The psychophysiology of real-time financial risk processing.

PubMed

Lo, Andrew W; Repin, Dmitry V

2002-04-01

A longstanding controversy in economics and finance is whether financial markets are governed by rational forces or by emotional responses. We study the importance of emotion in the decision-making process of professional securities traders by measuring their physiological characteristics (e.g., skin conductance, blood volume pulse, etc.) during live trading sessions while simultaneously capturing real-time prices from which market events can be detected. In a sample of 10 traders, we find statistically significant differences in mean electrodermal responses during transient market events relative to no-event control periods, and statistically significant mean changes in cardiovascular variables during periods of heightened market volatility relative to normal-volatility control periods. We also observe significant differences in these physiological responses across the 10 traders that may be systematically related to the traders' levels of experience.

Statistical analysis of nonmonotonic dose-response relationships: research design and analysis of nasal cell proliferation in rats exposed to formaldehyde.

PubMed

Gaylor, David W; Lutz, Werner K; Conolly, Rory B

2004-01-01

Statistical analyses of nonmonotonic dose-response curves are proposed, experimental designs to detect low-dose effects of J-shaped curves are suggested, and sample sizes are provided. For quantal data such as cancer incidence rates, much larger numbers of animals are required than for continuous data such as biomarker measurements. For example, 155 animals per dose group are required to have at least an 80% chance of detecting a decrease from a 20% incidence in controls to an incidence of 10% at a low dose. For a continuous measurement, only 14 animals per group are required to have at least an 80% chance of detecting a change of the mean by one standard deviation of the control group. Experimental designs based on three dose groups plus controls are discussed to detect nonmonotonicity or to estimate the zero equivalent dose (ZED), i.e., the dose that produces a response equal to the average response in the controls. Cell proliferation data in the nasal respiratory epithelium of rats exposed to formaldehyde by inhalation are used to illustrate the statistical procedures. Statistically significant departures from a monotonic dose response were obtained for time-weighted average labeling indices with an estimated ZED at a formaldehyde dose of 5.4 ppm, with a lower 95% confidence limit of 2.7 ppm. It is concluded that demonstration of a statistically significant bi-phasic dose-response curve, together with estimation of the resulting ZED, could serve as a point-of departure in establishing a reference dose for low-dose risk assessment.

Success of intra-arterial chemotherapy (chemosurgery) for retinoblastoma: effect of orbitovascular anatomy.

PubMed

Marr, Brian P; Hung, Crystal; Gobin, Yves P; Dunkel, Ira J; Brodie, Scott E; Abramson, David H

2012-02-01

To review results of orbital angiography performed during intra-arterial chemotherapy (chemosurgery) for treatment of retinoblastoma to assess the association of angiographic variability in orbitovascular anatomy with tumor response and outcomes. Medical records and 64 orbital angiograms were reviewed for 56 pediatric patients with retinoblastoma undergoing chemosurgery using a combination of melphalan hydrochloride, topotecan hydrochloride, or carboplatin. The major orbital arteries and capillary blush patterns were graded, and tumor response and recurrence were compared using the log-rank and Fisher exact tests. Statistically significant variables for tumor response were lacrimal artery prominence (P = .001), previous treatment (P = .003), and lacrimal blush (P = .004). The only statistically significant variable for vitreous seed response was ciliary body blush (P = .03). Statistically significant variables influencing time to recurrence and time to enucleation were choroidal blush absence (P = .01) and lacrimal artery presence (P = .03), respectively. The success of intra-arterial chemotherapy is dependent on delivery of drug to the target tumor within the eye via the ophthalmic artery. Because of the small volume of drug used (0.50-1.25 mL per treatment) and the selectivity of catheterization, variables affecting orbital blood flow greatly influence drug delivery and the success of chemosurgery.

Blood pressure and heart rate response to posteriorly directed pressure applied to the cervical spine in young, pain-free individuals: a randomized, repeated-measures, double-blind, placebo-controlled study.

PubMed

Yung, Emmanuel; Wong, Michael; Williams, Haddie; Mache, Kyle

2014-08-01

Randomized clinical trial. Objectives To compare the blood pressure (BP) and heart rate (HR) response of healthy volunteers to posteriorly directed (anterior-to-posterior [AP]) pressure applied to the cervical spine versus placebo. Manual therapists employ cervical spine AP mobilizations for various cervical-shoulder pain conditions. However, there is a paucity of literature describing the procedure, cardiovascular response, and safety profile. Thirty-nine (25 female) healthy participants (mean ± SD age, 24.7 ± 1.9 years) were randomly assigned to 1 of 2 groups. Group 1 received a placebo, consisting of light touch applied to the right C6 costal process. Group 2 received AP pressure at the same location. Blood pressure and HR were measured prior to, during, and after the application of AP pressure. One-way analysis of variance and paired-difference statistics were used for data analysis. There was no statistically significant difference between groups for mean systolic BP, mean diastolic BP, and mean HR (P >.05) for all time points. Within-group comparisons indicated statistically significant differences between baseline and post-AP pressure HR (-2.8 bpm; 95% confidence interval: -4.6, -1.1) and between baseline and post-AP pressure systolic BP (-2.4 mmHg; 95% confidence interval: -3.7, -1.0) in the AP group, and between baseline and postplacebo systolic BP (-2.6 mmHg; 95% confidence interval: -4.2, -1.0) in the placebo group. No participants reported any adverse reactions or side effects within 24 hours of testing. AP pressure caused a statistically significant physiologic response that resulted in a minor drop in HR (without causing asystole or vasodepression) after the procedure, whereas this cardiovascular change did not occur for those in the placebo group. Within both groups, there was a small but statistically significant reduction in systolic BP following the procedure.

On the Identification of Associations between Five World Health Organization Water, Sanitation and Hygiene Phenotypes and Six Predictors in Low and Middle-Income Countries.

PubMed

Ellis, Hugh; Schoenberger, Erica

2017-01-01

According to the most recent estimates, 842,000 deaths in low- to middle-income countries were attributable to inadequate water, sanitation and hygiene in 2012. Despite billions of dollars and decades of effort, we still lack a sound understanding of which kinds of WASH interventions are most effective in improving public health outcomes, and an important corollary-whether the right things are being measured. The World Health Organization (WHO) has made a concerted effort to compile comprehensive data on drinking water quality and sanitation in the developing world. A recent 2014 report provides information on three phenotypes (responses): Unsafe Water Deaths, Unsafe Sanitation Deaths, Unsafe Hygiene Deaths; two grouped phenotypes: Unsafe Water and Sanitation Deaths and Unsafe Water, Sanitation and Hygiene Deaths; and six explanatory variables (predictors): Improved Sanitation, Unimproved Water Source, Piped Water To Premises, Other Improved Water Source, Filtered and Bottled Water in the Household and Handwashing. Regression analyses were performed to identify statistically significant associations between these mortality responses and predictors. Good fitted-model performance required: (1) the use of population-normalized death fractions as opposed to number of deaths; (2) transformed response (logit or power); and (3) square-root predictor transformation. Given the complexity and heterogeneity of the relationships and countries being studied, these models exhibited remarkable performance and explained, for example, about 85% of the observed variance in population-normalized Unsafe Sanitation Death fraction, with a high F-statistic and highly statistically significant predictor p-values. Similar performance was found for all other responses, which was an unexpected result (the expected associations between responses and predictors-i.e., water-related with water-related, etc. did not occur). The set of statistically significant predictors remains the same across all responses. That is, Unsafe Water Source (UWS), Improved Sanitation (IS) and Filtered and Bottled Water in the Household (FBH) were the only statistically significant predictors whether the response was Unsafe Sanitation Death Fraction, Unsafe Hygiene Death Fraction or Unsafe Water Death Fraction. Moreover, the fraction of variance explained for all fitted models remained relatively high (adjusted R2 ranges from 0.7605 to 0.8533). We find that two of the statistically significant predictors-Improved Sanitation and Unimproved Water Sources-are particularly influential. We also find that some predictors (Piped Water to Premises, Other Improved Water Sources) have very little explanatory power for predicting mortality and one (Other Improved Water Sources) has a counterintuitive effect on response (Unsafe Sanitary Death Fraction increases with increases in OIWS) and one predictor (Hand Washing) to have essentially no explanatory usefulness. Our results suggest that a higher priority may need to be given to improved sanitation than has been the case. Nevertheless, while our focus in this paper is mortality, morbidity is a staggering consequence of inadequate water, sanitation and hygiene, and lower impact on mortality may not mean a similarly low impact on morbidity. More specifically, those predictors that we found uninfluential for predicting mortality-related responses may indeed be important when morbidity is the response.

Analysis of responses of cold pressor tests on pilots and executives

NASA Technical Reports Server (NTRS)

Swaroop, R.

1977-01-01

Statistical analyses were performed to study the relationship between cold pressor test responses and certain medical attributes of a group of 81 pilots and a group of 466 executives. The important results of this study were as follows: There was a significant relationship between a subject's cold pressor test response and his profession (that is, pilot or executive). The executives' diastolic cold pressor test responses were significantly related to their medical conditions, and their families' medical conditions. Significant relationships were observed between executives' diastolic and systolic cold pressor test responses and their history of tranquilizer and cardiac drug use.

Effectiveness of groundwater governance structures and institutions in Tanzania

NASA Astrophysics Data System (ADS)

Gudaga, J. L.; Kabote, S. J.; Tarimo, A. K. P. R.; Mosha, D. B.; Kashaigili, J. J.

2018-05-01

This paper examines effectiveness of groundwater governance structures and institutions in Mbarali District, Mbeya Region. The paper adopts exploratory sequential research design to collect quantitative and qualitative data. A random sample of 90 groundwater users with 50% women was involved in the survey. Descriptive statistics, Kruskal-Wallis H test and Mann-Whitney U test were used to compare the differences in responses between groups, while qualitative data were subjected to content analysis. The results show that the Village Councils and Community Water Supply Organizations (COWSOs) were effective in governing groundwater. The results also show statistical significant difference on the overall extent of effectiveness of the Village Councils in governing groundwater between villages ( P = 0.0001), yet there was no significant difference ( P > 0.05) between male and female responses on the effectiveness of Village Councils, village water committees and COWSOs. The Mann-Whitney U test showed statistical significant difference between male and female responses on effectiveness of formal and informal institutions ( P = 0.0001), such that informal institutions were effective relative to formal institutions. The Kruskal-Wallis H test also showed statistical significant difference ( P ≤ 0.05) on the extent of effectiveness of formal institutions, norms and values between low, medium and high categories. The paper concludes that COWSOs were more effective in governing groundwater than other groundwater governance structures. Similarly, norms and values were more effective than formal institutions. The paper recommends sensitization and awareness creation on formal institutions so that they can influence water users' behaviour to govern groundwater.

A novel robot for imposing perturbations during overground walking: mechanism, control and normative stepping responses.

PubMed

Olenšek, Andrej; Zadravec, Matjaž; Matjačić, Zlatko

2016-06-11

The most common approach to studying dynamic balance during walking is by applying perturbations. Previous studies that investigated dynamic balance responses predominantly focused on applying perturbations in frontal plane while walking on treadmill. The goal of our work was to develop balance assessment robot (BAR) that can be used during overground walking and to assess normative balance responses to perturbations in transversal plane in a group of neurologically healthy individuals. BAR provides three passive degrees of freedom (DoF) and three actuated DoF in pelvis that are admittance-controlled in such a way that the natural movement of pelvis is not significantly affected. In this study BAR was used to assess normative balance responses in neurologically healthy individuals by applying linear perturbations in frontal and sagittal planes and angular perturbations in transversal plane of pelvis. One way repeated measure ANOVA was used to statistically evaluate the effect of selected perturbations on stepping responses. Standard deviations of assessed responses were similar in unperturbed and perturbed walking. Perturbations in frontal direction evoked substantial pelvis displacement and caused statistically significant effect on step length, step width and step time. Likewise, perturbations in sagittal plane also caused statistically significant effect on step length, step width and step time but with less explicit impact on pelvis movement in frontal plane. On the other hand, except from substantial pelvis rotation angular perturbations did not have substantial effect on pelvis movement in frontal and sagittal planes while statistically significant effect was noted only in step length and step width after perturbation in clockwise direction. Results indicate that the proposed device can repeatedly reproduce similar experimental conditions. Results also suggest that "stepping strategy" is the dominant strategy for coping with perturbations in frontal plane, perturbations in sagittal plane are to greater extent handled by "ankle strategy" while angular perturbations in transversal plane do not pose substantial challenge for balance. Results also show that specific perturbation in general elicits responses that extend also to other planes of movement that are not directly associated with plane of perturbation as well as to spatio temporal parameters of gait.

Multiple-Choice versus Constructed-Response Tests in the Assessment of Mathematics Computation Skills.

ERIC Educational Resources Information Center

Gadalla, Tahany M.

The equivalence of multiple-choice (MC) and constructed response (discrete) (CR-D) response formats as applied to mathematics computation at grade levels two to six was tested. The difference between total scores from the two response formats was tested for statistical significance, and the factor structure of items in both response formats was…

Sensitivity and responsiveness of the patient-reported TED-QOL to rehabilitative surgery in thyroid eye disease.

PubMed

Fayers, Tessa; Fayers, Peter M; Dolman, Peter J

2016-12-01

We tested the sensitivity and responsiveness of the TED-QOL to rehabilitative surgery in thyroid eye disease (TED). The 3-item TED-QOL and 16-item GO-QOL, which assess quality of life (QoL) in TED, were administered to consecutive patients undergoing rehabilitative surgery. The questionnaires were completed pre-and post-operatively to assess sensitivity (ability to discriminate between different surgical groups) and responsiveness (ability to detect within patient changes over time).56 patients underwent 69 procedures for TED (29 orbital decompressions, 15 strabismus operations, 25 eyelid procedures). The differences in scores between the three types of surgery (a measure of sensitivity) were statistically significant at the 5% level pre-operatively and post-operatively for all 3 TED-QOL scales and for both GO-QOL scales, but much more so for the TED-QOL scales in each case. The within-patient changes between the pre- and post-operative scores for the same subjects (a measure of responsiveness) were statistically very highly significant for the TED-QOL overall and appearance scales for each of the surgeries. The pre- and post-operative difference for the TED-QOL functioning scale was highly statistically significant for strabismus surgery but not for decompression or lid surgery. The change between the pre- and post-operative scores for the GO-QOL was significant for the functioning scale with strabismus and lid surgery, and was highly significant for the appearance scale with lid surgery but not for strabismus surgery or decompression. The 3-item TED-QOL is sensitive and responsive to rehabilitative surgery in TED and compares favorably with the lengthier GO-QOL for these parameters.

Response properties of ON-OFF retinal ganglion cells to high-order stimulus statistics.

PubMed

Xiao, Lei; Gong, Han-Yan; Gong, Hai-Qing; Liang, Pei-Ji; Zhang, Pu-Ming

2014-10-17

The visual stimulus statistics are the fundamental parameters to provide the reference for studying visual coding rules. In this study, the multi-electrode extracellular recording experiments were designed and implemented on bullfrog retinal ganglion cells to explore the neural response properties to the changes in stimulus statistics. The changes in low-order stimulus statistics, such as intensity and contrast, were clearly reflected in the neuronal firing rate. However, it was difficult to distinguish the changes in high-order statistics, such as skewness and kurtosis, only based on the neuronal firing rate. The neuronal temporal filtering and sensitivity characteristics were further analyzed. We observed that the peak-to-peak amplitude of the temporal filter and the neuronal sensitivity, which were obtained from either neuronal ON spikes or OFF spikes, could exhibit significant changes when the high-order stimulus statistics were changed. These results indicate that in the retina, the neuronal response properties may be reliable and powerful in carrying some complex and subtle visual information. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Disaster response team FAST skills training with a portable ultrasound simulator compared to traditional training: pilot study.

PubMed

Paddock, Michael T; Bailitz, John; Horowitz, Russ; Khishfe, Basem; Cosby, Karen; Sergel, Michelle J

2015-03-01

Pre-hospital focused assessment with sonography in trauma (FAST) has been effectively used to improve patient care in multiple mass casualty events throughout the world. Although requisite FAST knowledge may now be learned remotely by disaster response team members, traditional live instructor and model hands-on FAST skills training remains logistically challenging. The objective of this pilot study was to compare the effectiveness of a novel portable ultrasound (US) simulator with traditional FAST skills training for a deployed mixed provider disaster response team. We randomized participants into one of three training groups stratified by provider role: Group A. Traditional Skills Training, Group B. US Simulator Skills Training, and Group C. Traditional Skills Training Plus US Simulator Skills Training. After skills training, we measured participants' FAST image acquisition and interpretation skills using a standardized direct observation tool (SDOT) with healthy models and review of FAST patient images. Pre- and post-course US and FAST knowledge were also assessed using a previously validated multiple-choice evaluation. We used the ANOVA procedure to determine the statistical significance of differences between the means of each group's skills scores. Paired sample t-tests were used to determine the statistical significance of pre- and post-course mean knowledge scores within groups. We enrolled 36 participants, 12 randomized to each training group. Randomization resulted in similar distribution of participants between training groups with respect to provider role, age, sex, and prior US training. For the FAST SDOT image acquisition and interpretation mean skills scores, there was no statistically significant difference between training groups. For US and FAST mean knowledge scores, there was a statistically significant improvement between pre- and post-course scores within each group, but again there was not a statistically significant difference between training groups. This pilot study of a deployed mixed-provider disaster response team suggests that a novel portable US simulator may provide equivalent skills training in comparison to traditional live instructor and model training. Further studies with a larger sample size and other measures of short- and long-term clinical performance are warranted.

Low-Level Contrast Statistics of Natural Images Can Modulate the Frequency of Event-Related Potentials (ERP) in Humans.

PubMed

Ghodrati, Masoud; Ghodousi, Mahrad; Yoonessi, Ali

2016-01-01

Humans are fast and accurate in categorizing complex natural images. It is, however, unclear what features of visual information are exploited by brain to perceive the images with such speed and accuracy. It has been shown that low-level contrast statistics of natural scenes can explain the variance of amplitude of event-related potentials (ERP) in response to rapidly presented images. In this study, we investigated the effect of these statistics on frequency content of ERPs. We recorded ERPs from human subjects, while they viewed natural images each presented for 70 ms. Our results showed that Weibull contrast statistics, as a biologically plausible model, explained the variance of ERPs the best, compared to other image statistics that we assessed. Our time-frequency analysis revealed a significant correlation between these statistics and ERPs' power within theta frequency band (~3-7 Hz). This is interesting, as theta band is believed to be involved in context updating and semantic encoding. This correlation became significant at ~110 ms after stimulus onset, and peaked at 138 ms. Our results show that not only the amplitude but also the frequency of neural responses can be modulated with low-level contrast statistics of natural images and highlights their potential role in scene perception.

Low-Level Contrast Statistics of Natural Images Can Modulate the Frequency of Event-Related Potentials (ERP) in Humans

PubMed Central

Ghodrati, Masoud; Ghodousi, Mahrad; Yoonessi, Ali

2016-01-01

Humans are fast and accurate in categorizing complex natural images. It is, however, unclear what features of visual information are exploited by brain to perceive the images with such speed and accuracy. It has been shown that low-level contrast statistics of natural scenes can explain the variance of amplitude of event-related potentials (ERP) in response to rapidly presented images. In this study, we investigated the effect of these statistics on frequency content of ERPs. We recorded ERPs from human subjects, while they viewed natural images each presented for 70 ms. Our results showed that Weibull contrast statistics, as a biologically plausible model, explained the variance of ERPs the best, compared to other image statistics that we assessed. Our time-frequency analysis revealed a significant correlation between these statistics and ERPs' power within theta frequency band (~3–7 Hz). This is interesting, as theta band is believed to be involved in context updating and semantic encoding. This correlation became significant at ~110 ms after stimulus onset, and peaked at 138 ms. Our results show that not only the amplitude but also the frequency of neural responses can be modulated with low-level contrast statistics of natural images and highlights their potential role in scene perception. PMID:28018197

[Relationships between workers' interpersonal helping behavior, social supports, job stressors, psychological stress responses, and vigor in manufacturing industry].

PubMed

Horita, Yuji; Otsuka, Yasumasa

2014-01-01

In the NIOSH Generic Job Stress Model, social support is assumed to moderate the relationship between job stressors and stress responses. However, few studies have investigated how to enhance social support in the workplace. The purpose of this study was to explore the relationships between interpersonal helping behavior, social support, job stressors, psychological stress responses, and vigor among Japanese workers. A total of 240 workers in manufacturing companies returned a questionnaire regarding their interpersonal helping behavior, social support, job stressors, psychological stress responses, and vigor (response rate = 96.0%). After excluding 40 participants due to missing responses, data from a total of 200 participants (163 male and 37 female, mean age = 40.3 yr) were used in the final analyses. Interpersonal helping behavior was assessed by the Japanese version of the Organizational Citizenship Behavior Scale. The Brief Job Stress Questionnaire was used to measure job stressors, psychological stress responses, social support, and vigor. Structured equation modeling was performed to examine the relationships between interpersonal helping behavior, social support, job stressors, psychological stress responses, and vigor. Interpersonal helping behavior had a statistically significant negative effect on psychological stress response through increasing social support. However, interpersonal helping behavior had a statistically significant positive effect on psychological stress response through increasing the quantitative workload. Of these two effects, the former was stronger than the latter. In addition, interpersonal helping behavior had a statistically significant positive effect on vigor through increasing social support. Although interpersonal helping behavior, which helps other workers may increase quantitative workload, leading to high levels of psychological stress responses, that same behavior strengthens trust and team spirit among workers and may enhance social support, leading to low levels of psychological stress responses and high levels of vigor. However, reverse causal relationships may also exist, because our study design was cross-sectional.

Statistical learning of music- and language-like sequences and tolerance for spectral shifts.

PubMed

Daikoku, Tatsuya; Yatomi, Yutaka; Yumoto, Masato

2015-02-01

In our previous study (Daikoku, Yatomi, & Yumoto, 2014), we demonstrated that the N1m response could be a marker for the statistical learning process of pitch sequence, in which each tone was ordered by a Markov stochastic model. The aim of the present study was to investigate how the statistical learning of music- and language-like auditory sequences is reflected in the N1m responses based on the assumption that both language and music share domain generality. By using vowel sounds generated by a formant synthesizer, we devised music- and language-like auditory sequences in which higher-ordered transitional rules were embedded according to a Markov stochastic model by controlling fundamental (F0) and/or formant frequencies (F1-F2). In each sequence, F0 and/or F1-F2 were spectrally shifted in the last one-third of the tone sequence. Neuromagnetic responses to the tone sequences were recorded from 14 right-handed normal volunteers. In the music- and language-like sequences with pitch change, the N1m responses to the tones that appeared with higher transitional probability were significantly decreased compared with the responses to the tones that appeared with lower transitional probability within the first two-thirds of each sequence. Moreover, the amplitude difference was even retained within the last one-third of the sequence after the spectral shifts. However, in the language-like sequence without pitch change, no significant difference could be detected. The pitch change may facilitate the statistical learning in language and music. Statistically acquired knowledge may be appropriated to process altered auditory sequences with spectral shifts. The relative processing of spectral sequences may be a domain-general auditory mechanism that is innate to humans. Copyright © 2014 Elsevier Inc. All rights reserved.

Auditory Magnetoencephalographic Frequency-Tagged Responses Mirror the Ongoing Segmentation Processes Underlying Statistical Learning.

PubMed

Farthouat, Juliane; Franco, Ana; Mary, Alison; Delpouve, Julie; Wens, Vincent; Op de Beeck, Marc; De Tiège, Xavier; Peigneux, Philippe

2017-03-01

Humans are highly sensitive to statistical regularities in their environment. This phenomenon, usually referred as statistical learning, is most often assessed using post-learning behavioural measures that are limited by a lack of sensibility and do not monitor the temporal dynamics of learning. In the present study, we used magnetoencephalographic frequency-tagged responses to investigate the neural sources and temporal development of the ongoing brain activity that supports the detection of regularities embedded in auditory streams. Participants passively listened to statistical streams in which tones were grouped as triplets, and to random streams in which tones were randomly presented. Results show that during exposure to statistical (vs. random) streams, tritone frequency-related responses reflecting the learning of regularities embedded in the stream increased in the left supplementary motor area and left posterior superior temporal sulcus (pSTS), whereas tone frequency-related responses decreased in the right angular gyrus and right pSTS. Tritone frequency-related responses rapidly developed to reach significance after 3 min of exposure. These results suggest that the incidental extraction of novel regularities is subtended by a gradual shift from rhythmic activity reflecting individual tone succession toward rhythmic activity synchronised with triplet presentation, and that these rhythmic processes are subtended by distinct neural sources.

Evaluation of the ecological relevance of mysid toxicity tests using population modeling techniques

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuhn-Hines, A.; Munns, W.R. Jr.; Lussier, S.

1995-12-31

A number of acute and chronic bioassay statistics are used to evaluate the toxicity and risks of chemical stressors to the mysid shrimp, Mysidopsis bahia. These include LC{sub 50}S from acute tests, NOECs from 7-day and life-cycle tests, and the US EPA Water Quality Criteria Criterion Continuous Concentrations (CCC). Because these statistics are generated from endpoints which focus upon the responses of individual organisms, their relationships to significant effects at higher levels of ecological organization are unknown. This study was conducted to evaluate the quantitative relationships between toxicity test statistics and a concentration-based statistic derived from exposure-response models describing populationmore » growth rate ({lambda}) to stressor concentration. This statistic, C{sup {sm_bullet}} (concentration where {lambda} = I, zero population growth) describes the concentration above which mysid populations are projected to decline in abundance as determined using population modeling techniques. An analysis of M. bahia responses to 9 metals and 9 organic contaminants indicated the NOEC from life-cycle tests to be the best predictor of C{sup {sm_bullet}}, although the acute LC{sub 50} predicted population-level response surprisingly well. These analyses provide useful information regarding uncertainties of extrapolation among test statistics in assessments of ecological risk.« less

Investigation of Millennial Students' Responses to a Shelter-in-Place Experience

ERIC Educational Resources Information Center

Johnson, Thomas C.; Frick, Melodie H.

2016-01-01

This study investigated millennial students' responses to an armed gunman threat and shelter-in-place warnings that occurred on a university campus. Using descriptive statistics and quantitative analysis, several significant differences were found for students' responses for sheltering-in-place and engaging in protective behaviors. Baxter Magolda'…

Active Female Maximal and Anaerobic Threshold Cardiorespiratory Responses to Six Different Water Aerobics Exercises.

PubMed

Antunes, Amanda H; Alberton, Cristine L; Finatto, Paula; Pinto, Stephanie S; Cadore, Eduardo L; Zaffari, Paula; Kruel, Luiz F M

2015-01-01

Maximal tests conducted on land are not suitable for the prescription of aquatic exercises, which makes it difficult to optimize the intensity of water aerobics classes. The aim of the present study was to evaluate the maximal and anaerobic threshold cardiorespiratory responses to 6 water aerobics exercises. Volunteers performed 3 of the exercises in the sagittal plane and 3 in the frontal plane. Twelve active female volunteers (aged 24 ± 2 years) performed 6 maximal progressive test sessions. Throughout the exercise tests, we measured heart rate (HR) and oxygen consumption (VO2). We randomized all sessions with a minimum interval of 48 hr between each session. For statistical analysis, we used repeated-measures 1-way analysis of variance. Regarding the maximal responses, for the peak VO2, abductor hop and jumping jacks (JJ) showed significantly lower values than frontal kick and cross-country skiing (CCS; p < .001; partial η(2) = .509), while for the peak HR, JJ showed statistically significantly lower responses compared with stationary running and CCS (p < .001; partial η(2) = .401). At anaerobic threshold intensity expressed as the percentage of the maximum values, no statistically significant differences were found among exercises. Cardiorespiratory responses are directly associated with the muscle mass involved in the exercise. Thus, it is worth emphasizing the importance of performing a maximal test that is specific to the analyzed exercise so the prescription of the intensity can be safer and valid.

Prison Radicalization: The New Extremist Training Grounds?

DTIC Science & Technology

2007-09-01

distributing and collecting survey data , and the data analysis. The analytical methodology includes descriptive and inferential statistical methods, in... statistical analysis of the responses to identify significant correlations and relationships. B. SURVEY DATA COLLECTION To effectively access a...Q18, Q19, Q20, and Q21. Due to the exploratory nature of this small survey, data analyses were confined mostly to descriptive statistics and

Survey of responsible handling of local anesthetic in Indian dental operatory

PubMed Central

Rooban, Thavarajah; Rao, Umadevi Krishnamohan; Joshua, Elizabeth; Ranganathan, Kannan

2013-01-01

Background: Dental operatory requires handling of numerous toxic fluids such as denture acrylic monomer, alcohol and formalin for effective oral care delivery. The efficacy and responsible handling of such fluids has not been analyzed among Indian dentists and this study aims to address this lacunae. Materials and Methods: Closed ended questionnaire was distributed through email to Indian dentists in July 2012. After inclusion/exclusion criteria, 1484 practitioners constituted the study group with a response rate of 52%. Statistics: SPSS® Version 17.0 (SPSS-IBM Inc., IL, USA) was used to carry out statistical analysis. Descriptive statistics were presented. Chi square test was used to identify the association between the parameters; P ≤ 0.05 was considered as statistically significant. Results: Males (80.8%), undergraduates (78%), exclusive practitioners (81.2%), urban practitioners (68.5%) were the predominant respondents. Predominant of the respondents (97%) used local anesthetic (LA) from bottles. Eight percent have encountered instances of injecting formalin instead of LA in their settings. Safe disposal rules and regulations (P ≤ 0.05), opinion on injecting the other fluids instead of LA as a severe negligent act (P ≤ 0.05) were statistically significant between age groups. Educational status did not appear to influence the outcome. Only a third of the respondents were aware of the rules and regulations for safe disposal of empty LA bottles while 49.1% were not aware of them and willing to learn. Discussion: The lacunae in responsible handling of toxic fluids need to be addressed to prevent inadvertent and negligence suits against dentists, highlighting the need through continuing dental education programmes. PMID:24255564

Neoadjuvant Long-Course Chemoradiotherapy for Rectal Cancer: Does Time to Surgery Matter?

PubMed Central

Panagiotopoulou, Ioanna G.; Parashar, Deepak; Qasem, Eyas; Mezher-Sikafi, Rasha; Parmar, Jitesh; Wells, Alan D.; Bajwa, Farrukh M.; Menon, Madhav; Jephcott, Catherine R.

2015-01-01

The objective of this paper was to evaluate whether delaying surgery following long-course chemoradiotherapy for rectal cancer correlates with pathologic complete response. Pre-operative chemoradiotherapy (CRT) is standard practice in the UK for the management of locally advanced rectal cancer. Optimal timing of surgery following CRT is still not clearly defined. All patients with a diagnosis of rectal cancer who had undergone long-course CRT prior to surgery between January 2008 and December 2011 were included. Statistical analysis was performed using Stata 11. Fifty-nine patients received long-course CRT prior to surgery in the selected period. Twenty-seven percent (16/59) of patients showed a complete histopathologic response and 59.3% (35/59) of patients had tumor down-staging from radiologically-assessed node positive to histologically-proven node negative disease. There was no statistically significant delay to surgery after completion of CRT in the 16 patients with complete response (CR) compared with the rest of the group [IR: incomplete response; CR group median: 74.5 days (IQR: 70–87.5) and IR group median: 72 days (IQR: 57–83), P = 0.470]. Although no statistically significant predictors of either complete response or tumor nodal status down-staging were identified in logistic regression analyses, a trend toward complete response was seen with longer delay to surgery following completion of long-course CRT. PMID:26414816

Wilderness adventure therapy effects on the mental health of youth participants.

PubMed

Bowen, Daniel J; Neill, James T; Crisp, Simon J R

2016-10-01

Adventure therapy offers a prevention, early intervention, and treatment modality for people with behavioural, psychological, and psychosocial issues. It can appeal to youth-at-risk who are often less responsive to traditional psychotherapeutic interventions. This study evaluated Wilderness Adventure Therapy (WAT) outcomes based on participants' pre-program, post-program, and follow-up responses to self-report questionnaires. The sample consisted of 36 adolescent out-patients with mixed mental health issues who completed a 10-week, manualised WAT intervention. The overall short-term standardised mean effect size was small, positive, and statistically significant (0.26), with moderate, statistically significant improvements in psychological resilience and social self-esteem. Total short-term effects were within age-based adventure therapy meta-analytic benchmark 90% confidence intervals, except for the change in suicidality which was lower than the comparable benchmark. The short-term changes were retained at the three-month follow-up, except for family functioning (significant reduction) and suicidality (significant improvement). For participants in clinical ranges pre-program, there was a large, statistically significant reduction in depressive symptomology, and large to very large, statistically significant improvements in behavioural and emotional functioning. These changes were retained at the three-month follow-up. These findings indicate that WAT is as effective as traditional psychotherapy techniques for clinically symptomatic people. Future research utilising a comparison or wait-list control group, multiple sources of data, and a larger sample, could help to qualify and extend these findings. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Statistics, Uncertainty, and Transmitted Variation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wendelberger, Joanne Roth

2014-11-05

The field of Statistics provides methods for modeling and understanding data and making decisions in the presence of uncertainty. When examining response functions, variation present in the input variables will be transmitted via the response function to the output variables. This phenomenon can potentially have significant impacts on the uncertainty associated with results from subsequent analysis. This presentation will examine the concept of transmitted variation, its impact on designed experiments, and a method for identifying and estimating sources of transmitted variation in certain settings.

Using the bootstrap to establish statistical significance for relative validity comparisons among patient-reported outcome measures

PubMed Central

2013-01-01

Background Relative validity (RV), a ratio of ANOVA F-statistics, is often used to compare the validity of patient-reported outcome (PRO) measures. We used the bootstrap to establish the statistical significance of the RV and to identify key factors affecting its significance. Methods Based on responses from 453 chronic kidney disease (CKD) patients to 16 CKD-specific and generic PRO measures, RVs were computed to determine how well each measure discriminated across clinically-defined groups of patients compared to the most discriminating (reference) measure. Statistical significance of RV was quantified by the 95% bootstrap confidence interval. Simulations examined the effects of sample size, denominator F-statistic, correlation between comparator and reference measures, and number of bootstrap replicates. Results The statistical significance of the RV increased as the magnitude of denominator F-statistic increased or as the correlation between comparator and reference measures increased. A denominator F-statistic of 57 conveyed sufficient power (80%) to detect an RV of 0.6 for two measures correlated at r = 0.7. Larger denominator F-statistics or higher correlations provided greater power. Larger sample size with a fixed denominator F-statistic or more bootstrap replicates (beyond 500) had minimal impact. Conclusions The bootstrap is valuable for establishing the statistical significance of RV estimates. A reasonably large denominator F-statistic (F > 57) is required for adequate power when using the RV to compare the validity of measures with small or moderate correlations (r < 0.7). Substantially greater power can be achieved when comparing measures of a very high correlation (r > 0.9). PMID:23721463

Hemispheric Asymmetry of Visual Cortical Response by Means of Functional Transcranial Doppler

PubMed Central

Roje-Bedeković, Marina; Lovrenčić-Huzjan, Arijana; Bosnar-Puretić, Marijana; Šerić, Vesna; Demarin, Vida

2012-01-01

We assessed the visual evoked response and investigated side-to-side differences in mean blood flow velocities (MBFVs) by means of functional transcranial Doppler (fTCD) in 49 right-handed patients with severe internal carotid artery (ICA) stenosis and 30 healthy volunteers, simultaneously in both posterior cerebral arteries (PCAs) using 2 MHz probes, successively in the dark and during the white light stimulation. Statistically significant correlation (P = 0.001) was shown in healthy and in patients (P < 0.05) between MBFV in right PCA in physiological conditions and MBFV in right PCA during the white light stimulation and in the dark. The correlation between MBVF in right PCA and contralateral left PCA was not statistically significant (P > 0.05). The correlation between ipsilateral left PCA was significantly higher than the one with contralateral right PCA (P < 0.05). There is a clear trend towards the lateralisation of the visual evoked response in the right PCA. PMID:22135771

Effects of Environmental Context on Physiological Response During Team Handball Small Sided Games.

PubMed

Bělka, Jan; Hulka, Karel; Machová, Iva; Šafář, Michal; Weisser, Radim; Bellar, David M; Hoover, Donald L; Judge, Lawrence W

2017-01-01

This study examined the distance covered and physiological effects of altering the number of players during small-sided games (SSG) in team handball. Twelve professional female handball players [24.6±3.7 years, 172±6.2 cm, 68.2 ± 9.9kg, 22.7 ± 2 kg/m 2 ] participated in this study. The SSG were played, first with five on each side (SSG 5), then four (SSG 4), then three (SSG 3). Each game was four minutes long, followed by three minutes of rest. The distance covered and time spent in four speed zones (based on player movement speed) were selected for analysis: Zone 1 (0-1.4 m/s), Zone 2 (1.5-3.4 m/s), Zone 3 (3.5-5.2 m/s), and Zone 4 (>5.2 m/s). Statistically significant differences were found in Zone 2, between conditions SSG 3 and SSG 4 (p=.049,ω 2 = .32). The highest average heart rate (HR) occurred during SSG 3. Average HR between SSG 3 (89.7 % HRmax) and SSG 5 (87.8 % HRmax) (p= .04, ω2= .26) were also significantly different. Participant HR response between the speed zones was not statistically significant. HR response was negatively correlated with the number of players within the SSG condition. Statistically significant results were found for RPE between SSG 3 and the other two SSG conditions (SSG 4, p = .01, and SSG 5, p = .00). These results indicate that changing the number of SSG players can be used to manipulate the physiological response during handball training.

Effects of Environmental Context on Physiological Response During Team Handball Small Sided Games

PubMed Central

BĚLKA, JAN; HULKA, KAREL; MACHOVÁ, IVA; ŠAFÁŘ, MICHAL; WEISSER, RADIM; BELLAR, DAVID M.; HOOVER, DONALD L; JUDGE, LAWRENCE W.

2017-01-01

This study examined the distance covered and physiological effects of altering the number of players during small-sided games (SSG) in team handball. Twelve professional female handball players [24.6±3.7 years, 172±6.2 cm, 68.2 ± 9.9kg, 22.7 ± 2 kg/m2] participated in this study. The SSG were played, first with five on each side (SSG 5), then four (SSG 4), then three (SSG 3). Each game was four minutes long, followed by three minutes of rest. The distance covered and time spent in four speed zones (based on player movement speed) were selected for analysis: Zone 1 (0–1.4 m/s), Zone 2 (1.5–3.4 m/s), Zone 3 (3.5–5.2 m/s), and Zone 4 (>5.2 m/s). Statistically significant differences were found in Zone 2, between conditions SSG 3 and SSG 4 (p=.049,ω2= .32). The highest average heart rate (HR) occurred during SSG 3. Average HR between SSG 3 (89.7 % HRmax) and SSG 5 (87.8 % HRmax) (p= .04, ω2= .26) were also significantly different. Participant HR response between the speed zones was not statistically significant. HR response was negatively correlated with the number of players within the SSG condition. Statistically significant results were found for RPE between SSG 3 and the other two SSG conditions (SSG 4, p = .01, and SSG 5, p = .00). These results indicate that changing the number of SSG players can be used to manipulate the physiological response during handball training. PMID:29399252

Effect of Two Different Doses of Dexmedetomidine on Stress Response in Laparoscopic Pyeloplasty: A Randomized Prospective Controlled Study.

PubMed

Shamim, Rafat; Srivastava, Shashi; Rastogi, Amit; Kishore, Kamal; Srivastava, Aneesh

2017-01-01

Clonidine, opioids, β-blockers, and dexmedetomidine have been tried to attenuate stress responses during laparoscopic surgery. We evaluated the efficacy of dexmedetomidine in two different doses in attenuating stress responses on patients undergoing laparoscopic pyeloplasty. Ninety patients were assigned to one of the three groups: Group A, Group B, and Group C. Group B received dexmedetomidine 1 mcg/kg as loading dose, followed by 0.7 mcg/kg/h for maintenance; Group C received dexmedetomidine 0.7 mcg/kg as a loading dose, followed by 0.5 mcg/kg/h for maintenance. Group A received normal saline. Stress responses were assessed by the variations in heart rate (HR), mean arterial pressure (MAP), blood glucose levels, and serum cortisol levels. One-way analysis of variance test was applied. Multiple comparisons between groups were done with post hoc Bonferroni test. The HR and MAP were found to be higher in Group A. The difference was statistically significant ( P < 0.05) during intubation, carbon dioxide insufflation, and extubation when compared with Groups B and C. Blood glucose levels at postintubation and at extubation were higher in Group A and statistically significant ( P < 0.05) when compared with Groups B and C. Serum cortisol levels at postintubation, during midsurgery, and 2 h after extubation were higher in Group A and statistically significant ( P < 0.05) when compared with Groups B and C. However, HR, MAP, blood glucose levels, and serum cortisol levels were similar in dexmedetomidine groups. Dexmedetomidine decreases stress response and provides good condition for maintenance of anesthesia. Dexmedetomidine when used in lower dose in Group C decreases stress response comparable to higher dose in Group B.

Potentiation Effects of Half-Squats Performed in a Ballistic or Nonballistic Manner.

PubMed

Suchomel, Timothy J; Sato, Kimitake; DeWeese, Brad H; Ebben, William P; Stone, Michael H

2016-06-01

This study examined and compared the acute effects of ballistic and nonballistic concentric-only half-squats (COHSs) on squat jump performance. Fifteen resistance-trained men performed a squat jump 2 minutes after a control protocol or 2 COHSs at 90% of their 1 repetition maximum (1RM) COHS performed in a ballistic or nonballistic manner. Jump height (JH), peak power (PP), and allometrically scaled peak power (PPa) were compared using three 3 × 2 repeated-measures analyses of variance. Statistically significant condition × time interaction effects existed for JH (p = 0.037), PP (p = 0.041), and PPa (p = 0.031). Post hoc analysis revealed that the ballistic condition produced statistically greater JH (p = 0.017 and p = 0.036), PP (p = 0.031 and p = 0.026), and PPa (p = 0.024 and p = 0.023) than the control and nonballistic conditions, respectively. Small effect sizes for JH, PP, and PPa existed during the ballistic condition (d = 0.28-0.44), whereas trivial effect sizes existed during the control (d = 0.0-0.18) and nonballistic (d = 0.0-0.17) conditions. Large statistically significant relationships existed between the JH potentiation response and the subject's relative back squat 1RM (r = 0.520; p = 0.047) and relative COHS 1RM (r = 0.569; p = 0.027) during the ballistic condition. In addition, large statistically significant relationship existed between JH potentiation response and the subject's relative back squat strength (r = 0.633; p = 0.011), whereas the moderate relationship with the subject's relative COHS strength trended toward significance (r = 0.483; p = 0.068). Ballistic COHS produced superior potentiation effects compared with COHS performed in a nonballistic manner. Relative strength may contribute to the elicited potentiation response after ballistic and nonballistic COHS.

The antigravity suit in neurosurgery. Cardiovascular responses in seated neurosurgical patients.

PubMed

Brodrick, P M; Ingram, G S

1988-09-01

The haemodynamic responses associated with inflation of the antigravity suit (G suit, aviation type) to 8.0 kPa were studied in a series of 40 patients who underwent neurosurgical operations in the sitting position. The study showed statistically significant increases in systolic arterial pressure (p less than 0.005) and mean central venous pressure (p less than 0.001) with inflation of the suit. The systolic arterial and mean central venous pressures remained significantly elevated immediately before deflation of the suit at the end of the operation (p less than 0.001 and p less than 0.005 respectively). The addition of 0.8-1.0 kPa positive end expiratory pressure during suit inflation was also investigated. A further increase in central venous pressure occurred but this did not achieve statistical significance.

Nitrogen Dioxide Exposure and Airway Responsiveness in Individuals with Asthma

EPA Science Inventory

Controlled human exposure studies evaluating the effect of inhaled NO2 on the inherent responsiveness of the airways to challenge by bronchoconstricting agents have had mixed results. In general, existing meta-analyses show statistically significant effects of NO2 on the airway r...

Assessing the Effects of Financial Literacy on Patient Engagement.

PubMed

Meyer, Melanie A; Hudak, Ronald P

2016-07-01

We investigated the relationship between financial literacy and patient engagement while considering the possible interaction effects due to patient financial responsibility and patient-physician shared decision making, and the impact of personal attributes. Participants consisted of an Internet-based sample of American adults (N = 160). Hierarchical multiple linear regression analysis was conducted to examine the relationship of the study variables on patient engagement. We found that patient financial responsibility (β = -.19, p < .05) and patient-physician shared decision-making (β = .17, p < .05) predicted patient engagement. However, there was no statistically significant relationship between patient financial literacy and patient engagement; moreover, the moderation effects of patient financial responsibility and shared decision making with financial literacy also were not statistically significant. Increasing patient financial responsibility and patient-physician shared decision making can impact patient engagement. Understanding the predictors of patient engagement and the factors that influence financial behaviors may allow for the development of interventions to enable patients to make better healthcare decisions, and ultimately, improve health outcomes.

A retrospective analysis of hyperthermic intraperitoneal chemotherapy for gastric cancer with peritoneal metastasis

PubMed Central

Yuan, Meiqin; Wang, Zeng; Hu, Guinv; Yang, Yunshan; Lv, Wangxia; Lu, Fangxiao; Zhong, Haijun

2016-01-01

Peritoneal metastasis (PM) is a poor prognostic factor in patients with gastric cancer. The aim of this study was to evaluate the efficacy and safety of hyperthermic intraperitoneal chemotherapy (HIPEC) in patients with advanced gastric cancer with PM by retrospective analysis. A total of 54 gastric cancer patients with positive ascitic fluid cytology were included in this study: 23 patients were treated with systemic chemotherapy combined with HIPEC (HIPEC+ group) and 31 received systemic chemotherapy alone (HIPEC- group). The patients were divided into 4 categories according to the changes of ascites, namely disappear, decrease, stable and increase. The disappear + decrease rate in the HIPEC+ group was 82.60%, which was statistically significantly superior to that of the HIPEC- group (54.80%). The disappear + decrease + stable rate was 95.70% in the HIPEC+ group and 74.20% in the HIPEC- group, but the difference was not statistically significant. In 33 patients with complete survival data, including 12 from the HIPEC+ and 21 from the HIPEC- group, the median progression-free survival was 164 and 129 days, respectively, and the median overall survival (OS) was 494 and 223 days, respectively. In patients with ascites disappear/decrease/stable, the OS appeared to be better compared with that in patients with ascites increase, but the difference was not statistically significant. Further analysis revealed that patients with controlled disease (complete response + partial response + stable disease) may have a better OS compared with patients with progressive disease, with a statistically significant difference. The toxicities were well tolerated in both groups. Therefore, HIPEC was found to improve survival in advanced gastric cancer patients with PM, but the difference was not statistically significant, which may be attributed to the small number of cases. Further studies with larger samples are required to confirm our data. PMID:27446587

Prospective evaluation of [11C]Choline PET/CT in therapy response assessment of standardized docetaxel first-line chemotherapy in patients with advanced castration refractory prostate cancer.

PubMed

Schwarzenböck, Sarah M; Eiber, Matthias; Kundt, Günther; Retz, Margitta; Sakretz, Monique; Kurth, Jens; Treiber, Uwe; Nawroth, Roman; Rummeny, Ernst J; Gschwend, Jürgen E; Schwaiger, Markus; Thalgott, Mark; Krause, Bernd J

2016-11-01

The aim of this study was to prospectively evaluate the value of [ 11 C] Choline PET/CT in monitoring early and late response to a standardized first-line docetaxel chemotherapy in castration refractory prostate cancer (mCRPC) patients. Thirty-two patients were referred for [ 11 C] Choline PET/CT before the start of docetaxel chemotherapy, after one and ten chemotherapy cycles (or - in case of discontinuation - after the last administered cycle) for therapy response assessment. [ 11 C] Choline uptake (SUV max , SUV mean ), CT derived Houndsfield units (HU max , HU mean ), and volume of bone, lung, and nodal metastases and local recurrence were measured semi-automatically at these timepoints. Change in SUV max , SUV mean , HU max , HU mean, and volume was assessed between PET 2 and 1 (early response assessment, ERA) and PET 3 and 1 (late response assessment, LRA) on a patient and lesion basis. Results of PET/CT were compared to clinically used RECIST 1.1 and clinical criteria based therapy response assessment including PSA for defining progressive disease (PD) and non-progressive disease (nPD), respectively. Relationships between changes of SUV max and SUV mean (early and late) and changes of PSA early and PSA late were evaluated. Prognostic value of initial SUV max and SUV mean was assessed. Statistical analyses were performed using SPSS. In the patient-based ERA and LRA there were no statistically significant differences in change of choline uptake, HU, and volume between PD and nPD applying RECIST or clinical response criteria. In the lesion-based ERA, decrease in choline uptake of bone metastases was even higher in PD (applying RECIST criteria), whereas in LRA the decrease was higher in nPD (applying clinical criteria). There were only significant correlations between change in choline uptake and PSA in ERA in PD, in LRA no significant correlations were discovered. Initial SUV max and SUV mean were statistically significantly higher in nPD (applying clinical criteria). There is no significant correlation between change in choline uptake in [ 11 C] Choline PET/CT and clinically routinely used objective response assessment during the early and late course of docetaxel chemotherapy. Therefore, [ 11 C] Choline PET/CT seems to be of limited use in therapy response assessment in standardized first-line chemotherapy in mCRPC patients.

Response surface methodology as an approach to determine optimal activities of lipase entrapped in sol-gel matrix using different vegetable oils.

PubMed

Pinheiro, Rubiane C; Soares, Cleide M F; de Castro, Heizir F; Moraes, Flavio F; Zanin, Gisella M

2008-03-01

The conditions for maximization of the enzymatic activity of lipase entrapped in sol-gel matrix were determined for different vegetable oils using an experimental design. The effects of pH, temperature, and biocatalyst loading on lipase activity were verified using a central composite experimental design leading to a set of 13 assays and the surface response analysis. For canola oil and entrapped lipase, statistical analyses showed significant effects for pH and temperature and also the interactions between pH and temperature and temperature and biocatalyst loading. For the olive oil and entrapped lipase, it was verified that the pH was the only variable statistically significant. This study demonstrated that response surface analysis is a methodology appropriate for the maximization of the percentage of hydrolysis, as a function of pH, temperature, and lipase loading.

Statistical Modeling of Zr/Hf Extraction using TBP-D2EHPA Mixtures

NASA Astrophysics Data System (ADS)

Rezaeinejhad Jirandehi, Vahid; Haghshenas Fatmehsari, Davoud; Firoozi, Sadegh; Taghizadeh, Mohammad; Keshavarz Alamdari, Eskandar

2012-12-01

In the present work, response surface methodology was employed for the study and prediction of Zr/Hf extraction curves in a solvent extraction system using D2EHPA-TBP mixtures. The effect of change in the levels of temperature, nitric acid concentration, and TBP/D2EHPA ratio (T/D) on the Zr/Hf extraction/separation was studied by the use of central composite design. The results showed a statistically significant effect of T/D, nitric acid concentration, and temperature on the extraction percentage of Zr and Hf. In the case of Zr, a statistically significant interaction was found between T/D and nitric acid, whereas for Hf, both interactive terms between temperature and T/D and nitric acid were significant. Additionally, the extraction curves were profitably predicted applying the developed statistical regression equations; this approach is faster and more economical compared with experimentally obtained curves.

Statistical Analysis of Human Body Movement and Group Interactions in Response to Music

NASA Astrophysics Data System (ADS)

Desmet, Frank; Leman, Marc; Lesaffre, Micheline; de Bruyn, Leen

Quantification of time series that relate to physiological data is challenging for empirical music research. Up to now, most studies have focused on time-dependent responses of individual subjects in controlled environments. However, little is known about time-dependent responses of between-subject interactions in an ecological context. This paper provides new findings on the statistical analysis of group synchronicity in response to musical stimuli. Different statistical techniques were applied to time-dependent data obtained from an experiment on embodied listening in individual and group settings. Analysis of inter group synchronicity are described. Dynamic Time Warping (DTW) and Cross Correlation Function (CCF) were found to be valid methods to estimate group coherence of the resulting movements. It was found that synchronicity of movements between individuals (human-human interactions) increases significantly in the social context. Moreover, Analysis of Variance (ANOVA) revealed that the type of music is the predominant factor in both the individual and the social context.

Benchmarking can add up for healthcare accounting.

PubMed

Czarnecki, M T

1994-09-01

In 1993, a healthcare accounting and finance benchmarking survey of hospital and nonhospital organizations gathered statistics about key common performance areas. A low response did not allow for statistically significant findings, but the survey identified performance measures that can be used in healthcare financial management settings. This article explains the benchmarking process and examines some of the 1993 study's findings.

In vitro fluoride release from a different kind of conventional and resin modified glass-ionomer cements.

PubMed

Selimović-Dragaš, Mediha; Hasić-Branković, Lajla; Korać, Fehim; Đapo, Nermin; Huseinbegović, Amina; Kobašlija, Sedin; Lekić, Meliha; Hatibović-Kofman, Šahza

2013-08-01

Fluoride release is important characteristic of glass-ionomer cements. Quantity of fluoride ions released from the glass-ionomer cements has major importance in definition of their biological activity. The objectives of this study were to define the quantity of fluoride ions released from the experimental glass-ionomer cements and to define the effect of fluoride ions released from the experimental glass-ionomer cements on their cytotoxicity. Concentrations of the fluoride ions released in the evaluated glass-ionomer cements were measured indirectly, by the fluoride-selective WTW, F500 electrode potential, combined with reference R503/D electrode. Statistical analyses of F-ion concentrations released by all glass-ionomers evaluated at two time points, after 8 and after 24 hours, show statistically higher fluoride releases from RMGICs: Vitrebond, Fuji II LC and Fuji Plus, when compared to conventional glass-ionomer cements: Fuji Triage, Fuji IX GP Fast and Ketac Silver, both after 8 and after 24 hours. Correlation coefficient between concentrations of fluoride ion released by evaluated glass-ionomer cements and cytotoxic response of UMR-106 osteoblast cell-line are relatively high, but do not reach levels of biological significance. Correlation between concentrations of fluoride ion released and cytotoxic response of NIH3T3 mouse fibroblast cell line after 8 hours is high, positive and statistically significant for conventional GICs, Fuji Triage and Fuji IX GP Fast, and RMGIC, Fuji II LC. Statistically significant Correlation coefficient between concentrations of fluoride ion released and cytotoxic response of NIH3T3 cell line after 24 hours is defined for RMGIC Fuji II LC only.

Analgesic Activity of Tramadol and Buprenorphine after Voluntary Ingestion by Rats (Rattus norvegicus)

PubMed Central

Taylor, Bryan F; Ramirez, Harvey E; Battles, August H; Andrutis, Karl A; Neubert, John K

2016-01-01

Effective pain management for rats and mice is crucial due to the continuing increase in the use of these species in biomedical research. Here we used a recently validated operant orofacial pain assay to determine dose–response curves for buprenorphine and tramadol when mixed in nut paste and administered to male and female rats. Statistically significant analgesic doses of tramadol in nut paste included doses of 20, 30, and 40 mg/kg for female rats but only 40 mg/kg for male rats. For male rats receiving buprenorphine mixed in nut paste, a significant analgesic response was observed at 0.5 and 0.6 mg/kg. None of the doses tested produced a significant analgesic response in female rats. Our results indicate that at the doses tested, tramadol and buprenorphine produced an analgesic response in male rats. In female rats, tramadol shows a higher analgesic effect than buprenorphine. The analgesic effects observed 60 min after administration of the statistically significant oral doses of both drugs were similar to the analgesic effects of 0.03 mg/kg subcutaneous buprenorphine 30 min after administration. The method of voluntary ingestion could be effective, is easy to use, and would minimize stress to the rats during the immediate postoperative period. PMID:26817983

Early PET/CT scan is more effective than RECIST in predicting outcome of patients with liver metastases from colorectal cancer treated with preoperative chemotherapy plus bevacizumab.

PubMed

Lastoria, Secondo; Piccirillo, Maria Carmela; Caracò, Corradina; Nasti, Guglielmo; Aloj, Luigi; Arrichiello, Cecilia; de Lutio di Castelguidone, Elisabetta; Tatangelo, Fabiana; Ottaiano, Alessandro; Iaffaioli, Rosario Vincenzo; Izzo, Francesco; Romano, Giovanni; Giordano, Pasqualina; Signoriello, Simona; Gallo, Ciro; Perrone, Francesco

2013-12-01

Markers predictive of treatment effect might be useful to improve the treatment of patients with metastatic solid tumors. Particularly, early changes in tumor metabolism measured by PET/CT with (18)F-FDG could predict the efficacy of treatment better than standard dimensional Response Evaluation Criteria In Solid Tumors (RECIST) response. We performed PET/CT evaluation before and after 1 cycle of treatment in patients with resectable liver metastases from colorectal cancer, within a phase 2 trial of preoperative FOLFIRI plus bevacizumab. For each lesion, the maximum standardized uptake value (SUV) and the total lesion glycolysis (TLG) were determined. On the basis of previous studies, a ≤ -50% change from baseline was used as a threshold for significant metabolic response for maximum SUV and, exploratively, for TLG. Standard RECIST response was assessed with CT after 3 mo of treatment. Pathologic response was assessed in patients undergoing resection. The association between metabolic and CT/RECIST and pathologic response was tested with the McNemar test; the ability to predict progression-free survival (PFS) and overall survival (OS) was tested with the Log-rank test and a multivariable Cox model. Thirty-three patients were analyzed. After treatment, there was a notable decrease of all the parameters measured by PET/CT. Early metabolic PET/CT response (either SUV- or TLG-based) had a stronger, independent and statistically significant predictive value for PFS and OS than both CT/RECIST and pathologic response at multivariate analysis, although with different degrees of statistical significance. The predictive value of CT/RECIST response was not significant at multivariate analysis. PET/CT response was significantly predictive of long-term outcomes during preoperative treatment of patients with liver metastases from colorectal cancer, and its predictive ability was higher than that of CT/RECIST response after 3 mo of treatment. Such findings need to be confirmed by larger prospective trials.

Aging Affects Adaptation to Sound-Level Statistics in Human Auditory Cortex.

PubMed

Herrmann, Björn; Maess, Burkhard; Johnsrude, Ingrid S

2018-02-21

Optimal perception requires efficient and adaptive neural processing of sensory input. Neurons in nonhuman mammals adapt to the statistical properties of acoustic feature distributions such that they become sensitive to sounds that are most likely to occur in the environment. However, whether human auditory responses adapt to stimulus statistical distributions and how aging affects adaptation to stimulus statistics is unknown. We used MEG to study how exposure to different distributions of sound levels affects adaptation in auditory cortex of younger (mean: 25 years; n = 19) and older (mean: 64 years; n = 20) adults (male and female). Participants passively listened to two sound-level distributions with different modes (either 15 or 45 dB sensation level). In a control block with long interstimulus intervals, allowing neural populations to recover from adaptation, neural response magnitudes were similar between younger and older adults. Critically, both age groups demonstrated adaptation to sound-level stimulus statistics, but adaptation was altered for older compared with younger people: in the older group, neural responses continued to be sensitive to sound level under conditions in which responses were fully adapted in the younger group. The lack of full adaptation to the statistics of the sensory environment may be a physiological mechanism underlying the known difficulty that older adults have with filtering out irrelevant sensory information. SIGNIFICANCE STATEMENT Behavior requires efficient processing of acoustic stimulation. Animal work suggests that neurons accomplish efficient processing by adjusting their response sensitivity depending on statistical properties of the acoustic environment. Little is known about the extent to which this adaptation to stimulus statistics generalizes to humans, particularly to older humans. We used MEG to investigate how aging influences adaptation to sound-level statistics. Listeners were presented with sounds drawn from sound-level distributions with different modes (15 vs 45 dB). Auditory cortex neurons adapted to sound-level statistics in younger and older adults, but adaptation was incomplete in older people. The data suggest that the aging auditory system does not fully capitalize on the statistics available in sound environments to tune the perceptual system dynamically. Copyright © 2018 the authors 0270-6474/18/381989-11$15.00/0.

Assessing response to treatment in non--small-cell lung cancer: role of tumor volume evaluated by computed tomography.

PubMed

Knollmann, Friedrich D; Kumthekar, Rohan; Fetzer, David; Socinski, Mark A

2014-03-01

We set out to investigate whether volumetric tumor measurements allow for a prediction of treatment response, as measured by patient survival, in patients with advanced non-small-cell lung cancer (NSCLC). Patients with nonresectable NSCLC (stage III or IV, n = 100) who were repeatedly evaluated for treatment response by computed tomography (CT) were included in a Health Insurance Portability and Accountability Act (HIPAA)-compliant retrospective study. Tumor response was measured by comparing tumor volumes over time. Patient survival was compared with Response Evaluation Criteria in Solid Tumors (RECIST) using Kaplan-Meier survival statistics and Cox regression analysis. The median overall patient survival was 553 days (standard error, 146 days); for patients with stage III NSCLC, it was 822 days, and for patients with stage IV disease, 479 days. The survival differences were not statistically significant (P = .09). According to RECIST, 5 patients demonstrated complete response, 39 partial response, 44 stable disease, and 12 progressive disease. Patient survival was not significantly associated with RECIST class, the change of the sum of tumor diameters (P = .98), nor the change of the sum of volumetric tumor dimensions (P = .17). In a group of 100 patients with advanced-stage NSCLC, neither volumetric CT measurements of changes in tumor size nor RECIST class significantly predicted patient survival. This observation suggests that size response may not be a sufficiently precise surrogate marker of success to steer treatment decisions in individual patients. Copyright © 2014 Elsevier Inc. All rights reserved.

Responses to human intruders by birds nesting in colonies: Experimental results and management guidelines

USGS Publications Warehouse

Erwin, R.M.

1989-01-01

Colonies of nesting wading birds and seabirds were studied at coastal sites in Virginia and North Carolina to determine distances at which birds flushed in response to human intrusion. There were few statistically significant relationships between flushing distances and colony size. Similarly, there were few differences between responses during incubation compared to post-hatching periods.

Précis of statistical significance: rationale, validity, and utility.

PubMed

Chow, S L

1998-04-01

The null-hypothesis significance-test procedure (NHSTP) is defended in the context of the theory-corroboration experiment, as well as the following contrasts: (a) substantive hypotheses versus statistical hypotheses, (b) theory corroboration versus statistical hypothesis testing, (c) theoretical inference versus statistical decision, (d) experiments versus nonexperimental studies, and (e) theory corroboration versus treatment assessment. The null hypothesis can be true because it is the hypothesis that errors are randomly distributed in data. Moreover, the null hypothesis is never used as a categorical proposition. Statistical significance means only that chance influences can be excluded as an explanation of data; it does not identify the nonchance factor responsible. The experimental conclusion is drawn with the inductive principle underlying the experimental design. A chain of deductive arguments gives rise to the theoretical conclusion via the experimental conclusion. The anomalous relationship between statistical significance and the effect size often used to criticize NHSTP is more apparent than real. The absolute size of the effect is not an index of evidential support for the substantive hypothesis. Nor is the effect size, by itself, informative as to the practical importance of the research result. Being a conditional probability, statistical power cannot be the a priori probability of statistical significance. The validity of statistical power is debatable because statistical significance is determined with a single sampling distribution of the test statistic based on H0, whereas it takes two distributions to represent statistical power or effect size. Sample size should not be determined in the mechanical manner envisaged in power analysis. It is inappropriate to criticize NHSTP for nonstatistical reasons. At the same time, neither effect size, nor confidence interval estimate, nor posterior probability can be used to exclude chance as an explanation of data. Neither can any of them fulfill the nonstatistical functions expected of them by critics.

Postural-Sway Response in Learning-Disabled Children: Pilot Data.

ERIC Educational Resources Information Center

Polatajko, H. J.

1987-01-01

The postural-sway response of five learning disabled (LD) and five nondisabled children was evaluated using a force platform. From statistical analysis of the two groups, the LD children appeared to use visual input to compensate for postural problems and had significant difficulty controlling posture with eyes closed. (SK)

On the Relationship Between Transfer Function-derived Response Times and Hydrograph Analysis Timing Parameters: Are there Similarities?

NASA Astrophysics Data System (ADS)

Bansah, S.; Ali, G.; Haque, M. A.; Tang, V.

2017-12-01

The proportion of precipitation that becomes streamflow is a function of internal catchment characteristics - which include geology, landscape characteristics and vegetation - and influence overall storage dynamics. The timing and quantity of water discharged by a catchment are indeed embedded in event hydrographs. Event hydrograph timing parameters, such as the response lag and time of concentration, are important descriptors of how long it takes the catchment to respond to input precipitation and how long it takes the latter to filter through the catchment. However, the extent to which hydrograph timing parameters relate to average response times derived from fitting transfer functions to annual hydrographs is unknown. In this study, we used a gamma transfer function to determine catchment average response times as well as event-specific hydrograph parameters across a network of eight nested watersheds ranging from 0.19 km2 to 74.6 km2 prairie catchments located in south central Manitoba (Canada). Various statistical analyses were then performed to correlate average response times - estimated using the parameters of the fitted gamma transfer function - to event-specific hydrograph parameters. Preliminary results show significant interannual variations in response times and hydrograph timing parameters: the former were in the order of a few hours to days, while the latter ranged from a few days to weeks. Some statistically significant relationships were detected between response times and event-specific hydrograph parameters. Future analyses will involve the comparison of statistical distributions of event-specific hydrograph parameters with that of runoff response times and baseflow transit times in order to quantity catchment storage dynamics across a range of temporal scales.

Effects of vibratory stimulation on sexual response in women with spinal cord injury.

PubMed

Sipski, Marca L; Alexander, Craig J; Gomez-Marin, Orlando; Grossbard, Marissa; Rosen, Raymond

2005-01-01

Women with spinal cord injuries (SCIs) have predictable alterations in sexual responses. They commonly have a decreased ability to achieve genital sexual arousal. This study determined whether the use of vibratory stimulation would result in increased genital arousal as measured by vaginal pulse amplitude in women with SCIs. Subjects included 46 women with SCIs and 11 nondisabled control subjects. Results revealed vibratory clitoral stimulation resulted in increased vaginal pulse amplitude as compared with manual clitoral stimulation in both SCI and nondisabled subjects; however, these differences were not statistically significant. Subjective levels of arousal were also compared between SCI and nondisabled control subjects. Both vibratory and manual clitoral stimulation resulted in significantly increased arousal levels in both groups of subjects; however, statistically significant differences between the two conditions were only noted in nondisabled subjects. Further studies of the effects of repetitive vibratory stimulation are underway.

Evaluation of interactive teaching for undergraduate medical students using a classroom interactive response system in India.

PubMed

Datta, Rakesh; Datta, Karuna; Venkatesh, M D

2015-07-01

The classical didactic lecture has been the cornerstone of the theoretical undergraduate medical education. Their efficacy however reduces due to reduced interaction and short attention span of the students. It is hypothesized that the interactive response pad obviates some of these drawbacks. The aim of this study was to evaluate the effectiveness of an interactive response system by comparing it with conventional classroom teaching. A prospective comparative longitudinal study was conducted on 192 students who were exposed to either conventional or interactive teaching over 20 classes. Pre-test, Post-test and retentions test (post 8-12 weeks) scores were collated and statistically analysed. An independent observer measured number of student interactions in each class. Pre-test scores from both groups were similar (p = 0.71). There was significant improvement in both post test scores when compared to pre-test scores in either method (p < 0.001). The interactive post-test score was better than conventional post test score (p < 0.001) by 8-10% (95% CI-difference of means - 8.2%-9.24%-10.3%). The interactive retention test score was better than conventional retention test score (p < 0.001) by 15-18% (95% CI-difference of means - 15.0%-16.64%-18.2%). There were 51 participative events in the interactive group vs 25 in the conventional group. The Interactive Response Pad method was efficacious in teaching. Students taught with the interactive method were likely to score 8-10% higher (statistically significant) in the immediate post class time and 15-18% higher (statistically significant) after 8-12 weeks. The number of student-teacher interactions increases when using the interactive response pads.

Culturally Responsive Adolescent Pregnancy and Sexually Transmitted Infection Prevention Program for Middle School Students in Hawai‘i

PubMed Central

Barker, Linda Toms; Chan, Vincent; Eucogco, Jasmine

2016-01-01

Objectives. To evaluate the effectiveness of Pono Choices, a culturally responsive adolescent pregnancy and sexually transmitted infection (STI) prevention program targeting middle school youths in Hawai‘i. Methods. We conducted a cluster randomized controlled trial with the school as the unit of random assignment over 3 semesters between 2012 and 2013. The sample consisted of 36 middle schools and 2203 students. We administered student surveys to collect baseline outcomes, student demographic data, and outcomes at 12 months after baseline. Results. We found statistically significant effects for the knowledge assessment, which focused on basic understanding of adolescent pregnancy and STI prevention. The average percentage of correct responses was 73.6 for the treatment group and 60.4 for the control group (P < .001). We did not find statistically significant effects on behavioral outcomes (initiation of sexual activity or engagement in high-risk sexual behavior) or on other nonbehavioral outcomes (attitudes, skills, intentions). Conclusions. Pono Choices had a statistically significant impact on knowledge of adolescent pregnancy and STI prevention among middle school students at 12 months after baseline, though it did not lead to detectable changes in behavioral outcomes within the 1-year observation period. These results call for an exploration of longer-term outcomes to assess effects on knowledge retention and behavioral changes. PMID:27689477

Definition of simulated driving tests for the evaluation of drivers' reactions and responses.

PubMed

Bartolozzi, Riccardo; Frendo, Francesco

2014-01-01

This article aims at identifying the most significant measures in 2 perception-response (PR) tests performed at a driving simulator: a braking test and a lateral skid test, which were developed in this work. Forty-eight subjects (26 females and 22 males) with a mean age of 24.9 ± 3.0 years were enrolled for this study. They were asked to perform a drive on the driving simulator at the University of Pisa (Italy) following a specific test protocol, including 8-10 braking tests and 8-10 lateral skid tests. Driver input signals and vehicle model signals were recorded during the drives and analyzed to extract measures such as the reaction time, first response time, etc. Following a statistical procedure (based on analysis of variance [ANOVA] and post hoc tests), all test measures (3 for the braking test and 8 for the lateral skid test) were analyzed in terms of statistically significant differences among different drivers. The presented procedure allows evaluation of the capability of a given test to distinguish among different drivers. In the braking test, the reaction time showed a high dispersion among single drivers, leading to just 4.8 percent of statistically significant driver pairs (using the Games-Howell post hoc test), whereas the pedal transition time scored 31.9 percent. In the lateral skid test, 28.5 percent of the 2 × 2 comparisons showed significantly different reaction times, 19.5 percent had different response times, 35.2 percent had a different second peak of the steering wheel signal, and 33 percent showed different values of the integral of the steering wheel signal. For the braking test, which has been widely employed in similar forms in the literature, it was shown how the reaction time, with respect to the pedal transition time, can have a higher dispersion due to the influence of external factors. For the lateral skid test, the following measures were identified as the most significant for application studies: the reaction time for the reaction phase, the second peak of the steering wheel angle for the first instinctive response, and the integral of the steering wheel angle for the complete response. The methodology used to analyze the test measures was founded on statistically based and objective evaluation criteria and could be applied to other tests. Even if obtained with a fixed-base simulator, the obtained results represent useful information for applications of the presented PR tests in experimental campaigns with driving simulators.

Electroencephalographic Response to Different Odors in Healthy Individuals: A Promising Tool for Objective Assessment of Olfactory Disorders.

PubMed

Krbot Skorić, Magdalena; Adamec, Ivan; Jerbić, Ana Branka; Gabelić, Tereza; Hajnšek, Sanja; Habek, Mario

2015-10-01

The aim of the present study was to examine human central nervous system response to three different odors. Electrophysiological activity was recorded in the baseline state and for 3 odors, lemon, peppermint, and vanilla, in 16 healthy participants. Electrodes were separated into groups according to the spatial position on the head. Fast Fourier transformation was performed on every set, and mean value of activity in theta was exported. As theta showed statistically significant results, further analysis was based only on the theta frequency band. On electrodes FP1, F3, Fz, F4, F8, T7, C3, Cz, C4, T8, TP9, CP5, CP1, CP2, CP6, P7, P3, Pz, P4, P8, PO9, and PO10 there was statistically significant difference in the electrical activity of the brain between four conditions. For peppermint and lemon, there was statistically significant difference in activity between different regions-F(1.576, 23.637)=16.030, P=.000 and F(1.362, 20.425)=4.54, P=.035, respectively-where the activity in the central area was significantly reduced compared with the activity in the other 4 areas and in the left and right anterior and left posterior area, respectively. There was no statistically significant difference for vanilla between specific areas, F(1.217, 18.257)=1.155, P=.309. The results indicate that olfactory stimuli can affect the frequency characteristics of the electrical activity of the brain. © EEG and Clinical Neuroscience Society (ECNS) 2014.

Comparing data collected by computerized and written surveys for adolescence health research.

PubMed

Wu, Ying; Newfield, Susan A

2007-01-01

This study assessed whether data-collection formats, computerized versus paper-and-pencil, affect response patterns and descriptive statistics for adolescent health assessment surveys. Youth were assessed as part of a health risk reduction program. Baseline data from 1131 youth were analyzed. Participants completed the questionnaire either by computer (n = 390) or by paper-and-pencil (n = 741). The rate of returned surveys meeting inclusion requirements was 90.6% and did not differ by methods. However, the computerized method resulted in significantly less incompleteness but more identical responses. Multiple regression indicated that the survey methods did not contribute to problematic responses. The two survey methods yielded similar scale internal reliability and descriptive statistics for behavioral and psychological outcomes, although the computerized method elicited higher reports of some risk items such as carrying a knife, beating up a person, selling drugs, and delivering drugs. Overall, the survey method did not produce a significant difference in outcomes. This provides support for program personnel selecting survey methods based on study goals with confidence that the method of administration will not have a significant impact on the outcome.

ROLE CONFUSION AND SELF ASSESSMENT IN INTERPROFESSIONAL TRAUMA TEAMS

PubMed Central

Steinemann, Susan; Kurosawa, Gene; Wei, Alexander; Ho, Nina; Lim, Eunjung; Suares, Gregory; Bhatt, Ajay; Berg, Benjamin

2015-01-01

Background Trauma care requires coordinating an interprofessional team, with formative feedback on teamwork skills. We hypothesized nurses and surgeons have different perceptions regarding roles during resuscitation; that nurses’ teamwork self-assessment differs from experts’, and that video debriefing might improve accuracy of self-assessment. Methods Trauma nurses and surgeons were surveyed regarding resuscitation responsibilities. Subsequently, nurses joined interprofessional teams in simulated trauma resuscitations. Following each resuscitation, nurses and teamwork experts independently scored teamwork (T-NOTECHS). After video debriefing, nurses repeated T-NOTECHS self-assessment. Results Nurses and surgeons assumed significantly more responsibility by their own profession for 71% of resuscitation tasks. Nurses’ overall T-NOTECHS ratings were slightly higher than experts’. This was evident in all T-NOTECHS subdomains except “leadership,” but despite statistical significance the difference was small and clinically irrelevant. Video debriefing did not improve the accuracy of self-assessment. Conclusions Nurses and physicians demonstrated discordant perceptions of responsibilities. Nurses’ self-assessment of teamwork was statistically, but not clinically significantly, higher than experts’ in all domains except physician leadership. PMID:26801092

High order statistical signatures from source-driven measurements of subcritical fissile systems

NASA Astrophysics Data System (ADS)

Mattingly, John Kelly

1998-11-01

This research focuses on the development and application of high order statistical analyses applied to measurements performed with subcritical fissile systems driven by an introduced neutron source. The signatures presented are derived from counting statistics of the introduced source and radiation detectors that observe the response of the fissile system. It is demonstrated that successively higher order counting statistics possess progressively higher sensitivity to reactivity. Consequently, these signatures are more sensitive to changes in the composition, fissile mass, and configuration of the fissile assembly. Furthermore, it is shown that these techniques are capable of distinguishing the response of the fissile system to the introduced source from its response to any internal or inherent sources. This ability combined with the enhanced sensitivity of higher order signatures indicates that these techniques will be of significant utility in a variety of applications. Potential applications include enhanced radiation signature identification of weapons components for nuclear disarmament and safeguards applications and augmented nondestructive analysis of spent nuclear fuel. In general, these techniques expand present capabilities in the analysis of subcritical measurements.

AN EXPLORATORY STUDY INVESTIGATING THE EFFECTS OF A TREATMENT MANUAL FOR VIDEO GAME ADDICTION.

PubMed

Pallesen, Ståle; Lorvik, Ingjerd Meen; Bu, Eli Hellandsjø; Molde, Helge

2015-10-01

This study investigated the effects of a manualized therapy for video game addiction in 12 males, ages 14-18 yr. The manual was based on cognitive-behavioral therapy, short-term strategic family therapy, solution-focused therapy, and motivational interviewing. Treatment response was reported by the patients, their mothers, and the therapists. The patients reported moderate (but statistically non-significant) improvement from pre- to post-treatment. The mothers, however, reported large effects and statistically significant improvement from pre- to post-treatment. The therapists reported marked or moderate treatment response in six of the 12 patients. The ratings of change by mothers converged well with the views of change of both the patients and therapists, whereas the convergence of views on change between the two latter sources was far lower.

Texture analysis of apparent diffusion coefficient maps for treatment response assessment in prostate cancer bone metastases-A pilot study.

PubMed

Reischauer, Carolin; Patzwahl, René; Koh, Dow-Mu; Froehlich, Johannes M; Gutzeit, Andreas

2018-04-01

To evaluate whole-lesion volumetric texture analysis of apparent diffusion coefficient (ADC) maps for assessing treatment response in prostate cancer bone metastases. Texture analysis is performed in 12 treatment-naïve patients with 34 metastases before treatment and at one, two, and three months after the initiation of androgen deprivation therapy. Four first-order and 19 second-order statistical texture features are computed on the ADC maps in each lesion at every time point. Repeatability, inter-patient variability, and changes in the feature values under therapy are investigated. Spearman rank's correlation coefficients are calculated across time to demonstrate the relationship between the texture features and the serum prostate specific antigen (PSA) levels. With few exceptions, the texture features exhibited moderate to high precision. At the same time, Friedman's tests revealed that all first-order and second-order statistical texture features changed significantly in response to therapy. Thereby, the majority of texture features showed significant changes in their values at all post-treatment time points relative to baseline. Bivariate analysis detected significant correlations between the great majority of texture features and the serum PSA levels. Thereby, three first-order and six second-order statistical features showed strong correlations with the serum PSA levels across time. The findings in the present work indicate that whole-tumor volumetric texture analysis may be utilized for response assessment in prostate cancer bone metastases. The approach may be used as a complementary measure for treatment monitoring in conjunction with averaged ADC values. Copyright © 2018 Elsevier B.V. All rights reserved.

Patterns of shading tolerance determined from experimental ...

EPA Pesticide Factsheets

An extensive review of the experimental literature on seagrass shading evaluated the relationship between experimental light reductions, duration of experiment and seagrass response metrics to determine whether there were consistent statistical patterns. There were highly significant linear relationships of both percent biomass and percent shoot density reduction versus percent light reduction (versus controls), although unexplained variation in the data were high. Duration of exposure affected extent of response for both metrics, but was more clearly a factor in biomass response. Both biomass and shoot density showed linear responses to duration of light reduction for treatments 60%. Unexplained variation was again high, and greater for shoot density than biomass. With few exceptions, regressions of both biomass and shoot density on light reduction for individual species and for genera were statistically significant, but also tended to show high degrees of variability in data. Multivariate regressions that included both percent light reduction and duration of reduction as dependent variables increased the percentage of variation explained in almost every case. Analysis of response data by seagrass life history category (Colonizing, Opportunistic, Persistent) did not yield clearly separate response relationships in most cases. Biomass tended to show somewhat less variation in response to light reduction than shoot density, and of the two, may be the prefe

PRECIPITIN RESPONSE TO HUMAN SERUM BY A RABBIT POPULATION. COMPARISON OF STRESSES ON SECONDARY PRECIPITIN RESPONSES.

DTIC Science & Technology

administered in this experiment, the following stresses and stress combinations produced a statistically significant depression of precipitin production ...greatest effect at the head of the list: 6- mercaptopurine ; 800 r whole-body gamma radiation immediately followed by 10 days at a simulated altitude of

Refining clinical features and therapeutic options of new daily persistent headache: a retrospective study of 63 patients in India.

PubMed

Prakash, Sanjay; Saini, Samir; Rana, Kaushikkumar Ramanlal; Mahato, Pinaki

2012-08-01

The aim of this retrospective study was to provide data on the clinical features and treatment outcomes of patients with NDPH (fulfilling Kung et al.'s criteria). A total of 63 patients were observed during a 5-yr period (2007-2012). More than one-third (35 %) patients had migrainous features; 65 % patients fulfilled the ICHD-II criteria. Both groups were similar in most clinical and epidemiological features. However, migrainous features were more common in patients with a prior history of episodic migraine (though statistically not significant). After a median follow-up of 9 months, 37 % patients showed "excellent" response (no or less than 1 headache per month). Another 30 % patients had "good" response (>50 % reduction in headache frequency or days per month). Excellent response was more in patients with a history of less than 6 months duration (statistically not significant). Patients with a recognized trigger showed better prognosis. Response was better in patients who received intravenous therapy of methyl prednisolone and sodium valproate. We suggest prospective and controlled studies to confirm our observations.

