:23719281
The Lawrence Berkeley Laboratory geothermal program in northern Nevada
NASA Technical Reports Server (NTRS)
Mirk, K. F.; Wollenberg, H. A.
1974-01-01
The Lawrence Berkeley Laboratory's geothermal program began with consideration of regions where fluids in the temperature range of 150 to 230 C may be economically accessible. Three valleys, located in an area of high regional heat flow in north central Nevada, were selected for geological, geophysical, and geochemical field studies. The objective of these ongoing field activities is to select a site for a 10-MW demonstration plant. Field activities (which started in September 1973) are described. A parallel effort has been directed toward the conceptual design of a 10-MW isobutane binary plant which is planned for construction at the selected site. Design details of the plant are described. Project schedule with milestones is shown together with a cost summary of the project.
Link, Gerhard
1984-01-01
A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540
The ABE/AMH Manual. An Instructional Guide for ABE Programs Serving Mentally Handicapped Adults.
ERIC Educational Resources Information Center
Lehman, Scott C.; Edgar, S. Keith
This handbook provides adult basic education teachers with instructional materials for working with adult mentally handicapped students. Section 1 examines planning programs for adult mentally retarded students (getting started, specific considerations, various kinds of program sites) and implementing instruction (staff selection and training).…
Site Selection for the Disposal of LLW in Taiwan
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chuang, W.S.; Chi, L.M.; Tien, N.C.
2006-07-01
This paper presents the implementation status of the low-level radioactive waste (LLW) disposal program in Taiwan, including the disposal facility regulations, status of waste management, final disposal program, licensing procedures, waste acceptance criteria, site selection criteria and processes and preliminary disposal concepts. The first phase of site selection for low-level radioactive waste final disposal in Taiwan was implemented between 1992 and 2002. The site selection process adopted a Geographic Information System (GIS), Hierarchical Analysis System, Expert Evaluation System, and site reconnaissance. An incentive program for voluntary sites was also initiated. After a series of evaluations and discussion of 30 potentialmore » candidate sites, including 8 recommended sites, 5 qualified voluntary townships, and several remote uninhabited small islets, Hsiao-chiou islet was selected as the first priority candidate site in February 1998. The geological investigation work in Hsiao-chiou was conducted from March 1999 through October 2000. An Environmental Impact Statement Report (EIS) and the Investment Feasibility Study Report (IFS) were submitted to the Environmental Protection Agency (EPA) in November 2000 and to the Ministry of Economic Affairs (MOEA) in June 2001, respectively. Unfortunately, the site investigation was discontinued in 2002 due to political and public acceptance consideration. After years of planning, the second phase of the site selection process was launched in August 2004 and will be conducted through 2008. It is planned that a repository will be constructed in early 2009 and start to operate in 2014. The site selection process for the second phase is based on the earlier work and four potential candidate sites were selected for evaluation until 2005. A near surface disposal concept is proposed for a site located in the Taiwan strait, and cavern disposal concepts are proposed for three other sites located on the main island. This paper presents the implementation status of the LLW disposal program in Taiwan, including the disposal facility regulations, status of waste management, final disposal program, licensing procedures, waste acceptance criteria, site selection criteria and processes, and preliminary disposal concepts 'NIMBY' (Not in my backyard) is a critical problem for implementation of the final disposal project. Resistance from local communities has been continuously received during site characterization. To overcome this, an incentive program to encourage community acceptance has been approved by the Government. Programs for community promotion are being proposed and negotiations are also underway. (authors)« less
The siting program of geological repository for spent fuel/high-level waste in Czech Republic
DOE Office of Scientific and Technical Information (OSTI.GOV)
Novotny, P.
1993-12-31
The management of high-level waste in Czech Republic have a very short history, because before the year 1989 spent nuclear fuel was re-exported back to USSR. The project ``Geological research of HLW repository in Czech Republic`` was initiated during 1990 by the Ministry of the Environment of the Czech Republic and by this project delegated the Czech Geological Survey (CGU) Prague. The first CGU project late in 1990 for multibarrier concept has proposed a geological repository to be located at a depth of about 500 m. Screening and studies of potential sites for repository started in 1991. First stage representedmore » regional siting of the Czech Republic for perspective rock types and massifs. In cooperation with GEOPHYSICS Co., Geophysical Institute of the Czech Academy of Sciences and Charles University Prague 27 perspective regions were selected, using criteria IAEA. This work in the Czech Republic was possible thanks to the detailed geological studies done in the past and thanks to the numerous archive data, concentrated in the central geological archive GEOFOND. Selection of perspective sites also respected natural conservation regions, regions conserving water and mineral waters resources. CGU opened up contact with countries with similar geological situation and started cooperation with SKB (Swedish Nuclear Fuel and Waste Management Co.). The Project of geological research for the next 10 years is a result of these activities.« less
Prediction of lysine ubiquitylation with ensemble classifier and feature selection.
Zhao, Xiaowei; Li, Xiangtao; Ma, Zhiqiang; Yin, Minghao
2011-01-01
Ubiquitylation is an important process of post-translational modification. Correct identification of protein lysine ubiquitylation sites is of fundamental importance to understand the molecular mechanism of lysine ubiquitylation in biological systems. This paper develops a novel computational method to effectively identify the lysine ubiquitylation sites based on the ensemble approach. In the proposed method, 468 ubiquitylation sites from 323 proteins retrieved from the Swiss-Prot database were encoded into feature vectors by using four kinds of protein sequences information. An effective feature selection method was then applied to extract informative feature subsets. After different feature subsets were obtained by setting different starting points in the search procedure, they were used to train multiple random forests classifiers and then aggregated into a consensus classifier by majority voting. Evaluated by jackknife tests and independent tests respectively, the accuracy of the proposed predictor reached 76.82% for the training dataset and 79.16% for the test dataset, indicating that this predictor is a useful tool to predict lysine ubiquitylation sites. Furthermore, site-specific feature analysis was performed and it was shown that ubiquitylation is intimately correlated with the features of its surrounding sites in addition to features derived from the lysine site itself. The feature selection method is available upon request.
Svensson, O; Kvarnemo, C
2003-09-01
Both natural selection and sexual selection may act on nest-building. We tested experimentally how different regimes of egg-predation and male-male competition influence nest-building before mating, using the marine fish sand goby, Pomatoschistus minutus. Males with sneaker males present built the smallest nest-openings, smaller than males held alone or with Pomatoschistus microps males (which may predate eggs and compete over nest-sites but not compete over fertilizations). Males with visual access to other nest-building males tended also to build smaller openings than males held alone or with P. microps. Males with egg-predators present built nests with openings not differing significantly from any other treatment. Our results indicate that the small nest-openings found in the sneaker male treatment are sexually selected through protection against sneaking or by female choice. Across treatments, time span before a male started to build his nest also explained variation in nest-opening width; males starting late built larger nest-openings.
Propulsive maneuver design for the Mars Exploration Rover mission
NASA Technical Reports Server (NTRS)
Potts, Christopher L.; Kangas, Julie A.; Raofi, Behzad
2006-01-01
Starting from approximately 150 candidate Martian landing sites, two distinct sites have been selected for further investigation by sophisticated rovers. The two rovers, named 'Spirit' and 'Opportunity', begin the surface mission respectively to Gusec Crater and Meridiani Planum in January 2004. the rovers are essentially robotic geologists, sent on a mission to research for evidence in the rocks and soil pertaining to the historical presence of water and the ability to possibly sustain life. Before this scientific search can commence, precise trajectory targeting and control is necessary to achieve the entry requirements for the selected landing sites within the constraints of the flight system. The maneuver design challenge is to meet or exceed these requirements while maintaining the necessary design flexibility to accommodate additional project concerns. Opportunities to improve performance and reduce risk based on trajectory control characteristics are also evaluated.
Wade, S.; Greenberg, S.
2009-01-01
This paper introduces the concept of social site characterization as a parallel effort to technical site characterization to be used in evaluating and planning carbon dioxides capture and storage (CCS) projects. Social site characterization, much like technical site characterization, relies on a series of iterative investigations into public attitudes towards a CCS project and the factors that will shape those views. This paper also suggests ways it can be used to design approaches for actively engaging stakeholders and communities in the deployment of CCS projects. This work is informed by observing the site selection process for FutureGen and the implementation of research projects under the Regional Carbon Sequestration Partnership Program. ?? 2009 Elsevier Ltd. All rights reserved.
Suh, E R; Waring, R B
1990-01-01
It has been proposed that recognition of the 3' splice site in many group I introns involves base pairing between the start of the 3' exon and a region of the intron known as the internal guide sequence (R. W. Davies, R. B. Waring, J. Ray, T. A. Brown, and C. Scazzocchio, Nature [London] 300:719-724, 1982). We have examined this hypothesis, using the self-splicing rRNA intron from Tetrahymena thermophila. Mutations in the 3' exon that weaken this proposed pairing increased use of a downstream cryptic 3' splice site. Compensatory mutations in the guide sequence that restore this pairing resulted in even stronger selection of the normal 3' splice site. These changes in 3' splice site usage were more pronounced in the background of a mutation (414A) which resulted in an adenine instead of a guanine being the last base of the intron. These results show that the proposed pairing (P10) plays an important role in ensuring that cryptic 3' splice sites are selected against. Surprisingly, the 414A mutation alone did not result in activation of the cryptic 3' splice site. Images PMID:2342465
PreTIS: A Tool to Predict Non-canonical 5’ UTR Translational Initiation Sites in Human and Mouse
Reuter, Kerstin; Helms, Volkhard
2016-01-01
Translation of mRNA sequences into proteins typically starts at an AUG triplet. In rare cases, translation may also start at alternative non–AUG codons located in the annotated 5’ UTR which leads to an increased regulatory complexity. Since ribosome profiling detects translational start sites at the nucleotide level, the properties of these start sites can then be used for the statistical evaluation of functional open reading frames. We developed a linear regression approach to predict in–frame and out–of–frame translational start sites within the 5’ UTR from mRNA sequence information together with their translation initiation confidence. Predicted start codons comprise AUG as well as near–cognate codons. The underlying datasets are based on published translational start sites for human HEK293 and mouse embryonic stem cells that were derived by the original authors from ribosome profiling data. The average prediction accuracy of true vs. false start sites for HEK293 cells was 80%. When applied to mouse mRNA sequences, the same model predicted translation initiation sites observed in mouse ES cells with an accuracy of 76%. Moreover, we illustrate the effect of in silico mutations in the flanking sequence context of a start site on the predicted initiation confidence. Our new webservice PreTIS visualizes alternative start sites and their respective ORFs and predicts their ability to initiate translation. Solely, the mRNA sequence is required as input. PreTIS is accessible at http://service.bioinformatik.uni-saarland.de/pretis. PMID:27768687
Chang, D D; Clayton, D A
1986-01-01
Transcription of the heavy strand of mouse mitochondrial DNA starts from two closely spaced, distinct sites located in the displacement loop region of the genome. We report here an analysis of regulatory sequences required for faithful transcription from these two sites. Data obtained from in vitro assays demonstrated that a 51-base-pair region, encompassing nucleotides -40 to +11 of the downstream start site, contains sufficient information for accurate transcription from both start sites. Deletion of the 3' flanking sequences, including one or both start sites to -17, resulted in the initiation of transcription by the mitochondrial RNA polymerase from alternative sites within vector DNA sequences. This feature places the mouse heavy-strand promoter uniquely among other known mitochondrial promoters, all of which absolutely require cognate start sites for transcription. Comparison of the heavy-strand promoter with those of other vertebrate mitochondrial DNAs revealed a remarkably high rate of sequence divergence among species. Images PMID:3785226
Influence of Translation Initiation on Organellar Protein Targeting in Arabidopsis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sally A. Mackenzie
2011-04-18
A primary focus of the Mackenzie laboratory is the elucidation of processes and machinery for mitochondrial genome maintenance and transmission in higher plants. We have found that numerous organellar DNA maintenance components in plants appear to be dual targeted to mitochondria and plastids. Of particular interest was the observation that some twin (tandemly arrayed) dual targeting presequences appeared to utilize non-AUG alternative translation initiation, allowing for multiple translation starts at a single gene. Two aspects of this phenomenon were of particular interest: (1) Alternative translation initiation might provide a mechanism to regulate protein targeting temporally and spatially, a possibility thatmore » had not been demonstrated previously, and (2) alternative translation initiation might occur in genes involved in nuclear-controlled mitochondrial genome recombination, thought to be exclusively mitochondrial in their function. During the course of this research, we pursued three aims, with an emphasis on two specific genes of interest: POLgamma2, an organellar DNA polymerase, and MSH1, a MutS homolog thought to participate in mitochondrial, but not plastid, genome recombination surveillance. Our aims were to (1) Identify additional genes within Arabidopsis and other genomes that employ non-AUG alternative translation initiation, (2) Locate sequences upstream to the annotated AUG that confer alternative non-AUG translation initiation activity, and (3) Identify cis and trans factors that influence start site selection in genes with non-AUG starts. Toward these ends, we have shown that non-AUG initiation occurs in a number of genes, likely influencing targeting behavior of the protein. We have also shown that start site selection is strongly influenced by Kozak consensus sequence environment, indicating that alternative translation initiation in plants occurs by relaxation of ribosome scanning.« less
Evolving artificial metalloenzymes via random mutagenesis
NASA Astrophysics Data System (ADS)
Yang, Hao; Swartz, Alan M.; Park, Hyun June; Srivastava, Poonam; Ellis-Guardiola, Ken; Upp, David M.; Lee, Gihoon; Belsare, Ketaki; Gu, Yifan; Zhang, Chen; Moellering, Raymond E.; Lewis, Jared C.
2018-03-01
Random mutagenesis has the potential to optimize the efficiency and selectivity of protein catalysts without requiring detailed knowledge of protein structure; however, introducing synthetic metal cofactors complicates the expression and screening of enzyme libraries, and activity arising from free cofactor must be eliminated. Here we report an efficient platform to create and screen libraries of artificial metalloenzymes (ArMs) via random mutagenesis, which we use to evolve highly selective dirhodium cyclopropanases. Error-prone PCR and combinatorial codon mutagenesis enabled multiplexed analysis of random mutations, including at sites distal to the putative ArM active site that are difficult to identify using targeted mutagenesis approaches. Variants that exhibited significantly improved selectivity for each of the cyclopropane product enantiomers were identified, and higher activity than previously reported ArM cyclopropanases obtained via targeted mutagenesis was also observed. This improved selectivity carried over to other dirhodium-catalysed transformations, including N-H, S-H and Si-H insertion, demonstrating that ArMs evolved for one reaction can serve as starting points to evolve catalysts for others.
Data Delivery and Mapping Over the Web: National Water-Quality Assessment Data Warehouse
Bell, Richard W.; Williamson, Alex K.
2006-01-01
The U.S. Geological Survey began its National Water-Quality Assessment (NAWQA) Program in 1991, systematically collecting chemical, biological, and physical water-quality data from study units (basins) across the Nation. In 1999, the NAWQA Program developed a data warehouse to better facilitate national and regional analysis of data from 36 study units started in 1991 and 1994. Data from 15 study units started in 1997 were added to the warehouse in 2001. The warehouse currently contains and links the following data: -- Chemical concentrations in water, sediment, and aquatic-organism tissues and related quality-control data from the USGS National Water Information System (NWIS), -- Biological data for stream-habitat and ecological-community data on fish, algae, and benthic invertebrates, -- Site, well, and basin information associated with thousands of descriptive variables derived from spatial analysis, like land use, soil, and population density, and -- Daily streamflow and temperature information from NWIS for selected sampling sites.
Croager, Emma J.; Gout, Alexander M.; Abraham, Lawrence J.
2000-01-01
CD30, as a member of the tumor necrosis factor (TNF) receptor family, is expressed on the surface of activated lymphoid cells. CD30 overexpression is a characteristic of lymphoproliferative diseases such as Hodgkin’s/non-Hodgkin’s lymphomas, embryonal carcinoma, and a number of Th2-associated diseases. The CD30 gene has been mapped to a region of the murine genome that is involved in susceptibility to systemic lupus erythematosus. Functionally, CD30 may play a role in the deletion of autoreactive T cells. We were interested in determining the molecular nature of CD30 overexpression. Sequence comparison has revealed significant identity between the TATA-less human and murine CD30 promoters; they share a number of common consensus binding motifs. Transfection assays identified three regions of transcriptional importance; the region between position −1.2 kb and −336 bp, containing a CCAT microsatellite sequence, a conserved Sp1 site at positions −43 to −38, and a downstream promoter element (DPE) at positions +24 to +29. EMSA and DNase I footprinting showed specific DNA-protein interactions of the CD30 promoter with the Sp1 site and the CCAT repeat region. The DPE element was shown to be essential for start site selection. We conclude that the conserved Sp1 site at −43 to −38 is associated with maximum reporter gene activity, the DPE element is required for start site selection, and the CCAT tetranucleotide repeats act to repress transcription. We also have shown that the microsatellite is multiallelic, when we screened a random healthy population. Further studies are required to determine whether microsatellite instability in the repressor predisposes susceptible individuals to CD30 overexpression. PMID:10793083
New Universal Rules of Eukaryotic Translation Initiation Fidelity
Zur, Hadas; Tuller, Tamir
2013-01-01
The accepted model of eukaryotic translation initiation begins with the scanning of the transcript by the pre-initiation complex from the 5′end until an ATG codon with a specific nucleotide (nt) context surrounding it is recognized (Kozak rule). According to this model, ATG codons upstream to the beginning of the ORF should affect translation. We perform for the first time, a genome-wide statistical analysis, uncovering a new, more comprehensive and quantitative, set of initiation rules for improving the cost of translation and its efficiency. Analyzing dozens of eukaryotic genomes, we find that in all frames there is a universal trend of selection for low numbers of ATG codons; specifically, 16–27 codons upstream, but also 5–11 codons downstream of the START ATG, include less ATG codons than expected. We further suggest that there is selection for anti optimal ATG contexts in the vicinity of the START ATG. Thus, the efficiency and fidelity of translation initiation is encoded in the 5′UTR as required by the scanning model, but also at the beginning of the ORF. The observed nt patterns suggest that in all the analyzed organisms the pre-initiation complex often misses the START ATG of the ORF, and may start translation from an alternative initiation start-site. Thus, to prevent the translation of undesired proteins, there is selection for nucleotide sequences with low affinity to the pre-initiation complex near the beginning of the ORF. With the new suggested rules we were able to obtain a twice higher correlation with ribosomal density and protein levels in comparison to the Kozak rule alone (e.g. for protein levels r = 0.7 vs. r = 0.31; p<10−12). PMID:23874179
Lim, Kwang-il; Klimczak, Ryan; Yu, Julie H.; Schaffer, David V.
2010-01-01
Retroviral vectors offer benefits of efficient delivery and stable gene expression; however, their clinical use raises the concerns of insertional mutagenesis and potential oncogenesis due to genomic integration preferences in transcriptional start sites (TSS). We have shifted the integration preferences of retroviral vectors by generating a library of viral variants with a DNA-binding domain inserted at random positions throughout murine leukemia virus Gag-Pol, then selecting for variants that are viable and exhibit altered integration properties. We found seven permissive zinc finger domain (ZFD) insertion sites throughout Gag-Pol, including within p12, reverse transcriptase, and integrase. Comprehensive genome integration analysis showed that several ZFD insertions yielded retroviral vector variants with shifted integration patterns that did not favor TSS. Furthermore, integration site analysis revealed selective integration for numerous mutants. For example, two retroviral variants with a given ZFD at appropriate positions in Gag-Pol strikingly integrated primarily into four common sites out of 3.1 × 109 possible human genome locations (P = 4.6 × 10-29). Our findings demonstrate that insertion of DNA-binding motifs into multiple locations in Gag-Pol can make considerable progress toward engineering safer retroviral vectors that integrate into a significantly narrowed pool of sites on human genome and overcome the preference for TSS. PMID:20616052
Disposing of High-Level Radioactive Waste in Germany - A Note from the Licensing Authority - 12530
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pick, Thomas Stefan; Bluth, Joachim; Lauenstein, Christof
Following the national German consensus on the termination of utilisation of nuclear energy in the summer of 2011, the Federal and Laender Governments have declared their intention to work together on a national consensus on the disposal of radioactive waste as well. Projected in the early 1970's the Federal Government had started exploring the possibility to establish a repository for HLW at the Gorleben site in 1977. However, there is still no repository available in Germany today. The delay results mainly from the national conflict over the suitability of the designated Gorleben site, considerably disrupting German society along the crevicemore » that runs between supporters and opponents of nuclear energy. The Gorleben salt dome is situated in Lower Saxony, the German state that also hosts the infamous Asse mine repository for LLW and ILW and the Konrad repository project designated to receive LLW and ILW as well. With the fourth German project, the Morsleben L/ILW repository only 20 km away across the state border, the state of Lower Saxony carries the main load for the disposal of radioactive waste in Germany. After more than 25 years of exploration and a 10 year moratorium the Gorleben project has now reached a cross-road. Current plans for setting up a new site selection procedure in Germany call for the selection and exploration of up to four alternative sites, depending only on suitable geology. In the meantime the discussion is still open on whether the Gorleben project should be terminated in order to pacify the societal conflict or being kept in the selection process on account of its promising geology. The Lower Saxony Ministry for Environment and Climate Protection proposes to follow a twelve-step-program for finding the appropriate site, including the Gorleben site in the process. With its long history of exploration the site is the benchmark that alternative sites will have to compare with. Following the national consensus of 2011 on the termination of nuclear energy utilisation, it is now the time to reach a national consensus on the disposal of radioactive waste as well. This is a task that the country and society, federal and state governments, political parties and the citizens will have to jointly master within the current generation and within German territory. The basis for the consensus will be a reset to the beginning of this process. It has to start with a new site selection procedure that will take into account and compare up to four alternative sites. This procedure will have to follow the principle of highest possible security. It should be based on a stepwise approach, strictly following scientific criteria. Public confidence in the process and trust can only be achieved by a transparent procedure allowing for the participation of the public and the stakeholders. It is therefore mandatory to consult, both on a national and regional level, all involved parties (public authority, scientist and citizen). The national consensus must also include a decision on the future of the Gorleben exploratory site. The site selection procedure must therefore take this site into account as well. Furthermore, the final decision on safe disposal of German radioactive wastes must be made by sovereign rule by Federal Parliament and Federal Council. (authors)« less
Enzymatic Detoxication, Conformational Selection, and the Role of Molten Globule Active Sites*
Honaker, Matthew T.; Acchione, Mauro; Zhang, Wei; Mannervik, Bengt; Atkins, William M.
2013-01-01
The role of conformational ensembles in enzymatic reactions remains unclear. Discussion concerning “induced fit” versus “conformational selection” has, however, ignored detoxication enzymes, which exhibit catalytic promiscuity. These enzymes dominate drug metabolism and determine drug-drug interactions. The detoxication enzyme glutathione transferase A1–1 (GSTA1–1), exploits a molten globule-like active site to achieve remarkable catalytic promiscuity wherein the substrate-free conformational ensemble is broad with barrierless transitions between states. A quantitative index of catalytic promiscuity is used to compare engineered variants of GSTA1–1 and the catalytic promiscuity correlates strongly with characteristics of the thermodynamic partition function, for the substrate-free enzymes. Access to chemically disparate transition states is encoded by the substrate-free conformational ensemble. Pre-steady state catalytic data confirm an extension of the conformational selection model, wherein different substrates select different starting conformations. The kinetic liability of the conformational breadth is minimized by a smooth landscape. We propose that “local” molten globule behavior optimizes detoxication enzymes. PMID:23649628
Soni, Vijay; Suryadevara, Priyanka; Sriram, Dharmarajan; Kumar, Santhosh; Nandicoori, Vinay Kumar; Yogeeswari, Perumal
2015-07-01
Persistent nature of Mycobacterium tuberculosis is one of the major factors which make the drug development process monotonous against this organism. The highly lipophilic cell wall, which constituting outer mycolic acid and inner peptidoglycan layers, acts as a barrier for the drugs to enter the bacteria. The rigidity of the cell wall is imparted by the peptidoglycan layer, which is covalently linked to mycolic acid by arabinogalactan. Uridine diphosphate-N-acetylglucosamine (UDP-GlcNAc) serves as the starting material in the biosynthesis of this peptidoglycan layers. This UDP-GlcNAc is synthesized by N-acetylglucosamine-1-phosphate uridyltransferase (GlmU(Mtb)), a bi-functional enzyme with two functional sites, acetyltransferase site and uridyltransferase site. Here, we report design and screening of nine inhibitors against UTP and NAcGlc-1-P of uridyltransferase active site of glmU(Mtb). Compound 4 was showing good inhibition and was selected for further analysis. The isothermal titration calorimetry (ITC) experiments showed the binding energy pattern of compound 4 to the uridyltransferase active site is similar to that of substrate UTP. In silico molecular dynamics (MD) simulation studies, for compound 4, carried out for 10 ns showed the protein-compound complex to be stable throughout the simulation with relative rmsd in acceptable range. Hence, these compounds can serve as a starting point in the drug discovery processes against Mycobacterium tuberculosis.
Substrate recognition by ribonucleoprotein ribonuclease MRP
Esakova, Olga; Perederina, Anna; Quan, Chao; Berezin, Igor; Krasilnikov, Andrey S.
2011-01-01
The ribonucleoprotein complex ribonuclease (RNase) MRP is a site-specific endoribonuclease essential for the survival of the eukaryotic cell. RNase MRP closely resembles RNase P (a universal endoribonuclease responsible for the maturation of the 5′ ends of tRNA) but recognizes distinct substrates including pre-rRNA and mRNA. Here we report the results of an in vitro selection of Saccharomyces cerevisiae RNase MRP substrates starting from a pool of random sequences. The results indicate that RNase MRP cleaves single-stranded RNA and is sensitive to sequences in the immediate vicinity of the cleavage site requiring a cytosine at the position +4 relative to the cleavage site. Structural implications of the differences in substrate recognition by RNases P and MRP are discussed. PMID:21173200
Substrate recognition by ribonucleoprotein ribonuclease MRP.
Esakova, Olga; Perederina, Anna; Quan, Chao; Berezin, Igor; Krasilnikov, Andrey S
2011-02-01
The ribonucleoprotein complex ribonuclease (RNase) MRP is a site-specific endoribonuclease essential for the survival of the eukaryotic cell. RNase MRP closely resembles RNase P (a universal endoribonuclease responsible for the maturation of the 5' ends of tRNA) but recognizes distinct substrates including pre-rRNA and mRNA. Here we report the results of an in vitro selection of Saccharomyces cerevisiae RNase MRP substrates starting from a pool of random sequences. The results indicate that RNase MRP cleaves single-stranded RNA and is sensitive to sequences in the immediate vicinity of the cleavage site requiring a cytosine at the position +4 relative to the cleavage site. Structural implications of the differences in substrate recognition by RNases P and MRP are discussed.
Spatially-Correlated Risk in Nature Reserve Site Selection
Albers, Heidi J.; Busby, Gwenlyn M.; Hamaide, Bertrand; Ando, Amy W.; Polasky, Stephen
2016-01-01
Establishing nature reserves protects species from land cover conversion and the resulting loss of habitat. Even within a reserve, however, many factors such as fires and defoliating insects still threaten habitat and the survival of species. To address the risk to species survival after reserve establishment, reserve networks can be created that allow some redundancy of species coverage to maximize the expected number of species that survive in the presence of threats. In some regions, however, the threats to species within a reserve may be spatially correlated. As examples, fires, diseases, and pest infestations can spread from a starting point and threaten neighboring parcels’ habitats, in addition to damage caused at the initial location. This paper develops a reserve site selection optimization framework that compares the optimal reserve networks in cases where risks do and do not reflect spatial correlation. By exploring the impact of spatially-correlated risk on reserve networks on a stylized landscape and on an Oregon landscape, this analysis demonstrates an appropriate and feasible method for incorporating such post-reserve establishment risks in the reserve site selection literature as an additional tool to be further developed for future conservation planning. PMID:26789127
NASA Astrophysics Data System (ADS)
van der Meer, Jaap; Beukema, Jan; Dekker, Rob
2002-12-01
The extent to which it pays settling larvae of marine benthic organisms to actively select the habitat where they will spend the rest of their life can only be fully appreciated if the fitness consequences of such habitat selection processes are known. We estimated the lifetime egg production of the tellinid bivalve Macoma balthica at 11 sites over a tidal gradient in the western Wadden Sea, using a 30-year data series. The difference in individual lifetime egg production between the best sites in the lower tidal zone and the poorest sites on the high tidal flats was about a factor 10. The differences in lifetime egg production were related to differences in growth and, more importantly, survival. We argue that the large observed differences in reproductive output do not necessarily imply a lack of active habitat selection. As most animals start their last migration before final settlement from the high tidal flats, the choice may be one between a long and risky migration with a low chance of reaching the good habitat versus a more certain but poor existence on the high tidal flats.
NASA Astrophysics Data System (ADS)
van der Meer, Jaap; Beukema, Jan J.; Dekker, Rob
2003-01-01
The extent to which it pays settling larvae of marine benthic organisms to actively select the habitat where they will spend the rest of their life can only be fully appreciated if the fitness consequences of such habitat selection processes are known. We estimated the lifetime egg production of the tellinid bivalve Macoma balthica at 11 sites over a tidal gradient in the western Wadden Sea, using a 30-year data series. The difference in individual lifetime egg production between the best sites in the lower tidal zone and the poorest sites on the high tidal flats was about a factor 10. The differences in lifetime egg production were related to differences in growth and, more importantly, survival. We argue that the large observed differences in reproductive output do not necessarily imply a lack of active habitat selection. As most animals start their last migration before final settlement from the high tidal flats, the choice may be one between a long and risky migration with a low chance of reaching the good habitat versus a more certain but poor existence on the high tidal flats.
Structure-Based Design and Synthesis of Potent and Selective Matrix Metalloproteinase 13 Inhibitors.
Choi, Jun Yong; Fuerst, Rita; Knapinska, Anna M; Taylor, Alexander B; Smith, Lyndsay; Cao, Xiaohang; Hart, P John; Fields, Gregg B; Roush, William R
2017-07-13
We describe the use of comparative structural analysis and structure-guided molecular design to develop potent and selective inhibitors (10d and (S)-17b) of matrix metalloproteinase 13 (MMP-13). We applied a three-step process, starting with a comparative analysis of the X-ray crystallographic structure of compound 5 in complex with MMP-13 with published structures of known MMP-13·inhibitor complexes followed by molecular design and synthesis of potent but nonselective zinc-chelating MMP inhibitors (e.g., 10a and 10b). After demonstrating that the pharmacophores of the chelating inhibitors (S)-10a, (R)-10a, and 10b were binding within the MMP-13 active site, the Zn 2+ chelating unit was replaced with nonchelating polar residues that bridged over the Zn 2+ binding site and reached into a solvent accessible area. After two rounds of structural optimization, these design approaches led to small molecule MMP-13 inhibitors 10d and (S)-17b, which bind within the substrate-binding site of MMP-13 and surround the catalytically active Zn 2+ ion without chelating to the metal. These compounds exhibit at least 500-fold selectivity versus other MMPs.
Mechanisms and regulation of DNA replication initiation in eukaryotes
Parker, Matthew W.; Botchan, Michael R.; Berger, James M.
2017-01-01
Cellular DNA replication is initiated through the action of multiprotein complexes that recognize replication start sites in the chromosome (termed origins) and facilitate duplex DNA melting within these regions. In a given cell cycle, initiation occurs only once per origin and each round of replication is tightly coupled to cell division. To avoid aberrant origin firing and re-replication, eukaryotes tightly regulate two events in the initiation process: loading of the replicative helicase, MCM2-7, onto chromatin by the Origin Recognition Complex (ORC), and subsequent activation of the helicase by incorporation into a complex known as the CMG. Recent work has begun to reveal the details of an orchestrated and sequential exchange of initiation factors on DNA that give rise to a replication-competent complex, the replisome. Here we review the molecular mechanisms that underpin eukaryotic DNA replication initiation – from selecting replication start sites to replicative helicase loading and activation – and describe how these events are often distinctly regulated across different eukaryotic model organisms. PMID:28094588
Mechanisms and regulation of DNA replication initiation in eukaryotes.
Parker, Matthew W; Botchan, Michael R; Berger, James M
2017-04-01
Cellular DNA replication is initiated through the action of multiprotein complexes that recognize replication start sites in the chromosome (termed origins) and facilitate duplex DNA melting within these regions. In a typical cell cycle, initiation occurs only once per origin and each round of replication is tightly coupled to cell division. To avoid aberrant origin firing and re-replication, eukaryotes tightly regulate two events in the initiation process: loading of the replicative helicase, MCM2-7, onto chromatin by the origin recognition complex (ORC), and subsequent activation of the helicase by its incorporation into a complex known as the CMG. Recent work has begun to reveal the details of an orchestrated and sequential exchange of initiation factors on DNA that give rise to a replication-competent complex, the replisome. Here, we review the molecular mechanisms that underpin eukaryotic DNA replication initiation - from selecting replication start sites to replicative helicase loading and activation - and describe how these events are often distinctly regulated across different eukaryotic model organisms.
Kamboj, Atul; Hallwirth, Claus V; Alexander, Ian E; McCowage, Geoffrey B; Kramer, Belinda
2017-06-17
The analysis of viral vector genomic integration sites is an important component in assessing the safety and efficiency of patient treatment using gene therapy. Alongside this clinical application, integration site identification is a key step in the genetic mapping of viral elements in mutagenesis screens that aim to elucidate gene function. We have developed a UNIX-based vector integration site analysis pipeline (Ub-ISAP) that utilises a UNIX-based workflow for automated integration site identification and annotation of both single and paired-end sequencing reads. Reads that contain viral sequences of interest are selected and aligned to the host genome, and unique integration sites are then classified as transcription start site-proximal, intragenic or intergenic. Ub-ISAP provides a reliable and efficient pipeline to generate large datasets for assessing the safety and efficiency of integrating vectors in clinical settings, with broader applications in cancer research. Ub-ISAP is available as an open source software package at https://sourceforge.net/projects/ub-isap/ .
Hullsiek, Katherine Huppler; Kagan, Jonathan M; Engen, Nicole; Grarup, Jesper; Hudson, Fleur; Denning, Eileen T; Carey, Catherine; Courtney-Rodgers, David; Finley, Elizabeth B; Jansson, Per O; Pearson, Mary T; Peavy, Dwight E; Belloso, Waldo H
2014-01-01
Background Trial monitoring protects participant safety and study integrity. While monitors commonly go on-site to verify source data, there is little evidence that this practice is efficient or effective. An ongoing international HIV treatment trial (START) provides an opportunity to explore the usefulness of different monitoring approaches. Methods All START sites are centrally monitored and required to follow a local monitoring plan requiring specific quality assurance activities. Additionally, sites were randomized (1:1) to receive, or not receive, annual on-site monitoring. The study will determine if on-site monitoring increases the identification of major protocol deviations (eligibility or consent violations, improper study drug use, primary or serious event underreporting, data alteration or fraud). Results The START study completed enrollment in December 2013, with planned follow-up through December 2016. The monitoring study is ongoing at 196 sites in 34 countries. Results are expected when the START study concludes in December 2016. PMID:25973346
The Cherenkov Telescope Array production system for Monte Carlo simulations and analysis
NASA Astrophysics Data System (ADS)
Arrabito, L.; Bernloehr, K.; Bregeon, J.; Cumani, P.; Hassan, T.; Haupt, A.; Maier, G.; Moralejo, A.; Neyroud, N.; pre="for the"> CTA Consortium, 2017-10-01 The Cherenkov Telescope Array (CTA), an array of many tens of Imaging Atmospheric Cherenkov Telescopes deployed on an unprecedented scale, is the next-generation instrument in the field of very high energy gamma-ray astronomy. An average data stream of about 0.9 GB/s for about 1300 hours of observation per year is expected, therefore resulting in 4 PB of raw data per year and a total of 27 PB/year, including archive and data processing. The start of CTA operation is foreseen in 2018 and it will last about 30 years. The installation of the first telescopes in the two selected locations (Paranal, Chile and La Palma, Spain) will start in 2017. In order to select the best site candidate to host CTA telescopes (in the Northern and in the Southern hemispheres), massive Monte Carlo simulations have been performed since 2012. Once the two sites have been selected, we have started new Monte Carlo simulations to determine the optimal array layout with respect to the obtained sensitivity. Taking into account that CTA may be finally composed of 7 different telescope types coming in 3 different sizes, many different combinations of telescope position and multiplicity as a function of the telescope type have been proposed. This last Monte Carlo campaign represented a huge computational effort, since several hundreds of telescope positions have been simulated, while for future instrument response function simulations, only the operating telescopes will be considered. In particular, during the last 18 months, about 2 PB of Monte Carlo data have been produced and processed with different analysis chains, with a corresponding overall CPU consumption of about 125 M HS06 hours. In these proceedings, we describe the employed computing model, based on the use of grid resources, as well as the production system setup, which relies on the DIRAC interware. Finally, we present the envisaged evolutions of the CTA production system for the off-line data processing during CTA operations and the instrument response function simulations.
Grichnik, J M; French, B A; Schwartz, R J
1988-01-01
The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124
ERIC Educational Resources Information Center
Fallek, Max
This collection of case studies is intended for use in a course in setting up a small business. The first, a case study of the process of setting up a service company, covers analyzing the pros and cons of starting one's own business, assessing the competition and local market, and selecting a site for and financing the business. The principal…
Zhukova, Anna; Fernandes, Luis Guilherme; Hugon, Perrine; Pappas, Christopher J.; Sismeiro, Odile; Coppée, Jean-Yves; Becavin, Christophe; Malabat, Christophe; Eshghi, Azad; Zhang, Jun-Jie; Yang, Frank X.; Picardeau, Mathieu
2017-01-01
Leptospira are emerging zoonotic pathogens transmitted from animals to humans typically through contaminated environmental sources of water and soil. Regulatory pathways of pathogenic Leptospira spp. underlying the adaptive response to different hosts and environmental conditions remains elusive. In this study, we provide the first global Transcriptional Start Site (TSS) map of a Leptospira species. RNA was obtained from the pathogen Leptospira interrogans grown at 30°C (optimal in vitro temperature) and 37°C (host temperature) and selectively enriched for 5′ ends of native transcripts. A total of 2865 and 2866 primary TSS (pTSS) were predicted in the genome of L. interrogans at 30 and 37°C, respectively. The majority of the pTSSs were located between 0 and 10 nucleotides from the translational start site, suggesting that leaderless transcripts are a common feature of the leptospiral translational landscape. Comparative differential RNA-sequencing (dRNA-seq) analysis revealed conservation of most pTSS at 30 and 37°C. Promoter prediction algorithms allow the identification of the binding sites of the alternative sigma factor sigma 54. However, other motifs were not identified indicating that Leptospira consensus promoter sequences are inherently different from the Escherichia coli model. RNA sequencing also identified 277 and 226 putative small regulatory RNAs (sRNAs) at 30 and 37°C, respectively, including eight validated sRNAs by Northern blots. These results provide the first global view of TSS and the repertoire of sRNAs in L. interrogans. These data will establish a foundation for future experimental work on gene regulation under various environmental conditions including those in the host. PMID:28154810
Ligand recognition by RAR and RXR receptors: binding and selectivity.
Sussman, Fredy; de Lera, Angel R
2005-10-06
Fundamental biological functions, most notably embriogenesis, cell growth, cell differentiation, and cell apoptosis, are in part regulated by a complex genomic network that starts with the binding (and activation) of retinoids to their cognate receptors, members of the superfamily of nuclear receptors. We have studied ligand recognition of retinoic receptors (RXRalpha and RARgamma) using a molecular-mechanics-based docking method. The protocol used in this work is able to rank the affinity of pairs of ligands for a single retinoid receptor, the highest values corresponding to those that adapt better to the shape of the binding site and generate the optimal set of electrostatic and apolar interactions with the receptor. Moreover, our studies shed light onto some of the energetic contributions to retinoid receptor ligand selectivity. In this regard we show that there is a difference in polarity between the binding site regions that anchor the carboxylate in RAR and RXR, which translates itself into large differences in the energy of interaction of both receptors with the same ligand. We observe that the latter energy change is canceled off by the solvation energy penalty upon binding. This energy compensation is borne out as well by experiments that address the effect of site-directed mutagenesis on ligand binding to RARgamma. The hypothesis that the difference in binding site polarity might be exploited to build RXR-selective ligands is tested with some compounds having a thiazolidinedione anchoring group.
Genome-wide transcription start site profiling in biofilm-grown Burkholderia cenocepacia J2315.
Sass, Andrea M; Van Acker, Heleen; Förstner, Konrad U; Van Nieuwerburgh, Filip; Deforce, Dieter; Vogel, Jörg; Coenye, Tom
2015-10-13
Burkholderia cenocepacia is a soil-dwelling Gram-negative Betaproteobacterium with an important role as opportunistic pathogen in humans. Infections with B. cenocepacia are very difficult to treat due to their high intrinsic resistance to most antibiotics. Biofilm formation further adds to their antibiotic resistance. B. cenocepacia harbours a large, multi-replicon genome with a high GC-content, the reference genome of strain J2315 includes 7374 annotated genes. This study aims to annotate transcription start sites and identify novel transcripts on a whole genome scale. RNA extracted from B. cenocepacia J2315 biofilms was analysed by differential RNA-sequencing and the resulting dataset compared to data derived from conventional, global RNA-sequencing. Transcription start sites were annotated and further analysed according to their position relative to annotated genes. Four thousand ten transcription start sites were mapped over the whole B. cenocepacia genome and the primary transcription start site of 2089 genes expressed in B. cenocepacia biofilms were defined. For 64 genes a start codon alternative to the annotated one was proposed. Substantial antisense transcription for 105 genes and two novel protein coding sequences were identified. The distribution of internal transcription start sites can be used to identify genomic islands in B. cenocepacia. A potassium pump strongly induced only under biofilm conditions was found and 15 non-coding small RNAs highly expressed in biofilms were discovered. Mapping transcription start sites across the B. cenocepacia genome added relevant information to the J2315 annotation. Genes and novel regulatory RNAs putatively involved in B. cenocepacia biofilm formation were identified. These findings will help in understanding regulation of B. cenocepacia biofilm formation.
Huang, Xiaoqiang; Xue, Jing; Lin, Min; Zhu, Yushan
2016-01-01
Active site preorganization helps native enzymes electrostatically stabilize the transition state better than the ground state for their primary substrates and achieve significant rate enhancement. In this report, we hypothesize that a complex active site model for active site preorganization modeling should help to create preorganized active site design and afford higher starting activities towards target reactions. Our matching algorithm ProdaMatch was improved by invoking effective pruning strategies and the native active sites for ten scaffolds in a benchmark test set were reproduced. The root-mean squared deviations between the matched transition states and those in the crystal structures were < 1.0 Å for the ten scaffolds, and the repacking calculation results showed that 91% of the hydrogen bonds within the active sites are recovered, indicating that the active sites can be preorganized based on the predicted positions of transition states. The application of the complex active site model for de novo enzyme design was evaluated by scaffold selection using a classic catalytic triad motif for the hydrolysis of p-nitrophenyl acetate. Eighty scaffolds were identified from a scaffold library with 1,491 proteins and four scaffolds were native esterase. Furthermore, enzyme design for complicated substrates was investigated for the hydrolysis of cephalexin using scaffold selection based on two different catalytic motifs. Only three scaffolds were identified from the scaffold library by virtue of the classic catalytic triad-based motif. In contrast, 40 scaffolds were identified using a more flexible, but still preorganized catalytic motif, where one scaffold corresponded to the α-amino acid ester hydrolase that catalyzes the hydrolysis and synthesis of cephalexin. Thus, the complex active site modeling approach for de novo enzyme design with the aid of the improved ProdaMatch program is a promising approach for the creation of active sites with high catalytic efficiencies towards target reactions.
Huang, Xiaoqiang; Xue, Jing; Lin, Min; Zhu, Yushan
2016-01-01
Active site preorganization helps native enzymes electrostatically stabilize the transition state better than the ground state for their primary substrates and achieve significant rate enhancement. In this report, we hypothesize that a complex active site model for active site preorganization modeling should help to create preorganized active site design and afford higher starting activities towards target reactions. Our matching algorithm ProdaMatch was improved by invoking effective pruning strategies and the native active sites for ten scaffolds in a benchmark test set were reproduced. The root-mean squared deviations between the matched transition states and those in the crystal structures were < 1.0 Å for the ten scaffolds, and the repacking calculation results showed that 91% of the hydrogen bonds within the active sites are recovered, indicating that the active sites can be preorganized based on the predicted positions of transition states. The application of the complex active site model for de novo enzyme design was evaluated by scaffold selection using a classic catalytic triad motif for the hydrolysis of p-nitrophenyl acetate. Eighty scaffolds were identified from a scaffold library with 1,491 proteins and four scaffolds were native esterase. Furthermore, enzyme design for complicated substrates was investigated for the hydrolysis of cephalexin using scaffold selection based on two different catalytic motifs. Only three scaffolds were identified from the scaffold library by virtue of the classic catalytic triad-based motif. In contrast, 40 scaffolds were identified using a more flexible, but still preorganized catalytic motif, where one scaffold corresponded to the α-amino acid ester hydrolase that catalyzes the hydrolysis and synthesis of cephalexin. Thus, the complex active site modeling approach for de novo enzyme design with the aid of the improved ProdaMatch program is a promising approach for the creation of active sites with high catalytic efficiencies towards target reactions. PMID:27243223
10 CFR 36.15 - Start of construction.
Code of Federal Regulations, 2010 CFR
2010-01-01
... Requirements § 36.15 Start of construction. The applicant may not begin construction of a new irradiator prior... work, purchase of a site, site surveys or soil testing, site preparation, site excavation, construction... license with respect to the requirements of the Atomic Energy Act of 1954, as amended, and rules...
A structured multi-stakeholder learning process for Sustainable Land Management.
Schwilch, Gudrun; Bachmann, Felicitas; Valente, Sandra; Coelho, Celeste; Moreira, Jorge; Laouina, Abdellah; Chaker, Miloud; Aderghal, Mohamed; Santos, Patricia; Reed, Mark S
2012-09-30
There are many, often competing, options for Sustainable Land Management (SLM). Each must be assessed - and sometimes negotiated - prior to implementation. Participatory, multi-stakeholder approaches to identification and selection of SLM options are increasingly popular, often motivated by social learning and empowerment goals. Yet there are few practical tools for facilitating processes in which land managers may share, select, and decide on the most appropriate SLM options. The research presented here aims to close the gap between the theory and the practice of stakeholder participation/learning in SLM decision-making processes. The paper describes a three-part participatory methodology for selecting SLM options that was tested in 14 desertification-prone study sites within the EU-DESIRE project. Cross-site analysis and in-depth evaluation of the Moroccan and Portuguese sites were used to evaluate how well the proposed process facilitated stakeholder learning and selection of appropriate SLM options for local implementation. The structured nature of the process - starting with SLM goal setting - was found to facilitate mutual understanding and collaboration between stakeholders. The deliberation process led to a high degree of consensus over the outcome and, though not an initial aim, it fostered social learning in many cases. This solution-oriented methodology is applicable in a wide range of contexts and may be implemented with limited time and resources. Copyright © 2012 Elsevier Ltd. All rights reserved.
7 CFR 1430.205 - Selection of starting month.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Selection of starting month. 1430.205 Section 1430... Program § 1430.205 Selection of starting month. (a) A dairy operation that enters into a MILC contract with CCC must designate the starting month for each fiscal year for the calculation of payments and...
Survey of atmospheric total gaseous mercury in Mexico
NASA Astrophysics Data System (ADS)
de la Rosa, D. A.; Volke-Sepúlveda, T.; Solórzano, G.; Green, C.; Tordon, R.; Beauchamp, S.
2004-09-01
While sources of gaseous mercury (natural and anthropogenic) are well known, studies on atmospheric mercury concentrations in Mexico are new. In order to assess the total gaseous mercury (TGM) levels at some characteristic Mexican sites, four locations were selected to start an exploratory survey and begin to asses the TGM behavior. This paper presents data obtained at an urban site (Mexico City), a rural site (Huejutla, Hidalgo), a coastline site (Puerto Angel, Oaxaca) and a closed mining site (Zacatecas City, Zacatecas). The highest TGM average values were found at this last site (71.82 ng m-3) together with the urban site (9.81 ng m-3). At the rural and coast line sites the lowest TGM values (1.32 and 1.46 ng m-3, respectively) were found. According to the ANOVA test, there were significant differences for the TGM values among all the studied sites, except between the coastline and the rural place. A multiple correlation test performed between TGM and some meteorological parameters showed that in sites without anthropogenic mercury sources influence (rural and coast line), the TGM levels are correlated with the temperature and relative humidity, while for the other two sites no clear correlation was found.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thal, David M.; Homan, Kristoff T.; Chen, Jun
2012-08-10
G protein-coupled receptor kinase 2 (GRK2) is a well-established therapeutic target for the treatment of heart failure. In this paper we identify the selective serotonin reuptake inhibitor (SSRI) paroxetine as a selective inhibitor of GRK2 activity both in vitro and in living cells. In the crystal structure of the GRK2·paroxetine–Gβγ complex, paroxetine binds in the active site of GRK2 and stabilizes the kinase domain in a novel conformation in which a unique regulatory loop forms part of the ligand binding site. Isolated cardiomyocytes show increased isoproterenol-induced shortening and contraction amplitude in the presence of paroxetine, and pretreatment of mice withmore » paroxetine before isoproterenol significantly increases left ventricular inotropic reserve in vivo with no significant effect on heart rate. Neither is observed in the presence of the SSRI fluoxetine. Our structural and functional results validate a widely available drug as a selective chemical probe for GRK2 and represent a starting point for the rational design of more potent and specific GRK2 inhibitors.« less
Follicular unit transplantation: 2005.
Bernstein, Robert M; Rassman, William R
2005-07-01
The recognition that the follicular unit is a discrete, anatomic and physiologic entity, and that preserving it through stereomicroscopic dissection is the best way to ensure the naturalness of the restoration, has brought hair transplantation into the twenty-first century. Issues yet to be resolved include determining the maximum density and number of grafts that can be used safely in a single session, deciding whether it is preferable to premake recipient sites or immediately place grafts into sites as they are made, and defining the precise role of follicular unit extraction. The essence of providing the best care for patients rests on proper patient selection, establishing realistic expectations, and using nonsurgical management for young persons who are just starting to thin.
Federated queries of clinical data repositories: Scaling to a national network.
Weber, Griffin M
2015-06-01
Federated networks of clinical research data repositories are rapidly growing in size from a handful of sites to true national networks with more than 100 hospitals. This study creates a conceptual framework for predicting how various properties of these systems will scale as they continue to expand. Starting with actual data from Harvard's four-site Shared Health Research Information Network (SHRINE), the framework is used to imagine a future 4000 site network, representing the majority of hospitals in the United States. From this it becomes clear that several common assumptions of small networks fail to scale to a national level, such as all sites being online at all times or containing data from the same date range. On the other hand, a large network enables researchers to select subsets of sites that are most appropriate for particular research questions. Developers of federated clinical data networks should be aware of how the properties of these networks change at different scales and design their software accordingly. Copyright © 2015 Elsevier Inc. All rights reserved.
Spatzal, Thomas; Perez, Kathryn A; Howard, James B; Rees, Douglas C
2015-12-16
Dinitrogen reduction in the biological nitrogen cycle is catalyzed by nitrogenase, a two-component metalloenzyme. Understanding of the transformation of the inert resting state of the active site FeMo-cofactor into an activated state capable of reducing dinitrogen remains elusive. Here we report the catalysis dependent, site-selective incorporation of selenium into the FeMo-cofactor from selenocyanate as a newly identified substrate and inhibitor. The 1.60 Å resolution structure reveals selenium occupying the S2B site of FeMo-cofactor in the Azotobacter vinelandii MoFe-protein, a position that was recently identified as the CO-binding site. The Se2B-labeled enzyme retains substrate reduction activity and marks the starting point for a crystallographic pulse-chase experiment of the active site during turnover. Through a series of crystal structures obtained at resolutions of 1.32-1.66 Å, including the CO-inhibited form of Av1-Se2B, the exchangeability of all three belt-sulfur sites is demonstrated, providing direct insights into unforeseen rearrangements of the metal center during catalysis.
The Euro-Argo education web site: using Argo data to teach data analysis and marine science
NASA Astrophysics Data System (ADS)
Byfield, Valborg; Scheurle, Carolyn; Gould, John; Macama, Emina; King, Brian
2013-04-01
The Euro-Argo education website (www.euroargo-edu.org) aims to make Argo and its data accessible to a non-specialist audience. The site is centred on a selection of floats, which have been chosen because of the insight they provide into key oceanographic processes, the physical and biogeochemical characteristics of different ocean regions around the world, and the role of the ocean in the global climate system. The float selection is a vehicle for teaching data analysis skills, linking these to current topics in the ocean and climate sciences. Each float in the selection has its own page, which provides access to the float data, data plots, background information on the ocean region in which the float can be found, and questions to guide data interpretation. Hidden 'model answers' allow users to check their understanding by comparing their own answers to those provided. The interactive component of the site also includes a series of quizzes, designed to teach data interpretation skills. These start at a basic level and take the students step by step through the most common ways to plot oceanographic data in space and time. More general background information covers the main aspects of the Argo programme, its history and applications, and basic technical information about the floats and sensors. 'World Tour' pages linked to the float selection provide information about the main ocean regions and link information from the Argo programme to oceanographic information from other sources such as satellite observations. The site is primarily aimed at young people between 11 and 18 years of age. However experience from using selected material from the site during science open days shows that children as young as 8-9 and adults of all ages also enjoy the challenge of using and interpreting the Argo data in different contexts.
National Airspace System (NAS)
2013-12-01
signed at Ft. Hood, Texas (Army Site) on August 29, 2013. DASR Installation and Check-Out ( INCO ) started at Dobbins AFB, Georgia (AF Site) on February 25...2013, with SAT completed on July 17, 2013 and DD250 signed on September 17, 2013. DASR INCO at Aviano AB, Italy started on September 9, 2013...Island (Navy site) on December 16, 2013. DASR INCO at Lajes Field, Portugal started on June 12, 2013; DASR SAT was completed on January 30, 2014
Wang, J; Froeyen, M; Hendrix, C; Andrei, C; Snoeck, R; Lescrinier, E; De Clercq, E; Herdewijn, P
2001-01-01
(D)- and (L)-cyclohexeneyl-G were synthesized enantioselectively starting from (R)-carvone. Both show potent and selective anti-herpesvirus activity (HSV-1, HSV-2, VZV, CMV). Molecular modeling demonstrates that both isomers are bound in the active site of HSV-1 thymidine kinase in a high-energy conformation with the base moiety orienting in an equatorial position. It is believed that the flexibility of the cyclohexene ring is essential for their antiviral activity.
Highly selective inhibition of myosin motors provides the basis of potential therapeutic application
Sirigu, Serena; Hartman, James J.; Ropars, Virginie; Clancy, Sheila; Wang, Xi; Chuang, Grace; Qian, Xiangping; Lu, Pu-Ping; Barrett, Edward; Rudolph, Karin; Royer, Christopher; Morgan, Bradley P.; Stura, Enrico A.; Malik, Fady I.; Houdusse, Anne M.
2016-01-01
Direct inhibition of smooth muscle myosin (SMM) is a potential means to treat hypercontractile smooth muscle diseases. The selective inhibitor CK-2018571 prevents strong binding to actin and promotes muscle relaxation in vitro and in vivo. The crystal structure of the SMM/drug complex reveals that CK-2018571 binds to a novel allosteric pocket that opens up during the “recovery stroke” transition necessary to reprime the motor. Trapped in an intermediate of this fast transition, SMM is inhibited with high selectivity compared with skeletal muscle myosin (IC50 = 9 nM and 11,300 nM, respectively), although all of the binding site residues are identical in these motors. This structure provides a starting point from which to design highly specific myosin modulators to treat several human diseases. It further illustrates the potential of targeting transition intermediates of molecular machines to develop exquisitely selective pharmacological agents. PMID:27815532
Developing A National Groundwater-Monitoring Network In Korea
NASA Astrophysics Data System (ADS)
Kim, N. J.; Cho, M. J.; Woo, N. C.
1995-04-01
Since the 1960's, the groundwater resources of Korea have been developed without a proper regulatory system for monitoring and preservation, resulting in significant source depletion, land subsidence, water contamination, and sea-water intrusion. With the activation of the "Groundwater Law" in June 1994, the government initiated a project to develop a groundwater-monitoring network to describe general groundwater quality, to define its long-term changes, and to identify major factors affecting changes in groundwater quality and yield. In selecting monitoring locations nationwide, criteria considered are 1) spatial distribution, 2) aquifer characteristics of hydrogeologic units, 3) local groundwater flow regime, 4) linkage with surface hydrology observations, 5) site accessibility, and 6) financial situations. A total of 310 sites in 78 small hydrologic basins were selected to compose the monitoring network. Installation of monitoring wells is scheduled to start in 1995 for 15 sites; the remainder are scheduled to be completed by 2001. At each site, a nest of monitoring wells was designed; shallow and deep groundwater will be monitored for water temperature, pH, EC, DO and TDS every month. Water-level fluctuations will also be measured by automatic recorders equipped with pressure transducers. As a next step, the government plans to develop a groundwater-database management system, which could be linked with surface hydrologic data.
Denning, E; Sharma, S; Smolskis, M; Touloumi, G; Walker, S; Babiker, A; Clewett, M; Emanuel, E; Florence, E; Papadopoulos, A; Sánchez, A; Tavel, J; Grady, C
2015-04-01
Efforts are needed to improve informed consent of participants in research. The Strategic Timing of AntiRetroviral Therapy (START) study provides a unique opportunity to study the effect of length and complexity of informed consent documents on understanding and satisfaction among geographically diverse participants. Interested START sites were randomized to use either the standard consent form or the concise consent form for all of the site's participants. A total of 4473 HIV-positive participants at 154 sites world-wide took part in the Informed Consent Substudy, with consent given in 11 primary languages. Most sites sent written information to potential participants in advance of clinic visits, usually including the consent form. At about half the sites, staff reported spending less than an hour per participant in the consent process. The vast majority of sites assessed participant understanding using informal nonspecific questions or clinical judgment. These data reflect the interest of START research staff in evaluating the consent process and improving informed consent. The START Informed Consent Substudy is by far the largest study of informed consent intervention ever conducted. Its results have the potential to impact how consent forms are written around the world. © 2015 British HIV Association.
For Parents: Vaccines for Your Children
... content Start of Search Controls Search Form Controls Vaccines site Cancel Submit CDC A-Z Index MENU ... Z # Start of Search Controls Search Form Controls Vaccines site Cancel Submit For Parents: Vaccines for Your ...
Science plus management equals successful remediation -- A case study
DOE Office of Scientific and Technical Information (OSTI.GOV)
Buehlman, M.D.; Rogers, D.T.; Payne, F.C.
In the past, owners of contaminated sites attempted to remediate as quickly as possible, usually by excavating contaminated soil or pumping and treating contaminated groundwater. Often, they started remediation before identifying all potential types and sources of contaminants, and before conducting a thorough hydrogeologic study. Such premature action usually resulted in the selected remedy not working, the contamination spreading, or unnecessary remedial activities. Today, successful site remediation is recognized as a complex and time-consuming undertaking--requiring a combination of careful scientific study, effective negotiation with the regulatory agencies and skillful management of multidisciplinary efforts. A case study involving a Brownfields sitemore » in southeastern Michigan clearly illustrates the elements of successful remediation. The site`s soil was contaminated with polychlorinated biphenyls (PCBs) and its groundwater with a variety of chlorinated solvents. The original estimate for remediation had exceeded $30 million. Several phases of investigation were conducted to evaluate the nature and sources of contaminants, the site`s hydrogeology, potential risks to human health and the environment, and feasible remedial technologies. Multiple cleanup criteria were established for different affected areas based on the results of the investigations, changes that were taking place with the state cleanup regulations and standards and subsequent negotiations with state and federal regulators. Innovative remedial technologies were selected. The result was a remediation that met or exceeded all soil and groundwater cleanup objectives, was performed on schedule, and was highly cost-effective. The final cost was limited to $3 million--one-tenth of the original estimate.« less
Evolutionary transitions to new DNA methyltransferases through target site expansion and shrinkage.
Rockah-Shmuel, Liat; Tawfik, Dan S
2012-12-01
DNA-binding and modifying proteins show high specificity but also exhibit a certain level of promiscuity. Such latent promiscuous activities comprise the starting points for new protein functions, but this hypothesis presents a paradox: a new activity can only evolve if it already exists. How then, do novel activities evolve? DNA methyltransferases, for example, are highly divergent in their target sites, but how transitions toward novel sites occur remains unknown. We performed laboratory evolution of the DNA methyltransferase M.HaeIII. We found that new target sites emerged primarily through expansion of the original site, GGCC, and the subsequent shrinkage of evolved expanded sites. Variants evolved for sites that are promiscuously methylated by M.HaeIII [GG((A)/(T))CC and GGCGCC] carried mutations in 'gate-keeper' residues. They could thereby methylate novel target sites such as GCGC and GGATCC that were neither selected for nor present in M.HaeIII. These 'generalist' intermediates were further evolved to obtain variants with novel target specificities. Our results demonstrate the ease by which new DNA-binding and modifying specificities evolve and the mechanism by which they occur at both the protein and DNA levels.
Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping
2018-04-01
In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.
