Wu, Yanhong; Deng, Zhenling; Wang, Huiru; Ma, Wenbo; Zhou, Chunxia; Zhang, Shuren
2016-09-20
Recently, the immunostimulatory roles of chemotherapeutics have been increasingly revealed, although bone marrow suppression is still a common toxicity of chemotherapy. While the numbers and ratios of different immune subpopulations are analyzed after chemotherapy, changes to immune status after each cycle of treatment are less studied and remain unclear. To determine the tumor-specific immune status and functions after different cycles of chemotherapy, we treated CT26 tumor-bearing mice with one to four cycles of 5-fluorouracil (5-FU). Overall survival was not improved when more than one cycle of 5-FU was administered. Here we present data concerning the immune statuses after one and three cycles of chemotherapy. We analyzed the amount of spleen cells from mice treated with one and three cycles of 5-FU as well as assayed their proliferation and cytotoxicity against the CT26 tumor cell line. We found that the absolute numbers of CD8 T-cells and NK cells were not influenced significantly after either one or three cycles of chemotherapy. However, after three cycles of 5-FU, proliferated CD8 T-cells were decreased, and CT26-specific cytotoxicity and IFN-γ secretion of spleen cells were impaired in vitro. After one cycle of 5-FU, there was a greater percentage of tumor infiltrating CD8 T-cells. In addition, more proliferated CD8 T-cells, enhanced tumor-specific cytotoxicity as well as IFN-γ secretion of spleen cells against CT26 in vitro were observed. Given the increased expression of immunosuppressive factors, such as PD-L1 and TGF-β, we assessed the effect of early introduction of immunotherapy in combination with chemotherapy. We found that mice treated with cytokine induced killer cells and PD-L1 monoclonal antibodies after one cycle of 5-FU had a better anti-tumor performance than those treated with chemotherapy or immunotherapy alone. These data suggest that a single cycle of 5-FU treatment promoted an anti-tumor immune response, whereas repeated chemotherapy cycles impaired anti-tumor immune functions. Though the amount of immune cells could recover after chemotherapy suspension, their anti-tumor functions were damaged by multiple rounds of chemotherapy. These findings also point towards early implementation of immunotherapy to improve the anti-tumor effect.
Beaumont, Kimberley A.; Anfosso, Andrea; Ahmed, Farzana
2015-01-01
Three-dimensional (3D) tumor spheroids are utilized in cancer research as a more accurate model of the in vivo tumor microenvironment, compared to traditional two-dimensional (2D) cell culture. The spheroid model is able to mimic the effects of cell-cell interaction, hypoxia and nutrient deprivation, and drug penetration. One characteristic of this model is the development of a necrotic core, surrounded by a ring of G1 arrested cells, with proliferating cells on the outer layers of the spheroid. Of interest in the cancer field is how different regions of the spheroid respond to drug therapies as well as genetic or environmental manipulation. We describe here the use of the fluorescence ubiquitination cell cycle indicator (FUCCI) system along with cytometry and image analysis using commercial software to characterize the cell cycle status of cells with respect to their position inside melanoma spheroids. These methods may be used to track changes in cell cycle status, gene/protein expression or cell viability in different sub-regions of tumor spheroids over time and under different conditions. PMID:26779761
Buckle, A. M.; Mottram, R.; Pierce, A.; Lucas, G. S.; Russell, N.; Miyan, J. A.; Whetton, A. D.
2000-01-01
BACKGROUND: Chronic Myeloid Leukaemia (CML) is characterised by the chromosomal translocation resulting in expression of the Bcr-Abl protein tyrosine kinase (PTK) in early stem cells and their progeny. However the precise nature of Bcr-Abl effects in primitive CML stem cells remains a matter of active debate. MATERIALS AND METHODS: Extremely primitive Bcr-Abl fusion positive cells were purified from patients with CML using multiparameter flow cytometric analysis of CD34, Thy, and lineage marker (Lin) expression, plus rhodamine-123 (Rh-123) brightness. Progenitor cells of increasing maturity were examined for cycling status by flow cytometry and their proliferative status directly correlated with cell phenotype. The activation status of a key transcription factor, signal transducers and activators of transcription (STAT-5), was also analyzed by immunocytochemistry. RESULTS: The most primitive stem cells currently defined (CD34+Lin-Thy+ Rh-1231o) were present as a lower proportion of the stem cell compartment (CD34+Lin-) of CML patients at presentation than of normal individuals (2.3% +/- 0.4 compared with 5.1% +/- 0.6 respectively). Conversely there was a significantly higher proportion of the more mature cells (CD34+Lin-Thy-Rh-123 hi) in CML patients than in normal individuals (79.3 +/- 1.8 compared with 70.9 +/- 3.3). No primitive subpopulation of CML CD34+Lin- cells was cycling to a significantly greater degree than cells from normal donors, in fact, late progenitor cells (CD34+Lin+) were cycling significantly less in CML samples than normal samples. STAT5, however, was observed to be activated in CML cells. CONCLUSIONS: We conclude that no subpopulation of CML stem cells displays significantly increased cell cycling. Thus, increased cycling cannot be a direct consequence of Bcr-Abl PTK acquisition in highly enriched stem cells from patients with CML. In vivo CML need not be considered a disease of unbridled stem cell proliferation, but a subtle defect in the balance between self renewal and maturation. PMID:11126203
Pede, Valerie; Rombout, Ans; Vermeire, Jolien; Naessens, Evelien; Mestdagh, Pieter; Robberecht, Nore; Vanderstraeten, Hanne; Van Roy, Nadine; Vandesompele, Jo; Speleman, Frank; Philippé, Jan; Verhasselt, Bruno
2013-01-01