In vitro fluoride release from a different kind of conventional and resin modified glass-ionomer cements

PubMed Central

Selimović-Dragaš, Mediha; Hasić-Branković, Lajla; Korać, Fehim; Đapo, Nermin; Huseinbegović, Amina; Kobašlija, Sedin; Lekić, Meliha; Hatibović-Kofman, Šahza

2013-01-01

Fluoride release is important characteristic of glass-ionomer cements. Quantity of fluoride ions released from the glass-ionomer cements has major importance in definition of their biological activity. The objectives of this study were to define the quantity of fluoride ions released from the experimental glass-ionomer cements and to define the effect of fluoride ions released from the experimental glass-ionomer cements on their cytotoxicity. Concentrations of the fluoride ions released in the evaluated glass-ionomer cements were measured indirectly, by the fluoride-selective WTW, F500 electrode potential, combined with reference R503/D electrode. Statistical analyses of F-ion concentrations released by all glass-ionomers evaluated at two time points, after 8 and after 24 hours, show statistically higher fluoride releases from RMGICs: Vitrebond, Fuji II LC and Fuji Plus, when compared to conventional glass-ionomer cements: Fuji Triage, Fuji IX GP Fast and Ketac Silver, both after 8 and after 24 hours. Correlation coefficient between concentrations of fluoride ion released by evaluated glass-ionomer cements and cytotoxic response of UMR-106 osteoblast cell-line are relatively high, but do not reach levels of biological significance. Correlation between concentrations of fluoride ion released and cytotoxic response of NIH3T3 mouse fibroblast cell line after 8 hours is high, positive and statistically significant for conventional GICs, Fuji Triage and Fuji IX GP Fast, and RMGIC, Fuji II LC. Statistically significant Correlation coefficient between concentrations of fluoride ion released and cytotoxic response of NIH3T3 cell line after 24 hours is defined for RMGIC Fuji II LC only. PMID:23988173

Effect of single dose of omeprazole on the gastrointestinal peptide response to food.

PubMed

Allen, J M; Adrian, T E; Webster, J; Howe, A; Bloom, S R

1984-02-01

The gastrointestinal peptide response to food was assessed in 6 healthy subjects following oral administration of 40 mg omeprazole. There was a small but statistically significant increase in basal plasma gastrin six hours after the dose of omeprazole, but the post-prandial plasma gastrin was not significantly increased. There was no significant effect on basal or post-prandial levels of somatostatin, insulin, pancreatic glucagon, enteroglucagon, gastric inhibitory polypeptide, pancreatic polypeptide, motilin, neurotensin, cholecystokinin, secretin, vasoactive intestinal peptide and gastrin-releasing peptide or blood glucose concentration.

The impact of a scheduling change on ninth grade high school performance on biology benchmark exams and the California Standards Test

NASA Astrophysics Data System (ADS)

Leonardi, Marcelo

The primary purpose of this study was to examine the impact of a scheduling change from a trimester 4x4 block schedule to a modified hybrid schedule on student achievement in ninth grade biology courses. This study examined the impact of the scheduling change on student achievement through teacher created benchmark assessments in Genetics, DNA, and Evolution and on the California Standardized Test in Biology. The secondary purpose of this study examined the ninth grade biology teacher perceptions of ninth grade biology student achievement. Using a mixed methods research approach, data was collected both quantitatively and qualitatively as aligned to research questions. Quantitative methods included gathering data from departmental benchmark exams and California Standardized Test in Biology and conducting multiple analysis of covariance and analysis of covariance to determine significance differences. Qualitative methods include journal entries questions and focus group interviews. The results revealed a statistically significant increase in scores on both the DNA and Evolution benchmark exams. DNA and Evolution benchmark exams showed significant improvements from a change in scheduling format. The scheduling change was responsible for 1.5% of the increase in DNA benchmark scores and 2% of the increase in Evolution benchmark scores. The results revealed a statistically significant decrease in scores on the Genetics Benchmark exam as a result of the scheduling change. The scheduling change was responsible for 1% of the decrease in Genetics benchmark scores. The results also revealed a statistically significant increase in scores on the CST Biology exam. The scheduling change was responsible for .7% of the increase in CST Biology scores. Results of the focus group discussions indicated that all teachers preferred the modified hybrid schedule over the trimester schedule and that it improved student achievement.

2012 Workplace and Gender Relations Survey of Active Duty Members: Nonresponse Bias Analysis Report

DTIC Science & Technology

2014-01-01

Control and Prevention ), or command climate surveys (e.g., DEOCS). 6 Table 1. Comparison of Trends in WGRA and SOFS-A Response Rates (Shown in...DMDC draws optimized samples to reduce survey burden on members as well as produce high levels of precision for important domain estimates by using...statistical significance at α= .05 Because paygrade is a significant predictor of survey response, we next examined the odds ratio of each paygrade levels

Emotion, working memory, and cognitive control in patients with first-onset and previously untreated minor depressive disorders.

PubMed

Li, Mi; Lu, Shengfu; Wang, Gang; Feng, Lei; Fu, Bingbing; Zhong, Ning

2016-06-01

To explore working memory and the ability to process different emotional stimuli in patients with first-onset and untreated minor (mild or moderate) depression. Patients with first-onset and previously untreated minor depression, and healthy controls, were enrolled. Using a modified Sternberg working memory paradigm to investigate the combined effects of emotional stimuli with working memory, participants were exposed to experimental stimuli comprising pictures that represented positive, neutral and negative emotions. Working memory ability was measured using reaction time and accuracy, and emotion-processing ability was measured using pupil diameter. Out of 36 participants (18 patients with minor depression and 18 controls), there were no statistically significant between-group differences in response time and accuracy. Positive stimuli evoked changes in pupil diameter that were significantly smaller in patients with minor depression versus controls, but changes in pupil diameter evoked by negative stimuli were not significantly different between the two groups. Healthy subjects showed a stronger emotional response to positive emotional stimuli than patients with first onset and previously untreated minor depression, but there were no differences in response to negative emotions. There were no statistically significant between-group differences in terms of speed of cognitive response, but this may have been due to the relatively small samples sizes assessed. Studies with larger sample populations are required to further investigate these results. © The Author(s) 2016.

Salt preference: age and sex related variability.

PubMed

Verma, Punam; Mittal, Sunita; Ghildiyal, Archana; Chaudhary, Lalita; Mahajan, K K

2007-01-01

Salt preference was assessed in 60 adults of 18-21 yrs of age (30 males and 30 females) and in 60 children of 7-12 yrs of age (30 boys and 30 girls). Subjects rated the preference on Likert scale for popcorns of five salt concentrations (OM, 1M, 2M, 3M and +3M). Statistical analysis using Two way ANOVA revealed statistically significant effect of age and sex on salt preference (F4,100 = 15.027, P < 0.01) and One Way ANOVA revealed statistically significant sex difference in salt preference of adults (F4,50 = 16.26, P < 0.01) but no statistically significant sex difference in salt preference of children (F4,50 = 4.08, P > 0.05). Dietary experiences during development and more physical activity in children may be responsible for higher salt preference in children while finding no sex variability in children favours the role of sex hormones in salt preference of male and females.

On Fitting Generalized Linear Mixed-effects Models for Binary Responses using Different Statistical Packages

PubMed Central

Zhang, Hui; Lu, Naiji; Feng, Changyong; Thurston, Sally W.; Xia, Yinglin; Tu, Xin M.

2011-01-01

Summary The generalized linear mixed-effects model (GLMM) is a popular paradigm to extend models for cross-sectional data to a longitudinal setting. When applied to modeling binary responses, different software packages and even different procedures within a package may give quite different results. In this report, we describe the statistical approaches that underlie these different procedures and discuss their strengths and weaknesses when applied to fit correlated binary responses. We then illustrate these considerations by applying these procedures implemented in some popular software packages to simulated and real study data. Our simulation results indicate a lack of reliability for most of the procedures considered, which carries significant implications for applying such popular software packages in practice. PMID:21671252

Respiratory effects of diesel exhaust in salt miners

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gamble, J.F.; Jones, W.G.

1983-09-01

The respiratory health of 259 white males working at 5 salt (NaCl) mines was assessed by questionnaire, chest radiographs, and air and He-O/sup 2/ spirometry. Response variables were symptoms, pneumoconiosis, and spirometry. Predictor variables included age, height, smoking, mine, and tenure in diesel-exposed jobs. The purpose was to assess the association of response measures of respiratory health with exposure to diesel exhaust. There were only 2 cases of Grade 1 pneumoconiosis, so no further analysis was done. Comparisons within the study population showed a statistically significant dose-related association of phlegm and diesel exposure. There was a nonsignificant trend for coughmore » and dyspnea, and no association with spirometry. Age- and smoking-adjusted rates of cough, phlegm, and dyspnea were 145, 159, and 93% of an external comparison population. Percent predicted flow rates showed statistically significant reductions, but the reductions were small and there were no dose-response relations. Percent predicted FEV1 and FVC were about 96% of predicted.« less

Reliability of dietary information from surrogate respondents.

PubMed

Hislop, T G; Coldman, A J; Zheng, Y Y; Ng, V T; Labo, T

1992-01-01

A self-administered food frequency questionnaire was included as part of a case-control study of breast cancer in 1980-82. In 1986-87, a second food frequency questionnaire was sent to surviving cases and husbands of deceased cases; 30 spouses (86% response rate) and 263 surviving cases (88% response rate) returned questionnaires. The dietary questions concerned consumption of specific food items by the case before diagnosis of breast cancer. Missing values were less common in the second questionnaire; there was no significant difference in missing values between surviving cases and spouses of deceased cases. Kappa statistics comparing responses in the first and second questionnaires were significantly lower for spouses of deceased cases than for surviving cases. Reported level of confidence by the husbands regarding knowledge about their wives' eating habits did not influence the kappa statistics or the frequencies of missing values. The lack of good agreement has important implications for the use of proxy interviews from husbands in retrospective dietary studies.

Individualism: a valid and important dimension of cultural differences between nations.

PubMed

Schimmack, Ulrich; Oishi, Shigehiro; Diener, Ed

2005-01-01

Oyserman, Coon, and Kemmelmeier's (2002) meta-analysis suggested problems in the measurement of individualism and collectivism. Studies using Hofstede's individualism scores show little convergent validity with more recent measures of individualism and collectivism. We propose that the lack of convergent validity is due to national differences in response styles. Whereas Hofstede statistically controlled for response styles, Oyserman et al.'s meta-analysis relied on uncorrected ratings. Data from an international student survey demonstrated convergent validity between Hofstede's individualism dimension and horizontal individualism when response styles were statistically controlled, whereas uncorrected scores correlated highly with the individualism scores in Oyserman et al.'s meta-analysis. Uncorrected horizontal individualism scores and meta-analytic individualism scores did not correlate significantly with nations' development, whereas corrected horizontal individualism scores and Hofstede's individualism dimension were significantly correlated with development. This pattern of results suggests that individualism is a valid construct for cross-cultural comparisons, but that the measurement of this construct needs improvement.

Limited responsiveness related to the minimal important difference of patient-reported outcomes in rare diseases.

PubMed

Johnston, Bradley C; Miller, Patricia A; Agarwal, Arnav; Mulla, Sohail; Khokhar, Rabia; De Oliveira, Kyle; Hitchcock, Christine L; Sadeghirad, Behnam; Mohiuddin, Mukarram; Sekercioglu, Nigar; Seweryn, Michal; Koperny, Magdalena; Bala, Malgorzata M; Adams-Webber, Thomasin; Granados, Alicia; Hamed, Alaa; Crawford, Mark W; van der Ploeg, Ans T; Guyatt, Gordon H

2016-11-01

To explore the responsiveness of patient-reported outcomes (PROs) in interventional studies involving patients with rare lysosomal storage diseases (LSDs). We searched eight databases for experimental and nonexperimental studies. Pairs of trained reviewers independently screened articles and subsequently extracted data from the eligible studies. Among studies with 10 or more patients using a valid PRO, we assessed the responsiveness of PROs based on a reanalysis of the data using minimal important difference estimates. Our analyses focused on statistically significant within-group differences in PROs for observational studies or the statistically significant between-group differences in PRO scores for controlled studies. Of 2,679 unique records, 62 interventional studies addressing patients with Fabry (55%), Gaucher (19%), Pompe (16%), and mucopolysaccharidoses (11%) proved eligible. The most frequently used PROs were the Short-Form-36 (25 studies), Brief Pain Inventory (20 studies), EuroQoL-5D (9 studies), and the Fatigue Severity Scale (6 studies). Observational studies suggest that PROs sometimes detect significant within-group changes when present. Randomized trials raise questions regarding the responsiveness of PROs to small differences between groups. Most studies have relied on generic PROs to evaluate quality of life and symptoms in patients with rare LSDs. PROs appear more responsive in observational studies than randomized trials. Copyright © 2016 Elsevier Inc. All rights reserved.

Speech-evoked Brainstem Auditory Responses and Auditory Processing Skills: A Correlation in Adults with Hearing Loss

PubMed Central

Sanguebuche, Taissane Rodrigues; Peixe, Bruna Pias; Bruno, Rúbia Soares; Biaggio, Eliara Pinto Vieira; Garcia, Michele Vargas

2018-01-01

Introduction  The auditory system consists of sensory structures and central connections. The evaluation of the auditory pathway at a central level can be performed through behavioral and electrophysiological tests, because they are complementary to each other and provide important information about comprehension. Objective  To correlate the findings of speech brainstem-evoked response audiometry with the behavioral tests Random Gap Detection Test and Masking Level Difference in adults with hearing loss. Methods  All patients were submitted to a basic audiological evaluation, to the aforementioned behavioral tests, and to an electrophysiological assessment, by means of click-evoked and speech-evoked brainstem response audiometry. Results  There were no statistically significant values among the electrophysiological test and the behavioral tests. However, there was a significant correlation between the V and A waves, as well as the D and F waves, of the speech-evoked brainstem response audiometry peaks. Such correlations are positive, indicating that the increase of a variable implies an increase in another and vice versa. Conclusion  It was possible to correlate the findings of the speech-evoked brainstem response audiometry with those of the behavioral tests Random Gap Detection and Masking Level Difference. However, there was no statistically significant correlation between them. This shows that the electrophysiological evaluation does not depend uniquely on the behavioral skills of temporal resolution and selective attention. PMID:29379574

Evaluation of zinc oxide nanoparticle toxicity in sludge products applied to agricultural soil using multispecies soil systems.

PubMed

Fernández, María Dolores; Alonso-Blázquez, María Nieves; García-Gómez, Concepción; Babin, Mar

2014-11-01

To study the environmental impact of nanoparticles, the sludges of wastewater (WWTS) and water treatment (WTS) plants enriched with ZnO nanoparticles were added to agricultural soil, and the toxic effects of the nanoparticles were studied using a microcosm system based on the soil. The WWTS treated soils were characterised by statistically significant decreases (p<0.05) in Vicia sativa germination at the lowest (76.2%) and medium (95.2%) application rates, decreases in the fresh biomass for Triticum aestivum (19.5%), Raphanus sativus (64.1%), V. sativa (37.4%) and Eisenia fetida (33.6%) at the highest application rate and a dose-related significant increase (p<0.05) in earthworm mortality. In WTS amended soils, significant reductions (p<0.05) of the fresh biomass (17.2%) and the chlorophyll index (24.4%) for T. aestivum and the fresh biomass for R. sativus (31.4%) were only recorded at the highest application doses. In addition, the soil phosphatase enzymatic activity decreased significantly (p<0.05) in both WWTS (dose related) and WTS treatments. For water organisms, a slight inhibition of the growth of Chlorella vulgaris was observed (WWTS treated soils), along with statistically significant dose-related inhibition responses on total glutathione cell content, and statistically significant dose-related induction responses on the glutathione S-transferase enzyme activity and the reactive oxygen species generation on the RTG-2 fish cell line. Copyright © 2014 Elsevier B.V. All rights reserved.

Serum IgE and IgG responses to food antigens in normal and atopic dogs, and dogs with gastrointestinal disease.

PubMed

Foster, A P; Knowles, T G; Moore, A Hotston; Cousins, P D G; Day, M J; Hall, E J

2003-05-12

In human food allergy, with or without concurrent atopy, there may be significant increases in serum allergen-specific IgE. Serological methods have been tried but are not currently recommended for diagnosis of suspected food allergy in dogs. The aim of this study was to investigate humoral immune responses to food antigens in dogs. Serum IgG and IgE antibodies specific for food antigens were measured by enzyme linked immunosorbent assay (ELISA) using polyclonal anti-dog IgG and IgE reagents. Antigens tested were beef, chicken, pork, lamb, chicken, turkey, white fish, whole egg, wheat, soybean, barley, rice, maize corn, potato, yeast and cow's milk. Three groups were examined: normal dogs, dogs with atopic dermatitis (AD); and dogs with one of four types of gastrointestinal (GI) disease: small intestinal bacterial overgrowth (SIBO), inflammatory bowel disease (IBD), food-responsive disease, and infectious diarrhoea. Statistically significant differences in food-specific antibodies were not detected between the GI subgroups. There were statistically significant differences in the IgE concentration between the normal dogs, and dogs with atopic or GI disease, for all of the antigens tested. There were statistically significant differences in the average IgG concentrations between the normal dogs, and dogs with atopic or GI disease, for all of the antigens tested, except egg and yeast. The relationship of antigen responses for pooled data was analysed using principle component analysis and cluster plots. Some clustering of variables was apparent for both IgE and IgG. For example, all dogs (normal and diseased) made a similar IgG antibody response to chicken and turkey. Compared with other groups, atopic dogs had more food allergen-specific IgE and this would be consistent with a Th(2) humoral response to food antigens. Dogs with GI disease had more food allergen-specific IgG compared with the other groups. This may reflect increased antigen exposure due to increased mucosal permeability which is a recognised feature of canine intestinal disease.

Local Inflammation in Fracture Hematoma: Results from a Combined Trauma Model in Pigs

PubMed Central

Horst, K.; Eschbach, D.; Pfeifer, R.; Hübenthal, S.; Sassen, M.; Steinfeldt, T.; Wulf, H.; Ruchholtz, S.; Pape, H. C.; Hildebrand, F.

2015-01-01

Background. Previous studies showed significant interaction between the local and systemic inflammatory response after severe trauma in small animal models. The purpose of this study was to establish a new combined trauma model in pigs to investigate fracture-associated local inflammation and gain information about the early inflammatory stages after polytrauma. Material and Methods. Combined trauma consisted of tibial fracture, lung contusion, liver laceration, and controlled hemorrhage. Animals were mechanically ventilated and under ICU-monitoring for 48 h. Blood and fracture hematoma samples were collected during the time course of the study. Local and systemic levels of serum cytokines and diverse alarmins were measured by ELISA kit. Results. A statistical significant difference in the systemic serum values of IL-6 and HMGB1 was observed when compared to the sham. Moreover, there was a statistical significant difference in the serum values of the fracture hematoma of IL-6, IL-8, IL-10, and HMGB1 when compared to the systemic inflammatory response. However a decrease of local proinflammatory concentrations was observed while anti-inflammatory mediators increased. Conclusion. Our data showed a time-dependent activation of the local and systemic inflammatory response. Indeed it is the first study focusing on the local and systemic inflammatory response to multiple-trauma in a large animal model. PMID:25694748

Effects of music on patients undergoing a C-clamp procedure after percutaneous coronary interventions.

PubMed

Chan, Moon Fai; Wong, Oi Chi; Chan, Hoi Lam; Fong, Mei Chu; Lai, Suet Yan; Lo, Ching Wah; Ho, Siu Mei; Ng, Suk Ying; Leung, Suk Kit

2006-03-01

This paper reports a study to determine the effect of music on physiological parameters and level of pain in patients undergoing application of a C-clamp after percutaneous coronary interventions. Most percutaneous coronary interventions are performed through the femoral artery. In order to stop bleeding and achieve homeostasis, a C-clamp is used after percutaneous coronary interventions. However, the experience is painful for patients and they inevitably suffer discomfort. Pain may lead to stress responses and may affect the physical and mental health of patients. One potential beneficial practice is having the patient listen to relaxing music, which might have the effect of reducing situational discomfort and pain. A randomized controlled study was conducted during the period September 2004 to March 2005. Forty-three people (20 experimental and 23 control) were recruited from the intensive care units of two acute care hospitals in Hong Kong. Physiological and psychological variables were collected at baseline and at 15, 30 and 45 minutes. In the music group, there were statistically significant reductions (P=0.001) in heart rate, respiratory rate, and oxygen saturation than the control participants at 45 minutes. In the music group, statistically significant reductions (P=0.001) in systolic blood pressure, heart rate, respiratory rate and oxygen saturation were found at the four time points, but not in the control group. No statistically significant differences were found at baseline comparison of the two groups, but statistically significant differences in pain scores were found at 45 minutes for participants in the music group compared with the control group (P=0.003). Participants in the control group showed statistically significant increases in pain at 45 minutes compared with baseline (P<0.001). The benefits of preventing physiological reactions to pain were demonstrated. Music is a simple, safe and effective method of reducing potentially harmful physiological and psychological responses arising from pain.

Effect of vagotomy and vagal cooling on bronchoconstrictor response to substance P in sheep.

PubMed

Corcoran, B M; Haigh, A L

1995-10-01

The bronchoconstrictor effect of intravenous substance P can be antagonised by atropine pre-treatment in several species, and we have previously reported this finding in anaesthetised sheep. In the present study, we have assessed the effect of cooling the right vagus after sectioning the left vagus (n = 6), and bilateral vagotomy (n = 7) on the bronchoconstrictor response to a single intravenous dose of substance P (SP) (0.3-1.0 mumol/kg) in anaesthetized female sheep aged 6 to 12 months. Respiratory parameters including tidal volume, flow and transpulmonary pressure pressure were measured, from which pulmonary resistance (RL; cmH2O.1(-1).s) and dynamic compliance (CDyn; ml.cmH2O(-1) were calculated. Systemic arterial pressures were also measured. Vagal cooling significantly attenuated the bronchoconstrictor response to SP at 7 degrees C (RL P < 0.01; Cdyn P < 0.001). A further reduction in the response to SP occurred at 3 degrees C, but this was not statistically significantly different from the response at 7 degrees C. Vagotomy abolished the response to SP. SP caused mild, but statistically insignificant, hypotension (119.7 vs. 107.7 mmHg). These results suggest SP causes bronchoconstriction in the anaesthetised sheep by vagal reflex mechanisms, involving stimulation of myelinated nerve fibre endings.

A statistical experiment design approach for optimizing biodegradation of weathered crude oil in coastal sediments.

PubMed

Mohajeri, Leila; Aziz, Hamidi Abdul; Isa, Mohamed Hasnain; Zahed, Mohammad Ali

2010-02-01

This work studied the bioremediation of weathered crude oil (WCO) in coastal sediment samples using central composite face centered design (CCFD) under response surface methodology (RSM). Initial oil concentration, biomass, nitrogen and phosphorus concentrations were used as independent variables (factors) and oil removal as dependent variable (response) in a 60 days trial. A statistically significant model for WCO removal was obtained. The coefficient of determination (R(2)=0.9732) and probability value (P<0.0001) demonstrated significance for the regression model. Numerical optimization based on desirability function were carried out for initial oil concentration of 2, 16 and 30 g per kg sediment and 83.13, 78.06 and 69.92 per cent removal were observed respectively, compare to 77.13, 74.17 and 69.87 per cent removal for un-optimized results.

Evaluation of the educational environment of postgraduate surgical teaching.

PubMed

Khan, Junaid Sarfraz

2008-01-01

Medical Education is becoming increasingly community-oriented, student-centred, self-learning and self & peer-assessing process especially in the undergraduate years. This is happening because of increasing patient awareness of their rights in our new healthcare world of increased consultant responsibility; and implementation in the U.K. health institutions of the 'European Working Time Directive' and 'Modernization of Medical Careers'. The study was conducted to determine the change if any in the education environment of postgraduate surgical teaching in a leading teaching hospital in London when a teacher-centred, old-fashioned postgraduate teaching approach was replaced with a student-centred, self-assessment, portfolio-based approach. Postgraduate Hospital Educational Environment Measure (PHEEM). Twenty postgraduate trainees filled in the questionnaire before and after the change in their learning/teaching pattern. The response rate was 100%. No statistically significant difference in the overall score for the two teaching environments (p = 0.8024, 95% CI = -5.549273 to 4.349273) was found, because the loss of on-call rooms, trainee's mess and catering services statistically significantly deteriorated the social support subscale of the PHEEM scale (p < 0.0001, 95% CI = 6.66752 to 13.03248) to counteract any statistically significant improvement in the teaching role perception subscale of the instrument (p = 0.001, 95% CI= -12.443896 to -4.856104). There was no statistically significant difference in the role autonomy perception subscale in the two methods (p = 0.3663, 95% CI = -5.870437 to 2.270437). A student-centred approach to postgraduate teaching is better than a teacher-centred approach. However, further studies will be needed to evaluate both postgraduate teaching and training environment.

Bone and Soft Tissue Response in Bone-Level Implants Restored with Platform Switching: A 5-Year Clinical Prospective Study.

PubMed

Lago, Laura; da Silva, Luis; Gude, Francisco; Rilo, Benito

The aim of this prospective study was to evaluate radiographic levels of peri-implant bone crest as well as soft tissue response, papilla height, and buccal mucosa recession, in bone-level implants restored with platform switching after 1-year and 5-year follow-ups. This prospective study called for the placement of 59 implants to obtain a target of 90% power. To compensate for possible dropouts, the sample size was adjusted to 67 implants. To assess marginal bone level changes, periapical radiographs were taken at baseline, 1 year, and 5 years after the definitive restorations. Peri-implant soft tissue modifications were evaluated by performing a photographic sequence at 15 days, 1 year, and 5 years after implant restoration. Parameters measured were: (1) distance from the tip of the papilla to the contact point and (2) apicocoronal crown length. A one-way analysis of variance (ANOVA rank test) was used to compare quantitative data among the three time points studied. Mean marginal bone level changes were as follows: -0.06 ± 0.32 mm from baseline to 1 year, -0.23 ± 0.38 mm from 1 to 5 years, and -0.28 ± 0.45 mm from baseline to 5 years. In bone-level outcomes, no statistically significant differences were found between baseline and 1 year, while the mean differences between 1 and 5 years and baseline and 5 years showed statistically significant differences. In the soft tissue analysis, the distance from the tip of the papilla to the contact point showed the following values: baseline, 2.08 mm; 1 year, 1.54 mm; 5 years, 1.31 mm. No statistically significant differences were found between baseline and 1 year, whereas statistically significant differences between 1 and 5 years and baseline and 5 years were found. Apicocoronal crown length measurements showed the following values: baseline, 9.44 mm; 1 year, 9.28 mm; 5 years, 9.81 mm. No significant differences were found between times studied. This prospective clinical study of 67 bone-level implants restored according to the platform-switching concept reported that radiographic levels of peri-implant bone crest were statistically significant between 1 and 5 years and baseline and 5 years. For the soft tissue response, the greatest reduction in the distance from the papilla to the contact point from 1 to 5 years and baseline to 5 years was observed. No significant differences were shown in the buccal margin.

Multivariate objective response detectors (MORD): statistical tools for multichannel EEG analysis during rhythmic stimulation.

PubMed

Felix, Leonardo Bonato; Miranda de Sá, Antonio Mauricio Ferreira Leite; Infantosi, Antonio Fernando Catelli; Yehia, Hani Camille

2007-03-01

The presence of cerebral evoked responses can be tested by using objective response detectors. They are statistical tests that provide a threshold above which responses can be assumed to have occurred. The detection power depends on the signal-to-noise ratio (SNR) of the response and the amount of data available. However, the correlation within the background noise could also affect the power of such detectors. For a fixed SNR, the detection can only be improved at the expense of using a longer stretch of signal. This can constitute a limitation, for instance, in monitored surgeries. Alternatively, multivariate objective response detection (MORD) could be used. This work applies two MORD techniques (multiple coherence and multiple component synchrony measure) to EEG data collected during intermittent photic stimulation. They were evaluated throughout Monte Carlo simulations, which also allowed verifying that correlation in the background reduces the detection rate. Considering the N EEG derivations as close as possible to the primary visual cortex, if N = 4, 6 or 8, multiple coherence leads to a statistically significant higher detection rate in comparison with multiple component synchrony measure. With the former, the best performance was obtained with six signals (O1, O2, T5, T6, P3 and P4).

Statistical Tests of System Linearity Based on the Method of Surrogate Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hunter, N.; Paez, T.; Red-Horse, J.

When dealing with measured data from dynamic systems we often make the tacit assumption that the data are generated by linear dynamics. While some systematic tests for linearity and determinism are available - for example the coherence fimction, the probability density fimction, and the bispectrum - fi,u-ther tests that quanti$ the existence and the degree of nonlinearity are clearly needed. In this paper we demonstrate a statistical test for the nonlinearity exhibited by a dynamic system excited by Gaussian random noise. We perform the usual division of the input and response time series data into blocks as required by themore » Welch method of spectrum estimation and search for significant relationships between a given input fkequency and response at harmonics of the selected input frequency. We argue that systematic tests based on the recently developed statistical method of surrogate data readily detect significant nonlinear relationships. The paper elucidates the method of surrogate data. Typical results are illustrated for a linear single degree-of-freedom system and for a system with polynomial stiffness nonlinearity.« less

Normal or defective immune response to Hepatitis B vaccine in patients with diabetes and celiac disease.

PubMed

Zanoni, Giovanna; Contreas, Giovanna; Valletta, Enrico; Gabrielli, Oretta; Mengoli, Carlo; Veneri, Dino

2015-01-01

A defective production of protective levels of antibodies to Hepatitis B (HB) vaccine is reported to occur in 4-10% of healthy subjects and a correlation with the presence of specific human leukocyte antigen (HLA) molecules, including DQ2, which also confers genetic predisposition to celiac disease (CD) and type I diabetes mellitus (T1DM), has been suggested.   The aim of this study was to analyze the serological response to HB vaccine and measles-containing vaccines in 69 diabetic patients (T1DM), 42 patients with celiac disease (CD) and 79 healthy control subjects (CT). The median interval between the third dose of HB vaccine and serum collection was 6.8, 3.5, and 4.7 years for T1DM, CD and CT groups, respectively. 50/69 (72%) T1DM patients, 32/42 (76%) CD patients and 61/79 (77%) CT subjects showed protective anti-HBs antibodies after vaccination, with no statistically significant difference. On the contrary, a lower statistically significant difference was found in the mean HBsAb level of T1DM subjects when compared with the other two groups. No correlation between HLA DQ2 expression in T1DM and vaccine response was detected. The comparison of serological response to measles after vaccination also showed no statistically significant differences in the three groups. Contrasting results between these data and those reported in the literature might be due to differences in the time intervals between vaccination and testing. Prospective studies in pathological and healthy groups with the same age at HBV vaccination and with the same time interval for blood sample collection to determine antibody titers are necessary in order to provide more conclusive data.

Normal or defective immune response to Hepatitis B vaccine in patients with diabetes and celiac disease

PubMed Central

Zanoni, Giovanna; Contreas, Giovanna; Valletta, Enrico; Gabrielli, Oretta; Mengoli, Carlo; Veneri, Dino

2014-01-01

A defective production of protective levels of antibodies to Hepatitis B (HB) vaccine is reported to occur in 4–10% of healthy subjects and a correlation with the presence of specific human leukocyte antigen (HLA) molecules, including DQ2, which also confers genetic predisposition to celiac disease (CD) and type I diabetes mellitus (T1DM), has been suggested. The aim of this study was to analyze the serological response to HB vaccine and measles-containing vaccines in 69 diabetic patients (T1DM), 42 patients with celiac disease (CD) and 79 healthy control subjects (CT). The median interval between the third dose of HB vaccine and serum collection was 6.8, 3.5, and 4.7 years for T1DM, CD and CT groups, respectively. 50/69 (72%) T1DM patients, 32/42 (76%) CD patients and 61/79 (77%) CT subjects showed protective anti-HBs antibodies after vaccination, with no statistically significant difference. On the contrary, a lower statistically significant difference was found in the mean HBsAb level of T1DM subjects when compared with the other two groups. No correlation between HLA DQ2 expression in T1DM and vaccine response was detected. The comparison of serological response to measles after vaccination also showed no statistically significant differences in the three groups. Contrasting results between these data and those reported in the literature might be due to differences in the time intervals between vaccination and testing. Prospective studies in pathological and healthy groups with the same age at HBV vaccination and with the same time interval for blood sample collection to determine antibody titers are necessary in order to provide more conclusive data. PMID:25483516

Statistical Analysis of Compressive and Flexural Test Results on the Sustainable Adobe Reinforced with Steel Wire Mesh

NASA Astrophysics Data System (ADS)

Jokhio, Gul A.; Syed Mohsin, Sharifah M.; Gul, Yasmeen

2018-04-01

It has been established that Adobe provides, in addition to being sustainable and economic, a better indoor air quality without spending extensive amounts of energy as opposed to the modern synthetic materials. The material, however, suffers from weak structural behaviour when subjected to adverse loading conditions. A wide range of mechanical properties has been reported in literature owing to lack of research and standardization. The present paper presents the statistical analysis of the results that were obtained through compressive and flexural tests on Adobe samples. Adobe specimens with and without wire mesh reinforcement were tested and the results were reported. The statistical analysis of these results presents an interesting read. It has been found that the compressive strength of adobe increases by about 43% after adding a single layer of wire mesh reinforcement. This increase is statistically significant. The flexural response of Adobe has also shown improvement with the addition of wire mesh reinforcement, however, the statistical significance of the same cannot be established.

Task-Specific and General Cognitive Effects in Chiari Malformation Type I

PubMed Central

Allen, Philip A.; Houston, James R.; Pollock, Joshua W.; Buzzelli, Christopher; Li, Xuan; Harrington, A. Katherine; Martin, Bryn A.; Loth, Francis; Lien, Mei-Ching; Maleki, Jahangir; Luciano, Mark G.

2014-01-01

Objective Our objective was to use episodic memory and executive function tests to determine whether or not Chiari Malformation Type I (CM) patients experience cognitive dysfunction. Background CM is a neurological syndrome in which the cerebellum descends into the cervical spine causing neural compression, severe headaches, neck pain, and number of other physical symptoms. While primarily a disorder of the cervico-medullary junction, both clinicians and researchers have suspected deficits in higher-level cognitive function. Design and Methods We tested 24 CM patients who had undergone decompression neurosurgery and 24 age- and education-matched controls on measures of immediate and delayed episodic memory, as well as three measures of executive function. Results The CM group showed performance decrements relative to the controls in response inhibition (Stroop interference), working memory computational speed (Ospan), and processing speed (automated digit symbol substitution task), but group differences in recall did not reach statistical significance. After statistical control for depression and anxiety scores, the group effects for working memory and processing speed were eliminated, but not for response inhibition. This response inhibition difference was not due to overall general slowing for the CM group, either, because when controls' data were transformed using the linear function fit to all of the reaction time tasks, the interaction with group remained statistically significant. Furthermore, there was a multivariate group effect for all of the response time measures and immediate and delayed recall after statistical control of depression and anxiety scores. Conclusion These results suggest that CM patients with decompression surgery exhibit cognitive dysfunction compared to age- and education-matched controls. While some of these results may be related to anxiety and depression (likely proxies for chronic pain), response inhibition effects, in particular, as well as a general cognitive deficit persisted even after control for anxiety and decompression. PMID:24736676

Full information acquisition in scanning probe microscopy and spectroscopy

DOEpatents

Jesse, Stephen; Belianinov, Alex; Kalinin, Sergei V.; Somnath, Suhas

2017-04-04

Apparatus and methods are described for scanning probe microscopy and spectroscopy based on acquisition of full probe response. The full probe response contains valuable information about the probe-sample interaction that is lost in traditional scanning probe microscopy and spectroscopy methods. The full probe response is analyzed post data acquisition using fast Fourier transform and adaptive filtering, as well as multivariate analysis. The full response data is further compressed to retain only statistically significant components before being permanently stored.

The role of T lymphocytes in cancer patients undergoing immunotherapy with autologous dendritic cells.

PubMed

Rodrigues, Cláudia M; Matias, Bruna F; Murta, Eddie F C; Michelin, Márcia A

2011-01-01

Cancer stems from mutations in specific genes that induce uncontrolled cell proliferation. Dendritic cells (DCs) are important immunologic cells and play a crucial role in the induction of an antitumour response. We examined the immune response mediated by T lymphocytes, helper T cells, cytotoxic T cells, and regulatory T cells, as well as the cytokines [interleukin (IL)-2, IL-12, interferon (IFN)-γ, tumour necrosis factor (TNF)-α and IL-10], produced by these cell populations, in cancer patients (N = 7) undergoing immunotheraphy with autologous DCs. We observed an initial increase in T helper cells (CD4+) expressing IL-2, IFN-γ, IL-12, TNF-α, and IL-10 after initiation of treatment, with statistically significant for the cytokines IL-2, TNF-α and IL-10. A similar significant effect was observed for IL-2-expressing cytotoxic T cells (CD8+). The percentage of total T cells (CD3+) remained elevated throughout immunotherapy. Regulatory T cells (CD25+/FOXP3+) only showed high percentage of their maximum value when analyzed the pretreatment levels, with statistically significant. Immunotherapy with DCs stimulated the immune response, as evidenced by an increase in percent fluorescence of most cell populations investigated during the specified treatment period.

Assessing the status of airline safety culture and its relationship to key employee attitudes

NASA Astrophysics Data System (ADS)

Owen, Edward L.

The need to identify the factors that influence the overall safety environment and compliance with safety procedures within airline operations is substantial. This study examines the relationships between job satisfaction, the overall perception of the safety culture, and compliance with safety rules and regulations of airline employees working in flight operations. A survey questionnaire administered via the internet gathered responses which were converted to numerical values for quantitative analysis. The results were grouped to provide indications of overall average levels in each of the three categories, satisfaction, perceptions, and compliance. Correlations between data in the three sets were tested for statistical significance using two-sample t-tests assuming equal variances. Strong statistical significance was found between job satisfaction and compliance with safety rules and between perceptions of the safety environment and safety compliance. The relationship between job satisfaction and safety perceptions did not show strong statistical significance.

System Study: Residual Heat Removal 1998-2014

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schroeder, John Alton

2015-12-01

This report presents an unreliability evaluation of the residual heat removal (RHR) system in two modes of operation (low-pressure injection in response to a large loss-of-coolant accident and post-trip shutdown-cooling) at 104 U.S. commercial nuclear power plants. Demand, run hours, and failure data from fiscal year 1998 through 2014 for selected components were obtained from the Institute of Nuclear Power Operations (INPO) Consolidated Events Database (ICES). The unreliability results are trended for the most recent 10 year period, while yearly estimates for system unreliability are provided for the entire active period. No statistically significant increasing trends were identified in themore » RHR results. A highly statistically significant decreasing trend was observed for the RHR injection mode start-only unreliability. Statistically significant decreasing trends were observed for RHR shutdown cooling mode start-only unreliability and RHR shutdown cooling model 24-hour unreliability.« less

The relationship between obligatory cortical auditory evoked potentials (CAEPs) and functional measures in young infants.

PubMed

Golding, Maryanne; Pearce, Wendy; Seymour, John; Cooper, Alison; Ching, Teresa; Dillon, Harvey

2007-02-01

Finding ways to evaluate the success of hearing aid fittings in young infants has increased in importance with the implementation of hearing screening programs. Cortical auditory evoked potentials (CAEP) can be recorded in infants and provides evidence for speech detection at the cortical level. The validity of this technique as a tool of hearing aid evaluation needs, however, to be demonstrated. The present study examined the relationship between the presence/absence of CAEPs to speech stimuli and the outcomes of a parental questionnaire in young infants who were fitted with hearing aids. The presence/absence of responses was determined by an experienced examiner as well as by a statistical measure, Hotelling's T(2). A statistically significant correlation between CAEPs and questionnaire scores was found using the examiner's grading (rs = 0.45) and using the statistical grading (rs = 0.41), and there was reasonably good agreement between traditional response detection methods and the statistical analysis.

The new statistics: why and how.

PubMed

Cumming, Geoff

2014-01-01

We need to make substantial changes to how we conduct research. First, in response to heightened concern that our published research literature is incomplete and untrustworthy, we need new requirements to ensure research integrity. These include prespecification of studies whenever possible, avoidance of selection and other inappropriate data-analytic practices, complete reporting, and encouragement of replication. Second, in response to renewed recognition of the severe flaws of null-hypothesis significance testing (NHST), we need to shift from reliance on NHST to estimation and other preferred techniques. The new statistics refers to recommended practices, including estimation based on effect sizes, confidence intervals, and meta-analysis. The techniques are not new, but adopting them widely would be new for many researchers, as well as highly beneficial. This article explains why the new statistics are important and offers guidance for their use. It describes an eight-step new-statistics strategy for research with integrity, which starts with formulation of research questions in estimation terms, has no place for NHST, and is aimed at building a cumulative quantitative discipline.

On fitting generalized linear mixed-effects models for binary responses using different statistical packages.

PubMed

Zhang, Hui; Lu, Naiji; Feng, Changyong; Thurston, Sally W; Xia, Yinglin; Zhu, Liang; Tu, Xin M

2011-09-10

The generalized linear mixed-effects model (GLMM) is a popular paradigm to extend models for cross-sectional data to a longitudinal setting. When applied to modeling binary responses, different software packages and even different procedures within a package may give quite different results. In this report, we describe the statistical approaches that underlie these different procedures and discuss their strengths and weaknesses when applied to fit correlated binary responses. We then illustrate these considerations by applying these procedures implemented in some popular software packages to simulated and real study data. Our simulation results indicate a lack of reliability for most of the procedures considered, which carries significant implications for applying such popular software packages in practice. Copyright © 2011 John Wiley & Sons, Ltd.

Alcohol consumption pattern and risk of Barrett's oesophagus and erosive oesophagitis: an Italian case-control study.

PubMed

Filiberti, Rosa A; Fontana, Vincenzo; De Ceglie, Antonella; Blanchi, Sabrina; Grossi, Enzo; Della Casa, Domenico; Lacchin, Teresa; De Matthaeis, Marina; Ignomirelli, Orazio; Cappiello, Roberta; Rosa, Alessandra; Foti, Monica; Laterza, Francesco; D'Onofrio, Vittorio; Iaquinto, Gaetano; Conio, Massimo

2017-04-01

Knowledge about the association between alcohol and Barrett's oesophagus and reflux oesophagitis is conflicting. In this case-control study we evaluated the role of specific alcoholic beverages (red and white wine, beer and liquors) in 339 Barrett's oesophagus and 462 oesophagitis patients compared with 619 endoscopic controls with other disorders, recruited in twelve Italian endoscopic units. Data on alcohol and other individual characteristics were obtained from structured questionnaires. No clear, monotonic significant dose-response relationship was pointed out for red wine. However, a generalised U-shaped trend of Barrett's oesophagus/oesophagitis risk due to red wine consumption particularly among current drinkers was found. Similar results were also found for white wine. Liquor/spirit consumption seemed to bring about a 1·14-2·30 risk excess, although statistically non-significant, for current Barrett's oesophagus/oesophagitis drinkers. Statistically significant decreasing dose-response relationships were found in Barrett's oesophagus for frequency and duration of beer consumption. Similar, but less clear downward tendencies were also found for oesophagitis patients. In conclusion, although often not statistically significant, our data suggested a reduced risk of Barrett's oesophagus and oesophagitis with a low/moderate intake of wine and beer consumption. A non-significant increased risk of Barrett's oesophagus/oesophagitis was observed with a higher intake of any type of heavy alcohol consumption, but no conclusion can be drawn owing to the high number of non-spirit drinkers and to the small number of drinkers at higher alcohol intake levels.

Use of a Self-Instructional Radiographic Anatomy Module for Dental Hygiene Faculty Calibration.

PubMed

Brame, Jennifer L; AlGheithy, Demah Salem; Platin, Enrique; Mitchell, Shannon H

2017-06-01

Purpose: Dental hygiene educators often provide inconsistent instruction in clinical settings and various attempts to address the lack of consistency have been reported in the literature. The purpose of this pilot study was to determine if the use of a use of a self-instructional, radiographic anatomy (SIRA) module improved DH faculty calibration regarding the identifica-tion of normal intraoral and extraoral radiographic anatomy and whether its effect could be sustained over a period of four months. Methods: A convenience sample consisting of all dental hygiene faculty members involved in clinical instruction (N=23) at the University of North Carolina (UNC) was invited to complete the four parts of this online pilot study: a pre-test, review of the SIRA module, an immediate post-test, and a four-month follow-up post-test. Descriptive analyses, the Friedman's ANOVA, and the exact form of the Wilcoxon-Signed-Rank test were used to an-alyze the data. Level of significance was set at 0.05. Participants who did not complete all parts of the study were omitted from data analysis comparing the pre to post-test performance. Results: The pre-test response rate was 73.9% (N=17), and 88.2% (N=15) of those initial participants completed both the immediate and follow-up post-tests. Faculty completing all parts of the study consisted of: 5 full-time faculty, 5 part-time faculty, and 5 graduate teaching assistants. The Friedman's ANOVA revealed no statistically significant difference (P=0.179) in percentages of correct responses between the three tests (pre, post and follow-up). The exact form of the Wilcoxon-Signed-Rank test revealed marginal significance when comparing percent of correct responses at pre-test and immediate post-test (P=0.054), and no statistically significant difference when comparing percent of correct responses at immediate post-test and the follow-up post-test four months later (P=0.106). Conclusions: Use of a SIRA module did not significantly affect DH faculty test performance. Lack of statistical significance in the percentages of correct responses between the three tests may have been affected by the small number of participants completing all four parts of the study (N=15). Additional research is needed to identify and improve methods for faculty calibration. Copyright © 2017 The American Dental Hygienists’ Association.

Impact of Damping Uncertainty on SEA Model Response Variance

NASA Technical Reports Server (NTRS)

Schiller, Noah; Cabell, Randolph; Grosveld, Ferdinand

2010-01-01

Statistical Energy Analysis (SEA) is commonly used to predict high-frequency vibroacoustic levels. This statistical approach provides the mean response over an ensemble of random subsystems that share the same gross system properties such as density, size, and damping. Recently, techniques have been developed to predict the ensemble variance as well as the mean response. However these techniques do not account for uncertainties in the system properties. In the present paper uncertainty in the damping loss factor is propagated through SEA to obtain more realistic prediction bounds that account for both ensemble and damping variance. The analysis is performed on a floor-equipped cylindrical test article that resembles an aircraft fuselage. Realistic bounds on the damping loss factor are determined from measurements acquired on the sidewall of the test article. The analysis demonstrates that uncertainties in damping have the potential to significantly impact the mean and variance of the predicted response.

Comparative trial of 5% dexpanthenol in water-in-oil formulation with 1% hydrocortisone ointment in the treatment of childhood atopic dermatitis: a pilot study.

PubMed

Udompataikul, Montree; Limpa-o-vart, Dipenn

2012-03-01

Atopic dermatitis (AD) is a common chronic relapsing disease particularly affecting children. The emollient used for protection of skin barrier function is the standard treatment for patients with AD. Currently, there is a growing interest in the use of nonsteroidal anti-inflammatory agents such as dexpanthenol (vitamin B5) as an alternative treatment. To compare the effectiveness of 5% dexpanthenol (DT) ointment with 1% hydrocortisone (HC) ointment in childhood AD therapy. Patients were treated topically with 5% DT ointment on the right side of the body and 1% HC ointment on the other side twice daily for 4 weeks. The clinical responses were evaluated by SCORAD (Scoring Atopic Dermatitis index) with statistical analysis using paired t-test. Of the 30 children enrolled, 26 completed the protocol; mean age was 7.19 years. The average baseline SCORAD score of the DT-treated side and the HC-treated side was 30.95 and 30.54, respectively. There was no statistically significant difference in SCORAD score reduction between the 2 agents. The edematous score of the HC-treated side exhibited faster resolution than that of the DT-treated side, with a statistically significant difference at week 1 and without a statistically significant difference at weeks 2 to 4. The lichenification response rate of HC treatment was more rapid than that of DT treatment; however, there was no statistical group difference. No adverse events were observed with either agent. The effectiveness of 5% DT ointment is equal to that of 1% HC ointment. DT ointment may be used as alternative treatment in mild to moderate childhood AD therapy.

Music listening for maintaining attention of older adults with cognitive impairments.

PubMed

Gregory, Dianne

2002-01-01

Twelve older adults with cognitive impairments who were participants in weekly community-based group music therapy sessions, 6 older adults in an Alzheimer's caregivers' group, and 6 college student volunteers listened to a 3.5 minute prepared audiotape of instrumental excerpts of patriotic selections. The tape consisted of 7 excerpts ranging from 18 s to 34 s in duration. Each music excerpt was followed by a 7-9 s period of silence, a "wait" excerpt. Listeners were instructed to move a Continuous Response Digital Interface (CRDI) to the name of the music excerpt depicted on the CRDI overlay when they heard a music excerpt. Likewise, they were instructed to move the dial to the word "WAIT" when there was no music. They were also instructed to maintain the dial position for the duration of each music or silence excerpt. Statistical analysis indicated no significant differences between the caregivers' and the college students' group means for total dial changes, correct and incorrect recognitions, correct and incorrect responses to silence excerpts, and reaction times. The mean scores of these 2 groups were combined and compared with the mean scores of the group of elderly adults with cognitive impairments. The mean total dial changes were significantly lower for the listeners with cognitive impairments, resulting in significant differences in all of the other response categories except incorrect recognitions. In addition, their mean absence of response to silence excerpts was significantly higher than their mean absence of responding to music excerpts. Their mean reaction time was significantly slower than the comparison group's reaction time. To evaluate training effects, 10 of the original 12 music therapy participants repeated the listening task with assistance from the therapist (treatment) immediately following the first listening (baseline). A week later the order was reversed for the 2 listening trials. Statistical and graphic analysis of responses between first and second baseline responses indicate significant improvement in responses to silence and music excerpts over the 2 sessions. Applications of the findings to music listening interventions for maintaining attention, eliciting social interaction between clients or caregivers and their patients, and evaluating this population's affective responses to music are discussed.

Depression and helplessness-induced cognitive deficits in the aged.

PubMed

Kennelly, K J; Hayslip, B; Richardson, S K

1985-01-01

Sixty-six community-residing elderly (mean age = 72.5) were categorized as depressed (mean = 11.3) or nondepressed (mean = 3.9) based on Beck Depression Inventory scores. After a pre-test battery measuring short-term memory and crystallized/fluid intelligence, the subjects responded to a word association task, disguised as a test of interpersonal empathy, under response dependent or response independent reinforcement conditions, or were assigned to a no treatment control. A post-test battery of alternate forms followed. Four of seven measures showed significant pre- to post-test declines in performance. For two of these four, response dependent reinforcement prevented otherwise significant declines. With pre-test differences statistically controlled, depression produced significant post-test deficits in three measures. Response dependent reinforcement eliminated this depression deficit in one measure. The results indicate that depression may exacerbate fatigue effects for the elderly and response dependent reinforcement may prevent fatigue-caused deficits in short-term memory.

Linking microbial community structure and microbial processes: An empirical and conceptual overview

USGS Publications Warehouse

Bier, R.L.; Bernhardt, Emily S.; Boot, Claudia M.; Graham, Emily B.; Hall, Edward K.; Lennon, Jay T.; Nemergut, Diana R.; Osborne, Brooke B.; Ruiz-Gonzalez, Clara; Schimel, Joshua P.; Waldrop, Mark P.; Wallenstein, Matthew D.

2015-01-01

A major goal of microbial ecology is to identify links between microbial community structure and microbial processes. Although this objective seems straightforward, there are conceptual and methodological challenges to designing studies that explicitly evaluate this link. Here, we analyzed literature documenting structure and process responses to manipulations to determine the frequency of structure-process links and whether experimental approaches and techniques influence link detection. We examined nine journals (published 2009–13) and retained 148 experimental studies measuring microbial community structure and processes. Many qualifying papers (112 of 148) documented structure and process responses, but few (38 of 112 papers) reported statistically testing for a link. Of these tested links, 75% were significant and typically used Spearman or Pearson's correlation analysis (68%). No particular approach for characterizing structure or processes was more likely to produce significant links. Process responses were detected earlier on average than responses in structure or both structure and process. Together, our findings suggest that few publications report statistically testing structure-process links. However, when links are tested for they often occur but share few commonalities in the processes or structures that were linked and the techniques used for measuring them.

Effect of cold-water immersion on skeletal muscle contractile properties in soccer players.

PubMed

García-Manso, Juan Manuel; Rodríguez-Matoso, Darío; Rodríguez-Ruiz, David; Sarmiento, Samuel; de Saa, Yves; Calderón, Javier

2011-05-01

This study was designed to analyze changes in muscle response after cold-water immersion. The vastus lateralis of the dominant leg was analyzed in 12 professional soccer players from the Spanish 2nd Division B using tensiomyography, before and after four cold-water immersions at 4°C lasting 4 mins each. Core temperature, skin temperature, and heart rate were monitored. A significant interaction (P ≤ 0.05) was found in muscle deformation between control conditions (5.12 ± 2.27 mm) and (1) immersion 3 (3.64 ± 2.27 mm) and (2) immersion 4 (3.38 ± 1.34 mm). A steady decrease was also observed in response velocity (immersion 1, -7.3%; immersion 2, -25.9%; immersion 3, -30.0%; immersion 4, -36.6%) and contraction velocity (immersion 1, -11.5%; immersion 2, -22.1%; immersion 3, -35.0%; immersion 4, -41.9%), with statistically significant differences (P ≤ 0.05) in relation to the reference values commencing with the third immersion. No significant differences were found between control conditions in subsequent exposures to cold water for the values of response time and contraction time. Sustained time and reaction time showed an increase during repeated exposures and with longer exposure time, although the increase was not statistically significant. This study shows that repeated cold-water immersions (4 × 4 mins at 4°C) cause considerable alterations to muscle behavior. These alterations significantly affect the state of muscles and their response capacity, particularly in relation to muscle stiffness and muscle contraction velocity.

Knowledge and opinions of Downsview physicians regarding the chiropractic profession

PubMed Central

Newton-Leo, Linda; King-Isaacs, Debra; Lichti, Janice

1994-01-01

This study was a preliminary investigation into the knowledge of and current attitudes towards the chiropractic profession by medical practitioners with varying years of clinical experience. A questionnaire was designed and mailed to seventy general practitioners in Downsview, Ontario who agreed to participate in the study. Twenty-six were returned for a response rate of 37%. The data were analyzed and responses from doctors with differing years of practice experience were compared using the chi square statistic. When comparing attitudes towards the chiropractic profession between medical practitioners with greater and less than 15 years of clinical experience a statistically significant difference was found (p = 0.0005). However, no significant differences were observed in terms of their interaction with or knowledge of the chiropractic profession. Further, 88% of respondents reported that they had referred a patient to a chiropractor. The limitations of the study and suggestions for improvement are discussed.

Monetary policy and the effects of oil price shocks on the Japanese economy

NASA Astrophysics Data System (ADS)

Lee, Byung Rhae

1998-12-01

The evidence of output decreases and price level increases following oil price shocks in the Japanese economy is presented in this paper. These negative effects of oil shocks are better explained by Hamilton's (1996) net oil price increase measure (NOPI) than by other oil measures. The fact that an oil shock has a statistically significant effect on the call money rate and real output and that the call money rate also has a statistically significant effect on real output appears to explain that the effects of oil price shocks on economic activity are partially attributed to contractionary monetary policy responses. The asymmetric effects of positive and negative oil shocks are also found in the Japanese economy and this asymmetry can also be partially explained by monetary policy responses. To assess the relative contribution of oil shocks and endogenous monetary policy responses to the economic downturns, I shut off the responses of the call money rate to oil shocks utilizing the impulse response results from the VAR model. Then, I re-run the VAR with the adjusted call money rate series. The empirical results show that around 30--40% of the negative effects of oil price shocks on the Japanese economy can be accounted for by oil shock induced monetary tightening.

Improvement of IFNγ ELISPOT Performance Following Overnight Resting of Frozen PBMC Samples Confirmed Through Rigorous Statistical Analysis

PubMed Central

Santos, Radleigh; Buying, Alcinette; Sabri, Nazila; Yu, John; Gringeri, Anthony; Bender, James; Janetzki, Sylvia; Pinilla, Clemencia; Judkowski, Valeria A.

2014-01-01

Immune monitoring of functional responses is a fundamental parameter to establish correlates of protection in clinical trials evaluating vaccines and therapies to boost antigen-specific responses. The IFNγ ELISPOT assay is a well-standardized and validated method for the determination of functional IFNγ-producing T-cells in peripheral blood mononuclear cells (PBMC); however, its performance greatly depends on the quality and integrity of the cryopreserved PBMC. Here, we investigate the effect of overnight (ON) resting of the PBMC on the detection of CD8-restricted peptide-specific responses by IFNγ ELISPOT. The study used PBMC from healthy donors to evaluate the CD8 T-cell response to five pooled or individual HLA-A2 viral peptides. The results were analyzed using a modification of the existing distribution free resampling (DFR) recommended for the analysis of ELISPOT data to ensure the most rigorous possible standard of significance. The results of the study demonstrate that ON resting of PBMC samples prior to IFNγ ELISPOT increases both the magnitude and the statistical significance of the responses. In addition, a comparison of the results with a 13-day preculture of PBMC with the peptides before testing demonstrates that ON resting is sufficient for the efficient evaluation of immune functioning. PMID:25546016

Late response to patient-reported outcome questionnaires after surgery was associated with worse outcome.

PubMed

Hutchings, Andrew; Grosse Frie, Kirstin; Neuburger, Jenny; van der Meulen, Jan; Black, Nick

2013-02-01

Nonresponse to patient-reported outcome (PRO) questionnaires after surgery might bias the results. Our aim was to gauge the potential impact of nonresponse bias by comparing the outcomes of early and late responders. This study compares 59,565 early and 20,735 late responders who underwent a hip or knee replacement, hernia repair, or varicose vein (VV) surgery. The association between timeliness of response and three outcomes (the mean postoperative disease-specific PRO and generic PRO scores and the proportion reporting a fair or poor result) was examined by regression analysis. Late responders were slightly more likely to be young, nonwhite, deprived, and have a more severe preoperative condition with poorer quality of life. Late response was associated with a slightly poorer outcome in all four procedures although not statistically significant (P < 0.05) for VV surgery. Adjusting for preoperative characteristics reduced the strength of the associations, but they remained statistically significant. As nonresponse to PRO questionnaires introduces slight bias, differences in response rates between hospitals should be taken into account when making comparisons so as to avoid overestimating the performance of those with lower response rates and failing to detect poor performing hospitals. Copyright © 2013 Elsevier Inc. All rights reserved.

Computational Analysis for Rocket-Based Combined-Cycle Systems During Rocket-Only Operation

NASA Technical Reports Server (NTRS)

Steffen, C. J., Jr.; Smith, T. D.; Yungster, S.; Keller, D. J.

2000-01-01

A series of Reynolds-averaged Navier-Stokes calculations were employed to study the performance of rocket-based combined-cycle systems operating in an all-rocket mode. This parametric series of calculations were executed within a statistical framework, commonly known as design of experiments. The parametric design space included four geometric and two flowfield variables set at three levels each, for a total of 729 possible combinations. A D-optimal design strategy was selected. It required that only 36 separate computational fluid dynamics (CFD) solutions be performed to develop a full response surface model, which quantified the linear, bilinear, and curvilinear effects of the six experimental variables. The axisymmetric, Reynolds-averaged Navier-Stokes simulations were executed with the NPARC v3.0 code. The response used in the statistical analysis was created from Isp efficiency data integrated from the 36 CFD simulations. The influence of turbulence modeling was analyzed by using both one- and two-equation models. Careful attention was also given to quantify the influence of mesh dependence, iterative convergence, and artificial viscosity upon the resulting statistical model. Thirteen statistically significant effects were observed to have an influence on rocket-based combined-cycle nozzle performance. It was apparent that the free-expansion process, directly downstream of the rocket nozzle, can influence the Isp efficiency. Numerical schlieren images and particle traces have been used to further understand the physical phenomena behind several of the statistically significant results.

Quality Matters: Systematic Analysis of Endpoints Related to “Cellular Life” in Vitro Data of Radiofrequency Electromagnetic Field Exposure

PubMed Central

Simkó, Myrtill; Remondini, Daniel; Zeni, Olga; Scarfi, Maria Rosaria

2016-01-01

Possible hazardous effects of radiofrequency electromagnetic fields (RF-EMF) at low exposure levels are controversially discussed due to inconsistent study findings. Therefore, the main focus of the present study is to detect if any statistical association exists between RF-EMF and cellular responses, considering cell proliferation and apoptosis endpoints separately and with both combined as a group of “cellular life” to increase the statistical power of the analysis. We searched for publications regarding RF-EMF in vitro studies in the PubMed database for the period 1995–2014 and extracted the data to the relevant parameters, such as cell culture type, frequency, exposure duration, SAR, and five exposure-related quality criteria. These parameters were used for an association study with the experimental outcome in terms of the defined endpoints. We identified 104 published articles, from which 483 different experiments were extracted and analyzed. Cellular responses after exposure to RF-EMF were significantly associated to cell lines rather than to primary cells. No other experimental parameter was significantly associated with cellular responses. A highly significant negative association with exposure condition-quality and cellular responses was detected, showing that the more the quality criteria requirements were satisfied, the smaller the number of detected cellular responses. According to our knowledge, this is the first systematic analysis of specific RF-EMF bio-effects in association to exposure quality, highlighting the need for more stringent quality procedures for the exposure conditions. PMID:27420084

Investigating chromosome damage and gammaH2AX response in human lymphocytes and lymphocyte subsets as potential biomarkers of radiation sensitivity

NASA Astrophysics Data System (ADS)

Beaton, Lindsay A.

This thesis examines in vitro irradiated blood samples from prostate cancer patients exhibiting late normal tissue damage after receiving radiotherapy, for lymphocyte response. Chromosomal aberrations, translocations and proliferation rate are measured, as well as gammaH2AX response in lymphocytes and lymphocyte subsets. The goal of this thesis is to determine whether the lymphocyte response to in vitro radiation could be used as a marker for radiosensitivity. Patients were selected from a randomized clinical trial evaluating the optimal timing of Dose Escalated Radiation and short course Androgen Deprivation Therapy. Of 438 patients, 3% developed Grade 3 late radiation proctitis and were considered to be radiosensitive. Blood was drawn from 10 of these patients along with 20 matched samples from patients with grade 0 proctitis. The samples were irradiated and were analyzed for dicentric chromosomes, excess fragments and proliferation rates (at 6 Gy), translocations, stable and unstable damage (at 4 Gy), and dose response (up to 10 Gy), along with time response after 2 Gy (0 -- 24 h). Chromosome aberrations, excess fragments per cell, translocations per cell and proliferation rates were analyzed by brightfield and fluorescent microscopy, while the gammaH2AX response in lymphocytes and lymphocyte subsets was analyzed by flow cytometry. Both groups were statistically similar for all endpoints at 0 Gy. At 6 Gy, there were statistically significant differences between the radiosensitive and control cohorts for three endpoints; the mean number of dicentric chromosomes per cell, the mean number of excess fragments per cell and the proportion of cells in second metaphase. At 4 Gy, there were statistically significant differences between the two cohorts for three endpoints; the mean number of translocations per cell, the mean number of dicentric chromosomes per cell and the mean number of deletions per cell. There were no significant differences between the gammaH2AX responses of the groups for either the dose or time course as measured with flow cytometry. Six cytogenetic endpoints, measuring chromosomal aberrations, demonstrated a strong correlation with radiosensitivity and should be studied further as markers of radiation response. These results will contribute to the search for an indicator for identifying radiosensitive patients and for tailoring radiotherapy treatments.

Evaluation of adding item-response theory analysis for evaluation of the European Board of Ophthalmology Diploma examination.

PubMed

Mathysen, Danny G P; Aclimandos, Wagih; Roelant, Ella; Wouters, Kristien; Creuzot-Garcher, Catherine; Ringens, Peter J; Hawlina, Marko; Tassignon, Marie-José

2013-11-01

To investigate whether introduction of item-response theory (IRT) analysis, in parallel to the 'traditional' statistical analysis methods available for performance evaluation of multiple T/F items as used in the European Board of Ophthalmology Diploma (EBOD) examination, has proved beneficial, and secondly, to study whether the overall assessment performance of the current written part of EBOD is sufficiently high (KR-20≥ 0.90) to be kept as examination format in future EBOD editions. 'Traditional' analysis methods for individual MCQ item performance comprise P-statistics, Rit-statistics and item discrimination, while overall reliability is evaluated through KR-20 for multiple T/F items. The additional set of statistical analysis methods for the evaluation of EBOD comprises mainly IRT analysis. These analysis techniques are used to monitor whether the introduction of negative marking for incorrect answers (since EBOD 2010) has a positive influence on the statistical performance of EBOD as a whole and its individual test items in particular. Item-response theory analysis demonstrated that item performance parameters should not be evaluated individually, but should be related to one another. Before the introduction of negative marking, the overall EBOD reliability (KR-20) was good though with room for improvement (EBOD 2008: 0.81; EBOD 2009: 0.78). After the introduction of negative marking, the overall reliability of EBOD improved significantly (EBOD 2010: 0.92; EBOD 2011:0.91; EBOD 2012: 0.91). Although many statistical performance parameters are available to evaluate individual items, our study demonstrates that the overall reliability assessment remains the only crucial parameter to be evaluated allowing comparison. While individual item performance analysis is worthwhile to undertake as secondary analysis, drawing final conclusions seems to be more difficult. Performance parameters need to be related, as shown by IRT analysis. Therefore, IRT analysis has proved beneficial for the statistical analysis of EBOD. Introduction of negative marking has led to a significant increase in the reliability (KR-20 > 0.90), indicating that the current examination format can be kept for future EBOD examinations. © 2013 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

Reaching Asian Americans: sampling strategies and incentives.

PubMed

Lee, Soo-Kyung; Cheng, Yu-Yao

2006-07-01

Reaching and recruiting representative samples of minority populations is often challenging. This study examined in Chinese and Korean Americans: 1) whether using two different sampling strategies (random sampling vs. convenience sampling) significantly affected characteristics of recruited participants and 2) whether providing different incentives in the mail survey produced different response rates. We found statistically significant, however mostly not remarkable, differences between random and convenience samples. Offering monetary incentives in the mail survey improved response rates among Chinese Americans, while offering a small gift did not improve response rates among either Chinese or Korean Americans. This information will be useful for researchers and practitioners working with Asian Americans.

Sb2Te3 and Its Superlattices: Optimization by Statistical Design.

PubMed

Behera, Jitendra K; Zhou, Xilin; Ranjan, Alok; Simpson, Robert E

2018-05-02

The objective of this work is to demonstrate the usefulness of fractional factorial design for optimizing the crystal quality of chalcogenide van der Waals (vdW) crystals. We statistically analyze the growth parameters of highly c axis oriented Sb 2 Te 3 crystals and Sb 2 Te 3 -GeTe phase change vdW heterostructured superlattices. The statistical significance of the growth parameters of temperature, pressure, power, buffer materials, and buffer layer thickness was found by fractional factorial design and response surface analysis. Temperature, pressure, power, and their second-order interactions are the major factors that significantly influence the quality of the crystals. Additionally, using tungsten rather than molybdenum as a buffer layer significantly enhances the crystal quality. Fractional factorial design minimizes the number of experiments that are necessary to find the optimal growth conditions, resulting in an order of magnitude improvement in the crystal quality. We highlight that statistical design of experiment methods, which is more commonly used in product design, should be considered more broadly by those designing and optimizing materials.

Clinical study of Mineral Trioxide Aggregate in primary molars. Comparison between Grey and White MTA--a long term follow-up (84 months).

PubMed

Cardoso-Silva, Cristina; Barbería, Elena; Maroto, Myriam; García-Godoy, Franklin

2011-02-01

The aim of the present study was to conduct a clinical and radiographic long-term evaluation of pulpotomy in temporary molars performed with Grey and White Mineral Trioxide Aggregate (MTA) and compare the results of Grey and White MTA pulpotomies in a sample of 233 primary molars with a maximum follow-up period of 84 months. The sample was selected from patients treated at the Department of Pediatric Dentistry, Faculty of Dentistry, Complutense University of Madrid, Spain. This prospective study included first and second primary molars treated with pulpotomy with Grey or White MTA, controlled for a maximum follow-up period of 84 months. Statistical analysis of clinical and radiographic findings was completed using ANOVA (P<0.05). Follow-up evaluations, performed every 6 months, revealed that only 2 molars treated with White MTA presented abscess and pathological mobility. Radiographic examination of the 210 molars revealed unfavourable pulp response in only 6 molars (internal or furcation root resorption), without statistically significant differences between Grey and White MTA. Two radiological findings were noticed: dentine bridge formation and partial or total root canal stenosis. Grey MTA induced a higher percentage of dentine bridges with statistically significant differences (P<0.05), and a higher percentage of pulp canal stenosis, without a statistically significant difference. Grey and White MTA presented high levels of clinical and radiographic success. Although the present study showed evidence of a very good biologic response with both types of MTA, Grey MTA showed significantly higher number of dentine bridge formation than White MTA. Copyright © 2010 Elsevier Ltd. All rights reserved.

Tocilizumab treatment leads to improvement in disease activity regardless of CCP status in rheumatoid arthritis.

PubMed

Cappelli, Laura C; Palmer, Judy Lynn; Kremer, Joel; Bingham, Clifton O

2017-10-01

Autoantibodies can be useful in predicting response to certain treatments in rheumatoid arthritis (RA). We aimed to evaluate initial response to tocilizumab (TCZ) by change in physician and patient-reported outcomes and laboratory parameters in a real-world cohort of patients with RA. We analyzed the data by autoantibody status to determine whether patients with seronegative RA had improved response to tocilizumab when compared to their seropositive counterparts. Data from the CORRONA RA registry were analyzed. Patients were included if they were started on TCZ and had data from a follow-up visit 4-8 months after initiation, as well as having information on serologic status. Serologic status was determined by presence of anti-cyclic citrullinated peptide (CCP) antibodies. Changes in disease activity measures from baseline to follow-up visit were evaluated. Both CCP-negative and -positive groups had statistically significant improvement in physician-reported measurements (physician rating of disease activity and joint counts), patient-reported measures (disease activity, pain, and fatigue), and acute phase reactants after 4-8 months of treatment with tocilizumab. The magnitude of improvement, however, did not differ significantly by CCP status. Tocilizumab led to statistically significant improvement in all patient- and physician-reported measures of disease activity evaluated in this cohort of patient with RA. The response to tocilizumab did not differ by CCP status. Copyright © 2017 Elsevier Inc. All rights reserved.

Defining Hepatoblastoma Responsiveness to Induction Therapy as Measured by Tumor Volume and Serum α-fetoprotein Kinetics

PubMed Central

Lovvorn, Harold N.; Ayers, Dan; Zhao, Zhiguo; Hilmes, Melissa; Prasad, Pinki; Shinall, Myrick C.; Berch, Barry; Neblett, Wallace W.; O'Neill, James A.

2010-01-01

Purpose Hepatoblastoma is commonly unresectable at presentation, necessitating induction chemotherapy before definitive resection. To refine the paradigm for timing of resection, we questioned whether a plateau in hepatoblastoma responsiveness to neoadjuvant therapy could be detected by calculating tumor volume (TV) and serum α-fetoprotein (sAFP) kinetics. Methods To calculate TV and sAFP as measures of treatment responsiveness over time, infants having initially unresectable epithelial-type hepatoblastomas were identified at a single institution (1996-2008). Effects of therapy type, therapy duration, and lobe of liver involvement on TV, sAFP, margin status, and toxicity were analyzed. Results Of 24 infants treated for epithelial-type hepatoblastoma during this interval, 5 were resected primarily, and 15 had complete digital films for kinetics analysis. Both TV and sAFP decreased dramatically over time (p<0.0001). No statistically significant difference in mean TV or sAFP was detected after chemotherapy cycle 2. Left lobe tumors had greater presenting levels of and significantly slower decay in sAFP compared to right lobe tumors (p=0.005), although no statistically significant differences in TV existed between liver lobes. Resection margins did not change with therapy duration. Conclusions Measuring TV and sAFP kinetics accurately reflects hepatoblastoma responsiveness to induction therapy. Treatment toxicities may be reduced by earlier resection and tailoring of chemotherapeutic regimens. PMID:20105591

What's in a Name?

NASA Astrophysics Data System (ADS)

Bonneau, Joseph; Just, Mike; Matthews, Greg

We study the efficiency of statistical attacks on human authentication systems relying on personal knowledge questions. We adapt techniques from guessing theory to measure security against a trawling attacker attempting to compromise a large number of strangers' accounts. We then examine a diverse corpus of real-world statistical distributions for likely answer categories such as the names of people, pets, and places and find that personal knowledge questions are significantly less secure than graphical or textual passwords. We also demonstrate that statistics can be used to increase security by proactively shaping the answer distribution to lower the prevalence of common responses.

Differences in pulmonary biochemical and inflammatory responses of rats and guinea pigs resulting from daytime or nighttime, single and repeated exposure to ozone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van Bree, L.; Marra, M.; Rombout, P.J.

1992-10-01

Rats and guinea pigs were exposed to 0.8 mg ozone (O3)/m3 (approximately 0.4 ppm) for 12 hr during the daytime, 12 hr during the nighttime, or continuously to investigate circadian variation in O3-induced pulmonary toxicity during single and repeated O3 exposures. Biomarkers in bronchoalveolar lavage (BAL) fluid and lung tissues were measured as indicators of biochemical and inflammatory responses. Nighttime O3 exposure of rats resulted in larger increases of protein, albumin, and inflammatory cells in BAL fluid compared to those after daytime O3 exposure and this daytime-nighttime difference was statistically significant (p < 0.05). Single daytime or nighttime O3 exposuremore » of guinea pigs resulted in comparable increases of BAL fluid proteins and inflammatory cells without a daytime-nighttime difference. Nighttime and continuous O3 exposure of rats for 3 days resulted in comparable increases in lung antioxidant enzyme activities, both of which differed statistically from effects from daytime O3 exposures (p < 0.05). Continuous O3 exposure of guinea pigs for 3 days caused, in general, statistically larger increases in lung tissue parameters compared to nighttime O3 exposures (p < 0.05). These results suggest that the extent of O3-induced acute pulmonary biochemical and inflammatory responses is directly related to the level of physical and respiratory activity. For rats, effects from continuous O3 exposure appear to be controlled by the nighttime, physically active period. In guinea pigs, the comparable responses following daytime or nighttime O3 exposure seem in accordance with their random behavioral daily activity pattern. This study supports the view that physical activity-related increases in inhaled dose significantly enhance the pulmonary O3 responses.« less

Respiratory response to formaldehyde and off-gas of urea formaldehyde foam insulation.

PubMed Central

Day, J H; Lees, R E; Clark, R H; Pattee, P L

1984-01-01

In 18 subjects, 9 of whom had previously complained of various nonrespiratory adverse effects from the urea formaldehyde foam insulation (UFFI) in their homes, pulmonary function was assessed before and after exposure in a laboratory. On separate occasions formaldehyde, 1 part per million (ppm), and UFFI off-gas yielding a formaldehyde concentration of 1.2 ppm, were delivered to each subject in an environmental chamber for 90 minutes and a fume hood for 30 minutes respectively. None of the measures of pulmonary function used (forced vital capacity, forced expiratory volume in 1 second or maximal midexpiratory flow rate) showed any clinically or statistically significant response to the exposure either immediately after or 8 hours after its beginning. There were no statistically significant differences between the responses of the group that had previously complained of adverse effects and of the group that had not. There was no evidence that either formaldehyde or UFFI off-gas operates as a lower airway allergen or important bronchospastic irritant in this heterogeneous population. Images Fig. 1 PMID:6388780

Non-response to sad mood induction: implications for emotion research.

PubMed

Rottenberg, Jonathan; Kovacs, Maria; Yaroslavsky, Ilya

2018-05-01

Experimental induction of sad mood states is a mainstay of laboratory research on affect and cognition, mood regulation, and mood disorders. Typically, the success of such mood manipulations is reported as a statistically significant pre- to post-induction change in the self-rated intensity of the target affect. The present commentary was motivated by an unexpected finding in one of our studies concerning the response rate to a well-validated sad mood induction. Using the customary statistical approach, we found a significant mean increase in self-rated sadness intensity with a moderate effect size, verifying the "success" of the mood induction. However, that "success" masked that, between one-fifth and about one-third of our samples (adolescents who had histories of childhood-onset major depressive disorder and healthy controls) reported absolutely no sadness in response to the mood induction procedure. We consider implications of our experience for emotion research by (1) commenting upon the typically overlooked phenomenon of nonresponse, (2) suggesting changes in reporting practices regarding mood induction success, and (3) outlining future directions to help scientists determine why some subjects do not respond to experimental mood induction.

Binary recursive partitioning: background, methods, and application to psychology.

PubMed

Merkle, Edgar C; Shaffer, Victoria A

2011-02-01

Binary recursive partitioning (BRP) is a computationally intensive statistical method that can be used in situations where linear models are often used. Instead of imposing many assumptions to arrive at a tractable statistical model, BRP simply seeks to accurately predict a response variable based on values of predictor variables. The method outputs a decision tree depicting the predictor variables that were related to the response variable, along with the nature of the variables' relationships. No significance tests are involved, and the tree's 'goodness' is judged based on its predictive accuracy. In this paper, we describe BRP methods in a detailed manner and illustrate their use in psychological research. We also provide R code for carrying out the methods.

EXTENDING MULTIVARIATE DISTANCE MATRIX REGRESSION WITH AN EFFECT SIZE MEASURE AND THE ASYMPTOTIC NULL DISTRIBUTION OF THE TEST STATISTIC

PubMed Central

McArtor, Daniel B.; Lubke, Gitta H.; Bergeman, C. S.

2017-01-01

Person-centered methods are useful for studying individual differences in terms of (dis)similarities between response profiles on multivariate outcomes. Multivariate distance matrix regression (MDMR) tests the significance of associations of response profile (dis)similarities and a set of predictors using permutation tests. This paper extends MDMR by deriving and empirically validating the asymptotic null distribution of its test statistic, and by proposing an effect size for individual outcome variables, which is shown to recover true associations. These extensions alleviate the computational burden of permutation tests currently used in MDMR and render more informative results, thus making MDMR accessible to new research domains. PMID:27738957

Extending multivariate distance matrix regression with an effect size measure and the asymptotic null distribution of the test statistic.

PubMed

McArtor, Daniel B; Lubke, Gitta H; Bergeman, C S

2017-12-01

Person-centered methods are useful for studying individual differences in terms of (dis)similarities between response profiles on multivariate outcomes. Multivariate distance matrix regression (MDMR) tests the significance of associations of response profile (dis)similarities and a set of predictors using permutation tests. This paper extends MDMR by deriving and empirically validating the asymptotic null distribution of its test statistic, and by proposing an effect size for individual outcome variables, which is shown to recover true associations. These extensions alleviate the computational burden of permutation tests currently used in MDMR and render more informative results, thus making MDMR accessible to new research domains.

Preventive Effect of Phosphodiesterase Inhibitor Pentoxifylline Against Medication-Related Osteonecrosis of the Jaw: An Animal Study.

PubMed

Yalcin-Ulker, Gül Merve; Cumbul, Alev; Duygu-Capar, Gonca; Uslu, Ünal; Sencift, Kemal

2017-11-01

The aim of this experimental study was to investigate the prophylactic effect of pentoxifylline (PTX) on medication-related osteonecrosis of the jaw (MRONJ). Female Sprague-Dawley rats (n = 33) received zoledronic acid (ZA) for 8 weeks to create an osteonecrosis model. The left mandibular second molars were extracted and the recovery period lasted 8 weeks before sacrifice. PTX was intraperitoneally administered to prevent MRONJ. The specimens were histopathologically and histomorphometrically evaluated. Histomorphometrically, between the control and ZA groups, there was no statistically significant difference in total bone volume (P = .999), but there was a statistically significant difference in bone ratio in the extraction sockets (P < .001). A comparison of the bone ratio of the ZA group with the ZA/PTX group (PTX administered after extraction) showed no statistically significant difference (P = .69), but there was a statistically significant difference with the ZA/PTX/PTX group (PTX administered before and after extraction; P = .008). Histopathologically, between the control and ZA groups, there were statistically significant differences for inflammation (P = .013), vascularization (P = .022), hemorrhage (P = .025), and regeneration (P = .008). Between the ZA and ZA/PTX groups, there were no statistically significant differences for inflammation (P = .536), vascularization (P = .642), hemorrhage (P = .765), and regeneration (P = .127). Between the ZA and ZA/PTX/PTX groups, there were statistically significant differences for inflammation (P = .017), vascularization (P = .04), hemorrhage (P = .044), and regeneration (P = .04). In this experimental model of MRONJ, it might be concluded that although PTX, given after tooth extraction, improves new bone formation that positively affects bone healing, it is not prophylactic. However, PTX given before tooth extraction is prophylactic. Therefore, PTX might affect healing in a positive way by optimizing the inflammatory response. Copyright © 2017 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Hypothesized eye movements of neurolinguistic programming: a statistical artifact.