Effects of cytosine methylation on transcription factor binding sites
2014-01-01
Background DNA methylation in promoters is closely linked to downstream gene repression. However, whether DNA methylation is a cause or a consequence of gene repression remains an open question. If it is a cause, then DNA methylation may affect the affinity of transcription factors (TFs) for their binding sites (TFBSs). If it is a consequence, then gene repression caused by chromatin modification may be stabilized by DNA methylation. Until now, these two possibilities have been supported only by non-systematic evidence and they have not been tested on a wide range of TFs. An average promoter methylation is usually used in studies, whereas recent results suggested that methylation of individual cytosines can also be important. Results We found that the methylation profiles of 16.6% of cytosines and the expression profiles of neighboring transcriptional start sites (TSSs) were significantly negatively correlated. We called the CpGs corresponding to such cytosines “traffic lights”. We observed a strong selection against CpG “traffic lights” within TFBSs. The negative selection was stronger for transcriptional repressors as compared with transcriptional activators or multifunctional TFs as well as for core TFBS positions as compared with flanking TFBS positions. Conclusions Our results indicate that direct and selective methylation of certain TFBS that prevents TF binding is restricted to special cases and cannot be considered as a general regulatory mechanism of transcription. PMID:24669864
Smyrnov, Pavlo; Broadhead, Robert S; Datsenko, Oleksandra; Matiyash, Oksana
2012-03-01
A peer-driven intervention (PDI) for injecting drug users (IDUs) was implemented in five Ukrainian city-sites to test-pilot its effectiveness in rejuvenating harm reduction (HR) projects that had become moribund. A PDI relies on drug users in a unique way to educate their peers in the community and recruit them for HIV prevention services. The goal of the PDI was to recruit in six month 500 IDUs who had never been respondents before to each of the five HR projects, especially stimulant- and women-injectors, and IDUs<25 years of age. We standardized the PDI's structure and operations across all five sites. All five PDIs were started in May 2007 using a carefully selected handful of "seed" IDU-recruiters who were trained to educate three peers who had never received HR services. We also accessed the database of all five projects and analysed the new respondents they recruited six-months prior to the start-up of the PDIs with the new recruits generated by the PDIs. Whilst the HR projects in the five city-sites recruited 72 new respondents on average during the six months prior to the PDIs' start-up, the PDIs recruited 455 new respondents on average in each city during their six months of operation, indicating that the PDI was 6.3 times more powerful as a recruitment mechanism. Compared to traditional outreach the PDIs resulted in significant increases in the recruitment of women- and young-injectors, and IDUs who injected a more diverse variety of drugs. The PDI can have a rejuvenating effect when added to HR projects that had become stagnate over time, resulting in an increase in the number and diversity of new IDU-respondents. Copyright © 2012 Elsevier B.V. All rights reserved.
Schwientek, Patrick; Neshat, Armin; Kalinowski, Jörn; Klein, Andreas; Rückert, Christian; Schneiker-Bekel, Susanne; Wendler, Sergej; Stoye, Jens; Pühler, Alfred
2014-11-20
Actinoplanes sp. SE50/110 is the producer of the alpha-glucosidase inhibitor acarbose, which is an economically relevant and potent drug in the treatment of type-2 diabetes mellitus. In this study, we present the detection of transcription start sites on this genome by sequencing enriched 5'-ends of primary transcripts. Altogether, 1427 putative transcription start sites were initially identified. With help of the annotated genome sequence, 661 transcription start sites were found to belong to the leader region of protein-coding genes with the surprising result that roughly 20% of these genes rank among the class of leaderless transcripts. Next, conserved promoter motifs were identified for protein-coding genes with and without leader sequences. The mapped transcription start sites were finally used to improve the annotation of the Actinoplanes sp. SE50/110 genome sequence. Concerning protein-coding genes, 41 translation start sites were corrected and 9 novel protein-coding genes could be identified. In addition to this, 122 previously undetermined non-coding RNA (ncRNA) genes of Actinoplanes sp. SE50/110 were defined. Focusing on antisense transcription start sites located within coding genes or their leader sequences, it was discovered that 96 of those ncRNA genes belong to the class of antisense RNA (asRNA) genes. The remaining 26 ncRNA genes were found outside of known protein-coding genes. Four chosen examples of prominent ncRNA genes, namely the transfer messenger RNA gene ssrA, the ribonuclease P class A RNA gene rnpB, the cobalamin riboswitch RNA gene cobRS, and the selenocysteine-specific tRNA gene selC, are presented in more detail. This study demonstrates that sequencing of enriched 5'-ends of primary transcripts and the identification of transcription start sites are valuable tools for advanced genome annotation of Actinoplanes sp. SE50/110 and most probably also for other bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.
AmeriFlux US-An2 Anaktuvuk River Moderate Burn
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hobbie, John; Rocha, Adrian; Shaver, Gaius
This is the AmeriFlux version of the carbon flux data for the site US-An2 Anaktuvuk River Moderate Burn. Site Description - The Anaktuvuk River fire on the North Slope of Alaska started on July 16, 2007 by lightning. It continued until the end of September when nearby lakes had already frozen over and burned >256,000 acres, creating a mosaic of patches that differed in burn severity. The Anaktuvuk River Severe Burn, Moderate Burn, and Unburned sites are 40 km to the west of the nearest road and were selected in late May 2008 to determine the effects of the firemore » on carbon, water, and energy exchanges during the growing season. Because the fire had burned through September of the previous year, initial deployment of flux towers occurred prior to any significant vegetative regrowth, and our sampling campaign captured the full growing season in 2008. The Moderate Burn site consisted of a large area with small patches of completely and partially burned tundra intermixed across the landscape.« less
AmeriFlux US-An3 Anaktuvuk River Unburned
Hobbie, John [Marine Biological Laboratory; Rocha, Adrian [Marine Biological Laboratory; Shaver, Gaius [Marine Biological Laboratory
2016-01-01
This is the AmeriFlux version of the carbon flux data for the site US-An3 Anaktuvuk River Unburned. Site Description - The Anaktuvuk River fire on the North Slope of Alaska started on July 16, 2007 by lightning. It continued until the end of September when nearby lakes had already frozen over and burned >256,000 acres, creating a mosaic of patches that differed in burn severity. The Anaktuvuk River Severe Burn, Moderate Burn, and Unburned sites are 40 km to the west of the nearest road and were selected in late May 2008 to determine the effects of the fire on carbon, water, and energy exchanges during the growing season. Because the fire had burned through September of the previous year, initial deployment of flux towers occurred prior to any significant vegetative regrowth, and our sampling campaign captured the full growing season in 2008. The Unburned site was located in a large area of tundra that was unaffected by the fire.
Starting Labor-Management Quality of Work Life Programs.
ERIC Educational Resources Information Center
Brower, Michael
This report summarizes the experiences of the Massachusetts Quality of Working Life Center in assisting the attempted and actual start-up of a number of quality of work life (QWL) programs in 1976 and 1977 and in providing ongoing assistance. Lessons learned by the three sites the center launched, other sites, as well as those sites that chose not…
Wang, J; Froeyen, M; Hendrix, C; Andrei, G; Snoeck, R; De Clercq, E; Herdewijn, P
2000-02-24
Both enantiomers of cyclohexenylguanine were synthesized in a stereospecific way starting from the same starting material: R-(-)-carvone. Both compounds showed potent and selective anti-herpesvirus activity (HSV-1, HSV-2, VZV, CMV). The binding of both cyclohexene nucleosides in the active site of HSV-1 thymidine kinase was investigated, and a model for the binding of both enantiomers is proposed. The amino acids involved in binding of the optical antipodes are the same, but the interaction energy of both enantiomers is slightly different. This may be attributed to the interaction of the secondary hydroxyl function of the nucleoside analogues with Glu-225. Structural analysis has demonstrated the flexibility of the cyclohexenyl system, and this may be considered as an important conformational characteristic explaining the potent antiviral activity.
NASA Astrophysics Data System (ADS)
Rodríguez-Rodríguez, Cristina; Rimola, Albert; Alí-Torres, Jorge; Sodupe, Mariona; González-Duarte, Pilar
2011-01-01
The development of new strategies to find commercial molecules with promising biochemical features is a main target in the field of biomedicine chemistry. In this work we present an in silico-based protocol that allows identifying commercial compounds with suitable metal coordinating and pharmacokinetic properties to act as metal-ion chelators in metal-promoted neurodegenerative diseases (MpND). Selection of the chelating ligands is done by combining quantum chemical calculations with the search of commercial compounds on different databases via virtual screening. Starting from different designed molecular frameworks, which mainly constitute the binding site, the virtual screening on databases facilitates the identification of different commercial molecules that enclose such scaffolds and, by imposing a set of chemical and pharmacokinetic filters, obey some drug-like requirements mandatory to deal with MpND. The quantum mechanical calculations are useful to gauge the chelating properties of the selected candidate molecules by determining the structure of metal complexes and evaluating their stability constants. With the proposed strategy, commercial compounds containing N and S donor atoms in the binding sites and capable to cross the BBB have been identified and their chelating properties analyzed.
Toward the identification of the cardiac cGMP inhibited-phosphodiesterase catalytic site
NASA Astrophysics Data System (ADS)
Fossa, Paola; Boggia, Raffaella; Mosti, Luisa
1998-07-01
Cyclic nucleotide phosphodiesterases (PDEs) comprise a complex group of enzymes; five major PDE families or classes with distinctive properties have been identified. Among these a great deal of interest has recently been focused on the so called cGMP-inhibited low Km cAMP phosphodiesterase (cGI PDE) or PDE III. A number of positive inotropic agents, including the well-known milrinone, display a specific inhibition of PDE III as primary mechanism of action. Recent studies have been carried out to develop a pharmacophore model of the PDE III active site. We therefore performed molecular modelling and 3D-SAR studies so as to better define structural requirements for potent and selective enzymatic inhibition. The DISCO (DIStance COmparison) strategy has been applied on a set of compounds taken from literature and a milrinone analogue previously synthesized by us, all of which are characterized by a marked inotropic effect but with varying degrees of enzyme selectivity. A common pharmacophoric model was derived, validated and considered as starting point to perform a 3D-SAR study using the GRID force field and PCA (Principal Component Analysis) with the aim of rationally designing more selective inhibitors. This paper presents the results of this theoretical approach.
Vavouri, Tanya; Lehner, Ben
2011-04-01
Chromatin in sperm is different from that in other cells, with most of the genome packaged by protamines not nucleosomes. Nucleosomes are, however, retained at some genomic sites, where they have the potential to transmit paternal epigenetic information. It is not understood how this retention is specified. Here we show that base composition is the major determinant of nucleosome retention in human sperm, predicting retention very well in both genic and non-genic regions of the genome. The retention of nucleosomes at GC-rich sequences with high intrinsic nucleosome affinity accounts for the previously reported retention at transcription start sites and at genes that regulate development. It also means that nucleosomes are retained at the start sites of most housekeeping genes. We also report a striking link between the retention of nucleosomes in sperm and the establishment of DNA methylation-free regions in the early embryo. Taken together, this suggests that paternal nucleosome transmission may facilitate robust gene regulation in the early embryo. We propose that chromatin organization in the male germline, rather than in somatic cells, is the major functional consequence of fine-scale base composition variation in the human genome. The selective pressure driving base composition evolution in mammals could, therefore, be the need to transmit paternal epigenetic information to the zygote.
45 CFR 1305.6 - Selection process.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 45 Public Welfare 4 2010-10-01 2010-10-01 false Selection process. 1305.6 Section 1305.6 Public... PROGRAM ELIGIBILITY, RECRUITMENT, SELECTION, ENROLLMENT AND ATTENDANCE IN HEAD START § 1305.6 Selection process. (a) Each Head Start program must have a formal process for establishing selection criteria and...
Enhancers Are Major Targets for Murine Leukemia Virus Vector Integration
De Ravin, Suk See; Su, Ling; Theobald, Narda; Choi, Uimook; Macpherson, Janet L.; Poidinger, Michael; Symonds, Geoff; Pond, Susan M.; Ferris, Andrea L.; Hughes, Stephen H.
2014-01-01
ABSTRACT Retroviral vectors have been used in successful gene therapies. However, in some patients, insertional mutagenesis led to leukemia or myelodysplasia. Both the strong promoter/enhancer elements in the long terminal repeats (LTRs) of murine leukemia virus (MLV)-based vectors and the vector-specific integration site preferences played an important role in these adverse clinical events. MLV integration is known to prefer regions in or near transcription start sites (TSS). Recently, BET family proteins were shown to be the major cellular proteins responsible for targeting MLV integration. Although MLV integration sites are significantly enriched at TSS, only a small fraction of the MLV integration sites (<15%) occur in this region. To resolve this apparent discrepancy, we created a high-resolution genome-wide integration map of more than one million integration sites from CD34+ hematopoietic stem cells transduced with a clinically relevant MLV-based vector. The integration sites form ∼60,000 tight clusters. These clusters comprise ∼1.9% of the genome. The vast majority (87%) of the integration sites are located within histone H3K4me1 islands, a hallmark of enhancers. The majority of these clusters also have H3K27ac histone modifications, which mark active enhancers. The enhancers of some oncogenes, including LMO2, are highly preferred targets for integration without in vivo selection. IMPORTANCE We show that active enhancer regions are the major targets for MLV integration; this means that MLV preferentially integrates in regions that are favorable for viral gene expression in a variety of cell types. The results provide insights for MLV integration target site selection and also explain the high risk of insertional mutagenesis that is associated with gene therapy trials using MLV vectors. PMID:24501411
Orbiter aborts from boost: Presimulation report
NASA Technical Reports Server (NTRS)
Backman, H. D.; Brechka, K. G.
1972-01-01
A description of a hybrid simulation of the 040C orbiter aborting from boost to specified landing site is provided. The simulation starts when the abort is initiated and continues until a terminal energy state (associated with the selected landing site) is reached. At abort it is assumed that all SRM's are jettisoned with the external tank remaining with the orbiter. The simulation described has six degrees of freedom with the vehicle simulated as a rigid body. A conventional form of autopilot is provided to control engine gimbaling during powered flight. An ideal form of an autopilot is provided to test conventional autopilot function and provide pseudo RCS function during coasting flight. The simulation is proposed to provide means for studies of abort guidance function and to gain information concerning ability to control the abort trajectory.
Raebel, Marsha A; Shetterly, Susan; Lu, Christine Y; Flory, James; Gagne, Joshua J; Harrell, Frank E; Haynes, Kevin; Herrinton, Lisa J; Patorno, Elisabetta; Popovic, Jennifer; Selvan, Mano; Shoaibi, Azadeh; Wang, Xingmei; Roy, Jason
2016-07-01
Our purpose was to quantify missing baseline laboratory results, assess predictors of missingness, and examine performance of missing data methods. Using the Mini-Sentinel Distributed Database from three sites, we selected three exposure-outcome scenarios with laboratory results as baseline confounders. We compared hazard ratios (HRs) or risk differences (RDs) and 95% confidence intervals (CIs) from models that omitted laboratory results, included only available results (complete cases), and included results after applying missing data methods (multiple imputation [MI] regression, MI predictive mean matching [PMM] indicator). Scenario 1 considered glucose among second-generation antipsychotic users and diabetes. Across sites, glucose was available for 27.7-58.9%. Results differed between complete case and missing data models (e.g., olanzapine: HR 0.92 [CI 0.73, 1.12] vs 1.02 [0.90, 1.16]). Across-site models employing different MI approaches provided similar HR and CI; site-specific models provided differing estimates. Scenario 2 evaluated creatinine among individuals starting high versus low dose lisinopril and hyperkalemia. Creatinine availability: 44.5-79.0%. Results differed between complete case and missing data models (e.g., HR 0.84 [CI 0.77, 0.92] vs. 0.88 [0.83, 0.94]). HR and CI were identical across MI methods. Scenario 3 examined international normalized ratio (INR) among warfarin users starting interacting versus noninteracting antimicrobials and bleeding. INR availability: 20.0-92.9%. Results differed between ignoring INR versus including INR using missing data methods (e.g., RD 0.05 [CI -0.03, 0.13] vs 0.09 [0.00, 0.18]). Indicator and PMM methods gave similar estimates. Multi-site studies must consider site variability in missing data. Different missing data methods performed similarly. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Bosshart, Andreas; Hee, Chee Seng; Bechtold, Matthias; Schirmer, Tilman; Panke, Sven
2015-03-02
Functional promiscuity of enzymes can often be harnessed as the starting point for the directed evolution of novel biocatalysts. Here we describe the divergent morphing of an engineered thermostable variant (Var8) of a promiscuous D-tagatose epimerase (DTE) into two efficient catalysts for the C3 epimerization of D-fructose to D-psicose and of L-sorbose to L-tagatose. Iterative single-site randomization and screening of 48 residues in the first and second shells around the substrate-binding site of Var8 yielded the eight-site mutant IDF8 (ninefold improved kcat for the epimerization of D-fructose) and the six-site mutant ILS6 (14-fold improved epimerization of L-sorbose), compared to Var8. Structure analysis of IDF8 revealed a charged patch at the entrance of its active site; this presumably facilitates entry of the polar substrate. The improvement in catalytic activity of variant ILS6 is thought to relate to subtle changes in the hydration of the bound substrate. The structures can now be used to select additional sites for further directed evolution of the ketohexose epimerase. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
2016-01-01
supportive of this work from the start . This research would not have been possible without the contributions made by a number of individuals throughout...and funding structures. We started with these questions in particular based on the primary concerns at AMOS identified in the results of Phase I...from the start . Keck maintains connections with a series of other sites within a remote observing network. Remote observing from the mainland
Radioactive waste management treatments: A selection for the Italian scenario
DOE Office of Scientific and Technical Information (OSTI.GOV)
Locatelli, G.; Mancini, M.; Sardini, M.
2012-07-01
The increased attention for radioactive waste management is one of the most peculiar aspects of the nuclear sector considering both reactors and not power sources. The aim of this paper is to present the state-of-art of treatments for radioactive waste management all over the world in order to derive guidelines for the radioactive waste management in the Italian scenario. Starting with an overview on the international situation, it analyses the different sources, amounts, treatments, social and economic impacts looking at countries with different industrial backgrounds, energetic policies, geography and population. It lists all these treatments and selects the most reasonablemore » according to technical, economic and social criteria. In particular, a double scenario is discussed (to be considered in case of few quantities of nuclear waste): the use of regional, centralized, off site processing facilities, which accept waste from many nuclear plants, and the use of mobile systems, which can be transported among multiple nuclear sites for processing campaigns. At the end the treatments suitable for the Italian scenario are presented providing simplified work-flows and guidelines. (authors)« less
A randomized trial comparing concise and standard consent forms in the START trial
Touloumi, Giota; Walker, A. Sarah; Smolskis, Mary; Sharma, Shweta; Babiker, Abdel G.; Pantazis, Nikos; Tavel, Jorge; Florence, Eric; Sanchez, Adriana; Hudson, Fleur; Papadopoulos, Antonios; Emanuel, Ezekiel; Clewett, Megan; Munroe, David; Denning, Eileen
2017-01-01
Background Improving the effectiveness and efficiency of research informed consent is a high priority. Some express concern about longer, more complex, written consent forms creating barriers to participant understanding. A recent meta-analysis concluded that randomized comparisons were needed. Methods We conducted a cluster-randomized non-inferiority comparison of a standard versus concise consent form within a multinational trial studying the timing of starting antiretroviral therapy in HIV+ adults (START). Interested sites were randomized to standard or concise consent forms for all individuals signing START consent. Participants completed a survey measuring comprehension of study information and satisfaction with the consent process. Site personnel reported usual site consent practices. The primary outcome was comprehension of the purpose of randomization (pre-specified 7.5% non-inferiority margin). Results 77 sites (2429 participants) were randomly allocated to use standard consent and 77 sites (2000 participants) concise consent, for an evaluable cohort of 4229. Site and participant characteristics were similar for the two groups. The concise consent was non-inferior to the standard consent on comprehension of randomization (80.2% versus 82%, site adjusted difference: 0.75% (95% CI -3.8%, +5.2%)); and the two groups did not differ significantly on total comprehension score, satisfaction, or voluntariness (p>0.1). Certain independent factors, such as education, influenced comprehension and satisfaction but not differences between consent groups. Conclusions An easier to read, more concise consent form neither hindered nor improved comprehension of study information nor satisfaction with the consent process among a large number of participants. This supports continued efforts to make consent forms more efficient. Trial registration Informed consent substudy was registered as part of START study in clinicaltrials.gov #NCT00867048, and EudraCT # 2008-006439-12 PMID:28445471
Project Developmental Continuity Evaluation: Site Visitors' Manual.
ERIC Educational Resources Information Center
Morris, Mary; Smith, Allen
This site visitors' manual is part of a series of documents on the evaluation of Project Developmental Continuity (PDC), a Head Start demonstration program aimed at providing educational and developmental continuity between children's Head Start and primary school experiences. The PDC evaluation documents and analyzes the process of program…
Automatic control algorithm effects on energy production
NASA Technical Reports Server (NTRS)
Mcnerney, G. M.
1981-01-01
A computer model was developed using actual wind time series and turbine performance data to simulate the power produced by the Sandia 17-m VAWT operating in automatic control. The model was used to investigate the influence of starting algorithms on annual energy production. The results indicate that, depending on turbine and local wind characteristics, a bad choice of a control algorithm can significantly reduce overall energy production. The model can be used to select control algorithms and threshold parameters that maximize long term energy production. The results from local site and turbine characteristics were generalized to obtain general guidelines for control algorithm design.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wiemers, K.D.; Daling, P.; Meier, K.
1999-01-04
Regulated pesticides, herbicides, miticides, and fungicides were evaluated for their potential past and current use at the Hanford Site. The starting list of these compounds is based on regulatory analyte input lists discussed in the Regulatory DQO. Twelve pesticide, herbicide, miticide, and fungicide compounds are identified for analysis in the Hanford SST and DST waste in support of the Regulatory DQO. The compounds considered for additional analyses are non-detected, considered stable in the tank waste matrix, and of higher toxicity/carcinogenicity.
Yu, Ming; Riva, Laura; Xie, Huafeng; Schindler, Yocheved; Moran, Tyler B.; Cheng, Yong; Yu, Duonan; Hardison, Ross; Weiss, Mitchell J; Orkin, Stuart H.; Bernstein, Bradley E.; Fraenkel, Ernest; Cantor, Alan B.
2009-01-01
Summary The transcription factor GATA-1 is required for terminal erythroid maturation and functions as an activator or repressor depending on gene context. Yet its in vivo site selectivity and ability to distinguish between activated versus repressed genes remain incompletely understood. In this study, we performed GATA-1 ChIP-seq in erythroid cells and compared it to GATA-1 induced gene expression changes. Bound and differentially expressed genes contain a greater number of GATA binding motifs, a higher frequency of palindromic GATA sites, and closer occupancy to the transcriptional start site versus non-differentially expressed genes. Moreover, we show that the transcription factor Zbtb7a occupies GATA-1 bound regions of some direct GATA-1 target genes, that the presence of SCL/TAL1 helps distinguish transcriptional activation versus repression, and that Polycomb Repressive Complex 2 (PRC2) is involved in epigenetic silencing of a subset of GATA-1 repressed genes. These data provide insights into GATA-1 mediated gene regulation in vivo. PMID:19941827
A new clustering algorithm applicable to multispectral and polarimetric SAR images
NASA Technical Reports Server (NTRS)
Wong, Yiu-Fai; Posner, Edward C.
1993-01-01
We describe an application of a scale-space clustering algorithm to the classification of a multispectral and polarimetric SAR image of an agricultural site. After the initial polarimetric and radiometric calibration and noise cancellation, we extracted a 12-dimensional feature vector for each pixel from the scattering matrix. The clustering algorithm was able to partition a set of unlabeled feature vectors from 13 selected sites, each site corresponding to a distinct crop, into 13 clusters without any supervision. The cluster parameters were then used to classify the whole image. The classification map is much less noisy and more accurate than those obtained by hierarchical rules. Starting with every point as a cluster, the algorithm works by melting the system to produce a tree of clusters in the scale space. It can cluster data in any multidimensional space and is insensitive to variability in cluster densities, sizes and ellipsoidal shapes. This algorithm, more powerful than existing ones, may be useful for remote sensing for land use.
Gou, Bin; Liu, Ying; Guntur, Ananya R.; Stern, Ulrich; Yang, Chung-Hui
2014-01-01
Selecting a suitable site to deposit their eggs is an important reproductive need of Drosophila females. While their choosiness towards egg-laying sites is well documented, the specific neural mechanism that activates females’ search for attractive egg-laying sites is not known. Here we show that distention/contraction of females’ internal reproductive tract triggered by egg-delivery through the tract plays a critical role in activating such search. We found that females start to exhibit acetic acid attraction prior to depositing each egg but no attraction when they are not laying eggs. Artificially distending the reproductive tract triggers acetic acid attraction in non-egg-laying females whereas silencing the mechanosensitive neurons we identified that can sense the contractile status of the tract eliminates such attraction. Our work uncovers the circuit basis of an important reproductive need of Drosophila females and provides a simple model to dissect the neural mechanism that underlies a reproductive need-induced behavioral modification. PMID:25373900
Influence of the inter-ion interaction on the phase diagrams of the 1D Falicov-Kimball system
NASA Astrophysics Data System (ADS)
Gajek, Z.; Lemański, R.
2004-05-01
A model of itinerant, spinless electrons interacting with ions via the on-site Coulomb potential U, modified by the inter-ionic nearest-neighbour interaction V, is studied on the one-dimensional infinite lattice. Only periodical configurations of the ions with a limited number of lattice sites in a unit cell and their mixtures are taken into account. Phases whose energies reach minimum values for given electron and ion chemical potentials are selected and depicted for a set of model parameters. Then the results are translated into the ion density-electron density canonical phase diagrams and summarized in the electrondensity-U plane. The diagrams clearly show how various kinds of charge ordering evolve with V, starting from V=0 case, that represents the standard Falicov-Kimball model discussed previously.
Segall-Shapiro, Thomas H; Nguyen, Peter Q; Dos Santos, Edgardo D; Subedi, Saurav; Judd, Justin; Suh, Junghae; Silberg, Jonathan J
2011-02-11
The extent to which thermostability influences the location of protein fragmentation sites that allow retention of function is not known. To evaluate this, we used a novel transposase-based approach to create libraries of vectors that express structurally-related fragments of Bacillus subtilis adenylate kinase (BsAK) and Thermotoga neapolitana adenylate kinase (TnAK) with identical modifications at their termini, and we selected for variants in each library that complement the growth of Escherichia coli with a temperature-sensitive adenylate kinase (AK). Mutants created using the hyperthermophilic TnAK were found to support growth with a higher frequency (44%) than those generated from the mesophilic BsAK (6%), and selected TnAK mutants complemented E. coli growth more strongly than homologous BsAK variants. Sequencing of functional clones from each library also identified a greater dispersion of fragmentation sites within TnAK. Nondisruptive fission sites were observed within the AMP binding and core domains of both AK homologs. However, only TnAK contained sites within the lid domain, which undergoes dynamic fluctuations that are critical for catalysis. These findings implicate the flexible lid domain as having an increased sensitivity to fission events at physiological temperatures. In addition, they provide evidence that comparisons of nondisruptive fission sites in homologous proteins could be useful for finding dynamic regions whose conformational fluctuations are important for function, and they show that the discovery of protein fragments that cooperatively function in mesophiles can be aided by the use of thermophilic enzymes as starting points for protein design. Copyright © 2010 Elsevier Ltd. All rights reserved.
Nationwide inventory of mosquito biodiversity (Diptera: Culicidae) in Belgium, Europe.
Versteirt, V; Boyer, S; Damiens, D; De Clercq, E M; Dekoninck, W; Ducheyne, E; Grootaert, P; Garros, C; Hance, T; Hendrickx, G; Coosemans, M; Van Bortel, W
2013-04-01
To advance our restricted knowledge on mosquito biodiversity and distribution in Belgium, a national inventory started in 2007 (MODIRISK) based on a random selection of 936 collection points in three main environmental types: urban, rural and natural areas. Additionally, 64 sites were selected because of the risk of importing a vector or pathogen in these sites. Each site was sampled once between May and October 2007 and once in 2008 using Mosquito Magnet Liberty Plus traps. Diversity in pre-defined habitat types was calculated using three indices. The association between species and environmental types was assessed using a correspondence analysis. Twenty-three mosquito species belonging to traditionally recognized genera were found, including 21 indigenous and two exotic species. Highest species diversity (Simpson 0.765) and species richness (20 species) was observed in natural areas, although urban sites scored also well (Simpson 0.476, 16 species). Four clusters could be distinguished based on the correspondence analysis. The first one is related to human modified landscapes (such as urban, rural and industrial sites). A second is composed of species not associated with a specific habitat type, including the now widely distributed Anopheles plumbeus. A third group includes species commonly found in restored natural or bird migration areas, and a fourth cluster is composed of forest species. Outcomes of this study demonstrate the effectiveness of the designed sampling scheme and support the choice of the trap type. Obtained results of this first country-wide inventory of the Culicidae in Belgium may serve as a basis for risk assessment of emerging mosquito-borne diseases.
Paiardini, Alessandro; Tramonti, Angela; Schirch, Doug; Guiducci, Giulia; di Salvo, Martino Luigi; Fiascarelli, Alessio; Giorgi, Alessandra; Maras, Bruno; Cutruzzolà, Francesca; Contestabile, Roberto
2016-11-01
The cytosolic and mitochondrial isoforms of serine hydroxymethyltransferase (SHMT1 and SHMT2, respectively) are well-recognized targets of cancer research, since their activity is critical for purine and pyrimidine biosynthesis and because of their prominent role in the metabolic reprogramming of cancer cells. Here we show that 3-bromopyruvate (3BP), a potent novel anti-tumour agent believed to function primarily by blocking energy metabolism, differentially inactivates human SHMT1 and SHMT2. SHMT1 is completely inhibited by 3BP, whereas SHMT2 retains a significant fraction of activity. Site directed mutagenesis experiments on SHMT1 demonstrate that selective inhibition relies on the presence of a cysteine residue at the active site of SHMT1 (Cys204) that is absent in SHMT2. Our results show that 3BP binds to SHMT1 active site, forming an enzyme-3BP complex, before reacting with Cys204. The physiological substrate l-serine is still able to bind at the active site of the inhibited enzyme, although catalysis does not occur. Modelling studies suggest that alkylation of Cys204 prevents a productive binding of l-serine, hampering interaction between substrate and Arg402. Conversely, the partial inactivation of SHMT2 takes place without the formation of a 3BP-enzyme complex. The introduction of a cysteine residue in the active site of SHMT2 by site directed mutagenesis (A206C mutation), at a location corresponding to that of Cys204 in SHMT1, yields an enzyme that forms a 3BP-enzyme complex and is completely inactivated. This work sets the basis for the development of selective SHMT1 inhibitors that target Cys204, starting from the structure and reactivity of 3BP. Copyright © 2016 Elsevier B.V. All rights reserved.
Jin, Zhao; Di Rienzi, Sara C.; Janzon, Anders; Werner, Jeff J.; Angenent, Largus T.; Dangl, Jeffrey L.; Fowler, Douglas M.
2015-01-01
Metagenomes derived from environmental microbiota encode a vast diversity of protein homologs. How this diversity impacts protein function can be explored through selection assays aimed to optimize function. While artificially generated gene sequence pools are typically used in selection assays, their usage may be limited because of technical or ethical reasons. Here, we investigate an alternative strategy, the use of soil microbial DNA as a starting point. We demonstrate this approach by optimizing the function of a widely occurring soil bacterial enzyme, 1-aminocyclopropane-1-carboxylate (ACC) deaminase. We identified a specific ACC deaminase domain region (ACCD-DR) that, when PCR amplified from the soil, produced a variant pool that we could swap into functional plasmids carrying ACC deaminase-encoding genes. Functional clones of ACC deaminase were selected for in a competition assay based on their capacity to provide nitrogen to Escherichia coli in vitro. The most successful ACCD-DR variants were identified after multiple rounds of selection by sequence analysis. We observed that previously identified essential active-site residues were fixed in the original unselected library and that additional residues went to fixation after selection. We identified a divergent essential residue whose presence hints at the possible use of alternative substrates and a cluster of neutral residues that did not influence ACCD performance. Using an artificial ACCD-DR variant library generated by DNA oligomer synthesis, we validated the same fixation patterns. Our study demonstrates that soil metagenomes are useful starting pools of protein-coding-gene diversity that can be utilized for protein optimization and functional characterization when synthetic libraries are not appropriate. PMID:26637602
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kolonko, Nadine; Bannach, Oliver; Aschermann, Katja
Viroids are single-stranded, circular RNAs of 250 to 400 bases, that replicate autonomously in their host plants but do not code for a protein. Viroids of the family Pospiviroidae, of which potato spindle tuber viroid (PSTVd) is the type strain, are replicated by the host's DNA-dependent RNA polymerase II in the nucleus. To analyze the initiation site of transcription from the (+)-stranded circles into (-)-stranded replication intermediates, we used a nuclear extract from a non-infected cell culture of the host plant S. tuberosum. The (-)-strands, which were de novo-synthesized in the extract upon addition of circular (+)-PSTVd, were purified bymore » affinity chromatography. This purification avoided contamination by host nucleic acids that had resulted in a misassignment of the start site in an earlier study. Primer-extension analysis of the de novo-synthesized (-)-strands revealed a single start site located in the hairpin loop of the left terminal region in circular PSTVd's secondary structure. This start site is supported further by analysis of the infectivity and replication behavior of site-directed mutants in planta.« less
Denning, Eileen; Sharma, Shweta; Smolskis, Mary; Touloumi, Giota; Walker, Sarah; Babiker, Abdel; Clewett, Megan; Emanuel, Ezekiel; Florence, Eric; Papadopoulos, Antonios; Sánchez, Adriana; Tavel, Jorge; Grady, Christine
2014-01-01
Objectives Efforts are needed to improve informed consent of participants in research. The Strategic Timing of AntiRetroviral Therapy (START) study provides a unique opportunity to study the effect of length and complexity of informed consent documents on understanding and satisfaction among geographically diverse participants. Methods Interested START sites were randomised to use either the standard consent form or the concise consent form for all of the site’s participants. Results A total of 4473 HIV-positive participants at 154 sites worldwide took part in the Informed Consent Substudy, with consent given in 11 primary languages. Most sites sent written information to potential participants in advance of clinic visits, usually including the consent form. At about half the sites, staff reported spending less than an hour per participant in the consent process. The vast majority of sites assessed participant understanding using informal nonspecific questions or clinical judgment. Conclusions These data reflect the interest of START research staff in evaluating the consent process and improving informed consent. The START Informed Consent Substudy is by far the largest study of informed consent intervention ever conducted. Its results have the potential to impact how consent forms are written around the world. PMID:25711320
Parker, Thomas C; Tang, Jianwu; Clark, Mahalia B; Moody, Michael M; Fetcher, Ned
2017-11-01
Eriophorum vaginatum is a tussock-forming sedge that contributes significantly to the structure and primary productivity of moist acidic tussock tundra. Locally adapted populations (ecotypes) have been identified across the geographical distribution of E. vaginatum ; however, little is known about how their growth and phenology differ over the course of a growing season. The growing season is short in the Arctic and therefore exerts a strong selection pressure on tundra species. This raises the hypothesis that the phenology of arctic species may be poorly adapted if the timing and length of the growing season change. Mature E. vaginatum tussocks from across a latitudinal gradient (65-70°N) were transplanted into a common garden at a central location (Toolik Lake, 68°38'N, 149°36'W) where half were warmed using open-top chambers. Over two growing seasons (2015 and 2016), leaf length was measured weekly to track growth rates, timing of senescence, and biomass accumulation. Growth rates were similar across ecotypes and between years and were not affected by warming. However, southern populations accumulated significantly more biomass, largely because they started to senesce later. In 2016, peak biomass and senescence of most populations occurred later than in 2015, probably induced by colder weather at the beginning of the growing season in 2016, which caused a delayed start to growth. The finish was delayed as well. Differences in phenology between populations were largely retained between years, suggesting that the amount of time that these ecotypes grow has been selected by the length of the growing seasons at their respective home sites. As potential growing seasons lengthen, E. vaginatum may be unable to respond appropriately as a result of genetic control and may have reduced fitness in the rapidly warming Arctic tundra.
Human-Specific Histone Methylation Signatures at Transcription Start Sites in Prefrontal Neurons
Cheung, Iris; Bharadwaj, Rahul; Chou, Hsin-Jung; Houston, Isaac B.; Peter, Cyril J.; Mitchell, Amanda C.; Yao, Wei-Dong; Myers, Richard H.; Chen, Jiang-fan; Preuss, Todd M.; Rogaev, Evgeny I.; Jensen, Jeffrey D.; Weng, Zhiping; Akbarian, Schahram
2012-01-01
Cognitive abilities and disorders unique to humans are thought to result from adaptively driven changes in brain transcriptomes, but little is known about the role of cis-regulatory changes affecting transcription start sites (TSS). Here, we mapped in human, chimpanzee, and macaque prefrontal cortex the genome-wide distribution of histone H3 trimethylated at lysine 4 (H3K4me3), an epigenetic mark sharply regulated at TSS, and identified 471 sequences with human-specific enrichment or depletion. Among these were 33 loci selectively methylated in neuronal but not non-neuronal chromatin from children and adults, including TSS at DPP10 (2q14.1), CNTN4 and CHL1 (3p26.3), and other neuropsychiatric susceptibility genes. Regulatory sequences at DPP10 and additional loci carried a strong footprint of hominid adaptation, including elevated nucleotide substitution rates and regulatory motifs absent in other primates (including archaic hominins), with evidence for selective pressures during more recent evolution and adaptive fixations in modern populations. Chromosome conformation capture at two neurodevelopmental disease loci, 2q14.1 and 16p11.2, revealed higher order chromatin structures resulting in physical contact of multiple human-specific H3K4me3 peaks spaced 0.5–1 Mb apart, in conjunction with a novel cis-bound antisense RNA linked to Polycomb repressor proteins and downregulated DPP10 expression. Therefore, coordinated epigenetic regulation via newly derived TSS chromatin could play an important role in the emergence of human-specific gene expression networks in brain that contribute to cognitive functions and neurological disease susceptibility in modern day humans. PMID:23185133
Physical signals for protein-DNA recognition
NASA Astrophysics Data System (ADS)
Cao, Xiao-Qin; Zeng, Jia; Yan, Hong
2009-09-01
This paper discovers consensus physical signals around eukaryotic splice sites, transcription start sites, and replication origin start and end sites on a genome-wide scale based on their DNA flexibility profiles calculated by three different flexibility models. These salient physical signals are localized highly rigid and flexible DNAs, which may play important roles in protein-DNA recognition by the sliding search mechanism. The found physical signals lead us to a detailed hypothetical view of the search process in which a DNA-binding protein first finds a genomic region close to the target site from an arbitrary starting location by three-dimensional (3D) hopping and intersegment transfer mechanisms for long distances, and subsequently uses the one-dimensional (1D) sliding mechanism facilitated by the localized highly rigid DNAs to accurately locate the target flexible binding site within 30 bp (base pair) short distances. Guided by these physical signals, DNA-binding proteins rapidly search the entire genome to recognize a specific target site from the 3D to 1D pathway. Our findings also show that current promoter prediction programs (PPPs) based on DNA physical properties may suffer from lots of false positives because other functional sites such as splice sites and replication origins have similar physical signals as promoters do.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tomas, J.
2003-02-25
Attempts to solve the problem of high-level waste disposal including the spent fuel from nuclear power plants have been made in the Czech Republic for over the 10 years. Already in 1991 the Ministry of Environment entitled The Czech Geological Survey to deal with the siting of the locality for HLW disposal and the project No. 3308 ''The geological research of the safe disposal of high level waste'' had started. Within this project a sub-project ''A selection of perspective HLW disposal sites in the Bohemian Massif'' has been elaborated and 27 prospective areas were identified in the Czech Republic. Thismore » selection has been later narrowed to 8 areas which are recently studied in more detail. As a parallel research activity with siting a granitic body Melechov Massif in Central Moldanubian Pluton has been chosen as a test site and the 1st stage of research i.e. evaluation and study of its geological, hydrogeological, geophysical, tectonic and structural properties has been already completed. The Melechov Massif was selected as a test site after the recommendation of WATRP (Waste Management Assessment and Technical Review Programme) mission of IAEA (1993) because it represents an area analogous with the host geological environment for the future HLW and spent fuel disposal in the Czech Republic, i.e. variscan granitoids. It is necessary to say that this site would not be in a locality where the deep repository will be built, although it is a site suitable for oriented research for the sampling and collection of descriptive data using up to date and advanced scientific methods. The Czech Republic HLW and spent fuel disposal programme is now based on The Concept of Radioactive Waste and Spent Nuclear Fuel Management (''Concept'' hereinafter) which has been prepared in compliance with energy policy approved by Government Decree No. 50 of 12th January 2000 and approved by the Government in May 2002. Preparation of the Concept was required, amongst other reasons in connection with preparations for the Czech Republic's accession to the European Union and in connection with the Joint Convention on the Safety of Spent Fuel Management and on the Safety of Radioactive Waste Management adopted under the auspices of the International Atomic Energy Agency, which was signed by the Czech Republic in 1997. According to the approved Concept it is expected that a deep geological repository in the Czech Republic will be built in granitic rocks.« less
ERIC Educational Resources Information Center
Leow, Christine; Wen, Xiaoli; Korfmacher, Jon
2015-01-01
This article compares regression modeling and propensity score analysis as different types of statistical techniques used in addressing selection bias when estimating the impact of two-year versus one-year Head Start on children's school readiness. The analyses were based on the national Head Start secondary dataset. After controlling for…
Komatsu, Ken; Hirata, Hisae; Fukagawa, Takako; Yamaji, Yasuyuki; Okano, Yukari; Ishikawa, Kazuya; Adachi, Tatsushi; Maejima, Kensaku; Hashimoto, Masayoshi; Namba, Shigetou
2012-07-01
The first open-reading frame (ORF) of apple stem grooving virus (ASGV), of the genus Capillovirus, encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP). However, our previous study revealed that ASGV mutants with distinct and discontinuous Rep- and CP-coding regions successfully infect plants, indicating that CP expressed via a subgenomic RNA (sgRNA) is sufficient for viability of the virus. Here we identified a transcription start site of the CP sgRNA and revealed that CP translated from the sgRNA is essential for ASGV infection. We mapped the transcription start sites of both the CP and the movement protein (MP) sgRNAs of ASGV and found a hexanucleotide motif, UUAGGU, conserved upstream from both sgRNA transcription start sites. Mutational analysis of the putative CP initiation codon and of the UUAGGU sequence upstream from the transcription start site of CP sgRNA demonstrated their importance for ASGV accumulation. Our results also demonstrated that potato virus T (PVT), an unassigned species closely related to ASGV, produces two sgRNAs putatively deployed for the CP and MP expression and that the same hexanucleotide motif as found in ASGV is located upstream from the transcription start sites of both sgRNAs. This motif, which constituted putative core elements of the sgRNA promoter, is broadly conserved among viruses in the families Alphaflexiviridae and Betaflexiviridae, suggesting that the gene expression strategy of the viruses in both families has been conserved throughout evolution. Copyright © 2012 Elsevier B.V. All rights reserved.
Washington State Even Start 1993-1994: Final Evaluation. A Report to the Office of Adult Literacy.
ERIC Educational Resources Information Center
Iglitzin, Lynne; Wandschneider, Mary
All 18 Washington State Even Start sites participated in the program's evaluation. Site coordinators administered the assessment and evaluation measures to the adults served by the program and to teachers working with children at both entry and exit from the program. An indepth study was conducted of 134 families for whom there were complete sets…
Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H
1999-10-28
We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium.
Medicinal chemistry of P2X receptors: allosteric modulators.
Müller, Christa E
2015-01-01
P2X receptors are trimeric ligand-gated ion channels whose potential as novel drug targets for a number of diseases has been recognized. They are mainly involved in inflammatory processes, including neuroinflammation, and pain sensation. The orthosteric binding site is lined by basic amino acid residues that bind the negatively charged agonist ATP. Therefore it is not easy to develop orthosteric ligands that possess drug-like properties for such a highly polar binding site. However, ligand-gated ion channels offer multiple additional binding sites for allosteric ligands, positive or negative allosteric modulators enhancing or blocking receptor function. So far, the P2X3 (and P2X2/3), as well as the P2X7 receptor subtype have been the main focus of drug development efforts. A number of potent and selective allosteric antagonists have been developed to block these receptors. We start to see the development of novel allosteric ligands also for the other P2X receptor subtypes, P2X1, P2X2 and especially P2X4. The times when only poor, non-selective, non-drug-like tools for studying P2X receptor function were available have been overcome. The first clinical studies with allosteric P2X3 and P2X7 antagonists suggest that P2X therapeutics may soon become a reality.
NASA Astrophysics Data System (ADS)
Sun, Xuanyu; Yu, Yingzhe; Zhang, Minhua
2018-03-01
Density functional theory calculations have been employed to investigate the effect of promoter Co on C2 oxygenate formation from syngas on pure Cu(100) and two kinds of Co-Cu bimetallic surfaces. Based on the results of previous studies that CH3O is a key intermediate in ethanol formation on Cu catalyst, five reactions starting from CH3O were taken into consideration. Different from the results on Cu(100) that CH3OH is the most favorable product on pure Co sites, CH3 formation is more favorable both kinetically and thermodynamically than CH3OH formation, which leads to more CH3 available for CHO insertion to form C2 oxygenates. On the other hand, Co-Cu bimetallic sites can facilitate CHO insertion into CH3 energetically, which is favorable for carbon chain growth. And the addition of Co can make the barrier of CH3 hydrogenation and CH3 coupling to CH4 and CH3CH3 higher, making CH3CHO much more selective than hydrocarbons. In conclusion, by introducing Co into Cu catalyst, the productivity and selectivity of C2 oxygenate precursor of ethanol can be effectively improved. The optimum Co-Cu catalyst should contain Cu ensembles and Co ensembles with proper sizes, and offer enough Co-Cu bimetallic sites at the same time.
A multicriteria-based methodology for site prioritisation in sediment management.
Alvarez-Guerra, Manuel; Viguri, Javier R; Voulvoulis, Nikolaos
2009-08-01
Decision-making for sediment management is a complex task that incorporates the selections of areas for remediation and the assessment of options for any mitigation required. The application of Multicriteria Analysis (MCA) to rank different areas, according to their need for sediment management, provides a great opportunity for prioritisation, a first step in an integrated methodology that finally aims to assess and select suitable alternatives for managing the identified priority sites. This paper develops a methodology that starts with the delimitation of management units within areas of study, followed by the application of MCA methods that allows ranking of these management units, according to their need for remediation. This proposed process considers not only scientific evidence on sediment quality, but also other relevant aspects such as social and economic criteria associated with such decisions. This methodology is illustrated with its application to the case study area of the Bay of Santander, in northern Spain, highlighting some of the implications of utilising different MCA methods in the process. It also uses site-specific data to assess the subjectivity in the decision-making process, mainly reflected through the assignment of the criteria weights and uncertainties in the criteria scores. Analysis of the sensitivity of the results to these factors is used as a way to assess the stability and robustness of the ranking as a first step of the sediment management decision-making process.
Dayan, Gustavo; Arredondo, Jose L.; Carrasquilla, Gabriel; Deseda, Carmen C.; Dietze, Reynaldo; Luz, Kleber; Costa, Maria Selma N.; Cunha, Rivaldo V.; Rey, Luis C.; Morales, Javier; Reynales, Humberto; Miranda, Maria; Zambrano, Betzana; Rivas, Enrique; Garbes, Pedro; Noriega, Fernando
2015-01-01
To prepare for a Phase III dengue vaccine efficacy trial, 20 investigational sites were selected for this observational study to identify dengue infections in a closed cohort (N = 3,000 children 9–16 years of age). Of 255 acute febrile episodes experienced by 235 children, 50 (21.3%) were considered serologically probable dengue, and 18 (7.7%) were considered virologically confirmed (i.e., dengue NS1 antigen positive) dengue cases. Considering the disease-free and at-risk period from study start to onset of symptoms, the overall incidence density of acute febrile episodes was 17.7 per 100 person-years of follow-up, ranging from 15.3 in Colombia to 22.0 in Puerto Rico. This study showed that all sites were capable of capturing and following up acute febrile episodes within a specific timeframe among the established cohort and to detect dengue cases. PMID:26013373
Telemedicine in South Africa: success or failure?
Gulube, S M; Wynchank, S
2001-01-01
A national telemedicine system for South Africa was planned in 1998. In the first phase, starting in 1999, 28 pilot sites were established in six provinces. The initial applications were teleradiology, tele-ultrasound for antenatal services, telepathology and tele-ophthalmology. Telemedicine equipment was connected by ISDN at 256 kbit/s. From January to September 2000, 2663 radiographic studies were performed at the three Northwest Province teleradiology transmission sites, of which 264 studies (10%) were selected for specialist radiologist reporting by teleradiology. From June to August 2000, nine antenatal care tele-ultrasound consultations were performed in the Northern Cape Province and four transfers were avoided through the use of telemedicine. One area of concern is the relatively low usage of the telemedicine system, which raises questions about its cost-effectiveness. The experience of telemedicine in South Africa confirmed, as others have found, that common problems relate to the technical and organizational challenges of introducing telemedicine.
Giresi, Paul G.; Kim, Jonghwan; McDaniell, Ryan M.; Iyer, Vishwanath R.; Lieb, Jason D.
2007-01-01
DNA segments that actively regulate transcription in vivo are typically characterized by eviction of nucleosomes from chromatin and are experimentally identified by their hypersensitivity to nucleases. Here we demonstrate a simple procedure for the isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements). To perform FAIRE, chromatin is crosslinked with formaldehyde in vivo, sheared by sonication, and phenol-chloroform extracted. The DNA recovered in the aqueous phase is fluorescently labeled and hybridized to a DNA microarray. FAIRE performed in human cells strongly enriches DNA coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, and active promoters. Evidence for cell-type–specific patterns of FAIRE enrichment is also presented. FAIRE has utility as a positive selection for genomic regions associated with regulatory activity, including regions traditionally detected by nuclease hypersensitivity assays. PMID:17179217
Boulton, Stephen; Selvaratnam, Rajeevan; Ahmed, Rashik; Melacini, Giuseppe
2018-01-01
Mapping allosteric sites is emerging as one of the central challenges in physiology, pathology, and pharmacology. Nuclear Magnetic Resonance (NMR) spectroscopy is ideally suited to map allosteric sites, given its ability to sense at atomic resolution the dynamics underlying allostery. Here, we focus specifically on the NMR CHEmical Shift Covariance Analysis (CHESCA), in which allosteric systems are interrogated through a targeted library of perturbations (e.g., mutations and/or analogs of the allosteric effector ligand). The atomic resolution readout for the response to such perturbation library is provided by NMR chemical shifts. These are then subject to statistical correlation and covariance analyses resulting in clusters of allosterically coupled residues that exhibit concerted responses to the common set of perturbations. This chapter provides a description of how each step in the CHESCA is implemented, starting from the selection of the perturbation library and ending with an overview of different clustering options.
USDOE/Russian Ministry of Fuel and Energy joint collaboration for renewable energy resources
DOE Office of Scientific and Technical Information (OSTI.GOV)
Touryan, K.
1997-12-01
This paper describes a joint collaboration between the US and Russia to develop renewable energy resources. There are five main goals of the project. First is to establish Intersolarcenter as a sister organization to NREL for joint R&D activities, and to provide training to the staff. Second is to install demonstration systems in parks and selected locations around Moscow. Third is to install pilot projects: a wind/diesel hybrid system at 21 sites in the northern territories; a 500 kW biomass power plant in the Arkhangelsk Region. Fourth is to assist in the start-up operations of a 2 MW/yr Triple Junctionmore » amorphous-Si manufacturing facility in Moscow using US technology. Fifth is to explore the possibilities of financing large-scale wind/hybrid and biomass power systems for the nouthern territories (possibly 900 sites).« less
2013-01-01
Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559
Berlin, Lisa J; Whiteside-Mansell, Leanne; Roggman, Lori A; Green, Beth L; Robinson, JoAnn; Spieker, Susan
2011-01-01
This study examined maternal depression, attachment avoidance, and attachment anxiety as moderators of Early Head Start's effects on four parenting outcomes assessed at age three. Participants (N = 947) were drawn from six sites of the Early Head Start National Research and Evaluation Project, a multi-site randomized trial. Findings suggest more positive program effects for mothers with less initial attachment avoidance or attachment anxiety. First, baseline attachment avoidance moderated Early Head Start program effects on observed maternal supportiveness, such that program mothers with lower baseline attachment avoidance were rated as more supportive of their three-year-olds than program mothers with higher baseline attachment avoidance. Second, program effects on spanking varied depending on mothers' baseline attachment anxiety.
NASA Astrophysics Data System (ADS)
Kobayashi, Yusuke; Watanabe, Teiji
2017-04-01
This study has three objectives: (1) to estimate changes of the eroded volume of mountain trails from 2014 to 2016 by making DSMs, (2) to understand a relationship between the trail erosion and micro-topography, and (3) to predict the volume of soil that can be eroded in future. Trail erosion has been investigated near Mt. Hokkai-dake in Daisetzuzan National Park, Hokkaido, northern Japan, with a drone (UAV) from 2014 to 2016. Seven segments with the soil erosion from starting sites to ending sites were selected to make DSMs and Orthophotographs by Agisoft, which is one of the Structure from Motion (SfM) software. Then, at fourteen points in each of the seven segments were selected to estimate the volume of soil that can be eroded in the future by PANDA2, a soil compaction penetrometer. The eroded volume in the segment with the largest eroded value attained 274.67 m3 for the two-year period although extremely heavy rain hit this area in the 2016 summer. The result obtained by PANDA2 shows that soil more than 100 cm in depth will be potentially eroded at four points in three years to one hundred years.
Ngororabanga, Jean Marie Vianney; Du Plessis, Jacolien; Mama, Neliswa
2017-01-01
A novel fluorescent polymer with pendant triazolyl coumarin units was synthesized through radical polymerization. The polymer showed reasonable sensitivity and selectivity towards Cu2+ in acetonitrile in comparison to other tested metal ions with a significant quenching effect on fluorescence and blue shifting in the range of 20 nm. The blue shift was assigned to the conformation changes of the diethylamino group from the coumarin moiety which led to planarization of the triazolyl coumarin units. The possible binding modes for Cu2+ towards the polymer were determined through the comparison of the emission responses of the polymer, starting vinyl monomer and reference compound, and the triazole ring was identified as one of the possible binding sites for Cu2+. The detection limits of the polymer and vinyl monomer towards Cu2+ were determined from fluorescence titration experiments and a higher sensitivity (35 times) was observed for the polymer compared with its starting monomer. PMID:28867764
Ngororabanga, Jean Marie Vianney; Du Plessis, Jacolien; Mama, Neliswa
2017-08-30
A novel fluorescent polymer with pendant triazolyl coumarin units was synthesized through radical polymerization. The polymer showed reasonable sensitivity and selectivity towards Cu 2+ in acetonitrile in comparison to other tested metal ions with a significant quenching effect on fluorescence and blue shifting in the range of 20 nm. The blue shift was assigned to the conformation changes of the diethylamino group from the coumarin moiety which led to planarization of the triazolyl coumarin units. The possible binding modes for Cu 2+ towards the polymer were determined through the comparison of the emission responses of the polymer, starting vinyl monomer and reference compound, and the triazole ring was identified as one of the possible binding sites for Cu 2+ . The detection limits of the polymer and vinyl monomer towards Cu 2+ were determined from fluorescence titration experiments and a higher sensitivity (35 times) was observed for the polymer compared with its starting monomer.
Vegetation in transition: the Southwest's dynamic past century
Raymond M. Turner
2005-01-01
Monitoring that follows long-term vegetation changes often requires selection of a temporal baseline. Any such starting point is to some degree artificial, but in some instances there are aids that can be used as guides to baseline selection. Matched photographs duplicating scenes first recorded on film a century or more ago reveal changes that help select the starting...
ERIC Educational Resources Information Center
Hanson, Lori, Comp.; Deere, David, Comp.; Lee, Carol Amundson, Comp.; Lewin, Amy, Comp.; Seval, Carolyn, Comp.
This paper describes the Starting Early Starting Smart (SESS) project, an early intervention program that has been developed in the context of the national, multi-site program and evaluation. The emphasis in SESS is on the integration of behavioral health services into easily accessible, non-threatening settings where caregivers naturally and…
Beigi, Parmida; Malenfant, Paul; Rasoulian, Abtin; Rohling, Robert; Dube, Alison; Gunka, Vit
2017-01-01
Current 2-D ultrasound technology is unable to perform a midline neuraxial needle insertion under real-time ultrasound guidance using a standard needle and without an assistant. The aim of the work described here was to determine the feasibility of a new technology providing such capability, starting with a study evaluating the selected puncture site. A novel 3-D ultrasound imaging technique was designed using thick-slice rendering in conjunction with a custom needle guide (3DUS + Epiguide). A clinical feasibility study evaluated the ability of 3DUS + Epiguide to identify the epidural needle puncture site for a midline insertion in the lumbar spine. We hypothesized that (i) the puncture site identified by 3DUS + Epiguide was within a 5-mm radius from the site chosen by standard palpation, and (ii) the difference between the two puncture sites was not correlated to the patient characteristics age, weight, height, body mass index and gestational age. The mean (±standard deviation) distances between puncture sites determined by 3DUS + Epiguide and palpation were 3.1 (±1.7) mm and 2.8 (±1.3) mm, for the L2-3 and L3-4 interspaces of 20 patients, respectively. Distances were comparable to intra-observer variability, indicating the potential for a thick-slice rendering of 3-D ultrasound along the Epiguide trajectory to select the puncture site of a midline neuraxial needle insertion. The long-term potential benefits of this system include increased efficiency and use of anesthesia, and a reduction in the frequency and severity of the complications from incorrect needle insertions. Epidural success in the most difficult cases (e.g., the obese) will be the focus of future work. Copyright © 2016 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.
AmeriFlux US-An1 Anaktuvuk River Severe Burn
Hobbie, John [Marine Biological Laboratory; Rocha, Adrian [Marine Biological Laboratory; Shaver, Gaius [Marine Biological Laboratory
2016-01-01
This is the AmeriFlux version of the carbon flux data for the site US-An1 Anaktuvuk River Severe Burn. Site Description - The Anaktuvuk River fire on the North Slope of Alaska started on July 16, 2007 by lightning. It continued until the end of September when nearby lakes had already frozen over and burned >256,000 acres, creating a mosaic of patches that differed in burn severity. The Anaktuvuk River Severe Burn, Moderate Burn, and Unburned sites are 40 km to the west of the nearest road and were selected in late May 2008 to determine the effects of the fire on carbon, water, and energy exchanges during the growing season. Because the fire had burned through September of the previous year, initial deployment of flux towers occurred prior to any significant vegetative regrowth, and our sampling campaign captured the full growing season in 2008. The Severe Burn site consisted of a large area in which all of the green vegetation were consumed in the fire and some of the organic matter had burnt to the mineral soil in many places. A bear damaged the tower during the last week of August 2008, and it was repaired shortly after.
Physico-chemical changes of the ground waters related to the 2011 El Hierro magmatic reactivation
NASA Astrophysics Data System (ADS)
Dionis, S.; Melián, G.; Padrón, E.; Padilla, G.; Nolasco, D.; Rodríguez, F.; Hernández, I.; Peraza, D.; Barrancos, J.; Hernández, P.; Calvo, D.; Pérez, N.
2012-04-01
The island of El Hierro (278 Km2), is the smallest, the southwesternmost and the youngest island (˜1.12 My) of the Canarian archipelago. The main geological characteristics of El Hierro consist on the presence of three convergent ridges of volcanic cones on a truncated trihedron shape and giant landslides between the three rift zones, being the most recent El Golfo on the northwest flank of the island. On July 2011 an anomalous seismic activity at Hierro Island started and suggested the initial stage of a volcanic unrest in the volcanic system. On October 10, after the occurrence of more than 10,000 earthquakes, a submarine eruption started. Evidences of this submarine volcanic eruption were visible on the sea surface to the south of La Restinga village, at the south of the island, in the form of large light-green coloured area, turbulent gas emission and the appearance of steamy volcanic fragments three days later. As part of its volcanic surveillance activities, the Instituto Volcanologico de Canarias (INVOLCAN) started a hydrogeochemical monitoring program on August 2011 in order to evaluate the temporal evolution of several physico-chemical parameters of the ground water system of El Hierro. Four observation sites were selected: three wells on the north of the island, where the seismic activity was located at the beginning of the volcano-seismic unrest (SIMO, FRON and PADO) and one horizontal well (gallery) in the south (TACO). Ground water sampling is being regularly collected, three times per week, at each observation site, and in-situ measurements of pH, conductivity and temperature measurements are performed. After 6 month of monitoring, no significant changes have been observed on pH and temperature measurements from all the observation sites. However, clear sharp decrease of conductivity was observed at SIMO on October 10 when the seismic tremor started. In addition, the strongest conductivity decrease pattern was observed later on at SIMO and PADO on November 4; one week earlier of the largest seismic event registered during this volcanic crisis on November 11 (M = 4.6). This observed physico-chemical changes in the ground water system might be explained as a result of the changes on the strain/stress field due to the seismic activity enhancing mixing of water bodies with different conductivities.
Rejman, Marek; Bilewski, Marek; Szczepan, Stefan; Klarowicz, Andrzej; Rudnik, Daria; Maćkała, Krzysztof
2017-01-01
The aim of this study was to analyse changes taking place within selected kinematic parameters of the swimming start, after completing a six-week plyometric training, assuming that the take-off power training improves its effectiveness. The experiment included nine male swimmers. In the pre-test the swimmers performed three starts focusing on the best performance. Next, a plyometric training programme, adapted from sprint running, was introduced in order to increase a power of the lower extremities. The programme entailed 75 minute sessions conducted twice a week. Afterwards, a post-test was performed, analogous to the pre-test. Spatio-temporal structure data of the swimming start were gathered from video recordings of the swimmer above and under water. Impulses triggered by the plyometric training contributed to a shorter start time (the main measure of start effectiveness) and glide time as well as increasing average take-off, flight and glide velocities including take-off, entry and glide instantaneous velocities. The glide angle decreased. The changes in selected parameters of the swimming start and its confirmed diagnostic values, showed the areas to be susceptible to plyometric training and suggested that applied plyometric training programme aimed at increasing take-off power enhances the effectiveness of the swimming start.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bender, Howard A.