Chronic lymphocytic leukemia (CLL) is a disease with variable clinical outcome. Several prognostic factors such as the immunoglobulin heavy chain variable genes (IGHV) mutation status are linked to the B-cell receptor (BCR) complex, supporting a role for triggering the BCR in vivo in the pathogenesis. The miRNA profile upon stimulation and correlation with IGHV mutation status is however unknown. To evaluate the transcriptional response of peripheral blood CLL cells upon BCR stimulation in vitro, miRNA and mRNA expression was measured using hybridization arrays and qPCR. We found both IGHV mutated and unmutated CLL cells to respond with increased expression of MYC and other genes associated with BCR activation, and a phenotype of cell cycle progression. Genome-wide expression studies showed hsa-miR-132-3p/hsa-miR-212 miRNA cluster induction associated with a set of downregulated genes, enriched for genes modulated by BCR activation and amplified by Myc. We conclude that BCR triggering of CLL cells induces a transcriptional response of genes associated with BCR activation, enhanced cell cycle entry and progression and suggest that part of the transcriptional profiles linked to IGHV mutation status observed in isolated peripheral blood are not cell intrinsic but rather secondary to in vivo BCR stimulation. PMID:23560086
NASA Astrophysics Data System (ADS)
Larsson, Fredrik; Bertilsson, Simon; Furlani, Maurizio; Albinsson, Ingvar; Mellander, Bengt-Erik
2018-01-01
Commercial 6.8 Ah lithium-ion cells with different ageing/status have been abused by external heating in an oven. Prior to the abuse test, selected cells were aged either by C/2 cycling up to 300 cycles or stored at 60 °C. Gas emissions were measured by FTIR and three separate vents were identified, two well before the thermal runaway while the third occurred simultaneously with the thermal runaway releasing heavy smoke and gas. Emissions of toxic carbon monoxide (CO), hydrogen fluoride (HF) and phosphorous oxyfluoride (POF3) were detected in the third vent, regardless if there was a fire or not. All abused cells went into thermal runaway and emitted smoke and gas, the working cells also released flames as well as sparks. The dead cells were however less reactive but still underwent thermal runaway. For about half of the working cells, for all levels of cycle ageing, ignition of the accumulated battery released gases occurred about 15 s after the thermal runaway resulting in a gas explosion. The thermal runaway temperature, about 190 °C, varied somewhat for the different cell ageing/status where a weak local minimum was found for cells cycled between 100 and 200 times.
Performance characteristics of ambient temperature secondary lithium cells
NASA Technical Reports Server (NTRS)
Deligiannis, F.; Shen, D.; Subbarao, S.; Whitcanack, L.; Halpert, G.
1988-01-01
State of art ambient temperature secondary lithium cells were evaluated to determine their performance capability and limitations and to assess the present status of the technology of these cells. Li-MoS2, Li-NbSe3 and Li-TiS2 cells were evaluated for their charge/discharge characteristics, rate capability, and cycle life performance. The cells evaluated have a cycle life of 100-250 cycles at moderate discharge rates (C/5). The specific energy of these cells is between 50 and 100 Wh/Kg, depending upon the system. This paper describes the details of the cell designs, the test procedures, and the results of the evaluation studies.
SAMHD1 controls cell cycle status, apoptosis and HIV-1 infection in monocytic THP-1 cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bonifati, Serena; Daly, Michele B.; St Gelais, Corine
SAMHD1 limits HIV-1 infection in non-dividing myeloid cells by decreasing intracellular dNTP pools. HIV-1 restriction by SAMHD1 in these cells likely prevents activation of antiviral immune responses and modulates viral pathogenesis, thus highlighting a critical role of SAMHD1 in HIV-1 physiopathology. Here, we explored the function of SAMHD1 in regulating cell proliferation, cell cycle progression and apoptosis in monocytic THP-1 cells. Using the CRISPR/Cas9 technology, we generated THP-1 cells with stable SAMHD1 knockout. We found that silencing of SAMHD1 in cycling cells stimulates cell proliferation, redistributes cell cycle population in the G{sub 1}/G{sub 0} phase and reduces apoptosis. These alterationsmore » correlated with increased dNTP levels and more efficient HIV-1 infection in dividing SAMHD1 knockout cells relative to control. Our results suggest that SAMHD1, through its dNTPase activity, affects cell proliferation, cell cycle distribution and apoptosis, and emphasize a key role of SAMHD1 in the interplay between cell cycle regulation and HIV-1 infection.« less
SAFT nickel hydrogen cell cycling status
NASA Technical Reports Server (NTRS)
Borthomieu, Yannick; Duquesne, Didier
1994-01-01
An overview of the NiH2 cell development is given. The NiH2 SAFT system is an electrochemical (single or dual) stack (IPV). The stack is mounted in an hydroformed Inconel 718 vessel operating at high pressure, equipped with 'rabbit ears' ceramic brazed electrical feedthroughs. The cell design is described: positive electrode, negative electrode, and stack configuration. Overviews of low earth orbit and geostationary earth orbit cyclings are provided. DPA results are also provided. The cycling and DPA results demonstrate that SAFT NiH2 is characterized by high reliability and very stable performances.
The USAF Phillips Laboratory sodium-sulfur battery technology program: Results and status
NASA Technical Reports Server (NTRS)
Rainbow, Marc E.; Somerville, Andrew
1996-01-01
Tests performed on NaS batteries are reported. The results of safety and abuse testing, shock and vibration tests, cell failure on warm-up, freeze thaw, overtemperature conditions, electrolyte fracture, overdischarge, and short circuit tests are presented along with GEO and LEO cycle tests and the status of the NaS cell flight tests.
Selenium as an essential micronutrient: roles in cell cycle and apoptosis.