PubMed

Farmer, A; Rooney, R; Cunningham, J R

1985-12-01

Neurolinguistic programming's hypothesized eye-movements were measured independently from videotapes of 30 subjects, aged 15 to 76 yr., who were asked to recall visual pictures, recorded audio sounds, and textural objects. chi 2 indicated that subjects' responses were significantly different from those predicted. When chi 2 comparisons were weighted by number of eye positions assigned to each modality (3 visual, 3 auditory, 1 kinesthetic), subjects' responses did not differ significantly from the expected pattern. These data indicate that the eye-movement hypothesis may represent randomly occurring rather than sensory-modality-related positions.

Enhanced retinal responses in Huntington's disease patients.

PubMed

Pearl, Jocelynn R; Heath, Laura M; Bergey, Dani E; Kelly, John P; Smith, Corrie; Laurino, Mercy Y; Weiss, Avery; Price, Nathan D; LaSpada, Albert; Bird, Thomas D; Jayadev, Suman

2017-01-01

Huntington's disease (HD) is a fatal progressive neurodegenerative disease characterized by chorea, cognitive impairment and psychiatric symptoms. Retinal examination of HD patients as well as in HD animal models have shown evidence of retinal dysfunction. However, a detailed retinal study employing clinically available measurement tools has not been reported to date in HD. The goal of this study was to assess retinal responses measured by electroretinogram (ERG) between HD patients and controls and evaluate any correlation between ERG measurements and stage of disease. Eighteen patients and 10 controls with inclusion criteria of ages 18-70 years (average age HD subjects: 52.1 yrs and control subjects: 51.9 yrs) were recruited for the study. Subjects with previous history of retinal or ophthalmologic disease were excluded. Retinal function was examined by full-field ERG in both eyes of each subject. Amplitudes and latencies to increasing flash intensities in both light- and dark-adaptation were measured in all subjects. Statistical analyses employed generalized estimating equations, which account for repeated measures per subject. We analyzed the b-wave amplitudes of ERG response in all flash intensities and with 30 Hz flicker stimulation. We found statistically significant increased amplitudes in HD patients compared to controls at light-adapted (photopic) 24.2 and 60.9 cd.sec/m2 intensities, dark-adapted (scotopic, red flash) 0.22 cd.sec/m2 intensity, and a trend toward significance at light-adapted 30 Hz flicker. Furthermore, we found a significant increase in light-adapted ERG response from female compared to male HD patients, but no significant difference between gender amongst controls. We also noted a positive association between number of CAG repeats and ERG response at the smallest light adapted intensity (3.1 cd.sec/m2). ERG studies revealed significantly altered retinal responses at multiple flash intensities in subjects with an HD expansion allele compared to controls. Significant differences were observed with either light-adapted tests or the dark-adapted red flash which suggests that the enhanced responses in HD patients is specific to the cone photoreceptor pathway.

Efficacy of a mail survey appeal for a dissertation.

PubMed

Gaski, John F

2004-12-01

Of all the determinants of mail survey response investigated, a dissertation as the purpose is one type of appeal not used in a covering letter. Two parallel field experiments involving populations of wholesale organizations (N=743 and 509) are reported in which such an appeal was tested. Lack of statistically significant findings indicates use of this appeal did not enhance response rate or quality.

Exploring models for the roles of health systems’ responsiveness and social determinants in explaining universal health coverage and health outcomes

PubMed Central

Bonsel, Gouke J.

2016-01-01

Background Intersectoral perspectives of health are present in the rhetoric of the sustainable development goals. Yet its descriptions of systematic approaches for an intersectoral monitoring vision, joining determinants of health, and barriers or facilitators to accessing healthcare services are lacking. Objective To explore models of associations between health outcomes and health service coverage, and health determinants and health systems responsiveness, and thereby to contribute to monitoring, analysis, and assessment approaches informed by an intersectoral vision of health. Design The study is designed as a series of ecological, cross-country regression analyses, covering between 23 and 57 countries with dependent health variables concentrated on the years 2002–2003. Countries cover a range of development contexts. Health outcome and health service coverage dependent variables were derived from World Health Organization (WHO) information sources. Predictor variables representing determinants are derived from the WHO and World Bank databases; variables used for health systems’ responsiveness are derived from the WHO World Health Survey. Responsiveness is a measure of acceptability of health services to the population, complementing financial health protection. Results Health determinants’ indicators – access to improved drinking sources, accountability, and average years of schooling – were statistically significant in particular health outcome regressions. Statistically significant coefficients were more common for mortality rate regressions than for coverage rate regressions. Responsiveness was systematically associated with poorer health and health service coverage. With respect to levels of inequality in health, the indicator of responsiveness problems experienced by the unhealthy poor groups in the population was statistically significant for regressions on measles vaccination inequalities between rich and poor. For the broader determinants, the Gini mattered most for inequalities in child mortality; education mattered more for inequalities in births attended by skilled personnel. Conclusions This paper adds to the literature on comparative health systems research. National and international health monitoring frameworks need to incorporate indicators on trends in and impacts of other policy sectors on health. This will empower the health sector to carry out public health practices that promote health and health equity. PMID:26942516

Exploring models for the roles of health systems' responsiveness and social determinants in explaining universal health coverage and health outcomes.

PubMed

Valentine, Nicole Britt; Bonsel, Gouke J

2016-01-01

Intersectoral perspectives of health are present in the rhetoric of the sustainable development goals. Yet its descriptions of systematic approaches for an intersectoral monitoring vision, joining determinants of health, and barriers or facilitators to accessing healthcare services are lacking. To explore models of associations between health outcomes and health service coverage, and health determinants and health systems responsiveness, and thereby to contribute to monitoring, analysis, and assessment approaches informed by an intersectoral vision of health. The study is designed as a series of ecological, cross-country regression analyses, covering between 23 and 57 countries with dependent health variables concentrated on the years 2002-2003. Countries cover a range of development contexts. Health outcome and health service coverage dependent variables were derived from World Health Organization (WHO) information sources. Predictor variables representing determinants are derived from the WHO and World Bank databases; variables used for health systems' responsiveness are derived from the WHO World Health Survey. Responsiveness is a measure of acceptability of health services to the population, complementing financial health protection. Health determinants' indicators - access to improved drinking sources, accountability, and average years of schooling - were statistically significant in particular health outcome regressions. Statistically significant coefficients were more common for mortality rate regressions than for coverage rate regressions. Responsiveness was systematically associated with poorer health and health service coverage. With respect to levels of inequality in health, the indicator of responsiveness problems experienced by the unhealthy poor groups in the population was statistically significant for regressions on measles vaccination inequalities between rich and poor. For the broader determinants, the Gini mattered most for inequalities in child mortality; education mattered more for inequalities in births attended by skilled personnel. This paper adds to the literature on comparative health systems research. National and international health monitoring frameworks need to incorporate indicators on trends in and impacts of other policy sectors on health. This will empower the health sector to carry out public health practices that promote health and health equity.

Changing response of the North Atlantic/European winter climate to the 11 year solar cycle

NASA Astrophysics Data System (ADS)

Ma, Hedi; Chen, Haishan; Gray, Lesley; Zhou, Liming; Li, Xing; Wang, Ruili; Zhu, Siguang

2018-03-01

Recent studies have presented conflicting results regarding the 11 year solar cycle (SC) influences on winter climate over the North Atlantic/European region. Analyses of only the most recent decades suggest a synchronized North Atlantic Oscillation (NAO)-like response pattern to the SC. Analyses of long-term climate data sets dating back to the late 19th century, however, suggest a mean sea level pressure (mslp) response that lags the SC by 2-4 years in the southern node of the NAO (i.e. Azores region). To understand the conflicting nature and cause of these time dependencies in the SC surface response, the present study employs a lead/lag multi-linear regression technique with a sliding window of 44 years over the period 1751-2016. Results confirm previous analyses, in which the average response for the whole time period features a statistically significant 2-4 year lagged mslp response centered over the Azores region. Overall, the lagged nature of Azores mslp response is generally consistent in time. Stronger and statistically significant SC signals tend to appear in the periods when the SC forcing amplitudes are relatively larger. Individual month analysis indicates the consistent lagged response in December-January-February average arises primarily from early winter months (i.e. December and January), which has been associated with ocean feedback processes that involve reinforcement by anomalies from the previous winter. Additional analysis suggests that the synchronous NAO-like response in recent decades arises primarily from late winter (February), possibly reflecting a result of strong internal noise.

Minnesota Multiphasic Personality Inventory-2-Restructured Form (MMPI-2-RF) scores generated from the MMPI-2 and MMPI-2-RF test booklets: internal structure comparability in a sample of criminal defendants.

PubMed

Tarescavage, Anthony M; Alosco, Michael L; Ben-Porath, Yossef S; Wood, Arcangela; Luna-Jones, Lynn

2015-04-01

We investigated the internal structure comparability of Minnesota Multiphasic Personality Inventory-2-Restructured Form (MMPI-2-RF) scores derived from the MMPI-2 and MMPI-2-RF booklets in a sample of 320 criminal defendants (229 males and 54 females). After exclusion of invalid protocols, the final sample consisted of 96 defendants who were administered the MMPI-2-RF booklet and 83 who completed the MMPI-2. No statistically significant differences in MMPI-2-RF invalidity rates were observed between the two forms. Individuals in the final sample who completed the MMPI-2-RF did not statistically differ on demographics or referral question from those who were administered the MMPI-2 booklet. Independent t tests showed no statistically significant differences between MMPI-2-RF scores generated with the MMPI-2 and MMPI-2-RF booklets on the test's substantive scales. Statistically significant small differences were observed on the revised Variable Response Inconsistency (VRIN-r) and True Response Inconsistency (TRIN-r) scales. Cronbach's alpha and standard errors of measurement were approximately equal between the booklets for all MMPI-2-RF scales. Finally, MMPI-2-RF intercorrelations produced from the two forms yielded mostly small and a few medium differences, indicating that discriminant validity and test structure are maintained. Overall, our findings reflect the internal structure comparability of MMPI-2-RF scale scores generated from MMPI-2 and MMPI-2-RF booklets. Implications of these results and limitations of these findings are discussed. © The Author(s) 2014.

The dose-response of salvage radiotherapy following radical prostatectomy: A systematic review and meta-analysis.

PubMed

King, Christopher R

2016-11-01

To date neither the optimal radiotherapy dose nor the existence of a dose-response has been established for salvage RT (SRT). A systematic review from 1996 to 2015 and meta-analysis was performed to identify the pathologic, clinical and treatment factors associated with relapse-free survival (RFS) after SRT (uniformly defined as a PSA>0.2ng/mL or rising above post-SRT nadir). A sigmoidal dose-response curve was objectively fitted and a non-parametric statistical test used to determine significance. 71 studies (10,034 patients) satisfied the meta-analysis criteria. SRT dose (p=0.0001), PSA prior to SRT (p=0.0009), ECE+ (p=0.039) and SV+ (p=0.046) had significant associations with RFS. Statistical analyses confirmed the independence of SRT dose-response. Omission of series with ADT did not alter results. Dose-response is well fit by a sigmoidal curve (p=0.0001) with a TCD 50 of 65.8Gy, with a dose of 70Gy achieving 58.4% RFS vs. 38.5% for 60Gy. A 2.0% [95% CI 1.1-3.2] improvement in RFS is achieved for each Gy. The SRT dose-response remarkably parallels that for definitive RT of localized disease. This study provides level 2a evidence for dose-escalated SRT>70Gy. The presence of an SRT dose-response for microscopic disease supports the hypothesis that prostate cancer is inherently radio-resistant. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Ensemble of Thermostatically Controlled Loads: Statistical Physics Approach.

PubMed

Chertkov, Michael; Chernyak, Vladimir

2017-08-17

Thermostatically controlled loads, e.g., air conditioners and heaters, are by far the most widespread consumers of electricity. Normally the devices are calibrated to provide the so-called bang-bang control - changing from on to off, and vice versa, depending on temperature. We considered aggregation of a large group of similar devices into a statistical ensemble, where the devices operate following the same dynamics, subject to stochastic perturbations and randomized, Poisson on/off switching policy. Using theoretical and computational tools of statistical physics, we analyzed how the ensemble relaxes to a stationary distribution and established a relationship between the relaxation and the statistics of the probability flux associated with devices' cycling in the mixed (discrete, switch on/off, and continuous temperature) phase space. This allowed us to derive the spectrum of the non-equilibrium (detailed balance broken) statistical system and uncover how switching policy affects oscillatory trends and the speed of the relaxation. Relaxation of the ensemble is of practical interest because it describes how the ensemble recovers from significant perturbations, e.g., forced temporary switching off aimed at utilizing the flexibility of the ensemble to provide "demand response" services to change consumption temporarily to balance a larger power grid. We discuss how the statistical analysis can guide further development of the emerging demand response technology.

Ensemble of Thermostatically Controlled Loads: Statistical Physics Approach

DOE PAGES

Chertkov, Michael; Chernyak, Vladimir

2017-01-17

Thermostatically Controlled Loads (TCL), e.g. air-conditioners and heaters, are by far the most wide-spread consumers of electricity. Normally the devices are calibrated to provide the so-called bang-bang control of temperature - changing from on to off , and vice versa, depending on temperature. Aggregation of a large group of similar devices into a statistical ensemble is considered, where the devices operate following the same dynamics subject to stochastic perturbations and randomized, Poisson on/off switching policy. We analyze, using theoretical and computational tools of statistical physics, how the ensemble relaxes to a stationary distribution and establish relation between the re- laxationmore » and statistics of the probability flux, associated with devices' cycling in the mixed (discrete, switch on/off , and continuous, temperature) phase space. This allowed us to derive and analyze spec- trum of the non-equilibrium (detailed balance broken) statistical system. and uncover how switching policy affects oscillatory trend and speed of the relaxation. Relaxation of the ensemble is of a practical interest because it describes how the ensemble recovers from significant perturbations, e.g. forceful temporary switching o aimed at utilizing flexibility of the ensemble in providing "demand response" services relieving consumption temporarily to balance larger power grid. We discuss how the statistical analysis can guide further development of the emerging demand response technology.« less

Ensemble of Thermostatically Controlled Loads: Statistical Physics Approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chertkov, Michael; Chernyak, Vladimir

Thermostatically Controlled Loads (TCL), e.g. air-conditioners and heaters, are by far the most wide-spread consumers of electricity. Normally the devices are calibrated to provide the so-called bang-bang control of temperature - changing from on to off , and vice versa, depending on temperature. Aggregation of a large group of similar devices into a statistical ensemble is considered, where the devices operate following the same dynamics subject to stochastic perturbations and randomized, Poisson on/off switching policy. We analyze, using theoretical and computational tools of statistical physics, how the ensemble relaxes to a stationary distribution and establish relation between the re- laxationmore » and statistics of the probability flux, associated with devices' cycling in the mixed (discrete, switch on/off , and continuous, temperature) phase space. This allowed us to derive and analyze spec- trum of the non-equilibrium (detailed balance broken) statistical system. and uncover how switching policy affects oscillatory trend and speed of the relaxation. Relaxation of the ensemble is of a practical interest because it describes how the ensemble recovers from significant perturbations, e.g. forceful temporary switching o aimed at utilizing flexibility of the ensemble in providing "demand response" services relieving consumption temporarily to balance larger power grid. We discuss how the statistical analysis can guide further development of the emerging demand response technology.« less

A Comparison of Right Unilateral and Sequential Bilateral Repetitive Transcranial Magnetic Stimulation for Major Depression: A Naturalistic Clinical Australian Study.

PubMed

Galletly, Cherrie A; Carnell, Benjamin L; Clarke, Patrick; Gill, Shane

2017-03-01

A great deal of research has established the efficacy of repetitive transcranial magnetic stimulation (rTMS) in the treatment of depression. However, questions remain about the optimal method to deliver treatment. One area requiring consideration is the difference in efficacy between bilateral and unilateral treatment protocols. This study aimed to compare the effectiveness of sequential bilateral rTMS and right unilateral rTMS. A total of 135 patients participated in the study, receiving either bilateral rTMS (N = 57) or right unilateral rTMS (N = 78). Treatment response was assessed using the Hamilton depression rating scale. Sequential bilateral rTMS had a higher response rate than right unilateral (43.9% vs 30.8%), but this difference was not statistically significant. This was also the case for remission rates (33.3% vs 21.8%, respectively). Controlling for pretreatment severity of depression, the results did not indicate a significant difference between the protocols with regard to posttreatment Hamilton depression rating scale scores. The current study found no statistically significant differences in response and remission rates between sequential bilateral rTMS and right unilateral rTMS. Given the shorter treatment time and the greater safety and tolerability of right unilateral rTMS, this may be a better choice than bilateral treatment in clinical settings.

The Role of T Lymphocytes in Cancer Patients Undergoing Immunotherapy with Autologous Dendritic Cells

PubMed Central

Rodrigues, Cláudia M.; Matias, Bruna F.; Murta, Eddie F.C.; Michelin, Márcia A.

2011-01-01

Introduction: Cancer stems from mutations in specific genes that induce uncontrolled cell proliferation. Dendritic cells (DCs) are important immunologic cells and play a crucial role in the induction of an antitumour response. Patients and methods: We examined the immune response mediated by T lymphocytes, helper T cells, cytotoxic T cells, and regulatory T cells, as well as the cytokines [interleukin (IL)-2, IL-12, interferon (IFN)-γ, tumour necrosis factor (TNF)-α and IL-10], produced by these cell populations, in cancer patients (N = 7) undergoing immunotheraphy with autologous DCs. Results: We observed an initial increase in T helper cells (CD4+) expressing IL-2, IFN-γ, IL-12, TNF-α, and IL-10 after initiation of treatment, with statistically significant for the cytokines IL-2, TNF-α and IL-10. A similar significant effect was observed for IL-2-expressing cytotoxic T cells (CD8+). The percentage of total T cells (CD3+) remained elevated throughout immunotherapy. Regulatory T cells (CD25+/FOXP3+) only showed high percentage of their maximum value when analyzed the pretreatment levels, with statistically significant. Conclusion: Immunotherapy with DCs stimulated the immune response, as evidenced by an increase in percent fluorescence of most cell populations investigated during the specified treatment period. PMID:21603246

Optimization of non-thermal plasma efficiency in the simultaneous elimination of benzene, toluene, ethyl-benzene, and xylene from polluted airstreams using response surface methodology.

PubMed

Najafpoor, Ali Asghar; Jonidi Jafari, Ahmad; Hosseinzadeh, Ahmad; Khani Jazani, Reza; Bargozin, Hasan

2018-01-01

Treatment with a non-thermal plasma (NTP) is a new and effective technology applied recently for conversion of gases for air pollution control. This research was initiated to optimize the efficient application of the NTP process in benzene, toluene, ethyl-benzene, and xylene (BTEX) removal. The effects of four variables including temperature, initial BTEX concentration, voltage, and flow rate on the BTEX elimination efficiency were investigated using response surface methodology (RSM). The constructed model was evaluated by analysis of variance (ANOVA). The model goodness-of-fit and statistical significance was assessed using determination coefficients (R 2 and R 2 adj ) and the F-test. The results revealed that the R 2 proportion was greater than 0.96 for BTEX removal efficiency. The statistical analysis demonstrated that the BTEX removal efficiency was significantly correlated with the temperature, BTEX concentration, voltage, and flow rate. Voltage was the most influential variable affecting the dependent variable as it exerted a significant effect (p < 0.0001) on the response variable. According to the achieved results, NTP can be applied as a progressive, cost-effective, and practical process for treatment of airstreams polluted with BTEX in conditions of low residence time and high concentrations of pollutants.

Superposed epoch analysis of physiological fluctuations: possible space weather connections

NASA Astrophysics Data System (ADS)

Wanliss, James; Cornélissen, Germaine; Halberg, Franz; Brown, Denzel; Washington, Brien

2018-03-01

There is a strong connection between space weather and fluctuations in technological systems. Some studies also suggest a statistical connection between space weather and subsequent fluctuations in the physiology of living creatures. This connection, however, has remained controversial and difficult to demonstrate. Here we present support for a response of human physiology to forcing from the explosive onset of the largest of space weather events—space storms. We consider a case study with over 16 years of high temporal resolution measurements of human blood pressure (systolic, diastolic) and heart rate variability to search for associations with space weather. We find no statistically significant change in human blood pressure but a statistically significant drop in heart rate during the main phase of space storms. Our empirical findings shed light on how human physiology may respond to exogenous space weather forcing.

Superposed epoch analysis of physiological fluctuations: possible space weather connections.

PubMed

Wanliss, James; Cornélissen, Germaine; Halberg, Franz; Brown, Denzel; Washington, Brien

2018-03-01

There is a strong connection between space weather and fluctuations in technological systems. Some studies also suggest a statistical connection between space weather and subsequent fluctuations in the physiology of living creatures. This connection, however, has remained controversial and difficult to demonstrate. Here we present support for a response of human physiology to forcing from the explosive onset of the largest of space weather events-space storms. We consider a case study with over 16 years of high temporal resolution measurements of human blood pressure (systolic, diastolic) and heart rate variability to search for associations with space weather. We find no statistically significant change in human blood pressure but a statistically significant drop in heart rate during the main phase of space storms. Our empirical findings shed light on how human physiology may respond to exogenous space weather forcing.

Spatial transformations between superior colliculus visual and motor response fields during head-unrestrained gaze shifts.

PubMed

Sadeh, Morteza; Sajad, Amirsaman; Wang, Hongying; Yan, Xiaogang; Crawford, John Douglas

2015-12-01

We previously reported that visuomotor activity in the superior colliculus (SC)--a key midbrain structure for the generation of rapid eye movements--preferentially encodes target position relative to the eye (Te) during low-latency head-unrestrained gaze shifts (DeSouza et al., 2011). Here, we trained two monkeys to perform head-unrestrained gaze shifts after a variable post-stimulus delay (400-700 ms), to test whether temporally separated SC visual and motor responses show different spatial codes. Target positions, final gaze positions and various frames of reference (eye, head, and space) were dissociated through natural (untrained) trial-to-trial variations in behaviour. 3D eye and head orientations were recorded, and 2D response field data were fitted against multiple models by use of a statistical method reported previously (Keith et al., 2009). Of 60 neurons, 17 showed a visual response, 12 showed a motor response, and 31 showed both visual and motor responses. The combined visual response field population (n = 48) showed a significant preference for Te, which was also preferred in each visual subpopulation. In contrast, the motor response field population (n = 43) showed a preference for final (relative to initial) gaze position models, and the Te model was statistically eliminated in the motor-only population. There was also a significant shift of coding from the visual to motor response within visuomotor neurons. These data confirm that SC response fields are gaze-centred, and show a target-to-gaze transformation between visual and motor responses. Thus, visuomotor transformations can occur between, and even within, neurons within a single frame of reference and brain structure. © 2015 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

The National Environmental Respiratory Center (NERC) experiment in multi-pollutant air quality health research: II. Comparison of responses to diesel and gasoline engine exhausts, hardwood smoke and simulated downwind coal emissions.

PubMed

Mauderly, J L; Barrett, E G; Day, K C; Gigliotti, A P; McDonald, J D; Harrod, K S; Lund, A K; Reed, M D; Seagrave, J C; Campen, M J; Seilkop, S K

2014-09-01

The NERC Program conducted identically designed exposure-response studies of the respiratory and cardiovascular responses of rodents exposed by inhalation for up to 6 months to diesel and gasoline exhausts (DE, GE), wood smoke (WS) and simulated downwind coal emissions (CE). Concentrations of the four combustion-derived mixtures ranged from near upper bound plausible to common occupational and environmental hotspot levels. An "exposure effect" statistic was created to compare the strengths of exposure-response relationships and adjustments were made to minimize false positives among the large number of comparisons. All four exposures caused statistically significant effects. No exposure caused overt illness, neutrophilic lung inflammation, increased circulating micronuclei or histopathology of major organs visible by light microscopy. DE and GE caused the greatest lung cytotoxicity. WS elicited the most responses in lung lavage fluid. All exposures reduced oxidant production by unstimulated alveolar macrophages, but only GE suppressed stimulated macrophages. Only DE retarded clearance of bacteria from the lung. DE before antigen challenge suppressed responses of allergic mice. CE tended to amplify allergic responses regardless of exposure order. GE and DE induced oxidant stress and pro-atherosclerotic responses in aorta; WS and CE had no such effects. No overall ranking of toxicity was plausible. The ranking of exposures by number of significant responses varied among the response models, with each of the four causing the most responses for at least one model. Each exposure could also be deemed most or least toxic depending on the exposure metric used for comparison. The database is available for additional analyses.

Response statistics of rotating shaft with non-linear elastic restoring forces by path integration

NASA Astrophysics Data System (ADS)

Gaidai, Oleg; Naess, Arvid; Dimentberg, Michael

2017-07-01

Extreme statistics of random vibrations is studied for a Jeffcott rotor under uniaxial white noise excitation. Restoring force is modelled as elastic non-linear; comparison is done with linearized restoring force to see the force non-linearity effect on the response statistics. While for the linear model analytical solutions and stability conditions are available, it is not generally the case for non-linear system except for some special cases. The statistics of non-linear case is studied by applying path integration (PI) method, which is based on the Markov property of the coupled dynamic system. The Jeffcott rotor response statistics can be obtained by solving the Fokker-Planck (FP) equation of the 4D dynamic system. An efficient implementation of PI algorithm is applied, namely fast Fourier transform (FFT) is used to simulate dynamic system additive noise. The latter allows significantly reduce computational time, compared to the classical PI. Excitation is modelled as Gaussian white noise, however any kind distributed white noise can be implemented with the same PI technique. Also multidirectional Markov noise can be modelled with PI in the same way as unidirectional. PI is accelerated by using Monte Carlo (MC) estimated joint probability density function (PDF) as initial input. Symmetry of dynamic system was utilized to afford higher mesh resolution. Both internal (rotating) and external damping are included in mechanical model of the rotor. The main advantage of using PI rather than MC is that PI offers high accuracy in the probability distribution tail. The latter is of critical importance for e.g. extreme value statistics, system reliability, and first passage probability.

SigTree: A Microbial Community Analysis Tool to Identify and Visualize Significantly Responsive Branches in a Phylogenetic Tree.

PubMed

Stevens, John R; Jones, Todd R; Lefevre, Michael; Ganesan, Balasubramanian; Weimer, Bart C

2017-01-01

Microbial community analysis experiments to assess the effect of a treatment intervention (or environmental change) on the relative abundance levels of multiple related microbial species (or operational taxonomic units) simultaneously using high throughput genomics are becoming increasingly common. Within the framework of the evolutionary phylogeny of all species considered in the experiment, this translates to a statistical need to identify the phylogenetic branches that exhibit a significant consensus response (in terms of operational taxonomic unit abundance) to the intervention. We present the R software package SigTree , a collection of flexible tools that make use of meta-analysis methods and regular expressions to identify and visualize significantly responsive branches in a phylogenetic tree, while appropriately adjusting for multiple comparisons.

Social Media Self-Efficacy of Health Education Specialists: Training and Organizational Development Implications.

PubMed

Alber, Julia M; Paige, Samantha; Stellefson, Michael; Bernhardt, Jay M

2016-11-01

A growing number of public health organizations are applying the power of social media (SM) for health promotion and behavior change. This cross-sectional study of health education specialists (n = 353) examined which demographic and occupational factors were associated with SM self-efficacy, and evaluated SM self-efficacy related to each of the Seven Areas of Responsibility. A series of one-way analyses of variance were conducted to determine whether differences in SM self-efficacy existed by sex, age, years of work experience, and SM access at work. A multiple linear regression examined the relationship between SM self-efficacy and SM experience when controlling for demographic and occupational factors. Statistically significant differences in SM self-efficacy existed by age, F(2, 289) = 6.54, p = .002. SM experience (β = 1.43, t = 11.35, p < .001) was a statistically significant predictor of SM self-efficacy, even after controlling for age, sex, years of work experience, and level of SM access, F(5, 290) = 30.88, p < .001, R 2 = .35. Results revealed statistically significant differences in mean SM self-efficacy scores by the Areas of Responsibility, F(4.69, 1425.46) = 22.46, p < .001. Professional health organizations should have policies in place and trainings that are conducive to learning and applying SM for health education research and practice. © 2016 Society for Public Health Education.

The extended statistical analysis of toxicity tests using standardised effect sizes (SESs): a comparison of nine published papers.

PubMed

Festing, Michael F W

2014-01-01

The safety of chemicals, drugs, novel foods and genetically modified crops is often tested using repeat-dose sub-acute toxicity tests in rats or mice. It is important to avoid misinterpretations of the results as these tests are used to help determine safe exposure levels in humans. Treated and control groups are compared for a range of haematological, biochemical and other biomarkers which may indicate tissue damage or other adverse effects. However, the statistical analysis and presentation of such data poses problems due to the large number of statistical tests which are involved. Often, it is not clear whether a "statistically significant" effect is real or a false positive (type I error) due to sampling variation. The author's conclusions appear to be reached somewhat subjectively by the pattern of statistical significances, discounting those which they judge to be type I errors and ignoring any biomarker where the p-value is greater than p = 0.05. However, by using standardised effect sizes (SESs) a range of graphical methods and an over-all assessment of the mean absolute response can be made. The approach is an extension, not a replacement of existing methods. It is intended to assist toxicologists and regulators in the interpretation of the results. Here, the SES analysis has been applied to data from nine published sub-acute toxicity tests in order to compare the findings with those of the author's. Line plots, box plots and bar plots show the pattern of response. Dose-response relationships are easily seen. A "bootstrap" test compares the mean absolute differences across dose groups. In four out of seven papers where the no observed adverse effect level (NOAEL) was estimated by the authors, it was set too high according to the bootstrap test, suggesting that possible toxicity is under-estimated.

Assessment of statistic analysis in non-radioisotopic local lymph node assay (non-RI-LLNA) with alpha-hexylcinnamic aldehyde as an example.

PubMed

Takeyoshi, Masahiro; Sawaki, Masakuni; Yamasaki, Kanji; Kimber, Ian

2003-09-30

The murine local lymph node assay (LLNA) is used for the identification of chemicals that have the potential to cause skin sensitization. However, it requires specific facility and handling procedures to accommodate a radioisotopic (RI) endpoint. We have developed non-radioisotopic (non-RI) endpoint of LLNA based on BrdU incorporation to avoid a use of RI. Although this alternative method appears viable in principle, it is somewhat less sensitive than the standard assay. In this study, we report investigations to determine the use of statistical analysis to improve the sensitivity of a non-RI LLNA procedure with alpha-hexylcinnamic aldehyde (HCA) in two separate experiments. Consequently, the alternative non-RI method required HCA concentrations of greater than 25% to elicit a positive response based on the criterion for classification as a skin sensitizer in the standard LLNA. Nevertheless, dose responses to HCA in the alternative method were consistent in both experiments and we examined whether the use of an endpoint based upon the statistical significance of induced changes in LNC turnover, rather than an SI of 3 or greater, might provide for additional sensitivity. The results reported here demonstrate that with HCA at least significant responses were, in each of two experiments, recorded following exposure of mice to 25% of HCA. These data suggest that this approach may be more satisfactory-at least when BrdU incorporation is measured. However, this modification of the LLNA is rather less sensitive than the standard method if employing statistical endpoint. Taken together the data reported here suggest that a modified LLNA in which BrdU is used in place of radioisotope incorporation shows some promise, but that in its present form, even with the use of a statistical endpoint, lacks some of the sensitivity of the standard method. The challenge is to develop strategies for further refinement of this approach.

Glucose, insulin and C-peptide secretion in obese and non obese women with polycystic ovarian disease.

PubMed

Mahabeer, S; Naidoo, C; Joubert, S M

1990-06-01

Plasma glucose, immunoreactive insulin (IRI) and C-peptide responses during oral glucose tolerance testing (OGTT) were evaluated in 10 non obese women with polycystic ovarian disease (NOB-PCOD) and 10 obese women with polycystic ovarian disease (OB-PCOD). Mean plasma glucose response at 120 minutes in OB-PCOD showed impaired glucose tolerance. Also in this group, 1 patient had frank diabetes mellitus, whilst 3 other patients had impaired glucose tolerance 1 NOB-PCOD patient had impaired glucose tolerance. Mean plasma glucose levels and mean incremental glucose areas were higher in the OB-PCOD at all time intervals and reached statistical significance at 60 and 90 minutes. Mean plasma IRI levels were also higher in OB-PCOD at all time intervals, and reached statistically significant higher levels at 0, 60 and 90 minutes. Mean serum C-peptide valves were also higher at all time intervals in OB-PCOD. The relationship between acanthosis nigricans, obesity and PCOD was also analysed. It is evident from this study that obesity has a significant negative impact on the overall carbohydrate status in women with PCOD.

CT-guided sternoclavicular joint injections: description of the procedure, reliability of imaging diagnosis, and short-term patient responses.

PubMed

Peterson, Cynthia K; Saupe, Nadja; Buck, Florian; Pfirrmann, Christian W A; Zanetti, Marco; Hodler, Juerg

2010-12-01

The purpose of this study was to evaluate pain relief 20 to 30 minutes after diagnostic or therapeutic injections into the sternoclavicular joint and to compare patient outcomes based on the CT diagnosis. Informed consent was obtained from each patient. Ethics approval was not required. Fifty patients who had CT-guided injections of corticosteroid and local anesthetic into their sternoclavicular joints were included in the study. Preinjection and 20- to 30-minute postinjection visual analog scale data were recorded and compared with the imaging findings agreed by consensus. Kappa statistics were calculated for the reliability of imaging diagnosis. The percentage of patients improving after joint injection was calculated, and the risk ratio comparing the response of patients with osteoarthritis to those without osteoarthritis was completed. The correlation between the severity of each patient's osteoarthritis and the pain response was calculated using Spearman's correlation coefficient. Sixty-six percent of the patients reported clinically significant pain reduction at between 20 and 30 minutes after injection. The proportion of patients with osteoarthritis who had a clinically significant response was 67% compared with 64% for patients who did not have osteoarthritis. This difference was not statistically or clinically significant. There was no correlation between the severity of osteoarthritis and the amount of pain reduction (r = 0.03). The reliability of imaging diagnosis was substantial. Two thirds of patients having sternoclavicular joint injections of corticosteroids and local anesthetics report clinically significant improvement regardless of the abnormalities detected on their CT images.

Responsiveness Comparison of the EQ-5D, PROMIS Global Health, and VR-12 Questionnaires in Knee Arthroscopy.

PubMed

Oak, Sameer R; Strnad, Gregory J; Bena, James; Farrow, Lutul D; Parker, Richard D; Jones, Morgan H; Spindler, Kurt P

2016-12-01

The EuroQol 5 dimensions questionnaire (EQ-5D), Patient-Reported Outcomes Measurement Information System (PROMIS) 10 Global Health, and Veterans RAND 12-Item Health Survey (VR-12) are generic patient-reported outcome (PRO) questionnaires that assess a patient's general health. In choosing a PRO to track general health status, it is necessary to consider which measure will be the most responsive to change after treatment. To date, no studies exist comparing responsiveness among the EQ-5D, PROMIS 10 Global Health, and the Veterans Rand 12-Item Health Survey (VR-12). To determine which of the generic PROs are most responsive internally and externally in the setting of knee arthroscopy. Cohort study (diagnosis); Level of evidence, 3. Fifty patients who underwent knee arthroscopy were surveyed preoperatively and a mean 3.6 months postoperatively, with 90% follow-up. PROs included the EQ-5D, EQ-5D visual analog scale, PROMIS 10 Global Health (PROMIS 10) physical and mental components, VR-12 physical and mental components, and the Knee injury and Osteoarthritis Outcome Score (KOOS)-pain subscale. Internal responsiveness was evaluated by performing paired t tests on the changes in measures and calculating 2 measures of effect size: Cohen d and standardized response mean (SRM). External responsiveness was evaluated by comparing Pearson correlation measures between the disease-specific reference KOOS-pain and generic PROs. For internal responsiveness, 3 PROs showed a statistically significant improvement in score after treatment (EQ-5D: +0.10 [95% CI, 0.06-0.15], VR-12 physical: +7.2 [95% CI, 4.0-10.4]), and PROMIS 10 physical: +4.4 [95% CI, 2.6-6.3]) and effect size statistics with moderate change (Cohen d and SRM, 0.5-0.8). Assessing external responsiveness, a high correlation with the disease-specific reference (KOOS-pain score) was found for EQ-5D (0.65), VR-12 physical (0.57), and PROMIS 10 physical (0.77). For both internal and external responsiveness, the EQ-5D, VR-12 physical, and PROMIS 10 physical showed significantly greater responsiveness compared with the other general PRO measures but no statistical differences among themselves. There is no statistical difference in internal or external responsiveness to change among the EQ-5D, VR-12 physical, and PROMIS 10 physical instruments. In tracking longitudinal patient health, researchers and administrators have the flexibility to choose any of the general PROs among the EQ-5D, VR-12 physical, and PROMIS 10 physical. We recommend that any study tracking PROs in knee arthroscopy include 1 of these generic instruments.

Efficiency of instant messaging applications in coordination of emergency calls for combat injuries: A pilot study.

PubMed

Eksert, Sami; Aşık, Mehmet Burak; Akay, Sinan; Keklikçi, Kenan; Aydın, Fevzi Nuri; Çoban, Mehmet; Kantemir, Ali; Güngör, Onur; Garip, Beyazıt; Turgut, Mustafa Suphi; Olcay, Kenan

2017-05-01

Coordination of an emergency response team is an important determinant of prompt treatment for combat injuries in hospitals. The authors hypothesized that instant messaging applications for smartphones could be appropriate tools for notifying emergency response team members. The objective of this study was to investigate the efficiency of a commercial instant messaging application (WhatsApp, Mountain View, CA) as a communication tool for the emergency team in a level-I trauma center. We retrospectively evaluated the messages in the instant messaging application group that was formed to coordinate responses to patients who suffered from combat injuries and who were transported to our hospital via helicopter during an 8-week period. We evaluated the response times, response time periods during or outside of work hours, and the differences in the response times of doctors, nurses, and technicians among the members of the emergency team to the team leader's initial message about the patients. A total of 510 emergency call messages pertaining to 17 combat injury emergency cases were logged. The median time of emergency response was 4.1 minutes, 6 minutes, and 5.3 minutes for doctors, nurses, and the other team members, respectively. The differences in these response times between the groups were statistically significant (p=0.03), with subgroup analyses revealing significant differences between doctors and nurses (p=0.038). However, no statistically significant differences were observed between the doctors and the technicians (p=0.19) or the nurses and the technicians (p=1.0). From the team leader's perspective, using this application reduced the workload and the time loss, and also encouraged the team. Instant messaging applications for smartphones can be efficient, easy-to-operate, and time-saving communication tools in the transfer of medical information and the coordination of emergency response team members in hospitals.

Predictive and Prognostic Implications of Variant Philadelphia Translocations in CML: Experience From a Tertiary Oncology Center in Southern India.

PubMed

Kanakasetty, Govind Babu; Kuntejowdahalli, Lakshmaiah; Thanky, Aditi Harsh; Dasappa, Lokanatha; Jacob, Linu Abraham; Mallekavu, Suresh Babu; Kumari, Prasanna

2017-01-01

Chronic myeloid leukemia (CML) is a myeloproliferative disorder characterized by Philadelphia (Ph) chromosome with classical t(9;22)(q34;q11) seen in up to 90% of cases. However 5% to 10% of patients who present with variant Ph translocations (vPh) have been an area of research for their significance in predicting response to various therapies including tyrosine kinase inhibitors as well as prognosticating survival outcomes for many years involving varied patient populations, with conflicting results. We retrospectively analyzed our data from January 2002 to December 2014. Patients with vPh in chronic phase of CML (CML-CP) were analyzed with respect to their demographic parameters, response to imatinib therapy, and survival and their data were compared with data of patients with classical Ph translocation (cPh). Of 615 patients diagnosed with CML-CP, 72 patients (11.7%) showed vPh. Most common chromosomes involved in these translocations were 14 (13.9%), 11 (12.5%), 19 (9.7%), and 7 (8.3%). Rates of complete hematological response, complete cytogenetic response, and major molecular response were not statistically different between the groups. At 5 years, event-free survival, failure-free survival, progression-free survival, and overall survival were 60% versus 67.9%, 62.7% versus 69.7%, 84.7% versus 92.1%, and 87.5% versus 92.4%, respectively, in vPh and cPh. The differences in survival were statistically not significant. To our knowledge, this is the largest series of variant translocations in CML-CP, pertaining to the Indian population. Our data suggest that the presence of vPh in CML has no significant effect in predicting response to imatinib as well as in prognosticating survival. Copyright © 2016 Elsevier Inc. All rights reserved.

Climatic and land-use driven change of runoff throughout Sweden

NASA Astrophysics Data System (ADS)

Worman, A. L. E.; Riml, J.; Lindstrom, G.

2015-12-01

Changes in runoff can be caused by climatic variations, land-use changes and water regulation. In this paper we propose a separation of the power spectral response of runoff in watersheds in terms of the product of the power spectra of precipitation and the impulse response function for the watershed. This allows a formal separation of the spectral response in climatic factors - the precipitation - from those of land-use change and regulation - the impulse response function. The latter function characterizes the surface water-groundwater interaction, stream network topology and open channel hydraulics. Based on daily data of digitalized hydro-climatological data from 1961, we constructed synthetic, but calibrated data of runoff from 1001 watersheds in Sweden. From spectral analysis of the data we found periodic fluctuations occurring on time scales of about a decade and a bi-annual peak. These multi-annual fluctuations could be statistically linked through the coherence spectra to climatic indices like the NAO, PDO, geostrophic wind velocity and sun spot numbers on common periods of 3,6 and 7,6 years. Such long-term fluctuations in runoff are not significantly affected by the land-use or regulation other than indirectly through impact on local hydro-climate. Based on a spectral separation of precipitation and impulse response function of the watersheds, we found that the intra-annual variation in runoff was primarily affected by the land-use change in 79 unregulated catchments with up to century-long time series of measured daily discharge. There is a statistically significant increasing slope of the catchments impulse response function for 63 of the 79 catchments and this suggest a significant hydrological effect of land-use practice in agriculture, urbanisation and forestry.

Germinal center texture entropy as possible indicator of humoral immune response: immunophysiology viewpoint.

PubMed

Pantic, Igor; Pantic, Senka

2012-10-01

In this article, we present the results indicating that spleen germinal center (GC) texture entropy determined by gray-level co-occurrence matrix (GLCM) method is related to humoral immune response. Spleen tissue was obtained from eight outbred male short-haired guinea pigs previously immunized by sheep red blood cells (SRBC). A total of 312 images from 39 germinal centers (156 GC light zone images and 156 GC dark zone images) were acquired and analyzed by GLCM method. Angular second moment, contrast, correlation, entropy, and inverse difference moment were calculated for each image. Humoral immune response to SRBC was measured using T cell-dependent antibody response (TDAR) assay. Statistically highly significant negative correlation was detected between light zone entropy and the number of TDAR plaque-forming cells (r (s) = -0.86, p < 0.01). The entropy decreased as the plaque-forming cells increased and vice versa. A statistically significant negative correlation was also detected between dark zone entropy values and the number of plaque-forming cells (r (s) = -0.69, p < 0.05). Germinal center texture entropy may be a powerful indicator of humoral immune response. This study is one of the first to point out the potential scientific value of GLCM image texture analysis in lymphoid tissue cytoarchitecture evaluation. Lymphoid tissue texture analysis could become an important and affordable addition to the conventional immunophysiology techniques.

The Impact of a Topical Sexual Enhancement Cream on the Female Sexual Response and Its Relationship to Clitoral Blood Flow.

PubMed

Pelekanos, Michael; Stofman, Guy M; Niren, Neil

2016-12-13

The aim of this investigation was to determine, through two Investigational Review Board (IRB)-approved studies, if a new topical vasodilating cream (NTVC; Life Science Enhancement Corporation, Pittsburgh PA) could improve female sexual response. Study I subjectively evaluated sexual female response as accessed by a modification of the Female Intervention Efficacy Index (FIEI). FIEI was developed at the University of California as an immediate outcome measure of medical intervention to treat female sexual dysfunction.1 In Study II, 10 randomly selected positive responders from Study I were subsequently analyzed objectively with clitoral plethysmography in order to determine the effect of the NTVC and placebo on blood flow.2 RESULTS: In the subjective Study I (81 patients ranging in age from 18 to 63), a positive response trend for the NTVC was demonstrated compared to the placebo. In the objective Study II, 10 randomly selected patients who responded positive in Study I were objectively evaluated for response of increased blood flow in the clitoris after application of both the NTVC and placebo. The clitoral blood flow was shown to have increased with statistical significance for the NTVC in all 10 patients compared to the placebo, with the NTVC exhibiting an average 69% increase in clitoral blood flow. The female sexual response is complex. In the subjective Study I, the NTVC demonstrated positive trends for enhanced lubrication, genital sensation, intercourse, and overall sexual experience. In the objective Study II, 10 of the positive subjective responders from Study I were randomly selected to evaluate their response to the NTVC compared to the placebo. This was done via Doppler plethysmography (DP). All 10 patients demonstrated a statistically significant response rate for increase in clitoral blood flow using the NTVC compared to the placebo, with an average blood flow increase of 69%. This portion of the investigation demonstrates a significant positive end organ response to the NTVC. The positive subjective trends combined with the significant and substantial increase in clitoral blood flow may result in enhanced female sexual satisfaction.

Hinged Capsulotomy – Does it Decrease Floaters After Yttrium Aluminum Garnet Laser Capsulotomy?

PubMed Central

Alipour, Fatemeh; Jabbarvand, Mahmoud; Hashemian, Hesam; Hosseini, Simindokht; Khodaparast, Mehdi

2015-01-01

Objectives: The objective was to compare conventional circular yttrium aluminum garnet (YAG) laser capsulotomy with hinged capsulotomy to manage posterior capsular opacification (PCO). Materials and Methods: This prospective, randomized clinical trial enrolled pseudophakic patients with visually significant posterior capsule opacification. Patients were randomized to undergo posterior YAG laser capsulotomy with either conventional circular technique or a new technique with an inferior hinge. At 1-month postoperatively, patients were asked if they had any annoying floaters and the responses were compared between groups. P < 0.05 was considered statistically significant. Results: A total of 83 patients were enrolled. Forty-three patients underwent hinged posterior YAG capsulotomy and 40 patients underwent routine circular capsulotomy. At 1-month postoperatively, there was a statistically significant decrease in annoying floaters in the group that underwent circular capsulotomy (P = 0.02). There was no statistically significant association in the total energy delivered (P = 0.4) or the number of spots (P = 0.2) and patient perception of annoying floaters. Conclusion: Hinged YAG capsulotomy was effective at decreasing the rate of floaters in patients with PCO. PMID:26180476

Hinged Capsulotomy--Does it Decrease Floaters After Yttrium Aluminum Garnet Laser Capsulotomy?

PubMed

Alipour, Fatemeh; Jabbarvand, Mahmoud; Hashemian, Hesam; Hosseini, Simindokht; Khodaparast, Mehdi

2015-01-01

The objective was to compare conventional circular yttrium aluminum garnet (YAG) laser capsulotomy with hinged capsulotomy to manage posterior capsular opacification (PCO). This prospective, randomized clinical trial enrolled pseudophakic patients with visually significant posterior capsule opacification. Patients were randomized to undergo posterior YAG laser capsulotomy with either conventional circular technique or a new technique with an inferior hinge. At 1-month postoperatively, patients were asked if they had any annoying floaters and the responses were compared between groups. P < 0.05 was considered statistically significant. A total of 83 patients were enrolled. Forty-three patients underwent hinged posterior YAG capsulotomy and 40 patients underwent routine circular capsulotomy. At 1-month postoperatively, there was a statistically significant decrease in annoying floaters in the group that underwent circular capsulotomy (P = 0.02). There was no statistically significant association in the total energy delivered (P = 0.4) or the number of spots (P = 0.2) and patient perception of annoying floaters. Hinged YAG capsulotomy was effective at decreasing the rate of floaters in patients with PCO.

A role for granulocyte-macrophage colony-stimulating factor in the regulation of CD8{sup +} T cell responses to rabies virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wanjalla, Celestine N.; Goldstein, Elizabeth F.; Wirblich, Christoph

2012-05-10

Inflammatory cytokines have a significant role in altering the innate and adaptive arms of immune responses. Here, we analyzed the effect of GM-CSF on a RABV-vaccine vector co-expressing HIV-1 Gag. To this end, we immunized mice with RABV expressing HIV-1 Gag and GM-CSF and analyzed the primary and recall CD8{sup +} T cell responses. We observed a statistically significant increase in antigen presenting cells (APCs) in the spleen and draining lymph nodes in response to GM-CSF. Despite the increase in APCs, the primary and memory anti HIV-1 CD8{sup +} T cell response was significantly lower. This was partly likely duemore » to lower levels of proliferation in the spleen. Animals treated with GM-CSF neutralizing antibodies restored the CD8{sup +} T cell response. These data define a role of GM-CSF expression, in the regulation of the CD8{sup +} T cell immune responses against RABV and has implications in the use of GM-CSF as a molecular adjuvant in vaccine development.« less

[Effect of consumption of bread with amaranth (Amaranthus dubius Mart. ex Thell.) on glycemic response and biochemical parameters in Sprague dawley rats].

PubMed

Montero-Quintero, Keyla Carolina; Moreno-Rojas, Rafael; Molina, Edgar Alí; Colina-Barriga, Máximo Segundo; Sánchez-Urdaneta, Adriana Beatriz

2014-11-01

The incorporation of functional ingredients like amaranth (Amaranthus dubius Mart. ex Thell.) in bread making is a strategy to increase fiber intake, which is associated with beneficial health effects, improving glycemic response and lipid profile. Thirty male Sprague dawley rats were randomized into three groups: diet of bread with 0% amaranth (PA0, control), diet of bread with 10% amaranth (PA10) and bread diet with 20% amaranth (PA20) for determining the feed intake, weight gain, triglyceride, total cholesterol, VLDL-C, LDL-C, HDL-C, protein and postprandial glycemic response. Data were analyzed using a completely randomized with 10 replications analysis, using the comparison test of Tukey for biochemical parameters. Postprandial glycemic response was analyzed by the method of repeated measures over time. The daily intake and weight gain was not affected (P>0.05) in the groups with PA10 and PA20. The concentration of glucose, triglycerides and protein showed statistically significant differences (P>0.05) by the difference in content of amaranth diets. The values of total cholesterol, LDL-C, and atherogenic risk factor index were statistically significant (P. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

Transcriptome profiling of a Saccharomyces cerevisiae mutant with a constitutively activated Ras/cAMP pathway.

PubMed

Jones, D L; Petty, J; Hoyle, D C; Hayes, A; Ragni, E; Popolo, L; Oliver, S G; Stateva, L I

2003-12-16

Often changes in gene expression levels have been considered significant only when above/below some arbitrarily chosen threshold. We investigated the effect of applying a purely statistical approach to microarray analysis and demonstrated that small changes in gene expression have biological significance. Whole genome microarray analysis of a pde2Delta mutant, constructed in the Saccharomyces cerevisiae reference strain FY23, revealed altered expression of approximately 11% of protein encoding genes. The mutant, characterized by constitutive activation of the Ras/cAMP pathway, has increased sensitivity to stress, reduced ability to assimilate nonfermentable carbon sources, and some cell wall integrity defects. Applying the Munich Information Centre for Protein Sequences (MIPS) functional categories revealed increased expression of genes related to ribosome biogenesis and downregulation of genes in the cell rescue, defense, cell death and aging category, suggesting a decreased response to stress conditions. A reduced level of gene expression in the unfolded protein response pathway (UPR) was observed. Cell wall genes whose expression was affected by this mutation were also identified. Several of the cAMP-responsive orphan genes, upon further investigation, revealed cell wall functions; others had previously unidentified phenotypes assigned to them. This investigation provides a statistical global transcriptome analysis of the cellular response to constitutive activation of the Ras/cAMP pathway.

Tacrolimus in the treatment of myasthenia gravis in patients with an inadequate response to glucocorticoid therapy: randomized, double-blind, placebo-controlled study conducted in China.

PubMed

Zhou, Lei; Liu, Weibin; Li, Wei; Li, Haifeng; Zhang, Xu; Shang, Huifang; Zhang, Xu; Bu, Bitao; Deng, Hui; Fang, Qi; Li, Jimei; Zhang, Hua; Song, Zhi; Ou, Changyi; Yan, Chuanzhu; Liu, Tao; Zhou, Hongyu; Bao, Jianhong; Lu, Jiahong; Shi, Huawei; Zhao, Chongbo

2017-09-01

To determine the efficacy of low-dose, immediate-release tacrolimus in patients with myasthenia gravis (MG) with inadequate response to glucocorticoid therapy in a randomized, double-blind, placebo-controlled study. Eligible patients had inadequate response to glucocorticoids (GCs) after ⩾6 weeks of treatment with prednisone ⩾0.75 mg/kg/day or 60-100 mg/day. Patients were randomized to receive 3 mg tacrolimus or placebo daily (orally) for 24 weeks. Concomitant glucocorticoids and pyridostigmine were allowed. Patients continued GC therapy from weeks 1-4; from week 5, the dose was decreased at the discretion of the investigator. The primary efficacy outcome measure was a reduction, relative to baseline, in quantitative myasthenia gravis (QMG) score assessed using a generalized linear model; supportive analyses used alternative models. Of 138 patients screened, 83 [tacrolimus ( n = 45); placebo ( n = 38)] were enrolled and treated. The change in adjusted mean QMG score from baseline to week 24 was -4.9 for tacrolimus and -3.3 for placebo (least squares mean difference: -1.7, 95% confidence interval: -3.5, -0.1; p = 0.067). A post-hoc analysis demonstrated a statistically significant difference for QMG score reduction of ⩾4 points in the tacrolimus group (68.2%) versus the placebo group (44.7%; p = 0.044). Adverse event profiles were similar between treatment groups. Tacrolimus 3 mg treatment for patients with MG and inadequate response to GCs did not demonstrate a statistically significant improvement in the primary endpoint versus placebo over 24 weeks; however, a post-hoc analysis demonstrated a statistically significant difference for QMG score reduction of ⩾4 points in the tacrolimus group versus the placebo group. This study was limited by the low number of patients, the absence of testing for acetylcholine receptor antibody and the absence of stratification by disease duration (which led to a disparity between the two groups). ClinicalTrials.gov identifier: NCT01325571.

A randomized clinical trial in subjects with dry mouth evaluating subjective perceptions of an experimental oral gel, an oral rinse and a mouth spray compared to water.

PubMed

Jose, Anto; Siddiqi, Muhammad; Cronin, Matthew; DiLauro, Thomas S; Bosma, Mary Lynn

2016-02-01

This multicenter, randomized, parallel group study analyzed the effectiveness of an experimental oral gel, a commercially available oral rinse and a commercially available mouth spray versus water alone at relieving self-reported symptoms of dry mouth over a 28-day home use treatment period. The effects of the study treatments on dry mouth-related quality of life (QoL) were also investigated. Eligible subjects were stratified by dry mouth severity (mild, moderate or severe) and randomized to receive one of the study treatments. Prior to first use they completed a questionnaire designed to assess their baseline dry mouth-related QoL. Following first use and on Day 8 (2 hours post-treatment only) and Day 29, subjects completed the modified Product Performance and Attributes Questionnaire (PPAQ) I at 0.5, 1, 2 and 4 hours post-treatment. Subjects further assessed treatment performance using the PPAQ II questionnaire on Days 8 and 29 and the dry mouth-related QoL questionnaire on Day 29. In 396 randomized subjects almost all comparisons of responses to PPAQ I, including those for the primary endpoint (response to PPAQ I Question 1 'Relieving the discomfort of dry mouth' after 2 hours on Day 29), were statistically significant in favor of active treatment groups versus water (P < 0.05). All comparisons of responses to PPAQ II on Days 8 and 29 were statistically significant in favor of active treatments versus water (P < 0.05). Moreover, nearly all comparisons for dry mouth-related QoL scores on Day 29 were statistically significant in favor of the active treatments versus water. All the dry mouth management strategies in this trial were well tolerated.

Cytokine Gene Expression in Response to SnSAG1 in Horses with Equine Protozoal Myeloencephalitis

PubMed Central

Spencer, Jennifer A.; Deinnocentes, Patricia; Moyana, Edith M.; Guarino, Anthony J.; Ellison, Siobhan E.; Bird, R. Curtis; Blagburn, Byron L.

2005-01-01

Equine protozoal myeloencephalitis (EPM) is a neurologic syndrome seen in horses from the Americas and is mainly caused by Sarcocystis neurona. Recently, a 29-kDa surface antigen from S. neurona merozoites was identified as being highly immunodominant on a Western blot. This antigen has been sequenced and cloned, and the expressed protein has been named SnSAG1. In a previous study, cell-mediated immune responses to SnSAG1 were shown to be statistically significantly reduced in horses with EPM in comparison to EPM-negative control horses. It therefore appears as though the parasite is able to induce immunosuppression towards parasite-derived antigens as parasite-specific responses are decreased. Isolated peripheral blood lymphocytes from 21 EPM (cerebrospinal fluid [CSF] Western blot)-negative horses with no clinical signs and 21 horses with clinical signs of EPM (CSF Western blot positive) were cocultured with SnSAG1 for 48 and 72 h, and the effect on cytokine production was investigated by means of reverse transcriptase PCR. Cytokines assayed include gamma interferon (IFN-γ), tumor necrosis factor alpha, interleukin (IL)-2, IL-4, and IL-6. β-Actin was used as the housekeeping gene. A Wilcoxon signed-rank test of the findings indicated that there was a statistically significant decrease in IFN-γ production after 48 h in culture for samples from horses with clinical disease. There was also a statistically significant increase in IL-4 production after 72 h in culture for samples from horses with EPM. These results further support the notion that this parasite is able to subvert the immune system in horses with clinical disease. PMID:15879026

Altered Cortical Responsiveness to Pain Stimuli after High Frequency Electrical Stimulation of the Skin in Patients with Persistent Pain after Inguinal Hernia Repair

PubMed Central

van den Broeke, Emanuel N.; Koeslag, Lonneke; Arendsen, Laura J.; Nienhuijs, Simon W.; Rosman, Camiel; van Rijn, Clementina M.; Wilder-Smith, Oliver H. G.; van Goor, Harry

2013-01-01

Background High Frequency electrical Stimulation (HFS) of the skin induces enhanced brain responsiveness expressed as enhanced Event-Related Potential (ERP) N1 amplitude to stimuli applied to the surrounding unconditioned skin in healthy volunteers. The aim of the present study was to investigate whether this enhanced ERP N1 amplitude could be a potential marker for altered cortical sensory processing in patients with persistent pain after surgery. Materials and Methods Nineteen male patients; 9 with and 10 without persistent pain after inguinal hernia repair received HFS. Before, directly after and thirty minutes after HFS evoked potentials and the subjective pain intensity were measured in response to electric pain stimuli applied to the surrounding unconditioned skin. Results The results show that, thirty minutes after HFS, the ERP N1 amplitude observed at the conditioned arm was statistically significantly larger than the amplitude at the control arm across all patients. No statistically significant differences were observed regarding ERP N1 amplitude between patients with and without persistent pain. However, thirty minutes after HFS we did observe statistically significant differences of P2 amplitude at the conditioned arm between the two groups. The P2 amplitude decreased in comparison to baseline in the group of patients with pain. Conclusion The ERP N1 effect, induced after HFS, was not different between patients with vs. without persistent pain. The decreasing P2 amplitude was not observed in the patients without pain and also not in the previous healthy volunteer study and thus might be a marker for altered cortical sensory processing in patients with persistent pain after surgery. PMID:24376568

Detection of short-term response of the low ionosphere on gamma ray bursts

NASA Astrophysics Data System (ADS)

Nina, Aleksandra; Simić, Saša.; Srećković, Vladimir A.; Popović, Luka Č.

2015-10-01

In this paper, we study the possibility of detection of short-term terrestrial lower ionospheric response to gamma ray bursts (GRBs) using a statistical analysis of perturbations of six very low or low-frequency (VLF/LF) radio signals emitted by transmitters located worldwide and recorded by VLF/LF receiver located in Belgrade (Serbia). We consider a sample of 54 short-lasting GRBs (shorter than 1 min) detected by the Swift satellite during the period 2009-2012. We find that a statistically significant perturbation can be present in the low ionosphere, and reactions on GRBs may be observed immediately after the beginning of the GRB event or with a time delay of 60 s-90 s.

Health assessment of gasoline and fuel oxygenate vapors: immunotoxicity evaluation.

PubMed

White, Kimber L; Peachee, Vanessa L; Armstrong, Sarah R; Twerdok, Lorraine E; Clark, Charles R; Schreiner, Ceinwen A

2014-11-01

Female Sprague Dawley rats were exposed via inhalation to vapor condensates of either gasoline or gasoline combined with various fuel oxygenates to assess potential immunotoxicity of evaporative emissions. Test articles included vapor condensates prepared from "baseline gasoline" (BGVC), or gasoline combined with methyl tertiary butyl ether (G/MTBE), ethyl t-butyl ether (G/ETBE), t-amyl methyl ether (G/TAME), diisopropyl ether (G/DIPE), ethanol (G/EtOH), or t-butyl alcohol (G/TBA). Target concentrations were 0, 2000, 10,000 or 20,000mg/mg(3) administered for 6h/day, 5days/week for 4weeks. The antibody-forming cell (AFC) response to the T-dependent antigen, sheep erythrocyte (sRBC), was used to determine the effects of the gasoline vapor condensates on the humoral components of the immune system. Exposure to BGVC, G/MTBE, G/TAME, and G/TBA did not result in significant changes in the IgM AFC response to sRBC, when evaluated as either specific activity (AFC/10(6) spleen cells) or as total spleen activity (AFC/spleen). Exposure to G/EtOH and G/DIPE resulted in a dose-dependent decrease in the AFC response, reaching the level of statistical significance only at the high 20,000mg/m(3) level. Exposure to G/ETBE resulted in a statistically significant decrease in the AFC response at the middle (10,000mg/m(3)) and high (20,000mg/m(3)) exposure concentrations. Copyright © 2014 Elsevier Inc. All rights reserved.

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Natural variation reveals relationships between pre-stress carbohydrate nutritional status and subsequent responses to xenobiotic and oxidative stress in Arabidopsis thaliana.

PubMed

Ramel, Fanny; Sulmon, Cécile; Gouesbet, Gwenola; Couée, Ivan

2009-12-01

Soluble sugars are involved in responses to stress, and act as signalling molecules that activate specific or hormone cross-talk transduction pathways. Thus, exogenous sucrose treatment efficiently induces tolerance to the herbicide atrazine in Arabidopsis thaliana plantlets, at least partially through large-scale modifications of expression of stress-related genes. Availability of sugars in planta for stress responses is likely to depend on complex dynamics of soluble sugar accumulation, sucrose-starch partition and organ allocation. The question of potential relationships between endogenous sugar levels and stress responses to atrazine treatment was investigated through analysis of natural genetic accessions of A. thaliana. Parallel quantitative and statistical analysis of biochemical parameters and of stress-sensitive physiological traits was carried out on a set of 11 accessions. Important natural variation was found between accessions of A. thaliana in pre-stress shoot endogenous sugar levels and responses of plantlets to subsequent atrazine stress. Moreover, consistent trends and statistically significant correlations were detected between specific endogenous sugar parameters, such as the pre-stress end of day sucrose level in shoots, and physiological markers of atrazine tolerance. These significant relationships between endogenous carbohydrate metabolism and stress response therefore point to an important integration of carbon nutritional status and induction of stress tolerance in plants. The specific correlation between pre-stress sucrose level and greater atrazine tolerance may reflect adaptive mechanisms that link sucrose accumulation, photosynthesis-related stress and sucrose induction of stress defences.

Complex patterns of response to oral hygiene instructions: longitudinal evaluation of periodontal patients.

PubMed

Amoo-Achampong, Felice; Vitunac, David E; Deeley, Kathleen; Modesto, Adriana; Vieira, Alexandre R

2018-05-02

Oral hygiene instruction is an intervention widely practiced but increased knowledge about oral health does not necessarily dramatically impact oral disease prevalence in populations. We aimed to measure plaque and bleeding in periodontal patients over time to determine patterns of patient response to oral hygiene instructions. Longitudinal plaque and bleeding index data were evaluated in 227 periodontal patients to determine the impact of oral hygiene instructions. Over multiple visits, we determined relative plaque accumulation and gingival bleeding for each patient. Subsequently, we grouped them in three types of oral hygiene status in response to initial instructions, using the longitudinal data over the period they were treated and followed for their periodontal needs. These patterns of oral hygiene based on the plaque and gingival bleeding indexes were evaluated based on age, sex, ethnic background, interleukin 1 alpha and beta genotypes, diabetes status, smoking habits, and other concomitant diseases. Chi-square and Fisher's exact tests were used to determine if any differences between these variables were statistically significant with alpha set at 0.05. Three patterns in response to oral hygiene instructions emerged. Plaque and gingival bleeding indexes improved, worsened, or fluctuated over time in the periodontal patients studied. Out of all the confounders considered, only ethnic background showed statistically significant differences. White individuals more often than other ethnic groups fluctuated in regards to oral hygiene quality after instructions. There are different responses to professional oral hygiene instructions. These responses may be related to ethnicity.

Efficacy and Physicochemical Evaluation of an Optimized Semisolid Formulation of Povidone Iodine Proposed by Extreme Vertices Statistical Design; a Practical Approach

PubMed Central

Lotfipour, Farzaneh; Valizadeh, Hadi; Shademan, Shahin; Monajjemzadeh, Farnaz

2015-01-01

One of the most significant issues in pharmaceutical industries, prior to commercialization of a pharmaceutical preparation is the "preformulation" stage. However, far too attention has been paid to verification of the software assisted statistical designs in preformulation studies. The main aim of this study was to report a step by step preformulation approach for a semisolid preparation based on a statistical mixture design and to verify the predictions made by the software with an in-vitro efficacy bioassay test. Extreme vertices mixture design (4 factors, 4 levels) was applied for preformulation of a semisolid Povidone Iodine preparation as Water removable ointment using different PolyEthylenGlycoles. Software Assisted (Minitab) analysis was then performed using four practically assessed response values including; Available iodine, viscosity (N index and yield value) and water absorption capacity. Subsequently mixture analysis was performed and finally, an optimized formulation was proposed. The efficacy of this formulation was bio-assayed using microbial tests in-vitro and MIC values were calculated for Escherichia coli, pseudomonaaeruginosa, staphylococcus aureus and Candida albicans. Results indicated the acceptable conformity of the measured responses. Thus, it can be concluded that the proposed design had an adequate power to predict the responses in practice. Stability studies, proved no significant change during the one year study for the optimized formulation. Efficacy was eligible on all tested species and in the case of staphylococcus aureus; the prepared semisolid formulation was even more effective. PMID:26664368

Stochastic dynamic analysis of marine risers considering Gaussian system uncertainties

NASA Astrophysics Data System (ADS)

Ni, Pinghe; Li, Jun; Hao, Hong; Xia, Yong

2018-03-01

This paper performs the stochastic dynamic response analysis of marine risers with material uncertainties, i.e. in the mass density and elastic modulus, by using Stochastic Finite Element Method (SFEM) and model reduction technique. These uncertainties are assumed having Gaussian distributions. The random mass density and elastic modulus are represented by using the Karhunen-Loève (KL) expansion. The Polynomial Chaos (PC) expansion is adopted to represent the vibration response because the covariance of the output is unknown. Model reduction based on the Iterated Improved Reduced System (IIRS) technique is applied to eliminate the PC coefficients of the slave degrees of freedom to reduce the dimension of the stochastic system. Monte Carlo Simulation (MCS) is conducted to obtain the reference response statistics. Two numerical examples are studied in this paper. The response statistics from the proposed approach are compared with those from MCS. It is noted that the computational time is significantly reduced while the accuracy is kept. The results demonstrate the efficiency of the proposed approach for stochastic dynamic response analysis of marine risers.

Psychosocial Predictors for Cancer Prevention Behaviors in Workplace Using Protection Motivation Theory.

PubMed

Zare Sakhvidi, Mohammad Javad; Zare, Maryam; Mostaghaci, Mehrdad; Mehrparvar, Amir Houshang; Morowatisharifabad, Mohammad Ali; Naghshineh, Elham

2015-01-01

Backgrounds. The aim of this study was to describe the preventive behaviors of industrial workers and factors influencing occupational cancer prevention behaviors using protection motivation theory. Methods. A self-administered questionnaire was completed by 161 petrochemical workers in Iran in 2014 which consisted of three sections: background information, protection motivation theory measures, and occupational cancers preventive behaviors. Results. A statistically significant positive correlation was found between PM and self-efficacy, response efficacy, and the cancer preventive behaviors. Meanwhile, statistically significant negative correlations were found between PM, cost, and reward. Conclusions. Among available PMT constructs, only self-efficacy and cost were significant predictors of preventive behaviors. Protection motivation model based health promotion interventions with focus on self-efficacy and cost would be desirable in the case of occupational cancers prevention.

Psychosocial Predictors for Cancer Prevention Behaviors in Workplace Using Protection Motivation Theory

PubMed Central

Zare Sakhvidi, Mohammad Javad; Zare, Maryam; Mehrparvar, Amir Houshang; Morowatisharifabad, Mohammad Ali; Naghshineh, Elham

2015-01-01

Backgrounds. The aim of this study was to describe the preventive behaviors of industrial workers and factors influencing occupational cancer prevention behaviors using protection motivation theory. Methods. A self-administered questionnaire was completed by 161 petrochemical workers in Iran in 2014 which consisted of three sections: background information, protection motivation theory measures, and occupational cancers preventive behaviors. Results. A statistically significant positive correlation was found between PM and self-efficacy, response efficacy, and the cancer preventive behaviors. Meanwhile, statistically significant negative correlations were found between PM, cost, and reward. Conclusions. Among available PMT constructs, only self-efficacy and cost were significant predictors of preventive behaviors. Protection motivation model based health promotion interventions with focus on self-efficacy and cost would be desirable in the case of occupational cancers prevention. PMID:26543649

Cognitive and Behavioral Treatments of Agoraphobia: Clinical, Behavioral, and Psychophysiological Outcomes.

ERIC Educational Resources Information Center

Michelson, Larry; And Others

1985-01-01

Agoraphobics (N=37) were randomly assigned to one of three cognitive-behavioral treatments: paradoxical intention, graduated exposure, or progressive deep muscle relaxation training. Results of follow-up analyses revealed statistically significant differences across treatments, tripartite response systems, and assessment phases. (Author/BL)

Empirical Evaluation of Visual Fatigue from Display Alignment Errors Using Cerebral Hemodynamic Responses

PubMed Central

Wiyor, Hanniebey D.; Ntuen, Celestine A.

2013-01-01

The purpose of this study was to investigate the effect of stereoscopic display alignment errors on visual fatigue and prefrontal cortical tissue hemodynamic responses. We collected hemodynamic data and perceptual ratings of visual fatigue while participants performed visual display tasks on 8 ft × 6 ft NEC LT silver screen with NEC LT 245 DLP projectors. There was statistical significant difference between subjective measures of visual fatigue before air traffic control task (BATC) and after air traffic control task (ATC 3), (P < 0.05). Statistical significance was observed between left dorsolateral prefrontal cortex oxygenated hemoglobin (l DLPFC-HbO2), left dorsolateral prefrontal cortex deoxygenated hemoglobin (l DLPFC-Hbb), and right dorsolateral prefrontal cortex deoxygenated hemoglobin (r DLPFC-Hbb) on stereoscopic alignment errors (P < 0.05). Thus, cortical tissue oxygenation requirement in the left hemisphere indicates that the effect of visual fatigue is more pronounced in the left dorsolateral prefrontal cortex. PMID:27006917

Improving Project Performance through Implementation of Agile Methodologies in the Renewable Energy Construction Industry

NASA Astrophysics Data System (ADS)

Hernandez Mendez, Arturo

Collaborative inquiry within undergraduate research experiences (UREs) is an effective curriculum tool to support student growth. This study seeks to understand how collaborative inquiry within undergraduate biology student experiences are affected within faculty mentored experiences and non-mentored experiences at a large private southeastern university. Undergraduate biology students engaged in UREs (faculty as mentor and non-mentor experiences) were examined for statistically significant differences in student self-efficacy. Self-efficacy was measured in three subcomponents (thinking and working like a scientist, scientific self-efficacy, and scientific identity) from student responses obtained in an online survey. Responses were analyzed using a nonparametric equivalent of a t test (Mann Whitney U test) to make comparisons between faculty mentored and non-mentored student groups. The conclusions of this study highlight the statistically significant effect of faculty mentoring in all three subcomponents. Faculty and university policy makers can apply these findings to develop further support for effective faculty mentoring practices in UREs.

The relationship between procrastination, learning strategies and statistics anxiety among Iranian college students: a canonical correlation analysis.

PubMed

Vahedi, Shahrum; Farrokhi, Farahman; Gahramani, Farahnaz; Issazadegan, Ali

2012-01-01

Approximately 66-80%of graduate students experience statistics anxiety and some researchers propose that many students identify statistics courses as the most anxiety-inducing courses in their academic curriculums. As such, it is likely that statistics anxiety is, in part, responsible for many students delaying enrollment in these courses for as long as possible. This paper proposes a canonical model by treating academic procrastination (AP), learning strategies (LS) as predictor variables and statistics anxiety (SA) as explained variables. A questionnaire survey was used for data collection and 246-college female student participated in this study. To examine the mutually independent relations between procrastination, learning strategies and statistics anxiety variables, a canonical correlation analysis was computed. Findings show that two canonical functions were statistically significant. The set of variables (metacognitive self-regulation, source management, preparing homework, preparing for test and preparing term papers) helped predict changes of statistics anxiety with respect to fearful behavior, Attitude towards math and class, Performance, but not Anxiety. These findings could be used in educational and psychological interventions in the context of statistics anxiety reduction.

Effect of interleukin-10 gene promoter polymorphisms -1082 G/A and -592 C/A on response to therapy in children and adolescents with chronic hepatitis C virus infection.

PubMed

El-Karaksy, Hanaa M; Sharaf, Sahar A; Mandour, Iman A; Mogahed, Engy A; Rady, Normeen H; El-Mougy, Fatma A

2016-12-01

Studying predictors of response to therapy for hepatitis C virus (HCV) infection in children may help avoid the inappropriate use of currently available costly therapy associated with numerous adverse effects. We tested the hypothesis that inheritance of single nucleotide polymorphisms (SNPs) of the interleukin-10 (IL-10) promoter gene might influence response to HCV treatment. The impact of SNPs, -1082 G/A and -592 C/A, in the promoter region of IL-10 gene, on response to HCV therapy was assessed in a cohort of 40 children treated with a combination of pegylated interferon (Peg-IFN) α2b and ribavirin. Sustained virological response was achieved in 48.7%. High viral load was associated with non-response to therapy. There was no association between histopathological degree of inflammation or fibrosis and response to therapy. There was no direct statistically significant association between polymorphisms in the IL-10 gene (-1082G/A and -592 C/A) as regards inflammation or response to therapy in children. As for the SNP -592 C/A; there was a statistically significant association with the score of fibrosis (P<0.004), concluding that the A allele was protective from moderate and severe fibrosis. Meanwhile the SNP -1082G/A did not show any association with the fibrosis score. We could not associate response to therapy for HCV with IL-10 polymorphisms -1082 G/A and -592 C/A. For the SNP -592 C/A, the A allele protected from moderate and severe fibrosis. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

Optimization of interferon gamma ELISPOT assay to detect human cytomegalovirus specific T-cell responses in solid organ transplants.

PubMed

Abate, Davide; Saldan, Alda; Forner, Gabriella; Tinto, Daniel; Bianchin, Alice; Palù, Giorgio

2014-02-01

Assessing the CMV specific CMI in transplant subjects represents a promising strategy to determine the risk of infection on individual basis. In this study 61 adult CMV IgG seropositive solid organ transplant recipients were examined in order to improve the efficacy of CMI detection. For this purpose, pair-wise comparisons were conducted comparing positive control stimuli PWM and PMA/iono and CMV stimuli, pp65 peptide pool and whole CMV particle. Rosette pre-depletion of blood was also investigated for detecting CD4+ or CD8+ T-cell responses using the IFN-g ELISPOT assay. In the time-points 30-180 days after transplantation, PMA/iono produced statistically significant higher responses compared to PWM, probably because PMA/iono activation pathway is independent from the effect of immunosuppressive drugs. The data showed that 11% of transplant patients displayed very low or undetectable responses to pp65 peptide pool antigen while having sustained high responses to whole CMV particle. In addition, in all the subjects analyzed, CMI responses to CMV particle produced a statistically significant higher number of spots compared to pp65 peptide pool antigen. Rosette pre-depletion of whole blood proved to be effective in detecting CD4+ or CD8+ T-cell responses similarly to flow cytometry. Taken together, the following recommendations are suggested to optimize the CMV-ELISPOT for transplantation settings: (1) use PMA/iono as positive control; (2) whole virus particle should be used to avoid peptide-related false negative responses; (3) a rosette pre-depletion step may be useful to detect CD4+ or CD8+ T-cell responses. Copyright © 2013 Elsevier B.V. All rights reserved.

Does the increasing placebo response impact outcomes of adult and pediatric ADHD clinical trials? Data from the US Food and Drug Administration 2000-2009.

PubMed

Khan, Arif; Fahl Mar, Kaysee; Brown, Walter A

2017-11-01

In a study of recent antidepressant clinical trial data, it was found placebo response had grown significantly over time and that contrary to expectations, trial outcome measures and success rate were not impacted. The aim of this paper was to evaluate if this trend of increasing placebo response and stable outcome measures could be seen in clinical trial data for Attention-Deficit Hyperactivity Disorder, a different psychiatric condition with susceptibility to placebo response. For this reason, we evaluated efficacy data reported in the FDA Medical and Statistical reviews for 10 ADHD medication programs (4917 patients, 17 trials, 29 treatment arms). Placebo and medication response were measured as percent symptom reduction and effect sizes and drug-placebo differences were calculated for each treatment arm and analyzed in relation to year of approval. We also investigated the potential role of age and medication class on trends and outcomes. Results showed a similar pattern to antidepressants wherein the placebo response is rising significantly over time (r = 0.636, p = 0.006) and effect size (r < 0.0001, p = 1.0), drug-placebo difference (r = -0.238, p = 0.214), and success rate (28/29 97%) have remained unaffected, likely due to a parallel, although not statistically significant increase in medication response (r = 0.326, p = 0.085). Age and medication class did not alter these observed time trends but pediatric trials and stimulants were found to have more robust treatment effects than adult trials and non-stimulants. The results of this study suggest that like antidepressants, the relationship between placebo response and the outcomes of ADHD clinical trials is weak at best. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Association of ED with chronic periodontal disease.

PubMed

Matsumoto, S; Matsuda, M; Takekawa, M; Okada, M; Hashizume, K; Wada, N; Hori, J; Tamaki, G; Kita, M; Iwata, T; Kakizaki, H

2014-01-01

To examine the relationship between chronic periodontal disease (CPD) and ED, the interview sheet including the CPD self-checklist (CPD score) and the five-item version of the International Index of Erectile Function (IIEF-5) was distributed to 300 adult men who received a comprehensive dental examination. Statistical analyses were performed by the Spearman's rank correlation coefficient and other methods. Statistical significance was accepted at the level of P<0.05. The interview sheets were collected from 88 men (response rate 29.3%, 50.9±16.6 years old). There was a statistically significant correlation between the CPD score and the presence of ED (P=0.0415). The results in the present study suggest that ED is related to the damage caused by endothelial dysfunction and the systematic inflammatory changes associated with CPD. The present study also suggests that dental health is important as a preventive medicine for ED.

Brain responses to verbal stimuli among multiple sclerosis patients with pseudobulbar affect.