This report presents results of multiple research projects, new and ongoing, funded under the Site-Directed Research and Development Program for the Nevada National Security Site during federal fiscal year 2015. The Site's legacy capabilities in remote sensing combined with new paradigms for emergency response and consequence management help drive the need to develop advanced aerial sensor platforms. Likewise, dynamic materials science is a critical area of scientific research for which basic physics issues are still unresolved. New methods of characterizing materials in extreme states are vitally needed, and these efforts are paving the way with new knowledge. Projects selected inmore » FY 2015 for the Exploratory Research portfolio exhibit a strong balance of NNSS mission relevance. Geoscience, seismology, and techniques for detecting underground nuclear events are still essential focus areas. Many of the project reports in the second major section of this annual report are ongoing continuations in multi-year lifecycles. Diagnostic techniques for stockpile and nuclear security science figured prominently as well, with a few key efforts coming to fruition, such as phase transition detection. In other areas, modeling efforts toward better understanding plasma focus physics has also started to pay dividends for major program needs.« less
Szałaj, Natalia; Bajda, Marek; Dudek, Katarzyna; Brus, Boris; Gobec, Stanislav; Malawska, Barbara
2015-08-01
Alzheimer's disease (AD) is a fatal and complex neurodegenerative disorder for which effective treatment remains the unmet challenge. Using donepezil as a starting point, we aimed to develop novel potential anti-AD agents with a multidirectional biological profile. We designed the target compounds as dual binding site acetylcholinesterase inhibitors, where the N-benzylamine pharmacophore is responsible for interactions with the catalytic anionic site of the enzyme. The heteroaromatic fragment responsible for interactions with the peripheral anionic site was modified and three different heterocycles were introduced: isoindoline, isoindolin-1-one, and saccharine. Based on the results of the pharmacological evaluation, we identified compound 8b with a saccharine moiety as the most potent and selective human acetylcholinesterase inhibitor (IC50 = 33 nM) and beta amyloid aggregation inhibitor. It acts as a non-competitive acetylcholinesterase inhibitor and is able to cross the blood-brain barrier in vitro. We believe that compound 8b represents an important lead compound for further development as potential anti-AD agent. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Allen, A.B.; Malavassi, L.; Ramirez, O.
1989-05-01
As a part of the Agency for International Development-funded cooperative project between Los Alamos and Costa Rica, the burning characteristics of Costa Rican peat were to be tested in an application. The cement plant owned by Industria National de Cemento in Cartago has a capability to handle solid fuel and was chosen for the burn demonstration. The Jungle No. 1 Peat Deposit near El Cairo was chosen as the site of the peat excavation. This peat production methodology study covers project site selection, installation of an access road and clearing of the jungle vegetation, removal of an upper layer ofmore » organic peat, excavation of fuel-grade peat, transport of the peat to the drying site, and drying and stockpiling of the finished product. As of this date the peat removal for the demonstration project has been started, and a description of the operation is included as an appendix to this paper. 10 figs.« less
Tu, N; Chen, H; Winnikes, U; Reinert, I; Pirke, K M; Lentes, K U
2000-09-22
Uncoupling protein-3 (UCP3) is considered as an important regulator of energy expenditure and thermogenesis in humans. To get insight into the mechanisms regulating its expression we have cloned and characterized about 5 kb of the 5'-flanking region of the human UCP3 (hUCP3) gene. 5'-RACE analysis suggested a single transcription initiation site 187 bp upstream from the translational start site. The promoter region contains both TATA and CAAT boxes as well as consensus motifs for PPRE, TRE, CRE and muscle-specific factors like MyoD and MEF2 sites. Functional characterization of a 3 kb hUCP3 promoter fragment in multiple cell lines using a CAT-ELISA identified a cis-acting negative regulatory element between -2983 and -982 while the region between -982 and -284 showed greatly increased basal promoter activity suggesting the presence of a strong enhancer element. Promoter activity was particularly enhanced in the murine skeletal muscle cell line C2C12 reflecting the tissue-selective expression pattern of UCP3.
Cardote, Teresa A F; Ciulli, Alessio
2017-09-21
Cullin RING E3 ubiquitin ligases (CRLs) are large dynamic multi-subunit complexes that control the fate of many proteins in cells. CRLs are attractive drug targets for the development of small-molecule inhibitors and chemical inducers of protein degradation. Herein we describe a structure-guided biophysical approach to probe the protein-protein interaction (PPI) between the Cullin-2 scaffold protein and the adaptor subunits Elongin BC within the context of the von Hippel-Lindau complex (CRL2 VHL ) using peptides. Two peptides were shown to bind at the targeted binding site on Elongin C, named the "EloC site", with micromolar dissociation constants, providing a starting point for future optimization. Our results suggest ligandability of the EloC binding site to short linear peptides, unveiling the opportunity and challenges to develop small molecules that have the potential to target selectively the Cul2-adaptor PPI within CRLs. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Belliure, Josabel; Carrascal, Luis M
2002-01-01
Heliothermy (heat gain by radiation) has been given a prominent role in basking lizards. However, thigmothermy (heat gain by conduction) could be relevant for heating in small lizards. To ascertain the importance of the different heat transmission modes to the thermoregulatory processes, we conducted an experimental study where we analyzed the role of heat transmission modes on heating rates and on the selection of sites for heating in the Mediterranean lizard Acanthodactylus erythrurus (Lacertidae). The study was conducted under laboratory conditions, where two situations of different operative temperatures (38 degrees and 50 degrees C) were simulated in a terrarium. In a first experiment, individuals were allowed to heat up during 2 min at both temperatures and under both heat transmission modes. In a second experiment, individuals were allowed to select between patches differing in the main transmission mode, at both temperatures, to heat up. Experiences were conducted with live, nontethered lizards with a starting body temperature of 27 degrees C. Temperature had a significant effect on the heating rate, with heat gain per unit of time being faster at the higher operative temperature (50 degrees C). The effect of the mode of heat transmission on the heating rate was also significant: at 50 degrees C, heating rate was greater when the main heat transmission mode was conduction from the substrate (thigmothermy) than when heating was mainly due to heat gain by radiation (heliothermy); at 38 degrees C, heating rates did not significantly differ between transmission modes. At 38 degrees C, selection of the site for heating was not significantly different from that expected by chance. However, at 50 degrees C, the heating site offering the slowest heating rate (heliothermic patch) was selected. These results show that heating rates vary not only with environmental temperature but also with different predominant heat transmission modes. Lizards are able to identify and exploit this heterogeneity, selecting the source of heat gain (radiation) that minimizes the risk of overheating when temperature is high.
Rogal, Shari S; Yakovchenko, Vera; Waltz, Thomas J; Powell, Byron J; Kirchner, JoAnn E; Proctor, Enola K; Gonzalez, Rachel; Park, Angela; Ross, David; Morgan, Timothy R; Chartier, Maggie; Chinman, Matthew J
2017-05-11
Hepatitis C virus (HCV) is a common and highly morbid illness. New medications that have much higher cure rates have become the new evidence-based practice in the field. Understanding the implementation of these new medications nationally provides an opportunity to advance the understanding of the role of implementation strategies in clinical outcomes on a large scale. The Expert Recommendations for Implementing Change (ERIC) study defined discrete implementation strategies and clustered these strategies into groups. The present evaluation assessed the use of these strategies and clusters in the context of HCV treatment across the US Department of Veterans Affairs (VA), Veterans Health Administration, the largest provider of HCV care nationally. A 73-item survey was developed and sent to all VA sites treating HCV via electronic survey, to assess whether or not a site used each ERIC-defined implementation strategy related to employing the new HCV medication in 2014. VA national data regarding the number of Veterans starting on the new HCV medications at each site were collected. The associations between treatment starts and number and type of implementation strategies were assessed. A total of 80 (62%) sites responded. Respondents endorsed an average of 25 ± 14 strategies. The number of treatment starts was positively correlated with the total number of strategies endorsed (r = 0.43, p < 0.001). Quartile of treatment starts was significantly associated with the number of strategies endorsed (p < 0.01), with the top quartile endorsing a median of 33 strategies, compared to 15 strategies in the lowest quartile. There were significant differences in the types of strategies endorsed by sites in the highest and lowest quartiles of treatment starts. Four of the 10 top strategies for sites in the top quartile had significant correlations with treatment starts compared to only 1 of the 10 top strategies in the bottom quartile sites. Overall, only 3 of the top 15 most frequently used strategies were associated with treatment. These results suggest that sites that used a greater number of implementation strategies were able to deliver more evidence-based treatment in HCV. The current assessment also demonstrates the feasibility of electronic self-reporting to evaluate ERIC strategies on a large scale. These results provide initial evidence for the clinical relevance of the ERIC strategies in a real-world implementation setting on a large scale. This is an initial step in identifying which strategies are associated with the uptake of evidence-based practices in nationwide healthcare systems.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 43 Public Lands: Interior 2 2012-10-01 2012-10-01 false What do I need to start preparing a site and building and testing a utilization facility on Federal land leased for geothermal resources? 3271.10 Section 3271.10 Public Lands: Interior Regulations Relating to Public Lands (Continued) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR...
Code of Federal Regulations, 2014 CFR
2014-10-01
... 43 Public Lands: Interior 2 2014-10-01 2014-10-01 false What do I need to start preparing a site and building and testing a utilization facility on Federal land leased for geothermal resources? 3271.10 Section 3271.10 Public Lands: Interior Regulations Relating to Public Lands (Continued) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR...
Code of Federal Regulations, 2013 CFR
2013-10-01
... 43 Public Lands: Interior 2 2013-10-01 2013-10-01 false What do I need to start preparing a site and building and testing a utilization facility on Federal land leased for geothermal resources? 3271.10 Section 3271.10 Public Lands: Interior Regulations Relating to Public Lands (Continued) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR...
Code of Federal Regulations, 2011 CFR
2011-10-01
... 43 Public Lands: Interior 2 2011-10-01 2011-10-01 false What do I need to start preparing a site and building and testing a utilization facility on Federal land leased for geothermal resources? 3271.10 Section 3271.10 Public Lands: Interior Regulations Relating to Public Lands (Continued) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR...
Wind Energy and Wildlife Pre- and Post-Construction Project at Pantex Plant
DOE Office of Scientific and Technical Information (OSTI.GOV)
Matlack, Raymond S.
From 2009-2017, we conducted pre- and post-construction monitoring of wildlife at the Pantex Plant before and after construction of five wind turbines on the plant in 2014-2015. Pre-construction acoustic monitoring for bats was conducted at five sites on Pantex. Acoustic (here after Anabat) files were downloaded 30 times with Anabat files recorded from 6/21/2010 through 1/17/2014. The resulting data include over 3,000,000 files and we hope to analyze them in the future. We were never successful recording acoustic data after 2014 (post-construction). This is despite numerous attempts to trouble shoot our acoustic monitors. Wind damage to cables going from themore » body of the monitor to their microphones could not be repaired or replaced while towers were standing. Sampling of breeding birds was accomplished through point counts conducted at sites selected for turbine construction and others selected as control sites. Precipitation varied greatly over the course of the study, from a low of 17.81 cm (7.01 inches) during 2011 to a high of 87.96 cm (34.63 inches) during 2015. The pre-construction portion of the project was characterized by fairly extreme drought starting in 2011. Total precipitation for 2011 and 2012 was just 49.12 cm (19.34 inches), less than 50% of the average for a two-year period. The impact of this drought on nesting grassland birds manifest as low nesting species richness and abundance. In 2011 and 2012, 20 and 17 species were documented during point counts, respectively. Post-construction sampling followed the wet year of 2015 (87.96 cm, 34.63 inches). Species richness of nesting birds in 2016 and 2017 was considerably higher than during the drought, 40 and 37 species, respectively. We suspect changes in resource availability associated with relief from drought starting after 2015 was responsible for the recovery/increase in species detected during the breeding season; less importantly any changes from installation of turbines or changes in surface management (e.g., row-crop type).« less
ExoMars 2018: the four final candidate Landing Sites
NASA Astrophysics Data System (ADS)
Loizeau, Damien; Flahaut, Jessica; Vago, Jorge L.; Hauber, Ernst; Bridges, John C.
2015-04-01
The ExoMars 2018 mission will land a rover on Mars, its scientific objectives are to search for signs of past and present life on Mars and to investigate the water/geochemical environment as a function of depth in the shallow subsurface. The rover will be able to travel several kilometres, analyzing surface and subsurface samples, down to a 2 meter depth. The very powerful combination of mobility with the ability to access in-depth locations, where organic molecules can be well preserved, is unique to this mission [1]. An invitation has been sent to the community to propose scientifically compelling sites for the mission [2], which comply to the main engineering constraints for landing and operation safety. Scientifically interesting sites include locations with evidence for long duration or frequently recurring aqueous activity, low energy transport and deposition, fined-grained, recently exposed sediments, and/or hydrated minerals such as clays or evaporites. The outcrops of interest must be distributed over the landing ellipse to ensure that the rover can access some of them over a short distance [2]. The received proposals have been reviewed by the Landing Site Selection Working Group (LSSWG) and at first eight sites were found to be compliant with the science, engineering, and planetary protection requirements [3]. These sites were presented by their proposers and discussed at the first landing site workshop that took place in ESAC, Spain, 26-28 March 2014. Following that workshop, four sites were selected for further investigation, on the base of their higher potential for long lived water activity, the presence of fine grained sediments, and also importantly on the high concentration of potential targets of interest over the whole landing ellipse [3]. The analysis of these sites, both in term of scientific relevance and engineering safety, is still on-going. Latest findings were presented during a second workshop that took place in ALTEC, Torino, Italy, 11 December 2014. The Aram Dorsum site comprises Noachian layered sedimentary rocks with a prominent inverted channel system (>80 km long). Potential targets include the inverted channel, the channel margins, a channel transition unit, and pits present within the floodplain. The Hypanis Vallis site lies near two fluvial fan/deltaic systems at the termination of Hypanis and Sabrina Valles. Potential targets include mainly outcrops of expected fine-grained sediments on the smooth transition unit that surrounds the delta/fan, and units around the rim of Magong crater. The Mawrth Vallis site contains one of the largest exposures of phyllosilicates detected on the Martian surface, in Noachian terrain [8]. Potential targets include the mineralogically diverse clay-rich outcrops and ancient channels. The Oxia Planum site lies on Fe/Mg phyllosilicates-rich exposures associated to layered rocks that may be related to the Mawrth Vallis sequence. Potential targets include the clay-rich outcrops as well as channels and inverted channels and delta-fan deposits. New data are being actively acquired by the HiRISE, CRISM and HRSC teams to support the ExoMars 2018 landing site selection process. The ellipses are large and new data are important for characterizing the potential targets and evaluating the safety of the sites. The proposing teams, the ExoMars project team and the LSSWG will continue their analysis and comparison of the sites, aiming to complete the certification of at least one site by September 2016 -- in time for the start of the mission's Critical Design Review (CDR). The final selection of the landing site is expected within 2017. References: [1] http://exploration.esa.int/mars/48088-mission-overview/ [2] http://exploration.esa.int/mars/53462-call-for-exo mars-2018-landing-site-selection/ [3] ExoMars 2018 LSSWG recommendation: http://exploration.esa.int/mars/54707-recommendation-for-the-narrowing-of-exomars-2018-landing-sites/
Bed-material characteristics of the Sacramento–San Joaquin Delta, California, 2010–13
Marineau, Mathieu D.; Wright, Scott A.
2017-02-10
The characteristics of bed material at selected sites within the Sacramento–San Joaquin Delta, California, during 2010–13 are described in a study conducted by the U.S. Geological Survey in cooperation with the Bureau of Reclamation. During 2010‒13, six complete sets of samples were collected. Samples were initially collected at 30 sites; however, starting in 2012, samples were collected at 7 additional sites. These sites are generally collocated with an active streamgage. At all but one site, a separate bed-material sample was collected at three locations within the channel (left, right, and center). Bed-material samples were collected using either a US BMH–60 or a US BM–54 (for sites with higher stream velocity) cable-suspended, scoop sampler. Samples from each location were oven-dried and sieved. Bed material finer than 2 millimeters was subsampled using a sieving riffler and processed using a Beckman Coulter LS 13–320 laser diffraction particle-size analyzer. To determine the organic content of the bed material, the loss on ignition method was used for one subsample from each location. Particle-size distributions are presented as cumulative percent finer than a given size. Median and 90th-percentile particle size, and the percentage of subsample mass lost using the loss on ignition method for each sample are also presented in this report.
Dauwalter, D.C.; Fisher, W.L.
2007-01-01
We documented the nesting chronology, nest site selection and nest success of smallmouth bass Micropterus dolomieu in an upstream (4th order) and downstream (5th order) reach of Baron Fork Creek, Oklahoma. Males started nesting in mid-Apr. when water temperatures increased to 16.9 C upstream, and in late-Apr. when temperatures increased to 16.2 C downstream. Streamflows were low (77% upstream to 82% downstream of mean Apr. streamflow, and 12 and 18% of meanjun. streamflow; 47 and 55 y of record), and decreased throughout the spawning period. Larger males nested first upstream, as has been observed in other populations, but not downstream. Upstream, progeny in 62 of 153 nests developed to swim-up stage. Downstream, progeny in 31 of 73 nests developed to swim-up. Nesting densities upstream (147/km) and downstream (100/km) were both higher than any densities previously reported. Males selected nest sites with intermediate water depths, low water velocity and near cover, behavior that is typical of smallmouth bass. Documented nest failures resulted from human disturbance, angling, and longear sunfish predation. Logistic exposure models showed that water velocity at the nest was negatively related and length of the guarding male was positively related to nest success upstream. Male length and number of degree days were both positively related to nest success downstream. Our results, and those of other studies, suggest that biological factors account for most nest failures during benign (stable, low flow) streamflow conditions, whereas nest failures attributed to substrate mobility or nest abandonment dominate when harsh streamflow conditions (spring floods) coincide with the spawning season.
Large U.S. liquids plant starts up
DOE Office of Scientific and Technical Information (OSTI.GOV)
Milios, P.B.; Harris, R.A.
1997-05-12
Operation began in 1996 on the new Chaco liquids-extraction plant in northwest New Mexico. The plant`s extraction capacity--50,000 b/d of NGLs from 600 MMcfd of gas--exceeds that of any other turboexpander plant in the lower 48 states. Regulatory reform made the project possible, and significant regulatory, economic, environmental, technical, and logistic challenges were overcome to achieve plant start-up. Operator El Paso Field Services, Houston, believes the new Chaco plant creates added value when compared to the lean-oil extraction plant which El Paso had operated at the San Juan basin site since the 1950s. Success of the project was based, inmore » part, on the following: creation of a free-market company by the spin-down of El Paso Field Services (EPFS) from El Paso Natural Gas (EPNG); establishment of agreements with producers behind the plant to share the benefits generated by the plant in exchange for acreage dedication; negotiation of an agreement with Mid-America Pipeline Co. to expand its pipeline system to receive and deliver to market liquids from the new plant; and selection of ABB Randall which committed to engineer, procure for, and construct the plant at a cost which provided an adequate rate of return. These four issues are discussed. Construction and start-up are described.« less
Targeted Quantification of Phosphorylation Dynamics in the Context of EGFR-MAPK Pathway.
Yi, Lian; Shi, Tujin; Gritsenko, Marina A; X'avia Chan, Chi-Yuet; Fillmore, Thomas L; Hess, Becky M; Swensen, Adam C; Liu, Tao; Smith, Richard D; Wiley, H Steven; Qian, Wei-Jun
2018-04-17
Large-scale phosphoproteomics with coverage of over 10,000 sites of phosphorylation have now been routinely achieved with advanced mass spectrometry (MS)-based workflows. However, accurate targeted MS-based quantification of phosphorylation dynamics, an important direction for gaining quantitative understanding of signaling pathways or networks, has been much less investigated. Herein, we report an assessment of the targeted workflow in the context of signal transduction pathways, using the epidermal growth factor receptor (EGFR)-mitogen-activated protein kinase (MAPK) pathway as our model. A total of 43 phosphopeptides from the EGFR-MAPK pathway were selected for the study. The recovery and sensitivity of two commonly used enrichment methods, immobilized metal affinity chromatography (IMAC) and titanium oxide (TiO 2 ), combined with selected reaction monitoring (SRM)-MS were evaluated. The recovery of phosphopeptides by IMAC and TiO 2 enrichment was quantified to be 38 ± 5% and 58 ± 20%, respectively, based on internal standards. Moreover, both enrichment methods provided comparable sensitivity from 1 to 100 μg starting peptides. Robust quantification was consistently achieved for most targeted phosphopeptides when starting with 25-100 μg peptides. However, the numbers of quantified targets significantly dropped when peptide samples were in the 1-25 μg range. Finally, IMAC-SRM was applied to quantify signaling dynamics of EGFR-MAPK pathway in Hs578T cells following 10 ng/mL EGF treatment. The kinetics of phosphorylation clearly revealed early and late phases of phosphorylation, even for very low abundance proteins. These results demonstrate the feasibility of robust targeted quantification of phosphorylation dynamics for specific pathways, even starting with relatively small amounts of protein.
Targeted Quantification of Phosphorylation Dynamics in the Context of EGFR-MAPK Pathway
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yi, Lian; Shi, Tujin; Gritsenko, Marina A.
2018-03-27
Large-scale phosphoproteomics with coverage of over 10,000 sites of phosphorylation have now been routinely achieved with advanced mass spectrometry (MS)-based workflows. However, accurate targeted MS-based quantification of phosphorylation dynamics, an important direction for gaining quantitative understanding of signaling pathways or networks, has been much less investigated. Herein, we report an assessment of the targeted workflow in the context of signal transduction pathways, using the epidermal growth factor receptor (EGFR)–mitogen-activated protein kinase (MAPK) pathway as our model. 43 phosphopeptides from the EGFR–MAPK pathway were selected for the study. The recovery and sensitivity of a workflow consisted of two commonly used enrichmentmore » methods, immobilized metal affinity chromatography (IMAC) and titanium oxide (TiO2), combined with selected reaction monitoring (SRM)-MS, were evaluated. The recovery of phosphopeptides by IMAC and TiO2 enrichment was quantified to be 38 ± 5% and 58 ± 20%, respectively, based on internal standards. Moreover, both enrichment methods provided comparable sensitivity from 1-100 g starting peptides. Robust quantification was consistently achieved for most targeted phosphopeptides when starting with 25-100 g peptides. However, the numbers of quantified targets significantly dropped when peptide samples were in the 1-25g range. Finally, IMAC-SRM was applied to quantify signaling dynamics of EGFR-MAPK pathway in Hs578T cells following 3 ng/mL EGF treatment. The kinetics of phosphorylation clearly revealed early and late phases of phosphorylation, even for very low abundance proteins. These results demonstrate the feasibility of robust targeted quantification of phosphorylation dynamics for specific pathways, even starting with relatively small amounts of protein.« less
Federal Register 2010, 2011, 2012, 2013, 2014
2011-02-09
... Interior's (DOI) ``Smart from the Start'' wind energy initiative, to identify areas for wind energy leasing... November 23, 2010, Secretary of the Interior Ken Salazar announced the ``Smart from the Start'' renewable... the ``Smart from the Start'' initiative can be found at http://www.boemre.gov/offshore/RenewableEnergy...
Centaur propellant acquisition system study
NASA Technical Reports Server (NTRS)
Blatt, M. H.; Walter, M. D.
1975-01-01
A study was performed to determine the desirability of replacing the hydrogen peroxide settling system on the Centaur D-1S with a capillary acquisition system. A comprehensive screening was performed to select the most promising capillary device fluid acquisition, thermal conditioning, and fabrication techniques. Refillable start baskets and bypass feed start tanks were selected for detailed design. Critical analysis areas were settling and refilling, start sequence development with an initially dry boost pump, and cooling the fluid delivered to the boost pump in order to provide necessary net position suction head (NPSH). Design drawings were prepared for the start basket and start tank concepts for both LO2 and LH2 tanks. System comparisons indicated that the start baskets using wicking for thermal conditioning, and thermal subcooling for boost pump NPSH, are the most desirable systems for future development.
Centaur propellant acquisition system
NASA Technical Reports Server (NTRS)
Blatt, M. H.; Aydelott, J. C.
1975-01-01
The desirability of replacing the hydrogen peroxide settling system of the Centaur D-1S with a capillary acquisition system was evaluated. A comprehensive screening was performed to select the most promising capillary device fluid acquisition, thermal conditioning, and fabrication techniques. Refillable start baskets and bypass feed start tanks were selected for detailed design. Critical analysis areas were settling and refilling, start sequence development with an initially dry boost pump, and cooling the fluid delivered to the boost pump to provide the necessary net positive suction head (NPSH). Design drawings were prepared for start basket and start tank concepts for both the liquid oxygen and liquid hydrogen tanks. System comparisons indicated that the start baskets using wicking flow for thermal conditioning, and thermal subcooling for providing boost pump NPSH, are the most desirable systems for future Centaur acquisition system development.
A parametric study of motor starting for a 2- to 10-kilowatt Brayton power system
NASA Technical Reports Server (NTRS)
Cantoni, D. A.
1971-01-01
A study of the motor starting of a Brayton cycle power system was conducted to provide estimates of system sensitivity to several controllable parameters. These sensitivity estimates were used as a basis for selection of an optimum motor-start scheme to be implemented on the 2- to 10-kilowatt Brayton power system designed and presently under test. The studies were conducted with an analog simulation of the Brayton power system and covered a range of frequencies from 400 Hz (33 percent design) to 1200 Hz (design), voltage-to-frequency ratios of 0.050 (50 percent design) to 0.100 (design), turbine-inlet temperatures of 800 K (1440 R, 70 percent design) to 1140 K (2060 deg R, design), and prestart pressure levels of 14.5 psia to 29.0 psia. These studies have shown the effect of selected system variables on motor starting. The final selection of motor-start variables can therefore be made on the basis of motor-start inverter complexity, battery size and weight, desired steady-state pressure level after startup, and other operational limitations. In general, the study showed the time required for motor starting to be inversely proportional to motor frequency, voltage, turbine-inlet temperature, and pressure level. An increase in any of these parameters decreases startup time.
Measuring Physical Activity Intensity
MedlinePlus Videos and Cool Tools
... Skip directly to site content Start of Search Controls Search Form Controls Cancel Submit Search the CDC CDC A-Z ... V W X Y Z # Start of Search Controls Search Form Controls Search The CDC Cancel Submit ...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boudreaux, David A.; Maiti, Tushar K.; Davies, Christopher W.
Ubiquitin carboxy-terminal hydrolase L1 (UCHL1) is a Parkinson disease-associated, putative cysteine protease found abundantly and selectively expressed in neurons. The crystal structure of apo UCHL1 showed that the active-site residues are not aligned in a canonical form, with the nucleophilic cysteine being 7.7 {angstrom} from the general base histidine, an arrangement consistent with an inactive form of the enzyme. Here we report the crystal structures of the wild type and two Parkinson disease-associated variants of the enzyme, S18Y and I93M, bound to a ubiquitin-based suicide substrate, ubiquitin vinyl methyl ester. These structures reveal that ubiquitin vinyl methyl ester binds primarilymore » at two sites on the enzyme, with its carboxy terminus at the active site and with its amino-terminal {beta}-hairpin at the distal site - a surface-exposed hydrophobic crevice 17 {angstrom} away from the active site. Binding at the distal site initiates a cascade of side-chain movements in the enzyme that starts at a highly conserved, surface-exposed phenylalanine and is relayed to the active site resulting in the reorientation and proximal placement of the general base within 4 {angstrom} of the catalytic cysteine, an arrangement found in productive cysteine proteases. Mutation of the distal-site, surface-exposed phenylalanine to alanine reduces ubiquitin binding and severely impairs the catalytic activity of the enzyme. These results suggest that the activity of UCHL1 may be regulated by its own substrate.« less
Identification of high-efficiency 3'GG gRNA motifs in indexed FASTA files with ngg2.
Roberson, Elisha D O
CRISPR/Cas9 is emerging as one of the most-used methods of genome modification in organisms ranging from bacteria to human cells. However, the efficiency of editing varies tremendously site-to-site. A recent report identified a novel motif, called the 3'GG motif, which substantially increases the efficiency of editing at all sites tested in C. elegans . Furthermore, they highlighted that previously published gRNAs with high editing efficiency also had this motif. I designed a python command-line tool, ngg2, to identify 3'GG gRNA sites from indexed FASTA files. As a proof-of-concept, I screened for these motifs in six model genomes: Saccharomyces cerevisiae , Caenorhabditis elegans , Drosophila melanogaster , Danio rerio , Mus musculus , and Homo sapiens. I also scanned the genomes of pig ( Sus scrofa ) and African elephant ( Loxodonta africana ) to demonstrate the utility in non-model organisms. I identified more than 60 million single match 3'GG motifs in these genomes. Greater than 61% of all protein coding genes in the reference genomes had at least one unique 3'GG gRNA site overlapping an exon. In particular, more than 96% of mouse and 93% of human protein coding genes have at least one unique, overlapping 3'GG gRNA. These identified sites can be used as a starting point in gRNA selection, and the ngg2 tool provides an important ability to identify 3'GG editing sites in any species with an available genome sequence.
Internet resources for the anaesthesiologist.
Johnson, Edward
2012-05-01
There is considerable useful information about anaesthesia available on the World Wide Web. However, at present, it is very incomplete and scattered around many sites. Many anaesthetists find it difficult to get the right information they need because of the sheer volume of information available on the internet. This article starts with the basics of the Internet, how to utilize the search engine at the maximum and presents a comprehensive list of important websites. These important websites, which are felt to offer high educational value for the anaesthesiologists, have been selected from an extensive search on the Internet. Top-rated anaesthesia websites, web blogs, forums, societies, e-books, e-journals and educational resources are elaborately discussed with relevant URLs.
Internet resources for the anaesthesiologist
Johnson, Edward
2012-01-01
There is considerable useful information about anaesthesia available on the World Wide Web. However, at present, it is very incomplete and scattered around many sites. Many anaesthetists find it difficult to get the right information they need because of the sheer volume of information available on the internet. This article starts with the basics of the Internet, how to utilize the search engine at the maximum and presents a comprehensive list of important websites. These important websites, which are felt to offer high educational value for the anaesthesiologists, have been selected from an extensive search on the Internet. Top-rated anaesthesia websites, web blogs, forums, societies, e-books, e-journals and educational resources are elaborately discussed with relevant URLs. PMID:22923818
Schmidt, Bernd; Kunz, Oliver
2013-01-01
Starting from the conveniently available ex-chiral pool building block (R,R)-hexa-1,5-diene-3,4-diol, the ten-membered ring lactones stagonolide E and curvulide A were synthesized using a bidirectional olefin-metathesis functionalization of the terminal double bonds. Key steps are (i) a site-selective cross metathesis, (ii) a highly diastereoselective extended tethered RCM to furnish a (Z,E)-configured dienyl carboxylic acid and (iii) a Ru-lipase-catalyzed dynamic kinetic resolution to establish the desired configuration at C9. Ring closure was accomplished by macrolactonization. Curvulide A was synthesized from stagonolide E through Sharpless epoxidation.
Gegenbauer-solvable quantum chain model
NASA Astrophysics Data System (ADS)
Znojil, Miloslav
2010-11-01
An N-level quantum model is proposed in which the energies are represented by an N-plet of zeros of a suitable classical orthogonal polynomial. The family of Gegenbauer polynomials G(n,a,x) is selected for illustrative purposes. The main obstacle lies in the non-Hermiticity (aka crypto-Hermiticity) of Hamiltonians H≠H†. We managed to (i) start from elementary secular equation G(N,a,En)=0, (ii) keep our H, in the nearest-neighbor-interaction spirit, tridiagonal, (iii) render it Hermitian in an ad hoc, nonunique Hilbert space endowed with metric Θ≠I, (iv) construct eligible metrics in closed forms ordered by increasing nondiagonality, and (v) interpret the model as a smeared N-site lattice.
Asquith, Christopher R M; Godoi, Paulo H; Couñago, Rafael M; Laitinen, Tuomo; Scott, John W; Langendorf, Christopher G; Oakhill, Jonathan S; Drewry, David H; Zuercher, William J; Koutentis, Panayiotis A; Willson, Timothy M; Kalogirou, Andreas S
2018-05-19
We demonstrate for the first time that 4 H -1,2,6-thiadiazin-4-one (TDZ) can function as a chemotype for the design of ATP-competitive kinase inhibitors. Using insights from a co-crystal structure of a 3,5-bis(arylamino)-4 H -1,2,6-thiadiazin-4-one bound to calcium/calmodulin-dependent protein kinase kinase 2 (CaMKK2), several analogues were identified with micromolar activity through targeted displacement of bound water molecules in the active site. Since the TDZ analogues showed reduced promiscuity compared to their 2,4-dianilinopyrimidine counter parts, they represent starting points for development of highly selective kinase inhibitors.
Grarup, J; Rappoport, C; Engen, N W; Carey, C; Hudson, F; Denning, E; Sharma, S; Florence, E; Vjecha, M J
2015-04-01
The aim of this report is to describe the challenges, successes and patterns of enrolment in the Strategic Timing of AntiRetroviral Treatment (START) study. START is a collaboration of many partners with central coordination provided by the protocol team, the statistical and data management centre (SDMC), the International Network for Strategic Initiatives in Global HIV Trials (INSIGHT) network leadership, international coordinating centres and site coordinating centres. The SDMC prepared reports on study accrual, baseline characteristics and site performance that allowed monitoring of enrolment and data quality and helped to ensure the successful enrolment of this large international trial. We describe the pattern of enrolment and challenges faced during the enrolment period of the trial. An initial pilot phase began in April 2009 and established feasibility of accrual at 101 sites. In August 2010, funding approval for an expanded definitive phase led to the successful accrual of 4688 participants from 215 sites in 35 countries by December 2013. Challenges to accrual included regulatory delays (e.g. national/local ethics approval and drug importation approval) and logistical obstacles (e.g. execution of contracts with pharmaceutical companies, setting up of a central drug repository and translation of participant materials). The personal engagement of investigators, strong central study coordination, and frequent and transparent communication with site investigators, community members and participants were key contributing factors to this success. Accrual into START was completed in a timely fashion despite multiple challenges. This success was attributable to the efforts of site investigators committed to maintaining study equipoise, transparent and responsive study coordination, and community involvement in problem-solving. © 2015 British HIV Association.
Rappoport, C; Engen, NW; Carey, C; Hudson, F; Denning, E; Sharma, S; Florence, E; Vjecha, MJ
2015-01-01
Objectives The aim of this report is to describe the challenges, successes and patterns of enrolment in the Strategic Timing of AntiRetroviral Treatment (START) study. Methods START is a collaboration of many partners with central coordination provided by the protocol team, the statistical and data management centre (SDMC), the International Network for Strategic Initiatives in Global HIV Trials (INSIGHT) network leadership, international coordinating centres and site coordinating centres. The SDMC prepared reports on study accrual, baseline characteristics and site performance that allowed monitoring of enrolment and data quality and helped to ensure the successful enrolment of this large international trial. We describe the pattern of enrolment and challenges faced during the enrolment period of the trial. Results An initial pilot phase began in April 2009 and established feasibility of accrual at 101 sites. In August 2010, funding approval for an expanded definitive phase led to the successful accrual of 4688 participants from 215 sites in 35 countries by December 2013. Challenges to accrual included regulatory delays (e.g. national/local ethics approval and drug importation approval) and logistical obstacles (e.g. execution of contracts with pharmaceutical companies, setting up of a central drug repository and translation of participant materials). The personal engagement of investigators, strong central study coordination, and frequent and transparent communication with site investigators, community members and participants were key contributing factors to this success. Conclusions Accrual into START was completed in a timely fashion despite multiple challenges. This success was attributable to the efforts of site investigators committed to maintaining study equipoise, transparent and responsive study coordination, and community involvement in problem‐solving. PMID:25711319
A Survey of Factors Influencing High School Start Times
ERIC Educational Resources Information Center
Wolfson, Amy R.; Carskadon, Mary A.
2005-01-01
The present study surveyed high school personnel regarding high school start times, factors influencing school start times, and decision making around school schedules. Surveys were analyzed from 345 secondary schools selected at random from the National Center for Educational Statistics database. Factors affecting reported start times included…
Identification of a starting point of breast skin tears during chicken plucking.
Pitcovski, J; Ohana, N; Amzaleg, L; Krispel, S; Bercovich, D; Pinchasov, Y
1997-02-01
A site (STP) was identified on the skin of the chicken, during defeathering in the slaughter house, at which about 90% of breast skin tears started. This site is on the ventral side of the pectoral tract area. There was no difference in location of this site with respect to different commercial lines, sexes, flocks, or time of the day. In order to demonstrate the importance of a small skin tear to ultimate damage, defeathered chickens with a minor tear at a particular site and undamaged defeathered chickens were passed through the defeathering machine a second time. Thirty-six percent of the STP chickens were torn further, but only a small percentage (about 4%) of the undamaged chickens were harmed.
Renovell, Agueda; Gago, Selma; Ruiz-Ruiz, Susana; Velázquez, Karelia; Navarro, Luis; Moreno, Pedro; Vives, Mari Carmen; Guerri, José
2010-10-25
Citrus leaf blotch virus has a single-stranded positive-sense genomic RNA (gRNA) of 8747 nt organized in three open reading frames (ORFs). The ORF1, encoding a polyprotein involved in replication, is translated directly from the gRNA, whereas ORFs encoding the movement (MP) and coat (CP) proteins are expressed via 3' coterminal subgenomic RNAs (sgRNAs). We characterized the minimal promoter region critical for the CP-sgRNA expression in infected cells by deletion analyses using Agrobacterium-mediated infection of Nicotiana benthamiana plants. The minimal CP-sgRNA promoter was mapped between nucleotides -67 and +50 nt around the transcription start site. Surprisingly, larger deletions in the region between the CP-sgRNA transcription start site and the CP translation initiation codon resulted in increased CP-sgRNA accumulation, suggesting that this sequence could modulate the CP-sgRNA transcription. Site-specific mutational analysis of the transcription start site revealed that the +1 guanylate and the +2 adenylate are important for CP-sgRNA synthesis. Copyright © 2010 Elsevier Inc. All rights reserved.
Muyoyeta, Monde; Moyo, Maureen; Kasese, Nkatya; Ndhlovu, Mapopa; Milimo, Deborah; Mwanza, Winfridah; Kapata, Nathan; Schaap, Albertus; Godfrey Faussett, Peter; Ayles, Helen
2015-01-01
The current cost of Xpert MTB RIF (Xpert) consumables is such that algorithms are needed to select which patients to prioritise for testing with Xpert. To evaluate two algorithms for prioritisation of Xpert in primary health care settings in a high TB and HIV burden setting. Consecutive, presumptive TB patients with a cough of any duration were offered either Xpert or Fluorescence microscopy (FM) test depending on their CXR score or HIV status. In one facility, sputa from patients with an abnormal CXR were tested with Xpert and those with a normal CXR were tested with FM ("CXR algorithm"). CXR was scored automatically using a Computer Aided Diagnosis (CAD) program. In the other facility, patients who were HIV positive were tested using Xpert and those who were HIV negative were tested with FM ("HIV algorithm"). Of 9482 individuals pre-screened with CXR, Xpert detected TB in 2090/6568 (31.8%) with an abnormal CXR, and FM was AFB positive in 8/2455 (0.3%) with a normal CXR. Of 4444 pre-screened with HIV, Xpert detected TB in 508/2265 (22.4%) HIV positive and FM was AFB positive in 212/1920 (11.0%) in HIV negative individuals. The notification rate of new bacteriologically confirmed TB increased; from 366 to 620/ 100,000/yr and from 145 to 261/100,000/yr at the CXR and HIV algorithm sites respectively. The median time to starting TB treatment at the CXR site compared to the HIV algorithm site was; 1(IQR 1-3 days) and 3 (2-5 days) (p<0.0001) respectively. Use of Xpert in a resource-limited setting at primary care level in conjunction with pre-screening tests reduced the number of Xpert tests performed. The routine use of Xpert resulted in additional cases of confirmed TB patients starting treatment. However, there was no increase in absolute numbers of patients starting TB treatment. Same day diagnosis and treatment commencement was achieved for both bacteriologically confirmed and empirically diagnosed patients where Xpert was used in conjunction with CXR.
Muyoyeta, Monde; Moyo, Maureen; Kasese, Nkatya; Ndhlovu, Mapopa; Milimo, Deborah; Mwanza, Winfridah; Kapata, Nathan; Schaap, Albertus; Godfrey Faussett, Peter; Ayles, Helen
2015-01-01
Background The current cost of Xpert MTB RIF (Xpert) consumables is such that algorithms are needed to select which patients to prioritise for testing with Xpert. Objective To evaluate two algorithms for prioritisation of Xpert in primary health care settings in a high TB and HIV burden setting. Method Consecutive, presumptive TB patients with a cough of any duration were offered either Xpert or Fluorescence microscopy (FM) test depending on their CXR score or HIV status. In one facility, sputa from patients with an abnormal CXR were tested with Xpert and those with a normal CXR were tested with FM (“CXR algorithm”). CXR was scored automatically using a Computer Aided Diagnosis (CAD) program. In the other facility, patients who were HIV positive were tested using Xpert and those who were HIV negative were tested with FM (“HIV algorithm”). Results Of 9482 individuals pre-screened with CXR, Xpert detected TB in 2090/6568 (31.8%) with an abnormal CXR, and FM was AFB positive in 8/2455 (0.3%) with a normal CXR. Of 4444 pre-screened with HIV, Xpert detected TB in 508/2265 (22.4%) HIV positive and FM was AFB positive in 212/1920 (11.0%) in HIV negative individuals. The notification rate of new bacteriologically confirmed TB increased; from 366 to 620/ 100,000/yr and from 145 to 261/100,000/yr at the CXR and HIV algorithm sites respectively. The median time to starting TB treatment at the CXR site compared to the HIV algorithm site was; 1(IQR 1-3 days) and 3 (2-5 days) (p<0.0001) respectively. Conclusion Use of Xpert in a resource-limited setting at primary care level in conjunction with pre-screening tests reduced the number of Xpert tests performed. The routine use of Xpert resulted in additional cases of confirmed TB patients starting treatment. However, there was no increase in absolute numbers of patients starting TB treatment. Same day diagnosis and treatment commencement was achieved for both bacteriologically confirmed and empirically diagnosed patients where Xpert was used in conjunction with CXR. PMID:26030301
Arias, Karen S; Climent, Maria J; Corma, Avelino; Iborra, Sara
2014-01-01
A new class of biodegradable anionic surfactants with structures based on 5-alkoxymethylfuroate was prepared starting from 5-hydroxymethylfurfural (HMF), through a one-pot-two-steps process which involves the selective etherification of HMF with fatty alcohols using heterogeneous solid acid, followed by a highly selective oxidation of the formyl group with a gold catalyst. The etherification step was optimized using aluminosilicates as acid catalysts with different pore topologies (H-Beta, HY, Mordenite, ZSM-5, ITQ-2, and MCM-41), different active sites (Bronsted or Lewis) and different adsorption properties. It was shown that highly hydrophobic defect-free H-Beta zeolites with Si/Al ratios higher than 25 are excellent acid catalysts to perform the selective etherification of HMF with fatty alcohols, avoiding the competitive self-etherification of HMF. Moreover, the 5-alkoxymethylfurfural derivatives obtained can be selectively oxidized to the corresponding furoic salts in excellent yield using Au/CeO2 as catalyst and air as oxidant, at moderated temperatures. Both H-Beta zeolite and Au/CeO2 could be reused several times without loss of activity. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Artificial selection for a secondary sexual character in males of Drosophila silvestris from Hawaii
Carson, Hampton L.; Teramoto, Linden T.
1984-01-01
Drosophila silvestris is endemic to the rain forests of Hawaii Island. In populations from the northeast side, the male foreleg tibia bears about 100 long cilia; these are used as a brush to stimulate the female during courtship. Cyclical family selection for high and low cilia number was carried out on progeny of lines started from single wild isofemales collected at a single site. Significant response in both directions was obtained; in the third generation the lines differed by a mean of 25 cilia. Despite much effort to save them, both lines died out without further advance; the low cilia number line died after five and the high cilia number line died after nine generations. The data are compatible with the view that the cilia character is polygenic and is maintained in nature by a stabilizing sexual selection that also favors a polygenic heterozygous state. Although selection in these experiments resulted in dysgenesis, such a result is not inevitable. Disorganization and reorganization of such a genetic system following a population bottleneck might be important as a predisposing condition for the emergence of a specifically novel and possibly isolating mode of courtship. PMID:16593479
Home Start Evaluation Study. Interim Report II: Program Analysis. Revised Draft.
ERIC Educational Resources Information Center
Deloria, Dennis; And Others
This document is the second in a series of evaluative reports directed to evaluation needs of Home Start planners and administrators. It focuses on implementation data about programs gathered during local site visits conducted in the spring and fall of 1972. The two basic evaluative questions asked are: (1) What was Home Start intended by its…
Mapping Cancer Cells’ Starting Lines | Center for Cancer Research
Many of the defective regulatory pathways that lead to aberrant proliferation in cancer converge on DNA replication. So replication regulatory pathways could be targeted to more specifically kill cancer cells. Unfortunately such targeting would require knowing where and when DNA replication starts in the cancer genome. In yeast, the locations of replication initiation sites on chromatin have been extensively mapped, but in human cancer cells only a handful of these sites have been identified.
Thomason, Maureen K.; Bischler, Thorsten; Eisenbart, Sara K.; Förstner, Konrad U.; Zhang, Aixia; Herbig, Alexander; Nieselt, Kay
2014-01-01
While the model organism Escherichia coli has been the subject of intense study for decades, the full complement of its RNAs is only now being examined. Here we describe a survey of the E. coli transcriptome carried out using a differential RNA sequencing (dRNA-seq) approach, which can distinguish between primary and processed transcripts, and an automated prediction algorithm for transcriptional start sites (TSS). With the criterion of expression under at least one of three growth conditions examined, we predicted 14,868 TSS candidates, including 5,574 internal to annotated genes (iTSS) and 5,495 TSS corresponding to potential antisense RNAs (asRNAs). We examined expression of 14 candidate asRNAs by Northern analysis using RNA from wild-type E. coli and from strains defective for RNases III and E, two RNases reported to be involved in asRNA processing. Interestingly, nine asRNAs detected as distinct bands by Northern analysis were differentially affected by the rnc and rne mutations. We also compared our asRNA candidates with previously published asRNA annotations from RNA-seq data and discuss the challenges associated with these cross-comparisons. Our global transcriptional start site map represents a valuable resource for identification of transcription start sites, promoters, and novel transcripts in E. coli and is easily accessible, together with the cDNA coverage plots, in an online genome browser. PMID:25266388
Origins of De Novo Genes in Human and Chimpanzee.
Ruiz-Orera, Jorge; Hernandez-Rodriguez, Jessica; Chiva, Cristina; Sabidó, Eduard; Kondova, Ivanela; Bontrop, Ronald; Marqués-Bonet, Tomàs; Albà, M Mar
2015-12-01
The birth of new genes is an important motor of evolutionary innovation. Whereas many new genes arise by gene duplication, others originate at genomic regions that did not contain any genes or gene copies. Some of these newly expressed genes may acquire coding or non-coding functions and be preserved by natural selection. However, it is yet unclear which is the prevalence and underlying mechanisms of de novo gene emergence. In order to obtain a comprehensive view of this process, we have performed in-depth sequencing of the transcriptomes of four mammalian species--human, chimpanzee, macaque, and mouse--and subsequently compared the assembled transcripts and the corresponding syntenic genomic regions. This has resulted in the identification of over five thousand new multiexonic transcriptional events in human and/or chimpanzee that are not observed in the rest of species. Using comparative genomics, we show that the expression of these transcripts is associated with the gain of regulatory motifs upstream of the transcription start site (TSS) and of U1 snRNP sites downstream of the TSS. In general, these transcripts show little evidence of purifying selection, suggesting that many of them are not functional. However, we find signatures of selection in a subset of de novo genes which have evidence of protein translation. Taken together, the data support a model in which frequently-occurring new transcriptional events in the genome provide the raw material for the evolution of new proteins.
Origins of De Novo Genes in Human and Chimpanzee
Ruiz-Orera, Jorge; Hernandez-Rodriguez, Jessica; Chiva, Cristina; Sabidó, Eduard; Kondova, Ivanela; Bontrop, Ronald; Marqués-Bonet, Tomàs; Albà, M.Mar
2015-01-01
The birth of new genes is an important motor of evolutionary innovation. Whereas many new genes arise by gene duplication, others originate at genomic regions that did not contain any genes or gene copies. Some of these newly expressed genes may acquire coding or non-coding functions and be preserved by natural selection. However, it is yet unclear which is the prevalence and underlying mechanisms of de novo gene emergence. In order to obtain a comprehensive view of this process, we have performed in-depth sequencing of the transcriptomes of four mammalian species—human, chimpanzee, macaque, and mouse—and subsequently compared the assembled transcripts and the corresponding syntenic genomic regions. This has resulted in the identification of over five thousand new multiexonic transcriptional events in human and/or chimpanzee that are not observed in the rest of species. Using comparative genomics, we show that the expression of these transcripts is associated with the gain of regulatory motifs upstream of the transcription start site (TSS) and of U1 snRNP sites downstream of the TSS. In general, these transcripts show little evidence of purifying selection, suggesting that many of them are not functional. However, we find signatures of selection in a subset of de novo genes which have evidence of protein translation. Taken together, the data support a model in which frequently-occurring new transcriptional events in the genome provide the raw material for the evolution of new proteins. PMID:26720152
van Lettow, Monique; Tweya, Hannock; Rosenberg, Nora E; Trapence, Clement; Kayoyo, Virginia; Kasende, Florence; Kaunda, Blessings; Hosseinipour, Mina C; Eliya, Michael; Cataldo, Fabian; Gugsa, Salem; Phiri, Sam
2017-07-11
Malawi introduced an ambitious public health program known as "Option B+" which provides all HIV-infected pregnant and breastfeeding women with lifelong combination antiretroviral therapy, regardless of WHO clinical stage or CD4 cell count. The PMTCT Uptake and REtention (PURE) study aimed at evaluating the effect of peer-support on care-seeking and retention in care. PURE Malawi was a three-arm cluster randomized controlled trial that compared facility-based and community-based models of peer support to standard of care under Option B+ strategy. Each arm was expected to enroll a minimum of 360 women with a total minimum sample size of 1080 participants. 21 sites (clusters) were selected for inclusion in the study. This paper describes the site selection, recruitment, enrollment process and baseline characteristics of study sites and women enrolled in the trial. Study implementation was managed by 3 partner organizations; each responsible for 7 study sites. The trial was conducted in the South East, South West, and Central West zones of Malawi, the zones where the implementing partners operate. Study sites included 2 district hospitals, 2 mission hospitals, 2 rural hospitals, 13 health centers and 1 private clinic. Enrollment occurred from November 2013 to November 2014, over a median period of 31 weeks (range 17-51) by site. A total of 1269 HIV-infected pregnant (1094) and breastfeeding (175) women, who were eligible to initiate ART under Option B+, were enrolled. Each site reached or surpassed the minimum sample size. Comparing the number of women enrolled versus antenatal cohort reports, sites recruited a median of 90% (IQR 75-100) of eligible reported women. In the majority of sites the ratio of pregnant and lactating women enrolled in the study was similar to the ratio of reported pregnant and lactating women starting ART in the same sites. The median age of all women was 27 (IQR 22-31) years. All women have ≥20 months of possible follow-up time; 96% ≥ 2 years (24-32 months). The PURE Malawi study showed that 3 implementing partner organizations could successfully recruit a complex cohort of pregnant and lactating women across 3 geographical zones in Malawi within a reasonable timeline. This study is registered at clinicaltrials.gov - ID Number NCT02005835 . Registered 4 December, 2013.
Rodent Control: Seal Up! Trap Up! Clean Up!
... Skip directly to site content Start of Search Controls Search Form Controls Cancel Submit Search The CDC CDC A-Z ... V W X Y Z # Start of Search Controls Search Form Controls Cancel Submit Search The CDC ...
Infection Control: The Use and Handling of Toothbrushes
... Skip directly to site content Start of Search Controls Search Form Controls Cancel Submit Search the CDC CDC A-Z ... V W X Y Z # Start of Search Controls Search Form Controls Search The CDC Cancel Submit ...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Inam, A., E-mail: aqil.ceet@pu.edu.pk; Brydson, R., E-mail: mtlrmdb@leeds.ac.uk; Edmonds, D.V., E-mail: d.v.edmonds@leeds.ac.uk
The potential for using graphite particles as an internal lubricant during machining is considered. Graphite particles were found to form during graphitisation of experimental medium-carbon steel alloyed with Si and Al. The graphite nucleation sites were strongly influenced by the starting microstructure, whether ferrite–pearlite, bainite or martensite, as revealed by light and electron microscopy. Favourable nucleation sites in the ferrite–pearlite starting microstructure were, not unexpectedly, found to be located within pearlite colonies, no doubt due to the presence of abundant cementite as a source of carbon. In consequence, the final distribution of graphite nodules in ferrite–pearlite microstructures was less uniformmore » than for the bainite microstructure studied. In the case of martensite, this study found a predominance of nucleation at grain boundaries, again leading to less uniform graphite dispersions. - Highlights: • Metallography of formation of graphite particles in experimental carbon steel. • Potential for using graphite in steel as an internal lubricant during machining. • Microstructure features expected to influence improved machinability studied. • Influence of pre-anneal starting microstructure on graphite nucleation sites. • Influence of pre-anneal starting microstructure on graphite distribution. • Potential benefit is new free-cutting steel compositions without e.g. Pb alloying.« less
Genomic structure and chromosomal mapping of the human CD22 gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wilson, G.L.; Kozlow, E.; Kehrl, J.H.
1993-06-01
The human CD22 gene is expressed specifically in B lymphocytes and likely has an important function in cell-cell interactions. A nearly full length human CD22 cDNA clone was used to isolate genomic clones that span the CD22 gene. The CD22 gene is spread over 22 kb of DNA and is composed of 15 exons. The first exon contains the major transcriptional start sites. The translation initiation codon is located in exon 3, which also encodes a portion of the signal peptide. Exons 4 to 10 encode the seven Ig domains of CD22, exon 11 encodes the transmembrane domain, exons 12more » to 15 encode the intracytoplasmic domain of CD22, and exon 15 also contains the 3' untranslated region. A minor form of CD22 mRNA likely results from splicing of exon 5 to exon 8, skipping exons 6 and 7. A 4.6-kb Xbal fragment of the CD22 gene was used to map the chromosomal location of CD22 by fluorescence in situ hybridization. The hybridization locus was identified by combining fluorescent images of the probe with the chromosomal banding pattern generated by an Alu probe. The results demonstrate the CD22 is located within the band region q13.1 of chromosome 19. Two closely clustered major transcription start sites and several minor start sites were mapped by primer extension. Similarly to many other lymphoid-specific genes, the CD22 promoter lacks an obvious TATA box. Approximately 4 kb of DNA 5' of the transcription start sites were sequenced and found to contain multiple Alu elements. Potential binding sites for the transcriptional factors NF-kB, AP-1, and Oct-2 are located within 300 bp 5' of the major transcription start sites. A 400-bp fragment (bp -339 through +71) of the CD22 promoter region was subcloned into a pGEM-chloramphenicol acetyltransferase vector and after transfection into B and T cells was found to be active in both B and T cells. 45 refs., 7 figs., 2 tabs.« less
Dayan, Gustavo; Arredondo, Jose L; Carrasquilla, Gabriel; Deseda, Carmen C; Dietze, Reynaldo; Luz, Kleber; Costa, Maria Selma N; Cunha, Rivaldo V; Rey, Luis C; Morales, Javier; Reynales, Humberto; Miranda, Maria; Zambrano, Betzana; Rivas, Enrique; Garbes, Pedro; Noriega, Fernando
2015-07-01
To prepare for a Phase III dengue vaccine efficacy trial, 20 investigational sites were selected for this observational study to identify dengue infections in a closed cohort (N = 3,000 children 9-16 years of age). Of 255 acute febrile episodes experienced by 235 children, 50 (21.3%) were considered serologically probable dengue, and 18 (7.7%) were considered virologically confirmed (i.e., dengue NS1 antigen positive) dengue cases. Considering the disease-free and at-risk period from study start to onset of symptoms, the overall incidence density of acute febrile episodes was 17.7 per 100 person-years of follow-up, ranging from 15.3 in Colombia to 22.0 in Puerto Rico. This study showed that all sites were capable of capturing and following up acute febrile episodes within a specific timeframe among the established cohort and to detect dengue cases. © The American Society of Tropical Medicine and Hygiene.
NASA Astrophysics Data System (ADS)
Bonacorsi, D.; Gutsche, O.
The Worldwide LHC Computing Grid (WLCG) project decided in March 2009 to perform scale tests of parts of its overall Grid infrastructure before the start of the LHC data taking. The "Scale Test for the Experiment Program" (STEP'09) was performed mainly in June 2009 -with more selected tests in September- October 2009 -and emphasized the simultaneous test of the computing systems of all 4 LHC experiments. CMS tested its Tier-0 tape writing and processing capabilities. The Tier-1 tape systems were stress tested using the complete range of Tier-1 work-flows: transfer from Tier-0 and custody of data on tape, processing and subsequent archival, redistribution of datasets amongst all Tier-1 sites as well as burst transfers of datasets to Tier-2 sites. The Tier-2 analysis capacity was tested using bulk analysis job submissions to backfill normal user activity. In this talk, we will report on the different performed tests and present their post-mortem analysis.
Ghorab, Mostafa M; Alsaid, Mansour S; El-Gaby, Mohamed S A; Elaasser, Mahmoud M; Nissan, Yassin M
2017-04-07
Various thiourea derivatives have been used as starting materials for compounds with better biological activities. Molecular modeling tools are used to explore their mechanism of action. A new series of thioureas were synthesized. Fluorinated pyridine derivative 4a showed the highest antimicrobial activity (with MIC values ranged from 1.95 to 15.63 µg/mL). Interestingly, thiadiazole derivative 4c and coumarin derivative 4d exhibited selective antibacterial activities against Gram positive bacteria. Fluorinated pyridine derivative 4a was the most active against HepG2 with IC50 value of 4.8 μg/mL. Molecular docking was performed on the active site of MK-2 with good results. Novel compounds were obtained with good anticancer and antibacterial activity especially fluorinated pyridine derivative 4a and molecular docking study suggest good activity as mitogen activated protein kinase-2 inhibitor. Graphical abstract Compound 4a in the active site of MK-2.
Xiong, Jie; Gao, Shan; Dui, Wen; Yang, Wentao; Chen, Xiao; Taverna, Sean D; Pearlman, Ronald E; Ashlock, Wendy; Miao, Wei; Liu, Yifan
2016-12-01
The ciliate protozoan Tetrahymena thermophila contains two types of structurally and functionally differentiated nuclei: the transcriptionally active somatic macronucleus (MAC) and the transcriptionally silent germ-line micronucleus (MIC). Here, we demonstrate that MAC features well-positioned nucleosomes downstream of transcription start sites and flanking splice sites. Transcription-associated trans-determinants promote nucleosome positioning in MAC. By contrast, nucleosomes in MIC are dramatically delocalized. Nucleosome occupancy in MAC and MIC are nonetheless highly correlated with each other, as well as with in vitro reconstitution and predictions based upon DNA sequence features, revealing unexpectedly strong contributions from cis-determinants. In particular, well-positioned nucleosomes are often matched with GC content oscillations. As many nucleosomes are coordinately accommodated by both cis- and trans-determinants, we propose that their distribution is shaped by the impact of these nucleosomes on the mutational and transcriptional landscape, and driven by evolutionary selection. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Akashi, A; Yoshida, Y; Nakagoshi, H; Kuroki, K; Hashimoto, T; Tagawa, K; Imamoto, F
1988-10-01
Stabilizing factor, a 9 kDa protein, stabilizes and facilitates formation of the complex between mitochondrial ATP synthase and its intrinsic inhibitor protein. A clone containing the gene encoding the 9 kDa protein was selected from a yeast genomic library to determine the structure of its precursor protein. As deduced from the nucleotide sequence, the precursor of the yeast 9 kDa stabilizing factor contains 86 amino acid residues and has a molecular weight of 10,062. From the predicted sequence we infer that the stabilizing factor precursor contains a presequence of 23 amino acid residues at its amino terminus. We also used S1 mapping to determine the initiation site of transcription under glucose-repressed or derepressed conditions. These experiments suggest that transcription of this gene starts at three different sites and that only one of them is not affected by the presence of glucose.
Determine the Impact of Novel BRCA1 Translation Start Sites on Therapy Resistance in Ovarian Cancer
2017-09-01
Award Number: W81XWH-15-1-0197 TITLE: PRINCIPAL INVESTIGATOR: Neil Johnson, Ph.D. CONTRACTING ORGANIZATION: Institute for Cancer Research...Therapy Resistance in Ovarian Cancer The views, opinions and/or findings contained in this report are those of the author(s) and should not be...Start Sites on Therapy 5b. GRANT NUMBER Resistance in Ovarian Cancer W81XWH-15-1-0197 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER Neil
ERIC Educational Resources Information Center
Bryant, Donna; Maxwell, Kelly; Taylor, Karen; Poe, Michele; Peisner-Feinberg, Ellen; Bernier, Kathleen
The primary goal of Smart Start is to ensure that all children enter school healthy and prepared to succeed. Smart Start has funded a variety of technical assistance (TA) activities to improve child care, including on-site technical assistance, quality improvement and facility grant, teacher education scholarships, license upgrades, teacher salary…
ERIC Educational Resources Information Center
Greene, Andrea; And Others
In 1991 the Department of Health and Human Services funded 32 sites throughout the United States to develop and implement Head Start-Public School Early Childhood Transition Demonstration Projects. The purpose of 31 projects, which are in their fourth year of operation, is to stimulate partnerships among Head Start agencies, public schools, and…
Wu, Yun; Li, Qing-Jun
2017-10-01
Floral traits have largely been attributed to phenotypic selection in plant-pollinator interactions. However, the strength of this link has rarely been ascertained with real pollinators. We conducted pollinator observations and estimated selection through female fitness on flowering phenology and floral traits between two Primula secundiflora populations. We quantified pollinator-mediated selection by subtracting estimates of selection gradients of plants receiving supplemental hand pollination from those of plants receiving open pollination. There was net directional selection for an earlier flowering start date at populations where the dominant pollinators were syrphid flies, and flowering phenology was also subjected to stabilized quadratic selection. However, a later flowering start date was significantly selected at populations where the dominant pollinators were legitimate (normal pollination through the corolla tube entrance) and illegitimate bumblebees (abnormal pollination through nectar robbing hole which located at the corolla tube), and flowering phenology was subjected to disruptive quadratic selection. Wider corolla tube entrance diameter was selected at both populations. Furthermore, the strength of net directional selection on flowering start date and corolla tube entrance diameter was stronger at the population where the dominant pollinators were syrphid flies. Pollinator-mediated selection explained most of the between-population variations in the net directional selection on flowering phenology and corolla tube entrance diameter. Our results suggested the important influence of pollinator-mediated selection on floral evolution. Variations in pollinator assemblages not only resulted in variation in the direction of selection but also the strength of selection on floral traits.