Zeng, Huawei
2009-03-23
Selenium is an essential trace element for humans and animals, and selenium deficiency is associated with several disease conditions such as immune impairment. In addition, selenium intakes that are greater than the recommended daily allowance (RDA) appear to protect against certain types of cancers. In humans and animals, cell proliferation and death must be regulated to maintain tissue homeostasis, and it has been well documented that numerous human diseases are directly related to the control of cell cycle progression and apoptosis. Thus, the elucidation of the mechanisms by which selenium regulates the cell cycle and apoptosis can lead to a better understanding of the nature of selenium's essentiality and its role in disease prevention. This article reviews the status of knowledge concerning the effect of selenium on cell cycle and apoptosis.
Powathil, Gibin G.; Adamson, Douglas J. A.; Chaplain, Mark A. J.
2013-01-01
In this paper we use a hybrid multiscale mathematical model that incorporates both individual cell behaviour through the cell-cycle and the effects of the changing microenvironment through oxygen dynamics to study the multiple effects of radiation therapy. The oxygenation status of the cells is considered as one of the important prognostic markers for determining radiation therapy, as hypoxic cells are less radiosensitive. Another factor that critically affects radiation sensitivity is cell-cycle regulation. The effects of radiation therapy are included in the model using a modified linear quadratic model for the radiation damage, incorporating the effects of hypoxia and cell-cycle in determining the cell-cycle phase-specific radiosensitivity. Furthermore, after irradiation, an individual cell's cell-cycle dynamics are intrinsically modified through the activation of pathways responsible for repair mechanisms, often resulting in a delay/arrest in the cell-cycle. The model is then used to study various combinations of multiple doses of cell-cycle dependent chemotherapies and radiation therapy, as radiation may work better by the partial synchronisation of cells in the most radiosensitive phase of the cell-cycle. Moreover, using this multi-scale model, we investigate the optimum sequencing and scheduling of these multi-modality treatments, and the impact of internal and external heterogeneity on the spatio-temporal patterning of the distribution of tumour cells and their response to different treatment schedules. PMID:23874170
Das, Mitali; Prasad, Shyam Babu; Yadav, Suresh Singh; Modi, Arusha; Singh, Sunita; Pradhan, Satyajit; Narayan, Gopeshwar
2015-12-01
Minichoromosome maintenance (MCM) proteins play key role in cell cycle progression by licensing DNA replication only once per cell cycle. These proteins are found to be overexpressed in cervical cancer cells. In this study, we depleted MCM4, one of the MCM 2-7 complex components by RNA interference (RNAi) in four cervical cancer cell lines. The four cell lines were selected on the basis of their human papillomavirus (HPV) infection: HPV16-positive SiHa, HPV18-positive ME-180, HPV16- and HPV18-positive CaSki, and HPV-negative C-33A. The MCM4-deficient cells irrespective of their HPV status grow for several generations and maintain regular cell cycle. We did not find any evidence of augmented response to a short-term (48 h) cisplatin treatment in these MCM4-deficient cells. However, MCM4-/HPV16+ SiHa cells cannot withstand a prolonged treatment (up to 5 days) of even a sublethal dosage of cisplatin. They show increased chromosomal instability compared to their control counterparts. On the other hand, MCM4-deficient CaSki cells (both HPV16+ and 18+) remain resistant to a prolonged exposure to cisplatin. Our study indicates that cervical cancer cells may be using excess MCMs as a backup for replicative stress; however, its regulatory mechanism is dependent on the HPV status of the cells.
Cell cycle in egg cell and its progression during zygotic development in rice.
Sukawa, Yumiko; Okamoto, Takashi
2018-03-01
Rice egg is arrested at G1 phase probably by OsKRP2. After fusion with sperm, karyogamy, OsWEE1-mediated parental DNA integrity in zygote nucleus, zygote progresses cell cycle to produce two-celled embryo. In angiosperms, female and male gametes exist in gametophytes after the complementation of meiosis and the progression of nuclear/cell division of the haploid cell. Within the embryo sac, the egg cell is specially differentiated for fertilization and subsequent embryogenesis, and cellular programs for embryonic development, such as restarting the cell cycle and de novo gene expression, are halted. There is only limited knowledge about how the cell cycle in egg cells restarts toward zygotic division, although the conversion of the cell cycle from a quiescent and arrested state to an active state is the most evident transition of cell status from egg cell to zygote. This is partly due to the difficulty in direct access and analysis of egg cells, zygotes and early embryos, which are deeply embedded in ovaries. In this study, precise relative DNA amounts in the nuclei of egg cells, developing zygotes and cells of early embryos were measured, and the cell cycle of a rice egg cell was estimated as the G1 phase with a 1C DNA level. In addition, increases in DNA content in zygote nuclei via karyogamy and DNA replication were also detectable according to progression of the cell cycle. In addition, expression profiles for cell cycle-related genes in egg cells and zygotes were also addressed, and it was suggested that OsKRP2 and OsWEE1 function in the inhibition of cell cycle progression in egg cells and in checkpoint of parental DNA integrity in zygote nucleus, respectively.