PubMed

Haiman, Guy; Pratt, Hillel; Miller, Ariel

2008-08-15

To characterize the brain activity and associated cortical structures involved in pseudobulbar affect (PBA), a condition characterized by uncontrollable episodes of emotional lability in patients with multiple sclerosis (MS). Behavioral responses and event related potentials (ERP) in response to subjectively significant and neutral verbal stimuli were recorded from 33 subjects in 3 groups: 1) MS patients with PBA (MS+PBA); 2) MS patients without PBA (MS); 3) Healthy control subjects (HC). Statistical non-parametric mapping comparisons of ERP source current density distributions between groups were conducted separately for subjectively significant and for neutral stimuli. Behavioral responses showed more impulsive performance in patients with PBA. As expected, almost all ERP waveform comparisons between the MS groups and controls were significant. Source analysis indicated significantly distinct activation in MS+PBA in the vicinity of the somatosensory and motor areas in response to neutral stimuli, and at pre-motor and supplementary motor areas in response to subjectively significant stimuli. Both subjectively significant and neutral stimuli evoked higher current density in MS+PBA compared to both other groups. PBA of MS patients involves cortical structures related to sensory-motor and emotional processing, in addition to overactive involvement of motor cortical areas in response to neutral stimuli. These results may suggest that a 'disinhibition' of a "gate control"-type mechanism for emotional expression may lead to the lower emotional expression threshold of pseudobulbar affect.

Main outcomes of an RCT to pilot test reporting and feedback to foster research integrity climates in the VA.

PubMed

Martinson, Brian C; Mohr, David C; Charns, Martin P; Nelson, David; Hagel-Campbell, Emily; Bangerter, Ann; Bloomfield, Hanna E; Owen, Richard; Thrush, Carol R

2017-01-01

Assessing the integrity of research climates and sharing such information with research leaders may support research best practices. We report here results of a pilot trial testing the effectiveness of a reporting and feedback intervention using the Survey of Organizational Research Climate (SOuRCe). We randomized 41 Veterans Health Administration (VA) facilities to a phone-based intervention designed to help research leaders understand their survey results (enhanced arm) or to an intervention in which results were simply distributed to research leaders (basic arm). Primary outcomes were (1) whether leaders took action, (2) whether actions taken were consistent with the feedback received, and (3) whether responses differed by receptivity to quality improvement input. Research leaders from 25 of 42 (59%) VA facilities consented to participate in the study intervention and follow-up, of which 14 were at facilities randomized to the enhanced arm. We completed follow-up interviews with 21 of the 25 leaders (88%), 12 from enhanced arm facilities. While not statistically significant, the proportion of leaders reporting taking some action in response to the feedback was twice as high in the enhanced arm than in the basic arm (67% vs. 33%, p = .20). While also not statistically significant, a higher proportion of actions taken among facilities in the enhanced arm were responsive to the survey results than in the basic arm (42% vs. 22%, p = .64). Enhanced feedback of survey results appears to be a promising intervention that may increase the likelihood of responsive action to improve organizational climates. Due to the small sample size of this pilot study, even large percentage-point differences between study arms are not statistically distinguishable. This hypothesis should be tested in a larger trial.

An Assessment of Organizational Health Literacy Practices at an Academic Health Center.

PubMed

Prince, Latrina Y; Schmidtke, Carsten; Beck, Jules K; Hadden, Kristie B

Organizational health literacy is the degree to which an organization considers and promotes the health literacy of patients. Addressing health literacy at an organizational level has the potential to have a greater impact on more health consumers in a health system than individual-level approaches. The purpose of this study was to assess health care practices at an academic health center using the 10 attributes of a health-literate health care organization. Using a survey research design, the Health Literate Healthcare Organization 10-Item Questionnaire was administered online using total population sampling. Employees (N = 10 300) rated the extent that their organization's health care practices consider and promote patients' health literacy. Differences in responses were assessed using factorial analysis of variance. The mean response was 4.7 on a 7-point Likert scale. Employee training and communication about costs received the lowest ratings. Univariate analyses revealed that there were no statistically significant differences (P = .05) by employees' health profession, years of service, or level of patient contact. There were statistically significant differences by highest education obtained with lowest ratings from employees with college degrees. Survey responses indicate a need for improvements in health care practices to better assist patients with inadequate health literacy.

Effects of inbreeding on potential and realized immune responses in Tenebrio molitor.

PubMed

Rantala, Markus J; Viitaniemi, Heidi; Roff, Derek A

2011-06-01

Although numerous studies on vertebrates suggest that inbreeding reduces their resistance against parasites and pathogens, studies in insects have found contradictory evidence. In this study we tested the effect of 1 generation of brother-sister mating (inbreeding) on potential and realized immune responses and other life-history traits in Tenebrio molitor. We found that inbreeding reduced adult mass, pre-adult survival and increased development time, suggesting that inbreeding reduced the condition of the adults and thus potentially made them more susceptible to physiological stress. However, we found no significant effect of inbreeding on the potential immune response (encapsulation response), but inbreeding reduced the realized immune response (resistance against the entomopathogenic fungi, Beauveria bassiana). There was a significant family effect on encapsulation response, but no family effect on the resistance against the entomopathogenic fungi. Given that this latter trait showed significant inbreeding depression and that the sample size for the family-effect analysis was small it is likely that the lack of a significant family effect is due to reduced statistical power, rather than the lack of a heritable basis to the trait. Our study highlights the importance of using pathogens and parasites in immunoecological studies.

Vedolizumab Compared with Certolizumab in the Therapy of Crohn Disease: A Systematic Review and Indirect Comparison.

PubMed

Kawalec, Paweł; Moćko, Pawel; Pilc, Andrzej; Radziwon-Zalewska, Maria; Malinowska-Lipień, Iwona

2016-08-01

The increasing prevalence of Crohn disease (CD) underscores the need to identify new effective drugs, which is particularly important for patients who do not respond or do not tolerate standard biologic therapies. The purpose of this analysis was to compare the efficacy and safety of vedolizumab and certolizumab pegol in patients with active moderate to severe CD. This analysis was prepared according to the Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines. A systematic literature search of Medline (PubMed), Embase, and the Cochrane Library was conducted through March 5, 2016. Studies included were randomized controlled trials (RCTs) that enrolled patients treated for CD with vedolizumab or certolizumab pegol. All studies were critically appraised; indirect comparison was performed with the Bucher method. Eight RCTs were identified, and four were homogeneous enough to be included in the indirect comparison of the induction phase of treatment. No statistically significant differences were found in clinical response (relative risk [RR] 1.23, 95% confidence interval [CI] 0.81-1.88) or remission (RR 1.35, 95% CI 0.89-2.07) between vedolizumab and certolizumab pegol in the overall population. Similar nonstatistically significant differences in response and remission were noted in a subgroup analysis of anti-tumor necrosis factor-naive patients (RR 1.10, 95% CI 0.72-1.66 and RR 1.98, 95% CI 0.95-4.11, respectively). In addition, there were no statistically significant differences in safety profiles. This indirect comparison analysis demonstrated no statistically significant differences in efficacy and safety between vedolizumab and certolizumab pegol. © 2016 Pharmacotherapy Publications, Inc.

Functional differences between statistical learning with and without explicit training

PubMed Central

Reber, Paul J.; Paller, Ken A.

2015-01-01

Humans are capable of rapidly extracting regularities from environmental input, a process known as statistical learning. This type of learning typically occurs automatically, through passive exposure to environmental input. The presumed function of statistical learning is to optimize processing, allowing the brain to more accurately predict and prepare for incoming input. In this study, we ask whether the function of statistical learning may be enhanced through supplementary explicit training, in which underlying regularities are explicitly taught rather than simply abstracted through exposure. Learners were randomly assigned either to an explicit group or an implicit group. All learners were exposed to a continuous stream of repeating nonsense words. Prior to this implicit training, learners in the explicit group received supplementary explicit training on the nonsense words. Statistical learning was assessed through a speeded reaction-time (RT) task, which measured the extent to which learners used acquired statistical knowledge to optimize online processing. Both RTs and brain potentials revealed significant differences in online processing as a function of training condition. RTs showed a crossover interaction; responses in the explicit group were faster to predictable targets and marginally slower to less predictable targets relative to responses in the implicit group. P300 potentials to predictable targets were larger in the explicit group than in the implicit group, suggesting greater recruitment of controlled, effortful processes. Taken together, these results suggest that information abstracted through passive exposure during statistical learning may be processed more automatically and with less effort than information that is acquired explicitly. PMID:26472644

Assessing groundwater vulnerability to agrichemical contamination in the Midwest US

USGS Publications Warehouse

Burkart, M.R.; Kolpin, D.W.; James, D.E.

1999-01-01

Agrichemicals (herbicides and nitrate) are significant sources of diffuse pollution to groundwater. Indirect methods are needed to assess the potential for groundwater contamination by diffuse sources because groundwater monitoring is too costly to adequately define the geographic extent of contamination at a regional or national scale. This paper presents examples of the application of statistical, overlay and index, and process-based modeling methods for groundwater vulnerability assessments to a variety of data from the Midwest U.S. The principles for vulnerability assessment include both intrinsic (pedologic, climatologic, and hydrogeologic factors) and specific (contaminant and other anthropogenic factors) vulnerability of a location. Statistical methods use the frequency of contaminant occurrence, contaminant concentration, or contamination probability as a response variable. Statistical assessments are useful for defining the relations among explanatory and response variables whether they define intrinsic or specific vulnerability. Multivariate statistical analyses are useful for ranking variables critical to estimating water quality responses of interest. Overlay and index methods involve intersecting maps of intrinsic and specific vulnerability properties and indexing the variables by applying appropriate weights. Deterministic models use process-based equations to simulate contaminant transport and are distinguished from the other methods in their potential to predict contaminant transport in both space and time. An example of a one-dimensional leaching model linked to a geographic information system (GIS) to define a regional metamodel for contamination in the Midwest is included.

Impact of CYP2D6 polymorphisms on clinical efficacy & tolerability of metoprolol tartrate

PubMed Central

Hamadeh, Issam S.; Langaee, Taimour Y.; Dwivedi, Ruti; Garcia, Sofia; Burkley, Ben M.; Chapman, Arlene B.; Gums, John G.; Turner, Stephen T.; Gong, Yan; Cooper-DeHoff, Rhonda M.; Johnson, Julie A.

2014-01-01

Metoprolol is a selective β-1 adrenergic receptor blocker that undergoes extensive metabolism by the polymorphic enzyme, CYP2D6. Our objective was to investigate the influence of CYP2D6 polymorphisms on efficacy and tolerability of metoprolol tartrate. 281 study participants with uncomplicated hypertension received 50 mg of metoprolol twice daily followed by response guided titration to 100 mg twice daily. Phenotypes were assigned based on results of CYP2D6 genotyping and copy number variation assays. Clinical response to metoprolol and adverse effect rates were analyzed in relation to CYP2D6 phenotypes by using appropriate statistical tests. Heart rate response differed significantly by CYP2D6 phenotype (p-value <0.0001) with poor metabolizers & intermediate metabolizers showing greater HR reduction. However, blood pressure response and adverse effect rates were not significantly different by CYP2D6 phenotype. Other than a significant difference in heart rate response, CYP2D6 polymorphisms were not a determinant of the variability in response or tolerability to metoprolol. PMID:24637943

Evaluation of salivary fluoride retention from a new high fluoride mouthrinse.

PubMed

Mason, Stephen C; Shirodaria, Soha; Sufi, Farzana; Rees, Gareth D; Birkhed, Dowen

2010-11-01

To evaluate salivary fluoride retention from a new high fluoride daily use mouthrinse over a 120 min period. Sixteen subjects completed a randomised single-blind, four-treatment cross-over trial. Sensodyne® Pronamel® mouthrinse (A) contained 450 ppm fluoride; reference products were Colgate® Fluorigard® (B), Listerine® Total Care (C) and Listerine Softmint Sensation (D) containing 225, 100 and 0 ppm fluoride respectively. Salivary fluoride retention was monitored ex vivo after a single supervised use of test product (10 mL, 60 s). Samples were collected at 0, 1, 3, 5, 15, 30, 60 and 120 min post-rinse, generating fluoride clearance curves from which the area under the curve (AUC) was calculated. Differences in salivary fluoride concentrations for each product were analysed using ANCOVA at each time point using a 5% significance level, as well as lnAUC for the periods 0-120, 0-1, 1-15, 15-60 and 60-120 min. Pairwise comparisons between all treatment groups were performed. Salivary fluoride levels for A-C peaked immediately following use. Fluoride levels were statistically significantly higher for A versus B-D (p≤ 0.004), linear dose responses were apparent. AUC(0-120) was statistically significantly greater for A than for B (p = 0.035), C (p< 0.0001) and D (p< 0.0001). Post-hoc comparisons of lnAUC for the remaining time domains showed fluoride retention from A was statistically significantly greater versus B-D (p< 0.0001). Single-use treatment with the new mouthrinse containing 450 ppm fluoride resulted in statistically significantly higher salivary fluoride levels throughout the 120 min test period. Total fluoride retention (AUC(0-120)) was also statistically significantly greater versus comparator rinse treatments. Copyright © 2010 Elsevier Ltd. All rights reserved.

VEMP responses are not affected in non-insulin-dependent diabetes mellitus patients with or without polyneuropathy.

PubMed

Bektas, Devrim; Gazioglu, Sibel; Arslan, Selcuk; Cobanoglu, Bengu; Boz, Cavit; Caylan, Refik

2008-07-01

Vestibular evoked myogenic responses (VEMPs) are not affected in non-insulin-dependent diabetes mellitus (NIDDM) patients with or without polyneuropathy. To compare VEMP responses of NIDDM patients and healthy subjects. VEMP responses were collected from 25 NIDDM patients with polyneuropathy (PNP), 13 NIDDM patients without PNP and 21 healthy subjects using click stimulation. After excluding ears with hearing loss (HL) (worse than 25 dB) the VEMP responses (p13 and n21 latencies and amplitude) recorded in 105 dB stimulus intensity were compared. There was no statistically significant difference between groups. VEMP responses were found to be normal in NIDDM patients with or without PNP.

Do code of conduct audits improve chemical safety in garment factories? Lessons on corporate social responsibility in the supply chain from Fair Wear Foundation.

PubMed

Lindholm, Henrik; Egels-Zandén, Niklas; Rudén, Christina

2016-10-01

In managing chemical risks to the environment and human health in supply chains, voluntary corporate social responsibility (CSR) measures, such as auditing code of conduct compliance, play an important role. To examine how well suppliers' chemical health and safety performance complies with buyers' CSR policies and whether audited factories improve their performance. CSR audits (n = 288) of garment factories conducted by Fair Wear Foundation (FWF), an independent non-profit organization, were analyzed using descriptive statistics and statistical modeling. Forty-three per cent of factories did not comply with the FWF code of conduct, i.e. received remarks on chemical safety. Only among factories audited 10 or more times was there a significant increase in the number of factories receiving no remarks. Compliance with chemical safety requirements in garment supply chains is low and auditing is statistically correlated with improvements only at factories that have undergone numerous audits.

Do code of conduct audits improve chemical safety in garment factories? Lessons on corporate social responsibility in the supply chain from Fair Wear Foundation

PubMed Central

2016-01-01

Background In managing chemical risks to the environment and human health in supply chains, voluntary corporate social responsibility (CSR) measures, such as auditing code of conduct compliance, play an important role. Objectives To examine how well suppliers’ chemical health and safety performance complies with buyers’ CSR policies and whether audited factories improve their performance. Methods CSR audits (n = 288) of garment factories conducted by Fair Wear Foundation (FWF), an independent non-profit organization, were analyzed using descriptive statistics and statistical modeling. Results Forty-three per cent of factories did not comply with the FWF code of conduct, i.e. received remarks on chemical safety. Only among factories audited 10 or more times was there a significant increase in the number of factories receiving no remarks. Conclusions Compliance with chemical safety requirements in garment supply chains is low and auditing is statistically correlated with improvements only at factories that have undergone numerous audits. PMID:27611103

T-cell responses in oiled guillemots and swans in a rehabilitation setting.

PubMed

Troisi, Gera M

2013-07-01

Aquatic birds are commonly affected by oil spills. Despite rehabilitation efforts, the majority of rehabilitated common guillemots (Uria aalge) do not survive, whereas mute swans (Cygnus olor) tend to have higher postrelease survival. Polyaromatic hydrocarbons (PAHs) present in crude oil and diesel are immunotoxic in birds affecting cell-mediated responses to immunogens. Because it is a target of PAH toxicity, T-lymphocyte response to controlled mitogen administration (phytohemagglutinnin test) was investigated in a scoping study as a potentially useful minimally invasive in vivo test of cell-mediated immunity. The test was performed on 69 mute swans and 31 common guillemots stranded on the Norfolk and Lincolnshire coastline and inland waterways in England (UK) either due to injury or to contamination with crude or diesel oil. T-lymphocyte response was significantly decreased in swans with greater oil scores. T-lymphocyte responses were also decreased in guillemots, but this finding was not statistically significant.

MIX: a computer program to evaluate interaction between chemicals

Treesearch

Jacqueline L. Robertson; Kimberly C. Smith

1989-01-01

A computer program, MIX, was designed to identify pairs of chemicals whose interaction results in a response that departs significantly from the model predicated on the assumption of independent, uncorrelated joint action. This report describes the MIX program, its statistical basis, and instructions for its use.

Reconsidering barriers to wind power projects: community engagement, developer transparency and place

DOE Office of Scientific and Technical Information (OSTI.GOV)

Firestone, Jeremy; Hoen, Ben; Rand, Joseph

In 2016, we undertook a nationally representative wind power perceptions survey of individuals living within 8 km of over 600 projects in the United States, generating 1705 telephone, web, and mail responses. We sought information on a variety of topics, including procedural fairness and its relationship to project attitude, the foci of the present analysis. Here, we present a series of descriptive statistics and regression results, emphasizing those residents who were aware of their local project prior to construction. Sample weighting is employed to account for stratification and non-response. We find that a developer being open and transparent, a communitymore » being able to influence the outcome, and having a say in the planning process are all statistically significant predictors of a process perceived as being ‘fair,’ with an open and transparent developer having the largest effect. We also find developer transparency and ability to influence outcomes to have statistically significant relationships to a more positive attitude, with those findings holding when aesthetics, landscape, and wind turbine sound considerations are controlled for. The results indicate that jurisdictions might consider developing procedures, which ensure citizens are consulted and heard, and benchmarks or best practices for developer interaction with communities and citizens.« less

Reconsidering barriers to wind power projects: community engagement, developer transparency and place

DOE PAGES

Firestone, Jeremy; Hoen, Ben; Rand, Joseph; ...

2017-12-21

In 2016, we undertook a nationally representative wind power perceptions survey of individuals living within 8 km of over 600 projects in the United States, generating 1705 telephone, web, and mail responses. We sought information on a variety of topics, including procedural fairness and its relationship to project attitude, the foci of the present analysis. Here, we present a series of descriptive statistics and regression results, emphasizing those residents who were aware of their local project prior to construction. Sample weighting is employed to account for stratification and non-response. We find that a developer being open and transparent, a communitymore » being able to influence the outcome, and having a say in the planning process are all statistically significant predictors of a process perceived as being ‘fair,’ with an open and transparent developer having the largest effect. We also find developer transparency and ability to influence outcomes to have statistically significant relationships to a more positive attitude, with those findings holding when aesthetics, landscape, and wind turbine sound considerations are controlled for. The results indicate that jurisdictions might consider developing procedures, which ensure citizens are consulted and heard, and benchmarks or best practices for developer interaction with communities and citizens.« less

Use of response surface methodology in a fed-batch process for optimization of tricarboxylic acid cycle intermediates to achieve high levels of canthaxanthin from Dietzia natronolimnaea HS-1.

PubMed

Nasri Nasrabadi, Mohammad Reza; Razavi, Seyed Hadi

2010-04-01

In this work, we applied statistical experimental design to a fed-batch process for optimization of tricarboxylic acid cycle (TCA) intermediates in order to achieve high-level production of canthaxanthin from Dietzia natronolimnaea HS-1 cultured in beet molasses. A fractional factorial design (screening test) was first conducted on five TCA cycle intermediates. Out of the five TCA cycle intermediates investigated via screening tests, alfaketoglutarate, oxaloacetate and succinate were selected based on their statistically significant (P<0.05) and positive effects on canthaxanthin production. These significant factors were optimized by means of response surface methodology (RSM) in order to achieve high-level production of canthaxanthin. The experimental results of the RSM were fitted with a second-order polynomial equation by means of a multiple regression technique to identify the relationship between canthaxanthin production and the three TCA cycle intermediates. By means of this statistical design under a fed-batch process, the optimum conditions required to achieve the highest level of canthaxanthin (13172 + or - 25 microg l(-1)) were determined as follows: alfaketoglutarate, 9.69 mM; oxaloacetate, 8.68 mM; succinate, 8.51 mM. Copyright 2009 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Investigation of trends in flooding in the Tug Fork basin of Kentucky, Virginia, and West Virginia

USGS Publications Warehouse

Hirsch, Robert M.; Scott, Arthur G.; Wyant, Timothy

1982-01-01

Statistical analysis indicates that the average size of annual-flood peaks of the Tug Fork (Ky., Va., and W. Va.) has been increasing. However, additional statistical analysis does not indicate that the flood levels that were exceeded typically once or twice a year in the period 1947-79 are any more likely to be exceeded now than in 1947. Possible trends in streamchannel size also are investigated at three locations. No discernible trends in channel size are noted. Further statistical analysis of the trend in the size of annual-flood peaks shows that much of the annual variation is related to local rainfall and to the 'natural' hydrologic response in a relatively undisturbed subbasin. However, some statistical indication of trend persists after accounting for these natural factors, though it is of borderline statistical significance. Further study in the basin may relate flood magnitudes to both rainfall and to land use.

Evaluation of the internal and external responsiveness of the Pressure Ulcer Scale for Healing (PUSH) tool for assessing acute and chronic wounds.

PubMed

Choi, Edmond P H; Chin, Weng Yee; Wan, Eric Y F; Lam, Cindy L K

2016-05-01

To examine the internal and external responsiveness of the Pressure Ulcer Scale for Healing (PUSH) tool for assessing the healing progress in acute and chronic wounds. It is important to establish the responsiveness of instruments used in conducting wound care assessments to ensure that they are able to capture changes in wound healing accurately over time. Prospective longitudinal observational study. The key study instrument was the PUSH tool. Internal responsiveness was assessed using paired t-testing and effect size statistics. External responsiveness was assessed using multiple linear regression. All new patients with at least one eligible acute or chronic wound, enrolled in the Nurse and Allied Health Clinic-Wound Care programme between 1 December 2012 - 31 March 2013 were included for analysis (N = 541). Overall, the PUSH tool was able to detect statistically significant changes in wound healing between baseline and discharge. The effect size statistics were large. The internal responsiveness of the PUSH tool was confirmed in patients with a variety of different wound types including venous ulcers, pressure ulcers, neuropathic ulcers, burns and scalds, skin tears, surgical wounds and traumatic wounds. After controlling for age, gender and wound type, subjects in the 'wound improved but not healed' group had a smaller change in PUSH scores than those in the 'wound healed' group. Subjects in the 'wound static or worsened' group had the smallest change in PUSH scores. The external responsiveness was confirmed. The internal and external responsiveness of the PUSH tool confirmed that it can be used to track the healing progress of both acute and chronic wounds. © 2016 The Authors. Journal of Advanced Nursing Published by John Wiley & Sons Ltd.

Fate of thiamethoxam in mesocosms and response of the zooplankton community.

PubMed

Lobson, C; Luong, K; Seburn, D; White, M; Hann, B; Prosser, R S; Wong, C S; Hanson, M L

2018-05-14

Thiamethoxam is a neonicotinoid insecticide that can reach wetlands in agro-ecosystems through runoff. The fate and effects of thiamethoxam on non-target organisms in shallow wetland ecosystems have not been well characterized. To this end, a mesocosm study was conducted with a focus on characterizing zooplankton community responses. A single pulse application of thiamethoxam (0, 25, 50, 100, 250, and 500 μg/L; n = 3) was applied to experimental systems and monitored for 8 weeks. The mean half-life of thiamethoxam among the different treatments was 3.7 days in the water column with concentrations of <0.8 μg/L in the majority of mesocosms by 56 days. Principal response curve analysis did not show any significant concentration-dependent differences in the zooplankton community among treatments over the course of the study. The minimum detectable difference (MDD%) values for abundance of potentially sensitive arthropod taxa (nauplius larvae, cyclopoid copepods) allowed the detections from controls as low as 42 and 59% effect, respectively. The MDD% values for total abundance of zooplankton (including the potentially less sensitive taxonomic group of Rotifera) allowed the detection from controls as low as 41% effect. There were no statistically significant differences in zooplankton abundance or diversity between control and treated mesocosms at the end of the study. There were also no statistically significant differences for individual taxa that were sustained between sampling points, or manifested as a concentration-response. We conclude that acute exposure to thiamethoxam at environmentally relevant concentrations (typically ng/L) likely does not represent a significant adverse ecological risk to wetland zooplankton community abundance and structure. Copyright © 2018 Elsevier B.V. All rights reserved.

Impact of liver steatosis on response to pegylated interferon therapy in patients with chronic hepatitis B

PubMed Central

Ateş, Fehmi; Yalnız, Mehmet; Alan, Saadet

2011-01-01

AIM: To evaluate the impact of liver steatosis upon response to given therapy in chronic hepatitis B (CHB) patients. METHODS: 84 consecutive CHB patients treated with 48-wk PEGylated interferon (PEG-IFN) therapy were enrolled. Baseline characteristics and sustained viral response (SVR) to PEG-IFN therapy were evaluated. RESULTS: Mean body mass index (BMI) was 27.36 ± 4.4 kg/m2. Six (7.1%) had hypertension and three (3.5%) had diabetes mellitus. Steatosis was present in 22.6% (19/84) of liver biopsy samples. Age, BMI, and triglyceride levels of the patients with hepatic steatosis were significantly higher than those without hepatic steatosis (P < 0.05). SVR to PEG-IFN therapy was 21.4% (18/84). Sixteen of these 18 CHB patients with SVR (88.9%) did not have any histopathologically determined steatosis. On the other hand, only two of the 19 CHB patients with hepatic steatosis had SVR (10.5%). Although the SVR rate observed in patients without steatosis (16/65, 24.6%) was higher compared to those with steatosis (2/19, 10.5%), the difference was not statistically significant (P > 0.05). CONCLUSION: Occurrence of hepatic steatosis is significantly high in CHB patients and this association leads to a trend of decreased, but statistically insignificant, SVR rates to PEG-IFN treatment. PMID:22110283

Enzymatic recontouring of auricular cartilage in a rabbit model.

PubMed

Massengill, Phillip L; Goco, Paulino E; Norlund, L Layne; Muir-Padilla, Jeanne

2005-01-01

To evaluate the effectiveness of contouring auricular cartilage in a rabbit model using biologically active enzymes injected subcutaneously. The first phase determined the most effective volume and concentration required to affect the cartilage. To accomplish this task, we used ex vivo rabbit ears from a slaughterhouse. In the second phase, we injected 1 mL of hyaluronidase (150 U per milliliter of isotonic sodium chloride solution [saline]), elastase (1 mg per milliliter of saline), or saline into the ears of live rabbits. The study took place at the Madigan Army Medical Center (Tacoma, Wash), and included 10 animals. In each rabbit, we injected the test compound in one ear and saline in the other ear (control). We injected hyaluronidase in 5 ears and elastase in 5 ears. After injection, the ears were contoured and splinted for 4 weeks. In the third phase, we changed the injection pathway in 5 animals. At 4 weeks, 4 (80%) of the 5 ears injected with hyaluronidase showed full response and 1 (20%) had a partial response. Of the 5 ears injected with elastase, 4 (80%) showed a full response while 1 (20%) demonstrated a partial response. There was a response in all 10 of the ears injected with a test compound. Of the 10 control ears, 3 (30%) showed a partial response. At 6 weeks, approximately 6 (30%) of the ears had maintained contour demonstrating a full response. The difference between the test ears and the control ears was statistically significant (P = .006). Compared with the control ears, the results were statistically significant for elastase (P = .004) and hyaluronidase (P = .02). Overall, both agents demonstrated a subjective and objective response compared with control ears. This study demonstrates that bioactive enzymes and splinting can be effective in correcting ear deformities in a rabbit model.

[Survey and analysis of radiation safety education at radiological technology schools].

PubMed

Ohba, Hisateru; Ogasawara, Katsuhiko; Aburano, Tamio

2004-10-01

We carried out a questionnaire survey of all radiological technology schools, to investigate the status of radiation safety education. The questionnaire consisted of questions concerning full-time teachers, measures being taken for the Radiation Protection Supervisor Qualifying Examination, equipment available for radiation safety education, radiation safety education for other departments, curriculum of radiation safety education, and related problems. The returned questionnaires were analyzed according to different groups categorized by form of education and type of establishment. The overall response rate was 55%, and there were statistically significant differences in the response rates among the different forms of education. No statistically significant differences were found in the items relating to full-time teachers, measures for Radiation Protection Supervisor Qualifying Examination, and radiation safety education for other departments, either for the form of education or type of establishment. Queries on the equipment used for radiation safety education revealed a statistically significant difference in unsealed radioisotope institutes among the forms of education. In terms of curriculum, the percentage of radiological technology schools which dealt with neither the shielding calculation method for radiation facilities nor with the control of medical waste was found to be approximately 10%. Other educational problems that were indicated included shortages of full-time teachers and equipment for radiation safety education. In the future, in order to improve radiation safety education at radiological technology schools, we consider it necessary to develop unsealed radioisotope institutes, to appoint more full-time teachers, and to educate students about risk communication.

Rapid COJEC Induction Therapy for High-risk Neuroblastoma Patients - Cochrane Review.

PubMed

Peinemann, F; van Dalen, E C; Berthold, F

2016-04-01

Neuroblastoma is a rare malignant disease and patients with high-risk neuroblastoma have a poor prognosis. Rapid COJEC induction chemotherapy means (almost) the same total doses given within a shorter time period. In theory, rapid COJEC could reduce the risk of drug resistance and it has been considered as a potential candidate for improving the outcome. The objective was to evaluate effects of rapid COJEC compared to standard induction chemotherapy in patients with high-risk neuroblastoma. We searched the databases CENTRAL, MEDLINE, and EMBASE from inception to 11 November 2014 and included randomized controlled trials. We identified one relevant randomized controlled trial with 130 participants receiving rapid COJEC and 132 participants receiving standard OPEC/COJEC induction chemotherapy. There was no statistically significant difference between the treatment groups in complete response (risk ratio 0.99, 95% confidence interval 0.71 to 1.38, P=0.94) and treatment-related mortality (risk ratio 1.21, 95% confidence interval 0.33 to 4.39, P=0.77). A statistically significant difference in favor of the standard treatment arm was identified for the following early toxicities: febrile neutropenia, septicemia, and renal toxicity. The differences in complete response and treatment-related mortality between treatment alternatives were not statistically significantly different. Based on the currently available evidence, we are uncertain about the effects of rapid COJEC induction chemotherapy in patients with high-risk neuroblastoma. © Georg Thieme Verlag KG Stuttgart · New York.

Effects of Meteorological Conditions on Reactions to Noise Exposure

NASA Technical Reports Server (NTRS)

Shepherd, Kevin P. (Technical Monitor); Fields, James M.

2004-01-01

More than 80,000 residents' responses to transportation noise at different times of year provide the best, but imprecise, statistical estimates of the effects of season and meteorological conditions on community response to noise. Annoyance with noise is found to be slightly statistically significantly higher in the summer than in the winter in a seven-year study in the Netherlands. Analyses of 41 other surveys drawn from diverse countries, climates, and times of year find noise annoyance is increased by temperature, and may be increased by more sunshine, less precipitation, and reduced wind speeds. Meteorological conditions on the day of the interview or the immediately preceding days do not appear to have any more effect on reactions than do the conditions over the immediately preceding weeks or months.

Homicide mortality rates in Canada, 2000-2009: Youth at increased risk.

PubMed

Basham, C Andrew; Snider, Carolyn

2016-10-20

To estimate and compare Canadian homicide mortality rates (HMRs) and trends in HMRs across age groups, with a focus on trends for youth. Data for the period of 2000 to 2009 were collected from Statistics Canada's CANSIM (Canadian Statistical Information Management) Table 102-0540 with the following ICD-10-CA coded external causes of death: X85 to Y09 (assault) and Y87.1 (sequelae of assault). Annual population counts from 2000 to 2009 were obtained from Statistics Canada's CANSIM Table 051-0001. Both death and population counts were organized into five-year age groups. A random effects negative binomial regression analysis was conducted to estimate age group-specific rates, rate ratios, and trends in homicide mortality. There were 9,878 homicide deaths in Canada during the study period. The increase in the overall homicide mortality rate (HMR) of 0.3% per year was not statistically significant (95% CI: -1.1% to +1.8%). Canadians aged 15-19 years and 20-24 years had the highest HMRs during the study period, and experienced statistically significant annual increases in their HMRs of 3% and 4% respectively (p < 0.05). A general, though not statistically significant, decrease in the HMR was observed for all age groups 50+ years. A fixed effects negative binomial regression model showed that the HMR for males was higher than for females over the study period [RRfemale/male = 0.473 (95% CI: 0.361, 0.621)], but no significant difference in sex-specific trends in the HMR was found. An increasing risk of homicide mortality was identified among Canadian youth, ages 15-24, over the 10-year study period. Research that seeks to understand the reasons for the increased homicide risk facing Canada's youth, and public policy responses to reduce this risk, are warranted.

Motivators for children with severe intellectual disabilities in the self-contained classroom: a movement analysis.

PubMed

DeBedout, Jennifer K; Worden, Melissa C

2006-01-01

The purpose of this study was to analyze the impact of the presence of a music therapist versus the use of switch-activated toys and recorded music in evoking physiological, affective, and vocal responses in school-aged children who are considered SID, or Severely Intellectually Disabled. Researchers studied movement responses to determine how these children might respond more readily to a music therapist interacting musically with them than to the toys and to the recorded music. Each of the 17 children participated in a videotaped session that included 5 trials. Other than the rest trial, motivators presented were: a switch-activated pig toy, switch-activated recorded music, the music therapist playing and singing to the child contingent upon his touching the guitar, and the therapist playing and singing to the child continually. A data collection sheet was developed by the researchers to assess positive responses by measuring limb and head movement, vocal sound, and facial expression change. The Kruskal-Wallis test was used to determine differences in means responses to music and nonmusic trials. At a 90% level of confidence, statistical significance was attained in comparing the responses to the pig toy, recorded music, and "activated guitar" trial to the trial during which the therapist played guitar and sang continually to the child. In addition, at a 95% level of confidence, statistically significant differences were found in comparing the pig and the recorded music trials with the therapist trial.

A new test statistic for climate models that includes field and spatial dependencies using Gaussian Markov random fields

DOE PAGES

Nosedal-Sanchez, Alvaro; Jackson, Charles S.; Huerta, Gabriel

2016-07-20

A new test statistic for climate model evaluation has been developed that potentially mitigates some of the limitations that exist for observing and representing field and space dependencies of climate phenomena. Traditionally such dependencies have been ignored when climate models have been evaluated against observational data, which makes it difficult to assess whether any given model is simulating observed climate for the right reasons. The new statistic uses Gaussian Markov random fields for estimating field and space dependencies within a first-order grid point neighborhood structure. We illustrate the ability of Gaussian Markov random fields to represent empirical estimates of fieldmore » and space covariances using "witch hat" graphs. We further use the new statistic to evaluate the tropical response of a climate model (CAM3.1) to changes in two parameters important to its representation of cloud and precipitation physics. Overall, the inclusion of dependency information did not alter significantly the recognition of those regions of parameter space that best approximated observations. However, there were some qualitative differences in the shape of the response surface that suggest how such a measure could affect estimates of model uncertainty.« less

Combining censored and uncensored data in a U-statistic: design and sample size implications for cell therapy research.

PubMed

Moyé, Lemuel A; Lai, Dejian; Jing, Kaiyan; Baraniuk, Mary Sarah; Kwak, Minjung; Penn, Marc S; Wu, Colon O

2011-01-01

The assumptions that anchor large clinical trials are rooted in smaller, Phase II studies. In addition to specifying the target population, intervention delivery, and patient follow-up duration, physician-scientists who design these Phase II studies must select the appropriate response variables (endpoints). However, endpoint measures can be problematic. If the endpoint assesses the change in a continuous measure over time, then the occurrence of an intervening significant clinical event (SCE), such as death, can preclude the follow-up measurement. Finally, the ideal continuous endpoint measurement may be contraindicated in a fraction of the study patients, a change that requires a less precise substitution in this subset of participants.A score function that is based on the U-statistic can address these issues of 1) intercurrent SCE's and 2) response variable ascertainments that use different measurements of different precision. The scoring statistic is easy to apply, clinically relevant, and provides flexibility for the investigators' prospective design decisions. Sample size and power formulations for this statistic are provided as functions of clinical event rates and effect size estimates that are easy for investigators to identify and discuss. Examples are provided from current cardiovascular cell therapy research.

Quantification of uncertainty in the prediction of railway induced ground vibration due to the use of statistical track unevenness data

NASA Astrophysics Data System (ADS)

Lombaert, G.; Galvín, P.; François, S.; Degrande, G.

2014-09-01

Environmental vibrations due to railway traffic are predominantly due to dynamic axle loads caused by wheel and track unevenness and impact excitation by rail joints and wheel flats. Because of its irregular character, track unevenness is commonly processed statistically and represented by its power spectral density function or its root mean square (RMS) value in one-third octave bands. This statistical description does not uniquely define the track unevenness at a given site, however, and different track unevenness profiles matching the statistical description will lead to different predictions of dynamic axle loads and resulting ground vibration. This paper presents a methodology that allows quantifying the corresponding variability in ground vibration predictions. The procedure is derived assuming the geometry of the track and soil to be homogeneous along the track. The procedure is verified by means of Monte Carlo simulations and its usefulness for assessing the mismatch between predicted and measured ground vibrations is demonstrated in a case study. The results show that the response in time domain and its narrow band spectrum exhibit significant variability which is reduced when the running RMS value or the one-third octave band spectrum of the response is considered.

A new test statistic for climate models that includes field and spatial dependencies using Gaussian Markov random fields

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nosedal-Sanchez, Alvaro; Jackson, Charles S.; Huerta, Gabriel

A new test statistic for climate model evaluation has been developed that potentially mitigates some of the limitations that exist for observing and representing field and space dependencies of climate phenomena. Traditionally such dependencies have been ignored when climate models have been evaluated against observational data, which makes it difficult to assess whether any given model is simulating observed climate for the right reasons. The new statistic uses Gaussian Markov random fields for estimating field and space dependencies within a first-order grid point neighborhood structure. We illustrate the ability of Gaussian Markov random fields to represent empirical estimates of fieldmore » and space covariances using "witch hat" graphs. We further use the new statistic to evaluate the tropical response of a climate model (CAM3.1) to changes in two parameters important to its representation of cloud and precipitation physics. Overall, the inclusion of dependency information did not alter significantly the recognition of those regions of parameter space that best approximated observations. However, there were some qualitative differences in the shape of the response surface that suggest how such a measure could affect estimates of model uncertainty.« less

Fundamental Investigation of the Microstructural Parameters to Improve Dynamic Response in Al-Cu Model System

DTIC Science & Technology

2014-05-01

grain size. Recrystallization was then induced via annealing just above the solvus temperature. After quenching , the bars were immediately placed into...that the values were statistically significant. Precipitate sizes ranged from approximately 100 nanometers in diameter up to 2-5 microns in diameter

Using Elderly Educators to Increase Colorectal Cancer Screening.

ERIC Educational Resources Information Center

Weinrich, Sally P.; And Others

1993-01-01

Used elderly educator method for increasing rate of return of fecal occult blood sampling in colorectal screening among 171 socioeconomically disadvantaged older persons. Two methods using elderly educators had overall response rate of more than 60%. Found statistically significant difference between two methods that used elderly educators and two…

Spontaneous Humor among Right Hemisphere Stroke Survivors

ERIC Educational Resources Information Center

Heath, R.L.; Blonder, L.X.

2005-01-01

We analyzed spontaneous conversational humor production and response among 11 right hemisphere-damaged (RHD) patients, 10 left hemisphere-damaged (LHD) patients, 7 normal controls (NC), and their spouses. RHD patients and their spouses reported a statistically significant decline in the patients' orientation to humor post-stroke. Also, we found a…

Constructing the Exact Significance Level for a Person-Fit Statistic.

ERIC Educational Resources Information Center

Liou, Michelle; Chang, Chih-Hsin

1992-01-01

An extension is proposed for the network algorithm introduced by C.R. Mehta and N.R. Patel to construct exact tail probabilities for testing the general hypothesis that item responses are distributed according to the Rasch model. A simulation study indicates the efficiency of the algorithm. (SLD)

Prognostic Value of Serum Free Light Chain in Multiple Myeloma.

PubMed

El Naggar, Amel A; El-Naggar, Mostafa; Mokhamer, El-Hassan; Avad, Mona W

2015-01-01

The measurement of serum free light chain (sFLC) has been shown to be valuable in screening for the presence of plasma cell dyscrasia as well as for baseline prognosis in newly diagnosed patients. The aim of the present work was to study the prognostic value of sFLC in multiple myeloma in relation to other serum biomarkers, response to therapy and survival. Forty five newly diagnosed patients with MM were included in the study. Patients were divided into responders and non-responders groups according to response to therapy. sFLC and serum Amyloid A (SAA) were measured by immunonephelometry. The non-responders group showed a statistically significant higher kappa/lambda or lambda/kappa ratio and higher β2 microglobulin level, but lower albumin level at presentation, as compared to the responders group (P < 0.001). However, no statistically significant difference was detected between the two groups regarding SA A or calcium levels. Comparison between sFLC ratio obtained before and after therapy revealed significant decrease after treatment in the responders group (P = 0.05). Survival was significantly inferior in patients with an FLC ratio of ≥ 2.6 or ≤ 0.56 compared with those with an FLC ratio that was between 0.56 and 2.6 (P = 0.002).

Department of Defense Chiropractic Internships

PubMed Central

Dunn, Andrew S.

2006-01-01

Objective: Department of Defense (DoD) chiropractic internships first began in July of 2001. At the time of this study, 30 New York Chiropractic College student interns had completed part of their clinical education within chiropractic clinics at either the National Naval Medical Center or Naval Hospital Camp Lejeune. The purpose of this study was to evaluate and compare the careers of DoD chiropractic internship participants with comparable nonparticipants in terms of demographics, professional activities, income, and satisfaction. Methods: Survey research was employed to gather data from DoD chiropractic internship participants and comparable nonparticipants. Statistical analysis was carried out to determine significant differences with a nominal significance level set as.05. Results: There were no statistically significant differences in demographics, professional activities, income, or career satisfaction between the 21 DoD chiropractic internship participants (70% response rate) and 35 internship nonparticipants (35% response rate). Conclusions: This study utilized practice parameters as a form of feedback for a comparative analysis of DoD chiropractic internship participants and nonparticipants and found no significant differences between these groups. Limitations of the study may have influenced the results. Opportunities for chiropractic students to train within these settings remains limited and should be further explored, as should additional research into this component of chiropractic clinical education. PMID:18483629

Treatment of melasma with a depigmentation cream determined with colorimetry.

PubMed

Sabancilar, Emine; Aydin, Fatma; Bek, Yuksel; Ozden, Muge Guler; Ozcan, Muharrem; Senturk, Nilgün; Canturk, Tayyar; Turanli, Ahmet Yasar

2011-10-01

Melasma is a pigmentary disorder often recalcitrant to treatment. Few studies have objectively evaluated the efficacy of treatment colorimetrically. To evaluate the safety and efficacy of a depigmentation cream, including mainly glycolic acid and Rumex occidentalis. Twenty-seven patients applied the cream twice daily for the first 3 months and twice weekly for the following 3 months. L*, C* and h* values of the target lesions and the perilesional area were analyzed at baseline, 12 and 24 weeks colorimetrically. The physician and patient evaluated the clinical response rate. These results were compared statistically between the lesional and perilesional area. There was a significant difference between 0-12, 0-24 (L*, C* and h* values) and 12-24 weeks (L* value) (p <0.001). For C* and h* values, the difference was not significant between 12 and 24 weeks (p = 0.464 and 0.151, respectively). Statistical significance was detected only between 3 and 6 months for C* value (p < 0.05) for the lesional and the perilesional areas. Clinical response rate was significant (p < 0.05). Our depigmentation cream is a moderate effective agent, well tolerated and can be considered as an alternative treatment of melasma. Twice-daily application may enhance the efficacy of treatment instead of twice-weekly application in the maintenance period.

Impact of Coal Mining on Self-Rated Health among Appalachian Residents

PubMed Central

Woolley, Shannon M.; Bear, Todd M.; Balmert, Lauren C.; Talbott, Evelyn O.; Buchanich, Jeanine M.

2015-01-01

Objective. To determine the impact of coal mining, measured as the number of coal mining-related facilities nearby one's residence or employment in an occupation directly related to coal mining, on self-rated health in Appalachia. Methods. Unadjusted and adjusted ordinal logistic regression models calculated odds ratio estimates and associated 95% confidence intervals for the probability of having an excellent self-rated health response versus another response. Covariates considered in the analyses included number of coal mining-related facilities nearby one's residence and employment in an occupation directly related to coal mining, as well as potential confounders age, sex, BMI, smoking status, income, and education. Results. The number of coal mining facilities near the respondent's residence was not a statistically significant predictor of self-rated health. Employment in a coal-related occupation was a statistically significant predictor of self-rated health univariably; however, after adjusting for potential confounders, it was no longer a significant predictor. Conclusions. Self-rated health does not seem to be associated with residential proximity to coal mining facilities or employment in the coal industry. Future research should consider additional measures for the impact of coal mining. PMID:26240577

Test-retest reliability of auditory brainstem responses to chirp stimuli in newborns.

PubMed

Cobb, Kensi M; Stuart, Andrew

2014-11-01

The purpose of this study was to examine the test-retest reliability of auditory brainstem responses (ABRs) to air- and bone-conducted chirp stimuli in newborns as a function of intensity. A repeated measures quasi-experimental design was employed. Thirty healthy newborns participated. ABRs were evoked using 60, 45, and 30 dB nHL air-conducted CE-Chirps and 45, 30, and 15 dB nHL bone-conducted CE-Chirps at a rate of 57.7/s. Measures were repeated by a second tester. Statistically significant correlations (p <.0001) and predictive linear relations (p <.0001) were found between testers for wave V latencies and amplitudes to air- and bone-conducted CE-Chirps. There were also no statistically significant differences between testers with wave V latencies and amplitudes to air- and bone-conducted CE-Chirps (p >.05). As expected, significant differences in wave V latencies and amplitudes were seen as a function of stimulus intensity for air- and bone-conducted CE-Chirps (p <.0001). These results suggest that ABRs to air- and bone-conducted CE-Chirps can be reliably repeated in newborns with different testers. The CE-Chirp may be valuable for both screening and diagnostic audiologic assessments of newborns.

Clinical stage, therapy, and prognosis in canine anal sac gland carcinoma.

PubMed

Polton, Gerry A; Brearley, Malcolm J

2007-01-01

Reports of canine anal sac gland carcinoma (ASGC) describe varied clinical presentations and management and differing responses to therapy. A unifying approach to clinical stage determination and management of this disease has yet to be presented. An ordinal clinical staging scheme for canine ASGC can be devised on the basis of responses to therapy for a retrospective cohort of affected dogs. 130 dogs with naturally occurring ASGC. A simplified clinical stage system and a management algorithm for canine ASGC were derived from retrospective evaluation of a cohort of 80 dogs; applicability of both was then prospectively evaluated in a cohort of 50 dogs. Retrospective evaluation revealed 4 statistically significant negative prognostic indicators for survival: lack of therapy, presence of distant metastases, presence of lymph node metastases, and primary tumor size. Lymph node extirpation was a statistically significant positive prognostic indicator by bivariate analysis. In both retrospective and prospective analyses, the modified clinical stage scheme revealed a significant association with survival time. The clinical staging scheme permits differentiation between groups in terms of prognosis and, therefore, decisions on therapy. This will facilitate application of appropriate therapy and enhanced communication and collaboration in further investigations of ASGC.

Improved cellulase production by Botryosphaeria rhodina from OPEFB at low level moisture condition through statistical optimization.

PubMed

Bahrin, E K; Ibrahim, M F; Abd Razak, M N; Abd-Aziz, S; Shah, U K Md; Alitheen, N; Salleh, M Md

2012-01-01

The response surface method was applied in this study to improve cellulase production from oil palm empty fruit bunch (OPEFB) by Botryosphaeria rhodina. An experimental design based on a two-level factorial was employed to screen the significant environmental factors for cellulase production. The locally isolated fungus Botryosphaeria rhodina was cultivated on OPEFB under solid-state fermentation (SSF). From the analysis of variance (ANOVA), the initial moisture content, amount of substrate, and initial pH of nutrient supplied in the SSF system significantly influenced cellulase production. Then the optimization of the variables was done using the response surface method according to central composite design (CCD). Botryosphaeria rhodina exhibited its best performance with a high predicted value of FPase enzyme production (17.95 U/g) when the initial moisture content was at 24.32%, initial pH of nutrient was 5.96, and 3.98 g of substrate was present. The statistical optimization from actual experiment resulted in a significant increment of FPase production from 3.26 to 17.91 U/g (5.49-fold). High cellulase production at low moisture content is a very rare condition for fungi cultured in solid-state fermentation.

The assessment of macular electrophysiology and macular morphology in patients with vitiligo.

PubMed

Aydin, Rukiye; Ozsutcu, Mustafa; Erdur, Sevil Karaman; Dikkaya, Funda; Balevi, Ali; Ozbek, Merve; Senturk, Fevzi

2018-02-01

We aimed to analyze the electrophysiologic function and morphology of macula in vitiligo patients. Seventeen patients with vitiligo and 11 healthy subjects were studied. All participants underwent multifocal electroretinography (mfERG) and spectral domain optical coherence tomography (SD-OCT) evaluations. The mfERG (P1 mfERG responses central and peripheral) and retinal layer segmentation parameters (nine ETDRS subfields) were compared in vitiligo and control groups. The mean P1 response amplitudes were significantly decreased in central and peripheral rings of the fovea in patients with vitiligo compared with controls (p = 0.002 and p = 0.006, respectively). There was a tendency toward a prolonged mean implicit time for both central and peripheral in patients with vitiligo compared to controls, however, with no statistical significance (p = 0.453 and p = 0.05, respectively). There was no statistically significant difference in all retinal layers thickness between two groups. In patients with vitiligo, while photoreceptor segment preserved in SD-OCT, mfERG reduced showing potential decline in central retinal function. This study showed a potential decline in central retinal function in patients with vitiligo even if they have normal fundus appearance and SD-OCT findings.

Using SERVQUAL to evaluate quality disconfirmation of nursing service in Taiwan.

PubMed

Chou, Shieu-Ming; Chen, Thai-Form; Woodard, Beth; Yen, Miao-Fen

2005-06-01

The purpose of this study was to determine the extent of disconfirmation of the perceived quality of nursing services, and its relationship to patient's satisfaction, intent to return, and intent to recommend to others. The service dimensions were tangibles, reliability, responsiveness, assurance, and empathy, which were adopted from the Gap model of Parasuraman, Zeithaml and Berry (1985). A total of 186 subjects was tested by a modified SERVQUAL (service quality) instrument. These subjects were from 15 randomly selected medical-surgical units in a medical center in Taipei, Taiwan, Republic of China. The response rate was 92%. Descriptive statistics and multiple regression were used to analyze subjects' responses. A number of the demographic variables served as covariates in data analysis. Responsiveness was highly significant in predicting overall satisfaction with hospital service (p = .0003). Reliability was significant in predicting overall satisfaction with nursing care (p < .00005) and intent to return. Empathy was a highly significant predictor of intent to recommend.

The impact of the haemoglobin level on the response to radiotherapy.

PubMed

Haydaroğlu, A; Yürüt, V; Arican, A; Yalman, D; Bülent Aras, A; Esassolak, M; Ozkök, S

2002-01-01

To define the impact of preradiotherapy haemoglobin (Hb) levels on the response rate of radiotherapy in patients with head and neck, uterine cervix and lung cancer. One hundred thirteen patients- 38 with head and neck cancer, 43 with carcinona of the uterine cervix and 32 with lung cancer- were retrospectively evaluated to determine the correlation between tumor response and preradiotherapy Hb levels. Hb level of 11 g/dl was taken as cut-off value for anemia. Patients were divided in two groups according to their objective response to radiotherapy. Histologically 30 of the head and neck cancers, 36 of the cervical cancers and 17 of the lung cancers were squamous-cell carcinomas. Tumor response of the epidermoid carcinomas were significantly correlated with preradiotherapy Hb levels (p < 0.001). Tumor response in patients with head and neck and cervical cancers was significantly correlated with pretreatment Hb levels while in patients with lung cancer this correlation did not reach statistical significance (p=0.059). Preradiotherapy Hb level is an important factor in determining the efficacy of radiotherapy. Raising the Hb level before radiotherapy may have a beneficial impact on the response to radiotherapy.

A comparison of the brainstem auditory evoked response in healthy ears of unilaterally deaf dogs and bilaterally hearing dogs.

PubMed

Plonek, M; Nicpoń, J; Kubiak, K; Wrzosek, M

2017-03-01

Auditory plasticity in response to unilateral deafness has been reported in various animal species. Subcortical changes occurring in unilaterally deaf young dogs using the brainstem auditory evoked response have not been evaluated yet. The aim of this study was to assess the brainstem auditory evoked response findings in dogs with unilateral hearing loss, and compare them with recordings obtained from healthy dogs. Brainstem auditory evoked responses (amplitudes and latencies of waves I, II, III, V, the V/I wave amplitude ratio, wave I-V, I-III and III-V interpeak intervals) were studied retrospectively in forty-six privately owned dogs, which were either unilaterally deaf or had bilateral hearing. The data obtained from the hearing ears in unilaterally deaf dogs were compared to values obtained from their healthy littermates. Statistically significant differences in the amplitude of wave III and the V/I wave amplitude ratio at 75 dB nHL were found between the group of unilaterally deaf puppies and the control group. The recordings of dogs with single-sided deafness were compared, and the results showed no statistically significant differences in the latencies and amplitudes of the waves between left- (AL) and right-sided (AR) deafness. The recordings of the brainstem auditory evoked response in canines with unilateral inborn deafness in this study varied compared to recordings from healthy dogs. Future studies looking into electrophysiological assessment of hearing in conjunction with imaging modalities to determine subcortical auditory plasticity and auditory lateralization in unilaterally deaf dogs are warranted.

Natural variation reveals relationships between pre-stress carbohydrate nutritional status and subsequent responses to xenobiotic and oxidative stress in Arabidopsis thaliana

PubMed Central

Ramel, Fanny; Sulmon, Cécile; Gouesbet, Gwenola; Couée, Ivan

2009-01-01

Background Soluble sugars are involved in responses to stress, and act as signalling molecules that activate specific or hormone cross-talk transduction pathways. Thus, exogenous sucrose treatment efficiently induces tolerance to the herbicide atrazine in Arabidopsis thaliana plantlets, at least partially through large-scale modifications of expression of stress-related genes. Methods Availability of sugars in planta for stress responses is likely to depend on complex dynamics of soluble sugar accumulation, sucrose–starch partition and organ allocation. The question of potential relationships between endogenous sugar levels and stress responses to atrazine treatment was investigated through analysis of natural genetic accessions of A. thaliana. Parallel quantitative and statistical analysis of biochemical parameters and of stress-sensitive physiological traits was carried out on a set of 11 accessions. Key Results Important natural variation was found between accessions of A. thaliana in pre-stress shoot endogenous sugar levels and responses of plantlets to subsequent atrazine stress. Moreover, consistent trends and statistically significant correlations were detected between specific endogenous sugar parameters, such as the pre-stress end of day sucrose level in shoots, and physiological markers of atrazine tolerance. Conclusions These significant relationships between endogenous carbohydrate metabolism and stress response therefore point to an important integration of carbon nutritional status and induction of stress tolerance in plants. The specific correlation between pre-stress sucrose level and greater atrazine tolerance may reflect adaptive mechanisms that link sucrose accumulation, photosynthesis-related stress and sucrose induction of stress defences. PMID:19789177

Effect of thoracic epidural block on infection-induced inflammatory response: A randomized controlled trial.

PubMed

Tyagi, Asha; Bansal, Anuradha; Das, Shukla; Sethi, Ashok Kumar; Kakkar, Aanchal

2017-04-01

Epidural block decreases inflammation and oxidative stress in experimental models of sepsis as well as after surgery. There is, however, no clinical evidence evaluating its effect on infection-induced inflammatory process. The present trial evaluated the effect of thoracic epidural block (TEB) on systemic inflammatory response in patients with small intestinal perforation peritonitis. Outcome measures included systemic levels of interleukin (IL)-6, IL-10, procalcitonin, and C-reactive protein and postoperative Sepsis-Related Organ Failure Assessment scores. Sixty adult patients undergoing emergency abdominal laparotomy without any contraindication to TEB were randomized to receive general anesthesia alone or in combination with the TEB, which was continued for 48 hours postoperatively (n = 30 each). Use of TEB was associated with a statistically insignificant trend of preservation of anti-inflammatory response depicted by higher levels of IL-10 and lack of alteration in proinflammatory IL-6, along with appreciably lower procalcitonin levels, decreased incidence of raised C-reactive protein levels, and better postoperative SOFA score (P > .05). It resulted in significantly better postoperative respiratory function and faster return of bowel motility (P < .05). Although the sample size is too small for conclusive statement, none of the patients developed epidural abscess. Thoracic epidural block showed a trend toward better preservation of anti-inflammatory response and clinical recovery that, however, failed to achieve statistical significance (P > .05). Copyright © 2016 Elsevier Inc. All rights reserved.

Objective assessment of corticosteroid effect in plantar fasciitis: additional utility of ultrasound

PubMed Central

Moustafa, Asmaa Mahmoud Ali; Hassanein, Eshrak; Foti, Calogero

2015-01-01

Summary Background although plantar fascia thickening is well documented as a sonographic criterion for the diagnosis of plantar fasciitis (PF), however it was less evaluated as an objective measure of response to treatment. It is unknown to what extent if any different responses to different treatments are related to the ultrasound (US) morphology changes. We aimed to evaluate changes in US findings in correlation to pain reported. Methods this prospective observational trial included 21 plantar fasciitis patients (26 feet), resistant to conservative treatment for at least 2 months. Plantar fascia thickness and echogenicity were evaluated, compared to asymptomatic feet and correlated with visual analogue scale (VAS) and Heel Tenderness Index (HTI), before and after dexam-ethasone (DXM) iontophoresis in group I, and DXM injection in group II. Results increased thickness and reduced echogenicity were constant in symptomatic feet, with high statistical significant difference compared to asymptomatic side. Correlation between plantar fascia thickness with VAS and HTI before and after treatment showed statistically significant positive correlation (p<0.05). ROC curve test showed that reduction of plantar fascia thickness by US in response to DXM had 100% sensitivity, 65.2% specificity and 69% accuracy, with higher specificity and accuracy than VAS. Conclusion US changes showed concurrent validity correlated with self-reported clinical improvement. Accordingly, ultrasound can be considered an objective useful tool for monitoring response to corticosteroid in patients with plantar fasciitis. PMID:26958538

Objective assessment of corticosteroid effect in plantar fasciitis: additional utility of ultrasound.

PubMed

Moustafa, Asmaa Mahmoud Ali; Hassanein, Eshrak; Foti, Calogero

2015-01-01

although plantar fascia thickening is well documented as a sonographic criterion for the diagnosis of plantar fasciitis (PF), however it was less evaluated as an objective measure of response to treatment. It is unknown to what extent if any different responses to different treatments are related to the ultrasound (US) morphology changes. We aimed to evaluate changes in US findings in correlation to pain reported. this prospective observational trial included 21 plantar fasciitis patients (26 feet), resistant to conservative treatment for at least 2 months. Plantar fascia thickness and echogenicity were evaluated, compared to asymptomatic feet and correlated with visual analogue scale (VAS) and Heel Tenderness Index (HTI), before and after dexam-ethasone (DXM) iontophoresis in group I, and DXM injection in group II. increased thickness and reduced echogenicity were constant in symptomatic feet, with high statistical significant difference compared to asymptomatic side. Correlation between plantar fascia thickness with VAS and HTI before and after treatment showed statistically significant positive correlation (p<0.05). ROC curve test showed that reduction of plantar fascia thickness by US in response to DXM had 100% sensitivity, 65.2% specificity and 69% accuracy, with higher specificity and accuracy than VAS. US changes showed concurrent validity correlated with self-reported clinical improvement. Accordingly, ultrasound can be considered an objective useful tool for monitoring response to corticosteroid in patients with plantar fasciitis.

Modulating toll-like receptor-mediated inflammatory responses following exposure of whole cell and lipopolysaccharide component from Porphyromonas gingivalis in wistar rat models

PubMed Central

Nelwan, Sindy Cornelia; Nugraha, Ricardo Adrian; Endaryanto, Anang; Retno, Indrawati

2017-01-01

Objective: To explore host innate inflammatory response and the signal pathway induced by Porphyromonas gingivalis by measuring level of toll-like receptor 2 (TLR2) and TLR4 activity. Materials and Methods: Animal experimental study with pretest-posttest controlled group design were done between January 1 and December 10, 2016.. Total of 28 wistar rats had been used, randomized into 7 groups, each were given various dose of intra-sulcural injection of Porphyromonas gingivalis lipopolysaccharide. Statistical Analysis: Normality were measured by Shapiro–Wilk test, while statistical analysis made by ANOVA, t test, Pearson, and linear regression model.. Results: At day 0, no significant difference TLR2 and TLR4 level were measured. At day 4, there is a slight difference between TLR2 and TLR4 level in each group. At day 11, there is a significant difference between TLR2 and TLR4 level in each group. Group with exposure of whole cell will develop greater TLR2 but lower TLR4 level. In the contrary, group with exposure of LPS will develop greater TLR4 but lower TLR2 level. Conclusion: Our data supported that P. gingivalis played a vital role in the pathogenesis of pathogen-induced inflammatory responses in which TLR2 and TLR4 have different molecular mechanisms following recognition of pathogens and inflammatory response. PMID:29279665

Interferon for the treatment of genital warts: a systematic review

PubMed Central

2009-01-01

Background Interferon has been widely used in the treatment of genital warts for its immunomodulatory, antiproliferative and antiviral properties. Currently, no evidence that interferon improves the complete response rate or reduces the recurrence rate of genital warts has been generally provided. The aim of this review is to assess, from randomized control trials (RCTs), the efficacy and safety of interferon in curing genital warts. Methods We searched Cochrane Sexually Transmitted Diseases Group's Trials Register (January, 2009), Cochrane Central Register of Controlled Trials (2009, issue 1), PubMed (1950-2009), EMBASE (1974-2009), Chinese Biomedical Literature Database (CBM) (1975-2009), China National Knowledge Infrastructure (CNKI) (1979-2009), VIP database (1989-2009), as well as reference lists of relevant studies. Two reviewers independently screened searched studies, extracted data and evaluated their methodological qualities. RevMan 4.2.8 software was used for meta-analysis Results 12 RCTs involving 1445 people were included. Among them, 7 studies demonstrated the complete response rate of locally-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions differed significantly (locally-used interferon:44.4%; placebo:16.1%). The difference between the two groups had statistical significance (RR 2.68, 95% CI 1.79 to 4.02, P < 0.00001). 5 studies demonstrated the complete response rate of systemically-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions had no perceivable discrepancy (systemically-used interferon:27.4%; placebo:26.4%). The difference between the two groups had no statistical significance (RR1.25, 95% CI 0.80 to 1.95, P > 0.05). 7 studies demonstrated the recurrence rate of interferon as compared to placebo for treating genital warts. Based on meta-analysis, the recurrence rate of the two interventions had no perceivable discrepancy(interferon 21.1%; placebo: 34.2%). The difference between the two groups had no statistical significance (RR0.56, 95% CI 0.27 to 1.18, P > 0.05). However, subgroup analysis showed that HPV-infected patients with locally administered interferon were less likely than those given placebo to relapse, but that no significant difference in relapse rates was observed between systemic and placebo. The reported adverse events of interferon were mostly mild and transient, which could be well tolerated. Conclusion Interferon tends to be a fairly well-tolerated form of therapy. According to different routes of administration, locally-used interferon appears to be much more effective than both systemically-used interferon and placebo in either improving the complete response rate or reducing the recurrence rate for the treatment of genital warts. PMID:19772554

Interferon for the treatment of genital warts: a systematic review.

PubMed

Yang, Jin; Pu, Yu-Guo; Zeng, Zhong-Ming; Yu, Zhi-Jian; Huang, Na; Deng, Qi-Wen

2009-09-21

Interferon has been widely used in the treatment of genital warts for its immunomodulatory, antiproliferative and antiviral properties. Currently, no evidence that interferon improves the complete response rate or reduces the recurrence rate of genital warts has been generally provided. The aim of this review is to assess, from randomized control trials (RCTs), the efficacy and safety of interferon in curing genital warts. We searched Cochrane Sexually Transmitted Diseases Group's Trials Register (January, 2009), Cochrane Central Register of Controlled Trials (2009, issue 1), PubMed (1950-2009), EMBASE (1974-2009), Chinese Biomedical Literature Database (CBM) (1975-2009), China National Knowledge Infrastructure (CNKI) (1979-2009), VIP database (1989-2009), as well as reference lists of relevant studies. Two reviewers independently screened searched studies, extracted data and evaluated their methodological qualities. RevMan 4.2.8 software was used for meta-analysis 12 RCTs involving 1445 people were included. Among them, 7 studies demonstrated the complete response rate of locally-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions differed significantly (locally-used interferon:44.4%; placebo:16.1%). The difference between the two groups had statistical significance (RR 2.68, 95% CI 1.79 to 4.02, P < 0.00001). 5 studies demonstrated the complete response rate of systemically-used interferon as compared to placebo for treating genital warts. Based on meta-analysis, the rate of Complete response of the two interventions had no perceivable discrepancy (systemically-used interferon:27.4%; placebo:26.4%). The difference between the two groups had no statistical significance (RR1.25, 95% CI 0.80 to 1.95, P > 0.05). 7 studies demonstrated the recurrence rate of interferon as compared to placebo for treating genital warts. Based on meta-analysis, the recurrence rate of the two interventions had no perceivable discrepancy(interferon 21.1%; placebo: 34.2%). The difference between the two groups had no statistical significance (RR0.56, 95% CI 0.27 to 1.18, P > 0.05). However, subgroup analysis showed that HPV-infected patients with locally administered interferon were less likely than those given placebo to relapse, but that no significant difference in relapse rates was observed between systemic and placebo. The reported adverse events of interferon were mostly mild and transient, which could be well tolerated. Interferon tends to be a fairly well-tolerated form of therapy. According to different routes of administration, locally-used interferon appears to be much more effective than both systemically-used interferon and placebo in either improving the complete response rate or reducing the recurrence rate for the treatment of genital warts.

Contribution of Stress Responses to Antibiotic Tolerance in Pseudomonas aeruginosa Biofilms

PubMed Central

Franklin, Michael J.; Williamson, Kerry S.; Folsom, James P.; Boegli, Laura; James, Garth A.

2015-01-01

Enhanced tolerance of biofilm-associated bacteria to antibiotic treatments is likely due to a combination of factors, including changes in cell physiology as bacteria adapt to biofilm growth and the inherent physiological heterogeneity of biofilm bacteria. In this study, a transcriptomics approach was used to identify genes differentially expressed during biofilm growth of Pseudomonas aeruginosa. These genes were tested for statistically significant overlap, with independently compiled gene lists corresponding to stress responses and other putative antibiotic-protective mechanisms. Among the gene groups tested were those associated with biofilm response to tobramycin or ciprofloxacin, drug efflux pumps, acyl homoserine lactone quorum sensing, osmotic shock, heat shock, hypoxia stress, and stationary-phase growth. Regulons associated with Anr-mediated hypoxia stress, RpoS-regulated stationary-phase growth, and osmotic stress were significantly enriched in the set of genes induced in the biofilm. Mutant strains deficient in rpoS, relA and spoT, or anr were cultured in biofilms and challenged with ciprofloxacin and tobramycin. When challenged with ciprofloxacin, the mutant strain biofilms had 2.4- to 2.9-log reductions in viable cells compared to a 0.9-log reduction of the wild-type strain. Interestingly, none of the mutants exhibited a statistically significant alteration in tobramycin susceptibility compared to that with the wild-type biofilm. These results are consistent with a model in which multiple genes controlled by overlapping starvation or stress responses contribute to the protection of a P. aeruginosa biofilm from ciprofloxacin. A distinct and as yet undiscovered mechanism protects the biofilm bacteria from tobramycin. PMID:25870065

To study the effect of Kangaroo Mother Care on pain response in preterm neonates and to determine the behavioral and physiological responses to painful stimuli in preterm neonates: a study from western Rajasthan.

PubMed

Choudhary, Mukesh; Dogiyal, Hemaram; Sharma, Deepak; Datt Gupta, Brahma; Madabhavi, Irappa; Choudhary, Jagveer Singh; Choudhary, Sushil Kumar

2016-03-01

To study the effect of Kangaroo Mother Care (KMC) on pain response in preterm neonates and to determine the behavioral and physiological responses to painful stimuli in preterm neonates. This was a single-blind cross over study in which total 140 neonates were enrolled. Pain stimulus was given in the form of heel-lance before and after giving KMC and data were recorded. The effect of KMC on heart rate variability was statistically significant in preterm (30-34 wks) and very low birth weight (1.0-1.5 kg) neonates. The mean fall in SpO2 from base line was less in KMC group as compared to without KMC group at 60 s (1.63% versus 2.22%) and 120 s (0.45% versus 2.22%). The mean duration of cry was less in the KMC group (15.05 s) as compared to without KMC group (24.82 s) and the difference was statistically significant (p < 0.05). The mean duration of cry was reduced by 36% in KMC group as compared to the without KMC group. The effect of KMC on pain scores (premature infant pain profile (PIPP)) were significantly lower after heel-lance in KMC at 60 s (p < 0.01). KMC is a most physiological, non-pharmacological and easy intervention that involves parents: to manage procedural pain that can be implemented for physiological or behavioral stability in their premature infants.

Changes in compensatory eye movements associated with simulated stimulus conditions of spaceflight

NASA Technical Reports Server (NTRS)

Harm, Deborah L.; Zografos, Linda M.; Skinner, Noel C.; Parker, Donald E.

1993-01-01

Compensatory vertical eye movement gain (CVEMG) was recorded during pitch oscillation in darkness before, during, and immediately after exposures to the stimulus rearrangement produced by the Preflight Adaptation Trainer (PAT) Tilt-Translation Device (TTD). The TTD is designed to elicit adaptive responses that are similar to those observed in microgravity-adapted astronauts. The data from Experiment 1 yielded a statistically significant CVEMG decrease following 15 min of exposure to a stimulus rearrangement condition where the phase angle between subject pitch tilt and visual scene translation was 270 deg; statistically significant gain decreases were not observed following exposures either to a condition where the phase angle between subject pitch and scene translation was 90 deg or to a no-stimulus-rearrangement condition. Experiment 2 replicated the 270-deg-phase condition from Experiment 1 and extended the exposure duration from 30 to 45 min. Statistically significant additional changes in CVEMG associated with the increased exposure duration were not observed. The adaptation time constant estimated fram the combined data from Experiments 1 and 2 was 29 min.

Changes in Compensatory Eye Movements Associated with Simulated Stimulus Conditions of Spaceflight

NASA Technical Reports Server (NTRS)

Harm, Deborah L.; Zografos, Linda M.; Skinner, Noel C.; Parker, Donald E.

1993-01-01

Compensatory vertical eye movement gain (CVEMG) was recorded during pitch oscillation in darkness before, during and immediately after exposures to the stimulus rearrangement produced by the Preflight Adaptation Trainer (PAT) Tilt-Translation Device (TTD). The TTD is designed to elicit adaptive responses that are similar to those observed in microgravity-adapted astronauts. The data from Experiment 1 yielded a statistically significant CVEMG decrease following 15 minutes of exposure to a stimulus rearrangement condition where the phase angle between subject pitch tilt and visual scene translation was 270 degrees; statistically significant gain decreases were not observed following exposures either to a condition where the phase angle between subject pitch and scene translation was 90 degrees or to a no-stimulus-rearrangement condition. Experiment 2 replicated the 270 degree phase condition from Experiment 1 and extended the exposure duration from 30 to 45 minutes. Statistically significant additional changes in CVEMG associated with the increased exposure duration were not observed. The adaptation time constant estimated from the combined data from Experiments 1 and 2 was 29 minutes.

Methotrexate monotherapy and methotrexate combination therapy with traditional and biologic disease modifying antirheumatic drugs for rheumatoid arthritis: abridged Cochrane systematic review and network meta-analysis

PubMed Central

Barnabe, Cheryl; Tomlinson, George; Marshall, Deborah; Devoe, Dan; Bombardier, Claire

2016-01-01

Objective To compare methotrexate based disease modifying antirheumatic drug (DMARD) treatments for rheumatoid arthritis in patients naive to or with an inadequate response to methotrexate. Design Systematic review and Bayesian random effects network meta-analysis of trials assessing methotrexate used alone or in combination with other conventional synthetic DMARDs, biologic drugs, or tofacitinib in adult patients with rheumatoid arthritis. Data sources Trials were identified from Medline, Embase, and Central databases from inception to 19 January 2016; abstracts from two major rheumatology meetings from 2009 to 2015; two trial registers; and hand searches of Cochrane reviews. Study selection criteria Randomized or quasi-randomized trials that compared methotrexate with any other DMARD or combination of DMARDs and contributed to the network of evidence between the treatments of interest. Main outcomes American College of Rheumatology (ACR) 50 response (major clinical improvement), radiographic progression, and withdrawals due to adverse events. A comparison between two treatments was considered statistically significant if its credible interval excluded the null effect, indicating >97.5% probability that one treatment was superior. Results 158 trials were included, with between 10 and 53 trials available for each outcome. In methotrexate naive patients, several treatments were statistically superior to oral methotrexate for ACR50 response: sulfasalazine and hydroxychloroquine (“triple therapy”), several biologics (abatacept, adalimumab, etanercept, infliximab, rituximab, tocilizumab), and tofacitinib. The estimated probability of ACR50 response was similar between these treatments (range 56-67%), compared with 41% with methotrexate. Methotrexate combined with adalimumab, etanercept, certolizumab, or infliximab was statistically superior to oral methotrexate for inhibiting radiographic progression, but the estimated mean change over one year with all treatments was less than the minimal clinically important difference of 5 units on the Sharp-van der Heijde scale. Triple therapy had statistically fewer withdrawals due to adverse events than methotrexate plus infliximab. After an inadequate response to methotrexate, several treatments were statistically superior to oral methotrexate for ACR50 response: triple therapy, methotrexate plus hydroxychloroquine, methotrexate plus leflunomide, methotrexate plus intramuscular gold, methotrexate plus most biologics, and methotrexate plus tofacitinib. The probability of response was 61% with triple therapy and ranged widely (27-70%) with other treatments. No treatment was statistically superior to oral methotrexate for inhibiting radiographic progression. Methotrexate plus abatacept had a statistically lower rate of withdrawals due to adverse events than several treatments. Conclusions Triple therapy (methotrexate plus sulfasalazine plus hydroxychloroquine) and most regimens combining biologic DMARDs with methotrexate were effective in controlling disease activity, and all were generally well tolerated in both methotrexate naive and methotrexate exposed patients. PMID:27102806

Association among Working Hours, Occupational Stress, and Presenteeism among Wage Workers: Results from the Second Korean Working Conditions Survey.

PubMed

Jeon, Sung-Hwan; Leem, Jong-Han; Park, Shin-Goo; Heo, Yong-Seok; Lee, Bum-Joon; Moon, So-Hyun; Jung, Dal-Young; Kim, Hwan-Cheol

2014-03-24

The purpose of the present study was to identify the association between presenteeism and long working hours, shiftwork, and occupational stress using representative national survey data on Korean workers. We analyzed data from the second Korean Working Conditions Survey (KWCS), which was conducted in 2010, in which a total of 6,220 wage workers were analyzed. The study population included the economically active population aged above 15 years, and living in the Republic of Korea. We used the chi-squared test and multivariate logistic regression to test the statistical association between presenteeism and working hours, shiftwork, and occupational stress. Approximately 19% of the workers experienced presenteeism during the previous 12 months. Women had higher rates of presenteeism than men. We found a statistically significant dose-response relationship between working hours and presenteeism. Shift workers had a slightly higher rate of presenteeism than non-shift workers, but the difference was not statistically significant. Occupational stress, such as high job demand, lack of rewards, and inadequate social support, had a significant association with presenteeism. The present study suggests that long working hours and occupational stress are significantly related to presenteeism.

Association among Working Hours, Occupational Stress, and Presenteeism among Wage Workers: Results from the Second Korean Working Conditions Survey

PubMed Central

2014-01-01

Objectives The purpose of the present study was to identify the association between presenteeism and long working hours, shiftwork, and occupational stress using representative national survey data on Korean workers. Methods We analyzed data from the second Korean Working Conditions Survey (KWCS), which was conducted in 2010, in which a total of 6,220 wage workers were analyzed. The study population included the economically active population aged above 15 years, and living in the Republic of Korea. We used the chi-squared test and multivariate logistic regression to test the statistical association between presenteeism and working hours, shiftwork, and occupational stress. Results Approximately 19% of the workers experienced presenteeism during the previous 12 months. Women had higher rates of presenteeism than men. We found a statistically significant dose–response relationship between working hours and presenteeism. Shift workers had a slightly higher rate of presenteeism than non-shift workers, but the difference was not statistically significant. Occupational stress, such as high job demand, lack of rewards, and inadequate social support, had a significant association with presenteeism. Conclusions The present study suggests that long working hours and occupational stress are significantly related to presenteeism. PMID:24661575

Radiation-induced changes in gustatory function comparison of effects of neutron and photon irradiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mossman, K.L.; Chencharick, J.D.; Scheer, A.C.

1979-04-01

Changes in gustatory function were measured in 51 patients with various forms of cancer who received radiation to the head and neck region. Forty patients (group I) were treated with conventional photon radiation (e.g. 66 Gy/7 weeks), and 11 patients (group II) were treated with cyclotron produced fast neutrons (e.g. 22 Gy/7 weeks). Taste acuity was measured for four taste qualities (salt, sweet, sour, and bitter) by a forced choice-three stimulus drop technique which measured detection and recognition thresholds and by a forced scaling technique which measured taste intensity responsiveness. Subjective complaints of anorexia, dysgeusia, taste loss, and xerostomia weremore » also recorded. Patients were studied before, during and up to two months after therapy. Prior to therapy, detection and recognition thresholds, intensity responsiveness, and the frequency of subjective complaints in patients from groups I and II were statistically equivalent. During and up to 2 months after therapy, taste impairment and frequency of subjective complaints increased significantly in neutron and photon treated patients, but were statistically equivalent. Results of this study indicate that gustatory tissue response as measured by taste detection and recognition and intensity responsiveness, and the frequency of subjective complaints related to taste are statistically equivalent in patients before, during, or up 2 months after they were given either neutron or photon radiation for tumors of the head and neck.« less

Comparison of attitudes of non-science major students toward science and technology

NASA Astrophysics Data System (ADS)

Wick, Donald Gary

This study examines the attitudes of non-science major students who were enrolled in General Education Required (GER) science courses at three diverse Iowa post-secondary educational institutions: The University of Iowa, Cornell College, and Kirkwood Community College. The information was gathered using a survey instrument with the test subjects responding with a five-part Likert-scale to a series of statements regarding: (1) reasons for taking the science course, (2) views and attitudes toward science, and (3) the nature and implications of science and technology. The initial data gathered was analyzed using either chi-squared, analysis of variance (ANOVA), and/or Bonferroni tests. Responses to grouped statements were used to generate population indices related to: (1) experience, (2) attitude, (3) experimentation, and (4) technology. These indices were analyzed for statistically significant differences using Tukey's Studentized (HSD) and Tukey-Krammer tests. Statistically significant differences were found in the response means for some individual statements. When a population index was calculated for each school using the grouped responses related to attitude, experience, science/technology, multiple comparison testing determined significant differences with regards to attitude, experiences, and science/technology. No significant differences were found between the schools for the population index regarding experimentation. Demographic information gathered concerning the nature of the student populations included: (1) declared major, (2) classification, (3) previous number of science courses, (4) gender, and (5) use of computers for the science course. Analysis of demographic data also revealed statistically significant differences. The differences found in this study provide additional quantitative data to characterize the non-science major student. Recommendations based on this data are: (1) The University of Iowa strive for smaller GER class sizes and reevaluate current pedagogy, (2) Kirkwood Community College make class material more relevant and place more emphasis on research, (3) Cornell College utilize full professors in the non-major course and incorporate more technology, and (4) all reevaluate the science GERs course pedagogy, retain the science GERs, maintain the current number of GER science course choices, and, finally, reevaluate any GER science course credit reciprocity.

Monte Carlo study on pulse response of underwater optical channel

NASA Astrophysics Data System (ADS)

Li, Jing; Ma, Yong; Zhou, Qunqun; Zhou, Bo; Wang, Hongyuan

2012-06-01

Pulse response of the underwater wireless optical channel is significant for the analysis of channel capacity and error probability. Traditional vector radiative transfer theory (VRT) is not able to deal with the effect of receiving aperture. On the other hand, general water tank experiments cannot acquire an accurate pulse response due to the limited time resolution of the photo-electronic detector. We present a Monte Carlo simulation model to extract the time-domain pulse response undersea. In comparison with the VRT model, a more accurate pulse response for practical ocean communications could be achieved through statistical analysis of the received photons. The proposed model is more reasonable for the study of the underwater optical channel.