Parvinen, Kalle; Brännström, Åke
2016-08-01
Species that compete for access to or use of sites, such as parasitic mites attaching to honey bees or apple maggots laying eggs in fruits, can potentially increase their fitness by carefully selecting sites at which they face little or no competition. Here, we systematically investigate the evolution of site-selection strategies among animals competing for discrete sites. By developing and analyzing a mechanistic and population-dynamical model of site selection in which searching individuals encounter sites sequentially and can choose to accept or continue to search based on how many conspecifics are already there, we give a complete characterization of the different site-selection strategies that can evolve. We find that evolution of site-selection stabilizes population dynamics, promotes even distribution of individuals among sites, and occasionally causes evolutionary suicide. We also discuss the broader implications of our findings and propose how they can be reconciled with an earlier study (Nonaka et al. in J Theor Biol 317:96-104, 2013) that reported selection toward ever higher levels of aggregation among sites as a consequence of site-selection.
A nonparametric significance test for sampled networks.
Elliott, Andrew; Leicht, Elizabeth; Whitmore, Alan; Reinert, Gesine; Reed-Tsochas, Felix
2018-01-01
Our work is motivated by an interest in constructing a protein-protein interaction network that captures key features associated with Parkinson's disease. While there is an abundance of subnetwork construction methods available, it is often far from obvious which subnetwork is the most suitable starting point for further investigation. We provide a method to assess whether a subnetwork constructed from a seed list (a list of nodes known to be important in the area of interest) differs significantly from a randomly generated subnetwork. The proposed method uses a Monte Carlo approach. As different seed lists can give rise to the same subnetwork, we control for redundancy by constructing a minimal seed list as the starting point for the significance test. The null model is based on random seed lists of the same length as a minimum seed list that generates the subnetwork; in this random seed list the nodes have (approximately) the same degree distribution as the nodes in the minimum seed list. We use this null model to select subnetworks which deviate significantly from random on an appropriate set of statistics and might capture useful information for a real world protein-protein interaction network. The software used in this paper are available for download at https://sites.google.com/site/elliottande/. The software is written in Python and uses the NetworkX library. ande.elliott@gmail.com or felix.reed-tsochas@sbs.ox.ac.uk. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.
Transcription Start Site Evolution in Drosophila
Main, Bradley J.; Smith, Andrew D.; Jang, Hyosik; Nuzhdin, Sergey V.
2013-01-01
Transcription start site (TSS) evolution remains largely undescribed in Drosophila, likely due to limited annotations in non-melanogaster species. In this study, we introduce a concise new method that selectively sequences from the 5′-end of mRNA and used it to identify TSS in four Drosophila species, including Drosophila melanogaster, D. simulans, D. sechellia, and D. pseudoobscura. For verification, we compared our results in D. melanogaster with known annotations, published 5′-rapid amplification of cDNA ends data, and with RNAseq from the same mRNA pool. Then, we paired 2,849 D. melanogaster TSS with its closest equivalent TSS in each species (likely to be its true ortholog) using the available multiple sequence alignments. Most of the D. melanogaster TSSs were successfully paired with an ortholog in each species (83%, 86%, and 55% for D. simulans, D. sechellia, and D. pseudoobscura, respectively). On the basis of the number and distribution of reads mapped at each TSS, we also estimated promoter-specific expression (PSE) and TSS peak shape, respectively. Among paired TSS orthologs, the location and promoter activity were largely conserved. TSS location appears important as PSE, and TSS peak shape was more frequently divergent among TSS that had moved. Unpaired TSS were surprisingly common in D. pseudoobscura. An increased mutation rate upstream of TSS might explain this pattern. We found an enrichment of ribosomal protein genes among diverged TSS, suggesting that TSS evolution is not uniform across the genome. PMID:23649539
A nonparametric significance test for sampled networks
Leicht, Elizabeth; Whitmore, Alan; Reinert, Gesine; Reed-Tsochas, Felix
2018-01-01
Abstract Motivation Our work is motivated by an interest in constructing a protein–protein interaction network that captures key features associated with Parkinson’s disease. While there is an abundance of subnetwork construction methods available, it is often far from obvious which subnetwork is the most suitable starting point for further investigation. Results We provide a method to assess whether a subnetwork constructed from a seed list (a list of nodes known to be important in the area of interest) differs significantly from a randomly generated subnetwork. The proposed method uses a Monte Carlo approach. As different seed lists can give rise to the same subnetwork, we control for redundancy by constructing a minimal seed list as the starting point for the significance test. The null model is based on random seed lists of the same length as a minimum seed list that generates the subnetwork; in this random seed list the nodes have (approximately) the same degree distribution as the nodes in the minimum seed list. We use this null model to select subnetworks which deviate significantly from random on an appropriate set of statistics and might capture useful information for a real world protein–protein interaction network. Availability and implementation The software used in this paper are available for download at https://sites.google.com/site/elliottande/. The software is written in Python and uses the NetworkX library. Contact ande.elliott@gmail.com or felix.reed-tsochas@sbs.ox.ac.uk Supplementary information Supplementary data are available at Bioinformatics online. PMID:29036452
ERIC Educational Resources Information Center
Cohen, Arthur M.; Brawer, Florence B.; Kozeracki, Carol A.
This final report for the JumpStart III program presents a summary of the entrepreneurship training programs developed by each of the four JumpStart III partners selected in March 1997. Grants for the colleges totaled $354,546 over 2 years. The Jumpstart funding has been only a starting point for these and the other 12 Jumpstart partners in…
Berlin, Lisa J.; Whiteside-Mansell, Leanne; Roggman, Lori A.; Green, Beth L.; Robinson, JoAnn; Spieker, Susan
2010-01-01
This study examined maternal depression, attachment avoidance, and attachment anxiety as moderators of Early Head Start's effects on four parenting outcomes assessed at age 3. Participants (N = 947) were drawn from six sites of the Early Head Start National Research and Evaluation Project, a multi-site randomized trial. Findings suggest more positive program effects for mothers with less initial attachment avoidance or attachment anxiety. First, baseline attachment avoidance moderated EHS program effects on observed maternal supportiveness, such that program mothers with lower baseline attachment avoidance were rated as more supportive of their 3-year-olds than program mothers with higher baseline attachment avoidance. Second, program effects on spanking varied depending on mothers’ baseline attachment anxiety. PMID:21240694
Concentrating Solar Power Projects - Aalborg CSP-Brønderslev CSP with ORC
trough Turbine Capacity: Gross: 16.6 MW Status: Operational Start Year: 2016 Do you have more information Contact(s): Webmaster Solar Key References: Web site Break Ground: April 2016 Start Production: December
Thomason, Maureen K; Bischler, Thorsten; Eisenbart, Sara K; Förstner, Konrad U; Zhang, Aixia; Herbig, Alexander; Nieselt, Kay; Sharma, Cynthia M; Storz, Gisela
2015-01-01
While the model organism Escherichia coli has been the subject of intense study for decades, the full complement of its RNAs is only now being examined. Here we describe a survey of the E. coli transcriptome carried out using a differential RNA sequencing (dRNA-seq) approach, which can distinguish between primary and processed transcripts, and an automated prediction algorithm for transcriptional start sites (TSS). With the criterion of expression under at least one of three growth conditions examined, we predicted 14,868 TSS candidates, including 5,574 internal to annotated genes (iTSS) and 5,495 TSS corresponding to potential antisense RNAs (asRNAs). We examined expression of 14 candidate asRNAs by Northern analysis using RNA from wild-type E. coli and from strains defective for RNases III and E, two RNases reported to be involved in asRNA processing. Interestingly, nine asRNAs detected as distinct bands by Northern analysis were differentially affected by the rnc and rne mutations. We also compared our asRNA candidates with previously published asRNA annotations from RNA-seq data and discuss the challenges associated with these cross-comparisons. Our global transcriptional start site map represents a valuable resource for identification of transcription start sites, promoters, and novel transcripts in E. coli and is easily accessible, together with the cDNA coverage plots, in an online genome browser. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Marketing E-Commerce by Social media using Product Recommendations and user Embedding
NASA Astrophysics Data System (ADS)
Ramalingam, V. V.; Pandian, A.; Masilamani, Kirthiga
2018-04-01
MarketingE-CommercebySodal media is the best way to improve marketing and business widely.The major issues faced with E-commerce and Social media interfacing is cold- start cross-site problem. The cold-start problem occurs at a situation when user is not having the history of purchase records.For the user who does not have a history of purchase records, we have introduced a method of finding the users’ interested product without knowing any of the demographic information of the user. The product is recommended on basesof visits i.e., the item which is most likely to be visited by the users occur in the hit list. This product is rated at the top position for the users to purchase. The e-commerce with social media sites uses the strategy of user embedding and product recommendations. The product recommendations are achieved by incorporating LatentDirichlet Allocation(LDA), Re Ranking and Collaborative Filtering algorithms. The proposed framework can enhance the recommendation system by embedding products and users. This shows the potential of solving cold-start cross-site problem across the e-commerce and social media sites and enhances the marketing strategy.
40 CFR 63.6645 - What notifications must I submit and when?
Code of Federal Regulations, 2010 CFR
2010-07-01
... standards. (b) As specified in § 63.9(b)(2), if you start up your stationary RICE with a site rating of more..., you must submit an Initial Notification not later than December 13, 2004. (c) If you start up your new... than 120 days after you become subject to this subpart. (d) As specified in § 63.9(b)(2), if you start...
ERIC Educational Resources Information Center
Shriver, Lenka H.; Hildebrand, Deana; Austin, Heidi
2010-01-01
Objective: Determine relationships between self-efficacy, decisional balance, and processes of change and Stages of Change (SOC) related to fruit and vegetable (FV) availability among Hispanic Head Start parents. Design: A 2-phase descriptive study with mixed methodology. Setting: Two Head Start sites in a city in the midwestern United States.…
Home artificial nutrition in advanced cancer patients.
Ruggeri, Enrico; Agostini, Federica; Fettucciari, Luana; Giannantonio, Marilena; Pironi, Loris; Pannuti, Franco
2013-01-01
Malnutrition is over 50% in advanced cancer patients and is related to a decreased survival. Cachexia is the first reason for death in 4-23% of cases. The aim of the study was to estimate the appropriateness of the criteria to select patients for home artificial nutrition and its effectiveness to avoid death from cachexia and to improve quality of life in patients with advanced cancer assisted at home by the National Tumor Association (ANT) Foundation. The criteria for patient selection are: inadequate caloric intake ± malnutrition; life expectancy ≥6 weeks; suitable psycho-physical conditions; informed consent. The measured parameters were sex, age, tumor site, food intake, nutritional status, Karnofsky performance status, indication for home artificial nutrition, type of home artificial nutrition (enteral or parenteral), and survival after starting home artificial nutrition. The ANT Foundation assisted 29,348 patients in Bologna and its province from July 1990 to July 2012. Home artificial nutrition had been submitted to 618 patients (2.1%): enteral to 285/618 (46.1%) and parenteral to 333/618 (53.9%). Access routes for home artificial nutrition were: 39% nasogastric tube, 26% percutaneous endoscopic gastrostomy, 33% digiunostomy, and 2% gastrostomy. The central venous catheters used for home artificial nutrition were: 61% non-tunneled, 13 peripherally inserted, 8% partially tunneled, and 18% totally implanted. By July 2012, all the patients had died. Duration of life ≥6 weeks was 78% (484/618). Karnofsky performance status was related to survival ( P <0.0001): one month after starting home artificial nutrition, it decreased in 73 patients (12%), was unchanged in 414 (67%), and increased in 131 (21%). The low incidence of home artificial nutrition over all the patients assisted by the ANT Foundation and the achievement to avoid death from cachexia in 78% prove the efficacy of the criteria of patient selection in order to prevent its excessive and indiscriminate use. It was effective in maintaining and improving the performance status in 88% of patients. Karnofsky performance status is a reliable prognostic index to start home artificial nutrition.
Han, Seunggu J; Rolston, John D; Zygourakis, Corinna C; Sun, Matthew Z; McDermott, Michael W; Lau, Catherine Y; Aghi, Manish K
2016-01-01
On-time starts for the first case of the day are critical to maintaining efficiency in operating rooms (ORs). We studied whether a resident-led initiative to ensure on-time site marking and documentation of surgical consent could lead to improved first-case start time. In a resident-led initiative at a large 600-bed academic hospital with 25 ORs, we aimed to complete site marking and surgical consents half an hour before the scheduled start time for all first-case neurosurgical patients. We monitored the occurrence of delayed first starts and the length of delay during our initiative, and compared these cases to neurosurgical cases 3 months before the implementation of the initiative and to first-start nonneurosurgical cases. In the year of the initiative, both site marking and surgical consents were completed 30 minutes before the case start in 97% of neurosurgical cases. The average delay across all first-case starts was reduced to 7.17 minutes (N = 1271), compared with 9.67 minutes before the intervention (N = 345). During the study period, non-neurosurgical cases were delayed on average 10.3 minutes (N = 3592). There was a significant difference in latencies between the study period and the period before the initiative (p < 0.001), and also between neurosurgical cases and nonneurosurgical cases (p < 0.001). There was no reduction in delay times seen on the non-neurosurgical services in the study period when compared to the case 3 months before. Considering its effect across 1271 cases, this initiative over 1 year resulted in a total reduction of 52 hours and 57 minutes in delays. Through a resident-led quality improvement program, neurosurgical trainees successfully reduced delays in first-case starts on a surgical service. Engaging physician trainees in quality improvement and enhancing OR efficiency can be successfully achieved and can have a significant clinical and financial effect. Copyright © 2015 Association of Program Directors in Surgery. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Ge, J.; Magnani, M.; Waldron, B. A.
2006-12-01
We present the results of two seismic reflection experiments conducted in the Great Memphis area in April and July 2006. The two experiments consisted in a walk-away test and in the acquisition of a 1 km seismic reflection profile. The acquisition of the seismic data is part of a larger effort aimed at imaging the lateral continuity of the Upper Claiborne confining clay that separates the Memphis aquifer, the region's primary drinking water source, from the upper unconfined aquifer and protects the drinking aquifer from exposure to potential contamination. During the walk-away test, four P-wave sources, a 7.5 kg sledge hammer, a 20 kg weight drop, a 12-gauge Buffalo gun, and a Minivibe source were tested at two sites with the goal of selecting the best P-wave seismic source and acquisition parameters for shallow reflection surveys. Boreholes nearby both sites encountered the Upper Claiborne unit at a depth ranging from 10 m to 40 m. One site is located within a 100-meter length of road median that can be considered an urban environment. The second site is located at Shelby Farms within the City of Memphis yet reflects a rural setting with minimal noise and no subsurface infrastructure. Performing identical walk-away tests at both sites, the results indicate that the energy source selection is site dependent. At the urban site, the energy generated by the weight drop source is more coherent and can be interpreted with more confidence on the recorded data. However the Shelby Farms site the 12-gauge shotgun produced the strongest recorded energy, the highest dominant frequency and the broadest frequency band (6- 110 Hz). Strong attenuations are observed at both sites with a much higher attenuation in the urban road median site, where the near surface materials consisted of gravels, sands, clays, and pebbles. For both sites, surface waves and refractions dominate the seismic recordings. Filtering and gain of the data revealed the presence of shallow reflections related to the targeted clay layer. Based on the results of the walk-away test and on additional supporting data such as water table measurements, neotectonic structural mapping and borehole data, the location for a 1 km long, north-south trending seismic reflection profile was chosen at Shelby Farms extending south to the Wolf River. Based on the walk-away testing the 12-gauge Buffalo gun was selected as the energy source, used to detonate a single 200 g black powder shell in a 0.6 m deep water filled hole with a 1 m source interval and a 0.25 m geophone interval. Preliminary analysis of the data indicates dominating surface waves and refractions. Upon filtering, consistent reflections can be observed. Correlation of reflections at the start of the seismic line to nearby boreholes evidenced the signature of the Upper Claiborne confining clay at a depth of 18 m.
78 FR 20886 - Sunshine Act Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2013-04-08
... the BBG's public Web site at www.bbg.gov . Information regarding this meeting, including any updates or adjustments to its starting time, can also be found on the Agency's public Web site. CONTACT...
Identification of candidate transcription factor binding sites in the cattle genome
USDA-ARS?s Scientific Manuscript database
A resource that provides candidate transcription factor binding sites does not currently exist for cattle. Such data is necessary, as predicted sites may serve as excellent starting locations for future 'omics studies to develop transcriptional regulation hypotheses. In order to generate this resour...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Znojil, Miloslav
An N-level quantum model is proposed in which the energies are represented by an N-plet of zeros of a suitable classical orthogonal polynomial. The family of Gegenbauer polynomials G(n,a,x) is selected for illustrative purposes. The main obstacle lies in the non-Hermiticity (aka crypto-Hermiticity) of Hamiltonians H{ne}H{sup {dagger}.} We managed to (i) start from elementary secular equation G(N,a,E{sub n})=0, (ii) keep our H, in the nearest-neighbor-interaction spirit, tridiagonal, (iii) render it Hermitian in an ad hoc, nonunique Hilbert space endowed with metric {Theta}{ne}I, (iv) construct eligible metrics in closed forms ordered by increasing nondiagonality, and (v) interpret the model as amore » smeared N-site lattice.« less
Structure-based optimization of Cephalothin-analogue boronic acids as β-lactamase inhibitors
Morandi, Stefania; Morandi, Federica; Caselli, Emilia; Shoichet, Brian K.; Prati, Fabio
2008-01-01
Boronic acids have proved to be promising selective inhibitors of β-lactamases, acting as transition state analogues. Starting from a previously described nanomolar inhibitor of AmpC β-lactamase, three new inhibitors were designed to gain interactions with highly conserved residues, such as Asn343, and to bind more tightly to the enzyme. Among these, one was obtained by stereoselective synthesis and succeeded in placing its anionic group into the carboxylate binding site of the enzyme, as revealed by X-ray crystallography of the complex inhibitor/AmpC. Nevertheless, it failed at improving affinity, when compared to the lead from which it was derived. The origins of this structural and energetic discrepancy are discussed. PMID:17997318
NASA Astrophysics Data System (ADS)
Kaka, S. I.
2012-04-01
We have carried out a seismic noise study in order to understand the noise level at three selected locations at King Fahd University of Petroleum and Minerals (KFUPM), Dhahran, Saudi Arabia. The main purpose is to select a suitable site with low seismic noise and good signal-to-noise ratio for our new broadband seismic station. There are several factors involved in the selection of a site location for a new station. Most importantly, we need to strike a balance between a logistically convenient site versus a technically suitable site. As a starting point, we selected six potential sites due to accessibility and proximity to the seismic processing center laboratory in the Department of Earth Sciences (ESD) at KFUPM. We then eliminated two sites that are relatively close to possible low-frequency noise sources. We have considered many possible noise sources which include: vehicle traffic / heavy machinery, the direct path of air flowing from air conditioning vent, tall trees / power poles and metal doorways. One more site was eliminated because the site was located in the open where it experiences maximum wind speed which is considered a major source of noise. All three potential sites are situated within the Dammam Dome where both lower middle and upper Rus Formations are exposed. The upper Rus is mainly made up of fine grained chalky limestone and the lower Rus is made up of alternation of marls and thin dolomitic limestone. The area is not known for any major faults and considered very low seismicity and hence the identification of seismoteconic features is not required. Before conducting the noise study, we calibrated and tested the seismic recording system, which was recently acquired by the ESD at KFUPM. The system includes a seismic recorder and a sensor with a GPS device. We deployed the system in order to measure the low-frequency background noise. Knowing the low frequency noise will help in predicting the high-frequency noise. The recording systems were deployed for twenty eight days (based on the memory available with the recorder) continuously collecting data at all three potential sites. This continuous data collection was done as part of a larger study where microtremor measurements were made to better understand and characterize the origin of various near-surface noises over a non-producing reservoir in Dhahran, Saudi Arabia (Papoola and Kaka, 2011). The new station at KFUPM will be equipped with a 3-component 120s to 50Hz Trillium120 broad band seismometer, Taurus 24-bit data acquisition system along with a large LCD to display the waveform data in real-time. The KFUPM community will have an opportunity to observe daily seismic activity in real-time and to monitor/record both regional and teleseismic events. Moreover, students will gain the opportunity to identify P, S, Love, and Rayleigh waves and learn how to locate an earthquake. The station will also play an important role in providing a source of information about seismic activity for the general public. The new station is expected to be operational in a few months time.
ERIC Educational Resources Information Center
North Carolina State Dept. of Public Instruction, Raleigh. Div. of School Support.
The selection and planning of sites for school facilities can be critical and difficult due to the varied and complex demands schools must satisfy. This publication addresses the many factors that need consideration during the process of site selection, planning, development, and use. The report examines not only the site selection and planning…
Buchet, Anne; Eichler, Knut; Mandrand-Berthelot, Marie-Andrée
1998-01-01
The divergent structural operons caiTABCDE and fixABCX of Escherichia coli are required for anaerobic carnitine metabolism. Transcriptional monocopy lacZ fusion studies showed that both operons are coexpressed during anaerobic growth in the presence of carnitine, respond to common environmental stimuli (like glucose and nitrate), and are modulated positively by the same general regulators, CRP and FNR, and negatively by H-NS. Overproduction of the CaiF specific regulatory protein mediating the carnitine signal restored induction in an fnr mutant, corresponding to its role as the primary target for anaerobiosis. Transcript analysis identified two divergent transcription start points initiating 289 bp apart. DNase I footprinting revealed three sites with various affinities for the binding of the cAMP-CRP complex inside this regulatory region. Site-directed mutagenesis experiments indicated that previously reported perfect CRP motif 1, centered at −41.5 of the cai transcriptional start site, plays a direct role in the sole cai activation. In contrast, mutation in CRP site 2, positioned at −69.5 of the fix promoter, caused only a threefold reduction in fix expression. Thus, the role of the third CRP site, located at −126.5 of fix, might be to reinforce the action of site 2. A critical 50-bp cis-acting sequence overlapping the fix mRNA start site was found, by deletion analysis, to be necessary for cai transcription. This region is thought to be involved in transduction of the signal mediated by the CaiF regulator. PMID:9573142
Sen Gupta, Anirban
2016-01-01
Packaging of drug molecules within microparticles and nanoparticles has become an important strategy in intravascular drug delivery, where the particles are designed to protect the drugs from plasma effects, increase drug residence time in circulation, and often facilitate drug delivery specifically at disease sites. To this end, over the past few decades, interdisciplinary research has focused on developing biocompatible materials for particle fabrication, technologies for particle manufacture, drug formulation within the particles for efficient loading, and controlled release and refinement of particle surface chemistries to render selectivity toward disease site for site-selective action. Majority of the particle systems developed for such purposes are spherical nano and microparticles and they have had low-to-moderate success in clinical translation. To refine the design of delivery systems for enhanced performance, in recent years, researchers have started focusing on the physicomechanical aspects of carrier particles, especially their shape, size, and stiffness, as new design parameters. Recent computational modeling studies, as well as, experimental studies using microfluidic devices are indicating that these design parameters greatly influence the particles' behavior in hemodynamic circulation, as well as cell-particle interactions for targeted payload delivery. Certain cellular components of circulation are also providing interesting natural cues for refining the design of drug carrier systems. Based on such findings, new benefits and challenges are being realized for the next generation of drug carriers. The current article will provide a comprehensive review of these findings and discuss the emerging design paradigm of incorporating physicomechanical components in fabrication of particulate drug delivery systems. © 2015 Wiley Periodicals, Inc.
Centers for Disease Control and Prevention, Office of Minority Health & Health Equity (OMHHE)
... Skip directly to site content Start of Search Controls Search Form Controls Cancel Submit Search The CDC CDC A-Z ... V W X Y Z # Start of Search Controls Search Form Controls Cancel Submit Search The CDC ...
Parsons, Michael T.; Whiley, Phillip J.; Beesley, Jonathan; Drost, Mark; de Wind, Niels; Thompson, Bryony A.; Marquart, Louise; Hopper, John L.; Jenkins, Mark A.; Brown, Melissa A.; Tucker, Kathy; Warwick, Linda; Buchanan, Daniel D.; Spurdle, Amanda B.
2014-01-01
Variants that disrupt the translation initiation sequences in cancer predisposition genes are generally assumed to be deleterious. However few studies have validated these assumptions with functional and clinical data. Two cancer syndrome gene variants likely to affect native translation initiation were identified by clinical genetic testing: MLH1:c.1A>G p.(Met1?) and BRCA2:c.67+3A>G. In vitro GFP-reporter assays were conducted to assess the consequences of translation initiation disruption on alternative downstream initiation codon usage. Analysis of MLH1:c.1A>G p.(Met1?) showed that translation was mostly initiated at an in-frame position 103 nucleotides downstream, but also at two ATG sequences downstream. The protein product encoded by the in-frame transcript initiating from position c.103 showed loss of in vitro mismatch repair activity comparable to known pathogenic mutations. BRCA2:c.67+3A>G was shown by mRNA analysis to result in an aberrantly spliced transcript deleting exon 2 and the consensus ATG site. In the absence of exon 2, translation initiated mostly at an out-of-frame ATG 323 nucleotides downstream, and to a lesser extent at an in-frame ATG 370 nucleotides downstream. Initiation from any of the downstream alternative sites tested in both genes would lead to loss of protein function, but further clinical data is required to confirm if these variants are associated with a high cancer risk. Importantly, our results highlight the need for caution in interpreting the functional and clinical consequences of variation that leads to disruption of the initiation codon, since translation may not necessarily occur from the first downstream alternative start site, or from a single alternative start site. PMID:24302565
40 CFR 761.247 - Sample site selection for pipe segment removal.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Natural Gas Pipeline: Selecting Sample Sites, Collecting Surface Samples, and Analyzing Standard PCB Wipe Samples § 761.247 Sample site selection for pipe segment removal. (a) General. (1) Select the pipe... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Sample site selection for pipe segment...
School Site Selection and Approval Guide.
ERIC Educational Resources Information Center
California State Dept. of Education, Sacramento. Div. of School Facilities Planning.
This guide is designed to assist school districts in selecting school sites that provide both a safe and supportive environment for the instructional program and the learning process, and gain state approval for the selected sites. The guide includes a set of selection criteria that have proven helpful to site selection teams, information about…
40 CFR 761.247 - Sample site selection for pipe segment removal.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Sample site selection for pipe segment... Natural Gas Pipeline: Selecting Sample Sites, Collecting Surface Samples, and Analyzing Standard PCB Wipe Samples § 761.247 Sample site selection for pipe segment removal. (a) General. (1) Select the pipe...
Targeting Lysine Deacetylases (KDACs) in Parasites
Wang, Qi; Rosa, Bruce A.; Nare, Bakela; Powell, Kerrie; Valente, Sergio; Rotili, Dante; Mai, Antonello; Marshall, Garland R.; Mitreva, Makedonka
2015-01-01
Due to an increasing problem of drug resistance among almost all parasites species ranging from protists to worms, there is an urgent need to explore new drug targets and their inhibitors to provide new and effective parasitic therapeutics. In this regard, there is growing interest in exploring known drug leads of human epigenetic enzymes as potential starting points to develop novel treatments for parasitic diseases. This approach of repurposing (starting with validated targets and inhibitors) is quite attractive since it has the potential to reduce the expense of drug development and accelerate the process of developing novel drug candidates for parasite control. Lysine deacetylases (KDACs) are among the most studied epigenetic drug targets of humans, and a broad range of small-molecule inhibitors for these enzymes have been reported. In this work, we identify the KDAC protein families in representative species across important classes of parasites, screen a compound library of 23 hydroxamate- or benzamide-based small molecules KDAC inhibitors, and report their activities against a range of parasitic species, including the pathogen of malaria (Plasmodium falciparum), kinetoplastids (Trypanosoma brucei and Leishmania donovani), and nematodes (Brugia malayi, Dirofilaria immitis and Haemonchus contortus). Compound activity against parasites is compared to that observed against the mammalian cell line (L929 mouse fibroblast) in order to determine potential parasite-versus-host selectivity). The compounds showed nanomolar to sub-nanomolar potency against various parasites, and some selectivity was observed within the small panel of compounds tested. The possible binding modes of the active compounds at the different protein target sites within different species were explored by docking to homology models to help guide the discovery of more selective, parasite-specific inhibitors. This current work supports previous studies that explored the use of KDAC inhibitors in targeting Plasmodium to develop new anti-malarial treatments, and also pioneers experiments with these KDAC inhibitors as potential new anthelminthics. The selectivity observed begins to address the challenges of targeting specific parasitic diseases while limiting host toxicity. PMID:26402733
Cloning of a promoter-like soybean DNA sequence responding to IAA induction in Escherichia coli K12.
Kline, E L; Chiang, S J; Lattora, D; Chaung, W
1992-02-01
We have constructed a soybean genomic DNA library in Escherichia coli K12 strain KC13 using plasmid pPV33, which consists of a promoter-less tetracycline resistance (Tcr) gene. A recombinant clone, KC13(pAU-SB1)+, was obtained by selecting for resistance to tetracycline in the presence of indole-3-acetic acid (IAA). Restriction enzyme cleavage and Southern hybridization analysis revealed that the pAU-SB1 plasmid has a 250 bp soybean DNA insert fused with the Tcr gene. In the presence of a selected group of auxins, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are observed only in KC13(pAU-SB1)+ cultures. On the other hand, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are absent in cells harboring the cloning vector pPV33 or a recombinant plasmid containing the 250 bp insert in the reverse orientation, pAU-SB1ro. This demonstrated a need for the insertion of the 250 bp soybean DNA and the specificity of its orientation in response to IAA induction. The start point of mRNA transcription in response to IAA, IBA, IPA, 2,4,5-T, and a-NAP is at base pair -96 or -95 upstream of the translational start site of the Tcr gene and base pair -98 with 2,4-D.
Site-Selection in Single-Molecule Junction for Highly Reproducible Molecular Electronics.
Kaneko, Satoshi; Murai, Daigo; Marqués-González, Santiago; Nakamura, Hisao; Komoto, Yuki; Fujii, Shintaro; Nishino, Tomoaki; Ikeda, Katsuyoshi; Tsukagoshi, Kazuhito; Kiguchi, Manabu
2016-02-03
Adsorption sites of molecules critically determine the electric/photonic properties and the stability of heterogeneous molecule-metal interfaces. Then, selectivity of adsorption site is essential for development of the fields including organic electronics, catalysis, and biology. However, due to current technical limitations, site-selectivity, i.e., precise determination of the molecular adsorption site, remains a major challenge because of difficulty in precise selection of meaningful one among the sites. We have succeeded the single site-selection at a single-molecule junction by performing newly developed hybrid technique: simultaneous characterization of surface enhanced Raman scattering (SERS) and current-voltage (I-V) measurements. The I-V response of 1,4-benzenedithiol junctions reveals the existence of three metastable states arising from different adsorption sites. Notably, correlated SERS measurements show selectivity toward one of the adsorption sites: "bridge sites". This site-selectivity represents an essential step toward the reliable integration of individual molecules on metallic surfaces. Furthermore, the hybrid spectro-electric technique reveals the dependence of the SERS intensity on the strength of the molecule-metal interaction, showing the interdependence between the optical and electronic properties in single-molecule junctions.
Archaeological Investigations in the Upper Tombigbee Valley, Mississippi: Phase I. Volume 1.
1983-01-01
6.10 Site 221T563: Selected c,ramics; Alexander Incised .............................. 6.90 6.91 6.11 Site 221T563: Selected ceramics: Alexander... Incised .............................. 6.92 6.93 6.12 Site 221T563: Selected ceramics: Alexander Incised .............................. 6.94 6.95 6.13 Site...221T563: Selected ceramics: Alexander Incised .............................. 6.96 6.9i 6.14 Site 221T563: Selected ceramics: Alexander Incised
DOE Office of Scientific and Technical Information (OSTI.GOV)
Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal
Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable themore » differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i.e. cerebellum versus heart for differential variation at the gene, isoform, and transcription start site (TSS), and promoter level showed that several of the genes differed at all four levels. Interestingly, these genes were mainly annotated to the “electron transport chain” and neuronal differentiation, emphasizing that “tissue important” genes are regulated at several levels. Furthermore, our analysis shows that the “across tissue approach” has a promising potential when screening for possible explanations for variations, such as those observed at the gene expression levels.« less
STK Integrated Message Production List Editor (SIMPLE) for CEO Operations
NASA Technical Reports Server (NTRS)
Trenchard, Mike; Heydorn, James
2014-01-01
Late in fiscal year 2011, the Crew Earth Observations (CEO) team was tasked to upgrade and replace its mission planning and mission operations software systems, which were developed in the Space Shuttle era of the 1980s and 1990s. The impetuses for this change were the planned transition of all workstations to the Windows 7 64-bit operating system and the desire for more efficient and effective use of Satellite Tool Kit (STK) software required for reliable International Space Station (ISS) Earth location tracking. An additional requirement of this new system was the use of the same SQL database of CEO science sites from the SMMS, which was also being developed. STK Integrated Message Production List Editor (SIMPLE) is the essential, all-in-one tool now used by CEO staff to perform daily ISS mission planning to meet its requirement to acquire astronaut photography of specific sites on Earth. The sites are part of a managed, long-term database that has been defined and developed for scientific, educational, and public interest. SIMPLE's end product is a set of basic time and location data computed for an operator-selected set of targets that the ISS crew will be asked to photograph (photography is typically planned 12 to 36 hours out). The CEO operator uses SIMPLE to (a) specify a payload operations planning period; (b) acquire and validate the best available ephemeris data (vectors) for the ISS during the planning period; (c) ingest and display mission-specific site information from the CEO database; (d) identify and display potential current dynamic event targets as map features; (e) compute and display time and location information for each target; (f) screen and select targets based on known crew availability constraints, obliquity constraints, and real-time evaluated constraints to target visibility due to illumination (sun elevation) and atmospheric conditions (weather); and finally (g) incorporate basic, computed time and location information for each selected target into the daily CEO Target List product (message) for submission to ISS payload planning and integration teams for their review and approval prior to uplink. SIMPLE requires and uses the following resources: an ISS mission planning period Greenwich Mean Time start date/time and end date/time), the best available ISS mission ephemeris data (vectors) for that planning period, the STK software package configured for the ISS, and an ISS mission-specific subset of the CEO sites database. The primary advantages realized by the development and implementation of SIMPLE into the CEO payload operations support activity are a smooth transition to the Windows 7 operating system upon scheduled workstation refresh; streamlining of the input and verification of the current ISS ephemeris (vector data); seamless incorporation of selected contents of the SQL database of science sites; the ability to tag and display potential dynamic event opportunities on orbit track maps; simplification of the display and selection of encountered sites based on crew availability, illumination, obliquity, and weather constraints; the incorporation of high-quality mapping of the Earth with various satellite-based datasets for use in describing targets; and the ability to encapsulate and export the essential selected target elements in XML format for use by onboard Earth-location systems, such as Worldmap. SIMPLE is a carefully designed and crafted in-house software package that includes detailed help files for the user and meticulous internal documentation for future modifications. It was delivered in February 2012 for test and evaluation. Following acceptance, it was implemented for CEO mission operations support in May 2012.
Huang, Renhua; Fang, Pete; Kay, Brian K
2012-09-01
Site-directed mutagenesis is routinely performed in protein engineering experiments. One method, termed Kunkel mutagenesis, is frequently used for constructing libraries of peptide or protein variants in M13 bacteriophage, followed by affinity selection of phage particles. To make this method more efficient, the following two modifications were introduced: culture was incubated at 25°C for phage replication, which yielded two- to sevenfold more single-stranded DNA template compared to growth at 37°C, and restriction endonuclease recognition sites were used to remove non-recombinants. With both of the improvements, we could construct primary libraries of high complexity and that were 99-100% recombinant. Finally, with a third modification to the standard protocol of Kunkel mutagenesis, two secondary (mutagenic) libraries of a fibronectin type III (FN3) monobody were constructed with DNA segments that were amplified by error-prone and asymmetric PCR. Two advantages of this modification are that it bypasses the lengthy steps of restriction enzyme digestion and ligation, and that the pool of phage clones, recovered after affinity selection, can be used directly to generate a secondary library. Screening one of the two mutagenic libraries yielded variants that bound two- to fourfold tighter to human Pak1 kinase than the starting clone. The protocols described in this study should accelerate the discovery of phage-displayed recombinant affinity reagents. Copyright © 2012 Elsevier Inc. All rights reserved.
Ustyuzhanina, Nadezhda E; Fomitskaya, Polina A; Gerbst, Alexey G; Dmitrenok, Andrey S; Nifantiev, Nikolay E
2015-02-02
Natural anionic polysaccharides fucosylated chondroitin sulfates (FCS) from sea cucumbers attract great attention nowadays due to their ability to influence various biological processes, such as blood coagulation, thrombosis, angiogenesis, inflammation, bacterial and viral adhesion. To determine pharmacophore fragments in FCS we have started systematic synthesis of oligosaccharides with well-defined structure related to various fragments of these polysaccharides. In this communication, the synthesis of non-sulfated and selectively O-sulfated di- and trisaccharides structurally related to branching sites of FCS is described. The target compounds are built up of propyl β-d-glucuronic acid residue bearing at O-3 α-l-fucosyl or α-l-fucosyl-(1→3)-α-l-fucosyl substituents. O-Sulfation pattern in the fucose units of the synthetic targets was selected according to the known to date holothurian FCS structures. Stereospecific α-glycoside bond formation was achieved using 2-O-benzyl-3,4-di-O-chloroacetyl-α-l-fucosyl trichloroacetimidate as a donor. Stereochemical outcome of the glycosylation was explained by the remote participation of the chloroacetyl groups with the formation of the stabilized glycosyl cations, which could be attacked by the glycosyl acceptor only from the α-side. The experimental results were in good agreement with the SCF/MP2 calculated energies of such participation. The synthesized oligosaccharides are regarded as model compounds for the determination of a structure-activity relationship in FCS.
Ustyuzhanina, Nadezhda E.; Fomitskaya, Polina A.; Gerbst, Alexey G.; Dmitrenok, Andrey S.; Nifantiev, Nikolay E.
2015-01-01
Natural anionic polysaccharides fucosylated chondroitin sulfates (FCS) from sea cucumbers attract great attention nowadays due to their ability to influence various biological processes, such as blood coagulation, thrombosis, angiogenesis, inflammation, bacterial and viral adhesion. To determine pharmacophore fragments in FCS we have started systematic synthesis of oligosaccharides with well-defined structure related to various fragments of these polysaccharides. In this communication, the synthesis of non-sulfated and selectively O-sulfated di- and trisaccharides structurally related to branching sites of FCS is described. The target compounds are built up of propyl β-d-glucuronic acid residue bearing at O-3 α-l-fucosyl or α-l-fucosyl-(1→3)-α-l-fucosyl substituents. O-Sulfation pattern in the fucose units of the synthetic targets was selected according to the known to date holothurian FCS structures. Stereospecific α-glycoside bond formation was achieved using 2-O-benzyl-3,4-di-O-chloroacetyl-α-l-fucosyl trichloroacetimidate as a donor. Stereochemical outcome of the glycosylation was explained by the remote participation of the chloroacetyl groups with the formation of the stabilized glycosyl cations, which could be attacked by the glycosyl acceptor only from the α-side. The experimental results were in good agreement with the SCF/MP2 calculated energies of such participation. The synthesized oligosaccharides are regarded as model compounds for the determination of a structure-activity relationship in FCS. PMID:25648510
Method and apparatus for selectively controlling the speed of an engine
Davis, Roy Inge
2001-02-27
A control assembly 12 for use within a vehicle 10 having an engine 14 and which selectively controls the speed of the engine 14 in order to increase fuel efficiency and to effect relatively smooth starting and stopping of the engine. Particularly, in one embodiment, control assembly 12 cooperatively operates with a starter/alternator assembly 20 and is adapted for use with hybrid vehicles employing a start/stop powertrain assembly, wherein fuel efficiency is increased by selectively stopping engine operation when the vehicle has stopped.
Greenhouse Gas Reporting Program (GHGRP)
Site provides information on EPA's GHG reported data starting with RY 2010 to the present. The site also provides information on regulatory requirements, applicability, how to register a facility and report data, and how to access the GHG data.
Preferential cleavage sites for Sau3A restriction endonuclease in human ribosomal DNA.
Kupriyanova, N S; Kirilenko, P M; Netchvolodov, K K; Ryskov, A P
2000-07-21
Previous studies of cloned ribosomal DNA (rDNA) variants isolated from the cosmid library of human chromosome 13 have revealed some disproportion in representativity of different rDNA regions (N. S. Kupriyanova, K. K. Netchvolodov, P. M. Kirilenko, B. I. Kapanadze, N. K. Yankovsky, and A. P. Ryskov, Mol. Biol. 30, 51-60, 1996). Here we show nonrandom cleavage of human rDNA with Sau3A or its isoshizomer MboI under mild hydrolysis conditions. The hypersensitive cleavage sites were found to be located in the ribosomal intergenic spacer (rIGS), especially in the regions of about 5-5.5 and 11 kb upstream of the rRNA transcription start point. This finding is based on sequencing mapping of the rDNA insert ends in randomly selected cosmid clones of human chromosome 13 and on the data of digestion kinetics of cloned and noncloned human genomic rDNA with Sau3A and MboI. The results show that a methylation status and superhelicity state of the rIGS have no effect on cleavage site sensitivity. It is interesting that all primary cleavage sites are adjacent to or entering into Alu or Psi cdc 27 retroposons of the rIGS suggesting a possible role of neighboring sequences in nuclease accessibility. The results explain nonequal representation of rDNA sequences in the human genomic DNA library used for this study. Copyright 2000 Academic Press.
Wu, C J; Janssen, G R
1996-10-01
The Streptomyces vinaceus viomycin phosphotransferase (vph) mRNA contains an untranslated leader with a conventional Shine-Dalgarno homology. The vph leader was removed by ligation of the vph coding sequence to the transcriptional start site of a Streptomyces or an Escherichia coli promoter, such that transcription would initiate at the first position of the vph start codon. Analysis of mRNA demonstrated that transcription initiated primarily at the A of the vph AUG translational start codon in both Streptomyces lividans and E. coli; cells expressing the unleadered vph mRNA were resistant to viomycin indicating that the Shine-Dalgarno sequence, or other features contained within the leader, was not necessary for vph translation. Addition of four nucleotides (5'-AUGC-3') onto the 5' end of the unleadered vph mRNA resulted in translation initiation from the vph start codon and the AUG triplet contained within the added sequence. Translational fusions of vph sequence to a Tn5 neo reporter gene indicated that the first 16 codons of vph coding sequence were sufficient to specify the translational start site and reading frame for expression of neomycin resistance in both E. coli and S. lividans.
40 CFR 761.250 - Sample site selection for pipeline section abandonment.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Sample site selection for pipeline... Disposal of Natural Gas Pipeline: Selecting Sample Sites, Collecting Surface Samples, and Analyzing Standard PCB Wipe Samples § 761.250 Sample site selection for pipeline section abandonment. This procedure...
40 CFR 761.250 - Sample site selection for pipeline section abandonment.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Sample site selection for pipeline... Disposal of Natural Gas Pipeline: Selecting Sample Sites, Collecting Surface Samples, and Analyzing Standard PCB Wipe Samples § 761.250 Sample site selection for pipeline section abandonment. This procedure...
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Evolution of recombination rates in a multi-locus, haploid-selection, symmetric-viability model.
Chasnov, J R; Ye, Felix Xiaofeng
2013-02-01
A fast algorithm for computing multi-locus recombination is extended to include a recombination-modifier locus. This algorithm and a linear stability analysis is used to investigate the evolution of recombination rates in a multi-locus, haploid-selection, symmetric-viability model for which stable equilibria have recently been determined. When the starting equilibrium is symmetric with two selected loci, we show analytically that modifier alleles that reduce recombination always invade. When the starting equilibrium is monomorphic, and there is a fixed nonzero recombination rate between the modifier locus and the selected loci, we determine analytical conditions for which a modifier allele can invade. In particular, we show that a gap exists between the recombination rates of modifiers that can invade and the recombination rate that specifies the lower stability boundary of the monomorphic equilibrium. A numerical investigation shows that a similar gap exists in a weakened form when the starting equilibrium is fully polymorphic but asymmetric. Copyright © 2012 Elsevier Inc. All rights reserved.
Bochkareva, Aleksandra; Zenkin, Nikolay
2013-01-01
The mechanisms of abortive synthesis and promoter escape during initiation of transcription are poorly understood. Here, we show that, after initiation of RNA synthesis, non-specific interaction of σ70 region 1.2, present in all σ70 family factors, with the non-template strand around position −4 relative to the transcription start site facilitates unwinding of the DNA duplex downstream of the transcription start site. This leads to stabilization of short RNA products and allows their extension, i.e. promoter escape. We show that this activity of σ70 region 1.2 is assisted by the β-lobe domain, but does not involve the β′-rudder or the β′-switch-2, earlier proposed to participate in promoter escape. DNA sequence independence of this function of σ70 region 1.2 suggests that it may be conserved in all σ70 family factors. Our results indicate that the abortive nature of initial synthesis is caused, at least in part, by failure to open the downstream DNA by the β-lobe and σ region 1.2. PMID:23430153
Gülşen, İsmail; Ak, Hakan; Evcılı, Gökhan; Balbaloglu, Özlem; Sösüncü, Enver
2013-01-01
Background. In this retrospective study, we aimed to compare the results of two surgical techniques, conventional and transverse mini-incision. Materials and Methods. 95 patients were operated between 2011 and 2012 in Bitlis State Hospital. 50 patients were operated with conventional technique and 45 of them were operated with minimal transverse incision. Postoperative complications, incision site problems, and the time of starting to use their hands in daily activities were noted. Results. 95 patients were included in the study. The mean age was 48. 87 of them were female and 8 were male. There was no problem of incision site in both of the two surgical techniques. Only in one patient, anesthesia developed in minimal incision technique. The time of starting to use their hands in daily activities was 22,2 days and 17 days in conventional and minimal incision technique, respectively. Conclusion. Two surgical techniques did not show superiority to each other in terms of postoperative complications and incision site problems except the time of starting to use their hands in daily activities. PMID:24396607
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Lei
2008-01-01
Open reading frame 11 (ORF11) of Kaposi's sarcoma-associated herpesvirus belongs to a herpesviral homologous protein family shared by some members of the gamma- herpesvirus subfamily. Little is known about this ORF11 homologous protein family. We have characterized an unknown open reading frame, ORF11, located adjacent and in the opposite orientation to a well-characterized viral IL-6 gene. Northern blot analysis reveals that ORF11 is expressed during the KSHV lytic cycle with delayed-early transcription kinetics. We have determined the 5{prime} and 3{prime} untranslated region of the unspliced ORF11 transcript and identified both the transcription start site and the transcription termination site. Coremore » promoter region, representing ORF11 promoter activity, was mapped to a 159nt fragment 5{prime} most proximal to the transcription start site. A functional TATA box was identified in the core promoter region. Interestingly, we found that ORF11 transcriptional activation is not responsive to Rta, the KSHV lytic switch protein. We also discovered that part of the ORF11 promoter region, the 209nt fragment upstream of the transcription start site, was repressed by phorbol esters. Our data help to understand transcription regulation of ORF11 and to elucidate roles of ORF11 in KSHV pathogenesis and life cycle.« less
45 CFR 1305.4 - Age of children and family income eligibility.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 45 Public Welfare 4 2010-10-01 2010-10-01 false Age of children and family income eligibility... FAMILIES, HEAD START PROGRAM ELIGIBILITY, RECRUITMENT, SELECTION, ENROLLMENT AND ATTENDANCE IN HEAD START § 1305.4 Age of children and family income eligibility. (a) To be eligible for Head Start services, a...
Effect of a Starting Model on the Solution of a Travel Time Seismic Tomography Problem
NASA Astrophysics Data System (ADS)
Yanovskaya, T. B.; Medvedev, S. V.; Gobarenko, V. S.
2018-03-01
In the problems of three-dimensional (3D) travel time seismic tomography where the data are travel times of diving waves and the starting model is a system of plane layers where the velocity is a function of depth alone, the solution turns out to strongly depend on the selection of the starting model. This is due to the fact that in the different starting models, the rays between the same points can intersect different layers, which makes the tomography problem fundamentally nonlinear. This effect is demonstrated by the model example. Based on the same example, it is shown how the starting model should be selected to ensure a solution close to the true velocity distribution. The starting model (the average dependence of the seismic velocity on depth) should be determined by the method of successive iterations at each step of which the horizontal velocity variations in the layers are determined by solving the two-dimensional tomography problem. An example illustrating the application of this technique to the P-wave travel time data in the region of the Black Sea basin is presented.
Intermediate Outcomes, Strategies, and Challenges of Eight Healthy Start Projects
Walker, Deborah Klein; Hargreaves, Margaret; Rosenbach, Margo
2008-01-01
Site visits were conducted for the evaluation of the national Healthy Start program to gain an understanding of how projects design and implement five service components (outreach, case management, health education, depression screening and interconceptional care) and four system components (consortium, coordination/collaboration, local health system action plan and sustainability) as well as program staff’s perceptions of these components’ influence on intermediate outcomes. Interviews with project directors, case managers, local evaluators, clinicians, consortium members, outreach/lay workers and other stakeholders were conducted during 3-day in-depth site visits with eight Healthy Start grantees. Grantees reported that both services and systems components were related to self-reported service achievements (e.g. earlier entry into prenatal care) and systems achievements (e.g. consumer involvement). Outreach, case management, and health education were perceived as the service components that contributed most to their achievements while consortia was perceived as the most influential systems component in reaching their goals. Furthermore, cultural competence and community voice were overarching project components that addressed racial/ethnic disparities. Finally, there was great variability across sites regarding the challenges they faced, with poor service availability and limited funding the two most frequently reported. Service provision and systems development are both critical for successful Healthy Start projects to achieve intermediate program outcomes. Unique contextual and community issues influence Healthy Start project design, implementation and reported accomplishments. All eight projects implement the required program components yet outreach, case management, and health education are cited most frequently for contributing to their perceived achievements. PMID:19011959
A Comparative Study of Immigrant Children Starting Childcare
ERIC Educational Resources Information Center
Guo, Karen
2017-01-01
This comparative study investigated the experiences of starting childcare of three immigrant children in three different learning environments in New Zealand. The notion of learning environment was explored as a way of thinking about how different people, places, and approaches to learning have interacted to create a particular site for the…
Regulatory requirements for nuclear power plant site selection in Malaysia-a review.
Basri, N A; Hashim, S; Ramli, A T; Bradley, D A; Hamzah, K
2016-12-01
Malaysia has initiated a range of pre-project activities in preparation for its planned nuclear power programme. Clearly one of the first steps is the selection of sites that are deemed suitable for the construction and operation of a nuclear power plant. Here we outline the Malaysian regulatory requirements for nuclear power plant site selection, emphasizing details of the selection procedures and site characteristics needed, with a clear focus on radiation safety and radiation protection in respect of the site surroundings. The Malaysia Atomic Energy Licensing Board (AELB) site selection guidelines are in accord with those provided in International Atomic Energy Agency (IAEA) and United Stated Nuclear Regulatory Commission (USNRC) documents. To enhance the suitability criteria during selection, as well as to assist in the final decision making process, possible assessments using the site selection characteristics and information are proposed.
Using maximum entropy modeling for optimal selection of sampling sites for monitoring networks
Stohlgren, Thomas J.; Kumar, Sunil; Barnett, David T.; Evangelista, Paul H.
2011-01-01
Environmental monitoring programs must efficiently describe state shifts. We propose using maximum entropy modeling to select dissimilar sampling sites to capture environmental variability at low cost, and demonstrate a specific application: sample site selection for the Central Plains domain (453,490 km2) of the National Ecological Observatory Network (NEON). We relied on four environmental factors: mean annual temperature and precipitation, elevation, and vegetation type. A “sample site” was defined as a 20 km × 20 km area (equal to NEON’s airborne observation platform [AOP] footprint), within which each 1 km2 cell was evaluated for each environmental factor. After each model run, the most environmentally dissimilar site was selected from all potential sample sites. The iterative selection of eight sites captured approximately 80% of the environmental envelope of the domain, an improvement over stratified random sampling and simple random designs for sample site selection. This approach can be widely used for cost-efficient selection of survey and monitoring sites.
40 CFR 228.6 - Specific criteria for site selection.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 25 2011-07-01 2011-07-01 false Specific criteria for site selection... selection. (a) In the selection of disposal sites, in addition to other necessary or appropriate factors...) Existence at or in close proximity to the site of any significant natural or cultural features of historical...
de Souza, Gustavo A.; Arntzen, Magnus Ø.; Fortuin, Suereta; Schürch, Anita C.; Målen, Hiwa; McEvoy, Christopher R. E.; van Soolingen, Dick; Thiede, Bernd; Warren, Robin M.; Wiker, Harald G.
2011-01-01
Precise annotation of genes or open reading frames is still a difficult task that results in divergence even for data generated from the same genomic sequence. This has an impact in further proteomic studies, and also compromises the characterization of clinical isolates with many specific genetic variations that may not be represented in the selected database. We recently developed software called multistrain mass spectrometry prokaryotic database builder (MSMSpdbb) that can merge protein databases from several sources and be applied on any prokaryotic organism, in a proteomic-friendly approach. We generated a database for the Mycobacterium tuberculosis complex (using three strains of Mycobacterium bovis and five of M. tuberculosis), and analyzed data collected from two laboratory strains and two clinical isolates of M. tuberculosis. We identified 2561 proteins, of which 24 were present in M. tuberculosis H37Rv samples, but not annotated in the M. tuberculosis H37Rv genome. We were also able to identify 280 nonsynonymous single amino acid polymorphisms and confirm 367 translational start sites. As a proof of concept we applied the database to whole-genome DNA sequencing data of one of the clinical isolates, which allowed the validation of 116 predicted single amino acid polymorphisms and the annotation of 131 N-terminal start sites. Moreover we identified regions not present in the original M. tuberculosis H37Rv sequence, indicating strain divergence or errors in the reference sequence. In conclusion, we demonstrated the potential of using a merged database to better characterize laboratory or clinical bacterial strains. PMID:21030493
Deep sequencing reveals distinct patterns of DNA methylation in prostate cancer.
Kim, Jung H; Dhanasekaran, Saravana M; Prensner, John R; Cao, Xuhong; Robinson, Daniel; Kalyana-Sundaram, Shanker; Huang, Christina; Shankar, Sunita; Jing, Xiaojun; Iyer, Matthew; Hu, Ming; Sam, Lee; Grasso, Catherine; Maher, Christopher A; Palanisamy, Nallasivam; Mehra, Rohit; Kominsky, Hal D; Siddiqui, Javed; Yu, Jindan; Qin, Zhaohui S; Chinnaiyan, Arul M
2011-07-01
Beginning with precursor lesions, aberrant DNA methylation marks the entire spectrum of prostate cancer progression. We mapped the global DNA methylation patterns in select prostate tissues and cell lines using MethylPlex-next-generation sequencing (M-NGS). Hidden Markov model-based next-generation sequence analysis identified ∼68,000 methylated regions per sample. While global CpG island (CGI) methylation was not differential between benign adjacent and cancer samples, overall promoter CGI methylation significantly increased from ~12.6% in benign samples to 19.3% and 21.8% in localized and metastatic cancer tissues, respectively (P-value < 2 × 10(-16)). We found distinct patterns of promoter methylation around transcription start sites, where methylation occurred not only on the CGIs, but also on flanking regions and CGI sparse promoters. Among the 6691 methylated promoters in prostate tissues, 2481 differentially methylated regions (DMRs) are cancer-specific, including numerous novel DMRs. A novel cancer-specific DMR in the WFDC2 promoter showed frequent methylation in cancer (17/22 tissues, 6/6 cell lines), but not in the benign tissues (0/10) and normal PrEC cells. Integration of LNCaP DNA methylation and H3K4me3 data suggested an epigenetic mechanism for alternate transcription start site utilization, and these modifications segregated into distinct regions when present on the same promoter. Finally, we observed differences in repeat element methylation, particularly LINE-1, between ERG gene fusion-positive and -negative cancers, and we confirmed this observation using pyrosequencing on a tissue panel. This comprehensive methylome map will further our understanding of epigenetic regulation in prostate cancer progression.
Conservation of Transcription Start Sites within Genes across a Bacterial Genus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shao, Wenjun; Price, Morgan N.; Deutschbauer, Adam M.
Transcription start sites (TSSs) lying inside annotated genes, on the same or opposite strand, have been observed in diverse bacteria, but the function of these unexpected transcripts is unclear. Here, we use the metal-reducing bacterium Shewanella oneidensis MR-1 and its relatives to study the evolutionary conservation of unexpected TSSs. Using high-resolution tiling microarrays and 5'-end RNA sequencing, we identified 2,531 TSSs in S. oneidensis MR-1, of which 18% were located inside coding sequences (CDSs). Comparative transcriptome analysis with seven additional Shewanella species revealed that the majority (76%) of the TSSs within the upstream regions of annotated genes (gTSSs) were conserved.more » Thirty percent of the TSSs that were inside genes and on the sense strand (iTSSs) were also conserved. Sequence analysis around these iTSSs showed conserved promoter motifs, suggesting that many iTSS are under purifying selection. Furthermore, conserved iTSSs are enriched for regulatory motifs, suggesting that they are regulated, and they tend to eliminate polar effects, which confirms that they are functional. In contrast, the transcription of antisense TSSs located inside CDSs (aTSSs) was significantly less likely to be conserved (22%). However, aTSSs whose transcription was conserved often have conserved promoter motifs and drive the expression of nearby genes. Overall, our findings demonstrate that some internal TSSs are conserved and drive protein expression despite their unusual locations, but the majority are not conserved and may reflect noisy initiation of transcription rather than a biological function.« less
Policy improves what beverages are served to young children in child care.
Ritchie, Lorrene D; Sharma, Sushma; Gildengorin, Ginny; Yoshida, Sallie; Braff-Guajardo, Ellen; Crawford, Patricia
2015-05-01
During 2008, we conducted a statewide survey on beverages served to preschool-aged children in California child care that identified a need for beverage policy. During 2011, the US Department of Agriculture began requiring that sites participating in the Child and Adult Care Food Program (CACFP) make drinking water available throughout the day and serve only low-fat or nonfat milk to children aged 2 years and older. During 2012, the California Healthy Beverages in Childcare law additionally required that all child-care sites eliminate all beverages with added sweetener and limit 100% juice to once daily. To assess potential policy effects, we repeated the statewide survey in 2012. During 2008 and 2012, a cross-sectional sample of ∼1,400 licensed child-care sites was randomly selected after stratifying by category (ie, Head Start, state preschool, other CACFP center, non-CACFP center, CACFP home, and non-CACFP home). Responses were obtained from 429 sites in 2008 and 435 in 2012. After adjustment for child-care category, significant improvements in 2012 compared with 2008 were found; more sites served water with meals/snacks (47% vs 28%; P=0.008) and made water available indoors for children to self-serve (77% vs 69%; P=0.001), and fewer sites served whole milk usually (9% vs 22%; P=0.006) and 100% juice more than once daily (20% vs 27%; P=0.038). During 2012, 60% of sites were aware of beverage policies and 23% were judged fully compliant with the California law. A positive effect occurred on beverages served after enactment of state and federal policies. Efforts should continue to promote beverage policies and support their implementation. Copyright © 2015 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Lanuru, Mahatma; Mashoreng, S.; Amri, K.
2018-03-01
The success of seagrass transplantation is very much depending on the site selection and suitable transplantation methods. The main objective of this study is to develop and use a site-selection model to identify the suitability of sites for seagrass (Enhalus acoroides) transplantation. Model development was based on the physical and biological characteristics of the transplantation site. The site-selection process is divided into 3 phases: Phase I identifies potential seagrass habitat using available knowledge, removes unnecessary sites before the transplantation test is performed. Phase II involves field assessment and transplantation test of the best scoring areas identified in Phase I. Phase III is the final calculation of the TSI (Transplant Suitability Index), based on results from Phases I and II. The model was used to identify the suitability of sites for seagrass transplantation in the West coast of South Sulawesi (3 sites at Labakkang Coast, 3 sites at Awerange Bay, and 3 sites at Lale-Lae Island). Of the 9 sites, two sites were predicted by the site-selection model to be the most suitable sites for seagrass transplantation: Site II at Labakkang Coast and Site III at Lale-Lae Island.
Evaluation of a social marketing campaign targeting preschool children.