Bcl-2/Bax protein ratio predicts 5-fluorouracil sensitivity independently of p53 status
Mirjolet, J-F; Barberi-Heyob, M; Didelot, C; Peyrat, J-P; Abecassis, J; Millon, R; Merlin, J-L
2000-01-01
p53 tumour-suppressor gene is involved in cell growth control, arrest and apoptosis. Nevertheless cell cycle arrest and apoptosis induction can be observed in p53-defective cells after exposure to DNA-damaging agents such as 5-fluorouracil (5-FU) suggesting the importance of alternative pathways via p53-independent mechanisms. In order to establish relationship between p53 status, cell cycle arrest, Bcl-2/Bax regulation and 5-FU sensitivity, we examined p53 mRNA and protein expression and p53 protein functionality in wild-type (wt) and mutant (mt) p53 cell lines. p53 mRNA and p53 protein expression were determined before and after exposure to equitoxic 5-FU concentration in six human carcinoma cell lines differing in p53 status and displaying marked differences in 5-FU sensitivity, with IC 50 values ranging from 0.2–22.6 mM. 5-FU induced a rise in p53 mRNA expression in mt p53 cell lines and in human papilloma virus positive wt p53 cell line, whereas significant decrease in p53 mRNA expression was found in wt p53 cell line. Whatever p53 status, 5-FU altered p53 transcriptional and translational regulation leading to up-regulation of p53 protein. In relation with p53 functionality, but independently of p53 mutational status, after exposure to 5-FU equitoxic concentration, all cell lines were able to arrest in G1. No relationship was evidenced between G1 accumulation ability and 5-FU sensitivity. Moreover, after 5-FU exposure, Bax and Bcl-2 proteins regulation was under p53 protein control and a statistically significant relationship (r= 0.880,P= 0.0097) was observed between Bcl-2/Bax ratio and 5-FU sensitivity. In conclusion, whatever p53 status, Bcl-2 or Bax induction and Bcl-2/Bax protein ratio were correlated to 5-FU sensitivity. © 2000 Cancer Research Campaign PMID:11044365
Zhang, Chunlin; Deng, Zeyi; Pan, Xiaoli; Uehara, Takayuki; Suzuki, Mikio; Xie, Minqiang
2015-01-01
To map comprehensively the methylation status of the CpG sites within the HPV16 long control region (LCR) in HPV-positive cancer cells, and to explore further the effects of methylation status of HPV16 LCR on cell bioactivity and E6 and E7 expression. In addition, to analyze the methylation status of the LCR in HPV-positive oropharyngeal squamous cell carcinoma (OPSCC) patients. Methylation patterns of HPV16 LCR in UM-SCC47, CaSki, and SiHa cells and HPV16-positiive OPSCC specimens were detected by bisulfite-sequencing PCR and TA cloning. For cells treated with 5-aza-2'-deoxycytidine and E6 and E7 knockdown, MTS and trypan blue staining, annexin-V and 7-AAD staining, and prodidium iodide were used to evaluate cell growth and cell proliferation, cell apoptosis, and cell cycle arrest, respectively. E6 and E7 mRNA and protein expression were analyzed by quantitative real-time PCR and immunocytochemistry, respectively. Hypermethylation status of the LCR in UM-SCC47 (79.8%) and CaSki cells (90.0%) and unmethylation status of the LCR in SiHa cells (0%) were observed. Upon demethylation, the cells with different methylation levels responded differently during growth, apoptosis, and cell cycle arrest, as well as in terms of their E6 and E7 expression. In HPV16-positive OPSCC patients, the methylation rates were 9.5% in the entire LCR region, 13.9% in the 5'-LCR, 6.0% in the E6 enhancer, and 9.5% in the p97 promoter, and hypermethylation of p97 promoter was found in a subset of cases (20.0%, 2/10). Our study revealed two different methylation levels of the LCR in HPV16-positive cancer cells and OPSCC patients, which may represent different carcinogenesis mechanisms of HPV-positive cancers cells. Demethylating the meCpGs in HPV16 LCR might be a potential target for a subgroup of HPV16-positive patients with head and neck squamous cell carcinoma.
Statistical analysis of lithium iron sulfide status cell cycle life and failure mode
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gay, E.C.; Battles, J.E.; Miller, W.E.
1983-08-01
A statistical model was developed for life cycle testing of electrochemical cell life cycle trials and verified experimentally. The Weibull distribution was selected to predict the end of life for a cell, based on a 20 percent loss of initial stabilized capacity or a decrease to less than 95 percent coulombic efficiency. Groups of 12 or more Li-alloy/FeS cells were cycled to determine the mean time to failure (MTTF) and also to identify the failure modes. The cells were all full size electric vehicle batteries with 150-350 A-hr capacity. The Weibull shape factors were determined and verified in prediction ofmore » the number of cell failures in two 10 cell modules. The short circuit failure in the cells with BN-felt and MgO powder separators were found to be caused by the formation of Li-Al protrusions that penetrated the BN-felt separators, and the extrusion of active material at the edge of the electrodes.« less
The TCP4 transcription factor of Arabidopsis blocks cell division in yeast at G1→S transition.
Aggarwal, Pooja; Padmanabhan, Bhavna; Bhat, Abhay; Sarvepalli, Kavitha; Sadhale, Parag P; Nath, Utpal
2011-07-01
The TCP transcription factors control important aspects of plant development. Members of class I TCP proteins promote cell cycle by regulating genes directly involved in cell proliferation. In contrast, members of class II TCP proteins repress cell division. While it has been postulated that class II proteins induce differentiation signal, their exact role on cell cycle has not been studied. Here, we report that TCP4, a class II TCP protein from Arabidopsis that repress cell proliferation in developing leaves, inhibits cell division by blocking G1→S transition in budding yeast. Cells expressing TCP4 protein with increased transcriptional activity fail to progress beyond G1 phase. By analyzing global transcriptional status of these cells, we show that expression of a number of cell cycle genes is altered. The possible mechanism of G1→S arrest is discussed. Copyright © 2011 Elsevier Inc. All rights reserved.
Kota, Krishna P; Benko, Jacqueline G; Mudhasani, Rajini; Retterer, Cary; Tran, Julie P; Bavari, Sina; Panchal, Rekha G
2012-09-25
Viruses modulate a number of host biological responses including the cell cycle to favor their replication. In this study, we developed a high-content imaging (HCI) assay to measure DNA content and identify different phases of the cell cycle. We then investigated the potential effects of cell cycle arrest on Ebola virus (EBOV) infection. Cells arrested in G1 phase by serum starvation or G1/S phase using aphidicolin or G2/M phase using nocodazole showed much reduced EBOV infection compared to the untreated control. Release of cells from serum starvation or aphidicolin block resulted in a time-dependent increase in the percentage of EBOV infected cells. The effect of EBOV infection on cell cycle progression was found to be cell-type dependent. Infection of asynchronous MCF-10A cells with EBOV resulted in a reduced number of cells in G2/M phase with concomitant increase of cells in G1 phase. However, these effects were not observed in HeLa or A549 cells. Together, our studies suggest that EBOV requires actively proliferating cells for efficient replication. Furthermore, multiplexing of HCI based assays to detect viral infection, cell cycle status and other phenotypic changes in a single cell population will provide useful information during screening campaigns using siRNA and small molecule therapeutics.