Empirical Tryout of a New Statistic for Detecting Temporally Inconsistent Responders.

PubMed

Kerry, Matthew J

2018-01-01

Statistical screening of self-report data is often advised to support the quality of analyzed responses - For example, reduction of insufficient effort responding (IER). One recently introduced index based on Mahalanobis's D for detecting outliers in cross-sectional designs replaces centered scores with difference scores between repeated-measure items: Termed person temporal consistency ( D 2 ptc ). Although the adapted D 2 ptc index demonstrated usefulness in simulation datasets, it has not been applied to empirical data. The current study addresses D 2 ptc 's low uptake by critically appraising its performance across three empirical applications. Independent samples were selected to represent a range of scenarios commonly encountered by organizational researchers. First, in Sample 1, a repeat-measure of future time perspective (FTP) inexperienced working adults (age >40-years; n = 620) indicated that temporal inconsistency was significantly related to respondent age and item reverse-scoring. Second, in repeat-measure of team efficacy aggregations, D 2 ptc successfully detected team-level inconsistency across repeat-performance cycles. Thirdly, the usefulness of the D 2 ptc was examined in an experimental study dataset of subjective life expectancy indicated significantly more stable responding in experimental conditions compared to controls. The empirical findings support D 2 ptc 's flexible and useful application to distinct study designs. Discussion centers on current limitations and further extensions that may be of value to psychologists screening self-report data for strengthening response quality and meaningfulness of inferences from repeated-measures self-reports. Taken together, the findings support the usefulness of the newly devised statistic for detecting IER and other extreme response patterns.

Note: Nonpolar solute partial molar volume response to attractive interactions with water.

PubMed

Williams, Steven M; Ashbaugh, Henry S

2014-01-07

The impact of attractive interactions on the partial molar volumes of methane-like solutes in water is characterized using molecular simulations. Attractions account for a significant 20% volume drop between a repulsive Weeks-Chandler-Andersen and full Lennard-Jones description of methane interactions. The response of the volume to interaction perturbations is characterized by linear fits to our simulations and a rigorous statistical thermodynamic expression for the derivative of the volume to increasing attractions. While a weak non-linear response is observed, an average effective slope accurately captures the volume decrease. This response, however, is anticipated to become more non-linear with increasing solute size.

Note: Nonpolar solute partial molar volume response to attractive interactions with water

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, Steven M.; Ashbaugh, Henry S., E-mail: hanka@tulane.edu

2014-01-07

The impact of attractive interactions on the partial molar volumes of methane-like solutes in water is characterized using molecular simulations. Attractions account for a significant 20% volume drop between a repulsive Weeks-Chandler-Andersen and full Lennard-Jones description of methane interactions. The response of the volume to interaction perturbations is characterized by linear fits to our simulations and a rigorous statistical thermodynamic expression for the derivative of the volume to increasing attractions. While a weak non-linear response is observed, an average effective slope accurately captures the volume decrease. This response, however, is anticipated to become more non-linear with increasing solute size.

Reassessment of the relationship between M-protein decrement and survival in multiple myeloma.

PubMed

Palmer, M; Belch, A; Hanson, J; Brox, L

1989-01-01

The relationship between percentage M-protein decrement and survival is assessed in 134 multiple myeloma patients. The correlation did not achieve statistical significance (P = 0.069). Multivariate analysis using the Cox proportional hazards model, including a number of previously recognised prognostic factors, showed only percentage M-protein decrement, creatinine and haemoglobin to be significantly correlated with survival. However, the R'-statistic for each of these variables was low, indicating that their prognostic power is weak. We conclude that neither the percentage M-protein decrement nor the response derived from it can be used as an accurate means of assessing the efficacy of treatment in myeloma. Mature survival data alone should be used for this purpose.

Reassessment of the relationship between M-protein decrement and survival in multiple myeloma.

PubMed Central

Palmer, M.; Belch, A.; Hanson, J.; Brox, L.

1989-01-01

The relationship between percentage M-protein decrement and survival is assessed in 134 multiple myeloma patients. The correlation did not achieve statistical significance (P = 0.069). Multivariate analysis using the Cox proportional hazards model, including a number of previously recognised prognostic factors, showed only percentage M-protein decrement, creatinine and haemoglobin to be significantly correlated with survival. However, the R'-statistic for each of these variables was low, indicating that their prognostic power is weak. We conclude that neither the percentage M-protein decrement nor the response derived from it can be used as an accurate means of assessing the efficacy of treatment in myeloma. Mature survival data alone should be used for this purpose. PMID:2757916

Strategies for Reduced-Order Models in Uncertainty Quantification of Complex Turbulent Dynamical Systems

NASA Astrophysics Data System (ADS)

Qi, Di

Turbulent dynamical systems are ubiquitous in science and engineering. Uncertainty quantification (UQ) in turbulent dynamical systems is a grand challenge where the goal is to obtain statistical estimates for key physical quantities. In the development of a proper UQ scheme for systems characterized by both a high-dimensional phase space and a large number of instabilities, significant model errors compared with the true natural signal are always unavoidable due to both the imperfect understanding of the underlying physical processes and the limited computational resources available. One central issue in contemporary research is the development of a systematic methodology for reduced order models that can recover the crucial features both with model fidelity in statistical equilibrium and with model sensitivity in response to perturbations. In the first part, we discuss a general mathematical framework to construct statistically accurate reduced-order models that have skill in capturing the statistical variability in the principal directions of a general class of complex systems with quadratic nonlinearity. A systematic hierarchy of simple statistical closure schemes, which are built through new global statistical energy conservation principles combined with statistical equilibrium fidelity, are designed and tested for UQ of these problems. Second, the capacity of imperfect low-order stochastic approximations to model extreme events in a passive scalar field advected by turbulent flows is investigated. The effects in complicated flow systems are considered including strong nonlinear and non-Gaussian interactions, and much simpler and cheaper imperfect models with model error are constructed to capture the crucial statistical features in the stationary tracer field. Several mathematical ideas are introduced to improve the prediction skill of the imperfect reduced-order models. Most importantly, empirical information theory and statistical linear response theory are applied in the training phase for calibrating model errors to achieve optimal imperfect model parameters; and total statistical energy dynamics are introduced to improve the model sensitivity in the prediction phase especially when strong external perturbations are exerted. The validity of reduced-order models for predicting statistical responses and intermittency is demonstrated on a series of instructive models with increasing complexity, including the stochastic triad model, the Lorenz '96 model, and models for barotropic and baroclinic turbulence. The skillful low-order modeling methods developed here should also be useful for other applications such as efficient algorithms for data assimilation.

Intralesional tuberculin (PPD) versus measles, mumps, rubella (MMR) vaccine in treatment of multiple warts: a comparative clinical and immunological study.

PubMed

Shaheen, Maha Adel; Salem, Samar Abdallah M; Fouad, Dina Adel; El-Fatah, Abeer Aly Abd

2015-01-01

Intralesional purified protein derivative (PPD) or mumps, measles, rubella (MMR) were not previously compared regarding their efficacy or mechanism of action in treatment of warts. We aimed to compare their efficacy in treatment of multiple warts and investigate their effect on serum interleukin (IL)-4 and IL-12. Thirty patients with multiple warts were included (10 treated with PPD, 10 with MMR, and 10 with normal saline (control)). Injection was done every 3 weeks until clearance or maximum of three treatments. Clinical response of target and distant warts was evaluated. Serum ILs-4 and -12 were assessed before and after treatment. A significantly higher rate of complete response was found in target and distant warts with PPD (60% each) and MMR (80%, 40%, respectively) compared with controls (0%), with no significant difference between both treatments. After treatment, the control group showed the lowest serum IL-12 and IL-4 levels compared with the MMR- and PPD-treated groups with statistically significant difference in between. MMR resulted in a significantly higher serum IL-12 than PPD. With PPD, IL-4 was increased with statistically significant change compared with pretreat-ment level. Intralesional PPD and MMR show comparable efficacy and safety in treatment of multiple warts. Serum ILs-4 and-12 increase following antigen injection. © 2015 Wiley Periodicals, Inc.

Survey of editors and reviewers of high-impact psychology journals: statistical and research design problems in submitted manuscripts.

PubMed

Harris, Alex; Reeder, Rachelle; Hyun, Jenny

2011-01-01

The authors surveyed 21 editors and reviewers from major psychology journals to identify and describe the statistical and design errors they encounter most often and to get their advice regarding prevention of these problems. Content analysis of the text responses revealed themes in 3 major areas: (a) problems with research design and reporting (e.g., lack of an a priori power analysis, lack of congruence between research questions and study design/analysis, failure to adequately describe statistical procedures); (b) inappropriate data analysis (e.g., improper use of analysis of variance, too many statistical tests without adjustments, inadequate strategy for addressing missing data); and (c) misinterpretation of results. If researchers attended to these common methodological and analytic issues, the scientific quality of manuscripts submitted to high-impact psychology journals might be significantly improved.

Attitudes and behaviour towards waste management in the Dublin, Ireland region.

PubMed

Purcell, M; Magette, W L

2010-10-01

The hypothesis of this research was that attitudes about the management of biodegradable municipal waste (BMW) are spatially variable, even within a city of modest (1.2 million) population. For a select number of representative electoral districts in the Dublin, Ireland region, residents were surveyed regarding attitudes towards waste management in general, and BMW management in particular. A total of 850 survey responses were collected. Door-to-door interviews produced 688 responses in the residential sector; these were supplemented by 162 responses to a web-based survey. The surveys revealed that the majority of households use local authority, rather than private, waste collection services (both are available). The majority of residents, regardless of the local authority in which they live, were satisfied with their waste management service. "Reducing the quantity of waste generated" was regarded the most important future issue for 28% of residential respondents. Statistical analyses of the survey responses showed that the local authority in which respondents resided significantly influenced most responses (including waste collection service used, waste service satisfaction and backyard composting activity). Many responses (including waste service satisfaction, waste management influences) were also significantly related to the respondents' personal characteristics (e.g., education level, type of accommodation, age, etc.). These statistical results proved the hypothesis of the research and demonstrated that waste management initiatives designed for one area of the city (or, indeed, for uniform application to the city as a whole) could ignore the needs of other areas. The survey responses suggest that targeted intervention strategies would lead to improved diversion rates of BMW from landfill, a requirement of the Landfill Directive 1999/31/EC. (c) 2010 Elsevier Ltd. All rights reserved.

Significant linkage to airway responsiveness on chromosome 12q24 in families of children with asthma in Costa Rica.

PubMed

Celedón, Juan C; Soto-Quiros, Manuel E; Avila, Lydiana; Lake, Stephen L; Liang, Catherine; Fournier, Eduardo; Spesny, Mitzi; Hersh, Craig P; Sylvia, Jody S; Hudson, Thomas J; Verner, Andrei; Klanderman, Barbara J; Freimer, Nelson B; Silverman, Edwin K; Weiss, Scott T

2007-01-01

Although asthma is a major public health problem in certain Hispanic subgroups in the United States and Latin America, only one genome scan for asthma has included Hispanic individuals. Because of small sample size, that study had limited statistical power to detect linkage to asthma and its intermediate phenotypes in Hispanic participants. To identify genomic regions that contain susceptibility genes for asthma and airway responsiveness in an isolated Hispanic population living in the Central Valley of Costa Rica, we conducted a genome-wide linkage analysis of asthma (n = 638) and airway responsiveness (n = 488) in members of eight large pedigrees of Costa Rican children with asthma. Nonparametric multipoint linkage analysis of asthma was conducted by the NPL-PAIR allele-sharing statistic, and variance component models were used for the multipoint linkage analysis of airway responsiveness as a quantitative phenotype. All linkage analyses were repeated after exclusion of the phenotypic data of former and current smokers. Chromosome 12q showed some evidence of linkage to asthma, particularly in nonsmokers (P < 0.01). Among nonsmokers, there was suggestive evidence of linkage to airway responsiveness on chromosome 12q24.31 (LOD = 2.33 at 146 cM). After genotyping 18 additional short-tandem repeat markers on chromosome 12q, there was significant evidence of linkage to airway responsiveness on chromosome 12q24.31 (LOD = 3.79 at 144 cM), with a relatively narrow 1.5-LOD unit support interval for the observed linkage peak (142-147 cM). Our results suggest that chromosome 12q24.31 contains a locus (or loci) that influence a critical intermediate phenotype of asthma (airway responsiveness) in Costa Ricans.

Impact of imatinib interruption and duration of prior hydroxyurea on the treatment outcome in patients with chronic myeloid leukemia: Single institution experience.

PubMed

Edesa, Wael Abdelgawad; Abdel-malek, Raafat Ragaey

2015-06-01

Optimal response requires that patients should be maintained on the drug continuously. To evaluate the influence of imatinib interruption and prior hydroxyurea use on the outcome of patients with chronic myeloid leukemia. Between January 2010 and November 2013, patients with chronic phase who received imatinib at the Kasr Al-ainy Center of Clinical Oncology were included. Sixty patients were included in this study, thirty three patients (55%) received imatinib upfront, while 27 (45%) received imatinib post hydroxyurea. Imatinib was not given regularly in 50% of patients. In terms of response, only major molecular response and complete molecular response were statistically significant in favor of patients who were receiving imatinib regularly compared to those who had interruption (p<0.001, p<0.001, respectively) , while there was no difference in patients stratified according to prior hydroxyurea. The median progression free survival was 30.3 months (95% CI 24.3-36.3). Among the group of patients who received imatinib regularly, progression free survival was longer (p=0.049), there was no difference between those who received prior hydroxyurea versus those who did not (p=0.67). Duration of prior hydroxyurea had no impact on response or progression free survival, while patients regular on imatinib had statistically significant difference with respect to major molecular response, complete molecular response and progression free survival compared to those who had periods of drug interruption, thus we need more governmental support to supply the drug without interruption to improve the outcome of therapy. Copyright © 2015 The Authors. Production and hosting by Elsevier B.V. All rights reserved.

The Relationship Between Procrastination, Learning Strategies and Statistics Anxiety Among Iranian College Students: A Canonical Correlation Analysis

PubMed Central

Vahedi, Shahrum; Farrokhi, Farahman; Gahramani, Farahnaz; Issazadegan, Ali

2012-01-01

Objective: Approximately 66-80%of graduate students experience statistics anxiety and some researchers propose that many students identify statistics courses as the most anxiety-inducing courses in their academic curriculums. As such, it is likely that statistics anxiety is, in part, responsible for many students delaying enrollment in these courses for as long as possible. This paper proposes a canonical model by treating academic procrastination (AP), learning strategies (LS) as predictor variables and statistics anxiety (SA) as explained variables. Methods: A questionnaire survey was used for data collection and 246-college female student participated in this study. To examine the mutually independent relations between procrastination, learning strategies and statistics anxiety variables, a canonical correlation analysis was computed. Results: Findings show that two canonical functions were statistically significant. The set of variables (metacognitive self-regulation, source management, preparing homework, preparing for test and preparing term papers) helped predict changes of statistics anxiety with respect to fearful behavior, Attitude towards math and class, Performance, but not Anxiety. Conclusion: These findings could be used in educational and psychological interventions in the context of statistics anxiety reduction. PMID:24644468

Discovery of pathologies by orthodontists on lateral cephalograms.

PubMed

Moffitt, Allen Hall

2011-01-01

To determine the frequency of significant pathologies on lateral cephalograms discovered by orthodontists during their careers. A five-statement survey was sent to the 417 active and affiliate members of the Edward H. Angle Society of Orthodontists. The survey asked orthodontists to identify any significant radiographic pathology that they had discovered on lateral cephalograms during their careers to date. The data were analyzed statistically. Of the 417 surveys, 201 were returned for a 48% response rate. Ninety-nine respondents or 49.3% of the sample had discovered at least one significant pathology. Of the 1.3 million patients observed by the orthodontists in the sample, 268 patients (0.02%) with significant pathologies had been identified. Younger orthodontists had a statistically greater potential to discover pathologies than older orthodontists. The general types of pathologies discovered were musculoskeletal (38%), glandular (28%), and dental groups (12%). About 50% of orthodontists will likely discover a significant, potentially life-affecting pathology on a lateral cephalogram.

Spatially Pooled Contrast Responses Predict Neural and Perceptual Similarity of Naturalistic Image Categories

PubMed Central

Groen, Iris I. A.; Ghebreab, Sennay; Lamme, Victor A. F.; Scholte, H. Steven

2012-01-01

The visual world is complex and continuously changing. Yet, our brain transforms patterns of light falling on our retina into a coherent percept within a few hundred milliseconds. Possibly, low-level neural responses already carry substantial information to facilitate rapid characterization of the visual input. Here, we computationally estimated low-level contrast responses to computer-generated naturalistic images, and tested whether spatial pooling of these responses could predict image similarity at the neural and behavioral level. Using EEG, we show that statistics derived from pooled responses explain a large amount of variance between single-image evoked potentials (ERPs) in individual subjects. Dissimilarity analysis on multi-electrode ERPs demonstrated that large differences between images in pooled response statistics are predictive of more dissimilar patterns of evoked activity, whereas images with little difference in statistics give rise to highly similar evoked activity patterns. In a separate behavioral experiment, images with large differences in statistics were judged as different categories, whereas images with little differences were confused. These findings suggest that statistics derived from low-level contrast responses can be extracted in early visual processing and can be relevant for rapid judgment of visual similarity. We compared our results with two other, well- known contrast statistics: Fourier power spectra and higher-order properties of contrast distributions (skewness and kurtosis). Interestingly, whereas these statistics allow for accurate image categorization, they do not predict ERP response patterns or behavioral categorization confusions. These converging computational, neural and behavioral results suggest that statistics of pooled contrast responses contain information that corresponds with perceived visual similarity in a rapid, low-level categorization task. PMID:23093921

Statistically accurate low-order models for uncertainty quantification in turbulent dynamical systems.

PubMed

Sapsis, Themistoklis P; Majda, Andrew J

2013-08-20

A framework for low-order predictive statistical modeling and uncertainty quantification in turbulent dynamical systems is developed here. These reduced-order, modified quasilinear Gaussian (ROMQG) algorithms apply to turbulent dynamical systems in which there is significant linear instability or linear nonnormal dynamics in the unperturbed system and energy-conserving nonlinear interactions that transfer energy from the unstable modes to the stable modes where dissipation occurs, resulting in a statistical steady state; such turbulent dynamical systems are ubiquitous in geophysical and engineering turbulence. The ROMQG method involves constructing a low-order, nonlinear, dynamical system for the mean and covariance statistics in the reduced subspace that has the unperturbed statistics as a stable fixed point and optimally incorporates the indirect effect of non-Gaussian third-order statistics for the unperturbed system in a systematic calibration stage. This calibration procedure is achieved through information involving only the mean and covariance statistics for the unperturbed equilibrium. The performance of the ROMQG algorithm is assessed on two stringent test cases: the 40-mode Lorenz 96 model mimicking midlatitude atmospheric turbulence and two-layer baroclinic models for high-latitude ocean turbulence with over 125,000 degrees of freedom. In the Lorenz 96 model, the ROMQG algorithm with just a single mode captures the transient response to random or deterministic forcing. For the baroclinic ocean turbulence models, the inexpensive ROMQG algorithm with 252 modes, less than 0.2% of the total, captures the nonlinear response of the energy, the heat flux, and even the one-dimensional energy and heat flux spectra.

An Evidence-Based Medicine Curriculum Improves General Surgery Residents' Standardized Test Scores in Research and Statistics.

PubMed

Trickey, Amber W; Crosby, Moira E; Singh, Monika; Dort, Jonathan M

2014-12-01

The application of evidence-based medicine to patient care requires unique skills of the physician. Advancing residents' abilities to accurately evaluate the quality of evidence is built on understanding of fundamental research concepts. The American Board of Surgery In-Training Examination (ABSITE) provides a relevant measure of surgical residents' knowledge of research design and statistics. We implemented a research education curriculum in an independent academic medical center general residency program, and assessed the effect on ABSITE scores. The curriculum consisted of five 1-hour monthly research and statistics lectures. The lectures were presented before the 2012 and 2013 examinations. Forty residents completing ABSITE examinations from 2007 to 2013 were included in the study. Two investigators independently identified research-related item topics from examination summary reports. Correct and incorrect responses were compared precurriculum and postcurriculum. Regression models were calculated to estimate improvement in postcurriculum scores, adjusted for individuals' scores over time and postgraduate year level. Residents demonstrated significant improvement in postcurriculum examination scores for research and statistics items. Correct responses increased 27% (P < .001). Residents were 5 times more likely to achieve a perfect score on research and statistics items postcurriculum (P < .001). Residents at all levels demonstrated improved research and statistics scores after receiving the curriculum. Because the ABSITE includes a wide spectrum of research topics, sustained improvements suggest a genuine level of understanding that will promote lifelong evaluation and clinical application of the surgical literature.

Impact of Major Pulmonary Resections on Right Ventricular Function: Early Postoperative Changes.

PubMed

Elrakhawy, Hany M; Alassal, Mohamed A; Shaalan, Ayman M; Awad, Ahmed A; Sayed, Sameh; Saffan, Mohammad M

2018-01-15

Right ventricular (RV) dysfunction after pulmonary resection in the early postoperative period is documented by reduced RV ejection fraction and increased RV end-diastolic volume index. Supraventricular arrhythmia, particularly atrial fibrillation, is common after pulmonary resection. RV assessment can be done by non-invasive methods and/or invasive approaches such as right cardiac catheterization. Incorporation of a rapid response thermistor to pulmonary artery catheter permits continuous measurements of cardiac output, right ventricular ejection fraction, and right ventricular end-diastolic volume. It can also be used for right atrial and right ventricular pacing, and for measuring right-sided pressures, including pulmonary capillary wedge pressure. This study included 178 patients who underwent major pulmonary resections, 36 who underwent pneumonectomy assigned as group (I) and 142 who underwent lobectomy assigned as group (II). The study was conducted at the cardiothoracic surgery department of Benha University hospital in Egypt; patients enrolled were operated on from February 2012 to February 2016. A rapid response thermistor pulmonary artery catheter was inserted via the right internal jugular vein. Preoperatively the following was recorded: central venous pressure, mean pulmonary artery pressure, pulmonary capillary wedge pressure, cardiac output, right ventricular ejection fraction and volumes. The same parameters were collected in fixed time intervals after 3 hours, 6 hours, 12 hours, 24 hours, and 48 hours postoperatively. For group (I): There were no statistically significant changes between the preoperative and postoperative records in the central venous pressure and mean arterial pressure; there were no statistically significant changes in the preoperative and 12, 24, and 48 hour postoperative records for cardiac index; 3 and 6 hours postoperative showed significant changes. There were statistically significant changes between the preoperative and postoperative records for heart rate, mean pulmonary artery pressure, pulmonary capillary wedge pressure, pulmonary vascular resistance, right ventricular ejection fraction and right ventricular end diastolic volume index, in all postoperative records. For group (II): There were no statistically significant changes between the preoperative and all postoperative records for the central venous pressure, mean arterial pressure and cardiac index. There were statistically significant changes between the preoperative and postoperative records for heart rate, mean pulmonary artery pressure, pulmonary capillary wedge pressure, pulmonary vascular resistance, right ventricular ejection fraction and right ventricular end diastolic volume index in all postoperative records. There were statistically significant changes between the two groups in all postoperative records for heart rate, mean pulmonary artery pressure, pulmonary capillary wedge pressure, pulmonary vascular resistance, right ventricular ejection fraction and right ventricular end diastolic volume index. There is right ventricular dysfunction early after major pulmonary resection caused by increased right ventricular afterload. This dysfunction is more present in pneumonectomy than in lobectomy. Heart rate, mean pulmonary artery pressure, pulmonary capillary wedge pressure, pulmonary vascular resistance, right ventricular ejection fraction, and right ventricular end diastolic volume index are significantly affected by pulmonary resection.

Influence of bismuth oxide concentration on the pH level and biocompatibility of white Portland cement.

PubMed

Marciano, Marina Angélica; Garcia, Roberto Brandão; Cavenago, Bruno Cavalini; Minotti, Paloma Gagliardi; Midena, Raquel Zanin; Guimarães, Bruno Martini; Ordinola-Zapata, Ronald; Duarte, Marco Antonio Hungaro

2014-01-01

To investigate if there is a relation between the increase of bismuth oxide and the decrease of pH levels and an intensification of toxicity in the Portland cement. White Portland cement (WPC) was mixed with 0, 15, 20, 30 and 50% bismuth oxide, in weight. For the pH level test, polyethylene tubes were filled with the cements and immersed in Milli-Q water for 15, 30 and 60 days. After each period, the increase of the pH level was assessed. For the biocompatibility, two polyethylene tubes filled with the cements were implanted in ninety albino rats (n=6). The analysis of the intensity of the inflammatory infiltrate was performed after 15, 30 and 60 days. The statistical analysis was performed using the Kruskal-Wallis, Dunn and Friedman tests for the pH level and the Kruskal-Wallis and Dunn tests for the biological analysis (p<0.05). The results showed an increase of the pH level after 15 days, followed by a slight increase after 30 days and a decrease after 60 days. There were no significant statistical differences among the groups (p>0.05). For the inflammatory infiltrates, no significant statistical differences were found among the groups in each period (p>0.05). The 15% WPC showed a significant decrease of the inflammatory infiltrate from 15 to 30 and 60 days (p<0.05). The addition of bismuth oxide into Portland cement did not affect the pH level and the biological response. The concentration of 15% of bismuth oxide resulted in significant reduction in inflammatory response in comparison with the other concentrations evaluated.

The possibility of left dominant activation of the sensorimotor cortex during lip protrusion in men.

PubMed

Fukunaga, Atsushi; Ohira, Takayuki; Kamba, Masayuki; Ogawa, Seiji; Akiyama, Takenori; Kawase, Takeshi

2009-09-01

Lip protrusion requires bilateral symmetrical movements of the facial muscles, but the laterality of the activated sensorimotor cortex corresponding to the area of the face activated during lip protrusion remains under discussion. In this study, blood-oxygenation-level-dependent (BOLD) responses in the sensorimotor cortex during non-verbal lip protrusion were evaluated in a 3T magnetic field in twenty healthy right-handed subjects. The results showed that the activated sensorimotor area on the left side was larger than that on the right side, and there was a statistically significant difference in the number of activated voxels between the left and right sensorimotor cortex in an individual study of the male group, although approximately symmetrical motor action potentials of facial muscles were recorded during lip protrusion. There was a statistically significant difference in interaction between the hemisphere (right and left) and sex (men and women) and multiple comparison test showed statistical significant differences between "men and right" and "men and left", and between "men and left" and "women and left". The peak value of the percent changes in BOLD signal responses on the left side was approximately twice as high as that on the right side in the males of the group, though the bilateral sensorimotor cortex was almost equally activated in the females in the group. In addition, the left primary sensory area related to the face area was significantly activated as a region where Male was more active than Female in a general linear model (multi-study, multisubject) analysis. This study revealed the possibility that the left sensorimotor cortex was more closely involved in non-verbal mouth movement in men, suggesting sex-related differences in sensorimotor cortex activation.

Corneal Thickness Response after Anesthetic Eye Drops: Our Own Results and Meta-Analysis

PubMed Central

Calvo-Maroto, Ana M.; Moscardo, Monica; Murillo-Llorente, Mayte

2018-01-01

We aimed to test if there are different patterns in the central corneal thickness (CCT) response after instilling oxybuprocaine anesthetic eye drops and also to determine whether there is a significant change in the CCT. CCT was measured in 60 eyes of 60 healthy subjects before and during the hour after oxybuprocaine 0.4% eye drops were instilled. In addition, a systematic review and meta-analysis were carried out in order to answer the following PICO (patient, intervention, comparison, and outcome) question: What effect do anesthetic eye drops have on CCT values? We found no significant changes in the mean CCT values during the hour's observation (ANOVA, p = 0.209), and the meta-analysis revealed no statistically significant changes in the CCT after anesthesia (Q-Value = 1.111; p value = 1.000; I2 = 0.000; Tau2 = 0.000; Stderr = 0.020). However, we found three CCT response patterns 5 minutes after anesthesia: Pattern 1, subjects with no significant changes in their CCT values (n = 14, 46.7%); Pattern 2, subjects with significant CCT increases (n = 11, 36.7%); and Pattern 3, subjects with significant CCT decreases (n = 5, 16.7%). In sum, there are no significant changes in the CCT after anesthesia, but there are three different CCT response patterns 5 minutes after anesthesia. PMID:29693008

Corneal Thickness Response after Anesthetic Eye Drops: Our Own Results and Meta-Analysis.

PubMed

Perez-Bermejo, Marcelino; Cervino, Alejandro; Calvo-Maroto, Ana M; Moscardo, Monica; Murillo-Llorente, Mayte; Sanchis-Gimeno, Juan A

2018-01-01

We aimed to test if there are different patterns in the central corneal thickness (CCT) response after instilling oxybuprocaine anesthetic eye drops and also to determine whether there is a significant change in the CCT. CCT was measured in 60 eyes of 60 healthy subjects before and during the hour after oxybuprocaine 0.4% eye drops were instilled. In addition, a systematic review and meta-analysis were carried out in order to answer the following PICO (patient, intervention, comparison, and outcome) question: What effect do anesthetic eye drops have on CCT values? We found no significant changes in the mean CCT values during the hour's observation (ANOVA, p = 0.209), and the meta-analysis revealed no statistically significant changes in the CCT after anesthesia ( Q -Value = 1.111; p value = 1.000; I 2 = 0.000; Tau2 = 0.000; Stderr = 0.020). However, we found three CCT response patterns 5 minutes after anesthesia: Pattern 1, subjects with no significant changes in their CCT values ( n = 14, 46.7%); Pattern 2, subjects with significant CCT increases ( n = 11, 36.7%); and Pattern 3, subjects with significant CCT decreases ( n = 5, 16.7%). In sum, there are no significant changes in the CCT after anesthesia, but there are three different CCT response patterns 5 minutes after anesthesia.

Damage detection of engine bladed-disks using multivariate statistical analysis

NASA Astrophysics Data System (ADS)

Fang, X.; Tang, J.

2006-03-01

The timely detection of damage in aero-engine bladed-disks is an extremely important and challenging research topic. Bladed-disks have high modal density and, particularly, their vibration responses are subject to significant uncertainties due to manufacturing tolerance (blade-to-blade difference or mistuning), operating condition change and sensor noise. In this study, we present a new methodology for the on-line damage detection of engine bladed-disks using their vibratory responses during spin-up or spin-down operations which can be measured by blade-tip-timing sensing technique. We apply a principle component analysis (PCA)-based approach for data compression, feature extraction, and denoising. The non-model based damage detection is achieved by analyzing the change between response features of the healthy structure and of the damaged one. We facilitate such comparison by incorporating the Hotelling's statistic T2 analysis, which yields damage declaration with a given confidence level. The effectiveness of the method is demonstrated by case studies.

Effects of Antiseptics on Pulpal Healing under Calcium Hydroxide Pulp Capping: A Pilot Study

PubMed Central

Bal, Cenkhan; Alacam, Alev; Tuzuner, Tamer; Tirali, Resmiye Ebru; Baris, Emre

2011-01-01

Objectives: The objective of this pilot study was to evaluate the effects of three different antiseptic materials on healing processes of direct pulp therapies with Ca(OH)2 histopathologically. Methods: Twenty-eight upper and lower first molar teeth from 7 male Wistar rats were used in this study. Four cavities were prepared in each rat in four quadrants, and each quadrant represented different experimental groups. In Group I: 0.5% sodium hypochlorite (NaOCl); in Group II: 2% chlorhexidine digluconate (CHX); in Group III: 0.1% octenidine dihydrochloride (OCT); and in Group IV 0.9% sterile saline was applied to the exposure site with a sterile cotton pellet for 3 minutes. After hemorrhage control, the pulps were capped with hard setting Ca(OH)2 and, finally, restored with IRM. The animals were euthanized at 21 days post-operatively. After sacrificing, routine histological procedures were performed and evaluated statistically with non-parametric Kruskal-Wallis test among the groups and two-by-two comparisons by using the Mann-Whitney U test for inflammatory response and tissue organization scores at the confidence interval of 95%. Results: There were significant differences in inflammatory response and tissue organization scores between the groups (P<.05). Statistical evaluation of inflammatory response showed that Group IV was significantly different from Groups I, II and III separately with a higher inflammatory cell response (P<.05) whereas no significant differences were detected between the other groups in two-by-two comparisons (P>.05). Healthy coronal and radicular pulp tissue organization scores indicated that the Group I has better pulp tissue organization than Group IV and this was significantly different (P<.05) whereas no significant differences were observed between the other groups separately (P>.05). Conclusions: The antiseptic materials used in this study created an environment that, rather than saline solution, may affect clinical and histological success in a positive way. PMID:21769267

Voice Response System Statistics Program : Operational Handbook.

DOT National Transportation Integrated Search

1980-06-01

This report documents the Voice Response System (VRS) Statistics Program developed for the preflight weather briefing VRS. It describes the VRS statistical report format and contents, the software program structure, and the program operation.

[Effect of self-foot reflexology massage on depression, stress responses and immune functions of middle aged women].

PubMed

Lee, Yun-Mi

2006-02-01

This study was aimed to identify the effects of a self-foot reflexology massage on depression, stress responses and functions of the immune system of middle-aged women. This study was a one group pretest-posttest experimental design and the data was collected from August 1st, 2004 to May 31st, 2005. The subjects consisted of 46 middle-aged women (40 - 64 years) who were recruited from the Community Health Center in Busan city. Subjects were not treated for 4 weeks, subsequently they were trained in self foot reflexology massage for 2 weeks, and then they did their own daily for 6 weeks (2 days at the research center, 5 days at home). The outcome variables were measured 4 times, at baseline, pre training, after training, and after the intervention. The collected data was analyzed using repeated measure ANOVA by the SPSS/WIN program. There was a statistically significant difference in depression, perceived stress, systolic blood pressure, natural-killer cells and Ig G. However, there was not a statistically significant difference in diastolic blood pressure, pulse or serum cortisol. These results suggest that a self-foot reflexology massage could be utilized as an effective nursing intervention to reduce depression and stress responses, and to strengthen immune systems in middle-aged women.

Interventions for unilateral refractive amblyopia.

PubMed

Shotton, Kate; Powell, Christine; Voros, Gerasimos; Hatt, Sarah R

2008-10-08

Unilateral refractive amblyopia is a common cause of reduced visual acuity in childhood, but optimal treatment is not well defined. This review examined the treatment effect from spectacles and conventional occlusion. Evaluation of the evidence of the effectiveness of spectacles and or occlusion in the treatment of unilateral refractive amblyopia. We searched the Cochrane Central Register of Controlled Trials (CENTRAL), MEDLINE, EMBASE and LILACS. Relevant conference proceedings were manually searched. There were no date or language restrictions. The searches were last run on 7 July 2008. Randomised controlled trials of treatment for unilateral refractive amblyopia by spectacles, with or without occlusion were eligible. We included studies with participants of any age. Two authors independently assessed abstracts identified by the searches. We obtained full text copies and contacted study authors where necessary. Eight trials were eligible for inclusion. Data were extracted from seven. No meta-analysis was performed. For all studies mean acuity (standard deviation (SD)) in the amblyopic eye post treatment is reported.Comparison: Spectacles only versus no treatment (Clarke 2003). Mean (SD) visual acuity: spectacles group 0.31 (0.17); no treatment group 0.42 (0.19). Mean difference (MD) between groups -0.11 (borderline statistical significance: 95% confidence interval (CI) -0.22 to 0.00).Comparison: Spectacles plus occlusion versus no treatment (Clarke 2003). Mean (SD) visual acuity: full treatment 0.22 (0.13); no treatment 0.42 (0.19). Mean difference between the groups -0.20 (statistically significant: 95% CI -0.30 to -0.10).Comparison: Spectacles plus occlusion versus spectacles only: Clarke 2003 MD -0.09 (borderline statistical significance 95% CI, -0.18 to 0.00); PEDIG 2005b; MD -0.15 (not statistically significant 95% CI -0.32 to 0.02); PEDIG 2006a; MD 0.01 (not statistically significant 95% CI -0.08 to 0.10).Comparison: Occlusion regimes. PEDIG 2003a: 2 hours versus 6 hours for moderate amblyopia: MD 0.01 (not statistically significant: 95% CI -0.06 to 0.08); PEDIG 2003b: 6 hours versus full-time for severe amblyopia: MD 0.03 (not statistically significant: 95% CI -0.08 to 0.14). Stewart 2007a: 6 hours versus full-time occlusion: MD -0.12 (not statistically significant: 95% CI -0.27 to 0.03) In some cases of unilateral refractive amblyopia it appears that there is a treatment benefit from refractive correction alone. Where amblyopia persists there is some evidence that adding occlusion further improves vision. It remains unclear which treatment regimes are optimal for individual patients. The nature of any dose/response effect from occlusion still needs to be clarified.

Meaning of Parental Involvement among Korean Immigrant Parents: A Mixed-Methods Approach

ERIC Educational Resources Information Center

Kim, Yanghee Anna; An, Sohyun; Kim, Hyun Chu Leah; Kim, Jihye

2018-01-01

The authors' goal was to identify ways in which Korean immigrant parents define the concept of parental involvement and to examine the statistical significances of interrelationships among these meanings. Seventy-seven parents responded to an open-ended question that asked them to define the meaning of parental involvement; 141 responses were…

Empathy, Self-Reflection, and Curriculum Choice

ERIC Educational Resources Information Center

Grosseman, Suely; Hojat, Mohammadreza; Duke, Pamela M.; Mennin, Stewart; Rosenzweig, Steven; Novack, Dennis

2014-01-01

We administered the Jefferson Scale of Empathy and the Groningen Reflection Ability Scale to 61 of 64 entering medical students who self-selected a problem-based learning curricular track and to 163 of 198 who self-selected a lecture-based track (response rates of 95.3% and 82.3%, respectively, with no statistically significant differences in mean…

The Length of a Pestle: A Class Exercise in Measurement and Statistical Analysis.

ERIC Educational Resources Information Center

O'Reilly, James E.

1986-01-01

Outlines the simple exercise of measuring the length of an object as a concrete paradigm of the entire process of making chemical measurements and treating the resulting data. Discusses the procedure, significant figures, measurement error, spurious data, rejection of results, precision and accuracy, and student responses. (TW)

Monitoring of Educational Performance Indicators in Higher Education: A Comparison of Perceptions

ERIC Educational Resources Information Center

Sencan, Hüner; Karabulut, A. Tugba

2015-01-01

The purpose of this study is to explore whether there is a statistically significant difference between the ideas of university administrators and faculty members regarding how strictly Educational Performance Indicators for Educators (EPIE) should be monitored in the educational process. The responses of university directors were compared with…

Use of statistical design of experiments for surface modification of Kapton films by CF4sbnd O2 microwave plasma treatment

NASA Astrophysics Data System (ADS)

Grandoni, Andrea; Mannini, Giacomo; Glisenti, Antonella; Manariti, Antonella; Galli, Giancarlo

2017-10-01

A statistical design of experiments (DoE) was used to evaluate the effects of CF4sbnd O2 plasma on Kapton films in which the duration of treatment, volume ratio of plasma gases, and microwave power were selected as effective experimental factors for systematic investigation of surface modification. Static water contact angle (θW), polar component of surface free energy (γSp) and surface O/C atomic ratio were analyzed as response variables. A significant enhancement in wettability and polarity of the treated films compared to untreated Kapton films was observed; depending on the experimental conditions, θW very significantly decreased, showing full wettability, and γSp rose dramatically, up to ten times. Within the DoE the conditions of plasma treatment were identified that resulted in selected optimal values of θW, γSp and O/C responses. Surface chemical changes were detected by XPS and ATR-IR investigations that evidenced both the introduction of fluorinated groups and the opening of the imide ring in the plasma-treated films.

Clinical Pharmacokinetics and Pharmacodynamics of Atezolizumab in Metastatic Urothelial Carcinoma.

PubMed

Stroh, M; Winter, H; Marchand, M; Claret, L; Eppler, S; Ruppel, J; Abidoye, O; Teng, S L; Lin, W T; Dayog, S; Bruno, R; Jin, J; Girish, S

2017-08-01

Atezolizumab, a humanized immunoglobulin G1 (IgG1) monoclonal antibody targeting human programmed death-ligand 1 (PD-L1), is US Food and Drug Administration (FDA) approved in metastatic urothelial carcinoma (MUC) and is being investigated in various malignancies. This analysis based upon 906 patients from two phase I and one phase II MUC studies, is the first report of the clinical pharmacokinetics (PK) and pharmacodynamics (PD) of atezolizumab. Atezolizumab exhibited linear PK over a dose range of 1-20 mg/kg, including the labeled 1,200 mg dose. The clearance, volume of distribution, and terminal half-life estimates from population pharmacokinetic (PopPK) analysis of 0.200 L/day, 6.91 L, and 27 days, respectively, were as expected for an IgG1. Exposure-response analyses did not identify statistically significant relationships with either objective response rate or adverse events of grades 3-5 or of special interest. None of the statistically significant covariates from PopPK (body weight, gender, antitherapeutic antibody, albumin, and tumor burden) would require dose adjustment. © 2016 American Society for Clinical Pharmacology and Therapeutics.

Preliminary study on pharmacokinetics of dacarbazine and fotemustine in glioblastoma multiforme patients does not indicate gender-specific differences.

PubMed

Fazeny-Dörner, Barbara; Mader, Robert M; Piribauer, Maria; Rizovski, Blanka; Stögermaier, Barbara; Marosi, Christine

2004-06-01

Twelve patients (six female and six male) with histologically proven glioblastoma multiforme were investigated during the administration of the first cycle of dacarbazine (D; 200 mg/m) and fotemustine (F; 100 mg/m). In total, 18 blood samples were collected for pharmacokinetic analysis (maximum plasma concentration, area under the concentration-time curve and total clearance) of D and F at 14 time points during therapy. D, its metabolite 5-aminoimidazole-4-carboxamide and F were evaluated by reversed-phase HPLC. For statistical calculations, groups were compared by the non-parametric Wilcoxon test. p<0.05 was considered statistically significant. No significant gender-dependent differences were observed in the pharmacokinetics of D and F. An additional response re-evaluation of 100 patients (50 female and 50 male) with glioblastoma multiforme, treated at our institution with D and F, gave no hint of any gender-dependent different response rates. We conclude that there is no evidence, neither from pharmacokinetic nor from our clinical data, to consider different dosages of D and F in female and male patients with glioblastoma multiforme.

Basal (18)F-FDG PET/CT as a predictive biomarker of tumor response for neoadjuvant therapy in breast cancer.

PubMed

García Vicente, A M; Soriano Castrejón, A; Pruneda-González, R E; Fernández Calvo, G; Muñoz Sánchez, M M; Álvarez Cabellos, R; Espinosa Aunión, R; Relea Calatayud, F

2016-01-01

To explore the relation between tumor kinetic assessed by (18)F-FDG PET and final neoadjuvant chemotherapy (NC) response within a molecular phenotype perspective. Prospective study included 144 women with breast cancer. All patients underwent a dual-time point (18)F-FDG PET/CT previous to NC. The retention index (RI), between SUV-1 and SUV-2 was calculated. Molecular subtypes were re-grouped in low, intermediate and high-risk biological phenotypes. After NC, all residual primary tumor specimens were histopathologically classified in tumor regression grades (TRG) and response groups. The relation between SUV-1, SUV-2 and RI with the TRG and response groups was evaluated in all molecular subtypes and in accordance with the risk categories. Responder's lesions showed significant greater SUVmax compared to non-responders. The RI value did not show any significant relation with response. Attending to molecular phenotypes, statistical differences were observed with greater SUV for responders having high-risk molecular subtypes. Glycolytic tumor characteristics showed a significant correlation with NC response and dependence of risk phenotype. Copyright © 2015 Elsevier España, S.L.U. and SEMNIM. All rights reserved.

Comparison of pain neurophysiology knowledge among health sciences students: a cross-sectional study.

PubMed

Adillón, Cristina; Lozano, Èrik; Salvat, Isabel

2015-10-22

A key tool for use in approaching chronic pain treatment is educating patients to reconceptualize pain. Thus, health professionals are fundamental to the transmission of pain information to patients. Because their understanding of pain is acquired during the educational process, the aim of this study was to compare the knowledge about pain neurophysiology in first and final-year students from three different health science programs at a single University to determine their gain in knowledge using a well-known questionnaire designed to evaluate the understanding of pain. The Neurophysiology of Pain Questionnaire (19 closed-ended questions) was administered to students in their first and final years of study in Medicine, Physiotherapy, or Nutrition. The percentage of correct responses was determined and comparisons of the results were analyzed between the programs as well as between the first and final years of study within each program. For all tests, p-values were two-sided, and results with p-values below 0.05 were considered statistically significant. The participation rate was greater than 51% (n = 285). The mean percentage of correct responses, reported as mean (SD), among the first year students was 42.14 (12.23), without significant statistical differences detected between the programs. The mean percentages of correct responses for students in their final year were as follows: Medicine, 54.38 (13.87); Physiotherapy, 68.92 (16.22); Nutrition, 42.34 (10.11). We found statistically significant differences among all three programs and between the first and final years in Medicine and Physiotherapy. A question-by-question analysis showed that the percentage of correct responses for questions related to the biopsychosocial aspects of pain was higher for students in Physiotherapy than those in Medicine. Students in their final years of Medicine and Physiotherapy programs know more about the neurophysiology of pain than students in their first years of these programs, however there are some questions where first years students have better results. Physiotherapy students have greater knowledge of neurophysiology of pain than Medicine students, especially the biopsychosocial aspects. Even so, their understanding may not be sufficient and does not guarantee an approach to chronic pain that will help patients reconceptualize their pain.

Meta-analysis of the effects of prokinetic agents in patients with functional dyspepsia.

PubMed

Hiyama, Toru; Yoshihara, Masaharu; Matsuo, Keitaro; Kusunoki, Hiroaki; Kamada, Tomoari; Ito, Masanori; Tanaka, Shinji; Nishi, Nobuo; Chayama, Kazuaki; Haruma, Ken

2007-03-01

Functional dyspepsia (FD) is often treated with prokinetic agents; however, the efficacy of prokinetic agents in patients with FD has been questioned recently. The aim of this study was to perform a meta-analysis of the effects of prokinetic agents in patients with FD. Prokinetic agents, including metoclopramide, domperidone, trimebutine, cisapride, itopride and mosapride, used for treatment of FD between 1951 and 2005 were identified. Twenty-seven studies were selected. Difference in the probability of response between the interventional drug and placebo was used as a summary statistic for the treatment effect. Meta-regression analysis was used to detect sources of heterogeneity. In total, 1844 subjects were assigned to an experimental arm, and 1591 subjects were assigned to a placebo arm. Publication bias was ruled out by funnel plot and statistical testing (P = 0.975). In the overall analysis, the summary statistic was 0.295 (95% confidence interval: 0.208-0.382, P < 0.001), indicating that the interventional drug has 30% excess probability of producing a response compared with placebo. The most significant source of heterogeneity was the year of publication (P < 0.001). The data clearly indicate that prokinetic agents are significantly more effective than placebo in the treatment of FD. Although FD is a chronic condition, efficacy was assessed over short periods. Long-term randomized controlled trials are needed to confirm the effect.

Results from the Xylitol for Adult Caries Trial (X-ACT)

PubMed Central

Bader, James D.; Vollmer, William M.; Shugars, Daniel A.; Gilbert, Gregg H.; Amaechi, Bennett T.; Brown, John P.; Laws, Reesa L.; Funkhouser, Kimberly A.; Makhija, Sonia K.; Ritter, André V.; Leo, Michael C.

2013-01-01

Background Although caries is prevalent in adults, few preventive therapies have been tested in adult populations. This randomized clinical trial evaluated the effectiveness of xylitol lozenges in preventing caries in elevated caries-risk adults. Methods X-ACT was a three-site placebo-controlled randomized trial. Participants (n=691) ages 21–80 consumed five 1.0 g xylitol or placebo lozenges daily for 33 months. Clinical examinations occurred at baseline, 12, 24 and 33 months. Results Xylitol lozenges reduced the caries increment 11%. This reduction, which represented less than one-third of a surface per year, was not statistically significant. There was no indication of a dose-response effect. Conclusions Daily use of xylitol lozenges did not result in a statistically or clinically significant reduction in 33-month caries increment among elevated caries-risk adults. Clinical Implications These results suggest that xylitol used as a supplement in adults does not significantly reduce their caries experience. PMID:23283923

Exploring Attitudes of Indian Classical Singers Toward Seeking Vocal Health Care.

PubMed

Gunjawate, Dhanshree R; Aithal, Venkataraja U; Guddattu, Vasudeva; Kishore, Amrutha; Bellur, Rajashekhar

2016-11-01

The attitude of Indian classical singers toward seeking vocal health care is a dimension yet to be explored. The current study was aimed to determine the attitudes of these singers toward seeking vocal health care and further understand the influence of age and gender. Cross-sectional. A 10-item self-report questionnaire adapted from a study on contemporary commercial music singers was used. An additional question was added to ask if the singer was aware about the profession and role of speech-language pathologists (SLPs). The questionnaire was administered on 55 randomly selected self-identified trained Indian classical singers who rated the items using a five-point Likert scale. Demographic variables were summarized using descriptive statistics and t test was used to compare the mean scores between genders and age groups. Of the singers, 78.2% were likely to see a doctor for heath-related problems, whereas 81.8% were unlikely to seek medical care for voice-related problems; the difference was statistically significant (P < 0.001). Responses for the questions assessing the attitudes toward findings from medical examination by a specialist revealed a statistically significant difference (P = 0.02) between the genders. Age did not have a significant influence on the responses. Only 23.6% of the respondents were aware about the profession and the role of SLPs. The findings are in tune with western literature reporting hesitation of singers toward seeking vocal health care and draws attention of SLPs to promote their role in vocal health awareness and management. Copyright © 2016 The Voice Foundation. Published by Elsevier Inc. All rights reserved.

The Health, Enlightenment, Awareness, and Living (HEAL) Intervention: Outcome of an HIV and Hepatitis B and C Risk Reduction Intervention

PubMed Central

Henry-Akintobi, Tabia; Laster, Nastassia; Trotter, Jennie; Jacobs, DeBran; Johnson, Tarita; King Gordon, Tandeca; Miller, Assia

2016-01-01

African American women have among the highest HIV/AIDS and hepatitis B and C incidence rates in the United States, especially among those homeless or incarcerated. The objective of this study was to evaluate the Health Enlightenment, Awareness and Living Intervention, designed to decrease HIV/AIDS, hepatitis and related risky behaviors. The thirteen-session intervention was implemented among homeless and formerly incarcerated low-income African American women, ages 18 to 55, in Atlanta, Georgia from 2006 to 2010. A single group repeated measures study design was employed and consisted of a pre-test (n = 355) group, an immediate post-test (n = 228) group with a response rate of 64%, and a six-month follow up (n = 110) group with response rate of 48%, completing a 135-item survey. Paired-sample t-tests, McNemar tests, and repeated measures ANOVA were applied to compare survey results. Participants demonstrated statistically significant increases in hepatitis B and C knowledge over time (p < 0.001). Statistically significant decreases were also reported for unprotected sex in exchange for money, drugs or shelter (p = 0.008), and sex under the influence of drugs or alcohol (p < 0.001). Reported substance use decreased with statistical significance for alcohol (p = 0.011), marijuana (p = 0.011), illegal drugs (p = 0.002), and crack/cocaine (p = 0.003). Findings broaden the evidence base related to the effectiveness of HIV/AIDS and hepatitis risk reduction interventions designed for homeless and previously incarcerated African American women. PMID:27669284

Clinical, Radiologic, and Legal Significance of "Extensor Response" in Posttraumatic Coma.

PubMed

Firsching, Raimund; Woischneck, Dieter; Langejürgen, Alexander; Parreidt, Andreas; Bondar, Imre; Skalej, Martin; Röhl, Friedrich; Voellger, Benjamin

2015-11-01

The timely detection of neurologic deterioration can be critical for the survival of a neurosurgical patient following head injury. Because little reliable evidence is available on the prognostic value of the clinical sign "extensor response" in comatose posttraumatic patients, we investigated the correlation of this clinical sign with outcome and with early radiologic findings from magnetic resonance imaging (MRI). This retrospective analysis of prospectively obtained data included 157 patients who had remained in a coma for a minimum of 24 hours after traumatic brain injury. All patients received a 1.5-T MRI within 10 days (median: 2 days) of the injury. The correlations between clinical findings 12 and 24 hours after the injury-in particular, extensor response and pupillary function, MRI findings, and outcome after 1 year-were investigated. Statistical analysis included contingency tables, Fisher exact test, odds ratios (ORs) with confidence intervals (CIs), and weighted κ values. There were 48 patients with extensor response within the first 24 hours after the injury. Patients with extensor response (World Federation of Neurosurgical Societies coma grade III) statistically were significantly more likely to harbor MRI lesions in the brainstem when compared with patients in a coma who had no further deficiencies (coma grade I; p = 0.0004 by Fisher exact test, OR 10.8 with 95% CI, 2.7-42.5) and patients with unilateral loss of pupil function (coma grade II; p = 0.0187, OR 2.8 with 95% CI, 1.2-6.5). The correlation of brainstem lesions as found by MRI and outcome according to the Glasgow Outcome Scale after 1 year was also highly significant (p ≤ 0.016). The correlation of extensor response and loss of pupil function with an unfavorable outcome and with brainstem lesions revealed by MRI is highly significant. Their sudden onset may be associated with the sudden onset of brainstem dysfunction and should therefore be regarded as one of the most fundamental warning signs in the clinical monitoring of comatose patients. Georg Thieme Verlag KG Stuttgart · New York.

Ifosfamide in the treatment of recurrent or disseminated lung cancer: a phase II study of two dose schedules.

PubMed

Costanzi, J J; Gagliano, R; Loukas, D; Panettiere, F J; Hokanson, J A

1978-05-01

Ifosfamide was administered to 21 patients with recurrent or disseminated lung cancer at a dose of 4.0 gm/M2 iv every 3 weeks. The response rate was 33% with an additional 14% showing no response or stable disease. At a dose of 1.2 gm/M2 daily for 5 days every 4 weeks, 57% of 14 patients responded with 35% showing no response or stable disease. The majority of the patients (28) had epidermoid carcinoma. Two (7%) had complete response with 9 (32%) showing partial responses. Other responses included 1/2 oat cell carcinomas and 3/6 large cell undifferentiated carcinomas. Toxicity was equal in both regimens for nausea, vomiting, increased serum LDH and neutropenia but the 5 day program had significantly less hemorrhagic cystitis. Survival was greatly influenced by response. There was no statistical difference in overall length of response between responders and the non responding/stable disease patients. But these two groups had a very significant survival advantage when compared to those patients with increasing disease. Similarly, there was a significant improvement in response duration for the low dosage regimen. Therefore, the low dose 5 day regimen is recommended because of its response rate, it has less hemorrhagic cystitis and it has better patient acceptance in that it can be given as an outpatient and does not require a Foley catheter.

Immunomodulatory Effects of Levofloxacin on Patients with Pneumonia in Assiut University Hospitals.

PubMed

Badari, Mohamed S; Elgendy, Sherein G; Mohamed, Asmaa S; Hassan, Alaa T

2015-01-01

The immunomodulatory effects of antibiotics could influence the degree of systemic and local responses to infection, so investigation of their intrinsic influence on the host's inflammatory response appears to be essential. Fluoroquinolones are known to exert modulatory activity on immune responses to microbial infection. However the mechanism of this immunmodulation has not been well elucidated. The aim of the work, is to assess the immunomodulatory effects of a levofloxacin, through examining its effect on the concentrations of tumor necrosis factor α (TNF-α) and Interleukin - 10 (IL-10) in serum of pneumonic patients. After following local research ethics committee approval and informed consent. This study included 40 patients with different types of pneumonia, admitted to department of Chest Diseases, Faculty of Medicine, Assiut University Hospitals, Egypt. Also, 10 healthy volunteers served as randomized controls. Both patients and controls received levofloxacin (750 mg once daily for 10 days). Serum levels of TNF-α and IL-10 were measured in patients and control before and after levofloxacin administration (750 mg once daily for 10 days) using human TNF-α and IL-10 ELISA kits respectively. Levofloxacin caused a statistically significant decrease in the mean level of TNF-α in both patients (20.82 ± 1.31 pg/ml) (P < 0.009) and control group (17.12 ± 0.84 pg/ml) (P < 0.004). In contrast, there was statistically significant increase (P < 0.000) in the mean level of IL-1 0 in patients (61.75 ± 2.85 pg/ml) while statistically significant decrease (P < 0.005) in control group (28.57 ± 1.37 pg/ml). In conclusion, our study demonstrates that treatment with levofloxacin affects production of TNF-α as a pro-inflammatory cytokine and IL-10 as an anti-inflammatory cytokines which may provide additional benefits in treatment of respiratory tract infections that are independent of its antibacterial properties.

Biomarker profiling in reef corals of Tonga’s Ha’apai and Vava’u archipelagos

PubMed Central

Chen, Chii-Shiarng; Dempsey, Alexandra C.

2017-01-01

Given the significant threats towards Earth’s coral reefs, there is an urgent need to document the current physiological condition of the resident organisms, particularly the reef-building scleractinians themselves. Unfortunately, most of the planet’s reefs are understudied, and some have yet to be seen. For instance, the Kingdom of Tonga possesses an extensive reef system, with thousands of hectares of unobserved reefs; little is known about their ecology, nor is there any information on the health of the resident corals. Given such knowledge deficiencies, 59 reefs across three Tongan archipelagos were surveyed herein, and pocilloporid corals were sampled from approximately half of these surveyed sites; 10 molecular-scale response variable were assessed in 88 of the sampled colonies, and 12 colonies were found to be outliers based on employment of a multivariate statistics-based aberrancy detection system. These outliers differed from the statistically normally behaving colonies in having not only higher RNA/DNA ratios but also elevated expression levels of three genes: 1) Symbiodinium zinc-induced facilitator-like 1-like, 2) host coral copper-zinc superoxide dismutase, and 3) host green fluorescent protein-like chromoprotein. Outliers were also characterized by significantly higher variation amongst the molecular response variables assessed, and the response variables that contributed most significantly to colonies being delineated as outliers differed between the two predominant reef coral species sampled, Pocillopora damicornis and P. acuta. These closely related species also displayed dissimilar temporal fluctuation patterns in their molecular physiologies, an observation that may have been driven by differences in their feeding strategies. Future works should attempt to determine whether corals displaying statistically aberrant molecular physiology, such as the 12 Tongan outliers identified herein, are indeed characterized by a diminished capacity for acclimating to the rapid changes in their abiotic milieu occurring as a result of global climate change. PMID:29091723

Using Statistical Natural Language Processing for Understanding Complex Responses to Free-Response Tasks

ERIC Educational Resources Information Center

DeMark, Sarah F.; Behrens, John T.

2004-01-01

Whereas great advances have been made in the statistical sophistication of assessments in terms of evidence accumulation and task selection, relatively little statistical work has explored the possibility of applying statistical techniques to data for the purposes of determining appropriate domain understanding and to generate task-level scoring…

Network Controllability in the Inferior Frontal Gyrus Relates to Controlled Language Variability and Susceptibility to TMS.

PubMed

Medaglia, John D; Harvey, Denise Y; White, Nicole; Kelkar, Apoorva; Zimmerman, Jared; Bassett, Danielle S; Hamilton, Roy H

2018-06-08

In language production, humans are confronted with considerable word selection demands. Often, we must select a word from among similar, acceptable, and competing alternative words in order to construct a sentence that conveys an intended meaning. In recent years, the left inferior frontal gyrus (LIFG) has been identified as critical to this ability. Despite a recent emphasis on network approaches to understanding language, how the LIFG interacts with the brain's complex networks to facilitate controlled language performance remains unknown. Here, we take a novel approach to understand word selection as a network control process in the brain. Using an anatomical brain network derived from high-resolution diffusion spectrum imaging (DSI), we computed network controllability underlying the site of transcranial magnetic stimulation in the LIFG between administrations of language tasks that vary in response (cognitive control) demands: open-response (word generation) vs. closed-response (number naming) tasks. We find that a statistic that quantifies the LIFG's theoretically predicted control of communication across modules in the human connectome explains TMS-induced changes in open-response language task performance only. Moreover, we find that a statistic that quantifies the LIFG's theoretically predicted control of difficult-to-reach states explains vulnerability to TMS in the closed-ended (but not open-ended) response task. These findings establish a link between network controllability, cognitive function, and TMS effects. SIGNIFICANCE STATEMENT This work illustrates that network control statistics applied to anatomical connectivity data demonstrate relationships with cognitive variability during controlled language tasks and TMS effects. Copyright © 2018 the authors.

Disclosure of Medical Errors: What Factors Influence How Patients Respond?

PubMed Central

Mazor, Kathleen M; Reed, George W; Yood, Robert A; Fischer, Melissa A; Baril, Joann; Gurwitz, Jerry H

2006-01-01

BACKGROUND Disclosure of medical errors is encouraged, but research on how patients respond to specific practices is limited. OBJECTIVE This study sought to determine whether full disclosure, an existing positive physician-patient relationship, an offer to waive associated costs, and the severity of the clinical outcome influenced patients' responses to medical errors. PARTICIPANTS Four hundred and seven health plan members participated in a randomized experiment in which they viewed video depictions of medical error and disclosure. DESIGN Subjects were randomly assigned to experimental condition. Conditions varied in type of medication error, level of disclosure, reference to a prior positive physician-patient relationship, an offer to waive costs, and clinical outcome. MEASURES Self-reported likelihood of changing physicians and of seeking legal advice; satisfaction, trust, and emotional response. RESULTS Nondisclosure increased the likelihood of changing physicians, and reduced satisfaction and trust in both error conditions. Nondisclosure increased the likelihood of seeking legal advice and was associated with a more negative emotional response in the missed allergy error condition, but did not have a statistically significant impact on seeking legal advice or emotional response in the monitoring error condition. Neither the existence of a positive relationship nor an offer to waive costs had a statistically significant impact. CONCLUSIONS This study provides evidence that full disclosure is likely to have a positive effect or no effect on how patients respond to medical errors. The clinical outcome also influences patients' responses. The impact of an existing positive physician-patient relationship, or of waiving costs associated with the error remains uncertain. PMID:16808770

A critique of the use of indicator-species scores for identifying thresholds in species responses

USGS Publications Warehouse

Cuffney, Thomas F.; Qian, Song S.

2013-01-01

Identification of ecological thresholds is important both for theoretical and applied ecology. Recently, Baker and King (2010, King and Baker 2010) proposed a method, threshold indicator analysis (TITAN), to calculate species and community thresholds based on indicator species scores adapted from Dufrêne and Legendre (1997). We tested the ability of TITAN to detect thresholds using models with (broken-stick, disjointed broken-stick, dose-response, step-function, Gaussian) and without (linear) definitive thresholds. TITAN accurately and consistently detected thresholds in step-function models, but not in models characterized by abrupt changes in response slopes or response direction. Threshold detection in TITAN was very sensitive to the distribution of 0 values, which caused TITAN to identify thresholds associated with relatively small differences in the distribution of 0 values while ignoring thresholds associated with large changes in abundance. Threshold identification and tests of statistical significance were based on the same data permutations resulting in inflated estimates of statistical significance. Application of bootstrapping to the split-point problem that underlies TITAN led to underestimates of the confidence intervals of thresholds. Bias in the derivation of the z-scores used to identify TITAN thresholds and skewedness in the distribution of data along the gradient produced TITAN thresholds that were much more similar than the actual thresholds. This tendency may account for the synchronicity of thresholds reported in TITAN analyses. The thresholds identified by TITAN represented disparate characteristics of species responses that, when coupled with the inability of TITAN to identify thresholds accurately and consistently, does not support the aggregation of individual species thresholds into a community threshold.

Retrospective review of diphencyprone in the treatment of alopecia areata.

PubMed

Lamb, R C; Young, D; Holmes, S

2016-06-01

Contact immunotherapy with diphencyprone (DCP) is used to treat alopecia areata (AA). Its reported efficacy is variable, and individual response cannot be predicted. To identify patient and treatment course variables that may affect treatment outcome, and to review DCP service to identify potential areas for development and improvement. This was a retrospective review of a DCP service over a 20-year period (1991-2010). Complete data was available for 205 treatment courses, and 162 (79%) treatment courses were completed for 133 patients. Overall, 72.2% (96/133) of patients had some hair regrowth (any grade). In 15.8% of cases (21/133), response was > 90% regrowth. However, 27.1% (36/133) had no response. We found that extent of alopecia at baseline and duration of disease were statistically significant when comparing patients with an optimal outcome to those without (P < 0.05). In contrast to other reports, atopy, age at onset and nail dystrophy were not statistically significant. For patients receiving more than one course, response to DCP treatment was broadly consistent. Extent of alopecia at baseline and duration of disease are important factors in predicting response. Our results suggest that atopy should not be considered a predictor of poor outcome with respect to DCP treatment. A need for improved data collection, particularly regarding longer-term outcomes, was identified. The role of maintenance therapy requires objective assessment. Opportunities for DCP self-administration by patients should be explored. Limitations of this study include the retrospective nature of the review and lack of long-term follow-up data. © 2015 British Association of Dermatologists.

[Influence of a high-carbohydrate meal on taste perception].

PubMed

Suchecka, Wanda; Klimacka-Nawrot, Ewa; Gałazka, Andrzej; Hartman, Magdalena; Błońska-Fajfrowska, Barbara

2011-01-01

Taste sensitivity varies greatly in individuals and depends on many external and metabolic conditions. The studied group consisted of healthy, non-smoking 41 women and 40 men, aged 19-29. The volunteers were examined in fasting state and after a high-carbohydrate meal. Taste sensitivity to sweet, salty and sour as well as hedonic response to taste were examined by means of gustometry examination recommended by Polski Komitet Normalizacyjny (Polish Committee for Standardization). It has been shown that in women the meal did not influence the intensity of sweet taste perception of saccharose solutions or the hedonic response to taste, whereas in men it caused a statistically significant decrease in the intensity of taste perception and in the hedonic response to the sweet taste of suprathreshold saccharose solutions. The meal did not influence the salty taste perception in a statistically significant way, neither in men nor in women. After the meal, the women perceived the sour taste with more intensity than in fasting state, whereas in men such influence was not observed. 1. The consumption of a high-carbohydrate meal influences the sweet and sour taste perception and the effect is sex-dependent: - in men, both the taste sensitivity to saccharose and the hedonic response to sweet taste were decreased, whereas in women such influence was not observed; - in women, the taste sensitivity to citric acid increased and the hedonic response to sour taste decreased, whereas in men such influence was not observed. 2. There is negative correlation between the intensity of taste perception and the hedonic response to the sweet taste both in men and in women after a high-carbohydrate meal, whereas in fasting state such correlation was not observed.

An Initial evaluation of law enforcement overdose training in Rhode Island.

PubMed

Saucier, Cory D; Zaller, Nickolas; Macmadu, Alexandria; Green, Traci C

2016-05-01

To assess initial change in knowledge, self-efficacy, and anticipated behaviors among Rhode Island law enforcement officers on drug overdose response and prevention. Law enforcement officers (N=316) voluntarily completed a pre-post evaluation immediately before and after taking part in overdose prevention and response trainings. Assessment items included measures of knowledge (Brief Overdose Recognition and Response Assessment (BORRA)), self-efficacy, attitudes toward drugs and overdose prevention, awareness of the Good Samaritan Law, and open-ended items pertaining to overdose knowledge and response behaviors. Non-parametric tests measured within-group and between-group differences. Wilcoxon Signed Rank tests and Kruskal-Wallis tests evaluated changes in BORRA scores and self-efficacy items. McNemar's tests assessed changes regarding the Good Samaritan law and open-ended items. Wilcoxon Signed Rank tests measured post-training change in attitudes. Law enforcement officers demonstrated statistically significant improvements in self-efficacy (identifying signs of opioid overdose, naloxone indication, counseling witnesses in overdose prevention, and referring witnesses for more information), overdose identification knowledge (BORRA mean increased from 7.00 to 10.39), naloxone administration knowledge (BORRA mean increased from 10.15 to 12.59), Good Samaritan Law awareness (17.9% increase after training), and anticipated behaviors in response to future observed overdose (65.7% changed from passive to active response post training). Harm reduction programs can provide law enforcement officers with the knowledge and skills necessary to intervene and reduce overdose mortality. Given the statistically significant improvements in self-efficacy, attitudinal changes, and Good Samaritan law awareness, law enforcement officers are more prepared to actively interact with drug users during a drug-involved emergency. Copyright © 2016. Published by Elsevier Ireland Ltd.

Temozolomide treatment of pituitary carcinomas and atypical adenomas: systematic review of case reports

PubMed Central

Ji, Yan; Vogel, Rachel Isaksson; Lou, Emil

2016-01-01

Background Pituitary carcinomas (PC) and atypical pituitary adenomas (APA) are rare variants of pituitary tumors for which no evidence-based treatment currently exists. We sought to determine whether temozolomide represents an effective chemotherapeutic option for patients with PC and APA. Methods A systematic review was performed using all published cases of PC and APA treated with temozolomide, and for which information on treatment regimen, clinical response, and survival could be identified. The primary goal of this analysis was to describe overall survival and progression-free survival among PC and APA patients after temozolomide treatment. Secondary goals included assessment of response rate and biomarkers of response. Results We identified 57 cases and obtained follow-up data on 54 patients (31 APA and 23 PC) for analysis. Estimates of 5-year progression-free survival and overall survival were 21.9% and 57.4% for patients with APA and 36.1% and 56.2% for patients with PC. Among those who responded to temozolomide, overall survival was marginally statistically significantly greater for patients on long-term temozolomide therapy compared with those who were not (5-year overall survival 91.7% vs 54.1%, P = .08); Progression-free survival results were similar but not statistically significant. The objective response rate was 48.4% for patients with APA and 65.2% for patients with PC. Stable disease occurred in 29% of APA and 17.4% of PC patients. Neither histology nor expression of Ki-67 correlated with response; however, negative O6-methylguanine-DNA methyltransferase staining was strongly related to response to temozolomide in patients with APA (P < .001). Conclusions Temozolomide is an effective treatment of both PC and APA, and long-term treatment can be considered for particularly aggressive cases. PMID:27551432

Attitude of teaching faculty towards statistics at a medical university in Karachi, Pakistan.

PubMed

Khan, Nazeer; Mumtaz, Yasmin

2009-01-01

Statistics is mainly used in biological research to verify the clinicians and researchers findings and feelings, and gives scientific validity for their inferences. In Pakistan, the educational curriculum is developed in such a way that the students who are interested in entering in the field of biological sciences do not study mathematics after grade 10. Therefore, due to their fragile background of mathematical skills, the Pakistani medical professionals feel that they do not have adequate base to understand the basic concepts of statistical techniques when they try to use it in their research or read a scientific article. The aim of the study was to assess the attitude of medical faculty towards statistics. A questionnaire containing 42 close-ended and 4 open-ended questions, related to the attitude and knowledge of statistics, was distributed among the teaching faculty of Dow University of Health Sciences (DUHS). One hundred and sixty-seven filled questionnaires were returned from 374 faculty members (response rate 44.7%). Forty-three percent of the respondents claimed that they had 'introductive' level of statistics courses, 63% of the respondents strongly agreed that a good researcher must have some training in statistics, 82% of the faculty was in favour (strongly agreed or agreed) that statistics was really useful for research. Only 17% correctly stated that statistics is the science of uncertainty. Half of the respondents accepted that they have problem of writing the statistical section of the article. 64% of the subjects indicated that statistical teaching methods were the main reasons for the impression of its difficulties. 53% of the faculty indicated that the co-authorship of the statistician should depend upon his/her contribution in the study. Gender did not show any significant difference among the responses. However, senior faculty showed higher level of the importance for the use of statistics and difficulties of writing result section of articles as compared to junior faculty. The study showed a low level of knowledge, but high level of the awareness for the use of statistical techniques in research and exhibited a good level of motivation for further training.

HgNO3 sensitivity of AlGaN/GaN field effect transistors functionalized with phytochelating peptides

NASA Astrophysics Data System (ADS)

Rohrbaugh, Nathaniel; Hernandez-Balderrama, Luis; Kaess, Felix; Kirste, Ronny; Collazo, Ramon; Ivanisevic, Albena

2016-06-01

This study examined the conductance sensitivity of AlGaN/GaN field effect transistors in response to varying Hg/HNO3 solutions. FET surfaces were covalently functionalized with phytochelatin-5 peptides in order to detect Hg in solution. Results showed a resilience of peptide-AlGaN/GaN bonds in the presence of strong HNO3 aliquots, with significant degradation in FET ID signal. However, devices showed strong and varied response to Hg concentrations of 1, 10, 100, and 1000 ppm. The gathered statistically significant results indicate that peptide terminated AlGaN/GaN devices are capable of differentiating between Hg solutions and demonstrate device sensitivity.

Comparative Response of the Hepatic Transcriptomes of Domesticated and Wild Turkey to Aflatoxin B₁.

PubMed

Reed, Kent M; Mendoza, Kristelle M; Abrahante, Juan E; Coulombe, Roger A

2018-01-13

The food-borne mycotoxin aflatoxin B₁ (AFB₁) poses a significant risk to poultry, which are highly susceptible to its hepatotoxic effects. Domesticated turkeys ( Meleagris gallopavo ) are especially sensitive, whereas wild turkeys ( M. g. silvestris ) are more resistant. AFB₁ toxicity entails bioactivation by hepatic cytochrome P450s to the electrophilic exo-AFB₁-8,9-epoxide (AFBO). Domesticated turkeys lack functional hepatic GST-mediated detoxification of AFBO, and this is largely responsible for the differences in resistance between turkey types. This study was designed to characterize transcriptional changes induced in turkey livers by AFB₁, and to contrast the response of domesticated (susceptible) and wild (more resistant) birds. Gene expression responses to AFB₁ were examined using RNA-sequencing. Statistically significant differences in gene expression were observed among treatment groups and between turkey types. Expression analysis identified 4621 genes with significant differential expression (DE) in AFB₁-treated birds compared to controls. Characterization of DE transcripts revealed genes dis-regulated in response to toxic insult with significant association of Phase I and Phase II genes and others important in cellular regulation, modulation of apoptosis, and inflammatory responses. Constitutive expression of GSTA3 was significantly higher in wild birds and was significantly higher in AFB₁-treated birds when compared to controls for both genetic groups. This pattern was also observed by qRT-PCR in other wild and domesticated turkey strains. Results of this study emphasize the differential response of these genetically distinct birds, and identify genes and pathways that are differentially altered in aflatoxicosis.

Human single-neuron responses at the threshold of conscious recognition

PubMed Central

Quiroga, R. Quian; Mukamel, R.; Isham, E. A.; Malach, R.; Fried, I.

2008-01-01

We studied the responses of single neurons in the human medial temporal lobe while subjects viewed familiar faces, animals, and landmarks. By progressively shortening the duration of stimulus presentation, coupled with backward masking, we show two striking properties of these neurons. (i) Their responses are not statistically different for the 33-ms, 66-ms, and 132-ms stimulus durations, and only for the 264-ms presentations there is a significantly higher firing. (ii) These responses follow conscious perception, as indicated by the subjects' recognition report. Remarkably, when recognized, a single snapshot as brief as 33 ms was sufficient to trigger strong single-unit responses far outlasting stimulus presentation. These results suggest that neurons in the medial temporal lobe can reflect conscious recognition by “all-or-none” responses. PMID:18299568

Impact of land-use and climatic changes on hydrology of the Himalayan Basin: A case study of the Kosi Basin

NASA Astrophysics Data System (ADS)

Sharma, Keshav Prasad

1997-10-01

Land-use and climatic changes are of major concern in the Himalayan region because of their potential impacts on a predominantly agriculture-based economy and a regional hydrology dominated by strong seasonality. Such concerns are not limited to any particular basin but exist throughout the region including the downstream plain areas. As a representative basin of the Himalayas, we studied the Kosi basin (54,000 km2) located in the mountainous area of the central Himalayan region. We analyzed climatic and hydrologic information to assess the impacts of existing and potential future land-use and climatic changes over the basin. The assessment of anthropogenic inputs showed that the population grew at a compound growth rate of about one percent per annum over the basin during the last four decades. The comparison of land-use data based on the surveys made in the 1960s, and the surveys of 1978-79 did not reveal noticeable trends in land-use change. Analysis of meteorological and hydrological trends using parametric and nonparametric statistics for monthly data from 1947 to 1993 showed some increasing tendency for temperature and precipitation. Statistical tests of hydrological trends indicated an overall decrease of discharge along mainstem Kosi River and its major tributaries. The decreasing trends of streamflow were more significant during low-flow months. Statistical analysis of homogeneity showed that the climatological as well as the hydrological trends were more localized in nature lacking distinct basinwide significance. Statistical analysis of annual sediment time series, available for a single station on the Kosi River did not reveal a significant trend. We used water balance, statistical correlation, and distributed deterministic modeling approaches to analyze the hydrological sensitivity of the basin to possible land-use and climatic changes. The results indicated a stronger influence of basin characteristics compared to climatic characteristics on flow regime. Among the climatic variables, hydrologic response was much more sensitive to changes in precipitation, and the response was more significant in the drier areas of the basin. Rapid retreat of glaciers due to potential global warming was shown to be as important as projected deforestation scenarios in regulating sediment flux over the basin.

CD14 and IL18 gene polymorphisms associated with colorectal cancer subsite risks among atomic bomb survivors.

PubMed

Hu, Yiqun; Yoshida, Kengo; Cologne, John B; Maki, Mayumi; Morishita, Yukari; Sasaki, Keiko; Hayashi, Ikue; Ohishi, Waka; Hida, Ayumi; Kyoizumi, Seishi; Kusunoki, Yoichiro; Tokunaga, Katsushi; Nakachi, Kei; Hayashi, Tomonori

2015-01-01

Colorectal cancer (CRC) is a common malignancy worldwide, and chronic inflammation is a risk factor for CRC. In this study, we carried out a cohort study among the Japanese atomic bomb (A-bomb) survivor population to investigate any association between immune- and inflammation-related gene polymorphisms and CRC. We examined the effects of six single-nucleotide polymorphisms of CD14 and IL18 on relative risks (RRs) of CRC. Results showed that RRs of CRC, overall and by anatomic subsite, significantly increased with increasing radiation dose. The CD14-911A/A genotype showed statistically significant higher risks for all CRC and distal CRC compared with the other two genotypes. In addition, the IL18-137 G/G genotype showed statistically significant higher risks for proximal colon cancer compared with the other two genotypes. In phenotype-genotype analyses, the CD14-911A/A genotype presented significantly higher levels of membrane and soluble CD14 compared with the other two genotypes, and the IL18-137 G/G genotype tended to be lower levels of plasma interleukin (IL)-18 compared with the other two genotypes. These results suggest the potential involvement of a CD14-mediated inflammatory response in the development of distal CRC and an IL18-mediated inflammatory response in the development of proximal colon cancer among A-bomb survivors.