Johnson, Susan L; Bellows, Laura; Beckstrom, Leslie; Anderson, Jennifer
2007-01-01
To determine the effectiveness of a pilot social marketing program to increase preschoolers' willingness to try new foods. Four Head Start centers participated (2 experimental, 2 control) in a study using a quasi-experimental design. Experimental sites received a 12-week intervention developed using social marketing techniques. The program was evaluated via preference assessments, classroom observations, and teacher surveys. Increased preference for and willingness to try new foods were observed in children from the experimental sites (P<0.05). The program was positively received by Head Start staff. A social marketing campaign is an effective method to reduce children's neophobia.
Craig, R K; Hall, L; Parker, D; Campbell, P N
1981-01-01
A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038
Parallel synthesis of a series of potentially brain penetrant aminoalkyl benzoimidazoles.
Micco, Iolanda; Nencini, Arianna; Quinn, Joanna; Bothmann, Hendrick; Ghiron, Chiara; Padova, Alessandro; Papini, Silvia
2008-03-01
Alpha7 agonists were identified via GOLD (CCDC) docking in the putative agonist binding site of an alpha7 homology model and a series of aminoalkyl benzoimidazoles was synthesised to obtain potentially brain penetrant drugs. The array was prepared starting from the reaction of ortho-fluoronitrobenzenes with a selection of diamines, followed by reduction of the nitro group to obtain a series of monoalkylated phenylene diamines. N,N'-Carbonyldiimidazole (CDI) mediated acylation, followed by a parallel automated work-up procedure, afforded the monoacylated phenylenediamines which were cyclised under acidic conditions. Parallel work-up and purification afforded the array products in good yields and purities with a robust parallel methodology which will be useful for other libraries. Screening for alpha7 activity revealed compounds with agonist activity for the receptor.
Eleven Tribes Jump START Clean Energy Projects, Summer 2012 (Newsletter)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
This newsletter describes key activities of the DOE Office of Indian Energy Policy and Programs for Summer 2012. The U.S. Department of Energy Office of Indian Energy Policy and Programs (DOE-IE) has selected 11 Tribes - five in Alaska and six in the contiguous United States - to receive on-the-ground technical support for community-based energy efficiency and renewable energy projects as part of DOE-IE's Strategic Technical Assistance Response Team (START) Program. START finalists were selected based on the clarity of their requests for technical assistance and the ability of START to successfully work with their projects or community. Technical expertsmore » from DOE and its National Renewable Energy Laboratory (NREL) will work directly with community-based project teams to analyze local energy issues and assist the Tribes in moving their projects forward. In Alaska, the effort will be bolstered by DOE-IE's partnership with the Denali Commission, which will provide additional assistance and expertise, as well as funding to fuel the Alaska START initiative.« less
ERIC Educational Resources Information Center
Kutz, Gregory D.
2010-01-01
The Head Start program, overseen by the Department of Health and Human Services and administered by the Office of Head Start, provides child development services primarily to low-income families and their children. Federal law allows up to 10 percent of enrolled families to have incomes above 130 percent of the poverty line--GAO (Government…
Fandrick, Keith R; Ogikubo, Junichi; Fandrick, Daniel R; Patel, Nitinchandra D; Saha, Jaideep; Lee, Heewon; Ma, Shengli; Grinberg, Nelu; Busacca, Carl A; Senanayake, Chris H
2013-03-15
A practical and highly site-selective copper-PhBPE-catalyst-controlled allenylation with propargyl boronates has been developed. The methodology has shown to be tolerant of diverse ketones and aldehydes providing the allenyl adducts in high selectivity. The BPE ligand and boronate substituents were shown to direct the site selectivity for which either propargyl or allenyl adducts can be acquired in high selectivity. A model is proposed that explains the origin of the site selectivity.
DeVry, C G; Tsai, W; Clarke, S
1996-11-15
The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.
Kamuyango, Alfred A.; Hirschhorn, Lisa R; Wang, Wenjia; Jansen, Perry; Hoffman, Risa M.
2015-01-01
Objective To compare one-year outcomes of women started on antiretroviral therapy (ART) during pregnancy in the pre-Option B+ era to those in the Option B+ era. Methods A retrospective chart review was performed at three sites in Malawi. Women were included in the ‘pre-Option B+’ cohort if they started ART during pregnancy for a CD4 count < 350 cells/mm3 or WHO 3/4 condition and in the ‘Option B+’ cohort if they started ART during pregnancy regardless of CD4 count or clinical stage. One-year outcomes were compared using Fisher's exact and ANOVA F-tests. Results A higher proportion of women in the pre-Option B+ cohort started ART at WHO stage 3/4 (11.9% versus 1.1%, P < 0.001), switched ART regimens (5.9% versus 0%, P = 0.002), or died in the first year after starting treatment (3.9% versus .5%, P = 0.05). While more women in the Option B+ cohort had poor adherence or defaulted, these differences were not significant. Conclusions At our study sites, the transition to Option B+ has been associated with ART initiation in women with less advanced HIV infection, improved medication tolerability, and lower mortality. Further research is needed to better understand outcomes of Option B+. PMID:25774326
Kamuyango, Alfred A; Hirschhorn, Lisa R; Wang, Wenjia; Jansen, Perry; Hoffman, Risa M
2014-09-01
To compare one-year outcomes of women started on antiretroviral therapy (ART) during pregnancy in the pre-Option B+ era to those in the Option B+ era. A retrospective chart review was performed at three sites in Malawi. Women were included in the 'pre-Option B+' cohort if they started ART during pregnancy for a CD4 count < 350 cells/mm 3 or WHO 3/4 condition and in the 'Option B+' cohort if they started ART during pregnancy regardless of CD4 count or clinical stage. One-year outcomes were compared using Fisher's exact and ANOVA F-tests. A higher proportion of women in the pre-Option B+ cohort started ART at WHO stage 3/4 (11.9% versus 1.1%, P < 0.001), switched ART regimens (5.9% versus 0%, P = 0.002), or died in the first year after starting treatment (3.9% versus .5%, P = 0.05). While more women in the Option B+ cohort had poor adherence or defaulted, these differences were not significant. At our study sites, the transition to Option B+ has been associated with ART initiation in women with less advanced HIV infection, improved medication tolerability, and lower mortality. Further research is needed to better understand outcomes of Option B+.
This report is a description of field work and data analysis results comparing a design comparable to systematic site selection with one based on random selection of sites. The report is expected to validate the use of random site selection in the bioassessment program for the O...
Oliveira, Núbia M; Bento, Fátima M; Camargo, Flávio A O; Knorst, Aline Jéssica; Dos Santos, Anai Loreiro; Pizzolato, Tania M; Peralba, Maria do Carmo R
2011-01-01
Isolation of soil microorganisms from a landfarming site with a 19-year history of petrochemical residues disposal was carried out. After isolation, the bacteria behavior in mineral medium with 1% commercial gasoline (24% ethanol) was evaluated. Parameters employed for microorganism evaluation and selection of those with the greatest degradation potential were: microbial growth; biosurfactant generation and compound reduction in commercial gasoline. Starting from bacteria that presented the best degradation results, consortiums formed by 4 distinct microorganisms were formed. A microbial growth in the presence of commercial gasoline was observed and, for most of the bacteria, degradations of compounds such as benzene, toluene and xylenes (BTX) as well as biosurfactant production was observed. Ethanol was partially degraded by the bacterial isolates although the data does not allow affirming that it was degraded preferentially to the aromatic hydrocarbons investigated. The analyzed consortiums present an efficiency of 95% to 98% for most of the commercial gasoline compounds and a preferential attack to ethanol under the essay condition was not observed within 72 h.
Technical and design update in the AUBE French low-level radioactive waste disposal facility
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marque, Y.
1989-01-01
Long-term industrial management of radioactive waste in France is carried out by the Agence Nationale pour la Gestion des Dechets Radioactifs (ANDRA). ANDRA is in charge of design, siting, construction, and operation of disposal centers. The solution selected in France for the disposal of low- and medium-level, short-lived radioactive waste is near-surface disposal in the earth using the principle of multiple barriers, in accordance with national safety rules and regulations, and based on operating experience from the Centre de Stockage de la Manche. Since the center's start-up in 1969, 400,000 m{sup 3} of waste have been disposed of. The Frenchmore » national program for waste management is proceeding with the construction of a second near-surface disposal, which is expected to be operational in 1991. It is located in the department of AUBE (from which its name derives), 100 miles southeast of Paris. The paper describes the criteria for siting and design of the AUBE disposal facility, design of the AUBE facility disposal module, and comparison with North Carolina and Pennsylvania disposal facility designs.« less
Simulating Radionuclide Migrations of Low-level Wastes in Nearshore Environment
NASA Astrophysics Data System (ADS)
Lu, C. C.; Li, M. H.; Chen, J. S.; Yeh, G. T.
2016-12-01
Tunnel disposal into nearshore mountains was tentatively selected as one of final disposal sites for low-level wastes in Taiwan. Safety assessment on radionuclide migrations in far-filed may involve geosphere processes under coastal environments and into nearshore ocean. In this study the 3-D HYDROFEOCHE5.6 numerical model was used to perform simulations of groundwater flow and radionuclide transport with decay chains. Domain of interest on the surface includes nearby watersheds delineated by digital elevation models and nearshore seabed. As deep as 800 m below the surface and 400 m below sea bed were considered for simulations. The disposal site was located at 200m below the surface. Release rates of radionuclides from near-field was estimated by analytical solutions of radionuclide diffusion with decay out of engineered barriers. Far-field safety assessments were performed starting from the release of radionuclides out of engineered barriers to a time scale of 10,000 years. Sensitivity analyses of geosphere and transport parameters were performed to improve our understanding of safety on final disposal of low-level waste in nearshore environments.
Module 3: Text Versions | State, Local, and Tribal Governments | NREL
walk through the key considerations and activities that should be performed when evaluating a site for speak about larger systems. So generally when you start thinking about site evaluation and kinda moving some of the key considerations, key things that should be considered when you're doing a site
Strength and Power Qualities Are Highly Associated With Punching Impact in Elite Amateur Boxers.
Loturco, Irineu; Nakamura, Fabio Y; Artioli, Guilherme G; Kobal, Ronaldo; Kitamura, Katia; Cal Abad, Cesar C; Cruz, Igor F; Romano, Felipe; Pereira, Lucas A; Franchini, Emerson
2016-01-01
This study investigated the relationship between punching impact and selected strength and power variables in 15 amateur boxers from the Brazilian National Team (9 men and 6 women). Punching impact was assessed in the following conditions: 3 jabs starting from the standardized position, 3 crosses starting from the standardized position, 3 jabs starting from a self-selected position, and 3 crosses starting from a self-selected position. For punching tests, a force platform (1.02 × 0.76 m) covered by a body shield was mounted on the wall at a height of 1 m, perpendicular to the floor. The selected strength and power variables were vertical jump height (in squat jump and countermovement jump), mean propulsive power in the jump squat, bench press (BP), and bench throw, maximum isometric force in squat and BP, and rate of force development in the squat and BP. Sex and position main effects were observed, with higher impact for males compared with females (p ≤ 0.05) and the self-selected distance resulting in higher impact in the jab technique compared with the fixed distance (p ≤ 0.05). Finally, the correlations between strength/power variables and punching impact indices ranged between 0.67 and 0.85. Because of the strong associations between punching impact and strength/power variables (e.g., lower limb muscle power), this study provides important information for coaches to specifically design better training strategies to improve punching impact.
Site selection for MSFC operational tests of solar heating and cooling systems
NASA Technical Reports Server (NTRS)
1978-01-01
The criteria, methodology, and sequence aspects of the site selection process are presented. This report organized the logical thought process that should be applied to the site selection process, but final decisions are highly selective.
Speeding on the Information Superhighway: Strategies for Saving Time on the Web.
ERIC Educational Resources Information Center
Colaric, Susan M.; Carr-Chellman, Alison A.
2000-01-01
Outlines ways to make online searching more efficient. Highlights include starting with printed materials; online reference libraries; subject directories such as Yahoo; search engines; evaluating Web sites, including reliability; bookmarking helpful sites; and using links. (LRW)
Analysis Concerning the Inspection Threshold for Multi-Site Damage.
DOT National Transportation Integrated Search
1993-12-01
Periodic inspections, at a prescribed interval, for Multi-Site Damage (MS) in longitudinal fuselage lap-joints start when the aircraft has accumulated a certain number of flights, the inspection threshold. The work reported here was an attempt to obt...
Nagata, Jason M.; Golden, Neville H.; Leonard, Mary B.; Copelovitch, Lawrence; Denburg, Michelle R.
2017-01-01
Though previous studies have demonstrated an increased fracture risk in females with anorexia nervosa (AN), fracture risk in males is not well characterized. The objective of this study was to examine sex differences in fracture risk and site-specific fracture incidence in AN. We performed a population-based retrospective cohort study using The Health Improvement Network. The median calendar year for the start of the observation period was 2004–5. We identified 9,239 females and 556 males <60 years of age with AN, and 97,889 randomly selected sex-, age-, and practice-matched participants without eating disorders (92,329 females and 5560 males). Multivariable Cox regression was used to estimate the hazard ratio (HR) for incident fracture. Median age at start of observation was 29.8 years in females and 30.2 years in males. The HR for fracture associated with AN differed by sex and age (interaction p = 0.002). Females with AN had an increased fracture risk at all ages (HR 1.59; 95% confidence interval [95% CI], 1.45–1.75). AN was associated with a higher risk of fracture among males >40 years of age (HR 2.54, 95% CI 1.32–4.90; p = 0.005) but not among males ≤40 years. Females with AN had a higher risk of fracture at nearly all anatomic sites. The greatest excess fracture risk was noted at the hip/femur (HR 5.59; 95% CI, 3.44–9.09) and pelvis (HR 4.54; 95% CI 2.42–8.50) in females and at the vertebrae (HR 7.25; 95% CI, 1.21–43.45) for males with AN. AN was associated with higher incident fracture risk in females across all age groups and in males >40 years old. Sites of highest fracture risk include the hip/femur and pelvis in females and vertebrae in males with AN. PMID:28019700
Gaining Regulator Acceptance of Natural Attenuation as a Remediation Tool
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hughes, M.B.
Monitored natural attenuation (MNA) makes use of biological degradation, chemical reactions with natural materials, and other processes to clean up contaminated soils and groundwater. In the past, the regulatory community has been slow to accept natural attenuation due to a misperception that natural attenuation is a ''do nothing'' approach. Recently however, regulators have been more open to considering MNA as part of an overall clean-up plan that includes active treatment technologies to remove or contain the source of contamination at a site. MNA is currently being implemented at the Savannah River Site for remediation of selected contaminants. The South Carolinamore » Department of Health and Environmental Control, who has regulatory authority over these actions, has accepted this process. Significant overall cost savings are forecast. Additionally, there will be less disruption to the ecosystem, compared with engineered technologies. This paper describes the monitored natural attenuation concept as well as the process of constructive engagement with the regulators to achieve acceptance. Application to DOE, DOD, and commercial sites, as well as acceptability to other regulatory bodies, will be discussed with an emphasis on strategies to prevent false starts in the negotiation process and inventing options that result in mutual gains for all parties.« less
Ribosomal Binding Site Switching: An Effective Strategy for High-Throughput Cloning Constructions
Li, Yunlong; Zhang, Yong; Lu, Pei; Rayner, Simon; Chen, Shiyun
2012-01-01
Direct cloning of PCR fragments by TA cloning or blunt end ligation are two simple methods which would greatly benefit high-throughput (HTP) cloning constructions if the efficiency can be improved. In this study, we have developed a ribosomal binding site (RBS) switching strategy for direct cloning of PCR fragments. RBS is an A/G rich region upstream of the translational start codon and is essential for gene expression. Change from A/G to T/C in the RBS blocks its activity and thereby abolishes gene expression. Based on this property, we introduced an inactive RBS upstream of a selectable marker gene, and designed a fragment insertion site within this inactive RBS. Forward and reverse insertions of specifically tailed fragments will respectively form an active and inactive RBS, thus all background from vector self-ligation and fragment reverse insertions will be eliminated due to the non-expression of the marker gene. The effectiveness of our strategy for TA cloning and blunt end ligation are confirmed. Application of this strategy to gene over-expression, a bacterial two-hybrid system, a bacterial one-hybrid system, and promoter bank construction are also verified. The advantages of this simple procedure, together with its low cost and high efficiency, makes our strategy extremely useful in HTP cloning constructions. PMID:23185557
Kurcinski, Mateusz; Jamroz, Michal; Blaszczyk, Maciej; Kolinski, Andrzej; Kmiecik, Sebastian
2015-01-01
Protein–peptide interactions play a key role in cell functions. Their structural characterization, though challenging, is important for the discovery of new drugs. The CABS-dock web server provides an interface for modeling protein–peptide interactions using a highly efficient protocol for the flexible docking of peptides to proteins. While other docking algorithms require pre-defined localization of the binding site, CABS-dock does not require such knowledge. Given a protein receptor structure and a peptide sequence (and starting from random conformations and positions of the peptide), CABS-dock performs simulation search for the binding site allowing for full flexibility of the peptide and small fluctuations of the receptor backbone. This protocol was extensively tested over the largest dataset of non-redundant protein–peptide interactions available to date (including bound and unbound docking cases). For over 80% of bound and unbound dataset cases, we obtained models with high or medium accuracy (sufficient for practical applications). Additionally, as optional features, CABS-dock can exclude user-selected binding modes from docking search or to increase the level of flexibility for chosen receptor fragments. CABS-dock is freely available as a web server at http://biocomp.chem.uw.edu.pl/CABSdock. PMID:25943545
The Effects of Head Start Enrollment Duration on Migrant Children's Dental Health
ERIC Educational Resources Information Center
Lee, Kyunghee
2017-01-01
The purpose of this study was to identify factors affecting Migrant Head Start (MHS) children's dental health. Enrollment duration (number of years and weeks enrolled) and individual and family factors were considered. Children (N = 931) who enrolled in Michigan Migrant Head Start during 2012-2013 were selected for the study sample and classified…
Who starts forest fires in Maine - and how?
Wayne G. Banks; Fred E. Holt
1966-01-01
In 1964 the Maine Forest Service, in cooperation with the Northeastern Forest Experiment Station, conducted intensive investigations of a systematically selected sample of the fires that occurred in the State that year. The immediate purpose was to determine precisely how the fires started and who or what started them, and to assemble relevant information about the...
Scott, J.C.
1990-01-01
Computer software was written to randomly select sites for a ground-water-quality sampling network. The software uses digital cartographic techniques and subroutines from a proprietary geographic information system. The report presents the approaches, computer software, and sample applications. It is often desirable to collect ground-water-quality samples from various areas in a study region that have different values of a spatial characteristic, such as land-use or hydrogeologic setting. A stratified network can be used for testing hypotheses about relations between spatial characteristics and water quality, or for calculating statistical descriptions of water-quality data that account for variations that correspond to the spatial characteristic. In the software described, a study region is subdivided into areal subsets that have a common spatial characteristic to stratify the population into several categories from which sampling sites are selected. Different numbers of sites may be selected from each category of areal subsets. A population of potential sampling sites may be defined by either specifying a fixed population of existing sites, or by preparing an equally spaced population of potential sites. In either case, each site is identified with a single category, depending on the value of the spatial characteristic of the areal subset in which the site is located. Sites are selected from one category at a time. One of two approaches may be used to select sites. Sites may be selected randomly, or the areal subsets in the category can be grouped into cells and sites selected randomly from each cell.
Sandhill crane roost selection, human disturbance, and forage resources
Pearse, Aaron T.; Krapu, Gary; Brandt, David
2017-01-01
Sites used for roosting represent a key habitat requirement for many species of birds because availability and quality of roost sites can influence individual fitness. Birds select roost sites based on numerous factors, requirements, and motivations, and selection of roosts can be dynamic in time and space because of various ecological and environmental influences. For sandhill cranes (Antigone canadensis) at their main spring-staging area along the Platte River in south-central Nebraska, USA, past investigations of roosting cranes focused on physical channel characteristics related to perceived security as motivating roost distribution. We used 6,310 roost sites selected by 313 sandhill cranes over 5 spring migration seasons (2003–2007) to quantify resource selection functions of roost sites on the central Platte River using a discrete choice analysis. Sandhill cranes generally showed stronger selection for wider channels with shorter bank vegetation situated farther from potential human disturbance features such as roads, bridges, and dwellings. Furthermore, selection for roost sites with preferable physical characteristics (wide channels with short bank vegetation) was more resilient to nearby disturbance features than more narrow channels with taller bank vegetation. The amount of cornfields surrounding sandhill crane roost sites positively influenced relative probability of use but only for more narrow channels < 100 m and those with shorter bank vegetation. We confirmed key resource features that sandhill cranes selected at river channels along the Platte River, and after incorporating spatial variation due to human disturbance, our understanding of roost site selection was more robust, providing insights on how disturbance may interact with physical habitat features. Managers can use information on roost-site selection when developing plans to increase probability of crane use at existing roost sites and to identify new areas for potential use if existing sites become limited.
PNNL Delivers Expertise, Technology to Biofuels Start-up, InEnTec
Surma, Jeff
2017-12-09
Initially through its Entrepreneurial Leave of Absence Program, PNNL gives biofuels innovators a start in opening up a new business based on technology developed for incinerating waste on the Hanford Site. Today, the companies Plasma Enhanced Melters are in operation around the world converting organic waste into valuable, clean fuels.
Consistency of gene starts among Burkholderia genomes
2011-01-01
Background Evolutionary divergence in the position of the translational start site among orthologous genes can have significant functional impacts. Divergence can alter the translation rate, degradation rate, subcellular location, and function of the encoded proteins. Results Existing Genbank gene maps for Burkholderia genomes suggest that extensive divergence has occurred--53% of ortholog sets based on Genbank gene maps had inconsistent gene start sites. However, most of these inconsistencies appear to be gene-calling errors. Evolutionary divergence was the most plausible explanation for only 17% of the ortholog sets. Correcting probable errors in the Genbank gene maps decreased the percentage of ortholog sets with inconsistent starts by 68%, increased the percentage of ortholog sets with extractable upstream intergenic regions by 32%, increased the sequence similarity of intergenic regions and predicted proteins, and increased the number of proteins with identifiable signal peptides. Conclusions Our findings highlight an emerging problem in comparative genomics: single-digit percent errors in gene predictions can lead to double-digit percentages of inconsistent ortholog sets. The work demonstrates a simple approach to evaluate and improve the quality of gene maps. PMID:21342528
Lovewell, Thomas R J; McDonagh, Andrew J; Messenger, Andrew G; Azzouz, Mimoun; Tazi-Ahnini, Rachid
2015-01-01
The autoimmune regulator (AIRE) is expressed in the thymus, particularly in thymic medullary epithelial cells (mTECs), and is required for the ectopic expression of a diverse range of peripheral tissue antigens by mTECs, facilitating their ability to perform negative selection of auto-reactive immature T-cells. The expression profile of peripheral tissue antigens is affected not only by AIRE deficiency but also with variation of AIRE activity in the thymus. Therefore we screened 591bp upstream of the AIRE transcription start site including AIRE minimal promoter for single nucleotide polymorphism (SNPs) and identified two SNPs -655R (rs117557896) and -230Y (rs751032) respectively. To study the effect of these variations on AIRE promoter activity we generated a Flp-In host cell line which was stably transfected with a single copy of the reporter vector. Relative promoter activity was estimated by comparing the luciferase specific activity for lysates of the different reporter AIRE promoter-reporter gene constructs including AIRE-655G AIRE-230C, AIRE-655G AIRE-230T and AIRE-655A AIRE-230C. The analysis showed that the commonest haplotype AIRE-655G AIRE-230C has the highest luciferase specific activity (p<0.001). Whereas AIRE-655G AIRE-230T has a luciferase specific activity value that approaches null. Both AIRE promoter polymorphic sites have one allele that forms a CpG methylation site which we determined can be methylated in methylation assays using the M.SssI CpG methyltransferase. AIRE-230Y is in a conserved region of the promoter and is adjacent to a predicted WT1 transcription factor binding site, suggesting that AIRE-230Y affects AIRE expression by influencing the binding of biochemical factors to this region. Our findings show that AIRE-655GAIRE-230T haplotype could dramatically alter AIRE transcription and so have an effect on the process of negative selection and affect susceptibility to autoimmune conditions.
Bed site selection by neonate deer in grassland habitats on the northern Great Plains
Grovenburg, T.W.; Jacques, C.N.; Klaver, R.W.; Jenks, J.A.
2010-01-01
Bed site selection is an important behavioral trait influencing neonate survival. Vegetation characteristics of bed sites influence thermal protection of neonates and concealment from predators. Although previous studies describe bed site selection of neonatal white-tailed deer (Odocoileus virginianus) in regions of forested cover, none determined microhabitat effects on neonate bed site selection in the Northern Great Plains, an area of limited forest cover. During summers 2007–2009, we investigated bed site selection (n = 152) by 81 radiocollared neonate white-tailed deer in north-central South Dakota, USA. We documented 80 (52.6%) bed sites in tallgrass–Conservation Reserve Program lands, 35 (23.0%) bed sites in forested cover, and 37 (24.3%) in other habitats (e.g., pasture, alfalfa, wheat). Bed site selection varied with age and sex of neonate. Tree canopy cover (P < 0.001) and tree basal area (P < 0.001) decreased with age of neonates, with no bed sites observed in forested cover after 18 days of age. Male neonates selected sites with less grass cover (P < 0.001), vertical height of understory vegetation (P < 0.001), and density of understory vegetation (P < 0.001) but greater bare ground (P = 0.047), litter (P = 0.028), and wheat (P = 0.044) than did females. Odds of bed site selection increased 3.5% (odds ratio = 1.035, 95% CI = 1.008–1.062) for every 1-cm increase in vertical height of understory vegetation. Management for habitat throughout the grasslands of South Dakota that maximizes vertical height of understory vegetation would enhance cover characteristics selected by neonates.
Tuning the ion selectivity of tetrameric cation channels by changing the number of ion binding sites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Derebe, Mehabaw G.; Sauer, David B.; Zeng, Weizhong
2015-11-30
Selective ion conduction across ion channel pores is central to cellular physiology. To understand the underlying principles of ion selectivity in tetrameric cation channels, we engineered a set of cation channel pores based on the nonselective NaK channel and determined their structures to high resolution. These structures showcase an ensemble of selectivity filters with a various number of contiguous ion binding sites ranging from 2 to 4, with each individual site maintaining a geometry and ligand environment virtually identical to that of equivalent sites in K{sup +} channel selectivity filters. Combined with single channel electrophysiology, we show that only themore » channel with four ion binding sites is K{sup +} selective, whereas those with two or three are nonselective and permeate Na{sup +} and K{sup +} equally well. These observations strongly suggest that the number of contiguous ion binding sites in a single file is the key determinant of the channel's selectivity properties and the presence of four sites in K{sup +} channels is essential for highly selective and efficient permeation of K{sup +} ions.« less
π-Clamp-mediated cysteine conjugation
NASA Astrophysics Data System (ADS)
Zhang, Chi; Welborn, Matthew; Zhu, Tianyu; Yang, Nicole J.; Santos, Michael S.; van Voorhis, Troy; Pentelute, Bradley L.
2016-02-01
Site-selective functionalization of complex molecules is one of the most significant challenges in chemistry. Typically, protecting groups or catalysts must be used to enable the selective modification of one site among many that are similarly reactive, and general strategies that selectively tune the local chemical environment around a target site are rare. Here, we show a four-amino-acid sequence (Phe-Cys-Pro-Phe), which we call the ‘π-clamp’, that tunes the reactivity of its cysteine thiol for site-selective conjugation with perfluoroaromatic reagents. We use the π-clamp to selectively modify one cysteine site in proteins containing multiple endogenous cysteine residues. These examples include antibodies and cysteine-based enzymes that would be difficult to modify selectively using standard cysteine-based methods. Antibodies modified using the π-clamp retained binding affinity to their targets, enabling the synthesis of site-specific antibody-drug conjugates for selective killing of HER2-positive breast cancer cells. The π-clamp is an unexpected approach to mediate site-selective chemistry and provides new avenues to modify biomolecules for research and therapeutics.
Pronyk, Paul M; Muniz, Maria; Nemser, Ben; Somers, Marie-Andrée; McClellan, Lucy; Palm, Cheryl A; Huynh, Uyen Kim; Ben Amor, Yanis; Begashaw, Belay; McArthur, John W; Niang, Amadou; Sachs, Sonia Ehrlich; Singh, Prabhjot; Teklehaimanot, Awash; Sachs, Jeffrey D
2012-06-09
Simultaneously addressing multiple Millennium Development Goals (MDGs) has the potential to complement essential health interventions to accelerate gains in child survival. The Millennium Villages project is an integrated multisector approach to rural development operating across diverse sub-Saharan African sites. Our aim was to assess the effects of the project on MDG-related outcomes including child mortality 3 years after implementation and compare these changes to local comparison data. Village sites averaging 35,000 people were selected from rural areas across diverse agroecological zones with high baseline levels of poverty and undernutrition. Starting in 2006, simultaneous investments were made in agriculture, the environment, business development, education, infrastructure, and health in partnership with communities and local governments at an annual projected cost of US$120 per person. We assessed MDG-related progress by monitoring changes 3 years after implementation across Millenium Village sites in nine countries. The primary outcome was the mortality rate of children younger than 5 years of age. To assess plausibility and attribution, we compared changes to reference data gathered from matched randomly selected comparison sites for the mortality rate of children younger than 5 years of age. Analyses were done on a per-protocol basis. This trial is registered with ClinicalTrials.gov, number NCT01125618. Baseline levels of MDG-related spending averaged $27 per head, increasing to $116 by year 3 of which $25 was spent on health. After 3 years, reductions in poverty, food insecurity, stunting, and malaria parasitaemia were reported across nine Millennium Village sites. Access to improved water and sanitation increased, along with coverage for many maternal-child health interventions. Mortality rates in children younger than 5 years of age decreased by 22% in Millennium Village sites relative to baseline (absolute decrease 25 deaths per 1000 livebirths, p=0·015) and 32% relative to matched comparison sites (30 deaths per 1000 livebirths, p=0·033). An integrated multisector approach for addressing the MDGs can produce rapid declines in child mortality in the first 3 years of a long-term effort in rural sub-Saharan Africa. UN Human Security Trust Fund, the Lenfest Foundation, Bill & Melinda Gates Foundation, and Becton Dickinson. Copyright © 2012 Elsevier Ltd. All rights reserved.
Reliable Refuge: Two Sky Island Scorpion Species Select Larger, Thermally Stable Retreat Sites.
Becker, Jamie E; Brown, Christopher A
2016-01-01
Sky island scorpions shelter under rocks and other surface debris, but, as with other scorpions, it is unclear whether these species select retreat sites randomly. Furthermore, little is known about the thermal preferences of scorpions, and no research has been done to identify whether reproductive condition might influence retreat site selection. The objectives were to (1) identify physical or thermal characteristics for retreat sites occupied by two sky island scorpions (Vaejovis cashi Graham 2007 and V. electrum Hughes 2011) and those not occupied; (2) determine whether retreat site selection differs between the two study species; and (3) identify whether thermal selection differs between species and between gravid and non-gravid females of the same species. Within each scorpion's habitat, maximum dimensions of rocks along a transect line were measured and compared to occupied rocks to determine whether retreat site selection occurred randomly. Temperature loggers were placed under a subset of occupied and unoccupied rocks for 48 hours to compare the thermal characteristics of these rocks. Thermal gradient trials were conducted before parturition and after dispersal of young in order to identify whether gravidity influences thermal preference. Vaejovis cashi and V. electrum both selected larger retreat sites that had more stable thermal profiles. Neither species appeared to have thermal preferences influenced by reproductive condition. However, while thermal selection did not differ among non-gravid individuals, gravid V. electrum selected warmer temperatures than its gravid congener. Sky island scorpions appear to select large retreat sites to maintain thermal stability, although biotic factors (e.g., competition) could also be involved in this choice. Future studies should focus on identifying the various biotic or abiotic factors that could influence retreat site selection in scorpions, as well as determining whether reproductive condition affects thermal selection in other arachnids.
Spielman, Stephanie J; Wilke, Claus O
2016-11-01
The mutation-selection model of coding sequence evolution has received renewed attention for its use in estimating site-specific amino acid propensities and selection coefficient distributions. Two computationally tractable mutation-selection inference frameworks have been introduced: One framework employs a fixed-effects, highly parameterized maximum likelihood approach, whereas the other employs a random-effects Bayesian Dirichlet Process approach. While both implementations follow the same model, they appear to make distinct predictions about the distribution of selection coefficients. The fixed-effects framework estimates a large proportion of highly deleterious substitutions, whereas the random-effects framework estimates that all substitutions are either nearly neutral or weakly deleterious. It remains unknown, however, how accurately each method infers evolutionary constraints at individual sites. Indeed, selection coefficient distributions pool all site-specific inferences, thereby obscuring a precise assessment of site-specific estimates. Therefore, in this study, we use a simulation-based strategy to determine how accurately each approach recapitulates the selective constraint at individual sites. We find that the fixed-effects approach, despite its extensive parameterization, consistently and accurately estimates site-specific evolutionary constraint. By contrast, the random-effects Bayesian approach systematically underestimates the strength of natural selection, particularly for slowly evolving sites. We also find that, despite the strong differences between their inferred selection coefficient distributions, the fixed- and random-effects approaches yield surprisingly similar inferences of site-specific selective constraint. We conclude that the fixed-effects mutation-selection framework provides the more reliable software platform for model application and future development. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Dissecting transcription-coupled and global genomic repair in the chromatin of yeast GAL1-10 genes.
Li, Shisheng; Smerdon, Michael J
2004-04-02
Transcription-coupled repair (TCR) and global genomic repair (GGR) of UV-induced cyclobutane pyrimidine dimers were investigated in the yeast GAL1-10 genes. Both Rpb9- and Rad26-mediated TCR are confined to the transcribed strands, initiating at upstream sites approximately 100 nucleotides from the upstream activating sequence shared by the two genes. However, TCR initiation sites do not correlate with either transcription start sites or TATA boxes. Rad16-mediated GGR tightly correlates with nucleosome positioning when the genes are repressed and are slow in the nucleosome core and fast in linker DNA. Induction of transcription enhanced GGR in nucleosome core DNA, especially in the nucleosomes around and upstream of the transcription start sites. Furthermore, when the genes were induced, GGR was slower in the transcribed regions than in the upstream regions. Finally, simultaneous deletion of RAD16, RAD26, and RPB9 resulted in no detectable repair in all sites along the region analyzed. Our results suggest that (a). TCR may be initiated by a transcription activator, presumably through the loading of RNA polymerase II, rather than by transcription initiation or elongation per se; (b). TCR and nucleosome disruption-enhanced GGR are the major causes of rapid repair in regions around and upstream of transcription start sites; (c). transcription machinery may hinder access of NER factors to a DNA lesion in the absence of a transcription-repair coupling factor; and (d). other than GGR mediated by Rad16 and TCR mediated by Rad26 and Rpb9, no other nucleotide excision repair pathway exists in these RNA polymerase II-transcribed genes.
One- and two-objective approaches to an area-constrained habitat reserve site selection problem
Stephanie Snyder; Charles ReVelle; Robert Haight
2004-01-01
We compare several ways to model a habitat reserve site selection problem in which an upper bound on the total area of the selected sites is included. The models are cast as optimization coverage models drawn from the location science literature. Classic covering problems typically include a constraint on the number of sites that can be selected. If potential reserve...
NASA Astrophysics Data System (ADS)
Costantini, Mario; Francioni, Elena; Trillo, Francesco; Minati, Federico; Margottini, Claudio; Spizzichino, Daniele; Trigila, Alessandro; Iadanza, Carla
2017-04-01
Archaeological sites and cultural heritage are considered as critical assets for the society, representing not only the history of region or a culture, but also contributing to create a common identity of people living in a certain region. In this view, it is becoming more and more urgent to preserve them from climate changes effect and in general from their degradation. These structures are usually just as precious as fragile: remote sensing technology can be useful to monitor these treasures. In this work, we will focus on ground deformation measurements obtained by satellite SAR interferometry and on the methodology adopted and implemented in order to use the results operatively for conservation policies in a Italian archaeological site. The analysis is based on the processing of COSMO-SkyMed Himage data by the e-GEOS proprietary Persistent Scatterer Pair (PSP) SAR interferometry technology. The PSP technique is a proven SAR interferometry technology characterized by the fact of exploiting in the processing only the relative properties between close points (pairs) in order to overcome atmospheric artefacts (which are one of the main problems of SAR interferometry). Validations analyses [Costantini et al. 2015] settled that this technique applied to COSMO-SkyMed Himage data is able to retrieve very dense (except of course on vegetated or cultivated areas) millimetric deformation measurements with sub-metric localization. Considering the limitations of all the interferometric techniques, in particular the fact that the measurement are along the line of sight (LOS) and the geometric distortions, in order to obtain the maximum information from interferometric analysis, both ascending and descending geometry have been used. The ascending analysis allows selecting measurements points over the top and, approximately, South-West part of the structures, while the descending one over the top and the South-East part of the structures. The interferometric techniques needs to use a stack of SAR images to separate the deformation phase contributions from other spurious components (atmospheric, orbital, etc.). Historical/reference analyses of the period 2011-2014 have been performed to obtain such deformations and to have a start point for the next updates. In fact, starting from the reference analyses the deformation monitoring has then continued with monthly updates of the PSP analysis with new COSMO-SkyMed acquisitions both in ascending and descending geometry. In addition to this traditional monitoring service, the satellite interferometry analysis has been realized over specific time frame that have been selected on the bases of some important events (damages to structures, collapses, works etc.) and the analysis have been correlated with additional site information as weather conditions, critical meteorological events, historical information of the site, etc. The objective is to find a nominal behaviour of the site in response to critical events and/or related to natural degradation of infrastructures in order to prevent damages and guide maintenance activities. The first results of this cross correlated analysis showed that some deformation phenomena are identifiable by SAR satellite interferometric analysis and it has also been possible to validate them on field through a direct survey.
Single-Molecule FISH Reveals Non-selective Packaging of Rift Valley Fever Virus Genome Segments
Wichgers Schreur, Paul J.; Kortekaas, Jeroen
2016-01-01
The bunyavirus genome comprises a small (S), medium (M), and large (L) RNA segment of negative polarity. Although genome segmentation confers evolutionary advantages by enabling genome reassortment events with related viruses, genome segmentation also complicates genome replication and packaging. Accumulating evidence suggests that genomes of viruses with eight or more genome segments are incorporated into virions by highly selective processes. Remarkably, little is known about the genome packaging process of the tri-segmented bunyaviruses. Here, we evaluated, by single-molecule RNA fluorescence in situ hybridization (FISH), the intracellular spatio-temporal distribution and replication kinetics of the Rift Valley fever virus (RVFV) genome and determined the segment composition of mature virions. The results reveal that the RVFV genome segments start to replicate near the site of infection before spreading and replicating throughout the cytoplasm followed by translocation to the virion assembly site at the Golgi network. Despite the average intracellular S, M and L genome segments approached a 1:1:1 ratio, major differences in genome segment ratios were observed among cells. We also observed a significant amount of cells lacking evidence of M-segment replication. Analysis of two-segmented replicons and four-segmented viruses subsequently confirmed the previous notion that Golgi recruitment is mediated by the Gn glycoprotein. The absence of colocalization of the different segments in the cytoplasm and the successful rescue of a tri-segmented variant with a codon shuffled M-segment suggested that inter-segment interactions are unlikely to drive the copackaging of the different segments into a single virion. The latter was confirmed by direct visualization of RNPs inside mature virions which showed that the majority of virions lack one or more genome segments. Altogether, this study suggests that RVFV genome packaging is a non-selective process. PMID:27548280
Cao, Yan; Zhou, Hongcang; Jiang, Wu; Chen, Chien-Wei; Pan, Wei-Ping
2010-05-01
The formation of sulfur trioxide (SO(3)) in coal-fired utility boilers can have negative effects on boiler performance and operation, such as fouling and corrosion of equipment, efficiency loss in the air preheater (APH), increase in stack opacity, and the formation of PM(2.5). Sulfur trioxide can also compete with mercury when bonding with injected activated carbons. Tests in a lab-scale reactor confirmed there are major interferences between fly ash and SO(3) during SO(3) sampling. A modified SO(3) procedure to maximize the elimination of measurement biases, based on the inertial-filter-sampling and the selective-condensation-collecting of SO(3), was applied in SO(3) tests in three full-scale utility boilers. For the two units burning bituminous coal, SO(3) levels starting at 20 to 25 ppmv at the inlet to the selective catalytic reduction (SCR), increased slightly across the SCR, owing to catalytic conversion of SO(2) to SO(3,) and then declined in other air pollutant control device (APCD) modules downstream to approximately 5 ppmv and 15 ppmv at the two sites, respectively. In the unit burning sub-bituminous coal, the much lower initial concentration of SO(3) estimated to be approximately 1.5 ppmv at the inlet to the SCR was reduced to about 0.8 ppmv across the SCR and to about 0.3 ppmv at the exit of the wet flue gas desulfurization (WFGD). The SO(3) removal efficiency across the WFGD scrubbers at the three sites was generally 35% or less. Reductions in SO(3) across either the APH or the dry electrostatic precipitator (ESP) in units burning high-sulfur bituminous coal were attributed to operating temperatures being below the dew point of SO(3).
Protein-ligand docking with multiple flexible side chains
NASA Astrophysics Data System (ADS)
Zhao, Yong; Sanner, Michel F.
2008-09-01
In this work, we validate and analyze the results of previously published cross docking experiments and classify failed dockings based on the conformational changes observed in the receptors. We show that a majority of failed experiments (i.e. 25 out of 33, involving four different receptors: cAPK, CDK2, Ricin and HIVp) are due to conformational changes in side chains near the active site. For these cases, we identify the side chains to be made flexible during docking calculation by superimposing receptors and analyzing steric overlap between various ligands and receptor side chains. We demonstrate that allowing these side chains to assume rotameric conformations enables the successful cross docking of 19 complexes (ligand all atom RMSD < 2.0 Å) using our docking software FLIPDock. The number of side receptor side chains interacting with a ligand can vary according to the ligand's size and shape. Hence, when starting from a complex with a particular ligand one might have to extend the region of potential interacting side chains beyond the ones interacting with the known ligand. We discuss distance-based methods for selecting additional side chains in the neighborhood of the known active site. We show that while using the molecular surface to grow the neighborhood is more efficient than Euclidian-distance selection, the number of side chains selected by these methods often remains too large and additional methods for reducing their count are needed. Despite these difficulties, using geometric constraints obtained from the network of bonded and non-bonded interactions to rank residues and allowing the top ranked side chains to be flexible during docking makes 22 out of 25 complexes successful.
Computational Support for Technology- Investment Decisions
NASA Technical Reports Server (NTRS)
Adumitroaie, Virgil; Hua, Hook; Lincoln, William; Block, Gary; Mrozinski, Joseph; Shelton, Kacie; Weisbin, Charles; Elfes, Alberto; Smith, Jeffrey
2007-01-01
Strategic Assessment of Risk and Technology (START) is a user-friendly computer program that assists human managers in making decisions regarding research-and-development investment portfolios in the presence of uncertainties and of non-technological constraints that include budgetary and time limits, restrictions related to infrastructure, and programmatic and institutional priorities. START facilitates quantitative analysis of technologies, capabilities, missions, scenarios and programs, and thereby enables the selection and scheduling of value-optimal development efforts. START incorporates features that, variously, perform or support a unique combination of functions, most of which are not systematically performed or supported by prior decision- support software. These functions include the following: Optimal portfolio selection using an expected-utility-based assessment of capabilities and technologies; Temporal investment recommendations; Distinctions between enhancing and enabling capabilities; Analysis of partial funding for enhancing capabilities; and Sensitivity and uncertainty analysis. START can run on almost any computing hardware, within Linux and related operating systems that include Mac OS X versions 10.3 and later, and can run in Windows under the Cygwin environment. START can be distributed in binary code form. START calls, as external libraries, several open-source software packages. Output is in Excel (.xls) file format.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giri, U; Sarkar, B; Kaur, H
Purpose: To choose appropriate gantry starting angle for partial left breast irradiation using volumetric modulated arc therapy (VMAT). Methods: A random patient of left breast carcinoma was selected for this study. The slice which was selected for this mathematical formulation was having maximum breast thickness and maximum medial and lateral tangential distance. After this appropriate isocenter was chosen on that CT slice. The distances between various points were measured by the measuring tool in Monaco 5.00.04. Using the various trigonometric equations, a final equation was derived which shows the relationship between Gantry start angle, isocenter Location and tissue thickness. Results:more » The final equation for gantry start for right medial tangential arc is given asStarting angle = 270°+tan^(−1)(sin(θ)/(x-1/x-2 +cosθ))The above equation was tested for 10 cases and it was found to be appropriate for all the cases. Conclusion: Gantry starting angle for partial arc irradiation depends upon Breast thickness, Distance between Medial and lateral tangent and isocenter location.« less
You, Qi; Yan, Hengyu; Liu, Yue; Yi, Xin; Zhang, Kang; Xu, Wenying; Su, Zhen
2017-05-01
The 22-nucleotide non-coding microRNAs (miRNAs) are mostly transcribed by RNA polymerase II and are similar to protein-coding genes. Unlike the clear process from stem-loop precursors to mature miRNAs, the primary transcriptional regulation of miRNA, especially in plants, still needs to be further clarified, including the original transcription start site, functional cis-elements and primary transcript structures. Due to several well-characterized transcription signals in the promoter region, we proposed a systemic approach integrating multidimensional "omics" (including genomics, transcriptomics, and epigenomics) data to improve the genome-wide identification of primary miRNA transcripts. Here, we used the model plant Arabidopsis thaliana to improve the ability to identify candidate promoter locations in intergenic miRNAs and to determine rules for identifying primary transcription start sites of miRNAs by integrating high-throughput omics data, such as the DNase I hypersensitive sites, chromatin immunoprecipitation-sequencing of polymerase II and H3K4me3, as well as high throughput transcriptomic data. As a result, 93% of refined primary transcripts could be confirmed by the primer pairs from a previous study. Cis-element and secondary structure analyses also supported the feasibility of our results. This work will contribute to the primary transcriptional regulatory analysis of miRNAs, and the conserved regulatory pattern may be a suitable miRNA characteristic in other plant species.
1982-06-01
start/stop chiller optimization , and demand limiting were added. The system monitors a 7,000 ton chiller plant and controls 74 air handlers. The EMCS does...Modify analog limits. g. Adjust setpoints of selected controllers. h. Select manual or automatic control modes. i. Enable and disable individual points...or event schedules and controller setpoints ; make nonscheduled starts and stops of equipment or disable field panels when required for routine
Is part-night lighting an effective measure to limit the impacts of artificial lighting on bats?
Azam, Clémentine; Kerbiriou, Christian; Vernet, Arthur; Julien, Jean-François; Bas, Yves; Plichard, Laura; Maratrat, Julie; Le Viol, Isabelle
2015-12-01
As light pollution is currently considered to be a major threat to biodiversity, different lighting management options are being explored to mitigate the impact of artificial lighting on wildlife. Although part-night lighting schemes have been adopted by many local authorities across Europe to reduce the carbon footprint and save energy, their effects on biodiversity are unknown. Through a paired, in situ experiment, we compared the activity levels of 8 bat species under unlit, part-night, and full-night lighting treatments in a rural area located 60 km south of Paris, France. We selected 36 study locations composed of 1 lit site and a paired unlit control site; 24 of these sites were located in areas subject to part-night lighting schemes, and 12 sites were in areas under standard, full-night lighting. There was significantly more activity on part-night lighting sites compared to full-night lighting sites for the late-emerging, light-sensitive Plecotus spp., and a similar pattern was observable for Myotis spp., although not significant. In contrast, part-night lighting did not influence the activity of early emerging bat species around streetlights, except for Pipistrellus pipistrellus for which there was significantly less activity on part-night lighting sites than on full-night lighting sites. Overall, no significant difference in activity between part- and full-night lighting sites were observed in 5 of the 8 species studied, suggesting that current part-night lighting schemes fail to encompass the range of activity of most bat species. We recommend that such schemes start earlier at night to effectively mitigate the adverse effects of artificial lighting on light-sensitive species, particularly along ecological corridors that are especially important to the persistence of biodiversity in urban landscapes. © 2015 John Wiley & Sons Ltd.
Describing Willow Flycatcher habitats: scale perspectives and gender differences
Sedgwick, James A.; Knopf, Fritz L.
1992-01-01
We compared habitat characteristics of nest sites (female-selected sites) and song perch sites (male-selected sites) with those of sites unused by Willow Flycatchers (Empidonax traillii) at three different scales of vegetation measurement: (1) microplot (central willow [Salix spp.] bush and four adjacent bushes); (2) mesoplot (0.07 ha); and, (3) macroplot (flycatcher territory size). Willow Flycatchers exhibited vegetation preferences at all three scales. Nest sites were distinguished by high willow density and low variability in willow patch size and bush height. Song perch sites were characterized by large central shrubs, low central shrub vigor, and high variability in shrub size. Unused sites were characterized by greater distances between willows and willow patches, less willow coverage, and a smaller riparian zone width than either nest or song perch sites. At all scales, nest sites were situated farther from unused sites in multivariate habitat space than were song perch sites, suggesting (1) a correspondence among scales in their ability to describe Willow Flycatcher habitat, and (2) females are more discriminating in habitat selection than males. Microhabitat differences between male-selected (song perch) and female-selected (nest) sites were evident at the two smaller scales; at the finest scale, the segregation in habitat space between male-selected and female-selected sites was greater than that between male-selected and unused sites. Differences between song perch and nest sites were not apparent at the scale of flycatcher territory size, possibly due to inclusion of (1) both nest and song perch sites, (2) defended, but unused habitat, and/or (3) habitat outside of the territory, in larger scale analyses. The differences between nest and song perch sites at the finer scales reflect their different functions (e.g., nest concealment and microclimatic requirements vs. advertising and territorial defense, respectively), and suggest that the exclusive use of either nest or song perch sites in vegetation analyses can result in misleading, or at least incomplete, descriptions of a species' habitat. Habitat interpretations for Willow Flycatchers (and perhaps for many passerines) are a function of the gender-specific behavior of the birds observed and the scale of vegetation measurement.
Amide-Directed Photoredox Catalyzed C-C Bond Formation at Unactivated sp3 C-H Bonds
Chu, John C. K.; Rovis, Tomislav
2017-01-01
Carbon-carbon (C-C) bond formation is paramount in the synthesis of biologically relevant molecules, modern synthetic materials and commodity chemicals such as fuels and lubricants. Traditionally, the presence of a functional group is required at the site of C-C bond formation. Strategies that allow C-C bond formation at inert carbon-hydrogen (C-H) bonds allow scientists to access molecules which would otherwise be inaccessible and to develop more efficient syntheses of complex molecules.1,2 Herein we report a method for the formation of C-C bonds by directed cleavage of traditionally non-reactive C-H bonds and their subsequent coupling with readily available alkenes. Our methodology allows for the selective C-C bond formation at single C-H bonds in molecules that contain a multitude of seemingly indifferentiable such bonds. Selectivity arises through a relayed photoredox catalyzed oxidation of an N-H bond. We anticipate our findings to serve as a starting point for functionalization at inert C-H bonds through a hydrogen atom transfer strategy. PMID:27732580
DOE Office of Scientific and Technical Information (OSTI.GOV)
Friberg, Anders; Vigil, Dominico; Zhao, Bin
2012-12-17
Myeloid cell leukemia 1 (Mcl-1), a member of the Bcl-2 family of proteins, is overexpressed and amplified in various cancers and promotes the aberrant survival of tumor cells that otherwise would undergo apoptosis. Here we describe the discovery of potent and selective Mcl-1 inhibitors using fragment-based methods and structure-based design. NMR-based screening of a large fragment library identified two chemically distinct hit series that bind to different sites on Mcl-1. Members of the two fragment classes were merged together to produce lead compounds that bind to Mcl-1 with a dissociation constant of <100 nM with selectivity for Mcl-1 over Bcl-xLmore » and Bcl-2. Structures of merged compounds when complexed to Mcl-1 were obtained by X-ray crystallography and provide detailed information about the molecular recognition of small-molecule ligands binding Mcl-1. The compounds represent starting points for the discovery of clinically useful Mcl-1 inhibitors for the treatment of a wide variety of cancers.« less
Evaluation of free to grow: head start partnerships to promote substance-free communities.
Wolfson, Mark; Champion, Heather; Rogers, Todd; Neiberg, Rebecca H; Barker, Dianne C; Talton, Jennifer W; Ip, Edward H; D'Agostino, Ralph B; Parries, Maria T; Easterling, Doug
2011-04-01
Free to Grow: Head Start Partnerships to Promote Substance-free Communities (FTG) was a national initiative in which local Head Start (HS) agencies, in partnership with other community organizations, implemented a mix of evidence-based family-strengthening and community-strengthening strategies. The evaluation of FTG used a quasi-experimental design to compare 14 communities that participated in the FTG intervention with 14 matched comparison communities. Telephone surveys were conducted with two cohorts of the primary caregivers of children in HS at baseline and then annually for 2 years. The survey was also administered to repeated cross-sectional samples of primary caregivers of young children who were not enrolled in HS. No consistent evidence was found in changes in family functioning or neighborhood conditions when the 14 FTG sites were compared to 14 matched sites. However, caregivers of young children who were not in HS in three high-implementing FTG sites showed evidence of improvements in neighborhood organization, neighborhood norms against substance abuse, and child disciplinary practices. Results provide highly limited support for the concept that family and neighborhood conditions that are likely to affect child development and well-being can be changed through organized efforts implemented by local HS programs.
Nordborg, Magnus; Innan, Hideki
2003-01-01
A stochastic model for the genealogy of a sample of recombining sequences containing one or more sites subject to selection in a subdivided population is described. Selection is incorporated by dividing the population into allelic classes and then conditioning on the past sizes of these classes. The past allele frequencies at the selected sites are thus treated as parameters rather than as random variables. The purpose of the model is not to investigate the dynamics of selection, but to investigate effects of linkage to the selected sites on the genealogy of the surrounding chromosomal region. This approach is useful for modeling strong selection, when it is natural to parameterize the past allele frequencies at the selected sites. Several models of strong balancing selection are used as examples, and the effects on the pattern of neutral polymorphism in the chromosomal region are discussed. We focus in particular on the statistical power to detect balancing selection when it is present. PMID:12663556
Nordborg, Magnus; Innan, Hideki
2003-03-01
A stochastic model for the genealogy of a sample of recombining sequences containing one or more sites subject to selection in a subdivided population is described. Selection is incorporated by dividing the population into allelic classes and then conditioning on the past sizes of these classes. The past allele frequencies at the selected sites are thus treated as parameters rather than as random variables. The purpose of the model is not to investigate the dynamics of selection, but to investigate effects of linkage to the selected sites on the genealogy of the surrounding chromosomal region. This approach is useful for modeling strong selection, when it is natural to parameterize the past allele frequencies at the selected sites. Several models of strong balancing selection are used as examples, and the effects on the pattern of neutral polymorphism in the chromosomal region are discussed. We focus in particular on the statistical power to detect balancing selection when it is present.
Development of an Independent Global Land Cover Validation Dataset
NASA Astrophysics Data System (ADS)
Sulla-Menashe, D. J.; Olofsson, P.; Woodcock, C. E.; Holden, C.; Metcalfe, M.; Friedl, M. A.; Stehman, S. V.; Herold, M.; Giri, C.
2012-12-01
Accurate information related to the global distribution and dynamics in global land cover is critical for a large number of global change science questions. A growing number of land cover products have been produced at regional to global scales, but the uncertainty in these products and the relative strengths and weaknesses among available products are poorly characterized. To address this limitation we are compiling a database of high spatial resolution imagery to support international land cover validation studies. Validation sites were selected based on a probability sample, and may therefore be used to estimate statistically defensible accuracy statistics and associated standard errors. Validation site locations were identified using a stratified random design based on 21 strata derived from an intersection of Koppen climate classes and a population density layer. In this way, the two major sources of global variation in land cover (climate and human activity) are explicitly included in the stratification scheme. At each site we are acquiring high spatial resolution (< 1-m) satellite imagery for 5-km x 5-km blocks. The response design uses an object-oriented hierarchical legend that is compatible with the UN FAO Land Cover Classification System. Using this response design, we are classifying each site using a semi-automated algorithm that blends image segmentation with a supervised RandomForest classification algorithm. In the long run, the validation site database is designed to support international efforts to validate land cover products. To illustrate, we use the site database to validate the MODIS Collection 4 Land Cover product, providing a prototype for validating the VIIRS Surface Type Intermediate Product scheduled to start operational production early in 2013. As part of our analysis we evaluate sources of error in coarse resolution products including semantic issues related to the class definitions, mixed pixels, and poor spectral separation between classes.
Dombernowsky, Tilde; Haedersdal, Merete; Lassen, Ulrik; Thomsen, Simon F
2017-06-01
Clinical trial allocation in multinational pharmaceutical companies includes country selection and site selection. With emphasis on site selection, the overall aim of this study was to examine which factors pharmaceutical companies value most when allocating clinical trials. The specific aims were (1) to identify key decision makers during country and site selection, respectively, (2) to evaluate by which parameters subsidiaries are primarily assessed by headquarters with regard to conducting clinical trials, and (3) to evaluate which site-related qualities companies value most when selecting trial sites. Eleven semistructured interviews were conducted among employees engaged in trial allocation at 11 pharmaceutical companies. The interviews were analyzed by deductive content analysis, which included coding of data to a categorization matrix containing categories of site-related qualities. The results suggest that headquarters and regional departments are key decision makers during country selection, whereas subsidiaries decide on site selection. Study participants argued that headquarters primarily value timely patient recruitment and quality of data when assessing subsidiaries. The site-related qualities most commonly emphasized during interviews were study population availability, timely patient recruitment, resources at the site, and site personnel's interest and commitment. Costs of running the trials were described as less important. Site personnel experience in conducting trials was described as valuable but not imperative. In conclusion, multinational pharmaceutical companies consider recruitment-related factors as crucial when allocating clinical trials. Quality of data and site personnel's interest and commitment are also essential, whereas costs seem less important. While valued, site personnel experience in conducting clinical trials is not imperative.
Eighty routes to a ribonucleotide world; dispersion and stringency in the decisive selection.
Yarus, Michael
2018-05-21
We examine the initial emergence of genetics; that is, of an inherited chemical capability. The crucial actors are ribonucleotides, occasionally meeting in a prebiotic landscape. Previous work identified six influential variables during such random ribonucleotide pooling. Geochemical pools can be in periodic danger (e.g., from tides) or constant danger (e.g., from unfavorable weather). Such pools receive Gaussian nucleotide amounts sporadically, at random times, or get varying substrates simultaneously. Pools use cross-templated RNA synthesis (5'-5' product from 5'-3' template) or para-templated (5'-5' product from 5'-5' template) synthesis. Pools can undergo mild or strong selection, and be recently initiated (early) or late in age. Considering > 80 combinations of these variables, selection calculations identify a superior route. Most likely, an early, sporadically fed, cross-templating pool in constant danger, receiving ≥ 1 mM nucleotides while under strong selection for a coenzyme-like product will host selection of the first encoded biochemical functions. Predominantly templated products emerge from a critical event, the starting bloc selection, which exploits inevitable differences among early pools. Favorable selection has a simple rationale; it is increased by product dispersion (sd/mean), by selection intensity (mild or strong), or by combining these factors as stringency, reciprocal fraction of pools selected (1/sfsel). To summarize: chance utility, acting via a preference for disperse, templated coenzyme-like dinucleotides, uses stringent starting bloc selection to quickly establish majority encoded/genetic expression. Despite its computational origin, starting bloc selection is largely independent of specialized assumptions. This ribodinucleotide route to inheritance may also have facilitated 5'-3' chemical RNA replication. Published by Cold Spring Harbor Laboratory Press for the RNA Society.
32 CFR 644.22 - Site selection.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 32 National Defense 4 2010-07-01 2010-07-01 true Site selection. 644.22 Section 644.22 National... HANDBOOK Project Planning Military (army and Air Force) and Other Federal Agencies § 644.22 Site selection... selection will be the primary responsibility of the using service. A representative of the appropriate...
Estimates of External Validity Bias When Impact Evaluations Select Sites Nonrandomly
ERIC Educational Resources Information Center
Bell, Stephen H.; Olsen, Robert B.; Orr, Larry L.; Stuart, Elizabeth A.
2016-01-01
Evaluations of educational programs or interventions are typically conducted in nonrandomly selected samples of schools or districts. Recent research has shown that nonrandom site selection can yield biased impact estimates. To estimate the external validity bias from nonrandom site selection, we combine lists of school districts that were…
ERIC Educational Resources Information Center
Wisconsin Early Childhood Association, Madison.
A collection of 26 fact sheets on child care administration produced by the Wisconsin Child Care Improvement Project from 1986 through 1989 is presented. Individual fact sheets concern: national trends, center start-up, family day care start-up, site and facility acquisition, public funding, effective center operation, reporting of child abuse and…
The Home Visit as a Teaching Event: Lessons from Eight Even Start Family Literacy Sites.
ERIC Educational Resources Information Center
Roth, Jeffrey
Family literacy programs have arisen in an attempt to break the cycle of intergenerational poverty and illiteracy. Numerous federally-supported family literacy programs have recognized the importance of instructing parents and children in a home setting. The legislation of Even Start seeks to integrate parenting education, adult basic education,…
ERIC Educational Resources Information Center
Bernstein, V.J.; Harris, E.J.; Long, C.W.; Iida, E.; Hans, S.L.
2005-01-01
A national, multi-site study of behavioral health services integration developed a parent-child interaction assessment tool and culturally anchored videotape protocol. Representatives from programs serving Chinese, Native American, Latin-American, African-American, and Anglo-American families discussed cross-cultural issues in parenting and…
Mapping Cancer Cells’ Starting Lines | Center for Cancer Research
Many of the defective regulatory pathways that lead to aberrant proliferation in cancer converge on DNA replication. So replication regulatory pathways could be targeted to more specifically kill cancer cells. Unfortunately such targeting would require knowing where and when DNA replication starts in the cancer genome. In yeast, the locations of replication initiation sites
Automated training site selection for large-area remote-sensing image analysis
NASA Astrophysics Data System (ADS)
McCaffrey, Thomas M.; Franklin, Steven E.