Papanikolaou, Eleni; Paruzynski, Anna; Kasampalidis, Ioannis; Deichmann, Annette; Stamateris, Evangelos; Schmidt, Manfred; von Kalle, Christof; Anagnou, Nicholas P
2015-01-01
Gene therapy utilizing lentiviral-vectors (LVs) is postulated as a dynamic therapeutic alternative for monogenic diseases. However, retroviral gene transfer may cause insertional mutagenesis. Although, such risks had been originally estimated as extremely low, several reports of leukemias or clonal dominance, have led to a re-evaluation of the mechanisms operating in insertional mutagenesis. Therefore, unraveling the mechanism of retroviral integration is mandatory toward safer gene therapy applications. In the present study, we undertook an experimental approach which enabled direct correlation of the cell cycle stage of the target cell with the integration profile of LVs. CD34+ cells arrested at different stages of cell cycle, were transduced with a GFP-LV. LAM-PCR was employed for integration site detection, followed by microarray analysis to correlate transcribed genes with integration sites. The results indicate that ~10% of integration events occurred in actively transcribed genes and that the cell cycle stage of target cells affects integration pattern. Specifically, use of thymine promoted a safer profile, since it significantly reduced integration within cell cycle-related genes, while we observed increased possibility for integration into genes related to development, and decreased possibility for integration within cell cycle and cancer-related genes, when transduction occurs during mitosis. PMID:25523760
P53 alters the cytotoxicity and genotoxicity for oxidized graphene in human B-lymphoblastoid cells
NASA Astrophysics Data System (ADS)
Petibone, Dayton Matthew
Widespread use of oxidized graphene nanomaterials in industry, medicine, and consumer products raises concern about potential adverse impacts on human health. The p53 tumor suppressor protein is crucial to maintaining cellular and genetic stability to prevent carcinogenesis. Here, we show that oxygen functionalized graphene (f-G) absorption and p53 functional status correlate with cytotoxicity and genotoxicity in human B-lymphoblastoid cells. Trends in f-G absorption by were dose-dependent. Cells with functional p53 exposed to f-G arrested in G0/G1 phase of the cell cycle, suppressed f-G induced reactive oxygen species (ROS), and had elevated apoptosis. While compared to p53 competent cells, the p53 deficient cells exposed to f-G accumulated in S-phase of the cell cycle, had elevated ROS levels, and evaded apoptosis. The f-G genotoxicity was evident as increased loss-of-heterozygosity mutants independent of p53 status, and structural chromosome damage in p53 deficient cells. These findings have broad implications for the safety and efficacy of oxidized graphene nanomaterials in industrial, consumer products and biomedical applications.
Tageja, Nishant; Korde, Neha; Kazandjian, Dickran; Panch, Sandhya; Manasanch, Elisabet; Bhutani, Manisha; Kwok, Mary; Mailankody, Sham; Yuan, Constance; Stetler-Stevenson, Maryalice; Leitman, Susan F; Sportes, Claude; Landgren, Ola
2018-05-04
Still, many physicians give 4 cycles of combination therapy to multiple myeloma patients prior to collection of stem cells for autologous bone marrow transplant. This tradition originates from older doxorubicin-containing regiments which limited the number of cycles due to cumulative cardiotoxicity. Using older regiments, most patients had residual myeloma cells in their autologous stem-cell grafts during collection. Emerging data show that newly diagnosed multiple myeloma patients treated with modern carfilzomib/lenalidomide/dexamethasone (KRd) therapy, on average, take 6 cycles until reaching minimal residual disease (MRD) negativity. We assessed newly diagnosed patients treated with KRd focusing MRD status both in the individual patient's bone marrow, and the corresponding autologous hematopoietic progenitor cell grafts during collection. Per protocol, stem-cell collection was allowed after 4 to 8 cycles of KRd. We found similar stem-cell yield independent of the number of cycles of KRd. At stem-cell collection, 11/30 patients (36.6%) were MRD negative in their bone marrow; all 11 patients had MRD negative hematopoietic progenitor cell grafts. Furthermore, 18/19 patients who were MRD positive in their bone marrows also had MRD negative hematopoietic progenitor cell grafts. These observations support 6 cycles of KRd as an efficacious and safe induction strategy prior to stem-cell collection.
[Flowcytometry DNA analysis of oral and maxillofacial non-Hodgkin's lymphoma].
Ma, Li; He, Zhixiu; Wu, Lanyan; Cai, Yixin; Huang, Hechang; Lei, Song
2002-06-01
The purpose of this study was to investigate the relationship between the results of flowcytometry analyses of different clinical stage, location, pathologic grade and cell origin of oral and maxillofacial non-Hodgkin's lymphoma (NHL), and the diagnostic value of flowcytometry analysis in lymphoma. This study analyzed 50 oral and maxillofacial NHL cases and 10 reactive lymph nodes (formalin fixed and paraffin embedded) by flowcytometry (FCM). Reactive lymph nodes were all diploid. The diploid rate of NHL was 54%, and aneuploidy rate was 46%. There was statistically significant difference between reactive lymph nodes and NHL in the DNA ploidy status and cell cycle data (SPF, CV, S + G2/M, DI). The S phase fraction (SPF) and S + G2/M had close relationship with the grade of NHL. SPF value and DNA ploidy status had no obvious relationship with the prognosis. The results suggested that the FCM had diagnostic value in NHL, especially when the morphological diagnosis was difficult. Although the cell cycle data had no prognostic value, SPF and SPF + G2/M can show the proliferative status of NHL, which can help clinical doctor select therapeutic method.