CD14 and IL18 gene polymorphisms associated with colorectal cancer subsite risks among atomic bomb survivors

PubMed Central

Hu, Yiqun; Yoshida, Kengo; Cologne, John B; Maki, Mayumi; Morishita, Yukari; Sasaki, Keiko; Hayashi, Ikue; Ohishi, Waka; Hida, Ayumi; Kyoizumi, Seishi; Kusunoki, Yoichiro; Tokunaga, Katsushi; Nakachi, Kei; Hayashi, Tomonori

2015-01-01

Colorectal cancer (CRC) is a common malignancy worldwide, and chronic inflammation is a risk factor for CRC. In this study, we carried out a cohort study among the Japanese atomic bomb (A-bomb) survivor population to investigate any association between immune- and inflammation-related gene polymorphisms and CRC. We examined the effects of six single-nucleotide polymorphisms of CD14 and IL18 on relative risks (RRs) of CRC. Results showed that RRs of CRC, overall and by anatomic subsite, significantly increased with increasing radiation dose. The CD14–911A/A genotype showed statistically significant higher risks for all CRC and distal CRC compared with the other two genotypes. In addition, the IL18–137 G/G genotype showed statistically significant higher risks for proximal colon cancer compared with the other two genotypes. In phenotype–genotype analyses, the CD14–911A/A genotype presented significantly higher levels of membrane and soluble CD14 compared with the other two genotypes, and the IL18–137 G/G genotype tended to be lower levels of plasma interleukin (IL)-18 compared with the other two genotypes. These results suggest the potential involvement of a CD14-mediated inflammatory response in the development of distal CRC and an IL18-mediated inflammatory response in the development of proximal colon cancer among A-bomb survivors. PMID:27081544

Low-density lipoprotein receptor genetic polymorphism in chronic hepatitis C virus Egyptian patients affects treatment response

PubMed Central

Naga, Mazen; Amin, Mona; Algendy, Dina; Elbadry, Ahmed; Fawzi, May; Foda, Ayman; Esmat, Serag; Sabry, Dina; Rashed, Laila; Gabal, Samia; Kamal, Manal

2015-01-01

AIM: To correlate a genetic polymorphism of the low-density lipoprotein (LDL) receptor with antiviral responses in Egyptian chronic hepatitis C virus (HCV) patients. METHODS: Our study included 657 HCV-infected patients with genotype 4 who received interferon-based combination therapy. Patients were divided into two groups based on their response to therapy: 356 were responders, and 301 were non-responders. Patients were compared to 160 healthy controls. All patients and controls underwent a thorough physical examination, measurement of body mass index (BMI) and the following laboratory tests: serum alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, albumin, total bilirubin, direct bilirubin, prothrombin time, prothrombin concentration, INR, complete blood count, serum creatinine, fasting blood sugar, HCV antibody, and hepatitis B surface antigen. All HCV patients were further subjected to the following laboratory tests: HCV-RNA using quantitative polymerase chain reaction (PCR), antinuclear antibodies, thyroid-stimulating hormone, an LDL receptor (LDLR) genotype study of LDLR exon8c.1171G>A and exon10c.1413G>A using real-time PCR-based assays, abdominal ultrasonography, ultrasonographic-guided liver biopsy, and histopathological examination of liver biopsies. Correlations of LDL receptor polymorphisms with HAI, METAVIR score, presence of steatosis, and BMI were performed in all cases. RESULTS: There were no statistically significant differences in response rates between the different types of interferon used or LDLR exon10c.1413G>A. However, there was a significant difference in the frequency of the LDL receptor exon8c.1171G>A genotype between cases (AA: 25.9%, GA: 22.2%, GG: 51.9%) and controls (AA: 3.8%, GA: 53.1% and GG: 43.1%) (P < 0.001). There was a statistically significant difference in the frequency of the LDLR exon 8C:1171 G>A polymorphism between responders (AA: 3.6%, GA: 15.2%, GG: 81.2%) and non-responders (AA: 52.2%, GA: 30.6%, GG: 17.2%) (P < 0.001). The G allele of LDL receptor exon8c.1171G>A predominated in cases and controls over the A allele, and a statistically significant association with response to interferon was observed. The frequency of the LDLR exon8c.1171G>A allele in non-responders was: A: 67.4% and G: 32.6 vs A: 11.2% and G: 88.8% in responders (P < 0.001). Therefore, carriers of the A allele exhibited a 16.4 times greater risk for non-response. There was a significant association between LDL receptors exon8 c.1171G>A and HAI (P < 0.011). There was a significant association between LDL receptors exon8c.1171G>A and BMI. The mean BMI level was highest in patients carrying the AA genotype (28.7 ± 4.7 kg/m2) followed by the GA genotype (28.1 ± 4.8 kg/m2). The lowest BMI was the GG genotype (26.6 ± 4.3 kg/m2) (P < 0.001). The only significant associations were found between LDL receptors exon8 c.1171G>A and METAVIR score or steatosis (P < 0.001). CONCLUSION: LDL receptor gene polymorphisms play a role in the treatment response of HCV and the modulation of disease progression in Egyptians infected with chronic HCV. PMID:26494968

Low-density lipoprotein receptor genetic polymorphism in chronic hepatitis C virus Egyptian patients affects treatment response.

PubMed

Naga, Mazen; Amin, Mona; Algendy, Dina; Elbadry, Ahmed; Fawzi, May; Foda, Ayman; Esmat, Serag; Sabry, Dina; Rashed, Laila; Gabal, Samia; Kamal, Manal

2015-10-21

To correlate a genetic polymorphism of the low-density lipoprotein (LDL) receptor with antiviral responses in Egyptian chronic hepatitis C virus (HCV) patients. Our study included 657 HCV-infected patients with genotype 4 who received interferon-based combination therapy. Patients were divided into two groups based on their response to therapy: 356 were responders, and 301 were non-responders. Patients were compared to 160 healthy controls. All patients and controls underwent a thorough physical examination, measurement of body mass index (BMI) and the following laboratory tests: serum alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, albumin, total bilirubin, direct bilirubin, prothrombin time, prothrombin concentration, INR, complete blood count, serum creatinine, fasting blood sugar, HCV antibody, and hepatitis B surface antigen. All HCV patients were further subjected to the following laboratory tests: HCV-RNA using quantitative polymerase chain reaction (PCR), antinuclear antibodies, thyroid-stimulating hormone, an LDL receptor (LDLR) genotype study of LDLR exon8c.1171G>A and exon10c.1413G>A using real-time PCR-based assays, abdominal ultrasonography, ultrasonographic-guided liver biopsy, and histopathological examination of liver biopsies. Correlations of LDL receptor polymorphisms with HAI, METAVIR score, presence of steatosis, and BMI were performed in all cases. There were no statistically significant differences in response rates between the different types of interferon used or LDLR exon10c.1413G>A. However, there was a significant difference in the frequency of the LDL receptor exon8c.1171G>A genotype between cases (AA: 25.9%, GA: 22.2%, GG: 51.9%) and controls (AA: 3.8%, GA: 53.1% and GG: 43.1%) (P < 0.001). There was a statistically significant difference in the frequency of the LDLR exon 8C:1171 G>A polymorphism between responders (AA: 3.6%, GA: 15.2%, GG: 81.2%) and non-responders (AA: 52.2%, GA: 30.6%, GG: 17.2%) (P < 0.001). The G allele of LDL receptor exon8c.1171G>A predominated in cases and controls over the A allele, and a statistically significant association with response to interferon was observed. The frequency of the LDLR exon8c.1171G>A allele in non-responders was: A: 67.4% and G: 32.6 vs A: 11.2% and G: 88.8% in responders (P < 0.001). Therefore, carriers of the A allele exhibited a 16.4 times greater risk for non-response. There was a significant association between LDL receptors exon8 c.1171G>A and HAI (P < 0.011). There was a significant association between LDL receptors exon8c.1171G>A and BMI. The mean BMI level was highest in patients carrying the AA genotype (28.7 ± 4.7 kg/m(2)) followed by the GA genotype (28.1 ± 4.8 kg/m(2)). The lowest BMI was the GG genotype (26.6 ± 4.3 kg/m(2)) (P < 0.001). The only significant associations were found between LDL receptors exon8 c.1171G>A and METAVIR score or steatosis (P < 0.001). LDL receptor gene polymorphisms play a role in the treatment response of HCV and the modulation of disease progression in Egyptians infected with chronic HCV.

Glycaemic responses to liquid food supplements among three Asian ethnic groups.

PubMed

Tey, Siew Ling; Van Helvoort, Ardy; Henry, Christiani Jeyakumar

2016-12-01

A limited number of studies have compared the glycaemic index (GI) and glycaemic responses (GR) to solid foods between Caucasians and Asians. These studies have demonstrated that Asians have greater GI and GR values for solid foods than Caucasians. However, no study has compared the GI and GR to liquids among various Asian ethnic groups. A total of forty-eight males and females (16 Chinese, 16 Indians, and 16 Malay) took part in this randomised, crossover study. Glycaemic response to the reference food (glucose beverage) was measured on three occasions, and GR to three liquids were measured on one occasion each. Liquids with different macronutrient ratio's and carbohydrate types were chosen to be able to evaluate the response to products with different GIs. Blood glucose concentrations were measured in duplicate at baseline (-5 and 0 min) and once at 15, 30, 45, 60, 90, and 120 min after the commencement of beverage consumption. There were statistically significant differences in GI and GR between the three liquids (P < 0.01 in all cases). However, there were no statistically significant differences in GI and GR for the liquids between the ethnic groups (Chinese vs. Indian vs. Malay). The GR for three different types of liquid nutritional supplements did not differ between the three main ethnic groups in Asia. It appears that the GI of liquid food derived from one Asian ethnicity can be applicable to other Asian populations.

Non-invasive brain stimulation and computational models in post-stroke aphasic patients: single session of transcranial magnetic stimulation and transcranial direct current stimulation. A randomized clinical trial.

PubMed

Santos, Michele Devido Dos; Cavenaghi, Vitor Breseghello; Mac-Kay, Ana Paula Machado Goyano; Serafim, Vitor; Venturi, Alexandre; Truong, Dennis Quangvinh; Huang, Yu; Boggio, Paulo Sérgio; Fregni, Felipe; Simis, Marcel; Bikson, Marom; Gagliardi, Rubens José

2017-01-01

Patients undergoing the same neuromodulation protocol may present different responses. Computational models may help in understanding such differences. The aims of this study were, firstly, to compare the performance of aphasic patients in naming tasks before and after one session of transcranial direct current stimulation (tDCS), transcranial magnetic stimulation (TMS) and sham, and analyze the results between these neuromodulation techniques; and secondly, through computational model on the cortex and surrounding tissues, to assess current flow distribution and responses among patients who received tDCS and presented different levels of results from naming tasks. Prospective, descriptive, qualitative and quantitative, double blind, randomized and placebo-controlled study conducted at Faculdade de Ciências Médicas da Santa Casa de São Paulo. Patients with aphasia received one session of tDCS, TMS or sham stimulation. The time taken to name pictures and the response time were evaluated before and after neuromodulation. Selected patients from the first intervention underwent a computational model stimulation procedure that simulated tDCS. The results did not indicate any statistically significant differences from before to after the stimulation.The computational models showed different current flow distributions. The present study did not show any statistically significant difference between tDCS, TMS and sham stimulation regarding naming tasks. The patients'responses to the computational model showed different patterns of current distribution.

The use of computed tomography scans and the Bender Gestalt Test in the assessment of competency to stand trial and criminal responsibility in the field of mental health and law.

PubMed

Mosotho, Nathaniel Lehlohonolo; Timile, Ino; Joubert, Gina

computed tomography and the Bender Gestalt Test are some of the tests used routinely for the assessment of alleged offenders referred under Sections 77 and 78 of the Criminal Procedure Act 51 of 1977. An exploratory retrospective study was conducted at the Free State Psychiatric Complex. The aim of this study was to identify the extent to which the Bender Gestalt Test results and the computed tomography scans are associated with outcomes in the assessment of competency to stand trial and criminal responsibility in individuals referred to the Free State Psychiatric Complex (FSPC) observation unit. This was a cross-sectional study and the entire population of patients admitted in 2013 was included in the study. The clinical and demographic data were obtained from patient files. The majority of participants were black, males, single and unemployed. The most common diagnosis was schizophrenia. The current study showed no statistically significant association between the Bender Gestalt Test Hain's scores and the outcome of criminal responsibility and competency to stand trial. Similarly, the study also showed no statistically significant association between the presence of a brain lesion and the outcome of criminal responsibility and competency to stand trial. It was also concluded that as CT scans are expensive, patients should be referred for that service only when there is a clear clinical indication to do so. Copyright © 2016 Elsevier Ltd. All rights reserved.

Developing chemical criteria for wildlife: The benchmark dose versus NOAEL approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Linder, G.

1995-12-31

Wildlife may be exposed to a wide variety of chemicals in their environment, and various strategies for evaluating wildlife risk for these chemicals have been developed. One, a ``no-observable-adverse-effects-level`` or NOAEL-approach has increasingly been applied to develop chemical criteria for wildlife. In this approach, the NOAEL represents the highest experimental concentration at which there is no statistically significant change in some toxicity endpoint relative to a control. Another, the ``benchmark dose`` or BMD-approach relies on the lower confidence limit for a concentration that corresponds to a small, but statistically significant, change in effect over some reference condition. Rather than correspondingmore » to a single experimental concentration as does the NOAEL, the BMD-approach considers the full concentration response curve for derivation of the BMD. Here, using a variety of vertebrates and an assortment of chemicals (including carbofuran, paraquat, methylmercury, cadmium, zinc, and copper), the NOAEL-approach will be critically evaluated relative to the BMD approach. Statistical models used in the BMD approach suggest these methods are potentially available for eliminating safety factors in risk calculations. A reluctance to recommend this, however, stems from the uncertainty associated with the shape of concentration-response curves at low concentrations. Also, with existing data the derivation of BMDs has shortcomings when sample size is small (10 or fewer animals per treatment). The success of BMD models clearly depends upon the continued collection of wildlife data in the field and laboratory, the design of toxicity studies sufficient for BMD calculations, and complete reporting of these results in the literature. Overall, the BMD approach for developing chemical criteria for wildlife should be given further consideration, since it more fully evaluates concentration-response data.« less

Histological evaluations and inflammatory responses of different dental implant abutment materials: A human histology pilot study.

PubMed

Sampatanukul, Teeratida; Serichetaphongse, Pravej; Pimkhaokham, Atiphan

2018-04-01

Improvements of soft tissue to the abutment surface results in more stable peri-implant conditions, however, few human histological studies have compared soft tissue responses around different abutment materials. To describe the peri-implant tissue around 3 abutment materials; titanium, zirconia, and gold alloy, over an 8-week healing period. Fifteen edentulous sites were treated with implants. Eight weeks later, peri-implant tissue was harvested and processed using a nonseparation resin embedded technique. The tissue attachment characteristics were assessed at clinical stages using the gingival index (GI) score, surgical stage (surgical score), and histological stage (histological attachment percentage). Additionally, the inflammatory responses were evaluated using inflammatory extent and inflammatory cellularity grades. Nonparametrical statistics were used to describe the GI and surgical scores, and analytical statistics were used to analyze the histological attachment percentages as well as the inflammatory extent and cellularity grades amongst the 3 groups. There were no statistically significant differences among the groups for GI score (P = .071) and surgical score (P = .262). Titanium and zirconia exhibited nearly similar mean histological attachment percentages while gold alloy had a significantly lower percentage (P = .004). For the inflammatory extent and cellularity grades, the odds of being one grade higher for gold alloy abutment was 5.18 and 17.8 times that of titanium abutment, respectively. However, for the zirconia abutment, the odds were 0.87 and 7.5 times higher than the titanium group. The tissue around the gold alloy abutments resulted in worse attachment conditions compared with the titanium and zirconia abutments. Inflammation tended to be higher in the tissue around the gold alloy abutments than the titanium and zirconia abutments. © 2017 Wiley Periodicals, Inc.

Genetic polymorphisms of antioxidant enzymes CAT and SOD affect the outcome of clinical, biochemical, and anthropometric variables in people with obesity under a dietary intervention.

PubMed

Hernández-Guerrero, César; Parra-Carriedo, Alicia; Ruiz-de-Santiago, Diana; Galicia-Castillo, Oscar; Buenrostro-Jáuregui, Mario; Díaz-Gutiérrez, Carmen

2018-01-01

Genetic polymorphisms of antioxidant enzymes CAT, GPX, and SOD are involved in the etiology of obesity and its principal comorbidities. The aim of the present study was to analyze the effect of aforementioned SNPs over the output of several variables in people with obesity after a nutritional intervention. The study included 92 Mexican women, which received a dietary intervention by 3 months. Participants were genotyped and stratified into two groups: (1) carriers; mutated homozygous plus heterozygous (CR) and (2) homozygous wild type (WT). A comparison between CR and WT was done in clinical (CV), biochemical (BV), and anthropometric variables (AV), at the beginning and at the end of the intervention. Participants ( n  = 92) showed statistically significant differences ( p  < 0.05) at the end of the nutritional intervention in several CV, BV, and AV. However, two kinds of responses were observed after genotyping participants: (A) CR and WT showed statistically significant differences ( p  < 0.05) in several CV, BV, and AV for the SNPs 599C>T GPX1 (rs1050450), - 251A>G SOD1 (rs2070424), and - 262C>T CAT (rs1001179). (B) Only CR showed statistically changes ( p  < 0.05) in several CV, BV, and AV for the SNPs - 21A>T CAT (rs7943316) and 47C>T SOD2 (rs4880). The dietary intervention effect was statistically significantly between the polymorphisms of 47C>T SOD2 and BMI, SBP, TBARS, total cholesterol, and C-LCL ( p  < 0.05) and between the polymorphisms of - 21A>T CAT (rs7943316) and SBP, DBP, total cholesterol, and atherogenic index ( p  < 0.05). People with obesity display different response in several CV, BV, and AV after a nutritional intervention, depending on the antioxidant genetic background of SOD and CAT enzymes.

Regulation of local subcutaneous blood flow in patients with psoriasis and effects of antipsoriatic treatment on subcutaneous blood flow

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klemp, P.

1985-08-01

Local regulation of the doubled subcutaneous blood flow (SBF) rates in psoriatic lesional skin was studied in 8 patients using a traumatic epicutaneous /sup 133/Xe labeling washout technique. Venous stasis of 40 mm Hg induced a significant reduction in the SBF (-34%, p less than 0.01), i.e., a normal vasoconstrictor response. Limb elevation of 40 cm above heart level induced no statistical changes in the SBF (p = 0.50), i.e., a normal local autoregulation response. This indicates normal, local regulation mechanisms of SBF in psoriasis. In another 8 patients, the effect on SBF of a 4-week antipsoriatic treatment with tarmore » was studied in lesional and symmetrically nonlesional skin areas. One patient was clear of psoriasis on day 22, and was followed only to that time. The mean pretreatment SBF in lesional skin areas was 3.87 +/- SD 0.78 ml X (100 g X min)-1, which was not statistically different from measurements on days 3, 7, 14, and 21 after treatment had started. Between day 21 and day 28, the SBF decreased significantly to 3.38 +/- SD 0.78 ml X (100 g X min)-1, p less than 0.05. The difference between the pretreatment SBF and SBF at the end of treatment was statistically significant, p less than 0.05. The changes in SBF in symmetrically nonlesional skin areas were statistically nonsignificant during the period of treatment. Pretreatment SBF was 2.60 +/- SD 1.08 (N = 8), and on day 28 was 1.91 +/- SD 0.74 ml X (100 g X min)-1 (N = 7). However, the tendency of a decreasing SBF at the end of treatment was a clear trend, since SBF in 6 of 7 patients decreased during the third week and in the patient who was discharged on day 22, a decrease in the SBF was observed on days 14 and 21.« less

DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

PubMed

Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

2014-04-01

p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

DRAGO (KIAA0247), a New DNA Damage–Responsive, p53-Inducible Gene That Cooperates With p53 as Oncosupprossor

PubMed Central

Polato, Federica; Rusconi, Paolo

2014-01-01

Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652

Hot spot detection and spatio-temporal dispersion of dengue fever in Hanoi, Vietnam

PubMed Central

Toan, Do Thi Thanh; Hu, Wenbiao; Thai, Pham Quang; Hoat, Luu Ngoc; Wright, Pamela; Martens, Pim

2013-01-01

Introduction Dengue fever (DF) in Vietnam remains a serious emerging arboviral disease, which generates significant concerns among international health authorities. Incidence rates of DF have increased significantly during the last few years in many provinces and cities, especially Hanoi. The purpose of this study was to detect DF hot spots and identify the disease dynamics dispersion of DF over the period between 2004 and 2009 in Hanoi, Vietnam. Methods Daily data on DF cases and population data for each postcode area of Hanoi between January 1998 and December 2009 were obtained from the Hanoi Center for Preventive Health and the General Statistic Office of Vietnam. Moran's I statistic was used to assess the spatial autocorrelation of reported DF. Spatial scan statistics and logistic regression were used to identify space–time clusters and dispersion of DF. Results The study revealed a clear trend of geographic expansion of DF transmission in Hanoi through the study periods (OR 1.17, 95% CI 1.02–1.34). The spatial scan statistics showed that 6/14 (42.9%) districts in Hanoi had significant cluster patterns, which lasted 29 days and were limited to a radius of 1,000 m. The study also demonstrated that most DF cases occurred between June and November, during which the rainfall and temperatures are highest. Conclusions There is evidence for the existence of statistically significant clusters of DF in Hanoi, and that the geographical distribution of DF has expanded over recent years. This finding provides a foundation for further investigation into the social and environmental factors responsible for changing disease patterns, and provides data to inform program planning for DF control. PMID:23364076

Hot spot detection and spatio-temporal dispersion of dengue fever in Hanoi, Vietnam.

PubMed

Toan, Do Thi Thanh; Hu, Wenbiao; Quang Thai, Pham; Hoat, Luu Ngoc; Wright, Pamela; Martens, Pim

2013-01-24

Dengue fever (DF) in Vietnam remains a serious emerging arboviral disease, which generates significant concerns among international health authorities. Incidence rates of DF have increased significantly during the last few years in many provinces and cities, especially Hanoi. The purpose of this study was to detect DF hot spots and identify the disease dynamics dispersion of DF over the period between 2004 and 2009 in Hanoi, Vietnam. Daily data on DF cases and population data for each postcode area of Hanoi between January 1998 and December 2009 were obtained from the Hanoi Center for Preventive Health and the General Statistic Office of Vietnam. Moran's I statistic was used to assess the spatial autocorrelation of reported DF. Spatial scan statistics and logistic regression were used to identify space-time clusters and dispersion of DF. The study revealed a clear trend of geographic expansion of DF transmission in Hanoi through the study periods (OR 1.17, 95% CI 1.02-1.34). The spatial scan statistics showed that 6/14 (42.9%) districts in Hanoi had significant cluster patterns, which lasted 29 days and were limited to a radius of 1,000 m. The study also demonstrated that most DF cases occurred between June and November, during which the rainfall and temperatures are highest. There is evidence for the existence of statistically significant clusters of DF in Hanoi, and that the geographical distribution of DF has expanded over recent years. This finding provides a foundation for further investigation into the social and environmental factors responsible for changing disease patterns, and provides data to inform program planning for DF control.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, J.A.

This study was designed to investigate potential adverse reproductive outcome in veterinary personnel who are exposed to waste anesthetic gas and vapor at levels near the NIOSH recommended standards. Subjects for this case-control study of births with congenital abnormalities and spontaneous abortion, selected from the American Veterinary Medical Association roster, were contacted by mail and asked to complete a screening questionnaire regarding reproductive history. Crude prevalence rates for spontaneous abortion, births with congenital abnormalities and stillbirths, determined on the basis of the responses to the screening questionnaire, showed no excess rates when compared with national statistics. All pregnancies resulting inmore » spontaneous abortion, stillbirth, or birth with congenital abnormality were selected as cases. Controls were selected from the reported normal births on a stratified random basis to match maternal age and pregnancy number for cases. Occupational exposure to waste anesthetic gas and vapor in general was not found to be significantly associated with adverse reproductive outcome when adjustment was made for radiation exposure. For nitrous oxide exposure, however, an odds ratio significantly greater than one was found for spontaneous abortion among female veterinary assistants and wives of exposed male veterinarians. Use of diagnostic x-rays in veterinary practice was associated with spontaneous abortion in exposed females with a statistically significant dose response effect observed in female veterinarians.« less

Gender Variations in the Effects of Number of Organizational Memberships, Number of Social Networking Sites, and Grade-Point Average on Global Social Responsibility in Filipino University Students

PubMed Central

Lee, Romeo B.; Baring, Rito V.; Sta. Maria, Madelene A.

2016-01-01

The study seeks to estimate gender variations in the direct effects of (a) number of organizational memberships, (b) number of social networking sites (SNS), and (c) grade-point average (GPA) on global social responsibility (GSR); and in the indirect effects of (a) and of (b) through (c) on GSR. Cross-sectional survey data were drawn from questionnaire interviews involving 3,173 Filipino university students. Based on a path model, the three factors were tested to determine their inter-relationships and their relationships with GSR. The direct and total effects of the exogenous factors on the dependent variable are statistically significantly robust. The indirect effects of organizational memberships on GSR through GPA are also statistically significant, but the indirect effects of SNS on GSR through GPA are marginal. Men and women significantly differ only in terms of the total effects of their organizational memberships on GSR. The lack of broad gender variations in the effects of SNS, organizational memberships and GPA on GSR may be linked to the relatively homogenous characteristics and experiences of the university students interviewed. There is a need for more path models to better understand the predictors of GSR in local students. PMID:27247700

Gender Variations in the Effects of Number of Organizational Memberships, Number of Social Networking Sites, and Grade-Point Average on Global Social Responsibility in Filipino University Students.

PubMed

Lee, Romeo B; Baring, Rito V; Sta Maria, Madelene A

2016-02-01

The study seeks to estimate gender variations in the direct effects of (a) number of organizational memberships, (b) number of social networking sites (SNS), and (c) grade-point average (GPA) on global social responsibility (GSR); and in the indirect effects of (a) and of (b) through (c) on GSR. Cross-sectional survey data were drawn from questionnaire interviews involving 3,173 Filipino university students. Based on a path model, the three factors were tested to determine their inter-relationships and their relationships with GSR. The direct and total effects of the exogenous factors on the dependent variable are statistically significantly robust. The indirect effects of organizational memberships on GSR through GPA are also statistically significant, but the indirect effects of SNS on GSR through GPA are marginal. Men and women significantly differ only in terms of the total effects of their organizational memberships on GSR. The lack of broad gender variations in the effects of SNS, organizational memberships and GPA on GSR may be linked to the relatively homogenous characteristics and experiences of the university students interviewed. There is a need for more path models to better understand the predictors of GSR in local students.

High-frequency tone burst-evoked ABR latency-intensity functions.

PubMed

Fausti, S A; Olson, D J; Frey, R H; Henry, J A; Schaffer, H I

1993-01-01

High-frequency tone burst stimuli (8, 10, 12, and 14 kHz) have been developed and demonstrated to provide reliable and valid auditory brainstem responses (ABRs) in normal-hearing subjects. In this study, latency-intensity functions (LIFs) were determined using these stimuli in 14 normal-hearing individuals. Significant shifts in response latency occurred as a function of stimulus intensity for all tone burst frequencies. For each 10 dB shift in intensity, latency shifts for waves I and V were statistically significant except for one isolated instance. LIF slopes were comparable between frequencies, ranging from 0.020 to 0.030 msec/dB. These normal LIFs for high-frequency tone burst-evoked ABRs suggest the degree of response latency change that might be expected from, for example, progressive hearing loss due to ototoxic insult, although these phenomena may not be directly related.

Auditory Evoked Potential Mismatch Negativity in Normal-Hearing Adults

PubMed Central

Schwade, Laura Flach; Didoné, Dayane Domeneghini; Sleifer, Pricila

2017-01-01

Introduction  Mismatch Negativity (MMN) corresponds to a response of the central auditory nervous system. Objective  The objective of this study is to analyze MMN latencies and amplitudes in normal-hearing adults and compare the results between ears, gender and hand dominance. Methods  This is a cross-sectional study. Forty subjects participated, 20 women and 20 men, aged 18 to 29 years and having normal auditory thresholds. A frequency of 1000Hz (standard stimuli) and 2000Hz (deviant stimuli) was used to evoked the MMN. Results  Mean latencies in the right ear were 169.4ms and 175.3ms in the left ear, with mean amplitudes of 4.6µV in the right ear and 4.2µV in the left ear. There was no statistically significant difference between ears. The comparison of latencies between genders showed a statistically significant difference for the right ear, being higher in the men than in women. There was no significant statistical difference between ears for both right-handed and left-handed group. However, the results indicated that the latency of the right ear was significantly higher for the left handers than the right handers. We also found a significant result for the latency of the left ear, which was higher for the right handers. Conclusion  It was possible to obtain references of values for the MMN. There are no differences in the MMN latencies and amplitudes between the ears. Regarding gender, the male group presented higher latencies in relation to the female group in the right ear. Some results indicate that there is a significant statistical difference of the MMN between right- and left-handed individuals. PMID:28680490

Differentiation of women with premenstrual dysphoric disorder, recurrent brief depression, and healthy controls by daily mood rating dynamics.

PubMed

Pincus, Steven M; Schmidt, Peter J; Palladino-Negro, Paula; Rubinow, David R

2008-04-01

Enhanced statistical characterization of mood-rating data holds the potential to more precisely classify and sub-classify recurrent mood disorders like premenstrual dysphoric disorder (PMDD) and recurrent brief depressive disorder (RBD). We applied several complementary statistical methods to differentiate mood rating dynamics among women with PMDD, RBD, and normal controls (NC). We compared three subgroups of women: NC (n=8); PMDD (n=15); and RBD (n=9) on the basis of daily self-ratings of sadness, study lengths between 50 and 120 days. We analyzed mean levels; overall variability, SD; sequential irregularity, approximate entropy (ApEn); and a quantification of the extent of brief and staccato dynamics, denoted 'Spikiness'. For each of SD, irregularity (ApEn), and Spikiness, we showed highly significant subgroup differences, ANOVA0.001 for each statistic; additionally, many paired subgroup comparisons showed highly significant differences. In contrast, mean levels were indistinct among the subgroups. For SD, normal controls had much smaller levels than the other subgroups, with RBD intermediate. ApEn showed PMDD to be significantly more regular than the other subgroups. Spikiness showed NC and RBD data sets to be much more staccato than their PMDD counterparts, and appears to suitably characterize the defining feature of RBD dynamics. Compound criteria based on these statistical measures discriminated diagnostic subgroups with high sensitivity and specificity. Taken together, the statistical suite provides well-defined specifications of each subgroup. This can facilitate accurate diagnosis, and augment the prediction and evaluation of response to treatment. The statistical methodologies have broad and direct applicability to behavioral studies for many psychiatric disorders, and indeed to similar analyses of associated biological signals across multiple axes.

Should College Education Play a Significant Role in Teaching Students about Ethics?

ERIC Educational Resources Information Center

Coleman, Phillip D.; Atkinson, John K.; Waduge, Shashie

2015-01-01

A ten question survey was administered to a medium size university in the Midwest. The responses were fashioned in a 5-item Likert Scale ranging from Strongly Disagree to Strongly Agree. The results were interpreted by SPSS and relationships, frequencies, and descriptive statistics were drawn from the results of this program. The purpose of this…

Do Students' College Major Choices Respond to Changes in Wages? CEDR Working Paper. WP #2014-­6

ERIC Educational Resources Information Center

Long, Mark C.; Goldhaber, Dan; Huntington-Klein, Nick

2014-01-01

We find statistically significant relationships between changes in wages by occupation and subsequent changes in college majors completed in associated fields. College majors (defined at a detailed level) are most strongly related to wages observed three years earlier, when students were college freshmen. The responses to wages vary depending on…

The Alcohol Perception (AP) Project: A Study of the Perceptions of Adolescents toward Alcohol

ERIC Educational Resources Information Center

Hernandez, Marlow; DeGraff, Shawna; Suciu, Gabriel; Perez, Alina; Dodds, John; Burton, Kelli

2011-01-01

Four million individuals under the age of 21 admit to consuming alcohol in any given month. This is a significant statistic considering alcohol is responsible for most health problems related to drugs among adolescents. Research has shown that the high influence of alcohol advertising may encourage adolescents to emulate the behaviors seen in…

How Variances in Business School Rankings Affect Enrollment Trends and Practices

ERIC Educational Resources Information Center

De Veyga, Guillermo A.

2016-01-01

This study examined the effect that variances in the"U.S. News & World Report" rankings have on enrollment trends and practices in both top and non-top 25 business schools. The purpose of this study was to determine whether mobility in the rankings was met with a statistically significant response to the research questions presented.…

The l z ( p ) * Person-Fit Statistic in an Unfolding Model Context.

PubMed

Tendeiro, Jorge N

2017-01-01

Although person-fit analysis has a long-standing tradition within item response theory, it has been applied in combination with dominance response models almost exclusively. In this article, a popular log likelihood-based parametric person-fit statistic under the framework of the generalized graded unfolding model is used. Results from a simulation study indicate that the person-fit statistic performed relatively well in detecting midpoint response style patterns and not so well in detecting extreme response style patterns.

A Systematic Review and Meta-Regression Analysis of Lung Cancer Risk and Inorganic Arsenic in Drinking Water.

PubMed

Lamm, Steven H; Ferdosi, Hamid; Dissen, Elisabeth K; Li, Ji; Ahn, Jaeil

2015-12-07

High levels (> 200 µg/L) of inorganic arsenic in drinking water are known to be a cause of human lung cancer, but the evidence at lower levels is uncertain. We have sought the epidemiological studies that have examined the dose-response relationship between arsenic levels in drinking water and the risk of lung cancer over a range that includes both high and low levels of arsenic. Regression analysis, based on six studies identified from an electronic search, examined the relationship between the log of the relative risk and the log of the arsenic exposure over a range of 1-1000 µg/L. The best-fitting continuous meta-regression model was sought and found to be a no-constant linear-quadratic analysis where both the risk and the exposure had been logarithmically transformed. This yielded both a statistically significant positive coefficient for the quadratic term and a statistically significant negative coefficient for the linear term. Sub-analyses by study design yielded results that were similar for both ecological studies and non-ecological studies. Statistically significant X-intercepts consistently found no increased level of risk at approximately 100-150 µg/L arsenic.

Statistical analysis of the factors that influenced the mechanical properties improvement of cassava starch films

NASA Astrophysics Data System (ADS)

Monteiro, Mayra; Oliveira, Victor; Santos, Francisco; Barros Neto, Eduardo; Silva, Karyn; Silva, Rayane; Henrique, João; Chibério, Abimaelle

2017-08-01

In order to obtain cassava starch films with improved mechanical properties in relation to the synthetic polymer in the packaging production, a complete factorial design 23 was carried out in order to investigate which factor significantly influences the tensile strength of the biofilm. The factors to be investigated were cassava starch, glycerol and modified clay contents. Modified bentonite clay was used as a filling material of the biofilm. Glycerol was the plasticizer used to thermoplastify cassava starch. The factorial analysis suggested a regression model capable of predicting the optimal mechanical property of the cassava starch film from the maximization of the tensile strength. The reliability of the regression model was tested by the correlation established with the experimental data through the following statistical analyse: Pareto graph. The modified clay was the factor of greater statistical significance on the observed response variable, being the factor that contributed most to the improvement of the mechanical property of the starch film. The factorial experiments showed that the interaction of glycerol with both modified clay and cassava starch was significant for the reduction of biofilm ductility. Modified clay and cassava starch contributed to the maximization of biofilm ductility, while glycerol contributed to the minimization.

A Systematic Review and Meta-Regression Analysis of Lung Cancer Risk and Inorganic Arsenic in Drinking Water

PubMed Central

Lamm, Steven H.; Ferdosi, Hamid; Dissen, Elisabeth K.; Li, Ji; Ahn, Jaeil

2015-01-01

High levels (> 200 µg/L) of inorganic arsenic in drinking water are known to be a cause of human lung cancer, but the evidence at lower levels is uncertain. We have sought the epidemiological studies that have examined the dose-response relationship between arsenic levels in drinking water and the risk of lung cancer over a range that includes both high and low levels of arsenic. Regression analysis, based on six studies identified from an electronic search, examined the relationship between the log of the relative risk and the log of the arsenic exposure over a range of 1–1000 µg/L. The best-fitting continuous meta-regression model was sought and found to be a no-constant linear-quadratic analysis where both the risk and the exposure had been logarithmically transformed. This yielded both a statistically significant positive coefficient for the quadratic term and a statistically significant negative coefficient for the linear term. Sub-analyses by study design yielded results that were similar for both ecological studies and non-ecological studies. Statistically significant X-intercepts consistently found no increased level of risk at approximately 100–150 µg/L arsenic. PMID:26690190

Quantitatively measured tremor in hand-arm vibration-exposed workers.

PubMed

Edlund, Maria; Burström, Lage; Hagberg, Mats; Lundström, Ronnie; Nilsson, Tohr; Sandén, Helena; Wastensson, Gunilla

2015-04-01

The aim of the present study was to investigate the possible increase in hand tremor in relation to hand-arm vibration (HAV) exposure in a cohort of exposed and unexposed workers. Participants were 178 male workers with or without exposure to HAV. The study is cross-sectional regarding the outcome of tremor and has a longitudinal design with respect to exposure. The dose of HAV exposure was collected via questionnaires and measurements at several follow-ups. The CATSYS Tremor Pen(®) was used for measuring postural tremor. Multiple linear regression methods were used to analyze associations between different tremor variables and HAV exposure, along with predictor variables with biological relevance. There were no statistically significant associations between the different tremor variables and cumulative HAV or current exposure. Age was a statistically significant predictor of variation in tremor outcomes for three of the four tremor variables, whereas nicotine use was a statistically significant predictor of either left or right hand or both hands for all four tremor variables. In the present study, there was no evidence of an exposure-response association between HAV exposure and measured postural tremor. Increase in age and nicotine use appeared to be the strongest predictors of tremor.

Computational algebraic geometry for statistical modeling FY09Q2 progress.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thompson, David C.; Rojas, Joseph Maurice; Pebay, Philippe Pierre

2009-03-01

This is a progress report on polynomial system solving for statistical modeling. This is a progress report on polynomial system solving for statistical modeling. This quarter we have developed our first model of shock response data and an algorithm for identifying the chamber cone containing a polynomial system in n variables with n+k terms within polynomial time - a significant improvement over previous algorithms, all having exponential worst-case complexity. We have implemented and verified the chamber cone algorithm for n+3 and are working to extend the implementation to handle arbitrary k. Later sections of this report explain chamber cones inmore » more detail; the next section provides an overview of the project and how the current progress fits into it.« less

Understanding Short-Term Nonmigrating Tidal Variability in the Ionospheric Dynamo Region from SABER Using Information Theory and Bayesian Statistics

NASA Astrophysics Data System (ADS)

Kumari, K.; Oberheide, J.

2017-12-01

Nonmigrating tidal diagnostics of SABER temperature observations in the ionospheric dynamo region reveal a large amount of variability on time-scales of a few days to weeks. In this paper, we discuss the physical reasons for the observed short-term tidal variability using a novel approach based on Information theory and Bayesian statistics. We diagnose short-term tidal variability as a function of season, QBO, ENSO, and solar cycle and other drivers using time dependent probability density functions, Shannon entropy and Kullback-Leibler divergence. The statistical significance of the approach and its predictive capability is exemplified using SABER tidal diagnostics with emphasis on the responses to the QBO and solar cycle. Implications for F-region plasma density will be discussed.

Observations on Three Endpoint Properties and Their Relationship to Regulatory Outcomes of European Oncology Marketing Applications

PubMed Central

Stolk, Pieter; McAuslane, James Neil; Schellens, Jan; Breckenridge, Alasdair M.; Leufkens, Hubert

2015-01-01

Background. Guidance and exploratory evidence indicate that the type of endpoints and the magnitude of their outcome can define a therapy’s clinical activity; however, little empirical evidence relates specific endpoint properties with regulatory outcomes. Materials and Methods. We explored the relationship of 3 endpoint properties to regulatory outcomes by assessing 50 oncology marketing authorization applications (MAAs; reviewed from 2009 to 2013). Results. Overall, 16 (32%) had a negative outcome. The most commonly used hard endpoints were overall survival (OS) and the duration of response or stable disease. OS was a component of 91% approved and 63% failed MAAs. The most commonly used surrogate endpoints were progression-free survival (PFS), response rate, and health-related quality of life assessments. There was no difference (p = .3801) between the approved and failed MAA cohorts in the proportion of hard endpoints used. A mean of slightly more than four surrogate endpoints were used per approved MAA compared with slightly more than two for failed MAAs. Longer OS and PFS duration outcomes were generally associated with approvals, often when not statistically significant. The approved cohort was associated with a preponderance of statistically significant (p < .05) improvements in primary endpoints (p < .0001 difference between the approved and failed groups). Conclusion. Three key endpoint properties (type of endpoint [hard/surrogate], magnitude of an endpoint outcome, and its statistical significance) are consistent with the European Medicines Agency guidance and, notwithstanding the contribution of unique disease-specific circumstances, are associated with a predictable positive outcome for oncology MAAs. Implications for Practice: Regulatory decisions made by the European Medicines Agency determine which new medicines will be available to European prescribers and for which therapeutic indications. Regulatory success or failure can be influenced by many factors. This study assessed three key properties of endpoints used in preauthorization trials (type of endpoint [hard/surrogate], magnitude of endpoint outcome, and its statistical significance) and whether they are associated with a positive regulatory outcome. Clinicians can use these properties, which are described in the publicly available European public assessment reports, to help guide their understanding of the clinical effect of new oncologic therapies. PMID:25948678

Observations on Three Endpoint Properties and Their Relationship to Regulatory Outcomes of European Oncology Marketing Applications.

PubMed

Liberti, Lawrence; Stolk, Pieter; McAuslane, James Neil; Schellens, Jan; Breckenridge, Alasdair M; Leufkens, Hubert

2015-06-01

Guidance and exploratory evidence indicate that the type of endpoints and the magnitude of their outcome can define a therapy's clinical activity; however, little empirical evidence relates specific endpoint properties with regulatory outcomes. We explored the relationship of 3 endpoint properties to regulatory outcomes by assessing 50 oncology marketing authorization applications (MAAs; reviewed from 2009 to 2013). Overall, 16 (32%) had a negative outcome. The most commonly used hard endpoints were overall survival (OS) and the duration of response or stable disease. OS was a component of 91% approved and 63% failed MAAs. The most commonly used surrogate endpoints were progression-free survival (PFS), response rate, and health-related quality of life assessments. There was no difference (p = .3801) between the approved and failed MAA cohorts in the proportion of hard endpoints used. A mean of slightly more than four surrogate endpoints were used per approved MAA compared with slightly more than two for failed MAAs. Longer OS and PFS duration outcomes were generally associated with approvals, often when not statistically significant. The approved cohort was associated with a preponderance of statistically significant (p < .05) improvements in primary endpoints (p < .0001 difference between the approved and failed groups). Three key endpoint properties (type of endpoint [hard/surrogate], magnitude of an endpoint outcome, and its statistical significance) are consistent with the European Medicines Agency guidance and, notwithstanding the contribution of unique disease-specific circumstances, are associated with a predictable positive outcome for oncology MAAs. Regulatory decisions made by the European Medicines Agency determine which new medicines will be available to European prescribers and for which therapeutic indications. Regulatory success or failure can be influenced by many factors. This study assessed three key properties of endpoints used in preauthorization trials (type of endpoint [hard/surrogate], magnitude of endpoint outcome, and its statistical significance) and whether they are associated with a positive regulatory outcome. Clinicians can use these properties, which are described in the publicly available European public assessment reports, to help guide their understanding of the clinical effect of new oncologic therapies. ©AlphaMed Press.

Validity of in vitro tests on aqueous spray pumps as surrogates for nasal deposition, absorption, and biologic response.

PubMed

Suman, Julie D; Laube, Beth L; Dalby, Richard

2006-01-01

This research investigated the impact of the full range of in vitro spray characterization tests described in the FDA Draft Bioequivalence Guidance on nasal deposition pattern, pharmacokinetics, and biological response to nicotine administered by two aqueous nasal spray pumps in human volunteers. Nicotine was selected as a model drug (even though it is not locally acting) based on its ability to alter cardiac function and available plasma assay. Significant differences in pump performance-including mean volume diameters, spray angle, spray width, and ovality ratios-were observed between the two pumps. There were no significant differences in deposition pattern, or pharmacokinetic or pharmacodynamic response to the nasally administered nicotine. Although there were statistical differences in the in vitro tests between the two pumps, these differences did not result in significant alterations in the site of droplet deposition within the nose, the rate and extent of nicotine absorption, or the physiologic response it induced. These results suggest that current measures of in vitro performance, particularly spray angle and spray pattern (ovality), may not be clinically relevant. Additional research is needed to define what spray pump characteristics are likely to produce differences in deposition pattern and drug response.

A study of glycaemic effects following acute anthocyanin-rich blueberry supplementation in healthy young adults.

PubMed

Bell, L; Lamport, D J; Butler, L T; Williams, C M

2017-09-20

The postprandial response to ingested carbohydrate is recognised as a marker of metabolic health. Postprandial hyperglycaemia is observed in type 2 diabetes mellitus and is a significant risk factor for cardiovascular disease. Cognitive deficits are also associated with type 2 diabetes. Therefore interventions which moderate postprandial glucose profiles are desirable. Here we investigated the impact of anthocyanin-rich wild blueberries on postprandial glucose response. Seventeen healthy young adults consumed a range of doses of freeze-dried wild blueberry powder, in smoothie form, in both sugar-matched and no-added-sugar conditions. Plasma glucose was determined by a capillary sampling method at baseline and at regular intervals up to 2.5 hours postprandially. Blueberries were observed to significantly extend the postprandial glucose response beyond the period observed for a sugar-matched control, characteristic of a beneficial glycaemic response. Furthermore, blueberries were observed to reduce peak postprandial glucose levels, although statistical significance was not achieved. The findings suggest a tempering of the postprandial glucose response in the presence of anthocyanin-rich blueberry, and are discussed with reference to likely glucoregulatory mechanisms of action and their implications for cognitive and type 2 diabetes research.

Role of Stereotactic Body Radiation Therapy Before Orthotopic Liver Transplantation: Retrospective Evaluation of Pathologic Response and Outcomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mannina, Edward Michael, E-mail: emmannina@gmail.com; Cardenes, Higinia Rosa; Lasley, Foster D.

Purpose: To analyze the results of stereotactic body radiation therapy (SBRT) in patients with early-stage, localized hepatocellular carcinoma who underwent definitive orthotopic liver transplantation (OLT). Methods and Materials: The subjects of this retrospective report are 38 patients diagnosed with hepatocellular carcinoma who underwent SBRT per institutional phase 1 to 2 eligibility criteria, before definitive OLT. Pre-OLT radiographs were compared with pathologic gold standard. Analysis of treatment failures and deaths was undertaken. Results: With median follow-up of 4.8 years from OLT, 9 of 38 patients (24%) recurred, whereas 10 of 38 patients (26%) died. Kaplan-Meier estimates of 3-year overall survival and disease-free survivalmore » are 77% and 74%, respectively. Sum longest dimension of tumors was significantly associated with disease-free survival (hazard ratio 1.93, P=.026). Pathologic response rate (complete plus partial response) was 68%. Radiographic scoring criteria performed poorly; modified Response Evaluation Criteria in Solid Tumors produced highest concordance (κ = 0.224). Explants revealed viable tumor in 74% of evaluable patients. Treatment failures had statistically larger sum longest dimension of tumors (4.0 cm vs 2.8 cm, P=.014) and non–statistically significant higher rates of lymphovascular space invasion (44% vs 17%), cT2 disease (44% vs 21%), ≥pT2 disease (67% vs 34%), multifocal tumors at time of SBRT (44% vs 21%), and less robust mean α-fetoprotein response (−25 IU/mL vs −162 IU/mL). Conclusions: Stereotactic body radiation therapy before to OLT is a well-tolerated treatment providing 68% pathologic response, though 74% of explants ultimately contained viable tumor. Radiographic response criteria poorly approximate pathology. Our data suggest further stratification of patients according to initial disease burden and treatment response.« less

Recommendations to improve the positive and negative syndrome scale (PANSS) based on item response theory.

PubMed

Levine, Stephen Z; Rabinowitz, Jonathan; Rizopoulos, Dimitris

2011-08-15

The adequacy of the Positive and Negative Syndrome Scale (PANSS) items in measuring symptom severity in schizophrenia was examined using Item Response Theory (IRT). Baseline PANSS assessments were analyzed from two multi-center clinical trials of antipsychotic medication in chronic schizophrenia (n=1872). Generally, the results showed that the PANSS (a) item ratings discriminated symptom severity best for the negative symptoms; (b) has an excess of "Severe" and "Extremely severe" rating options; and (c) assessments are more reliable at medium than very low or high levels of symptom severity. Analysis also showed that the detection of statistically and non-statistically significant differences in treatment were highly similar for the original and IRT-modified PANSS. In clinical trials of chronic schizophrenia, the PANSS appears to require the following modifications: fewer rating options, adjustment of 'Lack of judgment and insight', and improved severe symptom assessment. 2011 Elsevier Ltd. All rights reserved.

Statistical-Dynamical Seasonal Forecasts of Central-Southwest Asian Winter Precipitation.

NASA Astrophysics Data System (ADS)

Tippett, Michael K.; Goddard, Lisa; Barnston, Anthony G.

2005-06-01

Interannual precipitation variability in central-southwest (CSW) Asia has been associated with East Asian jet stream variability and western Pacific tropical convection. However, atmospheric general circulation models (AGCMs) forced by observed sea surface temperature (SST) poorly simulate the region's interannual precipitation variability. The statistical-dynamical approach uses statistical methods to correct systematic deficiencies in the response of AGCMs to SST forcing. Statistical correction methods linking model-simulated Indo-west Pacific precipitation and observed CSW Asia precipitation result in modest, but statistically significant, cross-validated simulation skill in the northeast part of the domain for the period from 1951 to 1998. The statistical-dynamical method is also applied to recent (winter 1998/99 to 2002/03) multimodel, two-tier December-March precipitation forecasts initiated in October. This period includes 4 yr (winter of 1998/99 to 2001/02) of severe drought. Tercile probability forecasts are produced using ensemble-mean forecasts and forecast error estimates. The statistical-dynamical forecasts show enhanced probability of below-normal precipitation for the four drought years and capture the return to normal conditions in part of the region during the winter of 2002/03.May Kabul be without gold, but not without snow.—Traditional Afghan proverb

Comparative evaluation of the effectiveness of audio and audiovisual distraction aids in the management of anxious pediatric dental patients.

PubMed

Kaur, Rajwinder; Jindal, Ritu; Dua, Rohini; Mahajan, Sandeep; Sethi, Kunal; Garg, Sunny

2015-01-01

The aim of this study was to evaluate and compare audio and audiovisual distraction aids in management of anxious pediatric dental patients of different age groups and to study children's response to sequential dental visits with the use of distraction aids. This study was conducted on two age groups, that is, 4-6 years and 6-8 years with 30 patients in each age group on their first dental visit. The children of both the age groups were divided into 3 subgroups, the control group, audio distraction group, audiovisual distraction group with 10 patients in each subgroup. Each child in all the subgroups had gone through three dental visits. Child anxiety level at each visit was assessed by using a combination of anxiety measuring parameters. The data collected was tabulated and subjected to statistical analysis. Tukey honest significant difference post-hoc test at 0.05% level of significance revealed audiovisual group showed statistically highly significant difference from audio and control group, whereas audio group showed the statistically significant difference from the control group. Audiovisual distraction was found to be a more effective mode of distraction in the management of anxious children in both the age groups when compared to audio distraction. In both the age groups, a significant effect of the visit type was also observed.

Painful bone metastasis in elderly treated with radiation therapy: Single- or multiple-fraction regimen? A multicentre retrospective observational analysis.

PubMed

Falivene, S; Pezzulla, D; Di Franco, R; Giugliano, F M; Esposito, E; Scoglio, C; Amato, B; Borzillo, V; D'Aiuto, M; Muto, P

2017-02-01

Bone metastases are a frequent complication of advanced oncologic disease. Pain associated to bone metastasis is a major cause of morbidity in cancer patients, especially in elderly. The aim of this multicentric retrospective observational study is to evaluate the efficacy of different schedules of radiation therapy in elderly patients in terms of pain relief. 206 patients over the age of 60 were enrolled in 1 year time for a multicentre retrospective observational study. Patients were treated with palliative purposes for painful bone metastases. Pain intensity difference (PID) was found in 72% of patients. Reported PID was statistically significant for p < 0.01. Pain intensity measured by a point numeric rating scale was statistically significant reduced for p < 0.05 by one-fraction regimen compared to other two regimens. In recent years, numerous studies have evaluated the most appropriate regimen of fractionation in individual cases, despite this, a consensus about the best schedule is still debated. On our analysis, single-fractionation scheme (8 Gy) confirmed to be statistical significant effective in providing pain reduction due to bone metastases. Radiation therapy provides significant pain relief of symptomatic bone metastases, but appropriate radiotherapy scheduled is needed in order to get significant response to treatment. Multidisciplinary approach is warranted to value the balance between the therapeutic objectives and the patient quality of life.

A phase III concurrent chemoradiotherapy trial with cisplatin and paclitaxel or docetaxel or gemcitabine in unresectable non-small cell lung cancer: KASLC 0401.

PubMed

Oh, In-Jae; Kim, Kyu-Sik; Kim, Young-Chul; Ban, Hee-Jung; Kwon, Yong-Soo; Kim, Yu-Il; Lim, Sung-Chul; Chung, Woong-Ki; Nam, Taek-Keun; Song, Joo-Young; Yoon, Mee-Sun; Ahn, Sung-Ja

2013-12-01

Concurrent chemoradiotherapy (CCRT) is recommended for the management of patients with unresectable non-small cell lung cancer (NSCLC). This prospective study aimed to compare the efficacy of concurrently delivered cisplatin doublets with paclitaxel, or docetaxel, or gemcitabine. The main eligibility criteria consisted of previously untreated stage IIIB NSCLC. The subjects were randomized into three arms: paclitaxel 45 mg/m(2)/week (TP), docetaxel 20 mg/m(2)/week (DP), and gemcitabine 350 mg/m(2)/week (GP) in addition to cisplatin 20 mg/m(2)/week. Three-dimensional conformal radiotherapy was given once daily, weekly 5 fractions and the total prescription dose was 60-66 Gy. The primary endpoint was response rate, and the secondary endpoints were survival and toxicity. A total of 101 patients were recruited into this trial of whom 93 (TP: 33, DP: 29, GP: 31) patients were treated with CCRT from March 2005 to July 2007. Similar response rates were observed across arms: TP: 63.6 %, DP: 72.4 %, GP: 61.3 % (p = 0.679). There was no statistically significant difference of median survival (TP: 27.3, DP: 27.6, GP: 16.5 months, p = 0.771). In subgroup analysis, a survival benefit of consolidation chemotherapy was not seen, but leucopenia (63.2 %) and neutropenia (68.4 %) more than grade 3 were significantly high in DP arm. The grade ≥3 radiation esophagitis was more frequent in the GP arm (22.6 %, p = 0.163). Among the three arms, no statistically significant difference in response rate, survival, and toxicity was observed. However, clinically significant radiation toxicity was more frequent in the GP arm.

[Effect of vitamine A on mice immune response induced by specific periodontal pathogenic bacteria-immunization].

PubMed

Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai

2010-12-01

The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (P<0.05); The levels of IgG2a increased obviously, whereas the levels of IgG1 subtype antibody conspicuous decreased, with a significant difference (P<0.05). Aa immunized group could induce body to produce a strong specific T-cell immune response, but Aa immunized+VAD group had a higher T cell proliferate response compared with Aa immunized+RD group, with a statistically significant difference (P<0.05); The expression of RANKL, IFN-γ and TNF-α supernatant increased, while the expression of IL-10 decreased (P<0.05). The lack of vitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).

The influence of sea surface temperature anomalies on low-frequency variability of the North Atlantic Oscillation

NASA Astrophysics Data System (ADS)

Manganello, Julia V.

2008-05-01

The influence of sea surface temperature anomalies (SSTA) on multi-year persistence of the North Atlantic Oscillation (NAO) during the second half of the twentieth century is investigated using the Center for Ocean-Land-Atmosphere Studies (COLA) Atmospheric GCM (AGCM) with an emphasis on isolating the geographic location of the SSTA that produce this influence. The present study focuses on calculating the atmospheric response to the SSTA averaged over 1988 1995 (1961 1968) corresponding to the observed period of strong persistence of the positive (negative) phase of the decadal NAO. The model response to the global 1988 1995 average SSTA shows a statistically significant large-scale pattern characteristic of the positive phase of the NAO. Forcing with the global 1961 1968 average SSTA generates a NAO of the opposite polarity compared to observations. However, all large-scale features both in the model and observations during this period are weaker in magnitude and less significant compared to 1988 1995. Additional idealized experiments show that over the northern center of the NAO the non-linear component of the forced response appears to be quite important and acts to enhance the positive NAO signal. On the other hand, over the southern center where the model response is the strongest, it is also essentially linear. The 1988 1995 average SSTA restricted to the western tropical Pacific region produce a positive NAO remarkably similar in structure but stronger in magnitude than the model response to the global and tropical Indo-Pacific 1988 1995 forcing. A 200-hPa geopotential height response in these experiments shows a positive anomaly over the southern center of the NAO embedded in the Rossby wave trains propagating from the western tropical Pacific. Indian Ocean SSTA lead to much weaker positive NAO primarily through the effect on its northern center. SST forcing confined to the North Atlantic north of equator does not produce a response statistically different from the control simulation, suggesting that it is not strong enough to significantly affect the phase of the decadal NAO. Inclusion of the South Atlantic north of 45° south does not change this result.

Exploring the efficacy of electronic response devices in ninth-grade science classrooms

NASA Astrophysics Data System (ADS)

Dey, John A., Jr.

Student use of electronic response technology has been prevalent in postsecondary institutions and is beginning to penetrate K--12 classroom settings. Despite these trends, research exploring the impact of this technology in these settings has been limited. The extant research has relied heavily on survey methodologies and largely has focused on student/teacher perception or implementation practices while remaining silent on learning outcomes. The purpose of this study was to broaden the scope of research models used to explore electronic response technology and its impact on student learning. The study took place in a ninth-grade science classroom at a large high school with a comprehensive curriculum. Study participants were first-year high school students enrolled in one of two sections of the freshman science sequence focusing on Physical Science content. One section, serving as the Treatment group, used electronic response devices on a daily basis to respond to preplanned teacher questions. The other section, serving as the Comparison group, relied on traditional methods of interaction such as raising hands to respond to questions. They responded to the same set of preplanned questions and differed only in the manner of response, with the teacher asking the class and then calling on one of the students to answer. The study focused on academic achievement, as measured by student performance on a pre- and posttest, as well as student engagement, measured by momentary time sample data taken throughout the entire class with focused attention on periods of teacher questioning. The analysis of academic achievement employed an ANOVA, and no statistically significant difference was found between the groups. Engagement data were analyzed using an independent samples t test, and statistically significant differences were found between the two groups. Findings from this study indicated that, when using electronic response technology in their science classes, students demonstrated significantly higher levels of engagement across an entire class period as well as during teacher questioning. Implications of the study have been framed around the promise of electronic response technology for engaging and motivating students.

Declining Radial Growth Response of Coastal Forests to Hurricanes and Nor'easters

NASA Astrophysics Data System (ADS)

Fernandes, Arnold; Rollinson, Christine R.; Kearney, William S.; Dietze, Michael C.; Fagherazzi, Sergio

2018-03-01

The Mid-Atlantic coastal forests in Virginia are stressed by episodic disturbance from hurricanes and nor'easters. Using annual tree ring data, we adopt a dendroclimatic and statistical modeling approach to understand the response and resilience of a coastal pine forest to extreme storm events, over the past few decades. Results indicate that radial growth of trees in the study area is influenced by age, regional climate trends, and individual tree effects but dominated periodically by growth disturbance due to storms. We evaluated seven local extreme storm events to understand the effect of nor'easters and hurricanes on radial growth. A general decline in radial growth was observed in the year of the extreme storm and 3 years following it, after which the radial growth started recovering. The decline in radial growth showed a statistically significant correlation with the magnitude of the extreme storm (storm surge height and wind speed). This study contributes to understanding declining tree growth response and resilience of coastal forests to past disturbances. Given the potential increase in hurricanes and storm surge severity in the region, this can help predict vegetation response patterns to similar disturbances in the future.

Chorioamnionitis and chronic lung disease of prematurity: a path analysis of causality.

PubMed

Dessardo, Nada Sindičić; Mustać, Elvira; Dessardo, Sandro; Banac, Srđan; Peter, Branimir; Finderle, Aleksandar; Marić, Marinko; Haller, Herman

2012-02-01

Current evidence suggests that additional pathogenetic factors could play a role in the development of chronic lung disease of prematurity, other than mechanical ventilation and free radical injury. The introduction of the concept of "fetal inflammatory response syndrome" offers a new perspective on the pathogenesis of chronic lung disease of prematurity. New statistical approaches could be useful tools in evaluating causal relationships in the development of chronic morbidity in preterm infants. The aim of this study was to test a new statistical framework incorporating path analysis to evaluate causality between exposure to chorioamnionitis and fetal inflammatory response syndrome and the development of chronic lung disease of prematurity. We designed a prospective cohort study that included consecutively born premature infants less than 32 weeks of gestation whose placentas were collected for histological analysis. Histological chorioamnionitis, clinical data, and neonatal outcomes were related to chronic lung disease. Along with standard statistical methods, a path analysis was performed to test the relationship between histological chorioamnionitis, gestational age, mechanical ventilation, and development of chronic lung disease of prematurity. Among the newborns enrolled in the study, 69/189 (36%) had histological chorioamnionitis. Of those with histological chorioamnionitis, 28/69 (37%) were classified as having fetal inflammatory response syndrome, according to the presence of severe chorioamnionitis and funisitis. Histological chorioamnionitis was associated with a lower birth weight, shorter gestation, higher frequency of patent ductus arteriosus, greater use of surfactant, and higher frequency of chronic lung disease of prematurity. Severe chorioamnionitis and funisitis were significantly associated with lower birth weight, lower gestational age, lower Apgar score at 5 minutes, more frequent use of mechanical ventilatory support and surfactant, as well as higher frequency of patent ductus arteriosus and chronic lung disease. The results of the path analysis showed that fetal inflammatory response syndrome has a significant direct (0.66), indirect (0.11), and overall (0.77) effect on chronic lung disease. This study demonstrated a strong positive correlation between exposure of the fetus to a severe inflammatory response and the development of chronic lung disease of prematurity. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

Individual differences in posttraumatic distress: problems with the DSM-IV model.

PubMed

Bowman, M L

1999-02-01

To evaluate the evidence concerning the role of threatening life events in accounting for clinically significant posttraumatic stress responses. Research was examined to review the epidemiology, evidence of dose-response relations, and individual difference factors in accounting for variations in conditions, including posttraumatic stress disorder, after exposure to threatening events. The evidence is significantly discrepant from the clinical Diagnostic and Statistical Manual of Mental Disorders (DSM-IV) model. Greater distress arises from individual differences than from event characteristics. Important individual differences that interact with threat exposures include trait negative affectivity (neuroticism); beliefs about emotions, the self, the world, and the sources and consequences of danger; and prevent acts, disorders, and intelligence. Reasons for the discrepancies between the evidence and the current model of posttraumatic distress are proposed. In accounting for responses to threatening life events, the relatively minor contribution of event qualities compared with individual differences has significant treatment implications. Treatment approaches assuming that toxic event exposure creates a posttraumatic disorder fail to consider individual differences that could improve treatment efficacy.

Comparison of efficacy between TACE combined with apatinib and TACE alone in the treatment of intermediate and advanced hepatocellular carcinoma: A single-center randomized controlled trial.

PubMed

Lu, Wei; Jin, Xin-Li; Yang, Chao; Du, Peng; Jiang, Fu-Qiang; Ma, Jun-Peng; Yang, Jian; Xie, Peng; Zhang, Zhe

2017-06-03

This study was designed to compare the clinical efficacy and safety of transcatheter arterial chemoembolization (TACE) combined with apatinib and TACE alone in the treatment of intermediate and advanced hepatocellular carcinoma (HCC). From March 2015 to August 2015, a total of 44 patients with moderate and advanced HCC, who were admitted in the Navy General Hospital of China, were included into this study. These patients were randomly divided into 2 groups: group A and group B. Patients in group A underwent TACE alone, while patients in group B underwent the combined treatment of TACE with apatinib. Differences in preoperative general data between these 2 groups were not statistically significant (P > 0.05). All patients were followed up for 12-18 months. Changes in α-fetal protein (AFP) at 3 months after treatment and the objective response rate (ORR) at 3, 6, 9 and 12 months after treatment were compared between these 2 groups. Furthermore, progression-free survival (PFS) and the incidence of adverse reactions were also compared between these 2 groups. AFP levels in groups A and B significantly decreased after 3 months of treatment, compared with the levels before treatment, and the differences were statistically significant (P < 0.05). However, at 3 months after treatment, the difference between these 2 groups was not statistically significant (P > 0.05). ORR at 3, 6, 9 and 12 months after treatment was 36.36%, 27.27%, 13.64% and 9.09%, respectively, in group A; and 60%, 50%, 45% and 35%, respectively, in group B. At 3 and 6 months after treatment, the differences between these 2 groups were not statistically significant (P > 0.05); while at 9 and 12 months after treatment, the differences between these 2 groups were statistically significant (P < 0.05). The median PFS was 6.0 months in group A and 12.5 months in group B, and the difference was statistically significant (P < 0.05). The incidences of complications were related to oral apatinib, such as hypertension, hand-foot syndrome and proteinuria, were higher in group B than in group A, and the differences were statistically significant (P < 0.05). These symptoms all alleviated after symptomatic treatments. For intermediate and advanced HCC, the long-term curative effect of TACE combined with apatinib is better than that of TACE alone. The former can obviously prolong the PFS of patients and has a confirmed safety.

A 12-Day Course of Imiquimod 5% for the Treatment of Actinic Keratosis: Effectiveness and Local Reactions.

PubMed

Serra-Guillén, C; Nagore, E; Llombart, B; Sanmartín, O; Requena, C; Calomarde, L; Guillén, C

2018-04-01

Imiquimod is an excellent option for patients with actinic keratosis, although its use may be limited by the long course of treatment required (4 weeks) and the likelihood of local skin reactions. The objectives of the present study were to demonstrate the effectiveness of a 12-day course of imiquimod 5% for the treatment of actinic keratosis and to examine the association between treatment effectiveness and severity of local reactions. We included patients with at least 8 actinic keratoses treated with imiquimod 5% cream for 12 consecutive days. Local reactions were classified as mild, moderate, or severe. The statistical analysis of the association between local reactions and clinical response was based on the Pearson χ 2 test and the Spearman rank correlation test. Sixty-five patients completed the study. Complete response was recorded in 52.3% and partial response in 75.4%. We found a statistically significant association between severity of the local reaction and response to treatment in both the Pearson χ 2 test and the Spearman rank correlation test. A 12-day course of imiquimod 5% proved effective for the treatment of actinic keratosis. Severity of local reactions during treatment was correlated with clinical response. Copyright © 2017 AEDV. Publicado por Elsevier España, S.L.U. All rights reserved.

Responsibility Study: Main Illicit Psychoactive Substances Among Car Drivers Involved in Fatal Road Crashes

PubMed Central

Gadegbeku, Blandine; Amoros, Emmanuelle; Laumon, Bernard

2011-01-01

In 1999, in France, before considering modifications in drug legislation, the government requested a study of the effect of illicit drugs on the risk of road crashes. It implemented a systematic screening of illicit drugs for all drivers involved in fatal crashes between October 2001 and September 2003. Within the European DRUID project, the study was restricted to car drivers. The project reported here is a responsibility analysis and, as such, it belongs to the framework of case-control studies; the outcome of interest is “being responsible for a fatal crash”. It was assessed with a method adapted from Robertson and Drummer. Cases are the 4,946 car drivers who are responsible for the crash; controls are the 1,986 car drivers selected from the non-responsible car drivers, in a way that makes the control group similar to the general driving population. The effect of cannabis on fatal crash responsibility is significant after adjustment for age, sex and alcohol: adjusted odds ratio is 1.89 [1.43–2.51]. The dose-response effect is significant (p=0.0001). For alcohol (≥0.1 g/l), the adjusted odds ratio for responsibility is 8.39 [6.95–10.11]. No interaction was found between alcohol and cannabis. For amphetamine, cocaine and opiates, adjusted odds ratios were not significantly different from 1. However the statistical power is low. The study finds similar odds ratios for alcohol as previously published. For cannabis, the significant odds ratio together with the significant dose-response effect indicates a causal relationship between cannabis and road crashes. A multiplicative effect between cannabis and alcohol was noted. PMID:22105404

Identifying reprioritization response shift in a stroke caregiver population: a comparison of missing data methods.

PubMed

Sajobi, Tolulope T; Lix, Lisa M; Singh, Gurbakhshash; Lowerison, Mark; Engbers, Jordan; Mayo, Nancy E

2015-03-01

Response shift (RS) is an important phenomenon that influences the assessment of longitudinal changes in health-related quality of life (HRQOL) studies. Given that RS effects are often small, missing data due to attrition or item non-response can contribute to failure to detect RS effects. Since missing data are often encountered in longitudinal HRQOL data, effective strategies to deal with missing data are important to consider. This study aims to compare different imputation methods on the detection of reprioritization RS in the HRQOL of caregivers of stroke survivors. Data were from a Canadian multi-center longitudinal study of caregivers of stroke survivors over a one-year period. The Stroke Impact Scale physical function score at baseline, with a cutoff of 75, was used to measure patient stroke severity for the reprioritization RS analysis. Mean imputation, likelihood-based expectation-maximization imputation, and multiple imputation methods were compared in test procedures based on changes in relative importance weights to detect RS in SF-36 domains over a 6-month period. Monte Carlo simulation methods were used to compare the statistical powers of relative importance test procedures for detecting RS in incomplete longitudinal data under different missing data mechanisms and imputation methods. Of the 409 caregivers, 15.9 and 31.3 % of them had missing data at baseline and 6 months, respectively. There were no statistically significant changes in relative importance weights on any of the domains when complete-case analysis was adopted. But statistical significant changes were detected on physical functioning and/or vitality domains when mean imputation or EM imputation was adopted. There were also statistically significant changes in relative importance weights for physical functioning, mental health, and vitality domains when multiple imputation method was adopted. Our simulations revealed that relative importance test procedures were least powerful under complete-case analysis method and most powerful when a mean imputation or multiple imputation method was adopted for missing data, regardless of the missing data mechanism and proportion of missing data. Test procedures based on relative importance measures are sensitive to the type and amount of missing data and imputation method. Relative importance test procedures based on mean imputation and multiple imputation are recommended for detecting RS in incomplete data.

[Statistical analysis of German radiologic periodicals: developmental trends in the last 10 years].

PubMed

Golder, W

1999-09-01

To identify which statistical tests are applied in German radiological publications, to what extent their use has changed during the last decade, and which factors might be responsible for this development. The major articles published in "ROFO" and "DER RADIOLOGE" during 1988, 1993 and 1998 were reviewed for statistical content. The contributions were classified by principal focus and radiological subspecialty. The methods used were assigned to descriptive, basal and advanced statistics. Sample size, significance level and power were established. The use of experts' assistance was monitored. Finally, we calculated the so-called cumulative accessibility of the publications. 525 contributions were found to be eligible. In 1988, 87% used descriptive statistics only, 12.5% basal, and 0.5% advanced statistics. The corresponding figures in 1993 and 1998 are 62 and 49%, 32 and 41%, and 6 and 10%, respectively. Statistical techniques were most likely to be used in research on musculoskeletal imaging and articles dedicated to MRI. Six basic categories of statistical methods account for the complete statistical analysis appearing in 90% of the articles. ROC analysis is the single most common advanced technique. Authors make increasingly use of statistical experts' opinion and programs. During the last decade, the use of statistical methods in German radiological journals has fundamentally improved, both quantitatively and qualitatively. Presently, advanced techniques account for 20% of the pertinent statistical tests. This development seems to be promoted by the increasing availability of statistical analysis software.

Optimization of a Membrane Feeding Assay for Plasmodium vivax Infection in Anopheles albimanus.

PubMed

Vallejo, Andrés F; Rubiano, Kelly; Amado, Andres; Krystosik, Amy R; Herrera, Sócrates; Arévalo-Herrera, Myriam

2016-06-01

Individuals exposed to malaria infections for a long time develop immune responses capable of blocking Plasmodium transmission to mosquito vectors, potentially limiting parasite spreading in nature. Development of a malaria TB vaccine requires a better understanding of the mechanisms and main effectors responsible for transmission blocking (TB) responses. The lack of an in vitro culture system for Plasmodium vivax has been an important drawback for development of a standardized method to assess TB responses to this parasite. This study evaluated host, vector, and parasite factors that may influence Anopheles mosquito infection in order to develop an efficient and reliable assay to assess the TB immunity. A total of 94 P. vivax infected patients were enrolled as parasite donors or subjects of direct mosquito feeding in two malaria endemic regions of Colombia (Tierralta, and Buenaventura). Parasite infectiousness was assessed by membrane feeding assay or direct feeding assay using laboratory reared Anopheles mosquitoes. Infection was measured by qPCR and by microscopically examining mosquito midguts at day 7 for the presence of oocysts. Best infectivity was attained in four day old mosquitoes fed at a density of 100 mosquitos/cage. Membrane feeding assays produced statistically significant better infections than direct feeding assays in parasite donors; cytokine profiles showed increased IFN-γ, TNF and IL-1 levels in non-infectious individuals. Mosquito infections and parasite maturation were more reliably assessed by PCR compared to microscopy. We evaluated mosquito, parasite and host factors that may affect the outcome of parasite transmission as measured by artificial membrane feeding assays. Results have led us to conclude that: 1) optimal mosquito infectivity occurs with mosquitoes four days after emergence at a cage density of 100; 2) mosquito infectivity is best quantified by PCR as it may be underestimated by microscopy; 3) host cellular immune response did not appear to significantly affect mosquito infectivity; and 4) no statistically significant difference was observed in transmission between mosquitoes directly feeding on humans and artificial membrane feeding assays.

A New Method for Synthesizing Radiation Dose-Response Data From Multiple Trials Applied to Prostate Cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Diez, Patricia; Vogelius, Ivan S.; Department of Human Oncology, University of Wisconsin School of Medicine and Public Health, Madison, WI 53792

2010-07-15

Purpose: A new method is presented for synthesizing dose-response data for biochemical control of prostate cancer according to study design (randomized vs. nonrandomized) and risk group (low vs. intermediate-high). Methods and Materials: Nine published prostate cancer dose escalation studies including 6,539 patients were identified in the MEDLINE and CINAHL databases and reviewed to assess the relationship between dose and biochemical control. A novel method of analysis is presented in which the normalized dose-response gradient, {gamma}{sub 50}, is estimated for each study and subsequently synthesized across studies. Our method does not assume that biochemical control rates are directly comparable between studies.more » Results: Nonrandomized studies produced a statistically significantly higher {gamma}{sub 50} than randomized studies for intermediate- to high-risk patients ({gamma}{sub 50} = 1.63 vs. {gamma}{sub 50} = 0.93, p = 0.03) and a borderline significantly higher ({gamma}{sub 50} = 1.78 vs. {gamma}{sub 50} = 0.56, p = 0.08) for low-risk patients. No statistically significant difference in {gamma}{sub 50} was found between low- and intermediate- to high-risk patients (p = 0.31). From the pooled data of low and intermediate- to high-risk patients in randomized trials, we obtain the overall best estimate of {gamma}{sub 50} = 0.84 with 95% confidence interval 0.54-1.15. Conclusions: Nonrandomized studies overestimate the steepness of the dose-response curve as compared with randomized trials. This is probably the result of stage migration, improved treatment techniques, and a shorter follow-up in higher dose patients that were typically entered more recently. This overestimation leads to inflated expectations regarding the benefit from dose-escalation and could lead to underpowered clinical trials. There is no evidence of a steeper dose response for intermediate- to high-risk compared with low-risk patients.« less

Some Statistics for Assessing Person-Fit Based on Continuous-Response Models

ERIC Educational Resources Information Center

Ferrando, Pere Joan

2010-01-01

This article proposes several statistics for assessing individual fit based on two unidimensional models for continuous responses: linear factor analysis and Samejima's continuous response model. Both models are approached using a common framework based on underlying response variables and are formulated at the individual level as fixed regression…

In vivo evaluation of the effect of stimulus distribution on FIR statistical efficiency in event-related fMRI

PubMed Central

Jansma, J Martijn; de Zwart, Jacco A; van Gelderen, Peter; Duyn, Jeff H; Drevets, Wayne C; Furey, Maura L

2013-01-01

Technical developments in MRI have improved signal to noise, allowing use of analysis methods such as Finite impulse response (FIR) of rapid event related functional MRI (er-fMRI). FIR is one of the most informative analysis methods as it determines onset and full shape of the hemodynamic response function (HRF) without any a-priori assumptions. FIR is however vulnerable to multicollinearity, which is directly related to the distribution of stimuli over time. Efficiency can be optimized by simplifying a design, and restricting stimuli distribution to specific sequences, while more design flexibility necessarily reduces efficiency. However, the actual effect of efficiency on fMRI results has never been tested in vivo. Thus, it is currently difficult to make an informed choice between protocol flexibility and statistical efficiency. The main goal of this study was to assign concrete fMRI signal to noise values to the abstract scale of FIR statistical efficiency. Ten subjects repeated a perception task with five random and m-sequence based protocol, with varying but, according to literature, acceptable levels of multicollinearity. Results indicated substantial differences in signal standard deviation, while the level was a function of multicollinearity. Experiment protocols varied up to 55.4% in standard deviation. Results confirm that quality of fMRI in an FIR analysis can significantly and substantially vary with statistical efficiency. Our in vivo measurements can be used to aid in making an informed decision between freedom in protocol design and statistical efficiency. PMID:23473798

Response of animal and vegetative cells to the effect of a typical magnetic storm

NASA Astrophysics Data System (ADS)

Talikina, M. G.; Izyumov, Yu. G.; Krylov, V. V.

2013-12-01

Experimentally reproduced fluctuations of a low-frequency magnetic field in a nanotesla range (magnetic storm) affect the mitosis of animals and vegetative cells. Action of this factor during twenty four hours leads to a significant increase in the proliferative activity of embryo cells in roach ( Rutilus rutilus L.) and meristem cells of onion rootlets ( Allium cepa). The clastogenic effect statistically confirmed only in the Allium test seems to reflect the species specificity of the response and higher sensitivity of the cell association of the onion meristem to magnetic storm.

Statistics of Visual Responses to Image Object Stimuli from Primate AIT Neurons to DNN Neurons.

PubMed

Dong, Qiulei; Wang, Hong; Hu, Zhanyi

2018-02-01

Under the goal-driven paradigm, Yamins et al. ( 2014 ; Yamins & DiCarlo, 2016 ) have shown that by optimizing only the final eight-way categorization performance of a four-layer hierarchical network, not only can its top output layer quantitatively predict IT neuron responses but its penultimate layer can also automatically predict V4 neuron responses. Currently, deep neural networks (DNNs) in the field of computer vision have reached image object categorization performance comparable to that of human beings on ImageNet, a data set that contains 1.3 million training images of 1000 categories. We explore whether the DNN neurons (units in DNNs) possess image object representational statistics similar to monkey IT neurons, particularly when the network becomes deeper and the number of image categories becomes larger, using VGG19, a typical and widely used deep network of 19 layers in the computer vision field. Following Lehky, Kiani, Esteky, and Tanaka ( 2011 , 2014 ), where the response statistics of 674 IT neurons to 806 image stimuli are analyzed using three measures (kurtosis, Pareto tail index, and intrinsic dimensionality), we investigate the three issues in this letter using the same three measures: (1) the similarities and differences of the neural response statistics between VGG19 and primate IT cortex, (2) the variation trends of the response statistics of VGG19 neurons at different layers from low to high, and (3) the variation trends of the response statistics of VGG19 neurons when the numbers of stimuli and neurons increase. We find that the response statistics on both single-neuron selectivity and population sparseness of VGG19 neurons are fundamentally different from those of IT neurons in most cases; by increasing the number of neurons in different layers and the number of stimuli, the response statistics of neurons at different layers from low to high do not substantially change; and the estimated intrinsic dimensionality values at the low convolutional layers of VGG19 are considerably larger than the value of approximately 100 reported for IT neurons in Lehky et al. ( 2014 ), whereas those at the high fully connected layers are close to or lower than 100. To the best of our knowledge, this work is the first attempt to analyze the response statistics of DNN neurons with respect to primate IT neurons in image object representation.

Effect of Tdap when administered before, with or after the 13-valent pneumococcal conjugate vaccine (coadministered with the quadrivalent meningococcal conjugate vaccine) in adults: A randomised controlled trial.

PubMed

Tashani, M; Alfelali, M; Barasheed, O; Alqahtani, A S; Heron, L; Wong, M; Rashid, H; Booy, R

2016-11-21

Sequential or co-administration of vaccines has potential to alter the immune response to any of the antigens. Existing literature suggests that prior immunisation of tetanus/diphtheria-containing vaccines can either enhance or suppress immune response to conjugate pneumococcal or meningococcal vaccines. We examined this interaction among adult Australian travellers before attending the Hajj pilgrimage 2014. We also investigated tolerability of these vaccines separately and concomitantly. We randomly assigned each participant to one of three vaccination schedules. Group A received adult tetanus, diphtheria and acellular pertussis vaccine (Tdap) 3-4weeks before receiving CRM197-conjugated 13-valent pneumococcal vaccine (PCV13) and CRM197-conjugated quadrivalent meningococcal vaccine (MCV4). Group B received all three vaccines on one day. Group C received PCV13 and MCV4 3-4weeks before Tdap. Blood samples collected at baseline, each vaccination visit and 3-4weeks after vaccination were tested using the pneumococcal opsonophagocytic assay (OPA) and by ELISA for diphtheria and tetanus antibodies. Funding for meningococcal serology was not available. Participants completed symptom diaries after each vaccination. A total of 111 participants aged 18-64 (median 40) years were recruited. No statistically significant difference was detected across the three groups in achieving OPA titre ⩾1:8 post vaccination. However, compared to other groups, Group A had a statistically significant lower number of subjects achieving ⩾4-fold rise in serotype 3, and also significantly lower geometric mean titres (GMTs) to six (of 13) pneumococcal serotypes (3, 5, 18C, 4, 19A and 9V). Group C (given prior PCV13 and MVC4) had statistically significant higher pre-Tdap geometric mean concentration (GMC) of anti-diphtheria IgG; however, there was no difference across the three groups following Tdap. Anti-tetanus IgG GMCs were similar across the groups before and after Tdap. No serious adverse events were reported. In conclusion, Tdap vaccination 3-4weeks before concomitant administration of PCV13 and MCV4 significantly reduced the antibody response to six of the 13 pneumococcal serotypes in adults. The trial is registered at the Australian New Zealand Clinical Trials Registry (ANZCTR): ACTRN12613000536763. Copyright © 2016 Elsevier Ltd. All rights reserved.