1993-11-01
A computer program is presented to select training sites automatically from remotely sensed digital imagery. The basic ideas are to guide the image analyst through the process of selecting typical and representative areas for large-area image classifications by minimizing bias, and to provide an initial list of potential classes for which training sites are required to develop a classification scheme or to verify classification accuracy. Reducing subjectivity in training site selection is achieved by using a purely statistical selection of homogeneous sites which then can be compared to field knowledge, aerial photography, or other remote-sensing imagery and ancillary data to arrive at a final selection of sites to be used to train the classification decision rules. The selection of the homogeneous sites uses simple tests based on the coefficient of variance, the F-statistic, and the Student's i-statistic. Comparisons of site means are conducted with a linear growing list of previously located homogeneous pixels. The program supports a common pixel-interleaved digital image format and has been tested on aerial and satellite optical imagery. The program is coded efficiently in the C programming language and was developed under AIX-Unix on an IBM RISC 6000 24-bit color workstation.
Directing reaction pathways by catalyst active-site selection using self-assembled monolayers.
Pang, Simon H; Schoenbaum, Carolyn A; Schwartz, Daniel K; Medlin, J Will
2013-01-01
One key route for controlling reaction selectivity in heterogeneous catalysis is to prepare catalysts that exhibit only specific types of sites required for desired product formation. Here we show that alkanethiolate self-assembled monolayers with varying surface densities can be used to tune selectivity to desired hydrogenation and hydrodeoxygenation products during the reaction of furfural on supported palladium catalysts. Vibrational spectroscopic studies demonstrate that the selectivity improvement is achieved by controlling the availability of specific sites for the hydrogenation of furfural on supported palladium catalysts through the selection of an appropriate alkanethiolate. Increasing self-assembled monolayer density by controlling the steric bulk of the organic tail ligand restricts adsorption on terrace sites and dramatically increases selectivity to desired products furfuryl alcohol and methylfuran. This technique of active-site selection simultaneously serves both to enhance selectivity and provide insight into the reaction mechanism.
2017-01-01
The pulvinar complex is interconnected extensively with brain regions involved in spatial processing and eye movement control. Recent inactivation studies have shown that the dorsal pulvinar (dPul) plays a role in saccade target selection; however, it remains unknown whether it exerts effects on visual processing or at planning/execution stages. We used electrical microstimulation of the dPul while monkeys performed saccade tasks toward instructed and freely chosen targets. Timing of stimulation was varied, starting before, at, or after onset of target(s). Stimulation affected saccade properties and target selection in a time-dependent manner. Stimulation starting before but overlapping with target onset shortened saccadic reaction times (RTs) for ipsiversive (to the stimulation site) target locations, whereas stimulation starting at and after target onset caused systematic delays for both ipsiversive and contraversive locations. Similarly, stimulation starting before the onset of bilateral targets increased ipsiversive target choices, whereas stimulation after target onset increased contraversive choices. Properties of dPul neurons and stimulation effects were consistent with an overall contraversive drive, with varying outcomes contingent upon behavioral demands. RT and choice effects were largely congruent in the visually-guided task, but stimulation during memory-guided saccades, while influencing RTs and errors, did not affect choice behavior. Together, these results show that the dPul plays a primary role in action planning as opposed to visual processing, that it exerts its strongest influence on spatial choices when decision and action are temporally close, and that this choice effect can be dissociated from motor effects on saccade initiation and execution. SIGNIFICANCE STATEMENT Despite a recent surge of interest, the core function of the pulvinar, the largest thalamic complex in primates, remains elusive. This understanding is crucial given the central role of the pulvinar in current theories of integrative brain functions supporting cognition and goal-directed behaviors, but electrophysiological and causal interference studies of dorsal pulvinar (dPul) are rare. Building on our previous studies that pharmacologically suppressed dPul activity for several hours, here we used transient electrical microstimulation at different periods while monkeys performed instructed and choice eye movement tasks, to determine time-specific contributions of pulvinar to saccade generation and decision making. We show that stimulation effects depend on timing and behavioral state and that effects on choices can be dissociated from motor effects. PMID:28119401
Nusse, R; Theunissen, H; Wagenaar, E; Rijsewijk, F; Gennissen, A; Otte, A; Schuuring, E; van Ooyen, A
1990-01-01
Wnt-1 (int-1) is a cellular oncogene often activated by insertion of proviral DNA of the mouse mammary tumor virus. We have mapped the 5' end and the promoter area of the Wnt-1 gene by nuclease protection and primer extension assays. In differentiating P19 embryonal carcinoma cells, in which Wnt-1 is naturally expressed, two start sites of transcription were found, one preceded by two TATA boxes and one preceded by several GC boxes. In P19 cells, a 1-kilobase upstream sequence of Wnt-1 was able to confer differentiation-specific expression on a heterologous gene. We have investigated how Wnt-1 transcription was affected by mouse mammary tumor virus proviral integrations in various configurations near the promoters of the gene. One provirus has been inserted in the 5' nontranslated part of Wnt-1, in the same transcriptional orientation, and has functionally replaced the Wnt-1 promoters. Wnt-1 transcription in this tumor starts in the right long terminal repeat of the provirus, with considerable readthrough transcription from the left long terminal repeat. Another provirus has been inserted in the orientation opposite that of Wnt-1 into a GC box, disrupting the first Wnt-1 transcription start site but not the downstream start site. Most insertions have not structurally altered the Wnt-1 transcripts and have enhanced the activity of the normal two promoters. Images PMID:1695322
Identifying Nonprovider Factors Affecting Pediatric Emergency Medicine Provider Efficiency.
Saleh, Fareed; Breslin, Kristen; Mullan, Paul C; Tillett, Zachary; Chamberlain, James M
2017-10-31
The aim of this study was to create a multivariable model of standardized relative value units per hour by adjusting for nonprovider factors that influence efficiency. We obtained productivity data based on billing records measured in emergency relative value units for (1) both evaluation and management of visits and (2) procedures for 16 pediatric emergency medicine providers with more than 750 hours worked per year. Eligible shifts were in an urban, academic pediatric emergency department (ED) with 2 sites: a tertiary care main campus and a satellite community site. We used multivariable linear regression to adjust for the impact of shift and pediatric ED characteristics on individual-provider efficiency and then removed variables from the model with minimal effect on productivity. There were 2998 eligible shifts for the 16 providers during a 3-year period. The resulting model included 4 variables when looking at both ED sites combined. These variables include the following: (1) number of procedures billed by provider, (2) season of the year, (3) shift start time, and (4) day of week. Results were improved when we separately modeled each ED location. A 3-variable model using procedures billed by provider, shift start time, and season explained 23% of the variation in provider efficiency at the academic ED site. A 3-variable model using procedures billed by provider, patient arrivals per hour, and shift start time explained 45% of the variation in provider efficiency at the satellite ED site. Several nonprovider factors affect provider efficiency. These factors should be considered when designing productivity-based incentives.
E-ELT Site Chosen - World's Biggest Eye on the Sky to be Located on Armazones, Chile
NASA Astrophysics Data System (ADS)
2010-04-01
On 26 April 2010, the ESO Council selected Cerro Armazones as the baseline site for the planned 42-metre European Extremely Large Telescope (E-ELT). Cerro Armazones is a mountain at an altitude of 3060 metres in the central part of Chile's Atacama Desert, some 130 kilometres south of the town of Antofagasta and about 20 kilometres from Cerro Paranal, home of ESO's Very Large Telescope. "This is an important milestone that allows us to finalise the baseline design of this very ambitious project, which will vastly advance astronomical knowledge," says Tim de Zeeuw, ESO's Director General. "I thank the site selection team for the tremendous work they have done over the past few years." ESO's next step is to build a European extremely large optical/infrared telescope (E-ELT) with a primary mirror 42 metres in diameter. The E-ELT will be "the world's biggest eye on the sky" - the only such telescope in the world. ESO is drawing up detailed construction plans together with the community. The E-ELT will address many of the most pressing unsolved questions in astronomy, and may, eventually, revolutionise our perception of the Universe, much as Galileo's telescope did 400 years ago. The final go-ahead for construction is expected at the end of 2010, with the start of operations planned for 2018. The decision on the E-ELT site was taken by the ESO Council, which is the governing body of the Organisation composed of representatives of ESO's fourteen Member States, and is based on an extensive comparative meteorological investigation, which lasted several years. The majority of the data collected during the site selection campaigns will be made public in the course of the year 2010. Various factors needed to be considered in the site selection process. Obviously the "astronomical quality" of the atmosphere, for instance, the number of clear nights, the amount of water vapour, and the "stability" of the atmosphere (also known as seeing) played a crucial role. But other parameters had to be taken into account as well, such as the costs of construction and operations, and the operational and scientific synergy with other major facilities (VLT/VLTI, VISTA, VST, ALMA and SKA etc). In March 2010, the ESO Council was provided with a preliminary report with the main conclusions from the E-ELT Site Selection Advisory Committee [1]. These conclusions confirmed that all the sites examined in the final shortlist (Armazones, Ventarrones, Tolonchar and Vizcachas in Chile, and La Palma in Spain) have very good conditions for astronomical observing, each one with its particular strengths. The technical report concluded that Cerro Armazones, near Paranal, stands out as the clearly preferred site, because it has the best balance of sky quality for all the factors considered and can be operated in an integrated fashion with ESO's Paranal Observatory. Cerro Armazones and Paranal share the same ideal conditions for astronomical observations. In particular, over 320 nights are clear per year. Taking into account the very clear recommendation of the Site Selection Advisory Committee and all other relevant aspects, especially the scientific quality of the site, Council has now endorsed the choice of Cerro Armazones as the E-ELT baseline site [2]. "Adding the transformational scientific capabilities of the E-ELT to the already tremendously powerful integrated VLT observatory guarantees the long-term future of Paranal as the most advanced optical/infrared observatory in the world and further strengthens ESO's position as the world-leading organisation for ground-based astronomy," says de Zeeuw. In anticipation of the choice of Cerro Armazones as the future site of the E-ELT and to facilitate and support the project, the Chilean Government has agreed to donate to ESO a substantial tract of land contiguous to ESO's Paranal property and containing Armazones in order to ensure the continued protection of the site against all adverse influences, in particular light pollution and mining activities. Notes [1] The independent E-ELT Site Selection Advisory Committee (SSAC) has been analysing results from several possible sites worldwide in great detail. Similar efforts have been carried out by the Thirty-Meter Telescope (TMT) site selection team from the US. For the sake of efficiency, the sites pre-selected by the TMT team (all in North and South America) were not studied by the SSAC, as the TMT team shared their data with the SSAC. Two of the sites on the SSAC short list, including Armazones, were on the TMT list. [2] The full ESO Council Resolution reads as follow: Resolution of ESO Council on the Baseline Site for the E-ELT Recognising * the very clear recommendation from the Site Selection Advisory Committee that the E-ELT should be located on Cerro Armazones in Northern Chile * the considerable scientific synergy that would result between the E-ELT and future facilities in the Southern Hemisphere, most notably ALMA and SKA * the operational and scientific synergies with Paranal that would result and expressing its warmest appreciation for * the very generous offers from Spain and Chile to host the E-ELT * the very considerable contributions to the quality and depth of the discussion on the siting of the E-ELT made by Chile and Spain in the course of developing their offers; Council has concluded that the overriding driver for the decision on the location of the E-ELT should be the scientific quality of the site. The scientific qualities of Cerro Armazones and the positive impact that locating the E-ELT there will have on the future scientific leadership of ESO are sufficiently compelling to outweigh the very substantial offer made by Spain. Council has therefore resolved to approve the recommendation of the Director General to adopt Cerro Armazones in Chile as the baseline site for the E-ELT. Council noted that this decision is essential for the completion of the construction proposal for decision at a later date. More information ESO, the European Southern Observatory, is the foremost intergovernmental astronomy organisation in Europe and the world's most productive astronomical observatory. It is supported by 14 countries: Austria, Belgium, the Czech Republic, Denmark, France, Finland, Germany, Italy, the Netherlands, Portugal, Spain, Sweden, Switzerland and the United Kingdom. ESO carries out an ambitious programme focused on the design, construction and operation of powerful ground-based observing facilities enabling astronomers to make important scientific discoveries. ESO also plays a leading role in promoting and organising cooperation in astronomical research. ESO operates three unique world-class observing sites in Chile: La Silla, Paranal and Chajnantor. At Paranal, ESO operates the Very Large Telescope, the world's most advanced visible-light astronomical observatory and VISTA, the world's largest survey telescope. ESO is the European partner of a revolutionary astronomical telescope ALMA, the largest astronomical project in existence.
Daneman, Nick; Campitelli, Michael A.; Giannakeas, Vasily; Morris, Andrew M.; Bell, Chaim M.; Maxwell, Colleen J.; Jeffs, Lianne; Austin, Peter C.; Bronskill, Susan E.
2017-01-01
BACKGROUND: Understanding the extent to which current antibiotic prescribing behaviour is influenced by clinicians’ historical patterns of practice will help target interventions to optimize antibiotic use in long-term care. Our objective was to evaluate whether clinicians’ historical prescribing behaviours influence the start, prolongation and class selection for treatment with antibiotics in residents of long-term care facilities. METHODS: We conducted a retrospective cohort study of all physicians who prescribed to residents in long-term care facilities in Ontario between Jan. 1 and Dec. 31, 2014. We examined variability in antibiotic prescribing among physicians for 3 measures: start of treatment with antibiotics, use of prolonged durations exceeding 7 days and selection of fluoroquinolones. Funnel plots with control limits were used to determine the extent of variation and characterize physicians as extreme low, low, average, high and extreme high prescribers for each tendency. Multivariable logistic regression was used to assess whether a clinician’s prescribing tendency in the previous year predicted current prescribing patterns, after accounting for residents’ demographics, comorbidity, functional status and indwelling devices. RESULTS: Among 1695 long-term care physicians, who prescribed for 93 132 residents, there was wide variability in the start of antibiotic treatment (median 45% of patients, interquartile range [IQR] 32%–55%), use of prolonged treatment durations (median 30% of antibiotic prescriptions, IQR 19%–46%) and selection of fluoroquinolones (median 27% of antibiotic prescriptions, IQR 18%–37%). Prescribing tendencies for antibiotics by physicians in 2014 correlated strongly with tendencies in the previous year. After controlling for individual resident characteristics, prior prescribing tendency was a significant predictor of current practice. INTERPRETATION: Physicians prescribing antibiotics exhibited individual, measurable and historical tendencies toward start of antibiotic treatment, use of prolonged treatment duration and class selection. Prescriber audit and feedback may be a promising tool to optimize antibiotic use in long-term care facilities. PMID:28652480
Daneman, Nick; Campitelli, Michael A; Giannakeas, Vasily; Morris, Andrew M; Bell, Chaim M; Maxwell, Colleen J; Jeffs, Lianne; Austin, Peter C; Bronskill, Susan E
2017-06-26
Understanding the extent to which current antibiotic prescribing behaviour is influenced by clinicians' historical patterns of practice will help target interventions to optimize antibiotic use in long-term care. Our objective was to evaluate whether clinicians' historical prescribing behaviours influence the start, prolongation and class selection for treatment with antibiotics in residents of long-term care facilities. We conducted a retrospective cohort study of all physicians who prescribed to residents in long-term care facilities in Ontario between Jan. 1 and Dec. 31, 2014. We examined variability in antibiotic prescribing among physicians for 3 measures: start of treatment with antibiotics, use of prolonged durations exceeding 7 days and selection of fluoroquinolones. Funnel plots with control limits were used to determine the extent of variation and characterize physicians as extreme low, low, average, high and extreme high prescribers for each tendency. Multivariable logistic regression was used to assess whether a clinician's prescribing tendency in the previous year predicted current prescribing patterns, after accounting for residents' demographics, comorbidity, functional status and indwelling devices. Among 1695 long-term care physicians, who prescribed for 93 132 residents, there was wide variability in the start of antibiotic treatment (median 45% of patients, interquartile range [IQR] 32%-55%), use of prolonged treatment durations (median 30% of antibiotic prescriptions, IQR 19%-46%) and selection of fluoroquinolones (median 27% of antibiotic prescriptions, IQR 18%-37%). Prescribing tendencies for antibiotics by physicians in 2014 correlated strongly with tendencies in the previous year. After controlling for individual resident characteristics, prior prescribing tendency was a significant predictor of current practice. Physicians prescribing antibiotics exhibited individual, measurable and historical tendencies toward start of antibiotic treatment, use of prolonged treatment duration and class selection. Prescriber audit and feedback may be a promising tool to optimize antibiotic use in long-term care facilities. © 2017 Canadian Medical Association or its licensors.
Comanzo, Holly Ann; Setlur, Anant Achyut; Srivastava, Alok Mani
2006-04-04
Europium-activated phosphors comprise oxides of at least a rare-earth metal selected from the group consisting of gadolinium, yttrium, lanthanum, and combinations thereof and at least a Group-IIIB metal selected from the group consisting of aluminum, gallium, indium, and combinations thereof. A method for making such phosphors comprises adding at least a halide of at least one of the selected Group-IIIB metals in a starting mixture. The method further comprises firing the starting mixture in an oxygen-containing atmosphere. The phosphors produced by such a method exhibit improved absorption in the UV wavelength range and improved quantum efficiency.
Comanzo, Holly Ann; Setlur, Anant Achyut; Srivastava, Alok Mani; Manivannan, Venkatesan
2004-07-13
Europium-activated phosphors comprise oxides of at least a rare-earth metal selected from the group consisting of gadolinium, yttrium, lanthanum, and combinations thereof and at least a Group-IIIB metal selected from the group consisting of aluminum, gallium, indium, and combinations thereof. A method for making such phosphors comprises adding at least a halide of at least one of the selected Group-IIIB metals in a starting mixture. The method further comprises firing the starting mixture in an oxygen-containing atmosphere. The phosphors produced by such a method exhibit improved absorption in the UV wavelength range and improved quantum efficiency.
[Application and development of free composite tissue flap in plastic surgery].
Lu, Kaihua; Han, Yan; Guo, Shuzhong
2007-09-01
To summarize and review the development and experience of anastomosis vascular pedicle free composite tissue flap. From July 1987 to March 2007, 321 patients with complete records were treated. Fourteen tissue flaps were applied for the repair of trauma or tumor excision defects of the body, and for organ reconstruction. Vascular crisis occurred in 20 patients within 48 hours postoperatively. Necrosis occurred at flap end in 6 patients. The total survival rate was 94.8%. The main experience was: (1) Training to grasp the basic micro-vascular anastomosis technique was very important starting up period for surgeons. The basic technique should be often practiced to ensure the safty of clinical application. (2) Restoring appearance and function were equally important in practice. (3) Utilizing the minimal invasive methods and decreasing the loss of function of donor site were important for improvement of reconstruction quality. The purpose was to achieve functional and esthetic restoration in the condition of lowest donor site scarification. The application of free composite tissue flap is important for the development of plastic surgery. There are extensive applications for free flap, especially for those critical patients. The application of free flap could decrease the mobility rate, shorten the treatment period, ease the pain of patients and improve the reconstruction effect. The experience of donor site selection, the strategy of poor recipient site condition, the advantages and disadvantages of muscle flap, the applications time, infections wound treatment and application, are helpful for the future application.
Moskvin, Oleg V; Bolotin, Dmitry; Wang, Andrew; Ivanov, Pavel S; Gomelsky, Mark
2011-02-01
We present Rhodobase, a web-based meta-analytical tool for analysis of transcriptional regulation in a model anoxygenic photosynthetic bacterium, Rhodobacter sphaeroides. The gene association meta-analysis is based on the pooled data from 100 of R. sphaeroides whole-genome DNA microarrays. Gene-centric regulatory networks were visualized using the StarNet approach (Jupiter, D.C., VanBuren, V., 2008. A visual data mining tool that facilitates reconstruction of transcription regulatory networks. PLoS ONE 3, e1717) with several modifications. We developed a means to identify and visualize operons and superoperons. We designed a framework for the cross-genome search for transcription factor binding sites that takes into account high GC-content and oligonucleotide usage profile characteristic of the R. sphaeroides genome. To facilitate reconstruction of directional relationships between co-regulated genes, we screened upstream sequences (-400 to +20bp from start codons) of all genes for putative binding sites of bacterial transcription factors using a self-optimizing search method developed here. To test performance of the meta-analysis tools and transcription factor site predictions, we reconstructed selected nodes of the R. sphaeroides transcription factor-centric regulatory matrix. The test revealed regulatory relationships that correlate well with the experimentally derived data. The database of transcriptional profile correlations, the network visualization engine and the optimized search engine for transcription factor binding sites analysis are available at http://rhodobase.org. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Benchmarking: applications to transfusion medicine.
Apelseth, Torunn Oveland; Molnar, Laura; Arnold, Emmy; Heddle, Nancy M
2012-10-01
Benchmarking is as a structured continuous collaborative process in which comparisons for selected indicators are used to identify factors that, when implemented, will improve transfusion practices. This study aimed to identify transfusion medicine studies reporting on benchmarking, summarize the benchmarking approaches used, and identify important considerations to move the concept of benchmarking forward in the field of transfusion medicine. A systematic review of published literature was performed to identify transfusion medicine-related studies that compared at least 2 separate institutions or regions with the intention of benchmarking focusing on 4 areas: blood utilization, safety, operational aspects, and blood donation. Forty-five studies were included: blood utilization (n = 35), safety (n = 5), operational aspects of transfusion medicine (n = 5), and blood donation (n = 0). Based on predefined criteria, 7 publications were classified as benchmarking, 2 as trending, and 36 as single-event studies. Three models of benchmarking are described: (1) a regional benchmarking program that collects and links relevant data from existing electronic sources, (2) a sentinel site model where data from a limited number of sites are collected, and (3) an institutional-initiated model where a site identifies indicators of interest and approaches other institutions. Benchmarking approaches are needed in the field of transfusion medicine. Major challenges include defining best practices and developing cost-effective methods of data collection. For those interested in initiating a benchmarking program, the sentinel site model may be most effective and sustainable as a starting point, although the regional model would be the ideal goal. Copyright © 2012 Elsevier Inc. All rights reserved.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-01-08
... Select Staffing, Oxnard, CA; CalAmp Wireless Networks Corporation (CWNC), Including On- Site Leased... Division, including on-site leased workers from Select Staffing, Oxnard, California (TA-W-80,399). The...-site leased workers from Select Staffing, Oxnard, California (TA-W-80,399) and CalAmp Wireless Networks...
Backfilling with guarantees granted upon job submission.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Leung, Vitus Joseph; Bunde, David P.; Lindsay, Alexander M.
2011-01-01
In this paper, we present scheduling algorithms that simultaneously support guaranteed starting times and favor jobs with system desired traits. To achieve the first of these goals, our algorithms keep a profile with potential starting times for every unfinished job and never move these starting times later, just as in Conservative Backfilling. To achieve the second, they exploit previously unrecognized flexibility in the handling of holes opened in this profile when jobs finish early. We find that, with one choice of job selection function, our algorithms can consistently yield a lower average waiting time than Conservative Backfilling while still providingmore » a guaranteed start time to each job as it arrives. In fact, in most cases, the algorithms give a lower average waiting time than the more aggressive EASY backfilling algorithm, which does not provide guaranteed start times. Alternately, with a different choice of job selection function, our algorithms can focus the benefit on the widest submitted jobs, the reason for the existence of parallel systems. In this case, these jobs experience significantly lower waiting time than Conservative Backfilling with minimal impact on other jobs.« less
Desert amphibian selection of arid land breeding habitat undermines reproductive effort.
Kiesow, Anja B; Griffis-Kyle, Kerry L
2017-12-01
Understanding how animals select habitat is important for understanding how to better conserve those species. As droughts become more frequent and water availability declines in many systems, understanding selection of water sources becomes even more important for conservation. Tinajas and anthropogenic catchments are critical ephemeral breeding sites for Sonoran Desert anurans. Tadpoles have been documented in both water types even though anthropogenic catchments can contain very high concentrations of ammonia. We currently do not know how amphibians are selecting breeding habitat. We tested three hypotheses of habitat selection based on resource quality, resource quality and territoriality, and proximity of water site to other water sites. Male Anaxyrus punctatus called from all sites regardless of habitat quality or male quality; however, they were found more often at sites within 2 km of other sites. This suggests that male desert anurans are selecting close breeding habitat regardless of quality for breeding, indicating ammoniated sites are likely either population sinks or ecological traps. Consequently, adding anthropogenic water sites, without managing to reduce ammonia, will provide low quality habitat that could cause long-term declines in desert anuran populations.
Sun, Long; Zhang, Guang-hui; Luan, Li-li; Li, Zhen-wei; Geng, Ren
2016-02-01
Along the 368-591 mm precipitation gradient, 7 survey sites, i.e. a total 63 investigated plots were selected. At each sites, woodland, grassland, and cropland with similar restoration age were selected to investigate soil organic carbon distribution in surface soil (0-30 cm), and the influence of factors, e.g. climate, soil depth, and land uses, on soil organic carbon distribution were analyzed. The result showed that, along the precipitation gradient, the grassland (8.70 g . kg-1) > woodland (7.88 g . kg-1) > farmland (7.73 g . kg-1) in concentration and the grassland (20.28 kg . m-2) > farmland (19.34 kg . m-2) > woodland (17.14 kg . m-2) in density. The differences of soil organic carbon concentration of three land uses were not significant. Further analysis of pooled data of three land uses showed that the surface soil organic carbon concentration differed significantly at different precipitation levels (P<0.00 1). Significant positive relationship was detected between mean annual precipitation and soil organic carbon concentration (r=0.838, P<0.001) in the of pooled data. From south to north (start from northernmost Ordos), i.e. along the 368-591 mm precipitation gradient, the soil organic carbon increased with annual precipitation 0. 04 g . kg-1 . mm-1, density 0.08 kg . m-2 . mm-1. The soil organic carbon distribution was predicted with mean annual precipitation, soil clay content, plant litter in woodland, and root density in farmland.
ERIC Educational Resources Information Center
MacNab, G. L.
This paper reviews the results of research on various programs for learning French as a second language from kindergarten to grade 11 or 12 in selected Canadian school systems. Generally, it examines the effects of a number of factors on French learning, such as student selection procedures and student ability, starting age, total amount of time…
Peer Effects on Head Start Children’s Preschool Competency
DeLay, Dawn; Hanish, Laura D.; Martin, Carol Lynn; Fabes, Richard A.
2015-01-01
The goals of the present study were to investigate whether young children attending Head Start (N=292; Mage=4.3 years) selected peers based on their preschool competency and whether children’s levels of preschool competency were influenced by their peers’ levels of preschool competency. Children’s peer interaction partners were intensively observed several times a week over one academic year. Social network analyses revealed that children selected peer interaction partners with similar levels of preschool competency and were influenced over time by their partners’ levels of preschool competency. These effects held even after controlling for several child (e.g., sex and language) and family factors (e.g., financial strain and parent education). Implications for promoting preschool competency among Head Start children are discussed. PMID:26479545
On-site cell field test support program
NASA Astrophysics Data System (ADS)
Staniunas, J. W.; Merten, G. P.
1982-09-01
Utility sites for data monitoring were reviewed and selected. Each of these sites will be instrumented and its energy requirements monitored and analyzed for one year prior to the selection of 40 Kilowatt fuel cell field test sites. Analyses in support of the selection of sites for instrumentation shows that many building sectors offered considerable market potential. These sectors include nursing home, health club, restaurant, industrial, hotel/motel and apartment.
Progress on the Cluster Mission
NASA Technical Reports Server (NTRS)
Kivelson, Margaret; Khurana, Krishan; Acuna, Mario (Technical Monitor)
2002-01-01
Prof M. G. Kivelson and Dr. K. K. Khurana (UCLA (University of California, Los Angeles)) are co-investigators on the Cluster Magnetometer Consortium (CMC) that provided the fluxgate magnetometers and associated mission support for the Cluster Mission. The CMC designated UCLA as the site with primary responsibility for the inter-calibration of data from the four spacecraft and the production of fully corrected data critical to achieving the mission objectives. UCLA will also participate in the analysis and interpretation of the data. The UCLA group here reports its excellent progress in developing fully intra-calibrated data for large portions of the mission and an excellent start in developing inter-calibrated data for selected time intervals, especially extended intervals in August, 2001 on which a workshop held at ESTEC in March, 2002 focused. In addition, some scientific investigations were initiated and results were reported at meetings.
Marking Embryonic Stem Cells with a 2A Self-Cleaving Peptide: A NKX2-5 Emerald GFP BAC Reporter
Hsiao, Edward C.; Yoshinaga, Yuko; Nguyen, Trieu D.; Musone, Stacy L.; Kim, Judy E.; Swinton, Paul; Espineda, Isidro; Manalac, Carlota; deJong, Pieter J.; Conklin, Bruce R.
2008-01-01
Background Fluorescent reporters are useful for assaying gene expression in living cells and for identifying and isolating pure cell populations from heterogeneous cultures, including embryonic stem (ES) cells. Multiple fluorophores and genetic selection markers exist; however, a system for creating reporter constructs that preserve the regulatory sequences near a gene's native ATG start site has not been widely available. Methodology Here, we describe a series of modular marker plasmids containing independent reporter, bacterial selection, and eukaryotic selection components, compatible with both Gateway recombination and lambda prophage bacterial artificial chromosome (BAC) recombineering techniques. A 2A self-cleaving peptide links the reporter to the native open reading frame. We use an emerald GFP marker cassette to create a human BAC reporter and ES cell reporter line for the early cardiac marker NKX2-5. NKX2-5 expression was detected in differentiating mouse ES cells and ES cell-derived mice. Conclusions Our results describe a NKX2-5 ES cell reporter line for studying early events in cardiomyocyte formation. The results also demonstrate that our modular marker plasmids could be used for generating reporters from unmodified BACs, potentially as part of an ES cell reporter library. PMID:18596956
Hurtado-Chong, Anahí; Joeris, Alexander; Hess, Denise; Blauth, Michael
2017-07-12
A considerable number of clinical studies experience delays, which result in increased duration and costs. In multicentre studies, patient recruitment is among the leading causes of delays. Poor site selection can result in low recruitment and bad data quality. Site selection is therefore crucial for study quality and completion, but currently no specific guidelines are available. Selection of sites adequate to participate in a prospective multicentre cohort study was performed through an open call using a newly developed objective multistep approach. The method is based on use of a network, definition of objective criteria and a systematic screening process. Out of 266 interested sites, 24 were shortlisted and finally 12 sites were selected to participate in the study. The steps in the process included an open call through a network, use of selection questionnaires tailored to the study, evaluation of responses using objective criteria and scripted telephone interviews. At each step, the number of candidate sites was quickly reduced leaving only the most promising candidates. Recruitment and quality of data went according to expectations in spite of the contracting problems faced with some sites. The results of our first experience with a standardised and objective method of site selection are encouraging. The site selection method described here can serve as a guideline for other researchers performing multicentre studies. ClinicalTrials.gov: NCT02297581. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Clark, Steven M.; Dunham, Jason B.; McEnroe, Jeffery R.; Lightcap, Scott W.
2014-01-01
The fitness of female Pacific salmon (Oncorhynchus spp.) with respect to breeding behavior can be partitioned into at least four fitness components: survival to reproduction, competition for breeding sites, success of egg incubation, and suitability of the local environment near breeding sites for early rearing of juveniles. We evaluated the relative influences of habitat features linked to these fitness components with respect to selection of breeding sites by coho salmon (Oncorhynchus kisutch). We also evaluated associations between breeding site selection and additions of large wood, as the latter were introduced into the study system as a means of restoring habitat conditions to benefit coho salmon. We used a model selection approach to organize specific habitat features into groupings reflecting fitness components and influences of large wood. Results of this work suggest that female coho salmon likely select breeding sites based on a wide range of habitat features linked to all four hypothesized fitness components. More specifically, model parameter estimates indicated that breeding site selection was most strongly influenced by proximity to pool-tail crests and deeper water (mean and maximum depths). Linkages between large wood and breeding site selection were less clear. Overall, our findings suggest that breeding site selection by coho salmon is influenced by a suite of fitness components in addition to the egg incubation environment, which has been the emphasis of much work in the past.
Brand, Ellen; de Nijs, Ton C M; Dijkstra, Joris J; Comans, Rob N J
2016-10-01
As part of a more circular economy, current attention on waste is shifting from landfilling towards the prevention, re-use and recycling of waste materials. Although the need for landfills is decreasing, there are many landfills around the world that are still operational or at the point of starting the aftercare period. With traditional aftercare management, these landfills require perpetual aftercare at considerable cost due to monitoring and regular maintenance of liners. In an attempt to lower these aftercare costs, and to prevent that future generations become responsible for finding a sustainable solution of present day waste, the Dutch government takes action to explore the possibilities of sustainable landfill management. A project was started to investigate whether the use of source-oriented treatment techniques (so-called active treatment) of landfills can result in a sustainable emission reduction to soil and groundwater. During the next decade, sustainable landfill management is tested at three selected pilot landfills in the Netherlands. To enable this pilot testing and to determine its success after the experimental treatment period, a new methodology and conceptual framework was developed. The aim of this paper is to describe the development of the new methodology, and in particular the policy decisions, needed to determine whether the pilot experiments will be successful. The pilot projects are considered successful when the concentrations in the leachate of the pilot landfills have sufficiently been reduced and for longer periods of time and comply with the derived site-specific Environmental Protection Criteria (EPC). In that case, aftercare can be reduced, and it can be determined whether sustainable landfill management is economically feasible for further implementation. Copyright © 2016 Elsevier Ltd. All rights reserved.
Exceptionally long 5' UTR short tandem repeats specifically linked to primates.
Namdar-Aligoodarzi, P; Mohammadparast, S; Zaker-Kandjani, B; Talebi Kakroodi, S; Jafari Vesiehsari, M; Ohadi, M
2015-09-10
We have previously reported genome-scale short tandem repeats (STRs) in the core promoter interval (i.e. -120 to +1 to the transcription start site) of protein-coding genes that have evolved identically in primates vs. non-primates. Those STRs may function as evolutionary switch codes for primate speciation. In the current study, we used the Ensembl database to analyze the 5' untranslated region (5' UTR) between +1 and +60 of the transcription start site of the entire human protein-coding genes annotated in the GeneCards database, in order to identify "exceptionally long" STRs (≥5-repeats), which may be of selective/adaptive advantage. The importance of this critical interval is its function as core promoter, and its effect on transcription and translation. In order to minimize ascertainment bias, we analyzed the evolutionary status of the human 5' UTR STRs of ≥5-repeats in several species encompassing six major orders and superorders across mammals, including primates, rodents, Scandentia, Laurasiatheria, Afrotheria, and Xenarthra. We introduce primate-specific STRs, and STRs which have expanded from mouse to primates. Identical co-occurrence of the identified STRs of rare average frequency between 0.006 and 0.0001 in primates supports a role for those motifs in processes that diverged primates from other mammals, such as neuronal differentiation (e.g. APOD and FGF4), and craniofacial development (e.g. FILIP1L). A number of the identified STRs of ≥5-repeats may be human-specific (e.g. ZMYM3 and DAZAP1). Future work is warranted to examine the importance of the listed genes in primate/human evolution, development, and disease. Copyright © 2015 Elsevier B.V. All rights reserved.
Project Developmental Continuity: Field Procedures Manual.
ERIC Educational Resources Information Center
Morris, Mary
This operations manual for field staff (site monitors, site coordinators, and testers) involved in the observation and testing of children is part of a series of documents on the evaluation of Project Developmental Continuity (PDC), a Head Start demonstration program aimed at providing educational and developmental continuity between children's…
2006-11-29
Ames and Moffett Field (MFA) historical sites and memorials Site of the John W. Whisman Home. Headquarters and stopping place of the first stagecoach line between San Jose and San Francisco. Started in early autumn of 1849. Located at R.T.Jones Road and the Ames Child Care Center fence boundary.
ERIC Educational Resources Information Center
Spencer, Lynn, Ed.
These 7 case studies are part of a series of documents on the evaluation of Project Developmental Continuity (PDC), a Head Start demonstration program aimed at providing educational and developmental continuity between children's Head Start and primary school experiences. Each case study reviews the planning year at a PDC demonstration site in one…
ERIC Educational Resources Information Center
Spencer, Lynn, Ed.
These 8 case studies are part of a series of documents on the evaluation of Project Developmental Continuity (PDC), a Head Start demonstration program aimed at providing educational and developmental continuity between children's Head Start and primary school experiences. Each case study reviews the planning year at a PDC demonstration site in one…
Case Study of a Discontinued Start-Up Engineering Program: Critical Challenges and Lessons Learned
ERIC Educational Resources Information Center
Friess, Wilhelm A.
2017-01-01
The explanatory case study presented here analyzes the factors that have contributed to the failure of a start-up engineering program launched at an off-campus site, and aimed at imparting the first two years of the BSc Mechanical, Electrical, Computer and Civil Engineering utilizing an integrated curriculum. Findings indicate the root cause for…
Control of Ion Selectivity in LeuT: Two Na+ Binding Sites with two different mechanisms
Noskov, Sergei Y.; Roux, Benoît
2016-01-01
The x-ray structure of LeuT, a bacterial homologue of Na+/Cl−-dependent neurotransmitter transporter, provides a great opportunity to better understand the molecular basis of monovalent cation selectivity in ion-coupled transporters. LeuT possesses two ion-binding sites, NA1 and NA2, which are highly selective for Na+. Extensive all-atom free energy molecular dynamics simulations of LeuT embedded in an explicit membrane are performed at different temperatures and various occupancy states of the binding sites to dissect the molecular mechanism of ion selectivity. The results show that the two binding sites display robust selectivity for Na+ over K+ or Li+, the competing ions of most similar radii. Of particular interest, the mechanism primarily responsible for selectivity for each of the two binding sites appears to be different. In site NA1, selectivity for Na+ over K+ arises predominantly from the strong electrostatic field arising from the negatively charged carboxylate group of the leucine substrate coordinating the ion directly. In site NA2, which comprises only neutral ligands, selectivity for Na+ is enforced by the local structural restraints arising from the hydrogen-bonding network and the covalent connectivity of the poly-peptide chain surrounding the ion according to a snug-fit mechanism. PMID:18280500
Are Synonymous Sites in Primates and Rodents Functionally Constrained?
Price, Nicholas; Graur, Dan
2016-01-01
It has been claimed that synonymous sites in mammals are under selective constraint. Furthermore, in many studies the selective constraint at such sites in primates was claimed to be more stringent than that in rodents. Given the larger effective population sizes in rodents than in primates, the theoretical expectation is that selection in rodents would be more effective than that in primates. To resolve this contradiction between expectations and observations, we used processed pseudogenes as a model for strict neutral evolution, and estimated selective constraint on synonymous sites using the rate of substitution at pseudosynonymous and pseudononsynonymous sites in pseudogenes as the neutral expectation. After controlling for the effects of GC content, our results were similar to those from previous studies, i.e., synonymous sites in primates exhibited evidence for higher selective constraint that those in rodents. Specifically, our results indicated that in primates up to 24% of synonymous sites could be under purifying selection, while in rodents synonymous sites evolved neutrally. To further control for shifts in GC content, we estimated selective constraint at fourfold degenerate sites using a maximum parsimony approach. This allowed us to estimate selective constraint using mutational patterns that cause a shift in GC content (GT ↔ TG, CT ↔ TC, GA ↔ AG, and CA ↔ AC) and ones that do not (AT ↔ TA and CG ↔ GC). Using this approach, we found that synonymous sites evolve neutrally in both primates and rodents. Apparent deviations from neutrality were caused by a higher rate of C → A and C → T mutations in pseudogenes. Such differences are most likely caused by the shift in GC content experienced by pseudogenes. We conclude that previous estimates according to which 20-40% of synonymous sites in primates were under selective constraint were most likely artifacts of the biased pattern of mutation.
Hot Spots on the Web for Teacher Librarians: A Selection of Recommended Web Sites for TLs To Visit.
ERIC Educational Resources Information Center
1996
Six papers review and recommend sites on the Web as resources for teacher librarians include: "Just Do It: A Guide to Getting Out There and Doing It Yourself" (Catherine Ryan); "A Selection of Recommended Web Sites for TLs To Visit" (Karen Bonanno); "A Selection of Recommended Web Sites for TLs To Visit" (Sandra…
Urban Rain Gauge Siting Selection Based on Gis-Multicriteria Analysis
NASA Astrophysics Data System (ADS)
Fu, Yanli; Jing, Changfeng; Du, Mingyi
2016-06-01
With the increasingly rapid growth of urbanization and climate change, urban rainfall monitoring as well as urban waterlogging has widely been paid attention. In the light of conventional siting selection methods do not take into consideration of geographic surroundings and spatial-temporal scale for the urban rain gauge site selection, this paper primarily aims at finding the appropriate siting selection rules and methods for rain gauge in urban area. Additionally, for optimization gauge location, a spatial decision support system (DSS) aided by geographical information system (GIS) has been developed. In terms of a series of criteria, the rain gauge optimal site-search problem can be addressed by a multicriteria decision analysis (MCDA). A series of spatial analytical techniques are required for MCDA to identify the prospective sites. With the platform of GIS, using spatial kernel density analysis can reflect the population density; GIS buffer analysis is used to optimize the location with the rain gauge signal transmission character. Experiment results show that the rules and the proposed method are proper for the rain gauge site selection in urban areas, which is significant for the siting selection of urban hydrological facilities and infrastructure, such as water gauge.
The Central and Eastern U.S. Seismic Network: Legacy of USArray
NASA Astrophysics Data System (ADS)
Eakins, J. A.; Astiz, L.; Benz, H.; Busby, R. W.; Hafner, K.; Reyes, J. C.; Sharer, G.; Vernon, F.; Woodward, R.
2014-12-01
As the USArray Transportable Array entered the central and eastern United States, several Federal agencies (National Science Foundation, U.S. Geological Survey, U.S. Nuclear Regulatory Commission, and Department of Energy) recognized the unique opportunity to retain TA stations beyond the original timeline. The mission of the CEUSN is to produce data that enables researchers and Federal agencies alike to better understand the basic geologic questions, background earthquake rates and distribution, seismic hazard potential, and associated societal risks of this region. The selected long-term sub-array from Transportable Array (TA) stations includes nearly 200 sites, complemented by 100 broadband stations from the existing regional seismic networks to form the Central and Eastern United States Network (CEUSN). Multiple criteria for site selection were weighed by an inter-agency TA Station Selection (TASS) Working Group: seismic noise characteristics, data availability in real time, proximity to nuclear power plants, and homogeneous distribution throughout the region. The Array Network Facility (ANF) started collecting data for CEUSN network stations since late 2013, with all stations collected since May 2014. Regional seismic data streams are collected in real-time from the IRIS Data Management Center (DMC). TA stations selected to be part of CEUSN, retain the broadband sensor to which a 100 sps channel is added, the infrasound and environmental channels, and, at some stations, accelerometers are deployed. The upgraded sites become part of the N4 network for which ANF provides metadata and can issue remote commands to the station equipment. Stations still operated by TA, but planned for CEUSN, are included in the virtual network so all stations are currently available now. By the end of 2015, the remaining TA stations will be upgraded. Data quality control procedures developed for TA stations at ANF and at the DMC are currently performed on N4 data. However, teleseismic and regional events are only picked a few times a month to fulfill data quality checks on the data. The assembled CEUSN data sets can be requested from the DMC with the _CEUSN virtual network code. Acknowledgments to Seismic Regional Network Operators: C. Ammon, J. Ebel, D. Doser, R. Hermann, A. Holland, W-Y. Kim, C. Langston, T. Owens, and M. Withers.
Schramm, H.L.; Gerard, P.D.; Gill, D.A.
2003-01-01
We measured the importance of 24 fishing site attributes to Mississippi freshwater anglers. Factor analysis identified four multiattribute factors as important in the selection of fishing location: CLEAN ENVIRONMENT CATCH, COST AND HARVEST and AMENITIES AND SAFETY. In general, the importance of site selection factors differed little among anglers grouped by preferred type of fish, preferred fishing location (lakes and reservoirs, rivers and streams, ponds, or reservoir tailwaters), usual manner of fishing (engine-powered boat, nonpowered boat, or shore), or change in fishing frequency. COST AND HARVEST was more important to anglers with high harvest orientations. We found low correlations between site selection factor importance scores and angler age, fishing frequency, fishing expenditures, or fishing motivation factors. We suggest that the general lack of differences in site selection factors among angler groups indicates that management strategies to improve fishing site attributes should benefit all angler groups. Clean fishing environments and awareness of the availability of desired sport fishes were "very" or "extremely" important to fishing site selection by more than 70% of Mississippi freshwater anglers and should be priority management objectives.
Damodaram, Kamala Jayanthi Pagadala; Kempraj, Vivek; Aurade, Ravindra Mahadappa; Rajasekhar, Sowmya Bandhisara; Venkataramanappa, Ravindra Kothapalli; Nandagopal, Bakthavatsalam; Verghese, Abraham
2014-01-01
Oviposition site-selection in insects is mediated through innate recognition templates (IRTs) tuned to specific chemical cues. These cues aid gravid insects in choosing suitable oviposition sites and may even enhance the fitness of their offspring by warding off predators and parasitoids. However, studies on the evolution of oviposition site-selection and cues instigating oviposition in domesticated insects remain elusive. Using the interaction between the silkmoth, Bombyx mori, and its host plant mulberry, Morus alba, as a model system, we demonstrate that centuries of domestication of silkmoth has not impaired its oviposition site-selection function. Silkmoths significantly preferred mulberry leaves to filter paper as oviposition sites. Oviposition assays with filter paper, filter paper treated with leaf volatiles and leaf alone proved that surface texture was not a significant criterion for oviposition site-selection, but volatile cues were. Oviposition assays with electrophysiologically active compounds from mulberry revealed that two of the volatiles, valencene and α-humulene, aided moths in choosing suitable oviposition sites and enhanced egg-laying significantly. Moreover, we show that generalist egg-parasitoids are strongly repelled by valencene and α-humulene. Our results demonstrate that IRTs tuned to cues that aid crucial functions like oviposition site-selection are less likely to be impaired even after centuries of domestication. PMID:25503440
Covalent bonds against magnetism in transition metal compounds
Streltsov, Sergey V.; Khomskii, Daniel I.
2016-01-01
Magnetism in transition metal compounds is usually considered starting from a description of isolated ions, as exact as possible, and treating their (exchange) interaction at a later stage. We show that this standard approach may break down in many cases, especially in 4d and 5d compounds. We argue that there is an important intersite effect—an orbital-selective formation of covalent metal–metal bonds that leads to an “exclusion” of corresponding electrons from the magnetic subsystem, and thus strongly affects magnetic properties of the system. This effect is especially prominent for noninteger electron number, when it results in suppression of the famous double exchange, the main mechanism of ferromagnetism in transition metal compounds. We study this mechanism analytically and numerically and show that it explains magnetic properties of not only several 4d–5d materials, including Nb2O2F3 and Ba5AlIr2O11, but can also be operative in 3d transition metal oxides, e.g., in CrO2 under pressure. We also discuss the role of spin–orbit coupling on the competition between covalency and magnetism. Our results demonstrate that strong intersite coupling may invalidate the standard single-site starting point for considering magnetism, and can lead to a qualitatively new behavior. PMID:27601669
Kemter, Franziska S.; Messerschmidt, Sonja J.; Schallopp, Nadine; Sobetzko, Patrick; Bunk, Boyke; Spröer, Cathrin; Teschler, Jennifer K.; Yildiz, Fitnat H.
2018-01-01
Vibrio cholerae, the causative agent of the cholera disease, is commonly used as a model organism for the study of bacteria with multipartite genomes. Its two chromosomes of different sizes initiate their DNA replication at distinct time points in the cell cycle and terminate in synchrony. In this study, the time-delayed start of Chr2 was verified in a synchronized cell population. This replication pattern suggests two possible regulation mechanisms for other Vibrio species with different sized secondary chromosomes: Either all Chr2 start DNA replication with a fixed delay after Chr1 initiation, or the timepoint at which Chr2 initiates varies such that termination of chromosomal replication occurs in synchrony. We investigated these two models and revealed that the two chromosomes of various Vibrionaceae species terminate in synchrony while Chr2-initiation timing relative to Chr1 is variable. Moreover, the sequence and function of the Chr2-triggering crtS site recently discovered in V. cholerae were found to be conserved, explaining the observed timing mechanism. Our results suggest that it is beneficial for bacterial cells with multiple chromosomes to synchronize their replication termination, potentially to optimize chromosome related processes as dimer resolution or segregation. PMID:29505558
15 CFR 921.11 - Site selection and feasibility.
Code of Federal Regulations, 2013 CFR
2013-01-01
... MANAGEMENT NATIONAL ESTUARINE RESEARCH RESERVE SYSTEM REGULATIONS Site Selection, Post Site Selection and... National Estuarine Research Reserve System. NOAA will give priority consideration to proposals to establish... of flora and fauna, and capacity to attract a broad range of research and educational interests. The...
15 CFR 921.11 - Site selection and feasibility.
Code of Federal Regulations, 2011 CFR
2011-01-01
... MANAGEMENT NATIONAL ESTUARINE RESEARCH RESERVE SYSTEM REGULATIONS Site Selection, Post Site Selection and... National Estuarine Research Reserve System. NOAA will give priority consideration to proposals to establish... of flora and fauna, and capacity to attract a broad range of research and educational interests. The...
15 CFR 921.11 - Site selection and feasibility.
Code of Federal Regulations, 2012 CFR
2012-01-01
... MANAGEMENT NATIONAL ESTUARINE RESEARCH RESERVE SYSTEM REGULATIONS Site Selection, Post Site Selection and... National Estuarine Research Reserve System. NOAA will give priority consideration to proposals to establish... of flora and fauna, and capacity to attract a broad range of research and educational interests. The...
15 CFR 921.11 - Site selection and feasibility.
Code of Federal Regulations, 2014 CFR
2014-01-01
... MANAGEMENT NATIONAL ESTUARINE RESEARCH RESERVE SYSTEM REGULATIONS Site Selection, Post Site Selection and... National Estuarine Research Reserve System. NOAA will give priority consideration to proposals to establish... of flora and fauna, and capacity to attract a broad range of research and educational interests. The...
Code of Federal Regulations, 2011 CFR
2011-01-01
... ESTUARINE RESEARCH RESERVE SYSTEM REGULATIONS Site Selection, Post Site Selection and Management Plan... of site selection, preparation of documents specified in § 921.13 (draft management plan (DMP) and... recovered as a result of damage to natural resources located in the coastal zone, such assistance may be...
Code of Federal Regulations, 2010 CFR
2010-01-01
... ESTUARINE RESEARCH RESERVE SYSTEM REGULATIONS Site Selection, Post Site Selection and Management Plan... of site selection, preparation of documents specified in § 921.13 (draft management plan (DMP) and... recovered as a result of damage to natural resources located in the coastal zone, such assistance may be...
Fortier, Sylvie; Basset, Fabien A.; Mbourou, Ginette A.; Favérial, Jérôme; Teasdale, Normand
2005-01-01
The purpose of this study was twofold: (a) to examine if kinetic and kinematic parameters of the sprint start could differentiate elite from sub-elite sprinters and, (b) to investigate whether providing feedback (FB) about selected parameters could improve starting block performance of intermediate sprinters over a 6-week training period. Twelve male sprinters, assigned to an elite or a sub-elite group, participated in Experiment 1. Eight intermediate sprinters participated in Experiment 2. All athletes were required to perform three sprint starts at maximum intensity followed by a 10-m run. To detect differences between elite and sub-elite groups, comparisons were made using t-tests for independent samples. Parameters reaching a significant group difference were retained for the linear discriminant analysis (LDA). The LDA yielded four discriminative kinetic parameters. Feedback about these selected parameters was given to sprinters in Experiment 2. For this experiment, data acquisition was divided into three periods. The first six sessions were without specific FB, whereas the following six sessions were enriched by kinetic FB. Finally, athletes underwent a retention session (without FB) 4 weeks after the twelfth session. Even though differences were found in the time to front peak force, the time to rear peak force, and the front peak force in the retention session, the results of the present study showed that providing FB about selected kinetic parameters differentiating elite from sub-elite sprinters did not improve the starting block performance of intermediate sprinters. Key Points The linear discriminative analysis allows the identification of starting block parameters differentiating elite from sub-elite athletes. 6-week of feedback does not alter starting block performance in training context. The present results failed to confirm previous studies since feedback did not improve targeted kinetic parameters of the complex motor task in real-world context. PMID:24431969
Fortier, Sylvie; Basset, Fabien A; Mbourou, Ginette A; Favérial, Jérôme; Teasdale, Normand
2005-06-01
(a) to examine if kinetic and kinematic parameters of the sprint start could differentiate elite from sub-elite sprinters and, (b) to investigate whether providing feedback (FB) about selected parameters could improve starting block performance of intermediate sprinters over a 6-week training period. Twelve male sprinters, assigned to an elite or a sub-elite group, participated in Experiment 1. Eight intermediate sprinters participated in Experiment 2. All athletes were required to perform three sprint starts at maximum intensity followed by a 10-m run. To detect differences between elite and sub-elite groups, comparisons were made using t-tests for independent samples. Parameters reaching a significant group difference were retained for the linear discriminant analysis (LDA). The LDA yielded four discriminative kinetic parameters. Feedback about these selected parameters was given to sprinters in Experiment 2. For this experiment, data acquisition was divided into three periods. The first six sessions were without specific FB, whereas the following six sessions were enriched by kinetic FB. Finally, athletes underwent a retention session (without FB) 4 weeks after the twelfth session. Even though differences were found in the time to front peak force, the time to rear peak force, and the front peak force in the retention session, the results of the present study showed that providing FB about selected kinetic parameters differentiating elite from sub-elite sprinters did not improve the starting block performance of intermediate sprinters. Key PointsThe linear discriminative analysis allows the identification of starting block parameters differentiating elite from sub-elite athletes.6-week of feedback does not alter starting block performance in training context.The present results failed to confirm previous studies since feedback did not improve targeted kinetic parameters of the complex motor task in real-world context.
A Phenotypic Screen for Functional Mutants of Human Adenosine Deaminase Acting on RNA 1.
Wang, Yuru; Havel, Jocelyn; Beal, Peter A
2015-11-20
Adenosine deaminases acting on RNA (ADARs) are RNA-editing enzymes responsible for the conversion of adenosine to inosine at specific locations in cellular RNAs. ADAR1 and ADAR2 are two members of the family that have been shown to be catalytically active. Earlier, we reported a phenotypic screen for the study of human ADAR2 using budding yeast S. cerevisiae as the host system. While this screen has been successfully applied to the study of ADAR2, it failed with ADAR1. Here, we report a new reporter that uses a novel editing substrate and is suitable for the study of ADAR1. We screened plasmid libraries with randomized codons for two important residues in human ADAR1 (G1007 and E1008). The screening results combined with in vitro deamination assays led to the identification of mutants that are more active than the wild type protein. Furthermore, a screen of the ADAR1 E1008X library with a reporter construct bearing an A•G mismatch at the editing site suggests one role for the residue at position 1008 is to sense the identity of the base pairing partner for the editing site adenosine. This work has provided a starting point for future in vitro evolution studies of ADAR1 and led to new insight into ADAR's editing site selectivity.
Structural imprints in vivo decode RNA regulatory mechanisms.
Spitale, Robert C; Flynn, Ryan A; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y; Batista, Pedro J; Torre, Eduardo A; Kool, Eric T; Chang, Howard Y
2015-03-26
Visualizing the physical basis for molecular behaviour inside living cells is a great challenge for biology. RNAs are central to biological regulation, and the ability of RNA to adopt specific structures intimately controls every step of the gene expression program. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles include only two of the four nucleotides that make up RNA. Here we present a novel biochemical approach, in vivo click selective 2'-hydroxyl acylation and profiling experiment (icSHAPE), which enables the first global view, to our knowledge, of RNA secondary structures in living cells for all four bases. icSHAPE of the mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguish different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro conditions, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA-binding proteins or RNA-modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N(6)-methyladenosine (m(6)A) modification genome wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression.
Fluorophore Labeled Kinase Detects Ligands That Bind within the MAPK Insert of p38α Kinase
Termathe, Martin; Grütter, Christian; Rabiller, Matthias; van Otterlo, Willem A. L.; Rauh, Daniel
2012-01-01
The vast majority of small molecules known to modulate kinase activity, target the highly conserved ATP-pocket. Consequently, such ligands are often less specific and in case of inhibitors, this leads to the inhibition of multiple kinases. Thus, selective modulation of kinase function remains a major hurdle. One of the next great challenges in kinase research is the identification of ligands which bind to less conserved sites and target the non-catalytic functions of protein kinases. However, approaches that allow for the unambiguous identification of molecules that bind to these less conserved sites are few in number. We have previously reported the use of fluorescent labels in kinases (FLiK) to develop direct kinase binding assays that exclusively detect ligands which stabilize inactive (DFG-out) kinase conformations. Here, we present the successful application of the FLiK approach to develop a high-throughput binding assay capable of directly monitoring ligand binding to a remote site within the MAPK insert of p38α mitogen-activated protein kinase (MAPK). Guided by the crystal structure of an initially identified hit molecule in complex with p38α, we developed a tight binding ligand which may serve as an ideal starting point for further investigations of the biological function of the MAPK insert in regulating the p38α signaling pathway. PMID:22768308
Kurcinski, Mateusz; Jamroz, Michal; Blaszczyk, Maciej; Kolinski, Andrzej; Kmiecik, Sebastian
2015-07-01
Protein-peptide interactions play a key role in cell functions. Their structural characterization, though challenging, is important for the discovery of new drugs. The CABS-dock web server provides an interface for modeling protein-peptide interactions using a highly efficient protocol for the flexible docking of peptides to proteins. While other docking algorithms require pre-defined localization of the binding site, CABS-dock does not require such knowledge. Given a protein receptor structure and a peptide sequence (and starting from random conformations and positions of the peptide), CABS-dock performs simulation search for the binding site allowing for full flexibility of the peptide and small fluctuations of the receptor backbone. This protocol was extensively tested over the largest dataset of non-redundant protein-peptide interactions available to date (including bound and unbound docking cases). For over 80% of bound and unbound dataset cases, we obtained models with high or medium accuracy (sufficient for practical applications). Additionally, as optional features, CABS-dock can exclude user-selected binding modes from docking search or to increase the level of flexibility for chosen receptor fragments. CABS-dock is freely available as a web server at http://biocomp.chem.uw.edu.pl/CABSdock. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schriner, J.E.; Yi, W.; Hofmann, S.L.
Palmitoyl-protein thioesterase (PPT) is a small glycoprotein that removes palmitate groups from cysteine residues in lipid-modified proteins. We recently reported mutations in PPT in patients with infantile neuronal ceroid lipofuscinosis (INCL), a severe neurodegenerative disorder. INCL is characterized by the accumulation of proteolipid storage material in brain and other tissues, suggesting that the disease is a consequence of abnormal catabolism of acylated proteins. In the current paper, we report the sequence of the human PPT cDNA and the structure of the human PPT gene. The cDNA predicts a protein of 306 amino acids that contains a 25-amino-acid signal peptide, threemore » N-linked glycosylation sites, and consensus motifs characteristic of thioesterases. Northern analysis of a human tissue blot revealed ubiquitous expression of a single 2.5-kb mRNA, with highest expression in lung, brain, and heart. The human PPT gene spans 25 kb and is composed of seven coding exons and a large eighth exon, containing the entire 3{prime}-untranslated region of 1388 bp. An Alu repeat and promoter elements corresponding to putative binding sites for several general transcription factors were identified in the 1060 nucleotides upstream of the transcription start site. The human PPT cDNA sequence and gene structure will provide the means for the identification of further causative mutations in INCL and facilitate genetic screening in selected high-risk populations. 31 refs., 5 figs., 1 tab.« less
What software tools can I use to view ERBE HDF data products?
Atmospheric Science Data Center
2014-12-08
Visualize ERBE data with view_hdf: view_hdf a visualization and analysis tool for accessing data stored in Hierarchical Data Format (HDF) and HDF-EOS. ... Start HDFView Select File Select Open Select the file to be viewed ERBE: Data Access ...
NASA Astrophysics Data System (ADS)
Mohammed, Habiba Ibrahim; Majid, Zulkepli; Yusof, Norhakim Bin; Bello Yamusa, Yamusa
2018-03-01
Landfilling remains the most common systematic technique of solid waste disposal in most of the developed and developing countries. Finding a suitable site for landfill is a very challenging task. Landfill site selection process aims to provide suitable areas that will protect the environment and public health from pollution and hazards. Therefore, various factors such as environmental, physical, socio-economic, and geological criteria must be considered before siting any landfill. This makes the site selection process vigorous and tedious because it involves the processing of large amount of spatial data, rules and regulations from different agencies and also policy from decision makers. This allows the incorporation of conflicting objectives and decision maker preferences into spatial decision models. This paper particularly analyzes the multi-criteria evaluation (MCE) method of landfill site selection for solid waste management by means of literature reviews and surveys. The study will help the decision makers and waste management authorities to choose the most effective method when considering landfill site selection.
Using athletic training clinical education standards in radiography.
Giordano, Shelley; Harris, Katherine
2012-01-01
The selection of clinical education sites for radiography students is based on availability, access to radiographic examinations, and appropriate student-to-technologist ratio. Radiography program directors are not required to evaluate sites based on their educational validity (eg, the clinical instructor's knowledge of basic teaching and learning principles, how well the site communicates with the program, or the clinical instructor's involvement in professional organizations). The purpose of this study was to determine if a set of 12 clinical education standards used in athletic training would be applicable and beneficial to radiography program directors when selecting clinical sites for students. A survey concerning the applicability of the athletic training standards to radiography site selection was completed by 270 directors of radiography programs accredited by the Joint Review Committee on Education in Radiologic Technology. The survey results indicated the athletic training clinical education standards were considered applicable to the selection of clinical sites for radiography students and would be beneficial to radiography program directors when selecting sites.