Kagawa, Yoshinori; Matsumoto, Shinji; Kamioka, Yuji; Mimori, Koshi; Naito, Yoko; Ishii, Taeko; Okuzaki, Daisuke; Nishida, Naohiro; Maeda, Sakae; Naito, Atsushi; Kikuta, Junichi; Nishikawa, Keizo; Nishimura, Junichi; Haraguchi, Naotsugu; Takemasa, Ichiro; Mizushima, Tsunekazu; Ikeda, Masataka; Yamamoto, Hirofumi; Sekimoto, Mitsugu; Ishii, Hideshi; Doki, Yuichiro; Matsuda, Michiyuki; Kikuchi, Akira; Mori, Masaki; Ishii, Masaru
2013-01-01
The mechanism behind the spatiotemporal control of cancer cell dynamics and its possible association with cell proliferation has not been well established. By exploiting the intravital imaging technique, we found that cancer cell motility and invasive properties were closely associated with the cell cycle. In vivo inoculation of human colon cancer cells bearing fluorescence ubiquitination-based cell cycle indicator (Fucci) demonstrated an unexpected phenomenon: S/G2/M cells were more motile and invasive than G1 cells. Microarray analyses showed that Arhgap11a, an uncharacterized Rho GTPase-activating protein (RhoGAP), was expressed in a cell-cycle-dependent fashion. Expression of ARHGAP11A in cancer cells suppressed RhoA-dependent mechanisms, such as stress fiber formation and focal adhesion, which made the cells more prone to migrate. We also demonstrated that RhoA suppression by ARHGAP11A induced augmentation of relative Rac1 activity, leading to an increase in the invasive properties. RNAi-based inhibition of Arhgap11a reduced the invasion and in vivo expansion of cancers. Additionally, analysis of human specimens showed the significant up-regulation of Arhgap11a in colon cancers, which was correlated with clinical invasion status. The present study suggests that ARHGAP11A, a cell cycle-dependent RhoGAP, is a critical regulator of cancer cell mobility and is thus a promising therapeutic target in invasive cancers.
Kagawa, Yoshinori; Matsumoto, Shinji; Kamioka, Yuji; Mimori, Koshi; Naito, Yoko; Ishii, Taeko; Okuzaki, Daisuke; Nishida, Naohiro; Maeda, Sakae; Naito, Atsushi; Kikuta, Junichi; Nishikawa, Keizo; Nishimura, Junichi; Haraguchi, Naotsugu; Takemasa, Ichiro; Mizushima, Tsunekazu; Ikeda, Masataka; Yamamoto, Hirofumi; Sekimoto, Mitsugu; Ishii, Hideshi; Doki, Yuichiro; Matsuda, Michiyuki; Kikuchi, Akira; Mori, Masaki; Ishii, Masaru
2013-01-01
The mechanism behind the spatiotemporal control of cancer cell dynamics and its possible association with cell proliferation has not been well established. By exploiting the intravital imaging technique, we found that cancer cell motility and invasive properties were closely associated with the cell cycle. In vivo inoculation of human colon cancer cells bearing fluorescence ubiquitination-based cell cycle indicator (Fucci) demonstrated an unexpected phenomenon: S/G2/M cells were more motile and invasive than G1 cells. Microarray analyses showed that Arhgap11a, an uncharacterized Rho GTPase-activating protein (RhoGAP), was expressed in a cell-cycle-dependent fashion. Expression of ARHGAP11A in cancer cells suppressed RhoA-dependent mechanisms, such as stress fiber formation and focal adhesion, which made the cells more prone to migrate. We also demonstrated that RhoA suppression by ARHGAP11A induced augmentation of relative Rac1 activity, leading to an increase in the invasive properties. RNAi-based inhibition of Arhgap11a reduced the invasion and in vivo expansion of cancers. Additionally, analysis of human specimens showed the significant up-regulation of Arhgap11a in colon cancers, which was correlated with clinical invasion status. The present study suggests that ARHGAP11A, a cell cycle-dependent RhoGAP, is a critical regulator of cancer cell mobility and is thus a promising therapeutic target in invasive cancers. PMID:24386239
TP53 status and response to chemotherapy in breast cancer.
Bertheau, Philippe; Espié, Marc; Turpin, Elisabeth; Lehmann, Jacqueline; Plassa, Louis-François; Varna, Mariana; Janin, Anne; de Thé, Hugues
2008-01-01
Despite its central role in the control of apoptosis, senescence and cell cycle arrest, the tumor suppressor protein p53 remains an enigma for its possible role in predicting response to chemotherapy in cancer patients. Many studies remained inconclusive, others showed a better response for tumors with normal p53, and some recent studies showed adverse effects of normal p53 for response to treatment. p53 is not only a powerful pro-apoptotic factor in response to drug-induced DNA damages but also a potential inducer of cell cycle arrest, protecting tumor cells from further cytotoxic damages. Our review describes the classical as well as the more recent concepts. In order to draw definite conclusions, future works should use more reliable methods to assess the TP53 status and should address more homogeneous tumor subpopulations treated with homogeneous chemotherapy regimens. Copyright 2008 S. Karger AG, Basel.