Influence of Solar Variability on the North Atlantic / European Sector.

NASA Astrophysics Data System (ADS)

Gray, L. J.

2016-12-01

The 11year solar cycle signal in December-January-February averaged mean-sea-level pressure and Atlantic/European blocking frequency is examined using multilinear regression with indices to represent variability associated with the solar cycle, volcanic eruptions, the El Nino - Southern Oscillation (ENSO) and the Atlantic Multidecadal Oscillation (AMO). Results from a previous 11-year solar cycle signal study of the period 1870-2010 (140 years; 13 solar cycles) that suggested a 3-4 year lagged signal in SLP over the Atlantic are confirmed by analysis of a much longer reconstructed dataset for the period 1660-2010 (350 years; 32 solar cycles). Apparent discrepancies between earlier studies are resolved and stem primarily from the lagged nature of the response and differences between early- and late-winter responses. Analysis of the separate winter months provide supporting evidence for two mechanisms of influence, one operating via the atmosphere that maximises in late winter at 0-2 year lags and one via the mixd-layer ocean that maximises in early winter at 3-4 year lags. Corresponding analysis of DJF-averaged Atlantic / European blocking frequency shows a highly statistically significant signal at 1-year lag that originates promarily from the late winter response. The 11-year solar signal in DJF blocking frequency is compared with other known influences from ENSO and the AMO and found to be as large in amplitude and have a larger region of statistical significance.

Establishing glucose- and ABA-regulated transcription networks in Arabidopsis by microarray analysis and promoter classification using a Relevance Vector Machine.

PubMed

Li, Yunhai; Lee, Kee Khoon; Walsh, Sean; Smith, Caroline; Hadingham, Sophie; Sorefan, Karim; Cawley, Gavin; Bevan, Michael W

2006-03-01

Establishing transcriptional regulatory networks by analysis of gene expression data and promoter sequences shows great promise. We developed a novel promoter classification method using a Relevance Vector Machine (RVM) and Bayesian statistical principles to identify discriminatory features in the promoter sequences of genes that can correctly classify transcriptional responses. The method was applied to microarray data obtained from Arabidopsis seedlings treated with glucose or abscisic acid (ABA). Of those genes showing >2.5-fold changes in expression level, approximately 70% were correctly predicted as being up- or down-regulated (under 10-fold cross-validation), based on the presence or absence of a small set of discriminative promoter motifs. Many of these motifs have known regulatory functions in sugar- and ABA-mediated gene expression. One promoter motif that was not known to be involved in glucose-responsive gene expression was identified as the strongest classifier of glucose-up-regulated gene expression. We show it confers glucose-responsive gene expression in conjunction with another promoter motif, thus validating the classification method. We were able to establish a detailed model of glucose and ABA transcriptional regulatory networks and their interactions, which will help us to understand the mechanisms linking metabolism with growth in Arabidopsis. This study shows that machine learning strategies coupled to Bayesian statistical methods hold significant promise for identifying functionally significant promoter sequences.

The Effect of a Surgical Skills Course on Confidence Levels of Rural General Practitioners: An Observational Study.

PubMed

Byrd, Pippa; Ward, Olga; Hamdorf, Jeffrey

2016-10-01

Objective  To investigate the effect of a short surgical skills course on general practitioners' confidence levels to perform procedural skills. Design  Prospective observational study. Setting  The Clinical Evaluation and Training Centre, a practical skills-based educational facility, at The University of Western Australia. Participants  Medical practitioners who participated in these courses. Nurses, physiotherapists, and medical students were excluded. The response rate was 61% with 61 participants providing 788 responses for pre- and postcourse confidence levels regarding various surgical skills. Intervention  One- to two-day surgical skills courses consisting of presentations, demonstrations, and practical stations, facilitated by specialists. Main Outcome Measures  A two-page precourse and postcourse questionnaire was administered to medical practitioners on the day. Participants rated their confidence levels to perform skills addressed during the course on a 4-point Likert scale. Results  Of the 788 responses regarding confidence levels, 621 were rated as improved postcourse, 163 were rated as no change, and 4 were rated as lower postcourse. Seven of the courses showed a 25% median increase in confidence levels, and one course demonstrated a 50% median increase. All courses showed statistically significant results ( p  < 0.001). Conclusion  A short surgical skills course resulted in a statistically significant improvement in the confidence levels of rural general practitioners to perform these skills.

Post Hoc Analysis of Potential Predictors of Response to Atomoxetine for the Treatment of Adults with Attention-Deficit/Hyperactivity Disorder using an Integrated Database.

PubMed

Bushe, Chris; Sobanski, Esther; Coghill, David; Berggren, Lovisa; De Bruyckere, Katrien; Leppämäki, Sami

2016-04-01

Responses to atomoxetine vary for individual patients with attention-deficit/hyperactivity disorder (ADHD). However, we do not know whether any factors can be used to reliably predict how individuals with ADHD will respond to treatment. Our objective was to evaluate background variables that facilitate early identification of those adults with ADHD who are likely to respond to treatment with atomoxetine. We pooled data for atomoxetine-treated adults with ADHD from 12 clinical trials for a short-term (10-week) analysis, and from 11 clinical trials for a long-term (24-week) analysis. Patients not meeting a response definition [≥30 % reduction in Conners' Adult ADHD Rating Scales-Investigator Rated: Screening Version (CAARS-Inv:SV) total score and Clinical Global Impressions of ADHD Severity Scale (CGI-S) score ≤3 at endpoint], or who discontinued, were defined as non-responders. Another definition of response (≥30 % reduction in CAARS-Inv:SV total score at endpoint) was also used in these analyses; only the results with the former definition are shown in this abstract, as the same conclusions were gained with both definitions. A treatment-specified subgroup detection tool (a resampling-based ensemble tree method) was used to identify predictors of response. Of 1945 adults in the long-term analysis, 548 (28.2 %) were responders to atomoxetine at week 24; 65.2 % of 1397 non-responders had discontinued. Of 4524 adults in the short-term analysis, 1490 (32.9 %) were responders at week 10; 33.2 % of 1006 non-responders had discontinued. No analyzed baseline parameters (age, sex, prior stimulant use, ADHD subtype, CAARS-Inv:SV, CGI-S) were statistically significant predictors of response. Reductions in CAARS-Inv:SV total, CAARS-Inv:SV subscores, and CGI-S at week 4 in the short-term analysis, and at weeks 4 or 10 in the long-term analysis, were statistically significant predictors of response, i.e., patients with versus without these reductions early in treatment were more likely to be clinical responders at later time points. Sensitivity ranged from 28.6 to 85.9 %, and specificity ranged from 23.8 to 86.7 %. Predictors with higher sensitivity had lower specificity, and vice versa. Reductions in CAARS-Inv:SV and CGI-S scores at weeks 4 and 10 are statistically significant predictors of response to atomoxetine at later time points in adults with ADHD. However, the predictors identified by these analyses are not reliable enough for use in clinical practice. The only currently available method to judge whether individuals with ADHD will respond to atomoxetine is to start treatment and assess the response over an extended period, sometimes longer than 10 weeks.

Orexinergic Neurotransmission in Temperature Responses to Methamphetamine and Stress: Mathematical Modeling as a Data Assimilation Approach

PubMed Central

Behrouzvaziri, Abolhassan; Fu, Daniel; Tan, Patrick; Yoo, Yeonjoo; Zaretskaia, Maria V.; Rusyniak, Daniel E.; Molkov, Yaroslav I.; Zaretsky, Dmitry V.

2015-01-01

Experimental Data Orexinergic neurotransmission is involved in mediating temperature responses to methamphetamine (Meth). In experiments in rats, SB-334867 (SB), an antagonist of orexin receptors (OX1R), at a dose of 10 mg/kg decreases late temperature responses (t>60 min) to an intermediate dose of Meth (5 mg/kg). A higher dose of SB (30 mg/kg) attenuates temperature responses to low dose (1 mg/kg) of Meth and to stress. In contrast, it significantly exaggerates early responses (t<60 min) to intermediate and high doses (5 and 10 mg/kg) of Meth. As pretreatment with SB also inhibits temperature response to the stress of injection, traditional statistical analysis of temperature responses is difficult. Mathematical Modeling We have developed a mathematical model that explains the complexity of temperature responses to Meth as the interplay between excitatory and inhibitory nodes. We have extended the developed model to include the stress of manipulations and the effects of SB. Stress is synergistic with Meth on the action on excitatory node. Orexin receptors mediate an activation of on both excitatory and inhibitory nodes by low doses of Meth, but not on the node activated by high doses (HD). Exaggeration of early responses to high doses of Meth involves disinhibition: low dose of SB decreases tonic inhibition of HD and lowers the activation threshold, while the higher dose suppresses the inhibitory component. Using a modeling approach to data assimilation appears efficient in separating individual components of complex response with statistical analysis unachievable by traditional data processing methods. PMID:25993564

Learning by Doing or Learning by Studying the History of Statistics? A Response to "The Sociology of Teaching Graduate Statistics"

ERIC Educational Resources Information Center

Farkas, George

2005-01-01

This article presents the author's response to Timothy Patrick Moran's article "The Sociology of Teaching Graduate Statistics." Since 1972, the author has taught the required graduate-level social statistics course in three different departments. During this time, he has seen the truth of the concerns that Moran expresses at the beginning of his…

The quality assessment of family physician service in rural regions, Northeast of Iran in 2012

PubMed Central

Vafaee-Najar, Ali; Nejatzadegan, Zohreh; Pourtaleb, Arefeh; Kaffashi, Shahnaz; Vejdani, Marjan; Molavi-Taleghani, Yasamin; Ebrahimipour, Hosein

2014-01-01

Background: Following the implementation of family physician plan in rural areas, the quantity of provided services has been increased, but what leads on the next topic is the improvement in expected quality of service, as well. The present study aims at determining the gap between patients’ expectation and perception from the quality of services provided by family physicians during the spring and summer of 2012. Methods: This was a cross-sectional study in which 480 patients who referred to family physician centers were selected with clustering and simple randomized method. Data were collected through SERVQUAL standard questionnaire and were analyzed with descriptive statistics, using statistical T-test, Kruskal-Wallis, and Wilcoxon signed-rank tests by SPSS 16 at a significance level of 0.05. Results: The difference between the mean scores of expectation and perception was about -0.93, which is considered as statistically significant difference (P≤ 0.05). Also, the differences in five dimensions of quality were as follows: tangible -1.10, reliability -0.87, responsiveness -1.06, assurance -0.83, and empathy -0.82. Findings showed that there was a significant difference between expectation and perception in five concepts of the provided services (P≤ 0.05). Conclusion: There was a gap between the ideal situation and the current situation of family physician quality of services. Our suggestion is maintaining a strong focus on patients, creating a medical practice that would exceed patients’ expectations, providing high-quality healthcare services, and realizing the continuous improvement of all processes. In both tangible and responsive, the gap was greater than the other dimensions. It is recommended that more attention should be paid to the physical appearance of the health center environment and the availability of staff and employees. PMID:24757691

Solid Cancer Incidence in the Techa River Incidence Cohort: 1956-2007.

PubMed

Davis, F G; Yu, K L; Preston, D; Epifanova, S; Degteva, M; Akleyev, A V

2015-07-01

Previously reported studies of the Techa River Cohort have established associations between radiation dose and the occurrence of solid cancers and leukemia (non-CLL) that appear to be linear in dose response. These analyses include 17,435 cohort members alive and not known to have had cancer prior to January 1, 1956 who lived in areas near the river or Chelyabinsk City at some time between 1956 and the end of 2007, utilized individualized dose estimates computed using the Techa River Dosimetry System 2009 and included five more years of follow-up. The median and mean dose estimates based on these doses are consistently higher than those based on earlier Techa River Dosimetry System 2000 dose estimates. This article includes new site-specific cancer risk estimates and risk estimates adjusted for available information on smoking. There is a statistically significant (P = 0.02) linear trend in the smoking-adjusted all-solid cancer incidence risks with an excess relative risk (ERR) after exposure to 100 mGy of 0.077 with a 95% confidence interval of 0.013-0.15. Examination of site-specific risks revealed statistically significant radiation dose effects only for cancers of the esophagus and uterus with an ERR per 100 mGy estimates in excess of 0.10. Esophageal cancer risk estimates were modified by ethnicity and sex, but not smoking. While the solid cancer rates are attenuated when esophageal cancer is removed (ERR = 0.063 per 100 mGy), a dose-response relationship is present and it remains likely that radiation exposure has increased the risks for most solid cancers in the cohort despite the lack of power to detect statistically significant risks for specific sites.

Effect of ED-71, a New Active Vitamin D Analog, on Bone Formation in an Orthopedically Expanded Suture in Rats. A Histomorphometric Study

PubMed Central

Uysal, Tancan; Amasyali, Mihri; Enhos, Sukru; Sonmez, Mehmet Fatih; Sagdic, Deniz

2009-01-01

Objectives The aim of this experimental study was to evaluate the effects of ED-71, a new active vitamin D analog, on bone regeneration in response to expansion of the mid-palatal suture, in rats, histomorphometrically. Methods Sixteen male 50–60 days old Wistar rats were separated into two equal groups (control and experimental). Both groups were subjected to expansion, and 30 grams of force was applied to the maxillary incisors with a helical-spring. Experimental group was treated with single-dose ED-71 (0.8 μg/kg body weight) in the mid-palatal suture locally and eight control animals received vehicle solution. Bone regeneration in the mid-palatal suture was evaluated by bone histomorphometric method and mineralized area (Md.Ar), fibrosis area (Fb.Ar), mineralized area/fibrosis area (Md.Ar/Fb.Ar), bone area (B.Ar) and osteoblast number (N.Ob) parameters were evaluated. Mann Whitney-U test was used for statistical evaluation at P<.05 level. Results Statistical analysis showed significant differences between groups for all investigated histomorphometric parameters. Md.Ar (P<.001), Md.Ar/Fb.Ar (P<.001), B.Ar (P<.01) and N.Ob (P<.001) parameters were significantly increased and Fb.Ar (P<.001) measurement was significantly decreased in experimental group. ED-71 group with a mean of 24.55±6.47 showed statistically higher N.Ob than the control group (mean N.Ob: 12.82±5.81). Conclusions ED-71 has positive effects on early phase of bone regeneration in the mid-palatal suture in response to expansion and may be beneficial in routine maxillary expansion procedures. PMID:19756189

Periodontal response to orthodontic tooth movement in diabetes-induced rats with or without periodontal disease.

PubMed

Ferreira, Camila Lopes; da Rocha, Vinicius Clemente; da Silva Ursi, Weber José; De Marco, Andrea Carvalho; Santamaria, Milton; Santamaria, Mauro Pedrine; Jardini, Maria Aparecida Neves

2018-03-01

Systemic conditions can influence orthodontic tooth movement. This study evaluates histologic periodontal responses to orthodontic tooth movement in diabetes-induced rats with or without periodontal disease. Forty Wistar rats were divided according their systemic condition (SC) into diabetic (D) and non-diabetic (ND) groups. Each group was subdivided into control (C), orthodontic tooth movement (OM), ligature-induced periodontitis (P) and ligature-induced periodontitis with orthodontic movement (P+OM) groups. Diabetes mellitus (DM) was induced with alloxan monohydrate, and after 30 days, the P group received a cotton ligature around their first lower molar crown. An orthodontic device was placed in OM and P+OM groups for 7 days, and the animals were then euthanized. Differences in OM between D and ND groups were not significant (6.87± 3.55 mm and 6.81 ± 3.28 mm, respectively), but intragroup analysis revealed statistically significant differences between the P+OM groups for both SCs. Bone loss was greater in the D group (0.16 ± 0.07 mm 2 ) than in the ND group (0.10 ± 0.03 mm 2 ). In intragroup analysis of the D condition, the P+OM group differed statistically from the other groups, while in the ND condition, the P+OM group was different from the C and OM groups. There was a statistically significant difference in bone density between D and ND conditions (18.03 ± 8.09% and 22.53 ± 7.72%) in the C, P, and P+OM groups. DM has deleterious effects on bone density and bone loss in the furcation region. These effects are maximized when associated with ligature-induced periodontitis with orthodontic movement. © 2018 American Academy of Periodontology.

Differences in Empathy Levels of Medical Students Based on Gender, Year of Medical School and Career Choice.

PubMed

Tariq, Nabia; Tayyab, Ali; Jaffery, Tara

2018-04-01

To measure mean empathy scores of Pakistani medical students and to explore any association of empathy scores with gender, medical school year and future career choice. Cross-sectional survey. Shifa College of Medicine, Shifa Tameer-e-Millat University, during the academic year 2015-2016. The student version of Jefferson Scale of Physician Empathy (JSPE) was distributed to the students electronically via the student portal. Response that were completed in full were included in the study. Descriptive statistics was used to analyse student demographic data. The student score on the JSPE was reported as the mean (out of 7) of each item. Independent samples t-test was employed to check the significant differences between genders. Empathy score with advancing year of study was investigated using ANOVA. ANOVA with post-hoc Tukey's test was used to study the relationship between career choice and empathy score. The response rate was 70.94%. The mean score was 4.51 ±0.69. Females obtained greater, but statistically insignificant (p=0.08) empathy score (4.58) as compared to the male students (4.45). No statistically significant difference was seen between scores on the survey across the five academic years (F=0.88, p=0.47). Students who selected medicine and allied as career choice showed a significantly higher empathy score than those who opted for surgery. The internal consistency reliability (Cronbach's alpha) was 0.78. There were low levels of empathy in Pakistani medical students. Students with interest in medicine and allied showed higher empathy scores compared to surgical or technical specialties. No association of empathy scores with gender and medical school year was observed.

Cortical Auditory Evoked Potentials with Simple (Tone Burst) and Complex (Speech) Stimuli in Children with Cochlear Implant

PubMed Central

Martins, Kelly Vasconcelos Chaves; Gil, Daniela

2017-01-01

Introduction  The registry of the component P1 of the cortical auditory evoked potential has been widely used to analyze the behavior of auditory pathways in response to cochlear implant stimulation. Objective  To determine the influence of aural rehabilitation in the parameters of latency and amplitude of the P1 cortical auditory evoked potential component elicited by simple auditory stimuli (tone burst) and complex stimuli (speech) in children with cochlear implants. Method  The study included six individuals of both genders aged 5 to 10 years old who have been cochlear implant users for at least 12 months, and who attended auditory rehabilitation with an aural rehabilitation therapy approach. Participants were submitted to research of the cortical auditory evoked potential at the beginning of the study and after 3 months of aural rehabilitation. To elicit the responses, simple stimuli (tone burst) and complex stimuli (speech) were used and presented in free field at 70 dB HL. The results were statistically analyzed, and both evaluations were compared. Results  There was no significant difference between the type of eliciting stimulus of the cortical auditory evoked potential for the latency and the amplitude of P1. There was a statistically significant difference in the P1 latency between the evaluations for both stimuli, with reduction of the latency in the second evaluation after 3 months of auditory rehabilitation. There was no statistically significant difference regarding the amplitude of P1 under the two types of stimuli or in the two evaluations. Conclusion  A decrease in latency of the P1 component elicited by both simple and complex stimuli was observed within a three-month interval in children with cochlear implant undergoing aural rehabilitation. PMID:29018498

Biomedical research of novel biodegradable copoly(amino acid)s based on 6-aminocaproic acid and L-proline.

PubMed

Zhang, Weipeng; Shao, Jianmin

2010-08-01

The biomedical properties of novel biodegradable copoly(amino acid)s based on 6-aminocaproic acid and L-proline were analyzed in this article. The cytotoxicity of the copolymer films was tested in vitro using human embryonic kidney (HEK) 293 cells. The cell proliferation, cell cycle, cell apoptosis, and hemolysis of the polymers were also investigated. No significant cytotoxic response was detected statistically by cytotoxicity assay, and the results of cell apoptosis and cell cycle showed that there were no statistically significant differences in them. Generally, the cells spread and grew well on polymer film. Meanwhile, the extent of hemolysis on the polymers was acceptable. Evaluation of cytotoxicity by cell cycle and apoptosis as a supplementary assay is correspondingly discussed in this article. (c) 2010 Wiley Periodicals, Inc.

Serum electrolyte and protein changes after intravenous injection of sodium and meglumine diatrizoate (urograffin-370).

PubMed

Nzeh, D A; Erasmus, R T; Aiyedun, B A

1994-03-01

Serum electrolyte and protein changes in 35 Nigerian patients undergoing intravenous urography were evaluated after injection of 60 mls sodium and meglumine diatrizoate (Urograffin-370). Statistically, significant changes were noted in the values of serum calcium, proteins and albumin at 5 and 30 minutes after the injection (P < 0.005). The mean percentage decreases noted were calcium 13%, protein 17% and albumin 13%. At 30 minutes post-injection, the serum protein and albumin levels had incompletely recovered while calcium values continued to decrease. Non-statistically, significant changes were observed in the values of serum sodium, potassium and phosphate at 5 and 30 minutes respectively following contrast medium injection. Alterations in the levels of serum electrolytes especially calcium are most probably responsible for such adverse effects as convulsions and cardiac arrhythmias.

Is metabolic dysregulation associated with antidepressant response in depressed women in climacteric treated with individualized homeopathic medicines or fluoxetine? The HOMDEP-MENOP Study.

PubMed

Macías-Cortés, Emma Del Carmen; Llanes-González, Lidia; Aguilar-Faisal, Leopoldo; Asbun-Bojalil, Juan

2017-02-01

Climacteric is associated with both depression and metabolic dysregulation. Scarce evidence suggests that metabolic dysregulation may predict poor response to conventional antidepressants. Response to depression treatment has not been studied in homeopathic medicine. The aim of this study was to investigate the prevalence of metabolic disorders in depressed climacteric women treated with homeopathic medicines, fluoxetine or placebo, and if these alterations have any association with response to depression treatment. One hundred and thirty-three Mexican women (40-65 years) with depression, enrolled in the HOMDEP-MENOP study, a randomized, placebo-controlled, double-blind, double-dummy, three-arm trial with a 6 week follow-up, underwent a complete medical history and clinical examination. Metabolic parameters were assessed at baseline. Association between baseline metabolic parameters and response to depression treatment was analyzed with bivariate analysis in the three groups. Odds ratios (OR) with their 95% confidence interval (95% CI) were calculated. Metabolic parameters were considered for inclusion in the logistic regression model if they had a statistically significant relationship with response rate on bivariate analysis at p<0.05 or if they were clinically relevant. Overall combined prevalence (obesity and overweight) was 86.5%; 52.3% had hypertriglyceridemia; 44.7% hypercholesterolemia; 46.7% insulin resistance; and 16% subclinical hypothyroidism. There was no statistically significant association between dyslipidemia, overweight, or insulin resistance and non-response in the homeopathy group [OR (95% CI) 1.57 (0.46-5.32), p=0.467; 0.37 (0.003-1.11), p=0.059; 0.67 (0.16-2.7), p=0.579, respectively]. Metabolic dysregulation was not significantly associated with response to depression treatment in depressed climacteric women treated with individualized homeopathic treatment (IHT), fluoxetine or placebo. Due to the high prevalence of metabolic disorders and its relationship with depression in the climacteric, further investigation should be focused on whether individualized prescriptions based on classical homeopathy for depressed climacteric women have an effect on metabolic parameters, and/or if treating the metabolic disorders at the same time could lead to higher response rates. ClinicalTrials.gov Identifier: NCT01635218 URL: http://clinicaltrials.gov/ct2/show/NCT01635218?term=depression+homeopathy&rank=1. Copyright © 2016 The Faculty of Homeopathy. Published by Elsevier Ltd. All rights reserved.

Lesions Responsible for Delayed Oral Transit Time in Post-stroke Dysphagia.

PubMed

Moon, Hyun Im; Yoon, Seo Yeon; Yi, Tae Im; Jeong, Yoon Jeong; Cho, Tae Hwan

2018-06-01

Some stroke patients show oral phase dysphagia, characterized by a markedly prolonged oral transit time that hinders oral feeding. The aim of this study was to clarify the clinical characteristics and lesions responsible for delayed swallowing. We reviewed 90 patients with stroke. The oral processing time plus the postfaucial aggregation time required to swallow semisolid food was assessed. The patients were divided into two groups according to oral transit time, and we analyzed the differences in characteristics such as demographic factors, lesion factors, and cognitive function. Logistic regression analyses were performed to examine the predictors of delayed oral transit time. Lesion location and volume were measured on brain magnetic resonance images. We generated statistic maps of lesions related to delayed oral phase in swallowing using voxel-based lesion symptom mapping (VLSM). The group of patients who showed delayed oral transit time had significantly low cognitive function. Also, in a regression model, delayed oral phase was predicted with low K-MMSE (Korean version of the Mini Mental Status Exam). Using VLSM, we found the lesion location to be associated with delayed oral phase after adjusting for K-MMSE score. Although these results did not reach statistical significance, they showed the lesion pattern with predominant distribution in the left frontal lobe. Delayed oral phase in post-stroke patients was not negligible clinically. Patients' cognitive impairments affect the oral transit time. When adjusting it, we found a trend that the lesion responsible for delayed oral phase was located in the left frontal lobe, though the association did not reach significance. The delay might be related to praxis function.

Common pitfalls in statistical analysis: Clinical versus statistical significance

PubMed Central

Ranganathan, Priya; Pramesh, C. S.; Buyse, Marc

2015-01-01

In clinical research, study results, which are statistically significant are often interpreted as being clinically important. While statistical significance indicates the reliability of the study results, clinical significance reflects its impact on clinical practice. The third article in this series exploring pitfalls in statistical analysis clarifies the importance of differentiating between statistical significance and clinical significance. PMID:26229754

Recurrent Vulvovaginal Candidiasis: Could It Be Related to Cell-Mediated Immunity Defect in Response to Candida Antigen?

PubMed Central

Talaei, Zahra; Sheikhbahaei, Saba; Ostadi, Vajihe; Ganjalikhani Hakemi, Mazdak; Meidani, Mohsen; Naghshineh, Elham; Yaran, Majid; Naeini, Alireza Emami; Sherkat, Roya

2017-01-01

Background Recurrent vulvovaginal candidiasis (RVVC) is a common cause of morbidity affecting millions of women worldwide. Patients with RVVC are thought to have an underlying immunologic defect. This study has been established to evaluate cell-mediated immunity defect in response to candida antigen in RVVC cases. Materials and Methods Our cross-sectional study was performed in 3 groups of RVVC patients (cases), healthy individuals (control I) and known cases of chronic mucocutaneous candidiasis (CMC) (control II). Patients who met the inclusion criteria of RVVC were selected consecutively and were allocated in the case group. Peripheral blood mononuclear cells were isolated and labeled with CFSE and proliferation rate was measured in exposure to candida antigen via flow cytometry. Results T lymphocyte proliferation in response to candida was significantly lower in RVVC cases (n=24) and CMC patients (n=7) compared to healthy individuals (n=20, P<0.001), but no statistically significant difference was seen between cases and control II group (P>0.05). Family history of primary immunodeficiency diseases (PID) differed significantly among groups (P=0.01), RVVC patients has family history of PID more than control I (29.2 vs. 0%, P=0.008) but not statistically different from CMC patients (29.2 vs. 42.9%, P>0.05). Prevalence of atopy was greater in RVVC cases compared to healthy individuals (41.3 vs. 15%, P=0.054). Lymphoproliferative activity and vaginal symptoms were significantly different among RVVC cases with and without allergy (P=0.01, P=0.02). Conclusion Our findings revealed that T cells do not actively proliferate in response to Candida antigen in some RVVC cases. So it is concluded that patients with cell-mediated immunity defect are more susceptible to recurrent fungal infections of vulva and vagina. Nonetheless, some other cases of RVVC showed normal function of T cells. Further evaluations showed that these patients suffer from atopy. It is hypothesized that higher frequency of VVC in patients with history of atopy might be due to allergic response in mucocutaneous membranes rather than a functional impairment in immune system components. PMID:28868834

Assessment of frequency of diarrhoea in relation to drinking water among residents of Nurpur Shahan, Pakistan.

PubMed

Kakakhel, Zainab Masroor; Ibrar, Somabia; Khan, Wasim Alam; Bibi, Hajera; Zamir, Syed Ahmed; Khan, Shafin Sohail; Khan, Shabaz; Khan, Sohrab; Tariq, Wasif; Tahir, M Hassan; Iqbal, Saima

2011-09-01

To determine the source of drinking water and to assess its relationship with the frequency of diarrhoea among households of Nurpur Shahan. A cross-sectional descriptive study was carried out in January 2010 with a preformed questionnaire. Systematic random sampling was used to collect data. Participants' consent was obtained and confidentiality was maintained during the survey and during analysis. Households were evaluated for the frequency of diarrhoea in relation to their water source, its purification, and availability of sanitation facilities. All collected data was analyzed using SPSS 10.0. Of the 107 households surveyed, 2.8% used wells, 63% used tap water and 32.7% used hand pumps, whereas only 0.9% consumed store-bought water as their major source of drinking water. The difference in the frequency of diarrhoea between those households who purified their water and those that did not was just 1%. The relationship between the source of drinking water and the frequency of diarrhoea was not statistically significant (p = 0.319). Surprisingly households with no disposal facilities only had a 20% frequency of diarrhoea; this was found to be statistically significant (p = 0.023). This study contradicts the general conception that water supply is responsible for diarrhoea in the locality of Nurpur Shahan; it was found that the statistical difference between diarrhoea resulting from purified and non purified water was very small (p-value=0.587). Rather, improper sanitation and poor personal hygiene seem largely responsible for diarrhoea in this rural Islamabad community.

Population activity statistics dissect subthreshold and spiking variability in V1.

PubMed

Bányai, Mihály; Koman, Zsombor; Orbán, Gergő

2017-07-01

Response variability, as measured by fluctuating responses upon repeated performance of trials, is a major component of neural responses, and its characterization is key to interpret high dimensional population recordings. Response variability and covariability display predictable changes upon changes in stimulus and cognitive or behavioral state, providing an opportunity to test the predictive power of models of neural variability. Still, there is little agreement on which model to use as a building block for population-level analyses, and models of variability are often treated as a subject of choice. We investigate two competing models, the doubly stochastic Poisson (DSP) model assuming stochasticity at spike generation, and the rectified Gaussian (RG) model tracing variability back to membrane potential variance, to analyze stimulus-dependent modulation of both single-neuron and pairwise response statistics. Using a pair of model neurons, we demonstrate that the two models predict similar single-cell statistics. However, DSP and RG models have contradicting predictions on the joint statistics of spiking responses. To test the models against data, we build a population model to simulate stimulus change-related modulations in pairwise response statistics. We use single-unit data from the primary visual cortex (V1) of monkeys to show that while model predictions for variance are qualitatively similar to experimental data, only the RG model's predictions are compatible with joint statistics. These results suggest that models using Poisson-like variability might fail to capture important properties of response statistics. We argue that membrane potential-level modeling of stochasticity provides an efficient strategy to model correlations. NEW & NOTEWORTHY Neural variability and covariability are puzzling aspects of cortical computations. For efficient decoding and prediction, models of information encoding in neural populations hinge on an appropriate model of variability. Our work shows that stimulus-dependent changes in pairwise but not in single-cell statistics can differentiate between two widely used models of neuronal variability. Contrasting model predictions with neuronal data provides hints on the noise sources in spiking and provides constraints on statistical models of population activity. Copyright © 2017 the American Physiological Society.

Numbering questionnaires had no impact on the response rate and only a slight influence on the response content of a patient safety culture survey: a randomized trial.

PubMed

Kundig, François; Staines, Anthony; Kinge, Thompson; Perneger, Thomas V

2011-11-01

In self-completed surveys, anonymous questionnaires are sometimes numbered so as to avoid sending reminders to initial nonrespondents. This number may be perceived as a threat to confidentiality by some respondents, which may reduce the response rate, or cause social desirability bias. In this study, we evaluated whether using nonnumbered vs. numbered questionnaires influenced the response rate and the response content. During a patient safety culture survey, we randomized participants into two groups: one received an anonymous nonnumbered questionnaire and the other a numbered questionnaire. We compared the survey response rates and distributions of the responses for the 42-questionnaire items across the two groups. Response rates were similar in the two groups (nonnumbered, 75.2%; numbered, 72.8%; difference, 2.4%; P=0.28). Five of the 42 questions had statistically significant differences in distributions, but these differences were small. Unexpectedly, in all five instances, the patient safety culture ratings were more favorable in the nonnumbered group. Numbering of mailed questionnaires had no impact on the response rate. Numbering influenced significantly the response content of several items, but these differences were small and ran against the hypothesis of social desirability bias. Copyright © 2011 Elsevier Inc. All rights reserved.

Assessment of hydroxychloroquine maculopathy after cessation of treatment: an optical coherence tomography and multifocal electroretinography study

PubMed Central

Moschos, Marilita M; Nitoda, Eirini; Chatziralli, Irini P; Gatzioufas, Zisis; Koutsandrea, Chryssanthi; Kitsos, George

2015-01-01

Objective This study was conducted to evaluate the macular status of patients treated with hydroxychloroquine before and after cessation of treatment. Methods Forty-two patients with systemic lupus erythematosus underwent ocular examination based on visual acuity evaluation, optical coherence tomography retinal thickness measurements, and multifocal electroretinography (mfERG) records at first visit. The tests were repeated 6 months after treatment withdrawal and compared to the findings at their first visit. Results Mean visual acuity (measured in log minimum angle of resolution) of both eyes was statistically increased after hydroxychloroquine discontinuation (difference in means: 0.06 [P<0.0001] and 0.01 [P=0.003] for the right and left eyes, respectively). Retinal response amplitudes of central and peripheral areas were significantly improved for both eyes. The following values were observed for central responses: the difference in means was −19.9 (P<0.0001) and −13.6 (P<0.0001) for the right eye and the left eye, respectively; for peripheral responses, difference in means was −10.3 (P<0.0001) and −9.5 (P<0.0001) for right eye and left eye, respectively, after the 6-month examination. There were no statistically significant differences in the retinal thickness of patients after cessation of treatment. The visual acuity of the patients was correlated to central and peripheral mfERG responses (r=−0.53 [P<0.0001] and r=−0.53 [P<0.0001], for the right eye and the left eye, respectively). Conclusion The visual acuity of patients receiving hydroxychloroquine improves along with the amplitudes of the mfERG responses 6 months after discontinuation of the drug, but no difference in retinal thickness is identified. PMID:26089648

Assessment of hydroxychloroquine maculopathy after cessation of treatment: an optical coherence tomography and multifocal electroretinography study.

PubMed

Moschos, Marilita M; Nitoda, Eirini; Chatziralli, Irini P; Gatzioufas, Zisis; Koutsandrea, Chryssanthi; Kitsos, George

2015-01-01

This study was conducted to evaluate the macular status of patients treated with hydroxychloroquine before and after cessation of treatment. Forty-two patients with systemic lupus erythematosus underwent ocular examination based on visual acuity evaluation, optical coherence tomography retinal thickness measurements, and multifocal electroretinography (mfERG) records at first visit. The tests were repeated 6 months after treatment withdrawal and compared to the findings at their first visit. Mean visual acuity (measured in log minimum angle of resolution) of both eyes was statistically increased after hydroxychloroquine discontinuation (difference in means: 0.06 [P<0.0001] and 0.01 [P=0.003] for the right and left eyes, respectively). Retinal response amplitudes of central and peripheral areas were significantly improved for both eyes. The following values were observed for central responses: the difference in means was -19.9 (P<0.0001) and -13.6 (P<0.0001) for the right eye and the left eye, respectively; for peripheral responses, difference in means was -10.3 (P<0.0001) and -9.5 (P<0.0001) for right eye and left eye, respectively, after the 6-month examination. There were no statistically significant differences in the retinal thickness of patients after cessation of treatment. The visual acuity of the patients was correlated to central and peripheral mfERG responses (r=-0.53 [P<0.0001] and r=-0.53 [P<0.0001], for the right eye and the left eye, respectively). The visual acuity of patients receiving hydroxychloroquine improves along with the amplitudes of the mfERG responses 6 months after discontinuation of the drug, but no difference in retinal thickness is identified.

Efficacy and safety of the oral Janus kinase inhibitor peficitinib (ASP015K) monotherapy in patients with moderate to severe rheumatoid arthritis in Japan: a 12-week, randomised, double-blind, placebo-controlled phase IIb study

PubMed Central

Takeuchi, Tsutomu; Tanaka, Yoshiya; Iwasaki, Manabu; Ishikura, Hiroaki; Saeki, Satoshi; Kaneko, Yuichiro

2016-01-01

Objective To evaluate the efficacy, safety and dose response of a novel oral Janus kinase inhibitor, peficitinib (ASP015K), as monotherapy in Japanese patients with moderate to severe rheumatoid arthritis (RA). Methods In a 12-week, double-blind study, 281 adult patients with RA with active disease not on concomitant disease-modifying antirheumatic drug therapy were randomised equally to once-daily placebo or peficitinib 25, 50, 100 and 150 mg. The primary endpoint was American College of Rheumatology (ACR) 20 response in the peficitinib treatment groups versus placebo at week 12. Results Mean age was 53.0 years, 81.1% were female and 25.3% had previously used antitumour necrosis factor therapy. Peficitinib 50, 100 and 150 mg each showed statistically significantly higher ACR20 response rates compared with placebo, and response rates increased up to 150 mg with a statistically significant dose response. The total incidence of treatment-emergent adverse events (TEAEs) was similar between the placebo (64.3%) and peficitinib 25, 50, 100 and 150 mg groups (70.9%, 64.9%, 52.7% and 67.2%, respectively). TEAEs occurring more frequently in the peficitinib group compared with the placebo group included nasopharyngitis, increased blood creatine phosphokinase and diarrhoea. No cases of serious infections were reported. Herpes zoster occurred in four patients (two each in peficitinib 25 and 100 mg). Conclusions Treatment with peficitinib as monotherapy for 12 weeks in Japanese patients with moderate to severe RA is efficacious and showed acceptable safety profile. These findings support further developments of peficitinib for RA treatment. Trial registration number NCT01649999; Results. PMID:26672064

Importance of basophils in eosinophilic asthma: the murine counterpart.

PubMed

Poddighe, D; Mathias, C B; Brambilla, I; Marseglia, G L; Oettgen, H C

2018-01-01

Several experimental studies in mice showed that basophils participate in the initiation of Th2 adaptive immune response, in addition to the effector phase. However, the role of basophils in allergic airway inflammation is less clear. The aim of this experiment was to assess the importance of basophils in recruiting inflammatory cells and, in particular, eosinophils in a murine model of asthma induced by Aspergillus fumigatus allergens. Additionally, bronchial reactivity was evaluated. Basophil depletion resulted in a reduction of inflammatory cells in the airways and eosinophil recruitment was significantly impaired. Also bronchial reactivity seemed to be impaired in basophil-depleted mice, but the result was not statistically significant. According to these preliminary data, basophils seem to influence the local eosinophilic response of allergic asthma.

Postprandial glucose and insulin responses to various tropical fruits of equivalent carbohydrate content in non-insulin-dependent diabetes mellitus.

PubMed

Roongpisuthipong, C; Banphotkasem, S; Komindr, S; Tanphaichitr, V

1991-11-01

The plasma glucose and insulin responses were determined in 10 NIDDM female patients following the ingestion of tropical fruit containing 25 g of carbohydrate. The five tropical fruits were pineapple, mango, banana, durian and rambutan. Blood was drawn at 0, 30, 60, 120 and 180 min, respectively. The results showed that the glucose-response curves to mango and banana were significantly less than those to rambutan, durian and pineapple (P less than 0.05). Only the glucose area after mango ingestion was significantly less than the glucose areas of the other fruits (P less than 0.05). The insulin response curve and insulin area after durian ingestion was statistically greater than after ingestion of the others. We concluded that after mango ingestion, the glucose area was lower than it had been after rambutan, durian and pineapple ingestion and the insulin area was lower than that after durian ingestion of equivalent carbohydrate content in type 2 (NIDDM) diabetes.

Reduction of Cortisol Levels and Participants' Responses Following Art Making.

PubMed

Kaimal, Girija; Ray, Kendra; Muniz, Juan

2016-04-02

This quasi-experimental study investigated the impact of visual art making on the cortisol levels of 39 healthy adults. Participants provided saliva samples to assess cortisol levels before and after 45 minutes of art making. Participants also provided written responses about the experience at the end of the session. Results indicate that art making resulted in statistically significant lowering of cortisol levels. Participants' written responses indicated that they found the art-making session to be relaxing, enjoyable, helpful for learning about new aspects of self, freeing from constraints, an evolving process of initial struggle to later resolution, and about flow/losing themselves in the work. They also reflected that the session evoked a desire to make art in the future. There were weak associations between changes in cortisol level and age, time of day, and participant responses related to learning about one's self and references to an evolving process in art making. There were no significant differences in outcomes based on prior experiences with art making, media choice, or gender.

Statistical Mining of Predictability of Seasonal Precipitation over the United States

NASA Technical Reports Server (NTRS)

Lau, William K. M.; Kim, Kyu-Myong; Shen, S. P.

2001-01-01

Results from a new ensemble canonical correlation (ECC) prediction model yield a remarkable (10-20%) increases in baseline prediction skills for seasonal precipitation over the US for all seasons, compared to traditional statistical predictions. While the tropical Pacific, i.e., El Nino, contributes to the largest share of potential predictability in the southern tier States during boreal winter, the North Pacific and the North Atlantic are responsible for enhanced predictability in the northern Great Plains, Midwest and the southwest US during boreal summer. Most importantly, ECC significantly reduces the spring predictability barrier over the conterminous US, thereby raising the skill bar for dynamical predictions.

Statistical summary of air quality data for metropolitian Cleveland, Ohio, 1967 - 1972: Total suspended particulates, nitrogen dioxide, and sulfur dioxide

NASA Technical Reports Server (NTRS)

King, R. B.; Neustadter, H. E.; Fordyce, J. S.; Burr, J. C., Jr.; Cornett, C. L.

1974-01-01

Air-quality data for metropolitan Cleveland, Ohio, from 1967 through 1972 were collated and statistically analyzed. Total suspended particulates (TSP) departed from lognormal distribution in 1972. Nitrogen dioxide and sulfur dioxide, departed significantly from lognormal distributions in 1972. In Cleveland the Ohio standards were not met. However, the data indicate a general improvement in air quality. Unusually high precipitation (43% above the average in 1972) may be responsible in lowering these values from the 1971 levels. The mean values of TSP, NO2, and SO2 are 104, 191, and 83 microgram/cu m respectively.

Survey mode matters: adults' self-reported statistical confidence, ability to obtain health information, and perceptions of patient-health-care provider communication.

PubMed

Wallace, Lorraine S; Chisolm, Deena J; Abdel-Rasoul, Mahmoud; DeVoe, Jennifer E

2013-08-01

This study examined adults' self-reported understanding and formatting preferences of medical statistics, confidence in self-care and ability to obtain health advice or information, and perceptions of patient-health-care provider communication measured through dual survey modes (random digital dial and mail). Even while controlling for sociodemographic characteristics, significant differences in regard to adults' responses to survey variables emerged as a function of survey mode. While the analyses do not allow us to pinpoint the underlying causes of the differences observed, they do suggest that mode of administration should be carefully adjusted for and considered.

Effects of illness and disability on job separation.

PubMed

Magee, William

2004-03-01

Effects of illness and disability on job separation result from both voluntary and involuntary processes. Voluntary processes range from the reasoned actions of workers who weigh illness and disability in their decision-making, to reactive stress-avoidance responses. Involuntary processes include employer discrimination against ill or disabled workers. Analyses of the effects of illness and disability that differentiate reasons for job separation can illuminate the processes involved. This paper reports on an evaluation of effects of illness and disability on job separation predicted by theories of reasoned action, stress, and employer discrimination against ill and disabled workers. Effects of four illness/disability conditions on the rate of job separation for 12 reasons are estimated using data from a longitudinal study of a representative sample of the Canadian population-the Survey of Labour and Income Dynamics (SLID). Two of the four effects that are statistically significant (under conservative Bayesian criteria for statistical significance) are consistent with the idea that workers weigh illness and disability as costs, and calculate the costs and benefits of continuing to work with an illness or disability: (1) disabling illness increases the hazard of leaving a job in order to engage in caregiving, and (2) work-related disability increases the hazard of leaving a job due to poor pay. The other two significant effects indicate that: (3) disabling illness decreases the hazard of layoff, and (4) non-work disability increases the hazard of leaving one job to take a different job. This last effect is consistent with a stress-interruption process. Other effects are statistically significant under conventional criteria for statistical significance, and most of these effects are also consistent with cost-benefit and stress theories. Some effects of illness and disability are sex and age-specific, and reasons for the specificity of these effects are discussed.

Enhancing residents’ neonatal resuscitation competency through unannounced simulation-based training

PubMed Central

Surcouf, Jeffrey W.; Chauvin, Sheila W.; Ferry, Jenelle; Yang, Tong; Barkemeyer, Brian

2013-01-01

Background Almost half of pediatric third-year residents surveyed in 2000 had never led a resuscitation event. With increasing restrictions on residency work hours and a decline in patient volume in some hospitals, there is potential for fewer opportunities. Purpose Our primary purpose was to test the hypothesis that an unannounced mock resuscitation in a high-fidelity in-situ simulation training program would improve both residents’ self-confidence and observed performance of adopted best practices in neonatal resuscitation. Methods Each pediatric and medicine–pediatric resident in one pediatric residency program responded to an unannounced scenario that required resuscitation of the high fidelity infant simulator. Structured debriefing followed in the same setting, and a second cycle of scenario response and debriefing occurred before ending the 1-hour training experience. Measures included pre- and post-program confidence questionnaires and trained observer assessments of live and videotaped performances. Results Statistically significant pre–post gains for self-confidence were observed for 8 of the 14 NRP critical behaviors (p=0.00–0.03) reflecting knowledge, technical, and non-technical (teamwork) skills. The pre–post gain in overall confidence score was statistically significant (p=0.00). With a maximum possible assessment score of 41, the average pre–post gain was 8.28 and statistically significant (p<0.001). Results of the video-based assessments revealed statistically significant performance gains (p<0.0001). Correlation between live and video-based assessments were strong for pre–post training scenario performances (pre: r=0.64, p<0.0001; post: r=0.75, p<0.0001). Conclusions Results revealed high receptivity to in-situ, simulation-based training and significant positive gains in confidence and observed competency-related abilities. Results support the potential for other applications in residency and continuing education. PMID:23522399

Individual tree differences confound effects of growth regulators in rooting sugar maple softwood cuttings

Treesearch

John R. Donnelly

1971-01-01

Softwood stem cuttings from three mature sugar maple trees were treated with several types and concentrations of growth regulators. Lack of statistical significance was due to extreme variability in tree response: low levels of auxin stimulated rooting in two study trees, while auxins inhibited rooting in the other tree. It is postulated that variations in rooting...

Douglas-fir survival and growth in response to spring planting date and depth

Treesearch

R. O. Strothmann

1971-01-01

Douglas-fir seedlings were planted by four methods in late February and late March on hot, south-facing slopes in northwestern California. Besides standard planting, the techniques used included deep planting at two different depths, and shading the lower stem. The differences in survival after 3 growing seasons were not statistically significant, but deep planting had...

Investigating the Effectiveness of Graphic Organizer Instruction on the Comprehension and Recall of Science Content by Students with Learning Disabilities.

ERIC Educational Resources Information Center

Griffin, Cynthia C.; And Others

1991-01-01

The effect of graphic organizers on 14 learning-disabled students' (grades 5 and 6) recall of science content was compared with that of students taught identical content without the graphic organizer condition. Evaluation two weeks later found no statistically significant differences between the groups on production or choice response tasks. (DB)

Survey of Public Participation in the Arts: Volume II. Changes in American's Participation, 1982-1985. Final Report.

ERIC Educational Resources Information Center

Robinson, John P.; And Others

The primary purpose of this report was to compare data obtained from the 1982 and 1985 "Survey of Public Participation in the Arts." Comparisons of core questions and responses indicate that: (1) 1985 results are very close to those obtained in 1982; (2) there was a statistically significant decline in musical theater performance…

The Level of Awareness of Safety Measures Practiced in School Laboratories among Pre-Service Science Teachers at Najran University

ERIC Educational Resources Information Center

Fagihi, Yahea Ali

2018-01-01

This study is an attempt to identify the level of awareness of safety measures practiced in school laboratories among pre-service Science teachers at Najran University. It also aims to identify the sources of safety measures awareness and the statistically significant differences among the sample responses due to specialization and grade…

Serum antibody responses to vaccinal antigens in lean and obese geriatric dogs.

PubMed

Ellis, John; Gow, Sheryl; Rhodes, Carrie; Lacoste, Stacey; Kong, Lyndsay; Musil, Kristyna; Snead, Elisabeth

2016-05-01

The immune responses in control dogs [1 to 4 years of age, body condition score (BCS): 4 to 5 out of 9] were compared to those of aging dogs (based on breed and body size) either categorized as lean (BCS: 4 to 5 out of 9) or obese (BCS: 8 to 9 out of 9). Of interest were the serum titers to the following common agents found in vaccines, canine parainfluenza virus (CPIV), canine parvovirus (CPV), canine distemper virus (CDV), canine respiratory coronavirus (CRCoV), and Bordetella bronchiseptica. There were no statistical differences in the antibodies to CPIV, B. bronchispetica, and CRCoV, among the age/weight categories, nor among the age/weight categories and the time, in days, between the date of sample collection and the date of the last recorded vaccination for CPIV, B. bronchiseptica, CPV, and CDV. For CPV, the control dogs had significantly (P < 0.002) higher serum neutralization (SN) titers than the lean geriatric dogs and the obese geriatric dogs. For CDV SN titers, the only statistically significant (P = 0.01) difference was that the control dogs had higher SN titers than the lean geriatric dogs.

Serum antibody responses to vaccinal antigens in lean and obese geriatric dogs

PubMed Central

Ellis, John; Gow, Sheryl; Rhodes, Carrie; Lacoste, Stacey; Kong, Lyndsay; Musil, Kristyna; Snead, Elisabeth

2016-01-01

The immune responses in control dogs [1 to 4 years of age, body condition score (BCS): 4 to 5 out of 9] were compared to those of aging dogs (based on breed and body size) either categorized as lean (BCS: 4 to 5 out of 9) or obese (BCS: 8 to 9 out of 9). Of interest were the serum titers to the following common agents found in vaccines, canine parainfluenza virus (CPIV), canine parvovirus (CPV), canine distemper virus (CDV), canine respiratory coronavirus (CRCoV), and Bordetella bronchiseptica. There were no statistical differences in the antibodies to CPIV, B. bronchispetica, and CRCoV, among the age/weight categories, nor among the age/weight categories and the time, in days, between the date of sample collection and the date of the last recorded vaccination for CPIV, B. bronchiseptica, CPV, and CDV. For CPV, the control dogs had significantly (P < 0.002) higher serum neutralization (SN) titers than the lean geriatric dogs and the obese geriatric dogs. For CDV SN titers, the only statistically significant (P = 0.01) difference was that the control dogs had higher SN titers than the lean geriatric dogs. PMID:27152043

Changing Criminal Attitudes Among Incarcerated Offenders: Initial Examination of a Structured Treatment Program.

PubMed

Simourd, David J; Olver, Mark E; Brandenburg, Bryan

2016-09-01

The present study investigated the effect of a criminal attitude treatment program to changes on measured criminal attitudes and postprogram recidivism. The criminal attitude program (CAP) is a standardized therapeutic curriculum consisting of 15 modules offering 44 hr of therapeutic time. It was delivered by trained facilitators to a total of 113 male offenders incarcerated in one of five state correctional institutions. Pretreatment and posttreatment comparisons were made on standardized measures of criminal attitudes, response bias, and motivation for lifestyle changes. Results found statistically significant lower criminal attitudes at posttreatment that were unaffected by response bias. There were also increases in motivation for lifestyle changes, but these did not reach statistical significance. Fifty-seven participants were released into the community following the program and were eligible for recidivism analyses. Comparisons between participants who completed the CAP and those who did not complete the CAP revealed 7% lower rearrest among CAP completers. Although preliminary, these results indicate that the CAP had a positive effect on changes to criminal attitudes and recidivism. The findings are discussed in terms of conceptual and practical considerations in the assessment and treatment of criminal attitudes among offenders. © The Author(s) 2015.

Robots in food systems: a review and assessment of potential uses.

PubMed

Adams, E A; Messersmith, A M

1986-04-01

Management personnel in foodservice, food processing, and robot industries were surveyed to evaluate potential job functions for robots in the food industry. The survey instrument listed 64 different food-related job functions that participants were asked to assess as appropriate or not appropriate for robotic implementation. Demographic data were collected from each participant to determine any positive or negative influence on job function responses. The survey responses were statistically evaluated using frequencies and the chi-square test of significance. Sixteen of the 64 job functions were identified as appropriate for robot implementation in food industries by both robot manufacturing and food managers. The study indicated, first, that food managers lack knowledge about robots and robot manufacturing managers lack knowledge about food industries. Second, robots are not currently being used to any extent in the food industry. Third, analysis of the demographic data in relation to the 16 identified job functions showed no significant differences in responses.

Certolizumab pegol in a heterogeneous population of patients with moderate-to-severe rheumatoid arthritis

PubMed Central

Soriano, Enrique R; Dellepiane, Analia; Salvatierra, Gabriela; Benítez, Cristian Alejandro; Salinas, Rodrigo Garcia; Baruzzo, Carlos

2018-01-01

Aim: To determine the efficacy and safety of certolizumab pegol for the treatment of rheumatoid arthritis in a real-world setting. Materials & methods: Patients with moderate-to-severe rheumatoid arthritis who initiated therapy with certolizumab were followed for 12 weeks. Response was assessed with Disease Activity Score of 28 joints, European Ligue Against Rheumatism criteria and Simplified Disease Activity Index. Predictors of response were analyzed with binary logistic regression models. Results: Statistically significant decreases in tender and swollen joint counts, laboratory parameters and use of corticosteroids and disease-modifying antirheumatic drugs were found. Disease activity also significantly diminished. Higher Disease Activity Score of 28 joints at baseline was the main predictor of response. No severe adverse events were reported. Conclusion: Certolizumab was effective and well tolerated, particularly in the subpopulation with higher inflammatory burden at baseline. PMID:29682324

Vestibular evoked myogenic potential (Vemp): evaluation of responses in normal subjects.

PubMed

Felipe, Lilian; Santos, Marco Aurélio Rocha; Gonçalves, Denise Utsch

2008-01-01

the Vestibular Evoked Myogenic Potential (Vemp) is formed by myogenic neurophysiologic responses activated by high-intensity sound stimulation. The response is registered through surface electromyography of the cervical muscles during muscle contraction. The acoustic stimuli activate the saccular macula, the vestibular inferior nerve and the pathways related to the vestibule-spinal descendant nerves. to describe Vemp parameters in a normal population. thirty adults, 13 men and 17 women with no otoneurological complaints were selected. The stimuli were 200 tone burst, with a frequency of 1Hz and intensity of 118 dB Na, band-pass filter ranging from 10Hz to 1500Hz. The first potential biphasic P13-N23 wave was analyzed. no significant difference was observed between the sides of stimulation in terms of latency and amplitude. However, a statistically significant difference was found for amplitude between genders. Vemp demonstrated to be a reliable instrument in the clinical assessment of the vestibular function.

Assessment of corticosteroid-induced alkaline phosphatase as a prognostic indicator in canine lymphoma.

PubMed

Wiedemann, A L; Charney, S C; Barger, A M; Schaeffer, D J; Kitchell, B E

2005-04-01

To examine the incidence of elevated corticosteroid-induced alkaline phosphatase (sALP) in dogs with lymphoma and to determine if sALP is a reliable prognostic indicator in canine lymphoma. The medical records of 62 canine lymphoma patients treated with a combination chemotherapy protocol from 1994 to 2003 at the University of Illinois Veterinary Teaching Hospital were examined. Variables assessed with respect to response rate and remission duration included age, bodyweight, sex, breed, World Health Organization stage (I to V), substage (a or b), pretreatment administration of corticosteroid, and serum levels of alkaline phosphatase, sALP and alanine aminotransferase. sALP was not statistically significant with respect to response rate or duration of remission, nor was preinduction glucocorticoid administration. Stage was significant with respect to achieving remission. It was found that sALP is not a useful prognostic indicator for response rate and remission duration in dogs with lymphoma.

Exposure with response prevention versus habit reversal in Tourettes's syndrome: a controlled study.

PubMed

Verdellen, Cara W J; Keijsers, Ger P J; Cath, Danielle C; Hoogduin, Cees A L

2004-05-01

The intentional nature of tics provides the opportunity to apply behavioural interventions aimed at tic reduction through interruption of stimulus-response sequences. The aim of this study has been to evaluate the effect of exposure and response prevention (ER) versus habit reversal (HR) in 43 Tourette's syndrome (TS) patients. The three outcome measures were: the Yale Global Tic Severity Scale (YGTSS), 15-min tic frequency registrations monitored at the institute and 15-min home tic frequency registrations. Both treatment conditions resulted in statistically significant improvements on all outcome measures (p < 0.001). No significant differences were found between the treatment conditions on any of the outcome measures, although there was a tendency in favour of ER on the YGTSS (p = 0.05). These results suggest that, at least in the short term, TS tic symptoms can be treated effectively with both types of treatment.

Corneal biomechanical properties in floppy eyelid syndrome.

PubMed

Muniesa, MaJesús; Muniesa Royo, MaJesús; March, Ana; March de Ribot, Ana; Sánchez-de-la-Torre, Manuel; Huerva, Valetín; Huerva Escanilla, Valetín; Jurjo, Carmen; Jurjo Campo, Carmen; Barbé, Ferran; Barbé Illa, Ferran

2015-05-01

To determine corneal biomechanical properties in patients with floppy eyelid syndrome (FES) and to compare them with eyes of controls. This case-control study included 208 eyes (72 eyes with FES and 136 without FES) of 107 patients (37 patients with FES and 70 without FES). Patients underwent a complete clinical eye examination that included corneal biomechanical evaluation carried out with the Reichert Ocular Response Analyzer. Corneal hysteresis (CH), corneal resistance factor (CRF), central corneal thickness (CCT), Goldmann-correlated intraocular pressure (IOPg), and corneal-compensated intraocular pressure (IOPcc) were evaluated. Mean CH was significantly lower in patients with FES than in those without FES (9.51 ± 1.56 vs. 11.66 ± 9.11; P < 0.001). These results remained statistically significant after adjusting for age and apnea-hypoapnea index (AHI) (P = 0.028). Mean CRF was 10.02 ± 2.08 in the group of patients with FES and 11.21 ± 5.36 in the group of patients without FES (P = 0.001). Mean IOPcc was 17.7 ± 4.8 in patients with FES and 16.3 ± 4.4 in those without FES (P = 0.036). After adjusting for age and AHI, these differences in CRF and IOPcc were not statistically significant (P = 0.26 and P = 0.87, respectively). No statistically significant difference was found between patients with and without FES for Goldmann-correlated intraocular pressure or CCT. Patients with FES had statistically lower CH values. Our findings suggest that corneal biomechanical properties could be changed in patients with FES, reflecting additional structural changes in FES.

Awareness of basic life support among staff and students in a dental school.

PubMed

Reddy, Sahithi; Doshi, Dolar; Reddy, Padma; Kulkarni, Suhas; Reddy, Srikanth

2013-05-01

To assess and compare the knowledge of basic life support (BLS) among third, fourth and fifth (III, IV and V) year Bachelor of Dental Surgery (BDS) clinical students, dental interns, postgraduate students and Bachelor of Dental Surgery (BDS) and Master of Dental Surgery (MDS) faculty of Panineeya Institute of Dental Sciences and Hospital, Hyderabad, India. A BLS questionnaire consisting of 22 questions was used to assess the levels of III, IV and V years BDS clinical students, dental interns, postgraduate students and BDS and MDS faculty of Panineeya Institute of Dental Sciences and Hospital, Hyderabad, India. Statistical Package for Social Sciences software (SPSS version 12.0) was used to analyze the statistical data. The p<0.05 was considered statistically significant. A total of 338 respondents took part in the study. When gender comparison was done with correct knowledge responses, statistically significant differences were noted for Q6, Q9, Q12, Q13, Q15 and Q17. For age groups and educational qualifications, significant difference was observed for all questions. It was noted that III, IV and V year undergraduate clinical students and half of interns had adequate knowledge when compared to postgraduate students (6.9%), BDS tutors (0.00%) and MDS staff (10.7%). The study concludes that there is a significant lack of knowledge among postgraduates students BDS and MDS faculty, regarding BLS when compared to III, IV and V year's clinical BDS students and dental interns. This study emphasizes the need for all health care professionals to regularly update the knowledge and skills regarding BLS.

Evidence of effects of human disturbance on alert response in Père David's deer (Elaphurus davidianus).

PubMed

Li, Chunwang; Jiang, Zhigang; Tang, Songhua; Zeng, Yan

2007-11-01

To understand effects of human disturbance on alert response of Père David's deer, we carried out an experiment in the Dafeng Père David's Deer Reserve (32 degrees 59'-33 degrees 03'N, 120 degrees 47'-120 degrees 53'E), China. In the spring and summer, we observed alert responses (including stare, walking away, and flee) of deer and recorded the intensity of tourist disturbance in a small display pen using a laser-range finder to measure the alert distance of a free-ranging group in a large enclosure. We also recorded the pattern of head orientation when deer were resting in these two deer groups. After statistical analysis, we found that: 1) in small pen, the frequency of alert response was significantly different among different intensities of human disturbance; strong disturbance resulted in higher frequency of alert response; 2) stare distance in the free-ranging group in summer was significantly longer than that in spring, but the distance of walking away and the distance of flee showed no significant difference between the two seasons; and 3) in free-ranging group, there was no significant directional difference in head orientation, whereas in display group, there was a significant directional difference in head orientation. We suggest that: 1) under the captive situation, human disturbance may be one of the factors that affect alert response in Père David's deer; and 2) Père David's deer adopted different alert response to adapt to human disturbance under different circumstance. We recommended that relationships between alert response and human disturbance should be considered in ex situ conservation of this field extinct deer. Zoo Biol 26:461-470, 2007. (c) 2007 Wiley-Liss, Inc.

Dose-Response Relationship between Dietary Magnesium Intake and Risk of Type 2 Diabetes Mellitus: A Systematic Review and Meta-Regression Analysis of Prospective Cohort Studies.

PubMed

Fang, Xin; Han, Hedong; Li, Mei; Liang, Chun; Fan, Zhongjie; Aaseth, Jan; He, Jia; Montgomery, Scott; Cao, Yang

2016-11-19

The epidemiological evidence for a dose-response relationship between magnesium intake and risk of type 2 diabetes mellitus (T2D) is sparse. The aim of the study was to summarize the evidence for the association of dietary magnesium intake with risk of T2D and evaluate the dose-response relationship. We conducted a systematic review and meta-analysis of prospective cohort studies that reported dietary magnesium intake and risk of incident T2D. We identified relevant studies by searching major scientific literature databases and grey literature resources from their inception to February 2016. We included cohort studies that provided risk ratios, i.e., relative risks (RRs), odds ratios (ORs) or hazard ratios (HRs), for T2D. Linear dose-response relationships were assessed using random-effects meta-regression. Potential nonlinear associations were evaluated using restricted cubic splines. A total of 25 studies met the eligibility criteria. These studies comprised 637,922 individuals including 26,828 with a T2D diagnosis. Compared with the lowest magnesium consumption group in the population, the risk of T2D was reduced by 17% across all the studies; 19% in women and 16% in men. A statistically significant linear dose-response relationship was found between incremental magnesium intake and T2D risk. After adjusting for age and body mass index, the risk of T2D incidence was reduced by 8%-13% for per 100 mg/day increment in dietary magnesium intake. There was no evidence to support a nonlinear dose-response relationship between dietary magnesium intake and T2D risk. The combined data supports a role for magnesium in reducing risk of T2D, with a statistically significant linear dose-response pattern within the reference dose range of dietary intake among Asian and US populations. The evidence from Europe and black people is limited and more prospective studies are needed for the two subgroups.

Visual classification of very fine-grained sediments: Evaluation through univariate and multivariate statistics

USGS Publications Warehouse

Hohn, M. Ed; Nuhfer, E.B.; Vinopal, R.J.; Klanderman, D.S.

1980-01-01

Classifying very fine-grained rocks through fabric elements provides information about depositional environments, but is subject to the biases of visual taxonomy. To evaluate the statistical significance of an empirical classification of very fine-grained rocks, samples from Devonian shales in four cored wells in West Virginia and Virginia were measured for 15 variables: quartz, illite, pyrite and expandable clays determined by X-ray diffraction; total sulfur, organic content, inorganic carbon, matrix density, bulk density, porosity, silt, as well as density, sonic travel time, resistivity, and ??-ray response measured from well logs. The four lithologic types comprised: (1) sharply banded shale, (2) thinly laminated shale, (3) lenticularly laminated shale, and (4) nonbanded shale. Univariate and multivariate analyses of variance showed that the lithologic classification reflects significant differences for the variables measured, difference that can be detected independently of stratigraphic effects. Little-known statistical methods found useful in this work included: the multivariate analysis of variance with more than one effect, simultaneous plotting of samples and variables on canonical variates, and the use of parametric ANOVA and MANOVA on ranked data. ?? 1980 Plenum Publishing Corporation.

Intensity response function of the photopic negative response (PhNR): effect of age and test-retest reliability.

PubMed

Joshi, Nabin R; Ly, Emma; Viswanathan, Suresh

2017-08-01

To assess the effect of age and test-retest reliability of the intensity response function of the full-field photopic negative response (PhNR) in normal healthy human subjects. Full-field electroretinograms (ERGs) were recorded from one eye of 45 subjects, and 39 of these subjects were tested on two separate days with a Diagnosys Espion System (Lowell, MA, USA). The visual stimuli consisted of brief (<5 ms) red flashes ranging from 0.00625 to 6.4 phot cd.s/m 2 , delivered on a constant 7 cd/m 2 blue background. PhNR amplitudes were measured at its trough from baseline (BT) and from the preceding b-wave peak (PT), and b-wave amplitude was measured at its peak from the preceding a-wave trough or baseline if the a-wave was not present. The intensity response data of all three ERG measures were fitted with a generalized Naka-Rushton function to derive the saturated amplitude (V max ), semisaturation constant (K) and slope (n) parameters. Effect of age on the fit parameters was assessed with linear regression, and test-retest reliability was assessed with the Wilcoxon signed-rank test and Bland-Altman analysis. Holm's correction was applied to account for multiple comparisons. V max of BT was significantly smaller than that of PT and b-wave, and the V max of PT and b-wave was not significantly different from each other. The slope parameter n was smallest for BT and the largest for b-wave and the difference between the slopes of all three measures were statistically significant. Small differences observed in the mean values of K for the different measures did not reach statistical significance. The Wilcoxon signed-rank test indicated no significant differences between the two test visits for any of the Naka-Rushton parameters for the three ERG measures, and the Bland-Altman plots indicated that the mean difference between test and retest measurements of the different fit parameters was close to zero and within 6% of the average of the test and retest values of the respective parameters for all three ERG measurements, indicating minimal bias. While the coefficient of reliability (COR, defined as 1.96 times the standard deviation of the test and retest difference) of each fit parameter was more or less comparable across the three ERG measurements, the %COR (COR normalized to the mean test and retest measures) was generally larger for BT compared to both PT and b-wave for each fit parameter. The Naka-Rushton fit parameters did not show statistically significant changes with age for any of the ERG measures when corrections were applied for multiple comparisons. However, the V max of BT demonstrated a weak correlation with age prior to correction for multiple comparisons, and the effect of age on this parameter showed greater significance when the measure was expressed as a ratio of the V max of b-wave from the same subject. V max of the BT amplitude measure of PhNR at the best was weakly correlated with age. None of the other parameters of the Naka-Rushton fit to the intensity response data of either the PhNR or the b-wave showed any systematic changes with age. The test-retest reliability of the fit parameters for PhNR BT amplitude measurements appears to be lower than those of the PhNR PT and b-wave amplitude measurements.

Application of statistical experimental design to study the formulation variables influencing the coating process of lidocaine liposomes.

PubMed

González-Rodríguez, M L; Barros, L B; Palma, J; González-Rodríguez, P L; Rabasco, A M

2007-06-07

In this paper, we have used statistical experimental design to investigate the effect of several factors in coating process of lidocaine hydrochloride (LID) liposomes by a biodegradable polymer (chitosan, CH). These variables were the concentration of CH coating solution, the dripping rate of this solution on the liposome colloidal dispersion, the stirring rate, the time since the liposome production to the liposome coating and finally the amount of drug entrapped into liposomes. The selected response variables were drug encapsulation efficiency (EE, %), coating efficiency (CE, %) and zeta potential. Liposomes were obtained by thin-layer evaporation method. They were subsequently coated with CH according the experimental plan provided by a fractional factorial (2(5-1)) screening matrix. We have used spectroscopic methods to determine the zeta potential values. The EE (%) assay was carried out in dialysis bags and the brilliant red probe was used to determine CE (%) due to its property of forming molecular complexes with CH. The graphic analysis of the effects allowed the identification of the main formulation and technological factors by the analysis of the selected responses and permitted the determination of the proper level of these factors for the response improvement. Moreover, fractional design allowed quantifying the interactions between the factors, which will consider in next experiments. The results obtained pointed out that LID amount was the predominant factor that increased the drug entrapment capacity (EE). The CE (%) response was mainly affected by the concentration of the CH solution and the stirring rate, although all the interactions between the main factors have statistical significance.

A comparison of the responsible drinking dimensions among underage and legal drinkers: examining differences in beliefs, motives, self-efficacy, barriers and intentions.

PubMed

Barry, Adam E; Stellefson, Michael L; Woolsey, Conrad L

2014-01-22

To date, scholarly discourse over the Amethyst Initiative has primarily debated the relative effectiveness of the 21 year-old Minimum Legal Drinking Age (MLDA). Unfortunately, this discourse has failed to account for the Amethyst Initiative's central tenet/mission: facilitating responsible drinking among college students. This investigation seeks to help fill this gap by quantitatively determining whether a random sample of underage (n = 158) and legal (n = 298) drinkers differed with regard to their alcohol-related behaviors, responsible drinking behaviors, and responsible drinking beliefs. Compared to legal drinkers, underage drinkers reported: (a) significantly less confidence to perform responsible drinking behaviors during their next drinking episode [t(446) = -2.97, p < .003; d = -0.297], (b) significantly more perceived barriers to responsible drinking [t(388) = 3.44, p < .001; d = .368], and (c) significantly lower behavioral intentions to perform responsible drinking behaviors the next time they consumed alcohol [t(437) = -3.45, p < .001; d = -0.350]. Each of these differences remained statistically significant, even after controlling for sex and race, in three separate multiple linear regression models. While college students both above and below the 21 year-old MLDA have similar beliefs regarding what constitutes responsible drinking, students below the current MLDA have less intention to drink responsibly regardless of their behavioral beliefs and/or motives. College/university administrators should consider the negative repercussions that are possible if underage students who are less confident in their ability to drink responsibly are given the legal right to drink on campus.

A comparison of the responsible drinking dimensions among underage and legal drinkers: examining differences in beliefs, motives, self-efficacy, barriers and intentions

PubMed Central

2014-01-01

Background To date, scholarly discourse over the Amethyst Initiative has primarily debated the relative effectiveness of the 21 year-old Minimum Legal Drinking Age (MLDA). Unfortunately, this discourse has failed to account for the Amethyst Initiative’s central tenet/mission: facilitating responsible drinking among college students. This investigation seeks to help fill this gap by quantitatively determining whether a random sample of underage (n = 158) and legal (n = 298) drinkers differed with regard to their alcohol-related behaviors, responsible drinking behaviors, and responsible drinking beliefs. Findings Compared to legal drinkers, underage drinkers reported: (a) significantly less confidence to perform responsible drinking behaviors during their next drinking episode [t(446) = -2.97, p < .003; d = -0.297], (b) significantly more perceived barriers to responsible drinking [t(388) = 3.44, p < .001; d = .368], and (c) significantly lower behavioral intentions to perform responsible drinking behaviors the next time they consumed alcohol [t(437) = -3.45, p < .001; d = -0.350]. Each of these differences remained statistically significant, even after controlling for sex and race, in three separate multiple linear regression models. Conclusion While college students both above and below the 21 year-old MLDA have similar beliefs regarding what constitutes responsible drinking, students below the current MLDA have less intention to drink responsibly regardless of their behavioral beliefs and/or motives. College/university administrators should consider the negative repercussions that are possible if underage students who are less confident in their ability to drink responsibly are given the legal right to drink on campus. PMID:24450336

The Impact of US SO2 Emissions on Clouds and the Hydrological Cycle at Global and Regional Scales in Three Coupled Chemistry-Climate Models

NASA Astrophysics Data System (ADS)

Westervelt, D. M.

2016-12-01

It is widely expected that global and regional emissions of atmospheric aerosols and their precursors will decrease strongly throughout the remainder of the 21st century, due to emission reduction policies enacted to protect human health. Although there is some evidence that these aerosol reductions may lead to significant regional and global climate impacts, we currently lack a full understanding of the magnitude, spatial and temporal pattern, and statistical significance of these influences, especially for clouds and precipitation. Further, we often lack robust understanding of the processes by which regional aerosols influence local and remote climate. Here, we aim to quantify systematically the cloud and hydrological cycle response to regional changes in aerosols through model simulations using three fully coupled chemistry-climate models: NOAA Geophysical Fluid Dynamics Laboratory Coupled Model 3 (GFDL-CM3), NCAR Community Earth System Model (NCAR-CESM1), and NASA Goddard Institute for Space Studies ModelE2 (GISS-E2). The central approach we use is to contrast a long control experiment (400 years) with a collection of long individual perturbation experiments ( 200 years). We perturb emissions of sulfur dioxide (SO2; precursor to sulfate aerosol) in the United States and determine which responses are significant relative to internal variability and robust across the three models. Initial results show robust, statistically significant decreases in cloud droplet number and liquid water path in the source region across the three models due to decreases in sulfate aerosols. Setting SO2 emissions to zero over the U.S. causes both local and remote impacts in precipitation, with notable significant increases in Sahel and Arctic precipitation. In 13 of the 15 regions we analyze, the precipitation response to zero U.S. SO2 emissions agrees in sign, with agreement in magnitude to within one standard deviation in many of those regions. U.S. sulfate also impacts the timing of the arrival of the Sahel rainy season. Our approach enables us to develop a basis for understanding the response of regional emissions of aerosols and their precursors, and will be expanded to other regions and aerosol species in future work.

Gender-related analysis of the clinical presentation, treatment response and outcome in patients with immune thrombocytopenia.

PubMed

Andrès, Emmanuel; Mecili, Mustapha; Fothergill, Helen; Zimmer, Jacques; Vogel, Thomas; Maloisel, Frédéric

2012-09-01

Immune thrombocytopenia (idiopathic thrombocytopenic purpura [ITP]) frequently occurs in young adults, particularly women in their third or fourth decade. The female predominance suggests that sex hormones may play a role in the different aspects of ITP. In this paper, we report a gender-related analysis of patients with ITP, specifically examining the clinical manifestations, responses to treatment and overall outcomes of the patients. We included patients with "ITP" attending the departments of onco-hematology or internal medicine B (university hospital of Strasbourg, France) between 1990 and December 2010 The gender-related analysis was retrospective. We studied in 225 consecutive cases of established ITP with a follow-up period of 1.7 to 112 months The mean age of the patients was 44 years; 156 patients were female. The analysis revealed no significant statistical differences regarding patient characteristics between the female and male groups, with the exception of the following characteristics: the bleeding score, which altered in the presence of meno- and/or metrorrhagia and hematuria in female patients (P=0.03); the presence of anemia (P=0.04); and the detection of antinuclear and/or antiphospholipid antibodies (P=0.02). During the follow-up, no statistically significant difference was found regarding outcome or treatment response in relation to gender among these 225 patients (all P>0.05). Gender does not appear to affect the manifestation of immune thrombocytopenia, the outcome or response to treatment. However, further large-scale randomized trials are needed to confirm these findings. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Psychosocial consequences of allocation to lung cancer screening: a randomised controlled trial.

PubMed

Aggestrup, Louise Mosborg; Hestbech, Mie Sara; Siersma, Volkert; Pedersen, Jesper Holst; Brodersen, John

2012-01-01

To examine the psychosocial consequences of being allocated to the control group as compared with the screen group in a randomised lung cancer screening trial. The Danish Lung Cancer Screening Trial, a randomised controlled trial, ran from 2004 to 2010 with the purpose of investigating the benefits and harms of lung cancer screening. The participants in Danish Lung Cancer Screening Trial were randomised to either the control group or the screen group and were asked to complete the questionnaires Consequences Of Screening and Consequences Of Screening in Lung Cancer (COS-LC). The Consequences Of Screening and the COS-LC were used to examine the psychosocial consequences of participating in the study, by comparing the control and the screen groups' responses at the prevalence and at the incidence round. There was no statistically significant difference in socio-demographic characteristics or smoking habits between the two groups. Responses to the COS-LC collected before the incidence round were statistically significantly different on the scales 'anxiety', 'behaviour', 'dejection', 'self-blame', 'focus on airway symptoms' and 'introvert', with the control group reporting higher negative psychosocial consequences. Furthermore, the participants in both the control and the screen groups exhibited a mean increase in negative psychosocial consequences when their responses from the prevalence round were compared with their responses from the first incidence round. Participation in a randomised controlled trial on lung cancer screening has negative psychosocial consequences for the apparently healthy participants-both the participants in the screen group and the control group. This negative impact was greatest for the control group.

Serum polybrominated diphenyl ether (PBDE) concentrations in relation to biomarkers of oxidative stress and inflammation: The National Health and Nutrition Examination Survey 2003–2004

PubMed Central

Yuan, Ye; Meeker, John D.; Ferguson, Kelly K.

2016-01-01

Exposure to Polybrominated diphenyl ethers (PBDEs) has been associated with various adverse health outcomes related to liver, neural and endocrine systems. Some of these may be the result of PBDE-induced oxidative stress or inflammation, but these associations have been explored minimally in humans. In the present study we examined the relationship between PBDE concentrations and biomarkers of oxidative stress and inflammation measured in blood samples among a representative US sample from the National Health and Nutrition Examination Survey. Oxidative stress biomarkers showed no significant associations with PBDEs in adjusted regression models. For inflammation biomarkers, we observed small but statistically significant positive associations between BDE-153 and alkaline phosphatase (percent change with an interquartile range [IQR] increase in BDE-153=0.82, 95% confidence interval [CI] =0.01, 1.65) and absolute neutrophil count (percent change with IQR increase in BDE-153= 0.53%, 95% CI=0.03, 1.04). Associations with other PBDE congeners and inflammation markers were generally positive but did not reach statistical significance. These results are consistent with human research of oxidative stress and inflammation in response to PBDE congeners and mixtures, and support previous reports of inflammation in response to PBDE treatment in animal and in vitro studies. More detailed toxicological and epidemiologic research in humans is needed to confirm the present results, and to determine the potential clinical and public health significance of these findings. PMID:27750136

Serum polybrominated diphenyl ether (PBDE) concentrations in relation to biomarkers of oxidative stress and inflammation: The National Health and Nutrition Examination Survey 2003-2004.

PubMed

Yuan, Ye; Meeker, John D; Ferguson, Kelly K

2017-01-01

Exposure to polybrominated diphenyl ethers (PBDEs) has been associated with various adverse health outcomes related to liver, neural and endocrine systems. Some of these may be the result of PBDE-induced oxidative stress or inflammation, but these associations have been explored minimally in humans. In the present study we examined the relationship between PBDE concentrations and biomarkers of oxidative stress and inflammation measured in blood samples among a representative US sample from the National Health and Nutrition Examination Survey. Oxidative stress biomarkers showed no significant associations with PBDEs in adjusted regression models. For inflammation biomarkers, we observed small but statistically significant positive associations between BDE-153 and alkaline phosphatase (percent change with an interquartile range [IQR] increase in BDE-153=0.82, 95% confidence interval [CI]=0.01, 1.65) and absolute neutrophil count (percent change with IQR increase in BDE-153=0.53%, 95% CI=0.03, 1.04). Associations with other PBDE congeners and inflammation markers were generally positive but did not reach statistical significance. These results are consistent with human research of oxidative stress and inflammation in response to PBDE congeners and mixtures, and support previous reports of inflammation in response to PBDE treatment in animal and in vitro studies. More detailed toxicological and epidemiologic research in humans is needed to confirm the present results, and to determine the potential clinical and public health significance of these findings. Published by Elsevier B.V.