Dermol, Urška; Kontić, Branko
2011-01-01
The benefits of strategic environmental considerations in the process of siting a repository for low- and intermediate-level radioactive waste (LILW) are presented. The benefits have been explored by analyzing differences between the two site selection processes. One is a so-called official site selection process, which is implemented by the Agency for radwaste management (ARAO); the other is an optimization process suggested by experts working in the area of environmental impact assessment (EIA) and land-use (spatial) planning. The criteria on which the comparison of the results of the two site selection processes has been based are spatial organization, environmental impact, safety in terms of potential exposure of the population to radioactivity released from the repository, and feasibility of the repository from the technical, financial/economic and social point of view (the latter relates to consent by the local community for siting the repository). The site selection processes have been compared with the support of the decision expert system named DEX. The results of the comparison indicate that the sites selected by ARAO meet fewer suitability criteria than those identified by applying strategic environmental considerations in the framework of the optimization process. This result stands when taking into account spatial, environmental, safety and technical feasibility points of view. Acceptability of a site by a local community could not have been tested, since the formal site selection process has not yet been concluded; this remains as an uncertain and open point of the comparison. Copyright © 2010 Elsevier Ltd. All rights reserved.
Eucalyptus Energy Farm: feasibility study and demonstration. Phase 1: site and species selection
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mariani, E.O.; Wood, W.A.; Kouchoukos, P.C.
1978-06-01
The results of investigations to determine the feasibility for establishing ''Eucalyptus Energy Farms'' as a potential source of biomass derived energy are presented. Included in this report are: the results of an extensive literature search and numerous field interviews (both domestically and internationally) to identify those Eucalyptus species most suitable for use within the United States; a description of the site selection criteria, site selection process, and identification of potential sites for use in testing the Eucalyptus Energy Farm concept; a description of the Eucalyptus species selection criteria, species selection process, and an identification of the specific species recommended formore » testing at specific sites; preliminary engineering designs for each of the proposed plantation sites; and environmental impact considerations related to Eucalyptus growing. It is concluded that although the Eucalyptus are extremely temperature sensitive and the geographic areas which appear suitable for their planting (within the United States) are principally confined to western and central California and the warmest regions of the southeastern United States, each of the areas contain large amounts of marginal land which could be converted into Eucalyptus based biomass plantations. Suitable sites, which are representative of the larger marginal land areas, are immediately available for use in establishing Eucalyptus screening test sites. Furthermore, there are not significant environmental conditions which would preclude the establishment of these initial test sites. It is therefore recommended that efforts be initiated to obtain selected provenances of Eucalyptus seeds (of the designated species) for further field testing and data collection within the United States, and that actual site selection be initiated.« less
Electronic damping of anharmonic adsorbate vibrations at metallic surfaces
NASA Astrophysics Data System (ADS)
Tremblay, Jean Christophe; Monturet, Serge; Saalfrank, Peter
2010-03-01
The nonadiabatic coupling of an adsorbate close to a metallic surface leads to electronic damping of adsorbate vibrations and line broadening in vibrational spectroscopy. Here, a perturbative treatment of the electronic contribution to the lifetime broadening serves as a building block for a new approach, in which anharmonic vibrational transition rates are calculated from a position-dependent coupling function. Different models for the coupling function will be tested, all related to embedding theory. The first two are models based on a scattering approach with (i) a jellium-type and (ii) a density functional theory based embedding density, respectively. In a third variant a further refined model is used for the embedding density, and a semiempirical approach is taken in which a scaling factor is chosen to match harmonic, single-site, first-principles transition rates, obtained from periodic density functional theory. For the example of hydrogen atoms on (adsorption) and below (subsurface absorption) a Pd(111) surface, lifetimes of and transition rates between vibrational levels are computed. The transition rates emerging from different models serve as input for the selective subsurface adsorption of hydrogen in palladium starting from an adsorption site, by using sequences of infrared laser pulses in a laser distillation scheme.
Nevada Test Site-Directed Research, Development, and Demonstration. FY2005 report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lewis, Will
2006-09-01
The Nevada Test Site-Directed Research, Development, and Demonstration (SDRD) program completed a very successful year of research and development activities in FY 2005. Fifty new projects were selected for funding this year, and five FY 2004 projects were brought to conclusion. The total funds expended by the SDRD program were $5.4 million, for an average per project cost of just under $100,000. Two external audits of SDRD accounting practices were conducted in FY 2005. Both audits found the program's accounting practices consistent with the requirements of DOE Order 413.2A, and one included the observation that the NTS contractor ''did anmore » exceptional job in planning and executing year-start activities.'' Highlights for the year included: the filing of 18 invention disclosures for intellectual property generated by FY 2005 projects; programmatic adoption of 17 FY 2004 SDRD-developed technologies; participation in the tri-lab Laboratory Directed Research and Development (LDRD) and SDRD program review that was broadly attended by NTS, NNSA, LDRD, and U.S. Department of Homeland Security representatives; peer reviews of all FY 2005 projects; and the successful completion of 55 R&D projects, as presented in this report.« less
CAGEd-oPOSSUM: motif enrichment analysis from CAGE-derived TSSs.
Arenillas, David J; Forrest, Alistair R R; Kawaji, Hideya; Lassmann, Timo; Wasserman, Wyeth W; Mathelier, Anthony
2016-09-15
With the emergence of large-scale Cap Analysis of Gene Expression (CAGE) datasets from individual labs and the FANTOM consortium, one can now analyze the cis-regulatory regions associated with gene transcription at an unprecedented level of refinement. By coupling transcription factor binding site (TFBS) enrichment analysis with CAGE-derived genomic regions, CAGEd-oPOSSUM can identify TFs that act as key regulators of genes involved in specific mammalian cell and tissue types. The webtool allows for the analysis of CAGE-derived transcription start sites (TSSs) either provided by the user or selected from ∼1300 mammalian samples from the FANTOM5 project with pre-computed TFBS predicted with JASPAR TF binding profiles. The tool helps power insights into the regulation of genes through the study of the specific usage of TSSs within specific cell types and/or under specific conditions. The CAGEd-oPOSUM web tool is implemented in Perl, MySQL and Apache and is available at http://cagedop.cmmt.ubc.ca/CAGEd_oPOSSUM CONTACTS: anthony.mathelier@ncmm.uio.no or wyeth@cmmt.ubc.ca Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.
Shaw, L J; Shipley, J; Newell, E L; Harris, N; Clinch, J G; Lovell, C R
2013-07-01
Localized scleroderma is a rare but potentially disfiguring and disabling condition. Systemic treatment should be started early in those with active disease in key functional and cosmetic sites, but disease activity is difficult to determine clinically. Superficial blood flow has been shown to correlate with disease activity in localized scleroderma. To examine whether superficial blood flow measured by laser Doppler imaging (LDI) has the potential to predict disease progression and therefore select patients for early systemic treatment. A group of 20 individuals had clinical assessment and scanning LDI blood-flow measurements of 32 affected body sites. After a mean follow-up of 8.7 months their clinical outcome was compared with the results of the initial LDI assessment. Eleven out of 15 patients with an assessment of active LDI had progressed clinically, and 16 out of the 17 scans with inactive LDI assessment had not progressed, giving a positive predictive value of 73% and a negative predictive value of 94%. We believe that LDI can be a useful tool in predicting disease progression in localized scleroderma, and it may help clinicians to decide which patients to treat early. © 2013 The Authors BJD © 2013 British Association of Dermatologists.
Sang, Zhipei; Wang, Keren; Wang, Huifang; Yu, Lintao; Wang, Huijuan; Ma, Qianwen; Ye, Mengyao; Han, Xue; Liu, Wenmin
2017-11-15
A series of novel phthalimide-alkylamine derivatives were synthesized and evaluated as multi-functions inhibitors for the treatment of Alzheimer's disease (AD). The results showed that compound TM-9 could be regarded as a balanced multi-targets active molecule. It exhibited potent and balanced inhibitory activities against ChE and MAO-B (huAChE, huBuChE, and huMAO-B with IC 50 values of 1.2μM, 3.8μM and 2.6 μM, respectively) with low selectivity. Both kinetic analysis of AChE inhibition and molecular modeling study suggested that TM-9 binds simultaneously to the catalytic active site and peripheral anionic site of AChE. Interestingly, compound TM-9 abided by Lipinski's rule of five. Furthermore, our investigation proved that TM-9 indicated weak cytotoxicity, and it could cross the blood-brain barrier (BBB) in vitro. The results suggest that compound TM-9, an interesting multi-targeted active molecule, offers an attractive starting point for further lead optimization in the drug-discovery process against Alzheimer's disease. Copyright © 2017 Elsevier Ltd. All rights reserved.
CAGEd-oPOSSUM: motif enrichment analysis from CAGE-derived TSSs
Arenillas, David J.; Forrest, Alistair R. R.; Kawaji, Hideya; Lassmann, Timo; Wasserman, Wyeth W.; Mathelier, Anthony
2016-01-01
With the emergence of large-scale Cap Analysis of Gene Expression (CAGE) datasets from individual labs and the FANTOM consortium, one can now analyze the cis-regulatory regions associated with gene transcription at an unprecedented level of refinement. By coupling transcription factor binding site (TFBS) enrichment analysis with CAGE-derived genomic regions, CAGEd-oPOSSUM can identify TFs that act as key regulators of genes involved in specific mammalian cell and tissue types. The webtool allows for the analysis of CAGE-derived transcription start sites (TSSs) either provided by the user or selected from ∼1300 mammalian samples from the FANTOM5 project with pre-computed TFBS predicted with JASPAR TF binding profiles. The tool helps power insights into the regulation of genes through the study of the specific usage of TSSs within specific cell types and/or under specific conditions. Availability and Implementation: The CAGEd-oPOSUM web tool is implemented in Perl, MySQL and Apache and is available at http://cagedop.cmmt.ubc.ca/CAGEd_oPOSSUM. Contacts: anthony.mathelier@ncmm.uio.no or wyeth@cmmt.ubc.ca Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27334471
NASA Astrophysics Data System (ADS)
Pierotti, Lisa; Facca, Gianluca; Gherardi, Fabrizio
2015-04-01
Since late 2002, a geochemical monitoring network is operating in Tuscany, Central Italy, to collect data and possibly identify geochemical anomalies that characteristically occur before regionally significant (i.e. with magnitude > 3) seismic events. The network currently consists of 6 stations located in areas already investigated in detail for their geological setting, hydrogeological and geochemical background and boundary conditions. All these stations are equipped for remote, continuous monitoring of selected physicochemical parameters (temperature, pH, redox potential, electrical conductivity), and dissolved concentrations of CO2 and CH4. Additional information are obtained through in situ discrete monitoring. Field surveys are periodically performed to guarantee maintenance and performance control of the sensors of the automatic stations, and to collect water samples for the determination of the chemical and stable isotope composition of all the springs investigated for seismic precursors. Geochemical continuous signals are numerically processed to remove outliers, monitoring errors and aseismic effects from seasonal and climatic fluctuations. The elaboration of smoothed, long-term time series (more than 200000 data available today for each station) allows for a relatively accurate definition of geochemical background values. Geochemical values out of the two-sigma relative standard deviation domain are inspected as possible indicators of physicochemical changes related to regional seismic activity. Starting on November 2011, four stations of the Tuscany network located in two separate mountainous areas of Northern Apennines separating Tuscany from Emilia-Romagna region (Equi Terme and Gallicano), and Tuscany from Emilia-Romagna and Umbria regions (Vicchio and Caprese Michelangelo), started to register anomalous values in pH and CO2 partial pressure (PCO2). Cross-correlation analysis indicates an apparent relationship between the most important seismic events (magnitude >3 up to 5.4) experienced in the Tuscany, Emilia-Romagna and Umbria regions during the period 2012-2014, and these geochemical anomalies. Changes in pH (decreasing) and PCO2 (increasing) are generally observed from a few months to a few weeks before the main shock. This trend has been recognized for the Parma quake of 27 January 2012 (M = 5.4), for the Pieve Fosciana quake of 13 January 2013 (M = 4.8), for the Garfagnana-Lunigiana seismic sequence started June 21, 2013 (Mmax = 5.2), for the Montefeltro seismic sequence started July 11, 2013 (Mmax = 3.9), for the Gubbio seismic sequences of July and December 2013 (Mmax = 3.9), for the Città di Castello seismic sequences of April 2013 and December 2013 (Mmax = 3.9), for the Casentino seismic sequence started October 17, 2014 (Mmax = 3.5), and for the Chianti seismic sequence started December 19, 2014 (Mmax = 4.1). These features suggest that the selected mineral springs can be considered as appropriate sites for the search of geochemical earthquake precursors. Further investigations focused on in-depth analysis of signals are currently in progress.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-02-06
...] Commercial Wind Leasing and Site Assessment Activities on the Atlantic Outer Continental Shelf Offshore... governments, offshore wind energy developers, and the public in the Department of the Interior's (DOI) ``Smart from the Start'' wind energy initiative offshore Massachusetts. The purpose of the ``Smart from the...
Energized Learning Students Lessons Bullet Getting Started Bullet Bringing It Home Bullet Unit activities with keys to subject matter standards. As students work through one or more of the standards-based Why Use the Energized Learning Site? How will teachers and Students Use the Energized Learning Site
Ocean Drilling Program: Web Site Access Statistics
and products Drilling services and tools Online Janus database Search the ODP/TAMU web site ODP's main See statistics for JOIDES members. See statistics for Janus database. 1997 October November December accessible only on www-odp.tamu.edu. ** End of ODP, start of IODP. Privacy Policy ODP | Search | Database
ERIC Educational Resources Information Center
Speakman, Sheree T.; And Others
1997-01-01
Examines the need for new financial reporting and analysis, starting with rethinking the school finance field, retooling the management information systems for school finance, and re-evaluating knowledge about school-site management, accounting, and reporting. Demonstrates a new reporting methodology, the Financial Analysis Model, that traces…
Social Network Sites: A Starting Point for Career Development Practitioners
ERIC Educational Resources Information Center
Strehlke, Christina
2010-01-01
This action research study explores the career influence of social network sites (SNSs) by examining 14 web-based articles that consider the risks and opportunities of SNSs from a job search perspective. Three themes are discussed: user visibility, self-presentation, and network connections. Practical strategies are identified to help career…
Current reversals and metastable states in the infinite Bose-Hubbard chain with local particle loss
NASA Astrophysics Data System (ADS)
Kiefer-Emmanouilidis, M.; Sirker, J.
2017-12-01
We present an algorithm which combines the quantum trajectory approach to open quantum systems with a density-matrix renormalization-group scheme for infinite one-dimensional lattice systems. We apply this method to investigate the long-time dynamics in the Bose-Hubbard model with local particle loss starting from a Mott-insulating initial state with one boson per site. While the short-time dynamics can be described even quantitatively by an equation of motion (EOM) approach at the mean-field level, many-body interactions lead to unexpected effects at intermediate and long times: local particle currents far away from the dissipative site start to reverse direction ultimately leading to a metastable state with a total particle current pointing away from the lossy site. An alternative EOM approach based on an effective fermion model shows that the reversal of currents can be understood qualitatively by the creation of holon-doublon pairs at the edge of the region of reduced particle density. The doublons are then able to escape while the holes move towards the dissipative site, a process reminiscent—in a loose sense—of Hawking radiation.
NASA Technical Reports Server (NTRS)
Schwarz, D. E.; Ellefsen, R. E.
1981-01-01
Several general guidelines should be kept in mind when considering the selection of field sites for teaching remote sensing fundamentals. Proximity and vantage point are two very practical considerations. Only through viewing a broad enough area to place the site in context can one make efficient use of a site. The effects of inclement weather when selecting sites should be considered. If field work is to be an effective tool to illustrate remote sensing principles, the following criteria are critical: (1) the site must represent the range of class interest; (2) the site must have a theme or add something no other site offers; (3) there should be intrasite variation within the theme; (4) ground resolution and spectral signature distinction should be illustrated; and (5) the sites should not be ordered sequentially.
Technical Assistance Program: Off to a Running Start (Newsletter)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
This newsletter describes key activities of the DOE Office of Indian Energy Policy and Programs for Winter 2012. Between December 2, 2011, and January 15, 2012, 46 American Indian and Alaska Native Tribes submitted applications to receive technical assistance through the program, which provides Tribes with on-the-ground technical support from DOE and National Renewable Energy Laboratory (NREL) staff to help move tribal energy efficiency and renewable energy projects forward. The applications are being considered through the Strategic Technical Assistance Response Team (START) selection process, which incorporates expert reviews and outreach to Tribes who present a need for assistance with theirmore » community-based energy efficiency and renewable energy projects. The final successful applicants will be selected based on the clarity of their requests for technical assistance and the ability of START to successfully work with each unique project or community. At least three selected Tribes in Alaska will receive technical assistance between March and May 2012, and up to five selected Tribes in the contiguous United States will receive technical assistance between March and August 2012. During the months of START Program activity, DOE and NREL experts will work in the two locations. In Alaska, START experts will work directly with community-based project teams to analyze local energy issues and provide assistance with energy projects and cost savings initiatives. This effort will be bolstered by DOE-IE's partnership with the Denali Commission, which will provide further assistance and expertise. In the lower 48 states, NREL experts will work with the selected renewable energy START projects to evaluate financial and technical feasibility and provide early development technical assistance to better position the projects for financing and construction. This on-the-ground technical assistance is part of a broader DOE-IE effort to make reliable, accurate technical information and skills-based training available to tribal communities throughout the United States. The primary goal of the START initiative, according to DOE-IE Director Tracey A. LeBeau, is to bring about the next generation of energy development in Indian Country. Through energy project planning, quality training, and technical assistance, The START program will leverage the early-stage resource characterization and pre-feasibility investments that DOE has made in Indian Country over the years, and unlock the energy resources that exist on tribal lands to help build a 21st century tribal energy economy. Working collaboratively with a select group of Tribes and Alaska Native entities, the DOE Office of Indian Energy, NREL, and the Denali Commission will empower tribal leaders to make informed energy decisions and help build capacity to bring tribal energy visions to fruition and get renewable energy projects off the ground, said LeBeau. Ultimately, these efforts will serve to further the Obama Administration and DOE's shared commitment to provide Native American and Alaska Native communities with the tools and resources they need to foster tribal energy self-sufficiency and sustainability, advancing job creation and enhancing economic competitiveness.« less
45 CFR 1311.4 - Qualifications, selection, and placement.
Code of Federal Regulations, 2013 CFR
2013-10-01
... DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION FOR CHILDREN, YOUTH AND... Start program or otherwise working in the field of child development and family services. The... with services to children and families; and (5) Other appropriate settings. (c) A Head Start Fellow who...
45 CFR 1311.4 - Qualifications, selection, and placement.
Code of Federal Regulations, 2014 CFR
2014-10-01
... DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION FOR CHILDREN, YOUTH AND... Start program or otherwise working in the field of child development and family services. The... with services to children and families; and (5) Other appropriate settings. (c) A Head Start Fellow who...
45 CFR 1311.4 - Qualifications, selection, and placement.
Code of Federal Regulations, 2012 CFR
2012-10-01
... DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION FOR CHILDREN, YOUTH AND... Start program or otherwise working in the field of child development and family services. The... with services to children and families; and (5) Other appropriate settings. (c) A Head Start Fellow who...
Wind turbine siting: A summary of the state of the art
NASA Technical Reports Server (NTRS)
Hiester, T. R.
1982-01-01
The process of siting large wind turbines may be divided into two broad steps: site selection, and site evaluation. Site selection is the process of locating windy sites where wind energy development shows promise of economic viability. Site evaluation is the process of determining in detail for a given site the economic potential of the site. The state of the art in the first aspect of siting, site selection is emphasized. Several techniques for assessing the wind resource were explored or developed in the Federal Wind Energy Program. Local topography and meteorology will determine which of the techniques should be used in locating potential sites. None of the techniques can do the job alone, none are foolproof, and all require considerable knowledge and experience to apply correctly. Therefore, efficient siting requires a strategy which is founded on broad based application of several techniques without relying solely on one narrow field of expertise.
Petrographic Analyses of Lonestones from ODP Drill Sites Leg 188 Prydz Bay, Antarctica
NASA Astrophysics Data System (ADS)
Detterman, K.; Warnke, D. A.; Richter, C.
2006-12-01
ODP Leg 188 was drilled in 2000 to sample the first advances of the Antarctic ice sheet and to document further cryospheric development. Continental shelf Site 1166 documented the earliest stages of glaciation during the Eocene-Oligocene and continental slope Site 1167 documented rapid deposition by debris flows during the Pliocene-Pleistocene and a subtle change in onshore erosion areas. Site 1165, located on the continental rise, documented long-term transition from wet-based lower Miocene glaciers to dry-based upper Miocene glaciers, including short-term fluctuations starting in the early Miocene. Source areas for all drill sites are the Lambert Glacier-Amery Ice Shelf drainage area, encompassing the Northern and Southern Prince Charles Mountains, the Gamburtsev Sub-glacial Mountains, and the Grove Mountains. Lonestones occur in most of the cores from all sites of Leg 188 prompting research for potential source areas and transportation modes of the lonestones. One-hundred and seventeen thin sections of lonestones were prepared from Sites 1166, 1167, and 1165 for petrographic analyses. Metamorphic lonestones outnumber igneous and sedimentary lonestones at all three sites. Sedimentary lonestones were not found in the thin sections of Site 1166. Extrusive igneous lonestones were found only at Site 1165 and comprised 5.1 percent of Leg 188's lithology. The anorthite content of igneous and metamorphic lonestones represented at all three sites was albite-oligoclase plagioclase. Albite oligoclase plagioclase has been documented in the Southern Prince Charles Mountains. The results of this study of a selection of lonestones from Site 1167 supports a hypothesis first proposed by the Shipboard Scientific Party in 2001 that as time elapsed, the source area for Site 1167 lonestones shifted slightly from a largely sandstone source to a largely granitic source within the drainage area. One potential source area for the Site 1167 sandstone lonestones is the Permian to Triassic Amery Group in the Beaver Lake area of the Northern Prince Charles Mountains. We hypothesize that more easily eroded portions of the sandstone outcrops were planed off first while ubiquitous gneiss and granite outcrops provided the source material for the younger debris flows at Site 1167 in the Pliocene-Pleistocene. None of all the available lonestones suggest sources other than the drainage area of the Lambert Glacier- Amery Ice Shelf complex.
THE SCHOOL SITE--ITS SELECTION, ANALYSIS, DEVELOPMENT AND MAINTENANCE.
ERIC Educational Resources Information Center
BRUNING, WALTER F.
SCHOOL ADMINISTRATORS AND COMMUNITY PLANNERS CAN AID THE SCHOOL SITE SELECTION PROCESS BY WORKING TOGETHER ON A COMMUNITY MASTER PLAN. MANY COMMUNITIES HAVE DEVELOPED SUCH A PLAN UNDER THE STATE AND FEDERALLY AIDED 701 PROGRAM. SOUND SITE SELECTION PRINCIPLES REQUIRE CONSIDERATION OF OTHER FACTORS THAN STUDENT POPULATION DISTRIBUTION. IDEALLY…
20 CFR 638.303 - Site selection and facilities management.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Site selection and facilities management. 638... Facilities Management § 638.303 Site selection and facilities management. (a) The Job Corps Director shall... center, facilities engineering and real estate management will be conducted by the Job Corps Director or...
THE ROLE OF GIS IN SELECTING SITES FOR RIPARIAN RESTORATION BASED ON HYDROLOGY AND LAND USE
Successful long-term wetland restoration efforts require consideration of hydrology and surrounding land use during the site selection process. This article describes an approach to initial site selection in the San Luis Rey River watershed in southern California that uses waters...
Federal Register 2010, 2011, 2012, 2013, 2014
2012-03-06
..., Volt Workforce Solutions and Select Staffing, Osceola, WI; Amended Certification Regarding Eligibility... recreational vehicles. The company reports that workers leased from Select Staffing were employed on-site at... Select Staffing working on-site at the Osceola, Wisconsin location of Polaris Industries. The amended...
Federal Register 2010, 2011, 2012, 2013, 2014
2010-04-19
... Ingersoll Rand Including On-Site Leased Workers From Aerotek, Express Personnel Services, Select Staffing... Ingersoll Rand, including on-site leased workers from Aerotek, Express Personnel Staffing, and Select... from Aerotek, Express Personnel Staffing, Select Staffing, and Mechanical Contractors, Inc., Pueblo...
Selection of den sites by black bears in the southern Appalachians
Reynolds-Hogland, M. J.; Mitchell, M.S.; Powell, R.A.; Brown, D.C.
2007-01-01
We evaluated selection of den sites by American black bears (Ursus americanus) in the Pisgah Bear Sanctuary, western North Carolina, by comparing characteristics of dens at 53 den sites with availability of habitat characteristics in annual home ranges of bears and in the study area. We also tested whether den-site selection differed by sex, age, and reproductive status of bears. In addition, we evaluated whether the den component of an existing habitat model for black bears predicted where bears would select den sites. We found bears selected den sites far from gravel roads, on steep slopes, and at high elevations relative to what was available in both annual home ranges and in the study area. Den-site selection did not differ by sex or age, but it differed by reproductive status. Adult females with cubs preferred to den in areas that were relatively far from gravel roads, but adult females without cubs did not. The habitat model overestimated the value of areas near gravel roads, underestimated the value of moderately steep areas, and did not include elevation as a predictor variable. Our results highlight the importance of evaluating den selection in terms of both use and availability of den characteristics. ?? 2007 American Society of Mammalogists.
Gray, Sarah M; Akob, Denise M; Green, Stefan J; Kostka, Joel E
2012-01-01
The leaves of the carnivorous pitcher plant, Sarracenia purpurea, contain a microscopic aquatic food web that is considered a model system in ecological research. The species identity of the intermediate and top trophic level of this food web, as well the detritivore midge, are highly similar across the native geographic range of S. purpurea and, in some cases, appear to have co-evolved with the plant. However, until recently, the identity, geographic variation, and diversity of the bacteria in the bottom trophic level of this food web have remained largely unknown. This study investigated bacterial community composition inside the leaves of S. purpurea to address: 1) variation in bacterial communities at the beginning of succession at the local scale in different areas of the plant's native geographic range (southern and mid-regional sites) and 2) the impacts of bacterial consumers and other members of the aquatic food web (i.e., insects) on bacterial community structure. Communities from six leaves (one leaf per plant) from New York and Florida study sites were analyzed using 16S ribosomal RNA gene cloning. Each pitcher within each site had a distinct community; however, there was more overlap in bacterial composition within each site than when communities were compared across sites. In contrast, the identity of protozoans and metazoans in this community were similar in species identity both within a site and between the two sites, but abundances differed. Our results indicate that, at least during the beginning of succession, there is no strong selection for bacterial taxa and that there is no core group of bacteria required by the plant to start the decomposition of trapped insects. Co-evolution between the plant and bacteria appears to not have occurred as it has for other members of this community.
Gray, Sarah M.; Akob, Denise M.; Green, Stefan J.; Kostka, Joel E.
2012-01-01
The leaves of the carnivorous pitcher plant, Sarracenia purpurea, contain a microscopic aquatic food web that is considered a model system in ecological research. The species identity of the intermediate and top trophic level of this food web, as well the detritivore midge, are highly similar across the native geographic range of S. purpurea and, in some cases, appear to have co-evolved with the plant. However, until recently, the identity, geographic variation, and diversity of the bacteria in the bottom trophic level of this food web have remained largely unknown. This study investigated bacterial community composition inside the leaves of S. purpurea to address: 1) variation in bacterial communities at the beginning of succession at the local scale in different areas of the plant’s native geographic range (southern and mid-regional sites) and 2) the impacts of bacterial consumers and other members of the aquatic food web (i.e., insects) on bacterial community structure. Communities from six leaves (one leaf per plant) from New York and Florida study sites were analyzed using 16S ribosomal RNA gene cloning. Each pitcher within each site had a distinct community; however, there was more overlap in bacterial composition within each site than when communities were compared across sites. In contrast, the identity of protozoans and metazoans in this community were similar in species identity both within a site and between the two sites, but abundances differed. Our results indicate that, at least during the beginning of succession, there is no strong selection for bacterial taxa and that there is no core group of bacteria required by the plant to start the decomposition of trapped insects. Co-evolution between the plant and bacteria appears to not have occurred as it has for other members of this community. PMID:23227224
Strategy for selecting Mars Pathfinder landing sites
NASA Technical Reports Server (NTRS)
Greeley, Ronald; Kuzmin, Ruslin O.
1994-01-01
A strategy for Pathfinder site selection must be developed that is fundamentally different from most previous considerations. At least two approaches can be identified. In one approach, the objective is to select a site representing a key geologic unit on Mars, i.e., a unit that is widespread, easily recognized, and used frequently as a datum in various investigations. The second approach is to select a site that potentially affords access to a wide variety of rock types. Because rover range is limited, rocks from a variety of sources must be assembled in a small area for sampling. Regardless of the approach taken in site selection, the Pathfinder site should include eolian deposits and provisions should be made to obtain measurements on soils. A recommended approach for selecting the Mars Pathfinder landing site is to identify a deltaic deposit, composed of sediments derived from sources of various ages and geologic units that shows evidence of eolian activity. The site should be located as close as possible to the part of the outwash where rapid deposition occurred because the likelihood of 'sorting' by size and composition increases with distance, decreasing the probability of heterogeneity. In addition, it is recommended that field operation tests be conducted to gain experience and insight into conducting science with Pathfinder.
CO2CARE - Site Closure Assessment Research - Recent Results
NASA Astrophysics Data System (ADS)
Wipki, Mario; Liebscher, Axel; Kühn, Michael; Lüth, Stefan; Durucan, Sevket; Deflandre, Jean-Pierre; Wollenweber, Jens; Chadwick, Andy; Böhm, Gualtiero
2013-04-01
The EU project CO2CARE, which started in January 2011, supports the large scale demonstration of CCS technology by addressing requirements of operators and regulators face in terms of CO2 storage site abandonment. The CO2CARE consortium, consisting of 24 project partners from universities, research institutes, and the industry, investigate technologies and procedures for abandonment and post-closure safety, satisfying the regulatory requirements for the transfer of responsibility. Nine key injections sites in Europe, USA, Japan, and Australia, each with a specific (hydro) geological and environmental character, were selected for investigations. These sites can be divided into the CO2 storage types on-shore, off-shore, natural CO2 reservoir, depleted gas reservoirs, and saline aquifers. The project mainly focuses on three key areas: - well abandonment and long-term integrity; - reservoir management and prediction from closure to the long-term; - risk management methodologies for long-term safety. These key areas are in turn closely linked to the three high-level requirements of the EU Directive 2009/31/EC, Article 18 for CO2 storage which are: (i) absence of any detectable leakage, (ii) conformity of actual behaviour of the injected CO2 with the modeled behaviour, and (iii) the storage site is evolving towards a situation of long-term stability. The identification of criteria and the development of site abandonment procedures and technologies, which guarantee the fulfillment of the high-level requirements, are the major objectives in CO2CARE. These criteria have to be fulfilled prior to subsequent transfer of responsibility to the competent authorities, typically 20 or 30 years after site closure. Finally, the essential results of the different working groups in CO2CARE will feed into overall guidelines for regulatory compliance and "Best Practice" for site abandonment. Dissemination of the results will show policy makers and the general public how site abandonment procedures for CO2 storage sites can be undertaken sustainably, cost-effectively and with no adverse effect to the local population and the natural environment. After more than two-thirds of the project`s lifetime, an overview of the project`s goals and the most relevant research findings are presented.
Initial basalt target site selection evaluation for the Mars penetrator drop test
NASA Technical Reports Server (NTRS)
Bunch, T. E.; Quaide, W. L.; Polkowski, G.
1976-01-01
Potential basalt target sites for an air drop penetrator test were described and the criteria involved in site selection were discussed. A summary of the background field geology and recommendations for optimum sites are also presented.
CONTAMINANTS AND REMEDIAL OPTIONS AT SELECTED METAL-CONTAMINATED SITES
This document provides information that facilitates characterization of the site and selection of treatment technologies at metals-contaminated sites that would be capable of meeting site-specific cleanup levels. he document does not facilitate the determination of cleanup levels...
Mars exobiology landing sites for future exploration
NASA Technical Reports Server (NTRS)
Landheim, Ragnhild; Greeley, Ronald; Desmarais, David; Farmer, Jack D.; Klein, Harold
1993-01-01
The selection of landing sites for Exobiology is an important issue for planning for future Mars missions. Results of a recent site selection study which focused on potential landing sites described in the Mars Landing Site Catalog are presented. In addition, basic Exobiology science objectives in Mars exploration are reviewed, and the procedures used in site evaluation and prioritization are outlined.
76 FR 22672 - Shoshone Resource Advisory Committee
Federal Register 2010, 2011, 2012, 2013, 2014
2011-04-22
... Committee Act. The purpose of the meeting is to continue to review Title II project proposals and start... to the public. The following business will be conducted: (1) Continue to review Title II project proposals (2) Start selecting projects to recommend to the Designated Federal Official (3) Make a decision...
Peer Effects on Head Start Children's Preschool Competency
ERIC Educational Resources Information Center
DeLay, Dawn; Hanish, Laura D.; Martin, Carol Lynn; Fabes, Richard A.
2016-01-01
The goals of this study were to investigate whether young children attending Head Start (N = 292; M[subscript age] = 4.3 years) selected peers based on their preschool competency and whether children's levels of preschool competency were influenced by their peers' levels of preschool competency. Children's peer interaction partners were…
External Validity in Policy Evaluations That Choose Sites Purposively
ERIC Educational Resources Information Center
Olsen, Robert B.; Orr, Larry L.; Bell, Stephen H.; Stuart, Elizabeth A.
2013-01-01
Evaluations of the impact of social programs are often carried out in multiple sites, such as school districts, housing authorities, local TANF offices, or One-Stop Career Centers. Most evaluations select sites purposively following a process that is nonrandom. Unfortunately, purposive site selection can produce a sample of sites that is not…
The Tianlai 21cm intensity mapping experiment
NASA Astrophysics Data System (ADS)
Chen, Xuelei
2015-08-01
The Tianlai 21cm intensity mapping experiment is aimed at surveying the northern sky 21cm intensity at mid-redshifts, thus map out the neutral hydrogen distribution. The experiment is named "Tianlai" which means "heavenly sound" in classic Chinese, because its ultimate goal is to use the baryon acoustic oscillation (BAO) feature in the correlation function or power spectrum of large scale structure to constrain the cosmic expansion rate, and determine the nature of dark energy.The pathfinder experiment consists three cylinder reflectors of 15m wide x 40m long, and 16 dishes of 6 meter aperture, for testing the basic principle and key technologies. A radio-quiet site in Hongliuxia, Xinjiang of north-west China is selected, currently the facilities are under construction, and the prototype is expected to start commissioning later this year. The experiment is run by NAOC, with members from France, USA and Canada.
Selected ground-water information for the Pasco basin and adjacent areas, Washington, 1986-1989
Drost, B.W.; Schurr, K.M.; Lum, W. E.
1989-01-01
The U.S. Geological Survey, in cooperation with the United States Department of Energy, conducted a study of the Pasco basin and adjacent areas, Washington, in support of the Basalt Waste Isolation Project at the Hanford site, Washington. The purpose of the study was to develop a data set that would help define the groundwater-flow system of the Pasco Basin. This report contains the basic data, without interpretation, that were collected from the start of the project in February 1986 through January 1989. Information presented is from the U.S. Bureau of Reclamation, State of Washington Department of Ecology , US Army Corps of Engineers, Kennewick Irrigation District, and the Survey, and consists of well location and construction data, records of water levels in the wells, and aquifer designations for each well. The aquifer designation represents the geohydrologic unit to which the well is reported to be open. (USGS)
Computational Design of Clusters for Catalysis
NASA Astrophysics Data System (ADS)
Jimenez-Izal, Elisa; Alexandrova, Anastassia N.
2018-04-01
When small clusters are studied in chemical physics or physical chemistry, one perhaps thinks of the fundamental aspects of cluster electronic structure, or precision spectroscopy in ultracold molecular beams. However, small clusters are also of interest in catalysis, where the cold ground state or an isolated cluster may not even be the right starting point. Instead, the big question is: What happens to cluster-based catalysts under real conditions of catalysis, such as high temperature and coverage with reagents? Myriads of metastable cluster states become accessible, the entire system is dynamic, and catalysis may be driven by rare sites present only under those conditions. Activity, selectivity, and stability are highly dependent on size, composition, shape, support, and environment. To probe and master cluster catalysis, sophisticated tools are being developed for precision synthesis, operando measurements, and multiscale modeling. This review intends to tell the messy story of clusters in catalysis.
40 CFR 90.706 - Engine sample selection.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 40 Protection of Environment 20 2014-07-01 2013-07-01 true Engine sample selection. 90.706 Section...) CONTROL OF EMISSIONS FROM NONROAD SPARK-IGNITION ENGINES AT OR BELOW 19 KILOWATTS Manufacturer Production Line Testing Program § 90.706 Engine sample selection. (a) At the start of each model year, the small...
40 CFR 90.706 - Engine sample selection.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 21 2013-07-01 2013-07-01 false Engine sample selection. 90.706... (CONTINUED) CONTROL OF EMISSIONS FROM NONROAD SPARK-IGNITION ENGINES AT OR BELOW 19 KILOWATTS Manufacturer Production Line Testing Program § 90.706 Engine sample selection. (a) At the start of each model year, the...
40 CFR 91.506 - Engine sample selection.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 21 2013-07-01 2013-07-01 false Engine sample selection. 91.506... (CONTINUED) CONTROL OF EMISSIONS FROM MARINE SPARK-IGNITION ENGINES Manufacturer Production Line Testing Program § 91.506 Engine sample selection. (a) At the start of each model year, the marine SI engine...
Mitchell, Timothy S; Maciel, Jessica A; Janzen, Fredric J
2013-12-07
Evolutionary theory predicts that dioecious species should produce a balanced primary sex ratio maintained by frequency-dependent selection. Organisms with environmental sex determination, however, are vulnerable to maladaptive sex ratios, because environmental conditions vary spatio-temporally. For reptiles with temperature-dependent sex determination, nest-site choice is a behavioural maternal effect that could respond to sex-ratio selection, as mothers could adjust offspring sex ratios by choosing nest sites that will have particular thermal properties. This theoretical prediction has generated decades of empirical research, yet convincing evidence that sex-ratio selection is influencing nesting behaviours remains absent. Here, we provide the first experimental evidence from nature that sex-ratio selection, rather than only viability selection, is probably an important component of nest-site choice in a reptile with temperature-dependent sex determination. We compare painted turtle (Chrysemys picta) neonates from maternally selected nest sites with those from randomly selected nest sites, observing no substantive difference in hatching success or survival, but finding a profound difference in offspring sex ratio in the direction expected based on historical records. Additionally, we leverage long-term data to reconstruct our sex ratio results had the experiment been repeated in multiple years. As predicted by theory, our results suggest that sex-ratio selection has shaped nesting behaviour in ways likely to enhance maternal fitness.
Mitchell, Timothy S.; Maciel, Jessica A.; Janzen, Fredric J.
2013-01-01
Evolutionary theory predicts that dioecious species should produce a balanced primary sex ratio maintained by frequency-dependent selection. Organisms with environmental sex determination, however, are vulnerable to maladaptive sex ratios, because environmental conditions vary spatio-temporally. For reptiles with temperature-dependent sex determination, nest-site choice is a behavioural maternal effect that could respond to sex-ratio selection, as mothers could adjust offspring sex ratios by choosing nest sites that will have particular thermal properties. This theoretical prediction has generated decades of empirical research, yet convincing evidence that sex-ratio selection is influencing nesting behaviours remains absent. Here, we provide the first experimental evidence from nature that sex-ratio selection, rather than only viability selection, is probably an important component of nest-site choice in a reptile with temperature-dependent sex determination. We compare painted turtle (Chrysemys picta) neonates from maternally selected nest sites with those from randomly selected nest sites, observing no substantive difference in hatching success or survival, but finding a profound difference in offspring sex ratio in the direction expected based on historical records. Additionally, we leverage long-term data to reconstruct our sex ratio results had the experiment been repeated in multiple years. As predicted by theory, our results suggest that sex-ratio selection has shaped nesting behaviour in ways likely to enhance maternal fitness. PMID:24266033
NASA Astrophysics Data System (ADS)
Oyarzún, Bernardo; Mognetti, Bortolo Matteo
2018-03-01
We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.
Miklík, Dalibor; Šenigl, Filip; Hejnar, Jiří
2018-01-01
Individual groups of retroviruses and retroviral vectors differ in their integration site preference and interaction with the host genome. Hence, immediately after infection genome-wide distribution of integrated proviruses is non-random. During long-term in vitro or persistent in vivo infection, the genomic position and chromatin environment of the provirus affects its transcriptional activity. Thus, a selection of long-term stably expressed proviruses and elimination of proviruses, which have been gradually silenced by epigenetic mechanisms, helps in the identification of genomic compartments permissive for proviral transcription. We compare here the extent and time course of provirus silencing in single cell clones of the K562 human myeloid lymphoblastoma cell line that have been infected with retroviral reporter vectors derived from avian sarcoma/leukosis virus (ASLV), human immunodeficiency virus type 1 (HIV) and murine leukaemia virus (MLV). While MLV proviruses remain transcriptionally active, ASLV proviruses are prone to rapid silencing. The HIV provirus displays gradual silencing only after an extended time period in culture. The analysis of integration sites of long-term stably expressed proviruses shows a strong bias for some genomic features—especially integration close to the transcription start sites of active transcription units. Furthermore, complex analysis of histone modifications enriched at the site of integration points to the accumulation of proviruses of all three groups in gene regulatory segments, particularly close to the enhancer loci. We conclude that the proximity to active regulatory chromatin segments correlates with stable provirus expression in various retroviral species. PMID:29517993
Su, Hongsheng
2017-12-18
Distributed power grids generally contain multiple diverse types of distributed generators (DGs). Traditional particle swarm optimization (PSO) and simulated annealing PSO (SA-PSO) algorithms have some deficiencies in site selection and capacity determination of DGs, such as slow convergence speed and easily falling into local trap. In this paper, an improved SA-PSO (ISA-PSO) algorithm is proposed by introducing crossover and mutation operators of genetic algorithm (GA) into SA-PSO, so that the capabilities of the algorithm are well embodied in global searching and local exploration. In addition, diverse types of DGs are made equivalent to four types of nodes in flow calculation by the backward or forward sweep method, and reactive power sharing principles and allocation theory are applied to determine initial reactive power value and execute subsequent correction, thus providing the algorithm a better start to speed up the convergence. Finally, a mathematical model of the minimum economic cost is established for the siting and sizing of DGs under the location and capacity uncertainties of each single DG. Its objective function considers investment and operation cost of DGs, grid loss cost, annual purchase electricity cost, and environmental pollution cost, and the constraints include power flow, bus voltage, conductor current, and DG capacity. Through applications in an IEEE33-node distributed system, it is found that the proposed method can achieve desirable economic efficiency and safer voltage level relative to traditional PSO and SA-PSO algorithms, and is a more effective planning method for the siting and sizing of DGs in distributed power grids.
A Large-Scale, Multiagency Approach to Defining a Reference Network for Pacific Northwest Streams
NASA Astrophysics Data System (ADS)
Miller, Stephanie; Eldred, Peter; Muldoon, Ariel; Anlauf-Dunn, Kara; Stein, Charlie; Hubler, Shannon; Merrick, Lesley; Haxton, Nick; Larson, Chad; Rehn, Andrew; Ode, Peter; Vander Laan, Jake
2016-12-01
Aquatic monitoring programs vary widely in objectives and design. However, each program faces the unifying challenge of assessing conditions and quantifying reasonable expectations for measured indicators. A common approach for setting resource expectations is to define reference conditions that represent areas of least human disturbance or most natural state of a resource characterized by the range of natural variability across a region of interest. Identification of reference sites often relies heavily on professional judgment, resulting in varying and unrepeatable methods. Standardized methods for data collection, site characterization, and reference site selection facilitate greater cooperation among assessment programs and development of assessment tools that are readily shareable and comparable. We illustrate an example that can serve the broader global monitoring community on how to create a consistent and transparent reference network for multiple stream resource agencies. We provide a case study that offers a simple example of how reference sites can be used, at the landscape level, to link upslope management practices to a specific in-channel response. We found management practices, particularly areas with high road densities, have more fine sediments than areas with fewer roads. While this example uses data from only one of the partner agencies, if data were collected in a similar manner they can be combined and create a larger, more robust dataset. We hope that this starts a dialog regarding more standardized ways through inter-agency collaborations to evaluate data. Creating more consistency in physical and biological field protocols will increase the ability to share data.
Antidepressants: Selecting One That's Right for You
... unless you've tried other antidepressants first without improvement. Monoamine oxidase inhibitors (MAOIs). MAOIs — such as tranylcypromine ( ... selected an antidepressant, you may start to see improvement in a few weeks, but it may take ...
Constraints and Approach for Selecting the Mars Surveyor '01 Landing Site
NASA Technical Reports Server (NTRS)
Golombek, M.; Bridges, N.; Gilmore, M.; Haldemann, A.; Parker, T.; Saunders, R.; Spencer, D.; Smith, J.; Weitz, C.
1999-01-01
There are many similarities between the Mars Surveyor '01 (MS '01) landing site selection process and that of Mars Pathfinder. The selection process includes two parallel activities in which engineers define and refine the capabilities of the spacecraft through design, testing and modeling and scientists define a set of landing site constraints based on the spacecraft design and landing scenario. As for Pathfinder, the safety of the site is without question the single most important factor, for the simple reason that failure to land safely yields no science and exposes the mission and program to considerable risk. The selection process must be thorough and defensible and capable of surviving multiple withering reviews similar to the Pathfinder decision. On Pathfinder, this was accomplished by attempting to understand the surface properties of sites using available remote sensing data sets and models based on them. Science objectives are factored into the selection process only after the safety of the site is validated. Finally, as for Pathfinder, the selection process is being done in an open environment with multiple opportunities for community involvement including open workshops, with education and outreach opportunities.
Constraints, Approach and Present Status for Selecting the Mars Surveyor 2001 Landing Site
NASA Technical Reports Server (NTRS)
Golombek, M.; Anderson, F.; Bridges, N.; Briggs, G.; Gilmore, M.; Gulick, V.; Haldemann, A.; Parker, T.; Saunders, R.; Spencer, D.;
1999-01-01
There are many similarities between the Mars Surveyor '01 (MS '01) landing site selection process and that of Mars Pathfinder. The selection process includes two parallel activities in which engineers define and refine the capabilities of the spacecraft through design, testing and modeling and scientists define a set of landing site constraints based on the spacecraft design and landing scenario. As for Pathfinder, the safety of the site is without question the single most important factor, for the simple reason that failure to land safely yields no science and exposes the mission and program to considerable risk. The selection process must be thorough, defensible and capable of surviving multiple withering reviews similar to the Pathfinder decision. On Pathfinder, this was accomplished by attempting to understand the surface properties of sites using available remote sensing data sets and models based on them. Science objectives are factored into the selection process only after the safety of the site is validated. Finally, as for Pathfinder, the selection process is being done in an open environment with multiple opportunities for community involvement including open workshops, with education and outreach opportunities.
Demaerschalk, Bart M; Brown, Robert D; Roubin, Gary S; Howard, Virginia J; Cesko, Eldina; Barrett, Kevin M; Longbottom, Mary E; Voeks, Jenifer H; Chaturvedi, Seemant; Brott, Thomas G; Lal, Brajesh K; Meschia, James F; Howard, George
2017-09-01
Multicenter clinical trials attempt to select sites that can move rapidly to randomization and enroll sufficient numbers of patients. However, there are few assessments of the success of site selection. In the CREST-2 (Carotid Revascularization and Medical Management for Asymptomatic Carotid Stenosis Trials), we assess factors associated with the time between site selection and authorization to randomize, the time between authorization to randomize and the first randomization, and the average number of randomizations per site per month. Potential factors included characteristics of the site, specialty of the principal investigator, and site type. For 147 sites, the median time between site selection to authorization to randomize was 9.9 months (interquartile range, 7.7, 12.4), and factors associated with early site activation were not identified. The median time between authorization to randomize and a randomization was 4.6 months (interquartile range, 2.6, 10.5). Sites with authorization to randomize in only the carotid endarterectomy study were slower to randomize, and other factors examined were not significantly associated with time-to-randomization. The recruitment rate was 0.26 (95% confidence interval, 0.23-0.28) patients per site per month. By univariate analysis, factors associated with faster recruitment were authorization to randomize in both trials, principal investigator specialties of interventional radiology and cardiology, pre-trial reported performance >50 carotid angioplasty and stenting procedures per year, status in the top half of recruitment in the CREST trial, and classification as a private health facility. Participation in StrokeNet was associated with slower recruitment as compared with the non-StrokeNet sites. Overall, selection of sites with high enrollment rates will likely require customization to align the sites selected to the factor under study in the trial. URL: http://www.clinicaltrials.gov. Unique identifier: NCT02089217. © 2017 American Heart Association, Inc.
1995-06-01
Energy efficient, 30 and 40 watt ballasts are Rapid Start, thermally protected, automatic resetting. Class P, high or low power factor as required...BALLASTS Energy efficient, 30 ana 40 watt Rapic Start, thermally protected, automatic resetting. Class P. high power factor, CEM, sound rated A. unless...BALLASTS Energy efficient, 40 Watt Rapid Start, thermally protected, automatic resetting, Class P, high power factor, CBM, sound rated A, unless
Hussain, Shah; Schönbichler, Stefan A; Güzel, Yüksel; Sonderegger, Harald; Abel, Gudrun; Rainer, Matthias; Huck, Christian W; Bonn, Günther K
2013-10-01
Galloyl- and caffeoylquinic acids are among the most important pharmacological active groups of natural compounds. This study describes a pre-step in isolation of some selected representatives of these groups from biological samples. A selective solid-phase extraction (SPE) method for these compounds may help assign classes and isomer designations within complex mixtures. Pure zirconium silicate and bismuth citrate powders (325 mesh) were employed as two new sorbents for optimized SPE of phenolic acids. These sorbents possess electrostatic interaction sites which accounts for additional interactions for carbon acid moieties as compared to hydrophilic and hydrophobic sorbents alone. Based on this principle, a selective SPE method for 1,3,4,5-tetragalloylquinic acid (an anti-HIV and anti-asthamatic agent) as a starting compound was developed and then deployed upon other phenolic acids with success. The recoveries and selectivities of both sorbents were compared to most commonly applied and commercially available sorbents by using high performance liquid chromatography. The nature of interaction between the carrier sorbent and the acidic target molecules was investigated by studying hydrophilic (silica), hydrophobic (C18), mixed-mode (ionic and hydrophobic: Oasis(®) MAX) and predominantly electrostatic (zirconium silicate) materials. The newly developed zirconium silicate and bismuth citrate stationary phases revealed promising results for the selective extraction of galloyl- and caffeoylquinic acids from natural sources. It was observed that zirconium silicate exhibited maximum recovery and selectivity for tetragalloylquinic acid (84%), chlorogenic acid (82%) and dicaffeoylquinic acid (94%) among all the tested sorbents. Copyright © 2013 Elsevier B.V. All rights reserved.
Study on site selection of cold chain logistics in northwest territories
NASA Astrophysics Data System (ADS)
Liu, Yubin; Ren, Zongwei
2017-08-01
In this research, we mainly studied the Site selection problem of cold chain logistics in northwest of China. In the first place, we counted the demands of cold chain products in northwest territories, and then classified it into the Site selection problem in five provinces in northwest territories(Xinjiang, Qinghai, Gansu, Ningxia, Shanxi); Next, we used the Center of gravity Method to select initial location; Finally, we established the location of distribution by using Analytic Hierarchy Process (AHP)and fuzzy comprehensive evaluation method. Comparing with the traditional method, this method not only considered the cost of transportation and distance, but also deliberated the physical condition, social environment and economics condition which associated with Site selection problem.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1994-09-29
This decision document presents the final selected remedial action for the Stanley Kessler Superfund Site (the Site). The selected remedy for the Site will restore contaminated ground water to its beneficial use by cleaning up the ground water to background levels as established by EPA or the appropriate Maximum Contaminant Levels or non-zero Maximum Contaminant Level Goals established under the Federal Safe Drinking Water Act whichever is more stringent. The selected remedy is the only planned action for the Site.
Selective Se-for-S substitution in Cs-bearing uranyl compounds
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gurzhiy, Vladislav V., E-mail: vladgeo17@mail.ru; Tyumentseva, Olga S.; Krivovichev, Sergey V.
Phase formation in the mixed sulfate-selenate aqueous system of uranyl nitrate and cesium nitrate has been investigated. Two types of crystalline compounds have been obtained and characterized using a number of experimental (single crystal XRD, FTIR, SEM) and theoretical (information-based complexity calculations, topological analysis) techniques. No miscibility gaps have been observed for Cs{sub 2}[(UO{sub 2}){sub 2}(TO{sub 4}){sub 3}] (T= S, Se), which crystallizes in tetragonal system, P-42{sub 1}m, a =9.616(1)–9.856(2), c =8.105(1)–8.159(1) Å, V =749.6(2)–792.5(3) Å{sup 3}. Nine phases with variable amount of S and Se have been structurally characterized. The structures of the Cs{sub 2}[(UO{sub 2}){sub 2}(TO{sub 4}){sub 3}]more » (T= S, Se) compounds are based upon the [(UO{sub 2}){sub 2}(TO{sub 4}){sub 3}]{sup 2-} layers of corner-sharing uranyl pentagonal bipyramids and TO{sub 4} tetrahedra. The layers contain two types of tetrahedral sites: T1 (3-connected, i.e. having three O atoms shared by adjacent uranyl polyhedra) and T2 (4-connected). The Se-for-S substitution in tetrahedral sites is highly selective with smaller S{sup 6+} cation showing a strong preference for the more tightly bonded T2 site. Crystallization in the pure Se system starts with the formation of Cs{sub 2}[(UO{sub 2})(SeO{sub 4}){sub 2}(H{sub 2}O)](H{sub 2}O) crystals, its subsequent dissolution and formation of Cs{sub 2}[(UO{sub 2}){sub 2}(SeO{sub 4}){sub 3}]. The information-based structural complexity calculations for these two phases support the rule that more topologically complex structures form at the latest stages of crystallization. - Graphical abstract: Nine phases representing the Cs{sub 2}[(UO{sub 2}){sub 2}(TO{sub 4}){sub 3}] (T= S, Se) solid solution series with variable amount of S and Se have been prepared by isothermal evaporation from aqueous solutions and characterized using a number of experimental and theoretical techniques. No immiscibility is observed between the pure sulfate and selenate compounds. The Se-for-S substitution in tetrahedral sites is highly selective with smaller S{sup 6+} cation showing a strong preference for the more tightly bonded 4-connected site. - Highlights: • Single crystals of novel mixed sulfate-selenate uranyl oxysalts were prepared by evaporation method. • Topological analysis and information-based complexity calculations were used for structure description. • The selective Se-for-S substitution was observed. • Evolution of phase formation in the aqueous Cs{sup +}–UO{sub 2}{sup 2+}–SO{sub 4}{sup 2–}–SeO{sub 4}{sup 2–} system was analyzed.« less
Human Mars Landing Site and Impacts on Mars Surface Operations
NASA Technical Reports Server (NTRS)
Hoffman, Stephen J.; Bussey, Ben
2016-01-01
This paper describes NASA's initial steps for identifying and evaluating candidate Exploration Zones (EZs) and Regions of Interests (ROIs) for the first human crews that will explore the surface of Mars. NASA's current effort to define the exploration of this planet by human crews, known as the Evolvable Mars Campaign (EMC), provides the context in which these EZs and ROIs are being considered. The EMC spans all aspects of a human Mars mission including launch from Earth, transit to and from Mars, and operations on the surface of Mars. An EZ is a collection of ROIs located within approximately 100 kilometers of a centralized landing site. ROIs are areas relevant for scientific investigation and/or development/maturation of capabilities and resources necessary for a sustainable human presence. The EZ also contains one or more landing sites and a habitation site that will be used by multiple human crews during missions to explore and utilize the ROIs within the EZ. With the EMC as a conceptual basis, the EZ model has been refined to a point where specific site selection criteria for scientific exploration and in situ resource utilization can be defined. In 2015 these criteria were distributed to the planetary sciences community and the in situ resource utilization and civil engineering communities as part of a call for EZ proposals. The resulting "First Landing Site/Exploration Zone Workshop for Human Missions to the Surface of Mars" was held in October 2015 during which 47 proposals for EZs and ROIs were presented and discussed. Proposed locations spanned all longitudes and all allowable latitudes (+/- 50 degrees). Proposed justification for selecting one of these EZs also spanned a significant portion of the scientific and resource criteria provided to the community. Several important findings resulted from this Workshop including: (a) a strong consensus that, at a scale of 100 km (radius), multiple places on Mars exist that have both sufficient scientific interest to sustain multiple crews of exploring astronauts, AND potential resource deposits for ISRU indicating the current EZ definition is viable and should be retained for now, (b) new data types (needed for more definitive analysis of EZs) argued strongly for a new orbiter mission, and possibly one or more surface missions, to obtain these data, (c) a general consensus that this Workshop was an excellent start to identifying a place where future human missions to Mars can productively explore this planet and learn to live and work there for the long term. Building on these findings, HEOMD and SMD are: (a) refining the EZ selection criteria and overall selection process to improve on lessons learned from the first EZ workshop, (b) using these proposed locations to develop "reference EZs" for assessment purposes (primarily engineering assessments), (c) gathering data and conducting analyses to better understanding the different potential sources for water, including the ease of extraction and purification, and (d) assessing trends in additional data that are needed to better characterize EZs proposed at the workshop and how these data needs impact the design and operation of future robotic Mars missions.
Automated frame selection process for high-resolution microendoscopy
NASA Astrophysics Data System (ADS)
Ishijima, Ayumu; Schwarz, Richard A.; Shin, Dongsuk; Mondrik, Sharon; Vigneswaran, Nadarajah; Gillenwater, Ann M.; Anandasabapathy, Sharmila; Richards-Kortum, Rebecca
2015-04-01
We developed an automated frame selection algorithm for high-resolution microendoscopy video sequences. The algorithm rapidly selects a representative frame with minimal motion artifact from a short video sequence, enabling fully automated image analysis at the point-of-care. The algorithm was evaluated by quantitative comparison of diagnostically relevant image features and diagnostic classification results obtained using automated frame selection versus manual frame selection. A data set consisting of video sequences collected in vivo from 100 oral sites and 167 esophageal sites was used in the analysis. The area under the receiver operating characteristic curve was 0.78 (automated selection) versus 0.82 (manual selection) for oral sites, and 0.93 (automated selection) versus 0.92 (manual selection) for esophageal sites. The implementation of fully automated high-resolution microendoscopy at the point-of-care has the potential to reduce the number of biopsies needed for accurate diagnosis of precancer and cancer in low-resource settings where there may be limited infrastructure and personnel for standard histologic analysis.
Using environmental heterogeneity to plan for sea-level rise.
Hunter, Elizabeth A; Nibbelink, Nathan P
2017-12-01
Environmental heterogeneity is increasingly being used to select conservation areas that will provide for future biodiversity under a variety of climate scenarios. This approach, termed conserving nature's stage (CNS), assumes environmental features respond to climate change more slowly than biological communities, but will CNS be effective if the stage were to change as rapidly as the climate? We tested the effectiveness of using CNS to select sites in salt marshes for conservation in coastal Georgia (U.S.A.), where environmental features will change rapidly as sea level rises. We calculated species diversity based on distributions of 7 bird species with a variety of niches in Georgia salt marshes. Environmental heterogeneity was assessed across six landscape gradients (e.g., elevation, salinity, and patch area). We used 2 approaches to select sites with high environmental heterogeneity: site complementarity (environmental diversity [ED]) and local environmental heterogeneity (environmental richness [ER]). Sites selected based on ER predicted present-day species diversity better than randomly selected sites (up to an 8.1% improvement), were resilient to areal loss from SLR (1.0% average areal loss by 2050 compared with 0.9% loss of randomly selected sites), and provided habitat to a threatened species (0.63 average occupancy compared with 0.6 average occupancy of randomly selected sites). Sites selected based on ED predicted species diversity no better or worse than random and were not resilient to SLR (2.9% average areal loss by 2050). Despite the discrepancy between the 2 approaches, CNS is a viable strategy for conservation site selection in salt marshes because the ER approach was successful. It has potential for application in other coastal areas where SLR will affect environmental features, but its performance may depend on the magnitude of geological changes caused by SLR. Our results indicate that conservation planners that had heretofore excluded low-lying coasts from CNS planning could include coastal ecosystems in regional conservation strategies. © 2017 Society for Conservation Biology.
2017-10-01
Colonization PRINCIPAL INVESTIGATOR: Srinivas Nandana CONTRACTING ORGANIZATION: Cedars-Sinai Medical Center Los Angeles, CA, 90048 REPORT DATE...8. PERFORMING ORGANIZATION REPORT NUMBER Cedars-Sinai Medical Center, 8700 Beverly Blvd, Los Angeles, CA, 90048 9. SPONSORING / MONITORING...Revised Statement of Work (SOW): PROPOSED START DATE Sep 30, 2016 ACTUAL START DATE – Sep 18, 2017 Site: Uro -Oncology, Dept of Medicine
NASA Astrophysics Data System (ADS)
Lemon, M. G.; Keim, R.