Corneau, Aurélien; Cosma, Antonio; Even, Sophie; Katlama, Christine; Le Grand, Roger; Frachet, Véronique; Blanc, Catherine; Autran, Brigitte
2017-01-01
Mass cytometry allows large multiplex analysis of cell cycle stages together with differentiation, activation, and exhaustion markers, allowing further assessment of the quiescence status of resting CD4 T cells. Peripheral blood CD4 T lymphocytes from 8 individuals, 4 healthy donors, and 4 HIV-infected on antiretroviral treatment (T) were stained with the same 26 monoclonal antibodies and dyes targeting surface and intracellular markers of differentiation, activation, exhaustion, and cell cycle stages. Samples were run on a CYTOF-2. Patterns of naïve [TN] CD4 T cells strongly differed from all other memory subsets central-memory (CM), transitional-memory (TM), effector-memory (EM), and terminally differentiated RA-expressing (TEMRA) subsets, while stem-cell memory (SCM) and T follicular-helper cells (TfH) were close to CM and TM cells with the highest percentages in cell cycle. EM and TEMRA were the most altered by HIV infection, with an increased frequency of activated and cycling cells. Activation markers and coinhibitory receptor expression differed among cell cycle stages, with HLA-DR fitting better than CD25 or CD38 with cycle, and opposite PD-1 gradients along differentiation and cell cycle. "Resting" DR-CD25- CD4+ T cells contained similar amounts of cells in G1 than the activated DR ± CD25± ones but three fold lower cells in S-G2-M. This broad multiplex mass cytometry analysis demonstrates some subsets of the so-called "resting" CD25-DR- CD4+ T cells contain noticeable amounts of cells into cycle or expressing coinhibitory receptors, opening new avenues for a redefinition of resting peripheral blood CD4 T cells harboring the HIV reservoirs. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.
Hassani, Saeed; Khaleghian, Ali; Ahmadian, Shahin; Alizadeh, Shaban; Alimoghaddam, Kamran; Ghavamzadeh, Ardeshir; Ghaffari, Seyed H
2018-01-01
PML-RARα perturbs the normal epigenetic setting, which is essential to oncogenic transformation in acute promyelocytic leukemia (APL). Transcription induction and recruitment of DNA methyltransferases (DNMTs) by PML-RARα and subsequent hypermethylation are components of this perturbation. Arsenic trioxide (ATO), an important drug in APL therapy, concurrent with degradation of PML-RARα induces cell cycle change and apoptosis. How ATO causes cell cycle alteration has remained largely unexplained. Here, we investigated DNA methylation patterns of cell cycle regulatory genes promoters, the effects of ATO on the methylated genes and cell cycle distribution in an APL cell line, NB4. Analysis of promoter methylation status of 22 cell cycle related genes in NB4 revealed that CCND1, CCNE1, CCNF, CDKN1A, GADD45α, and RBL1 genes were methylated 60.7, 84.6, 58.6, 8.7, 33.4, and 73.7%, respectively, that after treatment with 2 μM ATO for 48 h, turn into 0.6, 13.8, 0.1, 6.6, 10.7, and 54.5% methylated. ATO significantly reduced the expression of DNMT1, 3A, and 3B. ATO induced the expression of CCND1, CCNE1, and GADD45α genes, suppressed the expression of CCNF and CDKN1A genes, which were consistent with decreased number of cells in G1 and S phases and increased number of cells in G2/M phase. In conclusion, demethylation and alteration in the expression level of the cell cycle related genes may be possible mechanisms in ATO-induced cell cycle arrest in APL cells. It may suggest that ATO by demethylation of CCND1 and CCNE1 and their transcriptional activation accelerates G1 and S transition into the G2/M cell cycle arrest.
Mort, Richard Lester; Ford, Matthew Jonathan; Sakaue-Sawano, Asako; Lindstrom, Nils Olof; Casadio, Angela; Douglas, Adam Thomas; Keighren, Margaret Anne; Hohenstein, Peter; Miyawaki, Atsushi; Jackson, Ian James
2014-01-01
Markers of cell cycle stage allow estimation of cell cycle dynamics in cell culture and during embryonic development. The Fucci system incorporates genetically encoded probes that highlight G1 and S/G2/M phases of the cell cycle allowing live imaging. However the available mouse models that incorporate Fucci are beset by problems with transgene inactivation, varying expression level, lack of conditional potential and/or the need to maintain separate transgenes-there is no transgenic mouse model that solves all these problems. To address these shortfalls we re-engineered the Fucci system to create 2 bicistronic Fucci variants incorporating both probes fused using the Thosea asigna virus 2A (T2A) self cleaving peptide. We characterize these variants in stable 3T3 cell lines. One of the variants (termed Fucci2a) faithfully recapitulated the nuclear localization and cell cycle stage specific florescence of the original Fucci system. We go on to develop a conditional mouse allele (R26Fucci2aR) carefully designed for high, inducible, ubiquitous expression allowing investigation of cell cycle status in single cell lineages within the developing embryo. We demonstrate the utility of R26Fucci2aR for live imaging by using high resolution confocal microscopy of ex vivo lung, kidney and neural crest development. Using our 3T3 system we describe and validate a method to estimate cell cycle times from relatively short time-lapse sequences that we then apply to our neural crest data. The Fucci2a system and the R26Fucci2aR mouse model are compelling new tools for the investigation of cell cycle dynamics in cell culture and during mouse embryonic development.