[K198N polymorphism in the EDN1 gene in patients with pulmonary arterial hypertension].

PubMed

Pousada, Guillermo; Baloira, Adolfo; Vilariño, Carlos; Valverde, Diana

2015-04-20

In pulmonary arterial hypertension (PAH) an association with a polymorphism in the endothelin gene (EDN1) has been described. The main objective of this study was to analyze the polymorphism K198N in the gene EDN1 in patients with PAH, correlating the results with clinical and hemodynamic parameters. We compared 41 patients diagnosed with idiopathic and associated PAH of group i with 50 healthy controls. Polymerase chain reaction and direct sequencing were used to analyze the polymorphism K198N. We compared the genotype distribution and searched for a correlation with clinical, hemodynamic and therapeutic response. Genotype GG was present in 42% of patients in this study and 65% of controls. The GT+TT genotypes appeared in 58% of patients and in 35% of controls. Statistically significant differences between patients and controls (P=.032) were detected, with a relative risk in carriers of having the T allele of 2.51 (95% CI 1.07 to 5.86). The analysis by PolyPhen software defined K198N change as pathogenic. No significant differences in the response to treatment at medium term were found. The genotype analysis of the EDN1 gene polymorphism shows statistically significant differences in patients with PAH compared to healthy individuals. Individuals carrying at least one T allele exhibit a higher relative significant risk to develop HAP. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

Kappa statistic to measure agreement beyond chance in free-response assessments.

PubMed

Carpentier, Marc; Combescure, Christophe; Merlini, Laura; Perneger, Thomas V

2017-04-19

The usual kappa statistic requires that all observations be enumerated. However, in free-response assessments, only positive (or abnormal) findings are notified, but negative (or normal) findings are not. This situation occurs frequently in imaging or other diagnostic studies. We propose here a kappa statistic that is suitable for free-response assessments. We derived the equivalent of Cohen's kappa statistic for two raters under the assumption that the number of possible findings for any given patient is very large, as well as a formula for sampling variance that is applicable to independent observations (for clustered observations, a bootstrap procedure is proposed). The proposed statistic was applied to a real-life dataset, and compared with the common practice of collapsing observations within a finite number of regions of interest. The free-response kappa is computed from the total numbers of discordant (b and c) and concordant positive (d) observations made in all patients, as 2d/(b + c + 2d). In 84 full-body magnetic resonance imaging procedures in children that were evaluated by 2 independent raters, the free-response kappa statistic was 0.820. Aggregation of results within regions of interest resulted in overestimation of agreement beyond chance. The free-response kappa provides an estimate of agreement beyond chance in situations where only positive findings are reported by raters.

Weather and emotional state: a search for associations between weather and calls to telephone counseling services

NASA Astrophysics Data System (ADS)

Driscoll, Dennis; Stillman, Daniel

2002-08-01

Previous research has revealed that an emotional response to weather might be indicated by calls to telephone counseling services. We analyzed call frequency from such "hotlines", each serving communities in a major metropolitan area of the United States (Detroit, Washington DC, Dallas and Seattle). The periods examined were all, or parts of, the years 1997 and 1998. Associations with subjectively derived synoptic weather types for all cities except Seattle, as well as with individual weather elements [cloudiness (sky cover), precipitation, windspeed, and interdiurnal temperature change] for all four cities, were investigated. Analysis of variance and t-tests (significance of means) were applied to test the statistical significance of differences. Although statistically significant results were obtained in scattered instances, the total number was within that expected by chance, and there was little in the way of consistency to these associations. One clear exception was the increased call frequency during destructive (severe) weather, when there is obvious concern about the damage done by it.

The probability of probability and research truths.

PubMed

Fatovich, Daniel M; Phillips, Michael

2017-04-01

The foundation of much medical research rests on the statistical significance of the P-value, but we have fallen prey to the seductive certainty of significance. Other scientific disciplines work to a different standard. This may partly explain why medical reversal is an increasing phenomenon, whereby new studies (based on the 0.05 standard) overturn previous significant findings. This has generated a crisis in the rigour of evidence-based medicine, as many people erroneously believe that a P < 0.05 means the treatment effect is clinically important. However, statistics are not facts about the world. Nor should they be based on an arbitrary threshold that arose for historical reasons. This arbitrary threshold encourages an unthinking automatic response that contributes to industry's influence on medical research. Examples from emergency medicine practice illustrate these themes. Study replication needs to be valued as much as discovery. Careful and thoughtful unbiased thinking about the results we do have is undervalued. © 2017 Australasian College for Emergency Medicine and Australasian Society for Emergency Medicine.

Person-Fit Statistics for Joint Models for Accuracy and Speed

ERIC Educational Resources Information Center

Fox, Jean-Paul; Marianti, Sukaesi

2017-01-01

Response accuracy and response time data can be analyzed with a joint model to measure ability and speed of working, while accounting for relationships between item and person characteristics. In this study, person-fit statistics are proposed for joint models to detect aberrant response accuracy and/or response time patterns. The person-fit tests…

Sociological Paradoxes and Graduate Statistics Classes. A Response to "The Sociology of Teaching Graduate Statistics"

ERIC Educational Resources Information Center

Hardy, Melissa

2005-01-01

This article presents a response to Timothy Patrick Moran's article "The Sociology of Teaching Graduate Statistics." In his essay, Moran argues that exciting developments in techniques of quantitative analysis are currently coupled with a much less exciting formulaic approach to teaching sociology graduate students about quantitative analysis. The…

Evaluating Item Fit for Multidimensional Item Response Models

ERIC Educational Resources Information Center

Zhang, Bo; Stone, Clement A.

2008-01-01

This research examines the utility of the s-x[superscript 2] statistic proposed by Orlando and Thissen (2000) in evaluating item fit for multidimensional item response models. Monte Carlo simulation was conducted to investigate both the Type I error and statistical power of this fit statistic in analyzing two kinds of multidimensional test…

[Does the care for the fear of falling bring a profit to community living elderly people who had experienced falls?].

PubMed

Landrot, Marion De Rogalski; Perrot, Catherine; Blanc, Patricia; Beauchet, Olivier; Blanchon, Marie Ange; Gonthier, Régis

2007-09-01

fall is common in old people and has multiple consequences, physical but also psychological, with a fear of falling which results in reduction in the activities of everyday life, loss of autonomy and entry in dependence. The aim of the study was to evluate the benefit of taking into account the fear of falling in the care of old people who had experienced falls. old people who experienced falls and with a good cognitive status were followed in a day hospital during one year. Evaluation including a specific assessment of the responsibility of the psychological factor, the photolangage, was performed before and after multi-field rehabilitation. We used the rating scales ADL, IADL, SF-36, SAFE, and verbal and analogical scales of the fear of falling. fifteen patients were included (mean age 85 years +/- 5,7). The majority were women living alone, with a good nutritional status, a moderated renal insufficiency, and a comorbidity involving polymedication. Scores on the ADL and IADL scales showed a consolidation of the patients' autonomy, with a slight but significant improvement of the IADL scores (p < 0,05). All scales assessing the fear of falling (visual analogical, verbal scales, SAFE) showed a statistically significant improvement (p<0,001). SF-36 scale, exploring the quality of life perceived by the patients, showed a great deterioration immediately after falling, and a statistically significant improvement on seven of the eight subscales after rehabilitation. The global physical score (GCV) was improved in a nonsignificant way, whereas the global psychic score (MCS) progressed in a statistically significant way (p < 0,001). this pilot study shows that multi-field rehabilitation and adapted assumption of responsibility of fear of falling brings a benefit in term of quality of life and preservation of autonomy in old people living in the community who had experienced falls.

Effects of tofacitinib monotherapy on patient-reported outcomes in a randomized phase 3 study of patients with active rheumatoid arthritis and inadequate responses to DMARDs.

PubMed

Strand, Vibeke; Kremer, Joel; Wallenstein, Gene; Kanik, Keith S; Connell, Carol; Gruben, David; Zwillich, Samuel H; Fleischmann, Roy

2015-11-04

Tofacitinib is an oral Janus kinase inhibitor for the treatment of rheumatoid arthritis. In this 6-month, phase 3, randomized, placebo-controlled trial, 611 patients with inadequate response to disease-modifying anti-rheumatic drugs (DMARD-IR) were randomized 4:4:1:1 to receive: tofacitinib 5 mg BID or tofacitinib 10 mg BID for the duration of the study, or placebo for 3 months followed by tofacitinib 5 mg BID or tofacitinib 10 mg BID. Patient-reported outcomes (PROs) included: Patient Global Assessment of Disease Activity (PtGA); Patient Assessment of Pain (Pain); Health Assessment Questionnaire-Disability Index (HAQ-DI); Medical Outcomes Survey (MOS) Short Form-36 (SF-36); Functional Assessment of Chronic Illness Therapy-Fatigue (FACIT-F); and MOS Sleep Scale. Time-to-event data (PtGA and Pain) were collected using an interactive voice response system daily diary (baseline through day 14). At month 3, tofacitinib 5 and 10 mg BID demonstrated statistically significant improvements versus placebo in PtGA (both p < 0.0001), Pain (both p < 0.0001), HAQ-DI (both p < 0.0001), SF-36 Physical (p < 0.0001) and Mental (p < 0.05 [5 mg BID] and p < 0.0001 [10 mg BID]), Component Summary scores and all domain scores (p < 0.05-p < 0.0001) and FACIT-F (both p < 0.0001). Statistically significant changes from baseline in MOS Sleep Scale were reported for 10 mg BID (p < 0.05). Benefits of tofacitinib treatment were rapid in onset and significant improvements were reported at week 2 for PtGA, Pain and HAQ-DI, and differentiation from baseline was seen as early as 3 days after treatment initiation for interactive voice response system (IVRS) PtGA and IVRS Pain. The numbers needed to treat for patients to report changes greater than or equal to the minimum clinically important difference in PtGA, Pain, HAQ-DI, SF-36 Physical Component Summary score and FACIT-F ranged between 4.0-6.1 (5 mg BID) and 3.2-5.0 (10 mg BID). Tofacitinib monotherapy in DMARD-IR patients resulted in statistically significant and clinically meaningful improvements in multiple PROs versus placebo at month 3, with sustained improvements over 6 months. Clinicaltrials.gov registration NCT00814307 , registered 22 December 2008.

The clinical utility of fibrin-related biomarkers in sepsis.

PubMed

Toh, Julien M H; Ken-Dror, Gie; Downey, Colin; Abrams, Simon T

2013-12-01

Sepsis is associated with systemic inflammatory responses and induction of intravascular fibrin formation. Our aim is to investigate whether three fibrin-related markers (FRM) reflect the extent of coagulation activation in vivo and evaluate their clinical usefulness in identifying as well as monitoring patients with sepsis. Fibrin-degradation products (FDP), D-dimer and soluble fibrin monomer assays were measured on plasma samples from patients in the ICU with sepsis (n = 37), systemic inflammatory response syndrome (SIRS) (n = 35) and healthy individuals (n = 15). The levels were correlated with each other and also with fibrinogen, prothrombin time, platelets and antithrombin III. Clinical correlation was also performed for the diagnosis of sepsis and longitudinal monitoring for survival or death.There was strong correlation between the three FRM (r = 0.38-0.93, P < 0.0001) with only fibrin monomer correlating significantly with prothrombin time, fibrinogen and platelet levels. Clinically, all three FRM could discriminate between patients with sepsis, SIRS and healthy individuals with FDP, and D-dimer showing statistical significance (P < 0.05). No FRM predicted outcome from a single measurement but FDP was significantly able to predict patient survival from serial samples [mean FDP (μg/ml) from 35.36 to 21.37 (first to third ICU-day), P < 0.05]. Fibrin monomer appears the most sensitive indicator of coagulation activation, whereas D-dimer and FDP levels can significantly differentiate ICU patients with sepsis from those without. In addition, FDP would be preferable for monitoring with its statistically significant time-dependent prediction of survival or death from sepsis.

The effectiveness of repeat lumbar transforaminal epidural steroid injections.

PubMed

Murthy, Naveen S; Geske, Jennifer R; Shelerud, Randy A; Wald, John T; Diehn, Felix E; Thielen, Kent R; Kaufmann, Timothy J; Morris, Jonathan M; Lehman, Vance T; Amrami, Kimberly K; Carter, Rickey E; Maus, Timothy P

2014-10-01

The aim of this study was to determine 1) if repeat lumbar transforaminal epidural steroid injections (TFESIs) resulted in recovery of pain relief, which has waned since an index injection, and 2) if cumulative benefit could be achieved by repeat injections within 3 months of the index injection. Retrospective observational study with statistical modeling of the response to repeat TFESI. Academic radiology practice. Two thousand eighty-seven single-level TFESIs were performed for radicular pain on 933 subjects. Subjects received repeat TFESIs >2 weeks and <1 year from the index injection. Hierarchical linear modeling was performed to evaluate changes in continuous and categorical pain relief outcomes after repeat TFESI. Subgroup analyses were performed on patients with <3 months duration of pain (acute pain), patients receiving repeat injections within 3 months (clustered injections), and in patients with both acute pain and clustered injections. Repeat TFESIs achieved pain relief in both continuous and categorical outcomes. Relative to the index injection, there was a minimal but statistically significant decrease in pain relief in modeled continuous outcome measures with subsequent injections. Acute pain patients recovered all prior benefit with a statistically significant cumulative benefit. Patients receiving clustered injections achieved statistically significant cumulative benefit, of greater magnitude in acute pain patients. Repeat TFESI may be performed for recurrence of radicular pain with the expectation of recovery of most or all previously achieved benefit; acute pain patients will likely recover all prior benefit. Repeat TFESIs within 3 months of the index injection can provide cumulative benefit. Wiley Periodicals, Inc.

Some implications for the clinical use of music facilitated imagery.

PubMed

Peach, S C

1984-01-01

In this study, Helen Bonny's Guided Imagery and Music technique provided the base experience for questionnaire responses from short-term psychiatric inpatients, students, and staff (total/n = 107). Independent measures of age range, sex, medication type, and recent relaxation practice were compared statistically with dependent responses of skin temperature, perceived ability to relax, production of images, and perceived helpfulness of the experience. Results demonstrated increases in skin temperature and relaxation perception and defined the average experience as manifesting three concurrent imagery modes. Among the man independent-dependent variable relationships, some significant differences in mean responses were present. These differences and their possible clinical implications are discussed; further research in the area, including replication, is recommended.

Evaluating the Effects of Aromatics Content in Gasoline on Gaseous and Particulate Matter Emissions from SI-PFI and SIDI Vehicles.

PubMed

Karavalakis, Georgios; Short, Daniel; Vu, Diep; Russell, Robert; Hajbabaei, Maryam; Asa-Awuku, Akua; Durbin, Thomas D

2015-06-02

We assessed the emissions response of a fleet of seven light-duty gasoline vehicles for gasoline fuel aromatic content while operating over the LA92 driving cycle. The test fleet consisted of model year 2012 vehicles equipped with spark-ignition (SI) and either port fuel injection (PFI) or direct injection (DI) technology. Three gasoline fuels were blended to meet a range of total aromatics targets (15%, 25%, and 35% by volume) while holding other fuel properties relatively constant within specified ranges, and a fourth fuel was formulated to meet a 35% by volume total aromatics target but with a higher octane number. Our results showed statistically significant increases in carbon monoxide, nonmethane hydrocarbon, particulate matter (PM) mass, particle number, and black carbon emissions with increasing aromatics content for all seven vehicles tested. Only one vehicle showed a statistically significant increase in total hydrocarbon emissions. The monoaromatic hydrocarbon species that were evaluated showed increases with increasing aromatic content in the fuel. Changes in fuel composition had no statistically significant effect on the emissions of nitrogen oxides (NOx), formaldehyde, or acetaldehyde. A good correlation was also found between the PM index and PM mass and number emissions for all vehicle/fuel combinations with the total aromatics group being a significant contributor to the total PM index followed by naphthalenes and indenes.

Will Outer Tropical Cyclone Size Change due to Anthropogenic Warming?

NASA Astrophysics Data System (ADS)

Schenkel, B. A.; Lin, N.; Chavas, D. R.; Vecchi, G. A.; Knutson, T. R.; Oppenheimer, M.

2017-12-01

Prior research has shown significant interbasin and intrabasin variability in outer tropical cyclone (TC) size. Moreover, outer TC size has even been shown to vary substantially over the lifetime of the majority of TCs. However, the factors responsible for both setting initial outer TC size and determining its evolution throughout the TC lifetime remain uncertain. Given these gaps in our physical understanding, there remains uncertainty in how outer TC size will change, if at all, due to anthropogenic warming. The present study seeks to quantify whether outer TC size will change significantly in response to anthropogenic warming using data from a high-resolution global climate model and a regional hurricane model. Similar to prior work, the outer TC size metric used in this study is the radius in which the azimuthal-mean surface azimuthal wind equals 8 m/s. The initial results from the high-resolution global climate model data suggest that the distribution of outer TC size shifts significantly towards larger values in each global TC basin during future climates, as revealed by 1) statistically significant increase of the median outer TC size by 5-10% (p<0.05) according to a 1,000-sample bootstrap resampling approach with replacement and 2) statistically significant differences between distributions of outer TC size from current and future climate simulations as shown using two-sample Kolmogorov Smirnov testing (p<<0.01). Additional analysis of the high-resolution global climate model data reveals that outer TC size does not uniformly increase within each basin in future climates, but rather shows substantial locational dependence. Future work will incorporate the regional mesoscale hurricane model data to help focus on identifying the source of the spatial variability in outer TC size increases within each basin during future climates and, more importantly, why outer TC size changes in response to anthropogenic warming.

Online Statistical Modeling (Regression Analysis) for Independent Responses

NASA Astrophysics Data System (ADS)

Made Tirta, I.; Anggraeni, Dian; Pandutama, Martinus

2017-06-01

Regression analysis (statistical analmodelling) are among statistical methods which are frequently needed in analyzing quantitative data, especially to model relationship between response and explanatory variables. Nowadays, statistical models have been developed into various directions to model various type and complex relationship of data. Rich varieties of advanced and recent statistical modelling are mostly available on open source software (one of them is R). However, these advanced statistical modelling, are not very friendly to novice R users, since they are based on programming script or command line interface. Our research aims to developed web interface (based on R and shiny), so that most recent and advanced statistical modelling are readily available, accessible and applicable on web. We have previously made interface in the form of e-tutorial for several modern and advanced statistical modelling on R especially for independent responses (including linear models/LM, generalized linier models/GLM, generalized additive model/GAM and generalized additive model for location scale and shape/GAMLSS). In this research we unified them in the form of data analysis, including model using Computer Intensive Statistics (Bootstrap and Markov Chain Monte Carlo/ MCMC). All are readily accessible on our online Virtual Statistics Laboratory. The web (interface) make the statistical modeling becomes easier to apply and easier to compare them in order to find the most appropriate model for the data.

Statistical context shapes stimulus-specific adaptation in human auditory cortex

PubMed Central

Henry, Molly J.; Fromboluti, Elisa Kim; McAuley, J. Devin

2015-01-01

Stimulus-specific adaptation is the phenomenon whereby neural response magnitude decreases with repeated stimulation. Inconsistencies between recent nonhuman animal recordings and computational modeling suggest dynamic influences on stimulus-specific adaptation. The present human electroencephalography (EEG) study investigates the potential role of statistical context in dynamically modulating stimulus-specific adaptation by examining the auditory cortex-generated N1 and P2 components. As in previous studies of stimulus-specific adaptation, listeners were presented with oddball sequences in which the presentation of a repeated tone was infrequently interrupted by rare spectral changes taking on three different magnitudes. Critically, the statistical context varied with respect to the probability of small versus large spectral changes within oddball sequences (half of the time a small change was most probable; in the other half a large change was most probable). We observed larger N1 and P2 amplitudes (i.e., release from adaptation) for all spectral changes in the small-change compared with the large-change statistical context. The increase in response magnitude also held for responses to tones presented with high probability, indicating that statistical adaptation can overrule stimulus probability per se in its influence on neural responses. Computational modeling showed that the degree of coadaptation in auditory cortex changed depending on the statistical context, which in turn affected stimulus-specific adaptation. Thus the present data demonstrate that stimulus-specific adaptation in human auditory cortex critically depends on statistical context. Finally, the present results challenge the implicit assumption of stationarity of neural response magnitudes that governs the practice of isolating established deviant-detection responses such as the mismatch negativity. PMID:25652920

Viral load of patients with hantavirus pulmonary syndrome in Argentina.

PubMed

Bellomo, Carla María; Pires-Marczeski, Fanny Clara; Padula, Paula Julieta

2015-11-01

Hantavirus causes severe illness including pneumonia, which leads to hospitalization and often death. At present, there is no specific treatment available. The hantavirus pathogenesis is not well understood, but most likely both virus-mediated and host-mediated mechanisms, are involved. The aim of this study was to correlate viral load in samples of hantavirus pulmonary syndrome cases and hantavirus infected individuals, with clinical epidemiological parameters and disease outcome. The variables that could potentially be related with viral load were analyzed. The retrospective study included 73 cases or household contacts, with different clinical evolution. Viral load was measured by reverse-transcription and real time polymerase chain reaction. There was no statistically significant association between blood viral RNA levels and severity of disease. However, viral load was inversely correlated with IgG response in a statistically significant manner. The level of viral RNA was significantly higher in patients infected with Andes virus South lineage, and was markedly low in persons infected with Laguna Negra virus. These results suggest that the infecting viral genotype is associated with disease severity, and that high viral load is associated with a low specific IgG response. Sex, age and disease severity were not related with viral load. Further investigations increasing strikingly the number of cases and also limiting the variables to be studied are necessary. © 2015 Wiley Periodicals, Inc.

Correlation between the characteristics of resonance and aging of the external ear.

PubMed

Silva, Aline Papin Roedas da; Blasca, Wanderléia Quinhoneiro; Lauris, José Roberto Pereira; Oliveira, Jerusa Roberta Massola de

2014-01-01

Aging causes changes in the external ear as a collapse of the external auditory canal and tympanic membrane senile. Knowing them is appropriate for the diagnosis of hearing loss and selection of hearing aids. For this reason, the study aimed to verify the influence of the anatomical changes of the external ear resonance in the auditory canal in the elderly. The sample consisted of objective measures of the external ear of elderly with collapse (group A), senile tympanic membrane (group B) and without changing the external auditory canal or tympanic membrane (group C) and adults without changing the external ear (group D). In the retrospective/clinical study were performed comparisons of measures of individuals with and without alteration of the external ear through the gain and response external ear resonant frequency and the primary peak to the right ear. In groups A, B and C was no statistically significant difference between Real Ear Unaided Response (REUR) and Real Ear Unaided Gain (REUG), but not for the peak frequency. For groups A and B were shown significant differences in REUR and REUG. Between the C and D groups were significant statistics to the REUR and REUG, but not for the frequency of the primary peak. Changes influence the external ear resonance, decreasing its amplitude. However, the frequency of the primary peak is not affected.

Increased Radioresistance to Lethal Doses of Gamma Rays in Mice and Rats after Exposure to Microwave Radiation Emitted by a GSM Mobile Phone Simulator

PubMed Central

Mortazavi, SMJ; Mosleh-Shirazi, MA; Tavassoli, AR; Taheri, M; Mehdizadeh, AR; Namazi, SAS; Jamali, A; Ghalandari, R; Bonyadi, S; Haghani, M; Shafie, M

2013-01-01

The aim of this study was to investigate the effect of pre-irradiation with microwaves on the induction of radioadaptive response. In the 1st phase of the study, 110 male mice were divided into 8 groups. The animals in these groups were exposed/sham-exposed to microwave, low dose rate gamma or both for 5 days. On day six, the animals were exposed to a lethal dose (LD). In the 2nd phase, 30 male rats were divided into 2 groups of 15 animals. The 1st group received microwave exposure. The 2nd group (controls) received the same LD but there was no treatment before the LD. On day 5, all animals were whole-body irradiated with the LD. Statistically significant differences between the survival rate of the mice only exposed to lethal dose of gamma radiation before irradiation with a lethal dose of gamma radiation with those of the animals pre-exposed to either microwave (p=0.02), low dose rate gamma (p=0.001) or both of these physical adapting doses (p=0.003) were observed. Likewise, a statistically significant difference between survival rates of the rats in control and test groups was observed. Altogether, these experiments showed that exposure to microwave radiation may induce a significant survival adaptive response. PMID:23930107

The development of immune responses in Balb/c mice following inoculation with attenuated or virulent Neospora caninum tachyzoites.

PubMed

Bartley, P M; Wright, S E; Maley, S W; Buxton, D; Nath, M; Innes, E A

2009-07-01

Balb/c mice were inoculated intraperitoneally (i.p.) with either 5 x 10(6) live virulent (group 1) or 5 x 10(6) live attenuated (group 2) tachyzoites, or Vero cells (group 3). Animals were killed at 0, 14, 28 and 42 days post-inoculation (p.i.), with the remaining mice receiving a lethal challenge on day 48 p.i. Serum, spleen and brain samples were collected post-mortem to examine humoral and cell-mediated immune responses as well as pathological lesions and to quantify parasite loads. On day 14 p.i. group 2 (attenuated) demonstrated statistically significant (P < 0.001) lower levels of mean morbidity and weight loss, while also showing significantly (P = 0.01) higher levels of splenocyte proliferation and IFN-gamma production (P = 0.003), compared to group 1 (virulent). Histology of brain samples showed milder lesions and a lower incidence of positive immunohistochemistry, demonstrating tachyzoites and tissue cysts, and statistically significant (P = 0.03) lower mean burdens of parasite DNA in group 2 (attenuated) compared to group 1 (virulent). All mice in group 2 were protected following challenge on day 48 p.i. whereas naïve control mice succumbed to the challenge. No mice from group 1 (virulent) survived beyond day 24 p.i. so they were not included in the challenge.

The Clinical Utility of Vestibular Evoked Myogenic Potentials in Patients of Benign Paroxysmal Positional Vertigo.

PubMed

Sreenivasan, Anuprasad; Sivaraman, Ganesan; Parida, Pradiptata Kumar; Alexander, Arun; Saxena, Sunil Kumar; Suria, Gopalakrishnan

2015-06-01

Vestibular Evoked Myogenic Potentials (VEMP) is an emerging tool to diagnose Benign Paroxysmal Positional Vertigo (BPPV). The clinical utility of VEMP has been reported only in small accord in Indian literature. To study the latency and amplitude of VEMP in patients with BPPV and compare it with that of normal subjects. The study included two groups. Group one (control group) were 18 normal subjects. Group two (test group) were 15 subjects with unilateral BPPV. Those subjects who fulfilled the selection criteria based on case history and audiological assessment were taken for the VEMP recording. The VEMP response consist of positive and negative successive waves (pI-nI), with latency values in adults about 13 and 23 milliseconds respectively. Data was analysed using Statistical Package for Social Sciences (SPSS) version 12 (Chicago, IL, USA). Unpaired t-test was employed to measure the statistical difference between control group and test group. The difference in n23 and the peak to peak amplitude between the ipsilateral and contralateral ears of the test group were statistically significant, whereas such a difference in the p13 latency turned out to be statistically insignificant. It should be noted that, out of 15 patients in the test group, five patients showed only artifact tracer recordings in both the ears which is considered as no response. The heterogeneity of the results extended from absence of VEMP to prolongation of both p13, n23; prolongation of p13 alone; and even side to side variations. Absent response from the ipsilateral ear, prolonged latency of n23 and decreased peak to peak amplitude (p13, n23), indicates the disease pathology. However, large sample size is required to draw further conclusions and to consolidate the usage of VEMP in the diagnosis of BPPV.

Statistical regularities of art images and natural scenes: spectra, sparseness and nonlinearities.

PubMed

Graham, Daniel J; Field, David J

2007-01-01

Paintings are the product of a process that begins with ordinary vision in the natural world and ends with manipulation of pigments on canvas. Because artists must produce images that can be seen by a visual system that is thought to take advantage of statistical regularities in natural scenes, artists are likely to replicate many of these regularities in their painted art. We have tested this notion by computing basic statistical properties and modeled cell response properties for a large set of digitized paintings and natural scenes. We find that both representational and non-representational (abstract) paintings from our sample (124 images) show basic similarities to a sample of natural scenes in terms of their spatial frequency amplitude spectra, but the paintings and natural scenes show significantly different mean amplitude spectrum slopes. We also find that the intensity distributions of paintings show a lower skewness and sparseness than natural scenes. We account for this by considering the range of luminances found in the environment compared to the range available in the medium of paint. A painting's range is limited by the reflective properties of its materials. We argue that artists do not simply scale the intensity range down but use a compressive nonlinearity. In our studies, modeled retinal and cortical filter responses to the images were less sparse for the paintings than for the natural scenes. But when a compressive nonlinearity was applied to the images, both the paintings' sparseness and the modeled responses to the paintings showed the same or greater sparseness compared to the natural scenes. This suggests that artists achieve some degree of nonlinear compression in their paintings. Because paintings have captivated humans for millennia, finding basic statistical regularities in paintings' spatial structure could grant insights into the range of spatial patterns that humans find compelling.

Are P values and statistical assessments in poster abstracts presented at annual meetings of Taiwan Society of Anesthesiologists relative to the characteristics of hospitals?

PubMed

Lee, Fu-Jung; Wu, Chih-Cheng; Peng, Shih-Yen; Fan, Kuo-Tung

2007-09-01

Many anesthesiologists in medical centers (MC) or in anesthesiologist-training hospitals (ATH) are accustomed to present their research data in the form of poster abstracts at the annual meetings of Taiwan Society of Anesthesiologists (TSA) to represent their academic gainings in a designated period of time. However, an orphaned P value without mentioning the related specified statistical test has frequently been found in these articles. The difference in presentation of statistical test after P value between MC/ATH and non-MC/non-ATH in recent three TSA consecutive annual meetings was explored in this article. We collected the proceedings handbooks of TSA annual meetings in a period spanning 3 yrs (2003 to 2005) and analyzed the hospital characteristic of first institute-byliner in the poster abstract. Data were analyzed with Fisher's exact test and statistical significance was assumed if P < 0.05. Included were 101 poster abstracts with byliners of 20 hospitals. Only 2 of the 20 hospitals were accredited as non-ATH and 4 as non-MC. There were 64 (63%) abstracts without specified statistical test after P value and no significant difference was found among each category. (P = 0.47 in ATH vs. non-ATH and P = 0.07 in MC vs. non-MC). The basic concept of P value with specified statistical test was not applicable comprehensively in poster abstracts of the annual conferences. Based on our wishful intention, we suggest that the anesthesia administrators and senior anesthesiologists at ATH or MC, and the members of the committee responsible for running academic affairs in TSA, should pay attention to this prodigy and work together to improve our basic statistics in poster presentation.

Influences of Self-Efficacy, Response Efficacy, and Reactance on Responses to Cigarette Health Warnings: A Longitudinal Study of Adult Smokers in Australia and Canada

PubMed Central

Thrasher, James F.; Swayampakala, Kamala; Borland, Ron; Nagelhout, Gera; Yong, Hua-Hie; Hammond, David; Bansal-Travers, Maansi; Thompson, Mary; Hardin, James

2016-01-01

ABSTRACT Guided by the extended parallel process model (EPPM) and reactance theory, this study examined the relationship between efficacy beliefs, reactance, and adult smokers’ responses to pictorial health warning labels (HWL) on cigarette packaging, including whether efficacy beliefs or reactance modify the relationship between HWL responses and subsequent smoking cessation behavior. Four waves of data were analyzed from prospective cohorts of smokers in Australia and Canada (n = 7,120 observations) over a period of time after implementation of more prominent, pictorial HWLs. Three types of HWL responses were studied: psychological threat responses (i.e., thinking about risks from smoking), forgoing cigarettes due to HWLs, and avoiding HWLs. The results from Generalized Estimating Equation models indicated that stronger efficacy beliefs and lower trait reactance were significantly associated with greater psychological threat responses to HWLs. Similar results were found for models predicting forgoing behavior, although response efficacy was inversely associated with it. Only response efficacy was significantly associated with avoiding HWLs, showing a positive relationship. Higher self-efficacy and stronger responses to HWLs, no matter the type, were associated with attempting to quit in the follow-up period; reactance was unassociated. No statistically significant interactions were found. These results suggest that stronger efficacy beliefs and lower trait reactance are associated with some stronger responses to fear-arousing HWL responses; however, these HWL responses appear no less likely to lead to cessation attempts among smokers with different levels of self-efficacy to quit, of response efficacy beliefs, or of trait reactance against attempts to control their behavior. PMID:27135826

Proper interpretation of chronic toxicity studies and their statistics: A critique of "Which level of evidence does the US National Toxicology Program provide? Statistical considerations using the Technical Report 578 on Ginkgo biloba as an example".

PubMed

Kissling, Grace E; Haseman, Joseph K; Zeiger, Errol

2015-09-02

A recent article by Gaus (2014) demonstrates a serious misunderstanding of the NTP's statistical analysis and interpretation of rodent carcinogenicity data as reported in Technical Report 578 (Ginkgo biloba) (NTP, 2013), as well as a failure to acknowledge the abundant literature on false positive rates in rodent carcinogenicity studies. The NTP reported Ginkgo biloba extract to be carcinogenic in mice and rats. Gaus claims that, in this study, 4800 statistical comparisons were possible, and that 209 of them were statistically significant (p<0.05) compared with 240 (4800×0.05) expected by chance alone; thus, the carcinogenicity of Ginkgo biloba extract cannot be definitively established. However, his assumptions and calculations are flawed since he incorrectly assumes that the NTP uses no correction for multiple comparisons, and that significance tests for discrete data operate at exactly the nominal level. He also misrepresents the NTP's decision making process, overstates the number of statistical comparisons made, and ignores the fact that the mouse liver tumor effects were so striking (e.g., p<0.0000000000001) that it is virtually impossible that they could be false positive outcomes. Gaus' conclusion that such obvious responses merely "generate a hypothesis" rather than demonstrate a real carcinogenic effect has no scientific credibility. Moreover, his claims regarding the high frequency of false positive outcomes in carcinogenicity studies are misleading because of his methodological misconceptions and errors. Published by Elsevier Ireland Ltd.

Proper interpretation of chronic toxicity studies and their statistics: A critique of “Which level of evidence does the US National Toxicology Program provide? Statistical considerations using the Technical Report 578 on Ginkgo biloba as an example”

PubMed Central

Kissling, Grace E.; Haseman, Joseph K.; Zeiger, Errol

2014-01-01

A recent article by Gaus (2014) demonstrates a serious misunderstanding of the NTP’s statistical analysis and interpretation of rodent carcinogenicity data as reported in Technical Report 578 (Ginkgo biloba) (NTP 2013), as well as a failure to acknowledge the abundant literature on false positive rates in rodent carcinogenicity studies. The NTP reported Ginkgo biloba extract to be carcinogenic in mice and rats. Gaus claims that, in this study, 4800 statistical comparisons were possible, and that 209 of them were statistically significant (p<0.05) compared with 240 (4800 × 0.05) expected by chance alone; thus, the carcinogenicity of Ginkgo biloba extract cannot be definitively established. However, his assumptions and calculations are flawed since he incorrectly assumes that the NTP uses no correction for multiple comparisons, and that significance tests for discrete data operate at exactly the nominal level. He also misrepresents the NTP’s decision making process, overstates the number of statistical comparisons made, and ignores that fact that that the mouse liver tumor effects were so striking (e.g., p<0.0000000000001) that it is virtually impossible that they could be false positive outcomes. Gaus’ conclusion that such obvious responses merely “generate a hypothesis” rather than demonstrate a real carcinogenic effect has no scientific credibility. Moreover, his claims regarding the high frequency of false positive outcomes in carcinogenicity studies are misleading because of his methodological misconceptions and errors. PMID:25261588

Ayahuasca-assisted therapy for addiction: results from a preliminary observational study in Canada.

PubMed

Thomas, Gerald; Lucas, Philippe; Capler, N Rielle; Tupper, Kenneth W; Martin, Gina

2013-03-01

This paper reports results from a preliminary observational study of ayahuasca-assisted treatment for problematic substance use and stress delivered in a rural First Nations community in British Columbia, Canada. The "Working with Addiction and Stress" retreats combined four days of group counselling with two expert-led ayahuasca ceremonies. This study collected pre-treatment and six months follow-up data from 12 participants on several psychological and behavioral factors related to problematic substance use, and qualitative data assessing the personal experiences of the participants six months after the retreat. Statistically significant (p < 0.05) improvements were demonstrated for scales assessing hopefulness, empowerment, mindfulness, and quality of life meaning and outlook subscales. Self-reported alcohol, tobacco and cocaine use declined, although cannabis and opiate use did not; reported reductions in problematic cocaine use were statistically significant. All study participants reported positive and lasting changes from participating in the retreats. This form of ayahuasca-assisted therapy appears to be associated with statistically significant improvements in several factors related to problematic substance use among a rural aboriginal population. These findings suggest participants may have experienced positive psychological and behavioral changes in response to this therapeutic approach, and that more rigorous research of ayahuasca-assisted therapy for problematic substance use is warranted.

Weather variability, tides, and Barmah Forest virus disease in the Gladstone region, Australia.

PubMed

Naish, Suchithra; Hu, Wenbiao; Nicholls, Neville; Mackenzie, John S; McMichael, Anthony J; Dale, Pat; Tong, Shilu

2006-05-01

In this study we examined the impact of weather variability and tides on the transmission of Barmah Forest virus (BFV) disease and developed a weather-based forecasting model for BFV disease in the Gladstone region, Australia. We used seasonal autoregressive integrated moving-average (SARIMA) models to determine the contribution of weather variables to BFV transmission after the time-series data of response and explanatory variables were made stationary through seasonal differencing. We obtained data on the monthly counts of BFV cases, weather variables (e.g., mean minimum and maximum temperature, total rainfall, and mean relative humidity), high and low tides, and the population size in the Gladstone region between January 1992 and December 2001 from the Queensland Department of Health, Australian Bureau of Meteorology, Queensland Department of Transport, and Australian Bureau of Statistics, respectively. The SARIMA model shows that the 5-month moving average of minimum temperature (b=0.15, p-value<0.001) was statistically significantly and positively associated with BFV disease, whereas high tide in the current month (b=-1.03, p-value=0.04) was statistically significantly and inversely associated with it. However, no significant association was found for other variables. These results may be applied to forecast the occurrence of BFV disease and to use public health resources in BFV control and prevention.

Statistical analysis of the electrocatalytic activity of Pt nanoparticles supported on novel functionalized reduced graphene oxide-chitosan for methanol electrooxidation

NASA Astrophysics Data System (ADS)

Ekrami-Kakhki, Mehri-Saddat; Abbasi, Sedigheh; Farzaneh, Nahid

2018-01-01

The purpose of this study is to statistically analyze the anodic current density and peak potential of methanol oxidation at Pt nanoparticles supported on functionalized reduced graphene oxide (RGO), using design of experiments methodology. RGO is functionalized with methyl viologen (MV) and chitosan (CH). The novel Pt/MV-RGO-CH catalyst is successfully prepared and characterized with transmission electron microscopy (TEM) image. The electrocatalytic activity of Pt/MV-RGOCH catalyst is experimentally evaluated for methanol oxidation. The effects of methanol concentration and scan rate factors are also investigated experimentally and statistically. The effects of these two main factors and their interactions are investigated, using analysis of variance test, Duncan's multiple range test and response surface method. The results of the analysis of variance show that all the main factors and their interactions have a significant effect on anodic current density and peak potential of methanol oxidation at α = 0.05. The suggested models which encompass significant factors can predict the variation of the anodic current density and peak potential of methanol oxidation. The results of Duncan's multiple range test confirmed that there is a significant difference between the studied levels of the main factors. [Figure not available: see fulltext.

An application of seasonal ARIMA models on group commodities to forecast Philippine merchandise exports performance

NASA Astrophysics Data System (ADS)

Natividad, Gina May R.; Cawiding, Olive R.; Addawe, Rizavel C.

2017-11-01

The increase in the merchandise exports of the country offers information about the Philippines' trading role within the global economy. Merchandise exports statistics are used to monitor the country's overall production that is consumed overseas. This paper investigates the comparison between two models obtained by a) clustering the commodity groups into two based on its proportional contribution to the total exports, and b) treating only the total exports. Different seasonal autoregressive integrated moving average (SARIMA) models were then developed for the clustered commodities and for the total exports based on the monthly merchandise exports of the Philippines from 2011 to 2016. The data set used in this study was retrieved from the Philippine Statistics Authority (PSA) which is the central statistical authority in the country responsible for primary data collection. A test for significance of the difference between means at 0.05 level of significance was then performed on the forecasts produced. The result indicates that there is a significant difference between the mean of the forecasts of the two models. Moreover, upon a comparison of the root mean square error (RMSE) and mean absolute error (MAE) of the models, it was found that the models used for the clustered groups outperform the model for the total exports.

Analysis of variance to assess statistical significance of Laplacian estimation accuracy improvement due to novel variable inter-ring distances concentric ring electrodes.

PubMed

Makeyev, Oleksandr; Joe, Cody; Lee, Colin; Besio, Walter G

2017-07-01

Concentric ring electrodes have shown promise in non-invasive electrophysiological measurement demonstrating their superiority to conventional disc electrodes, in particular, in accuracy of Laplacian estimation. Recently, we have proposed novel variable inter-ring distances concentric ring electrodes. Analytic and finite element method modeling results for linearly increasing distances electrode configurations suggested they may decrease the truncation error resulting in more accurate Laplacian estimates compared to currently used constant inter-ring distances configurations. This study assesses statistical significance of Laplacian estimation accuracy improvement due to novel variable inter-ring distances concentric ring electrodes. Full factorial design of analysis of variance was used with one categorical and two numerical factors: the inter-ring distances, the electrode diameter, and the number of concentric rings in the electrode. The response variables were the Relative Error and the Maximum Error of Laplacian estimation computed using a finite element method model for each of the combinations of levels of three factors. Effects of the main factors and their interactions on Relative Error and Maximum Error were assessed and the obtained results suggest that all three factors have statistically significant effects in the model confirming the potential of using inter-ring distances as a means of improving accuracy of Laplacian estimation.

Antibody response to actinomyces antigen and dental caries experience: implications for caries susceptibility.

PubMed

Levine, Martin; Owen, Willis L; Avery, Kevin T

2005-06-01

Fluoridated dentifrices reduce dental caries in subjects who perform effective oral hygiene. Actinomyces naeslundii increases in teeth-adherent microbial biofilms (plaques) in these subjects, and a well-characterized serum immunoglobulin G (IgG) antibody response (Actinomyces antibody [A-Ab]) is also increased. Other studies suggest that a serum IgG antibody response to streptococcal d-alanyl poly(glycerophosphate) (S-Ab) may indicate caries experience associated strongly with gingival health and exposure to fluoridated water. The aim of this study was to investigate relationships between A-Ab response, oral hygiene, S-Ab response, and caries experience. Measurements were made of A-Ab and S-Ab concentrations, caries experience (number of decayed, missing, and filled teeth [DMFT], number of teeth surfaces [DMFS], and number of decayed teeth needing treated [DT]), exposure to fluoridated water (Flu), mean clinical pocket depth (PD; in millimeters), and extent of plaque (PL) and gingival bleeding on probing (BOP). A-Ab concentration, the dependent variable in a multiple regression analysis, increased with S-Ab concentration and decreased with PL and DMFT adjusted for Flu (R(2) = 0.51, P < 0.002). Residual associations with age, DMFS, DT, and BOP were not significant. In addition, an elevated A-Ab response, defined from immunoprecipitation and immunoassay measurements, indicated a significant, 30% reduction in DMFT after adjustment for significant age and Flu covariance (analysis of variance with covariance F statistic = 10.6, P < 0.003; S-Ab response and interactions not significant). Thus, an elevated A-Ab response indicates less caries in subjects performing effective oral hygiene using fluoridated dentifrices. Conversely, a low A-Ab response is suggestive of decreased A. naeslundii binding to saliva-coated apatite and greater caries experience, as reported by others.

Nesting behavior of house mice (Mus domesticus) selected for increased wheel-running activity.

PubMed

Carter, P A; Swallow, J G; Davis, S J; Garland, T

2000-03-01

Nest building was measured in "active" (housed with access to running wheels) and "sedentary" (without wheel access) mice (Mus domesticus) from four replicate lines selected for 10 generations for high voluntary wheel-running behavior, and from four randombred control lines. Based on previous studies of mice bidirectionally selected for thermoregulatory nest building, it was hypothesized that nest building would show a negative correlated response to selection on wheel-running. Such a response could constrain the evolution of high voluntary activity because nesting has also been shown to be positively genetically correlated with successful production of weaned pups. With wheel access, selected mice of both sexes built significantly smaller nests than did control mice. Without wheel access, selected females also built significantly smaller nests than did control females, but only when body mass was excluded from the statistical model, suggesting that body mass mediated this correlated response to selection. Total distance run and mean running speed on wheels was significantly higher in selected mice than in controls, but no differences in amount of time spent running were measured, indicating a complex cause of the response of nesting to selection for voluntary wheel running.

Aging obviates sex-specific physiological responses to exercise.

PubMed

Deschenes, Michael R; Taylor, Jessica L; Mangis, Katherine A

2013-01-01

Both sex and aging have been shown to affect physiological responses to exercise. The aim of the present investigation was to determine whether aging impacted the sex-specific nature of physiological responses to exercise commonly noted among young adults. Ten aged men (69.0 ± 1.7 years; mean ± SE) and 10 aged women (71.6 ± 1.3 years) reporting similar levels of habitual physical activity performed a 30-min exercise session at 60-65% of their predetermined peak oxygen uptake. Cardiovascular, thermoregulatory, and metabolic variables were assessed before exercise, at the 15th and 30th min of exercise, and at 5 and 15 min into a passive postexercise recovery period. Variables of interest were statistically analyzed via two-way analysis of variance with repeated measures; significance was set at P < 0.05. Significant effects of time (i.e., exercise) for each physiological variable of interest were identified, but not once was a significant effect of group (i.e., sex) detected. Exercise-induced physiological responses to prolonged, moderate intensity exercise were similar among aged men and aged women. This evidence that the sexually dimorphic nature of physiological responses to exercise is obviated with age should be taken into account when prescribing health-related exercise training programs for older individuals. Copyright © 2013 Wiley Periodicals, Inc.

Functional genomics annotation of a statistical epistasis network associated with bladder cancer susceptibility.

PubMed

Hu, Ting; Pan, Qinxin; Andrew, Angeline S; Langer, Jillian M; Cole, Michael D; Tomlinson, Craig R; Karagas, Margaret R; Moore, Jason H

2014-04-11

Several different genetic and environmental factors have been identified as independent risk factors for bladder cancer in population-based studies. Recent studies have turned to understanding the role of gene-gene and gene-environment interactions in determining risk. We previously developed the bioinformatics framework of statistical epistasis networks (SEN) to characterize the global structure of interacting genetic factors associated with a particular disease or clinical outcome. By applying SEN to a population-based study of bladder cancer among Caucasians in New Hampshire, we were able to identify a set of connected genetic factors with strong and significant interaction effects on bladder cancer susceptibility. To support our statistical findings using networks, in the present study, we performed pathway enrichment analyses on the set of genes identified using SEN, and found that they are associated with the carcinogen benzo[a]pyrene, a component of tobacco smoke. We further carried out an mRNA expression microarray experiment to validate statistical genetic interactions, and to determine if the set of genes identified in the SEN were differentially expressed in a normal bladder cell line and a bladder cancer cell line in the presence or absence of benzo[a]pyrene. Significant nonrandom sets of genes from the SEN were found to be differentially expressed in response to benzo[a]pyrene in both the normal bladder cells and the bladder cancer cells. In addition, the patterns of gene expression were significantly different between these two cell types. The enrichment analyses and the gene expression microarray results support the idea that SEN analysis of bladder in population-based studies is able to identify biologically meaningful statistical patterns. These results bring us a step closer to a systems genetic approach to understanding cancer susceptibility that integrates population and laboratory-based studies.

In vitro fertilization outcomes in obese women under and above 35 years of age.

PubMed

Vural, F; Vural, B; Çakiroglu, Y

2016-01-01

To explore the impact of obesity on in vitro fertilization (IVF) outcomes and comparing the results with regards to age groups. This retrospective cohort recruited 780 women that underwent IVF. Women with polycystic ovarian syndrome (PCOS) were excluded from the study. Women under and above 35 years were categorized into three groups as normal weight, overweight, and obese. The main outcome measures were ovarian response, oocyte maturity, and clinical pregnancy rates. Despite oocyte count and fertilization rate that decreased in both younger and older obese women, this difference was not statistically significant. After age matched-normal weight controls, the clinical pregnancy rates were significantly decreased in older obese women. On the other hand, poor ovarian response observed significantly in young obese women without effect on pregnancy rates. These results suggested that obesity in young and old women has different outcomes and different steps of IVF process may be affected.

The relation between tilt table and acceleration-tolerance and their dependence on stature and physical fitness

NASA Technical Reports Server (NTRS)

Klein, K. E.; Backhausen, F.; Bruner, H.; Eichhorn, J.; Jovy, D.; Schotte, J.; Vogt, L.; Wegman, H. M.

1980-01-01

A group of 12 highly trained athletes and a group of 12untrained students were subjected to passive changes of position on a tilt table and positive accelerations in a centrifuge. During a 20 min tilt, including two additional respiratory maneuvers, the number of faints and average cardiovascular responses did not differ significantly between the groups. During linear increase of acceleration, the average blackout level was almost identical in both groups. Statistically significant coefficients of product-moment correlation for various relations were obtained. The coefficient of multiple determination computed for the dependence of acceleration tolerance on heart-eye distance and systolic blood pressure at rest allows the explanation of almost 50% of the variation of acceleration tolerance. The maximum oxygen uptake showed the expected significant correlation to the heart rate at rest, but not the acceleration tolerance, or to the cardiovascular responses to tilting.

In vivo evaluation of the effect of stimulus distribution on FIR statistical efficiency in event-related fMRI.

PubMed

Jansma, J Martijn; de Zwart, Jacco A; van Gelderen, Peter; Duyn, Jeff H; Drevets, Wayne C; Furey, Maura L

2013-05-15

Technical developments in MRI have improved signal to noise, allowing use of analysis methods such as Finite impulse response (FIR) of rapid event related functional MRI (er-fMRI). FIR is one of the most informative analysis methods as it determines onset and full shape of the hemodynamic response function (HRF) without any a priori assumptions. FIR is however vulnerable to multicollinearity, which is directly related to the distribution of stimuli over time. Efficiency can be optimized by simplifying a design, and restricting stimuli distribution to specific sequences, while more design flexibility necessarily reduces efficiency. However, the actual effect of efficiency on fMRI results has never been tested in vivo. Thus, it is currently difficult to make an informed choice between protocol flexibility and statistical efficiency. The main goal of this study was to assign concrete fMRI signal to noise values to the abstract scale of FIR statistical efficiency. Ten subjects repeated a perception task with five random and m-sequence based protocol, with varying but, according to literature, acceptable levels of multicollinearity. Results indicated substantial differences in signal standard deviation, while the level was a function of multicollinearity. Experiment protocols varied up to 55.4% in standard deviation. Results confirm that quality of fMRI in an FIR analysis can significantly and substantially vary with statistical efficiency. Our in vivo measurements can be used to aid in making an informed decision between freedom in protocol design and statistical efficiency. Published by Elsevier B.V.

Response of Legumes to Prescribed Burns in Loblolly Pine Stands of the South Carolina Piedmont

Treesearch

Charles T. Cushwa; Melvin Hopkins; Burd S. McGinnes

1970-01-01

The effects of prescribed burns in spring or summer on the leguminous plant cover and on seed production of legumes were studied at nine locations on the Sumter National Forest in the Piedmont of South Carolina. Numbers of legumes did not differ statistically from those on unburned control plots. Seed production on plots burned during the summer was significantly...

The Impact on Higher Education. Part of a Symposium: Funding Shortfalls and Their Impact on Policy Making in the 1990's.

ERIC Educational Resources Information Center

Petry, John R.; Kenney, Gordon E.

This paper examines the impact on higher education of funding shortfalls that are due to significant reductions of college budgets by state legislatures and that result in trimming of services and laying off of employees. First, an overview of national trends and statistics describes retrenchment as a key institutional response. A look at some…

Ecosystem responses to climate change at a Low Arctic and a High Arctic long-term research site

Treesearch

John E. Hobbie; Gaius R. Shaver; Edward B. Rastetter; Jessica E. Cherry; Scott J. Goetz; Kevin C. Guay; William A. Gould; George W. Kling

2017-01-01

Long-term measurements of ecological effects of warming are often not statistically significant because of annual variability or signal noise. These are reduced in indicators that filter or reduce the noise around the signal and allow effects of climate warming to emerge. In this way, certain indicators act as medium pass filters integrating the signal over years-to-...

Subharmonic Imaging and Pressure Estimation for Monitoring Neoadjuvant Chemotherapy

DTIC Science & Technology

2015-11-01

ultrasound contrast agents to improve the monitoring of breast cancer treatment response to neoadjuvant therapies in women diagnosed with LABC by imaging...estimation (SHAPE). Software for analyzing RF data from a Logiq 9 ultrasound scanner (GE Healthcare, Milwauke, WI) to produce 3D SHAPE pressure...responders; albeit not statistically significant (p > 0.19). 14. SUBJECT TERMS Breast Cancer, Ultrasound Imaging, Ultrasound Contrast Agent, Pressure

Early Assessment of Treatment Responses During Radiation Therapy for Lung Cancer Using Quantitative Analysis of Daily Computed Tomography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paul, Jijo; Yang, Cungeng; Wu, Hui

Purpose: To investigate early tumor and normal tissue responses during the course of radiation therapy (RT) for lung cancer using quantitative analysis of daily computed tomography (CT) scans. Methods and Materials: Daily diagnostic-quality CT scans acquired using CT-on-rails during CT-guided RT for 20 lung cancer patients were quantitatively analyzed. On each daily CT set, the contours of the gross tumor volume (GTV) and lungs were generated and the radiation dose delivered was reconstructed. The changes in CT image intensity (Hounsfield unit [HU]) features in the GTV and the multiple normal lung tissue shells around the GTV were extracted from themore » daily CT scans. The associations between the changes in the mean HUs, GTV, accumulated dose during RT delivery, and patient survival rate were analyzed. Results: During the RT course, radiation can induce substantial changes in the HU histogram features on the daily CT scans, with reductions in the GTV mean HUs (dH) observed in the range of 11 to 48 HU (median 30). The dH is statistically related to the accumulated GTV dose (R{sup 2} > 0.99) and correlates weakly with the change in GTV (R{sup 2} = 0.3481). Statistically significant increases in patient survival rates (P=.038) were observed for patients with a higher dH in the GTV. In the normal lung, the 4 regions proximal to the GTV showed statistically significant (P<.001) HU reductions from the first to last fraction. Conclusion: Quantitative analysis of the daily CT scans indicated that the mean HUs in lung tumor and surrounding normal tissue were reduced during RT delivery. This reduction was observed in the early phase of the treatment, is patient specific, and correlated with the delivered dose. A larger HU reduction in the GTV correlated significantly with greater patient survival. The changes in daily CT features, such as the mean HU, can be used for early assessment of the radiation response during RT delivery for lung cancer.« less

Early Assessment of Treatment Responses During Radiation Therapy for Lung Cancer Using Quantitative Analysis of Daily Computed Tomography.

PubMed

Paul, Jijo; Yang, Cungeng; Wu, Hui; Tai, An; Dalah, Entesar; Zheng, Cheng; Johnstone, Candice; Kong, Feng-Ming; Gore, Elizabeth; Li, X Allen

2017-06-01

To investigate early tumor and normal tissue responses during the course of radiation therapy (RT) for lung cancer using quantitative analysis of daily computed tomography (CT) scans. Daily diagnostic-quality CT scans acquired using CT-on-rails during CT-guided RT for 20 lung cancer patients were quantitatively analyzed. On each daily CT set, the contours of the gross tumor volume (GTV) and lungs were generated and the radiation dose delivered was reconstructed. The changes in CT image intensity (Hounsfield unit [HU]) features in the GTV and the multiple normal lung tissue shells around the GTV were extracted from the daily CT scans. The associations between the changes in the mean HUs, GTV, accumulated dose during RT delivery, and patient survival rate were analyzed. During the RT course, radiation can induce substantial changes in the HU histogram features on the daily CT scans, with reductions in the GTV mean HUs (dH) observed in the range of 11 to 48 HU (median 30). The dH is statistically related to the accumulated GTV dose (R 2  > 0.99) and correlates weakly with the change in GTV (R 2  = 0.3481). Statistically significant increases in patient survival rates (P=.038) were observed for patients with a higher dH in the GTV. In the normal lung, the 4 regions proximal to the GTV showed statistically significant (P<.001) HU reductions from the first to last fraction. Quantitative analysis of the daily CT scans indicated that the mean HUs in lung tumor and surrounding normal tissue were reduced during RT delivery. This reduction was observed in the early phase of the treatment, is patient specific, and correlated with the delivered dose. A larger HU reduction in the GTV correlated significantly with greater patient survival. The changes in daily CT features, such as the mean HU, can be used for early assessment of the radiation response during RT delivery for lung cancer. Copyright © 2017 Elsevier Inc. All rights reserved.

Effectiveness of intensive healthcare waste management training model among health professionals at teaching hospitals of Pakistan: a quasi-experimental study.

PubMed

Kumar, Ramesh; Somrongthong, Ratana; Shaikh, Babar Tasneem

2015-02-28

Infectious waste management has always remained a neglected public health problem in the developing countries, resulting in high burden of environmental pollution affecting general masses. Health workers are the key personnel who are responsible for the management of infectious waste at any hospital, however, their proper training and education is must for an optimal performance. This interventional study was conducted to assess the effectiveness of Intensive healthcare waste management (IHWM) training model at two tertiary care hospitals of Rawalpindi city, Pakistan. This study was quasi-experimental pre and post design with control and intervention groups. Out of 275 health care workers enrolled for the study, 138 workers were assigned for intervention group for 3 months trainings, hands-on practicum and reminders on infectious waste management; whereas 137 workers were assigned to the control hospital where routine activities on infectious health care waste management were performed. Pre and post intervention assessment was done for knowledge, attitude and practices (KAP); and was statistically analyzed. Bivariate and multivariate analysis, independent, paired and unpaired t-test, chi-square with p values, and mean of the responses were calculated. Overall the response rate was 92% at the end of intervention. During the baseline survey, 275 healthcare workers (HCW) included doctors, nurses, paramedics and sanitary workers, and after 3 months of intervention, 255 were reached out to complete the questionnaire. With regard to KAP at baseline, there were no significant differences between two groups at baseline, except for gender and department. However, in the post intervention survey, statistically significance difference (<0.05) between intervention and control group's knowledge, attitude and practices was found. Moreover, within the control group no statistically significant difference was reported (>0.05) after 3 months. Study results suggest that IHWM training could be an effective intervention for improving knowledge, attitudes and practices among health workers regarding infectious waste management. Such training should become a regular feature of all hospitals for reducing the hazards attached with infectious wastes.

Association of HPA axis hormones with copeptin after psychological stress differs by sex.

PubMed

Spanakis, Elias K; Wand, Gary S; Ji, Nan; Golden, Sherita Hill

2016-01-01

Copeptin levels are elevated in severe medical conditions, an effect that is attributed to elevated arginine vasopressin (AVP) levels in response to physiological stress, resulting in activation of hypothalamus-pituitary-adrenal (HPA) axis. In the current study, we wanted to determine if copeptin is responsive to psychological stress, correlates with cortisol and adrenocorticotropin hormone (ACTH), and if associations differed by sex. In a cross-sectional study that included 100 healthy men (41%) and women (59%) (aged 18-30 years; mean 24.6 ± 3 years), who underwent the Trier Social Stress Test (TSST), we examined the association between percent change (peak-baseline/baseline) in copeptin levels and percent change in log ACTH and cortisol. Three baselines samples were drawn followed by blood sampling at 20, 35, 50, 65 and 85 min after TSST. There was a significant positive association between the percent change in copeptin and the percent change in log-transformed salivary cortisol (β-coefficient=0.95; p=0.02). The association between percent change in copeptin and log-transformed serum cortisol was not statistically significant in the overall population. There was a trend for a non-significant association between percent change in copeptin and percent change in log-transformed ACTH (β-coefficient=1.14; p=0.06). In males, there was a significant positive association between the percent change in copeptin levels and log-transformed salivary (β-coefficient=1.33, p=0.016) and serum cortisol (β-coefficient=0.69, p=0.01), whereas in women there was no statistically significant association. We found a significant positive association between percent change in copeptin and percent change in salivary and serum cortisol among males only. Copyright © 2015 Elsevier Ltd. All rights reserved.

Safety of atomoxetine in combination with intravenous cocaine in cocaine-experienced participants.

PubMed

Cantilena, Louis; Kahn, Roberta; Duncan, Connie C; Li, Shou-Hua; Anderson, Ann; Elkashef, Ahmed

2012-12-01

Atomoxetine has been considered as an agonist replacement therapy for cocaine. We investigated the safety of the interaction of atomoxetine with cocaine and also whether cognitive function was affected by atomoxetine during short-term administration. In a double-blind placebo-controlled inpatient study of 20 cocaine-dependent volunteers, participants received atomoxetine 80 mg daily followed by 100 mg daily for 5 days each. On the fourth and fifth day at each dose, cocaine (20 and 40 mg) was infused intravenously in sequential daily sessions. Preinfusion mean systolic pressures showed a small but statistically significant difference between placebo and both doses of atomoxetine. Preinfusion mean diastolic pressures were significant between placebo and atomoxetine 80 mg only. The diastolic pressure response to 40 mg cocaine was statistically significant only between the 80- and 100-mg atomoxetine doses. All electrocardiogram parameters were unchanged. Visual Analog Scale (VAS) scores for "bad effect" in the atomoxetine group were significantly higher at baseline, then declined, and for "likely to use" declined with atomoxetine treatment. On the Addiction Research Center Inventory, the atomoxetine group scored significantly lower on amphetamine, euphoria, and energy subscales (P < 0.0001). Other VAS descriptors, Brief Substance Craving Scale, Profile of Moods State, and Brief Psychiatric Rating Scale showed no differences. Atomoxetine did not affect cocaine pharmacokinetics. In tests of working memory, sustained attention, cognitive flexibility, and decision-making, atomoxetine improved performance on the visual n-back task. There were no differences in any pharmacokinetic parameters for cocaine with atomoxetine. Atomoxetine was tolerated safely by all participants. Certain cognitive improvements and a dampening effect on VAS scores after cocaine were observed, but should be weighed against small but significant differences in hemodynamic responses after atomoxetine.

Safety of Atomoxetine in Combination with Intravenous Cocaine in Cocaine- Experienced Participants

PubMed Central

Cantilena, Louis; Kahn, Roberta; Duncan, Connie C.; Li, Shou-Hua; Anderson, Ann; Elkashef, Ahmed

2012-01-01

Objectives Atomoxetine has been considered as an agonist replacement therapy for cocaine. We investigated the safety of the interaction of atomoxetine with cocaine, and also whether cognitive function was affected by atomoxetine during short-term administration. Methods In a double-blind placebo-controlled inpatient study of 20 cocaine-dependent volunteers, participants received atomoxetine 80 mg daily followed by 100 mg daily for 5 days each. On the fourth and fifth day at each dose, cocaine (20 mg and 40 mg) was infused intravenously in sequential daily sessions. Results Pre-infusion mean systolic pressures showed a small but statistically significant difference between placebo and both doses of atomoxetine. Pre-infusion mean diastolic pressures were significant between placebo and atomoxetine 80 mg only. The diastolic pressure response to 40 mg cocaine was statistically significant only between the 80 mg and 100 mg atomoxetine doses. All ECG parameters were unchanged. VAS scores for “bad effect” in the atomoxetine group were significantly higher at baseline, then declined, and for “likely to use” declined with atomoxetine treatment. On the ARCI the atomoxetine group scored significantly lower on amphetamine, euphoria and energy subscales (p<0.0001). Other VAS descriptors, BSCS, POMS, and BPRS showed no differences. Atomoxetine did not affect cocaine pharmacokinetics. In tests of working memory, sustained attention, cognitive flexibility, and decision-making, atomoxetine improved performance on the visual n-back task. There were no differences in any pharmacokinetic parameters for cocaine with atomoxetine. Conclusions Atomoxetine was tolerated safely by all participants. Certain cognitive improvements and a dampening effect on VAS scores after cocaine were observed, but should be weighed against small but significant differences in hemodynamic responses after atomoxetine. PMID:22987022

[Usage of Calendula officinalis in the prevention and treatment of radiodermatitis: a randomized double-blind controlled clinical trial].

PubMed

Schneider, Franciane; Danski, Mitzy Tannia Reichembach; Vayego, Stela Adami

2015-04-01

To evaluate the efficacy of Calendula officinalis in relation to Essential Fatty Acids for the prevention and treatment of radiodermatitis. This is a randomized double-blind controlled clinical trial with 51 patients with head and neck cancer in radiotherapy treatment divided into two groups: control (27) and experimental (24). There is statistically significant evidence (p-value = 0.0120) that the proportion of radiodermatitis grade 2 in Essential Fatty Acids group is higher than Calendula group. Through the Kaplan-Meier survival curve we observed that Essential Fatty Acids group has always remained below the Calendula group survival curve, due to the lower risk of developing radiodermatitis grade 1, which makes the usage of Calendula more effective, with statistical significance (p-value = 0.00402). Calendula showed better therapeutic response than the Essential Fatty Acids in the prevention and treatment of radiodermatitis. Brazilian Registry of Clinical Trials: RBR-237v4b.

Pathophysiology of shock and hemorrhage in a fulminating viral infection (Ebola).

PubMed

Fisher-Hoch, S P; Platt, G S; Neild, G H; Southee, T; Baskerville, A; Raymond, R T; Lloyd, G; Simpson, D I

1985-11-01

Eleven rhesus monkeys were monitored intensively during experimental infection with Ebola virus. Prominent neutrophilia with left shift and lymphopenia were the earliest abnormalities and were statistically significant by day 4 (P less than .02 and P less than .01, respectively). By day 4 falls in platelet counts were not statistically significant, whereas in vitro platelet aggregation was markedly depressed, progressing rapidly to complete failure by the time of maximum illness. Intraplatelet protein studies suggested this event was the result of in vivo activation and degranulation. Coagulation cascade defects were mainly in the intrinsic system and were surprisingly mild, with no evidence of selective consumption or production deficit of factor VII or VIII. When the possibility of indirectly mediated damage to endothelium possibly by a nonspecific immune response was examined, weight loss was less severe in drug-treated monkeys, and all had detectable plasma prostacyclin metabolites, but there was no improvement in survival.

Mortality of aircraft maintenance workers exposed to trichloroethylene and other hydrocarbons and chemicals: extended follow up

PubMed Central

Radican, Larry; Blair, Aaron; Stewart, Patricia; Wartenberg, Daniel

2009-01-01

Objective To extend follow-up of 14,455 workers from 1990 to 2000, and evaluate mortality risk from exposure to trichloroethylene (TCE) and other chemicals. Methods Multivariable Cox models were used to estimate relative risk for exposed vs. unexposed workers based on previously developed exposure surrogates. Results Among TCE exposed workers, there was no statistically significant increased risk of all-cause mortality (RR=1.04) or death from all cancers (RR=1.03). Exposure-response gradients for TCE were relatively flat and did not materially change since 1990. Statistically significant excesses were found for several chemical exposure subgroups and causes, and were generally consistent with the previous follow up. Conclusions Patterns of mortality have not changed substantially since 1990. While positive associations with several cancers were observed, and are consistent with the published literature, interpretation is limited due to the small numbers of events for specific exposures. PMID:19001957

Response to Comment on "Does the Earth Have an Adaptive Infrared IRIS?"

NASA Technical Reports Server (NTRS)

Bell, Thomas L.; Chou, Ming-Dah; Lindzen, Richard S.; Hou, Arthur Y.

2001-01-01

Harrison's (2001) Comment on the Methodology in Lindzen et al (2001) has prompted re-examination of several aspects of study. Probably the most significant disagreement in our conclusions is due to our different approaches to minimizing the influence of long-time-scale variations in the variables A and T on the results. Given the strength of the annual cycle and the 20-month period covered by the data, we believe that removing monthly means is a better approach to minimizing the long-time-scale behavior of the data than removal of the linear trend, which might actually add spurious long- time- scale variability into the modified data. We have also indicated how our statistical methods of establishing statistical significance differ. More definitive conclusions may only possible after more data have been analyzed, but we feel that our results are robust enough to encourage further study of this phenomenon.

Using Cochran's Z Statistic to Test the Kernel-Smoothed Item Response Function Differences between Focal and Reference Groups

ERIC Educational Resources Information Center

Zheng, Yinggan; Gierl, Mark J.; Cui, Ying

2010-01-01

This study combined the kernel smoothing procedure and a nonparametric differential item functioning statistic--Cochran's Z--to statistically test the difference between the kernel-smoothed item response functions for reference and focal groups. Simulation studies were conducted to investigate the Type I error and power of the proposed…

The response of cortical neurons to in vivo-like input current: theory and experiment: II. Time-varying and spatially distributed inputs.

PubMed

Giugliano, Michele; La Camera, Giancarlo; Fusi, Stefano; Senn, Walter

2008-11-01

The response of a population of neurons to time-varying synaptic inputs can show a rich phenomenology, hardly predictable from the dynamical properties of the membrane's inherent time constants. For example, a network of neurons in a state of spontaneous activity can respond significantly more rapidly than each single neuron taken individually. Under the assumption that the statistics of the synaptic input is the same for a population of similarly behaving neurons (mean field approximation), it is possible to greatly simplify the study of neural circuits, both in the case in which the statistics of the input are stationary (reviewed in La Camera et al. in Biol Cybern, 2008) and in the case in which they are time varying and unevenly distributed over the dendritic tree. Here, we review theoretical and experimental results on the single-neuron properties that are relevant for the dynamical collective behavior of a population of neurons. We focus on the response of integrate-and-fire neurons and real cortical neurons to long-lasting, noisy, in vivo-like stationary inputs and show how the theory can predict the observed rhythmic activity of cultures of neurons. We then show how cortical neurons adapt on multiple time scales in response to input with stationary statistics in vitro. Next, we review how it is possible to study the general response properties of a neural circuit to time-varying inputs by estimating the response of single neurons to noisy sinusoidal currents. Finally, we address the dendrite-soma interactions in cortical neurons leading to gain modulation and spike bursts, and show how these effects can be captured by a two-compartment integrate-and-fire neuron. Most of the experimental results reviewed in this article have been successfully reproduced by simple integrate-and-fire model neurons.

A worldwide analysis of the impact of forest cover change on annual runoff across multiple spatial scales

NASA Astrophysics Data System (ADS)

Zhang, M.; Liu, S.

2017-12-01

Despite extensive studies on hydrological responses to forest cover change in small watersheds, the hydrological responses to forest change and associated mechanisms across multiple spatial scales have not been fully understood. This review thus examined about 312 watersheds worldwide to provide a generalized framework to evaluate hydrological responses to forest cover change and to identify the contribution of spatial scale, climate, forest type and hydrological regime in determining the intensity of forest change related hydrological responses in small (<1000 km2) and large watersheds (≥1000 km2). Key findings include: 1) the increase in annual runoff associated with forest cover loss is statistically significant at multiple spatial scales whereas the effect of forest cover gain is statistically inconsistent; 2) the sensitivity of annual runoff to forest cover change tends to attenuate as watershed size increases only in large watersheds; 3) annual runoff is more sensitive to forest cover change in water-limited watersheds than in energy-limited watersheds across all spatial scales; and 4) small mixed forest-dominated watersheds or large snow-dominated watersheds are more hydrologically resilient to forest cover change. These findings improve the understanding of hydrological response to forest cover change at different spatial scales and provide a scientific underpinning to future watershed management in the context of climate change and increasing anthropogenic disturbances.

Ultrasound-Assisted Extraction of Cannabinoids from Cannabis Sativa L. Optimized by Response Surface Methodology.

PubMed

Agarwal, Charu; Máthé, Katalin; Hofmann, Tamás; Csóka, Levente

2018-03-01

Ultrasonication was used to extract bioactive compounds from Cannabis sativa L. such as polyphenols, flavonoids, and cannabinoids. The influence of 3 independent factors (time, input power, and methanol concentration) was evaluated on the extraction of total phenols (TPC), flavonoids (TF), ferric reducing ability of plasma (FRAP) and the overall yield. A face-centered central composite design was used for statistical modelling of the response data, followed by regression and analysis of variance in order to determine the significance of the model and factors. Both the solvent composition and the time significantly affected the extraction while the sonication power had no significant impact on the responses. The response predictions obtained at optimum extraction conditions of 15 min time, 130 W power, and 80% methanol were 314.822 mg GAE/g DW of TPC, 28.173 mg QE/g DW of TF, 18.79 mM AAE/g DW of FRAP, and 10.86% of yield. A good correlation was observed between the predicted and experimental values of the responses, which validated the mathematical model. On comparing the ultrasonic process with the control extraction, noticeably higher values were obtained for each of the responses. Additionally, ultrasound considerably improved the extraction of cannabinoids present in Cannabis. Low frequency ultrasound was employed to extract bioactive compounds from the inflorescence part of Cannabis. The responses evaluated were-total phenols, flavonoids, ferric reducing assay and yield. The solvent composition and time significantly influenced the extraction process. Appreciably higher extraction of cannabinoids was achieved on sonication against control. © 2018 Institute of Food Technologists®.

Comparison of efficacy between TACE combined with apatinib and TACE alone in the treatment of intermediate and advanced hepatocellular carcinoma: A single-center randomized controlled trial

PubMed Central

Lu, Wei; Jin, Xin-Li; Yang, Chao; Du, Peng; Jiang, Fu-Qiang; Ma, Jun-Peng; Yang, Jian; Xie, Peng; Zhang, Zhe

2017-01-01

ABSTRACT Objective: This study was designed to compare the clinical efficacy and safety of transcatheter arterial chemoembolization (TACE) combined with apatinib and TACE alone in the treatment of intermediate and advanced hepatocellular carcinoma (HCC). Methods: From March 2015 to August 2015, a total of 44 patients with moderate and advanced HCC, who were admitted in the Navy General Hospital of China, were included into this study. These patients were randomly divided into 2 groups: group A and group B. Patients in group A underwent TACE alone, while patients in group B underwent the combined treatment of TACE with apatinib. Differences in preoperative general data between these 2 groups were not statistically significant (P > 0.05). All patients were followed up for 12–18 months. Changes in α-fetal protein (AFP) at 3 months after treatment and the objective response rate (ORR) at 3, 6, 9 and 12 months after treatment were compared between these 2 groups. Furthermore, progression-free survival (PFS) and the incidence of adverse reactions were also compared between these 2 groups. Results: AFP levels in groups A and B significantly decreased after 3 months of treatment, compared with the levels before treatment, and the differences were statistically significant (P < 0.05). However, at 3 months after treatment, the difference between these 2 groups was not statistically significant (P > 0.05). ORR at 3, 6, 9 and 12 months after treatment was 36.36%, 27.27%, 13.64% and 9.09%, respectively, in group A; and 60%, 50%, 45% and 35%, respectively, in group B. At 3 and 6 months after treatment, the differences between these 2 groups were not statistically significant (P > 0.05); while at 9 and 12 months after treatment, the differences between these 2 groups were statistically significant (P < 0.05). The median PFS was 6.0 months in group A and 12.5 months in group B, and the difference was statistically significant (P < 0.05). The incidences of complications were related to oral apatinib, such as hypertension, hand-foot syndrome and proteinuria, were higher in group B than in group A, and the differences were statistically significant (P < 0.05). These symptoms all alleviated after symptomatic treatments. Conclusions: For intermediate and advanced HCC, the long-term curative effect of TACE combined with apatinib is better than that of TACE alone. The former can obviously prolong the PFS of patients and has a confirmed safety. PMID:28548587

Statistical optimization and fabrication of a press coated pulsatile dosage form to treat nocturnal acid breakthrough.

PubMed

Agarwal, Vaibhav; Bansal, Mayank

2013-08-01

Present work focuses on the use of mimosa seed gum to develop a drug delivery system making combined use of floating and pulsatile principles, for the chrono-prevention of nocturnal acid breakthrough. The desired aim was achieved by fabricating a floating delivery system bearing time - lagged coating of Mimosa pudica seed polymer for the programmed release of Famotidine. Response Surface Methodology was the statistical tool that was employed for experiment designing, mathematical model generation and optimization study. A 3(2) full factorial design was used in designing the experiment.% weight ratio of mimosa gum to hydroxy propyl methyl cellulose in the coating combination and the coating weight were the independent variables, whereas the lag time and the cumulative % drug release in 360 minutes were the observed responses. Results revealed that both the coating composition and the coating weight significantly affected the release of drug from the dosage form. The optimized formulation prepared according to the computer generated software, Design-Expert(®) deciphered response which were in close proximity with the experimental responses, thus confirming the robustness as well as accuracy of the predicted model for the utilization of natural polymer like mimosa seed gum for the chronotherapeutic treatment of nocturnal acid breakthrough.

Effects of maternal inhalation of gasoline evaporative ...

EPA Pesticide Factsheets

In order to assess potential health effects resulting from exposure to ethanol-gasoline blend vapors, we previously conducted neurophysiological assessment of sensory function following gestational exposure to 100% ethanol vapor (Herr et al., Toxicologist, 2012). For comparison purposes, the current study investigated the same measures after gestational exposure to 100% gasoline evaporative condensates (GVC). Pregnant Long-Evans rats were exposed to 0, 3K, 6K, or 9K ppm GVC vapors for 6.5 h/day over GD9 – GD20. Sensory evaluations of male offspring began around PND106. Peripheral nerve function (compound action potentials, NCV), somatosensory (cortical and cerebellar evoked potentials), auditory (brainstem auditory evoked responses), and visual evoked responses were assessed. Visual function assessment included pattern elicited visual evoked potentials (VEP), VEP contrast sensitivity, and electroretinograms (ERG) recorded from dark-adapted (scotopic) and light-adapted (photopic) flashes, and UV and green flicker. Although some minor statistical differences were indicated for auditory and somatosensory responses, these changes were not consistently dose- or stimulus intensity-related. Scotopic ERGs had a statistically significant dose-related decrease in the b-wave implicit time. All other parameters of ERGs and VEPs were unaffected by treatment. All physiological responses showed changes related to stimulus intensity, and provided an estimate of detectable le

1H NMR-Based Metabolomic Analysis of Sub-Lethal Perfluorooctane Sulfonate Exposure to the Earthworm, Eisenia fetida, in Soil

PubMed Central

Lankadurai, Brian P.; Furdui, Vasile I.; Reiner, Eric J.; Simpson, André J.; Simpson, Myrna J.

2013-01-01

1H NMR-based metabolomics was used to measure the response of Eisenia fetida earthworms after exposure to sub-lethal concentrations of perfluorooctane sulfonate (PFOS) in soil. Earthworms were exposed to a range of PFOS concentrations (five, 10, 25, 50, 100 or 150 mg/kg) for two, seven and fourteen days. Earthworm tissues were extracted and analyzed by 1H NMR. Multivariate statistical analysis of the metabolic response of E. fetida to PFOS exposure identified time-dependent responses that were comprised of two separate modes of action: a non-polar narcosis type mechanism after two days of exposure and increased fatty acid oxidation after seven and fourteen days of exposure. Univariate statistical analysis revealed that 2-hexyl-5-ethyl-3-furansulfonate (HEFS), betaine, leucine, arginine, glutamate, maltose and ATP are potential indicators of PFOS exposure, as the concentrations of these metabolites fluctuated significantly. Overall, NMR-based metabolomic analysis suggests elevated fatty acid oxidation, disruption in energy metabolism and biological membrane structure and a possible interruption of ATP synthesis. These conclusions obtained from analysis of the metabolic profile in response to sub-lethal PFOS exposure indicates that NMR-based metabolomics is an excellent discovery tool when the mode of action (MOA) of contaminants is not clearly defined. PMID:24958147

Do geomagnetic storms change the behaviour of the stingless bee guiruçu ( Schwarziana quadripunctata)?

NASA Astrophysics Data System (ADS)

Esquivel, Darci M. S.; Wajnberg, E.; Do Nascimento, F. S.; Pinho, M. B.; de Barros, H. G. P. Lins; Eizemberg, R.

2007-02-01

Six behavioural experiments were carried out to investigate the magnetic field effects on the nest-exiting flight directions of the honeybee Schwarziana quadripunctata ( Meliponini). No significant differences resulted during six experiment days under varying geomagnetic field and the applied static inhomogeneous field (about ten times the geomagnetic field) conditions. A surprising statistically significant response was obtained on a unique magnetic storm day. The magnetic nanoparticles in these bees, revealed by ferromagnetic resonance, could be involved in the observed effect of the geomagnetic storm.