2017-12-01
Although specific controls are not well understood, the phenology of temperate forests is generally thought to be controlled by photoperiod and temperature, although recent research suggests that soil moisture may also be important. The phenological controls of forested wetlands have not been thoroughly studied, and may be more controlled by site hydrology than other forests. For this study, remotely sensed vegetation indices were used to investigate hydrological controls on start-of-season timing, growing season length, and end-of-season timing at five floodplains in Louisiana, Arkansas, and Texas. A simple spring green-up model was used to determine the null spring start of season time for each site as a function of land surface temperature and photoperiod, or two remotely sensed indices: MODIS phenology data product and the MODIS Nadir Bidirectional Reflectance Distribution Function-Adjusted Reflectance (NBAR) product. Preliminary results indicate that topographically lower areas within the floodplain with higher flood frequency experience later start-of-season timing. In addition, start-of-season is delayed in wet years relative to predicted timing based solely on temperature and photoperiod. The consequences for these controls unclear, but results suggest hydrological controls on floodplain ecosystem structure and carbon budgets are likely at least partially expressed by variations in growing season length.
Campos, José Luis; Charlesworth, Brian
2017-01-01
We used whole-genome resequencing data from a population of Drosophila melanogaster to investigate the causes of the negative correlation between the within-population synonymous nucleotide site diversity (πS) of a gene and its degree of divergence from related species at nonsynonymous nucleotide sites (KA). By using the estimated distributions of mutational effects on fitness at nonsynonymous and UTR sites, we predicted the effects of background selection at sites within a gene on πS and found that these could account for only part of the observed correlation between πS and KA. We developed a model of the effects of selective sweeps that included gene conversion as well as crossing over. We used this model to estimate the average strength of selection on positively selected mutations in coding sequences and in UTRs, as well as the proportions of new mutations that are selectively advantageous. Genes with high levels of selective constraint on nonsynonymous sites were found to have lower strengths of positive selection and lower proportions of advantageous mutations than genes with low levels of constraint. Overall, background selection and selective sweeps within a typical gene reduce its synonymous diversity to ∼75% of its value in the absence of selection, with larger reductions for genes with high KA. Gene conversion has a major effect on the estimates of the parameters of positive selection, such that the estimated strength of selection on favorable mutations is greatly reduced if it is ignored. PMID:28559322
Shrestha, J R; Manandhar, D S; Manandhar, S R; Adhikari, D; Rai, C; Rana, H; Poudel, M; Pradhan, A
2015-01-01
As part of the Partnership for Maternal and Newborn Health Project (PMNH), HealthRight International collaborated with Mother and Infant Research Activities (MIRA) to conduct operations research in Arghakhanchi district of Nepal to explore the intervention impact of strengthening health facility, improving community facility linkages along with Community Based Newborn Care Program (CB-NCP) on Maternal Neonatal Care (MNC) service quality, utilization, knowledge and care seeking behavior. This was a quasi-experimental study. Siddahara, Pokharathok, Subarnakhal,Narpani Health Posts (HPs) and Thada Primary Health Care Center(PHCC)in Electoral Constituency-2 were selected as intervention sites and Arghatosh, ,Argha, Khana, Hansapur HPs and Balkot PHCC in Electoral Constituency-1 were chosen as controls. The intervention started in February 2011 and was evaluated in August 2013. To compare MNC knowledge and practice in the community, mothers of children aged 0-23 months were selected from the corresponding Village Development Committees(VDCs) by a two stage cluster sampling design during both baseline (July 2010) and endline (August, 2013) assessments. The difference in difference analysis was used to understand the intervention impact. Local resource mobilization for MNC, knowledge about MNC and service utilization increased in intervention sites. Though there were improvements, many effects were not significant. Extensive trainings followed by reviews and quality monitoring visits increased the knowledge, improved skills and fostered motivation of health facility workers for better MNC service delivery. MNC indicators showed an upsurge in numbers due to the synergistic effects of many interventions.
Big maggots dig deeper: size-dependent larval dispersal in flies.
Davis, Jeremy M; Coogan, Laura E; Papaj, Daniel R
2015-09-01
The ability of individual animals to select habitats optimal for development and survival can be constrained by the costs of moving through the environment. Animals that seek overwintering sites underground, for example, may be constrained by the energy required to burrow into the soil. We conducted field and laboratory studies to determine the relationship between individual size and overwintering site selection in the tephritid flies, Rhagoletis juglandis and Rhagoletis suavis. We also explored the effect of site selection on pupal mortality, parasitism, and the ability to emerge from overwintering sites after eclosion. In both species, and in both lab and field tests, larger pupae were found at deeper soil depths. In addition, marginally non-significant trends indicated pupae in deeper sites were 48% more likely to survive the overwintering period. Finally, larger individuals were more likely to eclose and emerge from the soil at a given depth, but flies in deep overwintering sites were less likely to emerge from those sites than flies in shallow sites. Our data indicate that overwintering site selection represents a trade-off between avoiding predators and parasites that occur at shallow sites, and the energetic and mortality costs of burrowing to, overwintering in, and emerging from, deeper sites. The size-dependent overwintering site selection demonstrated here has implications for population dynamics and pest control strategies. Some fly control measures, such as the introduction of parasites or predators, will be mitigated when the deepest and least accessible overwintering pupae represent a disproportionately large amount of the population's reproductive capacity.
Criteria for site selection and frequency allocation (keynote paper), part 5
NASA Technical Reports Server (NTRS)
Rottger, J.
1985-01-01
Technical aspects of mesosphere-stratosphere-troposphere (MST) Radar on site and frequency selection were discussed. Recommendations on site selections are presented. Tests of interference will be conducted before selecting a site. A small directional antenna may be suitable to simulate sidelobe sensitivity of radars however, sophisticated data-processing methods make system sensitivity extremely good. The use of the complete data system to look for interference is recommended. There is the difficulty of allocation of frequencies -- almost continuous use by these radars will be made when the band 40 to 60 MHz is allocated to other services.
Second Information Technology in Education Study: SITES 2006 Technical Report
ERIC Educational Resources Information Center
Carstens, Ralph, Ed.; Pelgrum, Willem J., Ed.
2009-01-01
The International Association for the Evaluation of Educational Achievement (IEA) has been conducting comparative studies for 50 years. SITES 2006 is the fifth wave of surveys related to information and communication technology (ICT), a wave that IEA started with its Computers in Education Study (two studies with data collection in 1989 and 1992),…
Monitoring of natural outbreaks of Phytophthora ramorum in the United Kingdom.
Judith Turner; Alex Appiah; Philip Jennings; Gilli Humphries; Debbie Liddell; Sam McDonough; Jackie Stonehouse; David Lockley; Stephen Eales
2006-01-01
Over 40 outbreaks of Phytophthora ramorum have occurred in managed gardens in the United Kingdom. Three of these sites, one in the southeast of England and two in the southwest, have been closely monitored since October 2003. These sites represented differing disease scenarios at the start of monitoring, as eradication action had already taken...
Interrelationship between Attachment Styles and Facebook Addiction
ERIC Educational Resources Information Center
Eroglu, Yuksel
2016-01-01
Social networking sites have started to become one of the most frequently used online communication types in the world. It is reported that one of the commonly used social networking sites is Facebook. Since Facebook use is new yet, it can be stated that researches on the Facebook addiction are at the beginning level. For this reason, determining…
Effects of wildfires on riparian restoration sites, [electronic resource
Jonathan W. Long; B. Mae Burnette
2004-01-01
We monitored changes in vegetation and channel morphology along reaches of two perennial streams, Limestone Canyon and East Cedar Creek, on the White Mountain Apache Reservation in Arizona starting in the fall of 1995. Enormous wildfires caused extensive erosion and runoff in the watersheds containing the sites in 2002 and 2003, respectively. All reaches within the...
Verification of the exponential model of body temperature decrease after death in pigs.
Kaliszan, Michal; Hauser, Roman; Kaliszan, Roman; Wiczling, Paweł; Buczyñski, Janusz; Penkowski, Michal
2005-09-01
The authors have conducted a systematic study in pigs to verify the models of post-mortem body temperature decrease currently employed in forensic medicine. Twenty-four hour automatic temperature recordings were performed in four body sites starting 1.25 h after pig killing in an industrial slaughterhouse under typical environmental conditions (19.5-22.5 degrees C). The animals had been randomly selected under a regular manufacturing process. The temperature decrease time plots drawn starting 75 min after death for the eyeball, the orbit soft tissues, the rectum and muscle tissue were found to fit the single-exponential thermodynamic model originally proposed by H. Rainy in 1868. In view of the actual intersubject variability, the addition of a second exponential term to the model was demonstrated to be statistically insignificant. Therefore, the two-exponential model for death time estimation frequently recommended in the forensic medicine literature, even if theoretically substantiated for individual test cases, provides no advantage as regards the reliability of estimation in an actual case. The improvement of the precision of time of death estimation by the reconstruction of an individual curve on the basis of two dead body temperature measurements taken 1 h apart or taken continuously for a longer time (about 4 h), has also been proved incorrect. It was demonstrated that the reported increase of precision of time of death estimation due to use of a multiexponential model, with individual exponential terms to account for the cooling rate of the specific body sites separately, is artifactual. The results of this study support the use of the eyeball and/or the orbit soft tissues as temperature measuring sites at times shortly after death. A single-exponential model applied to the eyeball cooling has been shown to provide a very precise estimation of the time of death up to approximately 13 h after death. For the period thereafter, a better estimation of the time of death is obtained from temperature data collected from the muscles or the rectum.
Santos, Clara; Pérez-Fontán, Miguel; Rodríguez-Carmona, Ana; Calvo-Rodríguez, María; López-Muñiz, Andrés; López-Calviño, Beatriz; García-Falcón, Teresa
2016-01-01
♦ Peritoneal catheter tunnel and exit-site infection (TESI) complicates the clinical course of peritoneal dialysis (PD) patients. Adherence to recommendations for catheter insertion, exit-site care, and management of Staphylococcus aureus (SAu) carriage reduces, but does not abrogate the risk of these infections. ♦ To reappraise the risk profile for TESI in an experienced center with a long-term focus on management of SAu carriage and a low incidence of these infections. ♦ Following a retrospective, observational design, we investigated 665 patients incident on PD. The main study variable was survival to the first episode of TESI. We considered selected demographic, clinical, and technical variables, applying multivariate strategies of analysis. ♦ The overall incidence of TESI was 1 episode/68.5 patient-months. Staphylococcus aureus carriage disclosed at inception of PD (but not if observed sporadically during follow-up) (hazard ratio [HR] 1.53, p = 0.009), PD started shortly after catheter insertion (HR 0.98 per day, p = 0.011), PD after kidney transplant failure (HR 2.18, p = 0.017), lower hemoglobin levels (HR 0.88 per g/dL, p = 0.013) and fast peritoneal transport rates (HR 2.92, p = 0.03) portended an increased risk of TESI. Delaying PD ≥ 30 days after catheter insertion markedly improved the probability of TESI. Carriage of methicillin-resistant SAu since the start of PD was associated with a high incidence of TESI by these bacteria. On the contrary, resistance to mupirocin did not predict such a risk, probably due to the use of an alternative regime in affected patients. ♦ Adherence to current recommendations results in a low incidence of TESI in PD patients. Interventions on specific risk subsets have a potential to bring incidence close to negligible levels. Despite systematic screening and management, SAu carriage is still a predictor of TESI. Antibiotic susceptibility patterns may help to refine stratification of the risk of TESI by these bacteria. Early insertion of the peritoneal catheter should be considered whenever possible, to reduce the risk of later TESI. Copyright © 2016 International Society for Peritoneal Dialysis.
Successful Air Force Source Selections Start with an Effective Empowered Team
responsibilities of the team that will conduct a source selection, there is less guidance and focus how to create an effective source selection team and...empower that team to successfully complete a source selection. This purpose of this research was to determine if an increased focus on the formation and...empowerment of source selection teams and not just processes and procedures contribute to the efficiency and success of Air Force source selections
40 CFR 240.202 - Site selection.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Site selection. 240.202 Section 240.202 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR... selection. ...
Landfill site selection using combination of GIS and fuzzy AHP, a case study: Iranshahr, Iran.
Torabi-Kaveh, M; Babazadeh, R; Mohammadi, S D; Zaresefat, M
2016-03-09
One of the most important recent challenges in solid waste management throughout the world is site selection of sanitary landfill. Commonly, because of simultaneous effects of social, environmental, and technical parameters on suitability of a landfill site, landfill site selection is a complex process and depends on several criteria and regulations. This study develops a multi-criteria decision analysis (MCDA) process, which combines geographic information system (GIS) analysis with a fuzzy analytical hierarchy process (FAHP), to determine suitable sites for landfill construction in Iranshahr County, Iran. The GIS was used to calculate and classify selected criteria and FAHP was used to assess the criteria weights based on their effectiveness on selection of potential landfill sites. Finally, a suitability map was prepared by overlay analyses and suitable areas were identified. Four suitability classes within the study area were separated, including high, medium, low, and very low suitability areas, which represented 18%, 15%, 55%, and 12% of the study area, respectively. © The Author(s) 2016.
Nan, Yong Hai; Bang, Jeong-Kyu; Jacob, Binu; Park, Il-Seon; Shin, Song Yub
2012-06-01
To develop novel antimicrobial peptides (AMPs) with shorter lengths, improved prokaryotic selectivity and retained lipolysaccharide (LPS)-neutralizing activity compared to human cathelicidin AMP, LL-37, a series of amino acid-substituted analogs based on IG-19 (residues 13-31 of LL-37) were synthesized. Among the IG-19 analogs, the analog a4 showed the highest prokaryotic selectivity, but much lower LPS-neutralizing activity compared to parental LL-37. The analogs, a5, a6, a7 and a8 with higher hydrophobicity displayed LPS-neutralizing activity comparable to that of LL-37, but much lesser prokaryotic selectivity. These results indicate that the proper hydrophobicity of the peptides is crucial to exert the amalgamated property of LPS-neutralizing activity and prokaryotic selectivity. Furthermore, to increase LPS-neutralizing activity of the analog a4 without a remarkable decrease in prokaryotic selectivity, we synthesized Trp-substituted analogs (a4-W1 and a4-W2), in which Phe(5) or Phe(15) of a4 is replaced by Trp. Despite their same prokaryotic selectivity, a4-W2 displayed much higher LPS-neutralizing activity compared to a4-W1. When compared with parental LL-37, a4-W2 showed retained LPS-neutralizing activity and 2.8-fold enhanced prokaryotic selectivity. These results suggest that the effective site for Trp-substitution when designing novel AMPs with higher LPS-neutralizing activity, without a remarkable reduction in prokaryotic selectivity, is the amphipathic interface between the end of the hydrophilic side and the start of the hydrophobic side rather than the central position of the hydrophobic side in their α-helical wheel projection. Taken together, the analog a4-W2 can serve as a promising template for the development of therapeutic agents for the treatment of endotoxic shock and bacterial infection. Copyright © 2012. Published by Elsevier Inc.
Shape-Dependent Electrocatalytic Reduction of CO2 to CO on Triangular Silver Nanoplates.
Liu, Subiao; Tao, Hongbiao; Zeng, Li; Liu, Qi; Xu, Zhenghe; Liu, Qingxia; Luo, Jing-Li
2017-02-15
Electrochemical reduction of CO 2 (CO 2 RR) provides great potential for intermittent renewable energy storage. This study demonstrates a predominant shape-dependent electrocatalytic reduction of CO 2 to CO on triangular silver nanoplates (Tri-Ag-NPs) in 0.1 M KHCO 3 . Compared with similarly sized Ag nanoparticles (SS-Ag-NPs) and bulk Ag, Tri-Ag-NPs exhibited an enhanced current density and significantly improved Faradaic efficiency (96.8%) and energy efficiency (61.7%), together with a considerable durability (7 days). Additionally, CO starts to be observed at an ultralow overpotential of 96 mV, further confirming the superiority of Tri-Ag-NPs as a catalyst for CO 2 RR toward CO formation. Density functional theory calculations reveal that the significantly enhanced electrocatalytic activity and selectivity at lowered overpotential originate from the shape-controlled structure. This not only provides the optimum edge-to-corner ratio but also dominates at the facet of Ag(100) where it requires lower energy to initiate the rate-determining step. This study demonstrates a promising approach to tune electrocatalytic activity and selectivity of metal catalysts for CO 2 RR by creating optimal facet and edge site through shape-control synthesis.
Watershed scale response to climate change--Yampa River Basin, Colorado
Hay, Lauren E.; Battaglin, William A.; Markstrom, Steven L.
2012-01-01
General Circulation Model simulations of future climate through 2099 project a wide range of possible scenarios. To determine the sensitivity and potential effect of long-term climate change on the freshwater resources of the United States, the U.S. Geological Survey Global Change study, "An integrated watershed scale response to global change in selected basins across the United States" was started in 2008. The long-term goal of this national study is to provide the foundation for hydrologically based climate change studies across the nation. Fourteen basins for which the Precipitation Runoff Modeling System has been calibrated and evaluated were selected as study sites. Precipitation Runoff Modeling System is a deterministic, distributed parameter watershed model developed to evaluate the effects of various combinations of precipitation, temperature, and land use on streamflow and general basin hydrology. Output from five General Circulation Model simulations and four emission scenarios were used to develop an ensemble of climate-change scenarios for each basin. These ensembles were simulated with the corresponding Precipitation Runoff Modeling System model. This fact sheet summarizes the hydrologic effect and sensitivity of the Precipitation Runoff Modeling System simulations to climate change for the Yampa River Basin at Steamboat Springs, Colorado.
Inland waterway ports nodal attraction indices relevant in development strategies on regional level
NASA Astrophysics Data System (ADS)
Dinu, O.; Burciu, Ş.; Oprea, C.; Ilie, A.; Rosca, M.
2016-08-01
Present paper aims to propose a set of ranking indices and related criteria, concerning mainly spatial analysis, for the inland waterway port, with special view on inland ports of Danube. Commonly, the attraction potential of a certain transport node is assessed by its spatial accessibility indices considering both spatial features of the location provided by the networks that connect into that node and its economic potential defining the level of traffic flows depending on the economic centers of its hinterland. Paper starts with a overview of the critical needs that are required for potential sites to become inland waterway ports and presents nodal functions that coexist at different levels, leading to a port hierarchy from the points of view of: capacity, connection to hinterland, traffic structure and volume. After a brief review of the key inland waterway port ranking criterion, a selection of nodal attraction measures is made. Particular considerations for the Danube inland port case follows proposed methodology concerning indices of performance for network scale and centrality. As expected, the shorter the distance from an inland port to the nearest access point the greater accessibility. Major differences in ranking, dependent on selected criterion, were registered.
Mosaicked Historic Airborne Imagery from Seward Peninsula, Alaska, Starting in the 1950's
Cherry, Jessica; Wirth, Lisa
2016-12-06
Historical airborne imagery for each Seward Peninsula NGEE Arctic site - Teller, Kougarok, Council - with multiple years for each site. This dataset includes mosaicked, geolocated and, where possible, orthorectified, historic airborne and recent satellite imagery. The older photos were sourced from USGS's Earth Explorer site and the newer, satellite imagery is from the Statewide Digital Mapping Initiative (SDMI) project managed by the Geographic Information Network of Alaska on behalf of the state of Alaska.
Lovewell, Thomas R. J.; McDonagh, Andrew J.; Messenger, Andrew G.; Azzouz, Mimoun; Tazi-Ahnini, Rachid
2015-01-01
Background The autoimmune regulator (AIRE) is expressed in the thymus, particularly in thymic medullary epithelial cells (mTECs), and is required for the ectopic expression of a diverse range of peripheral tissue antigens by mTECs, facilitating their ability to perform negative selection of auto-reactive immature T-cells. The expression profile of peripheral tissue antigens is affected not only by AIRE deficiency but also with variation of AIRE activity in the thymus. Method and Results Therefore we screened 591bp upstream of the AIRE transcription start site including AIRE minimal promoter for single nucleotide polymorphism (SNPs) and identified two SNPs -655R (rs117557896) and -230Y (rs751032) respectively. To study the effect of these variations on AIRE promoter activity we generated a Flp-In host cell line which was stably transfected with a single copy of the reporter vector. Relative promoter activity was estimated by comparing the luciferase specific activity for lysates of the different reporter AIRE promoter-reporter gene constructs including AIRE-655G AIRE-230C, AIRE-655G AIRE-230T and AIRE-655A AIRE-230C. The analysis showed that the commonest haplotype AIRE-655G AIRE-230C has the highest luciferase specific activity (p<0.001). Whereas AIRE-655G AIRE-230T has a luciferase specific activity value that approaches null. Both AIRE promoter polymorphic sites have one allele that forms a CpG methylation site which we determined can be methylated in methylation assays using the M.SssI CpG methyltransferase. Conclusion AIRE-230Y is in a conserved region of the promoter and is adjacent to a predicted WT1 transcription factor binding site, suggesting that AIRE-230Y affects AIRE expression by influencing the binding of biochemical factors to this region. Our findings show that AIRE-655GAIRE-230T haplotype could dramatically alter AIRE transcription and so have an effect on the process of negative selection and affect susceptibility to autoimmune conditions. PMID:25978041
Decoy Plasminogen Receptor Containing a Selective Kunitz-Inhibitory Domain
2015-01-01
Kunitz domain 1 (KD1) of tissue factor pathway inhibitor-2 in which P2′ residue Leu17 (bovine pancreatic trypsin inhibitor numbering) is mutated to Arg selectively inhibits the active site of plasmin with ∼5-fold improved affinity. Thrombin cleavage (24 h extended incubation at a 1:50 enzyme-to-substrate ratio) of the KD1 mutant (Leu17Arg) yielded a smaller molecule containing the intact Kunitz domain with no detectable change in the active-site inhibitory function. The N-terminal sequencing and MALDI-TOF/ESI data revealed that the starting molecule has a C-terminal valine (KD1L17R-VT), whereas the smaller molecule has a C-terminal lysine (KD1L17R-KT). Because KD1L17R-KT has C-terminal lysine, we examined whether it could serve as a decoy receptor for plasminogen/plasmin. Such a molecule might inhibit plasminogen activation as well as the active site of generated plasmin. In surface plasmon resonance experiments, tissue plasminogen activator (tPA) and Glu-plasminogen bound to KD1L17R-KT (Kd ∼ 0.2 to 0.3 μM) but not to KD1L17R-VT. Furthermore, KD1L17R-KT inhibited tPA-induced plasma clot fibrinolysis more efficiently than KD1L17R-VT. Additionally, compared to ε-aminocaproic acid KD1L17R-KT was more effective in reducing blood loss in a mouse liver-laceration injury model, where the fibrinolytic system is activated. In further experiments, the micro(μ)-plasmin–KD1L17R-KT complex inhibited urokinase-induced plasminogen activation on phorbol-12-myristate-13-acetate-stimulated U937 monocyte-like cells, whereas the μ-plasmin–KD1L17R-VT complex failed to inhibit this process. In conclusion, KD1L17R-KT inhibits the active site of plasmin as well as acts as a decoy receptor for the kringle domain(s) of plasminogen/plasmin; hence, it limits both plasmin generation and activity. With its dual function, KD1L17R-KT could serve as a preferred agent for controlling plasminogen activation in pathological processes. PMID:24383758
Decoy plasminogen receptor containing a selective Kunitz-inhibitory domain.
Kumar, Yogesh; Vadivel, Kanagasabai; Schmidt, Amy E; Ogueli, Godwin I; Ponnuraj, Sathya M; Rannulu, Nalaka; Loo, Joseph A; Bajaj, Madhu S; Bajaj, S Paul
2014-01-28
Kunitz domain 1 (KD1) of tissue factor pathway inhibitor-2 in which P2' residue Leu17 (bovine pancreatic trypsin inhibitor numbering) is mutated to Arg selectively inhibits the active site of plasmin with ∼5-fold improved affinity. Thrombin cleavage (24 h extended incubation at a 1:50 enzyme-to-substrate ratio) of the KD1 mutant (Leu17Arg) yielded a smaller molecule containing the intact Kunitz domain with no detectable change in the active-site inhibitory function. The N-terminal sequencing and MALDI-TOF/ESI data revealed that the starting molecule has a C-terminal valine (KD1L17R-VT), whereas the smaller molecule has a C-terminal lysine (KD1L17R-KT). Because KD1L17R-KT has C-terminal lysine, we examined whether it could serve as a decoy receptor for plasminogen/plasmin. Such a molecule might inhibit plasminogen activation as well as the active site of generated plasmin. In surface plasmon resonance experiments, tissue plasminogen activator (tPA) and Glu-plasminogen bound to KD1L17R-KT (Kd ∼ 0.2 to 0.3 μM) but not to KD1L17R-VT. Furthermore, KD1L17R-KT inhibited tPA-induced plasma clot fibrinolysis more efficiently than KD1L17R-VT. Additionally, compared to ε-aminocaproic acid KD1L17R-KT was more effective in reducing blood loss in a mouse liver-laceration injury model, where the fibrinolytic system is activated. In further experiments, the micro(μ)-plasmin-KD1L17R-KT complex inhibited urokinase-induced plasminogen activation on phorbol-12-myristate-13-acetate-stimulated U937 monocyte-like cells, whereas the μ-plasmin-KD1L17R-VT complex failed to inhibit this process. In conclusion, KD1L17R-KT inhibits the active site of plasmin as well as acts as a decoy receptor for the kringle domain(s) of plasminogen/plasmin; hence, it limits both plasmin generation and activity. With its dual function, KD1L17R-KT could serve as a preferred agent for controlling plasminogen activation in pathological processes.
Factors affecting measured aircraft sound levels in the vicinity of start-of-takeoff roll
NASA Astrophysics Data System (ADS)
Richard, Horonjeff; Fleming, Gregg G.; Rickley, Edward J.; Connor, Thomas L.
This paper presents the findings of a recently conducted measurement and analysis program of jet transport aircraft sound levels in the vicinity of the star-of-takeoff roll. The purpose of the program was two-fold: (1) to evaluate the computational accuracy of the Federal Aviation Administration's Integrated Noise Model (INM) in the vicinity of start-of-takeoff roll with a recently updated database (INM 3.10), and (2) to provide guidance for future model improvements. Focusing on the second of these two goals, this paper examines several factors affecting Sound Exposure Levels (SELs) in the hemicircular area behind the aircraft brake release point at the start-of-takeoff. In addition to the aircraft type itself, these factors included the geometric relationship of the measurement site to the runway, the wind velocity (speed and direction), aircraft grow weight, and start-of-roll mode (static or rolling start).
Coupling GIS and multivariate approaches to reference site selection for wadeable stream monitoring.
Collier, Kevin J; Haigh, Andy; Kelly, Johlene
2007-04-01
Geographic Information System (GIS) was used to identify potential reference sites for wadeable stream monitoring, and multivariate analyses were applied to test whether invertebrate communities reflected a priori spatial and stream type classifications. We identified potential reference sites in segments with unmodified vegetation cover adjacent to the stream and in >85% of the upstream catchment. We then used various landcover, amenity and environmental impact databases to eliminate sites that had potential anthropogenic influences upstream and that fell into a range of access classes. Each site identified by this process was coded by four dominant stream classes and seven zones, and 119 candidate sites were randomly selected for follow-up assessment. This process yielded 16 sites conforming to reference site criteria using a conditional-probabilistic design, and these were augmented by an additional 14 existing or special interest reference sites. Non-metric multidimensional scaling (NMS) analysis of percent abundance invertebrate data indicated significant differences in community composition among some of the zones and stream classes identified a priori providing qualified support for this framework in reference site selection. NMS analysis of a range standardised condition and diversity metrics derived from the invertebrate data indicated a core set of 26 closely related sites, and four outliers that were considered atypical of reference site conditions and subsequently dropped from the network. Use of GIS linked to stream typology, available spatial databases and aerial photography greatly enhanced the objectivity and efficiency of reference site selection. The multi-metric ordination approach reduced variability among stream types and bias associated with non-random site selection, and provided an effective way to identify representative reference sites.
10 CFR 960.3-2-2-2 - Selection of sites within geohydrologic settings.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 10 Energy 4 2013-01-01 2013-01-01 false Selection of sites within geohydrologic settings. 960.3-2-2-2 Section 960.3-2-2-2 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR THE PRELIMINARY SCREENING OF POTENTIAL SITES FOR A NUCLEAR WASTE REPOSITORY Implementation Guidelines § 960.3-2-2-2 Selection...
10 CFR 960.3-2-2-2 - Selection of sites within geohydrologic settings.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 10 Energy 4 2014-01-01 2014-01-01 false Selection of sites within geohydrologic settings. 960.3-2-2-2 Section 960.3-2-2-2 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR THE PRELIMINARY SCREENING OF POTENTIAL SITES FOR A NUCLEAR WASTE REPOSITORY Implementation Guidelines § 960.3-2-2-2 Selection...
10 CFR 960.3-2-2-2 - Selection of sites within geohydrologic settings.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 10 Energy 4 2012-01-01 2012-01-01 false Selection of sites within geohydrologic settings. 960.3-2-2-2 Section 960.3-2-2-2 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR THE PRELIMINARY SCREENING OF POTENTIAL SITES FOR A NUCLEAR WASTE REPOSITORY Implementation Guidelines § 960.3-2-2-2 Selection...
Federal Register 2010, 2011, 2012, 2013, 2014
2011-02-01
... action alternatives and the No Action Alternative. Natural, cultural, and socioeconomic resource impacts.... Cohn, Chief, or Issac J. Gaston, Site Selection Specialist, Capacity Planning and Site Selection Branch..., Capacity Planning and Site Selection Branch. [FR Doc. 2011-1817 Filed 1-31-11; 8:45 am] BILLING CODE P ...
Federal Register 2010, 2011, 2012, 2013, 2014
2011-03-14
... Subsidiary of Legrand North America; Including On-Site Leased Workers From Select Staffing, also Known as... subsidiary of Legrand North America, including on-site leased workers from Select Staffing and Aerotek... reviewed the certification for workers of the subject firm. The company reports that Select Staffing, an on...
Anteau, M.J.; Sherfy, M.H.; Wiltermuth, M.T.
2012-01-01
Animals use proximate cues to select resources that maximize individual fitness. When animals have a diverse array of available habitats, those selected could give insights into true habitat preferences. Since the construction of the Garrison Dam on the Missouri River in North Dakota, Lake Sakakawea (SAK) has become an important breeding area for federally threatened piping plovers (Charadrius melodus; hereafter plovers). We used conditional logistic regression to examine nest-site selection at fine scales (1, 3, and 10 m) during summers 2006-2009 by comparing characteristics at 351 nests to those of 668 random sites within nesting territories. Plovers selected sites (1 m 2) that were lower than unused random sites, increasing the risk of nest inundation. Plovers selected nest sites that were flat, had little silt, and at least 1 cobble; they also selected for 3-m radius nest areas that were relatively flat and devoid of vegetation and litter. Ninety percent of nests had <38% coverage of silt and <10% slope at the site, and <15% coverage of vegetation or litter and <31% slope within the 3-m radius. Gravel was selected for at nest sites (11% median), but against in the area 10-m from the nest, suggesting plovers select for patches or strips of gravel. Although elevation is rarely evaluated in studies of ground-nesting birds, our results underscore its importance in habitat-selection studies. Relative to where plovers historically nested, habitat at SAK has more diverse topography, substrate composition, vegetation communities, and greater water-level fluctuations. Accordingly, our results provide an example of how habitat-selection results can be interpreted as habitat preferences because they are not influenced by desired habitats being scarce or absent. Further, our results will be useful for directing habitat conservation for plovers and interpreting other habitat-selection studies.
Anteau, Michael J.; Sherfy, Mark H.; Wiltermuth, Mark T.
2012-01-01
Animals use proximate cues to select resources that maximize individual fitness. When animals have a diverse array of available habitats, those selected could give insights into true habitat preferences. Since the construction of the Garrison Dam on the Missouri River in North Dakota, Lake Sakakawea (SAK) has become an important breeding area for federally threatened piping plovers (Charadrius melodus; hereafter plovers). We used conditional logistic regression to examine nest-site selection at fine scales (1, 3, and 10 m) during summers 2006–2009 by comparing characteristics at 351 nests to those of 668 random sites within nesting territories. Plovers selected sites (1 m2) that were lower than unused random sites, increasing the risk of nest inundation. Plovers selected nest sites that were flat, had little silt, and at least 1 cobble; they also selected for 3-m radius nest areas that were relatively flat and devoid of vegetation and litter. Ninety percent of nests had <38% coverage of silt and <10% slope at the site, and <15% coverage of vegetation or litter and <31% slope within the 3-m radius. Gravel was selected for at nest sites (11% median), but against in the area 10-m from the nest, suggesting plovers select for patches or strips of gravel. Although elevation is rarely evaluated in studies of ground-nesting birds, our results underscore its importance in habitat-selection studies. Relative to where plovers historically nested, habitat at SAK has more diverse topography, substrate composition, vegetation communities, and greater water-level fluctuations. Accordingly, our results provide an example of how habitat-selection results can be interpreted as habitat preferences because they are not influenced by desired habitats being scarce or absent. Further, our results will be useful for directing habitat conservation for plovers and interpreting other habitat-selection studies.
Anteau, Michael J; Sherfy, Mark H; Wiltermuth, Mark T
2012-01-01
Animals use proximate cues to select resources that maximize individual fitness. When animals have a diverse array of available habitats, those selected could give insights into true habitat preferences. Since the construction of the Garrison Dam on the Missouri River in North Dakota, Lake Sakakawea (SAK) has become an important breeding area for federally threatened piping plovers (Charadrius melodus; hereafter plovers). We used conditional logistic regression to examine nest-site selection at fine scales (1, 3, and 10 m) during summers 2006-2009 by comparing characteristics at 351 nests to those of 668 random sites within nesting territories. Plovers selected sites (1 m(2)) that were lower than unused random sites, increasing the risk of nest inundation. Plovers selected nest sites that were flat, had little silt, and at least 1 cobble; they also selected for 3-m radius nest areas that were relatively flat and devoid of vegetation and litter. Ninety percent of nests had <38% coverage of silt and <10% slope at the site, and <15% coverage of vegetation or litter and <31% slope within the 3-m radius. Gravel was selected for at nest sites (11% median), but against in the area 10-m from the nest, suggesting plovers select for patches or strips of gravel. Although elevation is rarely evaluated in studies of ground-nesting birds, our results underscore its importance in habitat-selection studies. Relative to where plovers historically nested, habitat at SAK has more diverse topography, substrate composition, vegetation communities, and greater water-level fluctuations. Accordingly, our results provide an example of how habitat-selection results can be interpreted as habitat preferences because they are not influenced by desired habitats being scarce or absent. Further, our results will be useful for directing habitat conservation for plovers and interpreting other habitat-selection studies.
Anteau, Michael J.; Sherfy, Mark H.; Wiltermuth, Mark T.
2012-01-01
Animals use proximate cues to select resources that maximize individual fitness. When animals have a diverse array of available habitats, those selected could give insights into true habitat preferences. Since the construction of the Garrison Dam on the Missouri River in North Dakota, Lake Sakakawea (SAK) has become an important breeding area for federally threatened piping plovers (Charadrius melodus; hereafter plovers). We used conditional logistic regression to examine nest-site selection at fine scales (1, 3, and 10 m) during summers 2006–2009 by comparing characteristics at 351 nests to those of 668 random sites within nesting territories. Plovers selected sites (1 m2) that were lower than unused random sites, increasing the risk of nest inundation. Plovers selected nest sites that were flat, had little silt, and at least 1 cobble; they also selected for 3-m radius nest areas that were relatively flat and devoid of vegetation and litter. Ninety percent of nests had <38% coverage of silt and <10% slope at the site, and <15% coverage of vegetation or litter and <31% slope within the 3-m radius. Gravel was selected for at nest sites (11% median), but against in the area 10-m from the nest, suggesting plovers select for patches or strips of gravel. Although elevation is rarely evaluated in studies of ground-nesting birds, our results underscore its importance in habitat-selection studies. Relative to where plovers historically nested, habitat at SAK has more diverse topography, substrate composition, vegetation communities, and greater water-level fluctuations. Accordingly, our results provide an example of how habitat-selection results can be interpreted as habitat preferences because they are not influenced by desired habitats being scarce or absent. Further, our results will be useful for directing habitat conservation for plovers and interpreting other habitat-selection studies. PMID:22299037
Journal Article: EPA's National Dioxin Air Monitoring Network ...
The U.S. Environmental Protection Agency (U.S. EPA) established the National Dioxin Air Monitoring Network (NDAMN) in June of 1998, and operated it until November of 2004. The objective of NDAMN was to determine background air concentrations of polychlorinated dibenzo-p-dioxins (PCDDs), polychlorinated dibenzofurans (PCDFs), and dioxin-like polychlorinated biphenyls (dl-PCBs). NDAMN started with 10 sampling sites, adding more over time until the final count of 34 sites was reached by the beginning of 2003. Samples were taken quarterly, and the final sample count was 685. All samples were measured for 17 PCDD/PCDF congeners, 8 PCDD/PCDF homologue groups, and 7 dl-PCBs (note: 5 additional dl-PCBs were added for samples starting in the summer of 2002; 317 samples had measurements of 12 dl-PCBs). The overall average total toxic equivalent (TEQ) concentration in the United States was 11.2 fg TEQ m−3 with dl-PCBs contributing 0.8 fg TEQ m−3 (7%) to this total. The archetype dioxin and furan background air congener profile was seen in the survey averages and in most individual samples. This archetype profile is characterized by low and similar concentrations for tetra – through hexa PCDD/PCDF congeners, with elevations in four congeners – a hepta dioxin and furan congener, and both octa congeners. Sites were generally categorized as urban (4 sites), rural (23 sites), or remote (7 sites). The average TEQ concentrations over all sites and samples within these cat
SELECTING SITES FOR COMPARISON WITH CREATED WETLANDS
The paper describes the method used for selecting natural wetlands to compare with created wetlands. The results of the selection process and the advantages and disadvantages of the method are discussed. The random site selection method required extensive field work and may have ...
McInnes, Rhona J; Arbuckle, Alix; Hoddinott, Pat
2015-04-02
Exclusive breastfeeding for six months is recommended but few parents achieve this; particularly younger and less well-educated mothers. Many parents introduce infant formula milk to manage feeding but describe a desire to express breastmilk alongside a lack of support or information. The Internet is highlighted as a key resource. This study aimed to examine UK websites on expressing breastmilk to identify key messages and how information is provided. We used search terms in Google to identify websites with information rich content on expressing breastmilk and breast pumps. Ten sites were purposively selected at two time points in 2013 and 2014 to represent 3 categories: commercial, NHS or 3(rd) sector (voluntary or not for profit). Each site was reviewed by two researchers, data and reflective analytical notes were uploaded into NVivo and thematic data analysis undertaken. Sites varied considerably in their design, use of images, videos, audio files, product placement and marketing opportunities. Three key themes emerged: depiction of expressing; reasons to express; and recommendations about expressing. Inconsistent and conflicting information was common within and between sites. Expressing was portrayed as similar to, but easier than, breastfeeding although at the same time difficult and requiring to be learned. Expressed breastmilk is promoted by mainly commercial sites as immediately available, although pumps were also presented as needing to be concealed, not heard or seen. Health benefits were the overarching reason for expressing. Although predicated on separation from the baby, commercial sites identified this as a positive choice while other sites focused on separation due to circumstance. Commercial sites emphasised restrictions related to breastfeeding, lack of sleep and bonding with the father and wider family. Non-commercial sites emphasised hand expression, with some not mentioning breast pumps. Practical information about starting expressing in relation to infant age or duration of breastfeeding was conflicting. Internet information about expressing breastmilk is inconsistent, incomplete and not evidence informed. The lack of research evidence on the relationship between expressing and feeding outcomes has provided opportunities for commercial companies, which have the potential to further exacerbate observed health inequalities. Access to good quality information based on robust evidence is urgently required.
Kördel, Werner; Bernhardt, Cornelia; Derz, Kerstin; Hund-Rinke, Kerstin; Harmsen, Joop; Peijnenburg, Willie; Comans, Rob; Terytze, Konstantin
2013-10-15
Nearly all publications dealing with availability or bioavailability of soil pollutants start with the following statement: the determination of total pollutant content will lead to an over-estimation of risk. However, an assessment of contaminated sites should be based on the determination of mobile fractions of pollutants, and the fractions with potential for mobilisation that threaten groundwater and surface water, and the actual and potential fractions available for uptake by plants, soil microflora and soil organisms. After reviewing the literature for method proposals concerning the determination of available/bioavailable fractions of contaminants with respect to leaching, plants, microorganisms (biodegradation) and soil organisms, we propose a testing and assessment scheme for contaminated sites. The proposal includes (i) already accepted and used methods, (ii) methods which are under standardisation, and (iii) methods for which development has just started in order to promote urgently needed research. Copyright © 2013 Elsevier B.V. All rights reserved.
Corbett-Detig, Russell B
2016-09-01
Chromosomal inversions are widespread among taxa, and have been implicated in a number of biological processes including adaptation, sex chromosome evolution, and segregation distortion. Consistent with selection favoring linkage between loci, it is well established that length is a selected trait of inversions. However, the factors that affect the distribution of inversion breakpoints remain poorly understood. "Sensitive sites" have been mapped on all euchromatic chromosome arms in Drosophila melanogaster, and may be a source of natural selection on inversion breakpoint positions. Briefly, sensitive sites are genomic regions wherein proximal structural rearrangements result in large reductions in local recombination rates in heterozygotes. Here, I show that breakpoints of common inversions are significantly more likely to lie within a cytological band containing a sensitive site than are breakpoints of rare inversions. Furthermore, common inversions for which neither breakpoint intersects a sensitive site are significantly longer than rare inversions, but common inversions whose breakpoints intersect a sensitive site show no evidence for increased length. I interpret these results to mean that selection favors inversions whose breakpoints disrupt synteny near to sensitive sites, possibly because these inversions suppress recombination in large genomic regions. To my knowledge this is the first evidence consistent with positive selection acting on inversion breakpoint positions. Copyright © 2016 by the Genetics Society of America.
Selection of the simplest RNA that binds isoleucine
LOZUPONE, CATHERINE; CHANGAYIL, SHANKAR; MAJERFELD, IRENE; YARUS, MICHAEL
2003-01-01
We have identified the simplest RNA binding site for isoleucine using selection-amplification (SELEX), by shrinking the size of the randomized region until affinity selection is extinguished. Such a protocol can be useful because selection does not necessarily make the simplest active motif most prominent, as is often assumed. We find an isoleucine binding site that behaves exactly as predicted for the site that requires fewest nucleotides. This UAUU motif (16 highly conserved positions; 27 total), is also the most abundant site in successful selections on short random tracts. The UAUU site, now isolated independently at least 63 times, is a small asymmetric internal loop. Conserved loop sequences include isoleucine codon and anticodon triplets, whose nucleotides are required for amino acid binding. This reproducible association between isoleucine and its coding sequences supports the idea that the genetic code is, at least in part, a stereochemical residue of the most easily isolated RNA–amino acid binding structures. PMID:14561881
Dissecting protein:protein interactions between transcription factors with an RNA aptamer.
Tian, Y; Adya, N; Wagner, S; Giam, C Z; Green, M R; Ellington, A D
1995-01-01
Nucleic acid aptamers isolated from random sequence pools have generally proven useful at inhibiting the interactions of nucleic acid binding proteins with their cognate nucleic acids. In order to develop reagents that could also be used to study protein:protein interactions, we have used in vitro selection to search for RNA aptamers that could interact with the transactivating protein Tax from human T-cell leukemia virus. Tax does not normally bind to nucleic acids, but instead stimulates transcription by interacting with a variety of cellular transcription factors, including the cyclic AMP-response element binding protein (CREB), NF-kappa B, and the serum response factor (SRF). Starting from a pool of greater than 10(13) different RNAs with a core of 120 random sequence positions, RNAs were selected for their ability to be co-retained on nitrocellulose filters with Tax. After five cycles of selection and amplification, a single nucleic acid species remained. This aptamer was found to bind Tax with high affinity and specificity, and could disrupt complex formation between Tax and NF-kappa B, but not with SRF. The differential effects of our aptamer probe on protein:protein interactions suggest a model for how the transcription factor binding sites on the surface of the Tax protein are organized. This model is consistent with data from a variety of other studies. PMID:7489503
Snapshots of Dynamics in Synthesizing N6-isopentenyladenosine at tRNA Anticodon†,‡
Chimnaronk, Sarin; Forouhar, Farhad; Sakai, Junichi; Yao, Min; Tron, Cecile M.; Atta, Mohamed; Fontecave, Marc; Hunt, John F.; Tanaka, Isao
2009-01-01
Bacterial and eukaryotic transfer RNAs that decode codons starting with uridine have a hydrophobically-hypermodified adenosine at the position 37 (A37) adjacent to the 3′-end of the anticodon, which is essential for efficient and highly accurate protein translation by the ribosome. However, it remains unclear how the corresponding tRNAs are selected to be modified by alkylation at the correct position of the adenosine base. We have determined a series of the crystal structures of bacterial tRNA isopentenyltransferase (MiaA) in apo- and tRNA-bound forms, which completely render snapshots of substrate selections during modification of RNA. A compact evolutionary inserted domain (herein ‘swinging domain’) in MiaA that exhibits as a highly mobile entity moves around the catalytic domain as likely to reach and trap the tRNA substrate. Thereby, MiaA clamps the anticodon stem loop of tRNA substrate between the catalytic and swinging domains, where the two conserved elongated residues from the swinging domain pinch the two flanking A36 and A38 together to squeeze out A37 into the reaction tunnel. The site-specific isopentenylation of RNA is thus ensured by a characteristic pinch-and-flip mechanism and by a reaction tunnel to confine the substrate selection. Furthermore, combining information from soaking experiments with structural comparisons, we propose a mechanism for the ordered substrate-binding of MiaA. PMID:19435325
15 CFR 921.12 - Post site selection.
Code of Federal Regulations, 2011 CFR
2011-01-01
... NOAA approval of a proposed site, the state may submit a request for funds to develop the draft... and biological characteristics of the site approved by NOAA necessary for providing EIS information to NOAA. The state's request for these post site selection funds must be accompanied by the information...
15 CFR 921.12 - Post site selection.
Code of Federal Regulations, 2014 CFR
2014-01-01
... NOAA approval of a proposed site, the state may submit a request for funds to develop the draft... and biological characteristics of the site approved by NOAA necessary for providing EIS information to NOAA. The state's request for these post site selection funds must be accompanied by the information...
15 CFR 921.12 - Post site selection.
Code of Federal Regulations, 2013 CFR
2013-01-01
... NOAA approval of a proposed site, the state may submit a request for funds to develop the draft... and biological characteristics of the site approved by NOAA necessary for providing EIS information to NOAA. The state's request for these post site selection funds must be accompanied by the information...
15 CFR 921.12 - Post site selection.
Code of Federal Regulations, 2012 CFR
2012-01-01
... NOAA approval of a proposed site, the state may submit a request for funds to develop the draft... and biological characteristics of the site approved by NOAA necessary for providing EIS information to NOAA. The state's request for these post site selection funds must be accompanied by the information...
15 CFR 921.12 - Post site selection.
Code of Federal Regulations, 2010 CFR
2010-01-01
... NOAA approval of a proposed site, the state may submit a request for funds to develop the draft... and biological characteristics of the site approved by NOAA necessary for providing EIS information to NOAA. The state's request for these post site selection funds must be accompanied by the information...
Turbidity monitoring at select MDOT construction sites.
DOT National Transportation Integrated Search
2012-06-01
The objective of this project was to establish baseline turbidity conditions at select construction : sites by establishing a water quality monitoring program and documenting MDOT approved : BMPs on site. In 2009 the United States Environmental Prote...
US EPA record of decision review for landfills: Sanitary landfill (740-G), Savannah River Site
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1993-06-01
This report presents the results of a review of the US Environmental Protection Agency (EPA) Record of Decision System (RODS) database search conducted to identify Superfund landfill sites where a Record of Decision (ROD) has been prepared by EPA, the States or the US Army Corps of Engineers describing the selected remedy at the site. ROD abstracts from the database were reviewed to identify site information including site type, contaminants of concern, components of the selected remedy, and cleanup goals. Only RODs from landfill sites were evaluated so that the results of the analysis can be used to support themore » remedy selection process for the Sanitary Landfill at the Savannah River Site (SRS).« less
Qiao, Huan; May, James M.
2012-01-01
Transcription of the ascorbate transporter, SVCT2, is driven by two distinct promoters in exon 1 of the transporter sequence. The exon 1a promoter lacks a classical transcription start site and little is known about regulation of promoter activity in the transcription start site core (TSSC) region. Here we present evidence that the TSSC binds the multifunctional initiator-binding protein YY1. Electrophoresis shift assays using YY1 antibody showed that YY1 is present as one of two major complexes that specifically bind to the TSSC. The other complex contains the transcription factor NF-Y. Mutations in the TSSC that decreased YY1 binding also impaired the exon 1a promoter activity despite the presence of an upstream activating NF-Y/USF complex, suggesting that YY1 is involved in the regulation of the exon 1a transcription. Furthermore, YY1 interaction with NF-Y and/or USF synergistically enhanced the exon 1a promoter activity in transient transfections and co-activator p300 enhanced their synergistic activation. We propose that the TSSC plays a vital role in the exon 1a transcription and that this function is partially carried out by the transcription factor YY1. Moreover, co-activator p300 might be able to synergistically enhance the TSSC function via a “bridge” mechanism with upstream sequences. PMID:22532872
An APC/C-Cdh1 Biosensor Reveals the Dynamics of Cdh1 Inactivation at the G1/S Transition.
Ondracka, Andrej; Robbins, Jonathan A; Cross, Frederick R
2016-01-01
B-type cyclin-dependent kinase activity must be turned off for mitotic exit and G1 stabilization. B-type cyclin degradation is mediated by the anaphase-promoting complex/cyclosome (APC/C); during and after mitotic exit, APC/C is dependent on Cdh1. Cdh1 is in turn phosphorylated and inactivated by cyclin-CDK at the Start transition of the new cell cycle. We developed a biosensor to assess the cell cycle dynamics of APC/C-Cdh1. Nuclear exit of the G1 transcriptional repressor Whi5 is a known marker of Start; APC/C-Cdh1 is inactivated 12 min after Whi5 nuclear exit with little measurable cell-to-cell timing variability. Multiple phosphorylation sites on Cdh1 act in a redundant manner to repress its activity. Reducing the number of phosphorylation sites on Cdh1 can to some extent be tolerated for cell viability, but it increases variability in timing of APC/C-Cdh1 inactivation. Mutants with minimal subsets of phosphorylation sites required for viability exhibit striking stochasticity in multiple responses including budding, nuclear division, and APC/C-Cdh1 activity itself. Multiple cyclin-CDK complexes, as well as the stoichiometric inhibitor Acm1, contribute to APC/C-Cdh1 inactivation; this redundant control is likely to promote rapid and reliable APC/C-Cdh1 inactivation immediately following the Start transition.
Development of Understanding of Selected Science Phenomena in Young Children.
ERIC Educational Resources Information Center
Donaldson, Marcia Jackson
The major purpose of this study was to investigate developmental patterns of understandings of four types of selected phenomena possessed by economically and racially different boys and girls. A total of 64 boys and girls, 32 blacks and 32 whites, were selected from Head Start, kindergarten, nursery, and primary schooling environments and then…
Fisher, Jessica F.; Cole, Kenneth L.; Anderson, R. Scott
2006-01-01
The fossil and sub-fossil plant macrofossils and pollen grains found in packrat middens can serve as important proxies for climate and vegetation change in the arid Southwestern United States. A new application for packrat midden research is in understanding post-settlement vegetation changes caused by the grazing of domesticated animals. This work examines a series of 27 middens from Glen Canyon National Recreation Area (GLCA), spanning from 995 yr BP to the present, which detail vegetation during the periods just prior to, and following, the introduction of domesticated grazers. By comparing middens deposited before and after the start of grazing by domesticated sheep and cattle, the effect on the native plant communities through time can be determined. This analysis of change through time is augmented by measurements of change through space by contrasting contemporaneous middens from nearby similar grazed and ungrazed sites. These comparisons are only made possible by the presence of inaccessible ungrazed areas surrounded by steep cliffs. Multivariate ordinations of the plant assemblages from packrat middens demonstrated that even though all middens were selected from similar geologic substrates, soils, and vegetation type, their primary variability was site-to-site. This suggests that selecting comparable grazed versus ungrazed study treatments would be difficult, and that two similar sites several kilometers apart should not be assumed to have been the same prior to grazing without pre-grazing data. But, the changes through time on grazed areas, as well as the differences between grazed and ungrazed areas in the diversity of certain taxonomic groups, both suggest that grazing by domesticated ungulates has had a noticeable effect on the vegetation. The changes seen through time suggested that grazing lowered the number of taxa recorded and lessened the pre-existing differences within sites, homogenizing the resultant plant associations. Late Holocene pre-settlement middens, and modern middens from ungrazed areas, contained more native grasses, skunkbush sumac (Rhus trilobata), blackbrush (Coleogyne ramosissima), winterfat (Krascheninnikovia lanata), Utah serviceberry (Amelanchier utahensis), and roundleaf buffaloberry (Shepherdia rotundifolia) than modern middens from grazed areas. Pollen data supported the macrofossil data, recording decreases in pollen of the goosefoot family (Chenopodiaceae), grass family (Poaceae), and globemallow (Sphaeralcea spp.) from pre- to post-settlement.
Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.
1998-01-01
Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886
Hassanain, Mazen; Zamakhshary, Mohammed; Farhat, Ghada; Al-Badr, Ahmed
2017-04-01
The objective of this study was to assess whether an intervention on process efficiency using the Lean methodology leads to improved utilization of the operating room (OR), as measured by key performance metrics of OR efficiency. A quasi-experimental design was used to test the impact of the intervention by comparing pre-intervention and post-intervention data on five key performance indicators. The ORs of 12 hospitals were selected across regions of the Kingdom of Saudi Arabia (KSA). The participants were patients treated at these hospitals during the study period. The intervention comprised the following: (i) creation of visual dashboards that enable starting the first case on time; (ii) use of computerized surgical list management; (iii) optimization of time allocation; (iv) development of an operating model with policies and procedures for the pre-anesthesia clinic; and (iv) creation of a governance structure with policies and procedures for day surgeries. The following were the main outcome measures: on-time start for the first case, room turnover times, percent of overrun cases, average weekly procedure volume and OR utilization. The hospital exhibited statistically significant improvements in the following performance metrics: on-time start for the first case, room turnover times and percent of overrun cases. A statistically significant difference in OR utilization or average weekly procedure volumes was not detected. The implementation of a Lean-based intervention targeting process efficiency applied in ORs across various KSA hospitals resulted in encouraging results on some metrics at some sites, suggesting that the approach has the potential to produce significant benefit in the future. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Nebraska files suit to block disposal site
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
Just when the Central Interstate Low-Level Radioactive Waste Compact thought things might be starting to go its way, the state of Nebraska, following instructions from Gov. Ben Nelson, has filed a new lawsuit to block development of an LLW disposal site within its borders. The suit maintains that the recently reconfigured proposed site (in which an area of wetlands was excluded) has not received [open quotes]community consent,[close quotes] as required by state law; says that site developer, US Ecology, has not obtained county consent; and asks that the court permanently prevent development of any LLW site in Nebraska until communitymore » consent is demonstrated.« less
Winter roost-site selection by seminole bats in the lower coastal plain of South Carolina
Cris D. Hein; Steven B. Castleberry; Karl V. Miller
2005-01-01
The winter roost-site selection of most North American foliage-roosting bats is relatively unknown. We examined winter roost-site selection of Seminole bats (Lasiurus seminolus) in the Lower Coastal Plain of South Carolina during January 2004. Seminole bats used a variety of day-roost structures including the canopy of overstory hardwood trees,...
Constraints, Approach, and Status of Mars Surveyor 2001 Landing Site Selection
NASA Technical Reports Server (NTRS)
Golombek, M.; Bridges, N.; Briggs, G.; Gilmore, M.; Haldemann, A.; Parker, T.; Saunders, R.; Spencer, D.; Smith, J.; Soderblom, L.
1999-01-01
There are many similarities between the Mars Surveyor '01 (MS '01) landing site selection process and that of Mars Pathfinder. The selection process includes two parallel activities in which engineers define and refine the capabilities of the spacecraft through design, testing and modeling and scientists define a set of landing site constraints based on the spacecraft design and landing scenario. As for Pathfinder, the safety of the site is without question the single most important factor, for the simple reason that failure to land safely yields no science and exposes the mission and program to considerable risk. The selection process must be thorough and defensible and capable of surviving multiple withering reviews similar to the Pathfinder decision. On Pathfinder, this was accomplished by attempting to understand the surface properties of sites using available remote sensing data sets and models based on them. Science objectives are factored into the selection process only after the safety of the site is validated. Finally, as for Pathfinder, the selection process is being done in an open environment with multiple opportunities for community involvement including open workshops, with education and outreach opportunities. Additional information is contained in the original extended abstract.
Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan
2008-01-01
Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.
Dugal, Cherie J; van Beest, Floris M; Vander Wal, Eric; Brook, Ryan K
2013-10-01
Endemic and emerging diseases are rarely uniform in their spatial distribution or prevalence among cohorts of wildlife. Spatial models that quantify risk-driven differences in resource selection and hunter mortality of animals at fine spatial scales can assist disease management by identifying high-risk areas and individuals. We used resource selection functions (RSFs) and selection ratios (SRs) to quantify sex- and age-specific resource selection patterns of collared (n = 67) and hunter-killed (n = 796) nonmigratory elk (Cervus canadensis manitobensis) during the hunting season between 2002 and 2012, in southwestern Manitoba, Canada. Distance to protected area was the most important covariate influencing resource selection and hunter-kill sites of elk (AICw = 1.00). Collared adult males (which are most likely to be infected with bovine tuberculosis (Mycobacterium bovis) and chronic wasting disease) rarely selected for sites outside of parks during the hunting season in contrast to adult females and juvenile males. The RSFs showed selection by adult females and juvenile males to be negatively associated with landscape-level forest cover, high road density, and water cover, whereas hunter-kill sites of these cohorts were positively associated with landscape-level forest cover and increasing distance to streams and negatively associated with high road density. Local-level forest was positively associated with collared animal locations and hunter-kill sites; however, selection was stronger for collared juvenile males and hunter-killed adult females. In instances where disease infects a metapopulation and eradication is infeasible, a principle goal of management is to limit the spread of disease among infected animals. We map high-risk areas that are regularly used by potentially infectious hosts but currently underrepresented in the distribution of kill sites. We present a novel application of widely available data to target hunter distribution based on host resource selection and kill sites as a promising tool for applying selective hunting to the management of transmissible diseases in a game species.
Social Network Privacy: Overcoming Facebook Policies that put Users at Risk
2011-01-01
risks. The Rise of Facebook Facebook is one of the largest web sites in the world. The site was started in 2004 by Mark Zucker- berg when he was...sites collect. Aggregation of Facebook Data Could a more sophisticated aggregation of Facebook data allow privacy to be exposed? Facebook CEO Mark ... Zuckerberg says he is providing “the power to share in or- der to make the world more open…” Facebook’s advanced search allows one to query the
Novel Immune Modulating Cellular Vaccine for Prostate Cancer
2014-10-01
restriction sites. Murine PSMA : The cDNA encoding mPSMA was purchased from Sino Biologicals and was cloned into the HindIII and BamHI sites of pSP73-Sph/A64...sequence) and reverse primer 5’-TATATAGAGCTCTCAGATGTTCCGATACACATCTC-3’ Murine PSMA no signal sequence (mPSMA-SS): Murine PSMA minus the signal sequence...contains a HindIII site for cloning and utilizes an ATG that lies downstream of the signal sequence as the start codon in PSMA -SS ( PSMA without signal
77 FR 32637 - Sunshine Act Meeting Notice
Federal Register 2010, 2011, 2012, 2013, 2014
2012-06-01
... 20551. Status: Open. On the day of the meeting, you will be able to view the meeting via Web cast from a link available on the Board's public Web site. You do not need to register to view the Web cast of the... start of the meeting. Both links may be accessed from the Board's public Web site at www.federalreserve...
A proposed site index for red spruce in the Northeast
T. F. McLintock; C. A. Bickford
1957-01-01
A basic principle that should be recognized at the start of any forward-looking forest-management plan is that the intensity or level of management that can be profitably applied to a given tract will be controlled largely by four factors: markets, labor supply, accessibility, and site. The more favorable these factors are, the higher the intensity of management that...
Factors affecting the persistence of drug-induced reprogramming of the cancer methylome
Bell, Joshua S. K.; Kagey, Jacob D.; Barwick, Benjamin G.; Dwivedi, Bhakti; McCabe, Michael T.; Kowalski, Jeanne; Vertino, Paula M.
2016-01-01
ABSTRACT Aberrant DNA methylation is a critical feature of cancer. Epigenetic therapy seeks to reverse these changes to restore normal gene expression. DNA demethylating agents, including 5-aza-2′-deoxycytidine (DAC), are currently used to treat certain leukemias, and can sensitize solid tumors to chemotherapy and immunotherapy. However, it has been difficult to pin the clinical efficacy of these agents to specific demethylation events, and the factors that contribute to the durability of response remain largely unknown. Here we examined the genome-wide kinetics of DAC-induced DNA demethylation and subsequent remethylation after drug withdrawal in breast cancer cells. We find that CpGs differ in both their susceptibility to demethylation and propensity for remethylation after drug removal. DAC-induced demethylation was most apparent at CpGs with higher initial methylation levels and further from CpG islands. Once demethylated, such sites exhibited varied remethylation potentials. The most rapidly remethylating CpGs regained >75% of their starting methylation within a month of drug withdrawal. These sites had higher pretreatment methylation levels, were enriched in gene bodies, marked by H3K36me3, and tended to be methylated in normal breast cells. In contrast, a more resistant class of CpG sites failed to regain even 20% of their initial methylation after 3 months. These sites had lower pretreatment methylation levels, were within or near CpG islands, marked by H3K79me2 or H3K4me2/3, and were overrepresented in sites that become aberrantly hypermethylated in breast cancers. Thus, whereas DAC-induced demethylation affects both endogenous and aberrantly methylated sites, tumor-specific hypermethylation is more slowly regained, even as normal methylation promptly recovers. Taken together, these data suggest that the durability of DAC response is linked to its selective ability to stably reset at least a portion of the cancer methylome. PMID:27082926