Guan, Y; Hogge, D E
2000-12-01
One possible explanation for the competitive advantage that malignant cells in patients with acute myelogenous leukemia (AML) appear to have over normal hematopoietic elements is that leukemic progenitors proliferate more rapidly than their normal progenitor cell counterparts. To test this hypothesis, an overnight 3H-thymidine (3H-Tdr) suicide assay was used to analyze the proliferative status of malignant progenitors detected in both colony-forming cell (CFC) and long-term culture initiating cell (LTC-IC) assays from the peripheral blood of nine patients with newly diagnosed AML. Culture of AML cells in serum-free medium with 100 ng/ml Steel factor (SF), 20 ng/ml interleukin 3 (IL-3) and 20 ng/ml granulocyte colony-stimulating factor (G-CSF) for 16-24 h maintained the number of AML-CFC and LTC-IC at near input values (mean % input +/- s.d. for CFC and LTC-IC were 78 +/- 33 and 126 +/- 53, respectively). The addition of 20 muCi/ml high specific activity 3H-Tdr to these cultures reduced the numbers of both progenitor cell types from most of the patient samples substantially: mean % kill +/- s.d. for AML-CFC and LTC-IC were 64 +/- 27 and 82 +/- 16, respectively, indicating that a large proportion of both progenitor populations were actively cycling. FISH analysis of colonies from CFC and LTC-IC assays confirmed that most cytogenetically abnormal CFC and LTC-IC were actively cycling (mean % kill +/- s.d.: 68 +/- 26 and 85 +/- 13, respectively). Interestingly, in six patient samples where a significant number of cytogenetically normal LTC-ICs were detected, the % kill of these cells (74 +/- 20) was similar to that of the abnormal progenitors. These data contrast with the predominantly quiescent cell cycle status of CFC and LTC-IC previously observed in steady-state peripheral blood from normal individuals but also provide evidence that a significant proportion of primitive malignant progenitors from AML patients are quiescent and therefore may be resistant to standard chemotherapeutic regimens.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aggarwal, Pooja; Padmanabhan, Bhavna; Bhat, Abhay
2011-07-01
Highlights: {yields} TCP4 is a class II TCP transcription factor, that represses cell division in Arabidopsis. {yields} TCP4 expression in yeast retards cell division by blocking G1 {yields} S transition. {yields} Genome-wide expression studies and Western analysis reveals stabilization of cell cycle inhibitor Sic1, as possible mechanism. -- Abstract: The TCP transcription factors control important aspects of plant development. Members of class I TCP proteins promote cell cycle by regulating genes directly involved in cell proliferation. In contrast, members of class II TCP proteins repress cell division. While it has been postulated that class II proteins induce differentiation signal, theirmore » exact role on cell cycle has not been studied. Here, we report that TCP4, a class II TCP protein from Arabidopsis that repress cell proliferation in developing leaves, inhibits cell division by blocking G1 {yields} S transition in budding yeast. Cells expressing TCP4 protein with increased transcriptional activity fail to progress beyond G1 phase. By analyzing global transcriptional status of these cells, we show that expression of a number of cell cycle genes is altered. The possible mechanism of G1 {yields} S arrest is discussed.« less
Argonne National Laboratory Li-alloy/FeS cell testing and R and D programs
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gay, E.C.
1982-01-01
Groups of 12 or more identical Li-alloy/FeS cells fabricated by Eagle-Picher Industries, Inc. and Gould Inc. were operated at Argonne National Laboratory (ANL) in the status cell test program to obtain data for statistical analysis of cell cycle life and failure modes. The cells were full-size electric vehicle battery cells (150 to 350 Ah capacity) and they were cycled at the 4-h discharge rate and 8-h charge rate. The end of life was defined as a 20% loss of capacity or a decrease in the coulombic efficiency to less than 95%. Seventy-four cells (six groups of identical cells) were cycle-lifemore » tested and the results were analyzed statistically. The ultimate goal of this analysis was to predict cell and battery reliability. Testing of groups of identical cells also provided a means of identifying common failure modes which were eliminated by cell design changes. Mean time to failure (MTTF) for the cells based on the Weibull distribution is presented.« less
An authentic imaging probe to track cell fate from beginning to end.
Lee, Seung Koo; Mortensen, Luke J; Lin, Charles P; Tung, Ching-Hsuan
2014-10-17
Accurate tracing of cell viability is critical for optimizing delivery methods and evaluating the efficacy and safety of cell therapeutics. A nanoparticle-based cell tracker is developed to image cell fate from live to dead. The particle is fabricated from two types of optically quenched polyelectrolytes, a life indicator and a death indicator, through electrostatic interactions. On incubation with cells, the fabricated bifunctional nanoprobes are taken up efficiently and the first colour is produced by normal intracellular proteolysis, reflecting the healthy status of the cells. Depending on the number of coated layers, the signal can persist for several replication cycles. However, as the cells begin dying, the second colour appears quickly to reflect the new cell status. Using this chameleon-like cell tracker, live cells can be distinguished from apoptotic and necrotic cells instantly and definitively.
Mazar, Joseph; Rosado, Amy; Shelley, John; Marchica, John; Westmoreland, Tamarah J
2017-01-01
The long non-coding RNA GAS5 has been shown to modulate cancer proliferation in numerous human cancer systems and has been correlated with successful patient outcome. Our examination of GAS5 in neuroblastoma has revealed robust expression in both MYCN-amplified and non-amplified cell lines. Knockdown of GAS5 In vitro resulted in defects in cell proliferation, apoptosis, and induced cell cycle arrest. Further analysis of GAS5 clones revealed multiple novel splice variants, two of which inversely modulated with MYCN status. Complementation studies of the variants post-knockdown of GAS5 indicated alternate phenotypes, with one variant (FL) considerably enhancing cell proliferation by rescuing cell cycle arrest and the other (C2) driving apoptosis, suggesting a unique role for each in neuroblastoma cancer physiology. Global sequencing and ELISA arrays revealed that the loss of GAS5 induced p53, BRCA1, and GADD45A, which appeared to modulate cell cycle arrest in concert. Complementation with only the FL GAS5 clone could rescue cell cycle arrest, stabilizing HDM2, and leading to the loss of p53. Together, these data offer novel therapeutic targets in the form of lncRNA splice variants for separate challenges against cancer growth and cell death. PMID:28035057
Prolyl oligopeptidase inhibition-induced growth arrest of human gastric cancer cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Suzuki, Kanayo; Sakaguchi, Minoru, E-mail: sakaguti@gly.oups.ac.jp; Tanaka, Satoshi
2014-01-03
Highlights: •We examined the effects of prolyl oligopeptidase (POP) inhibition on p53 null gastric cancer cell growth. •POP inhibition-induced cell growth suppression was associated with an increase in a quiescent G{sub 0} state. •POP might regulate the exit from and/or reentry into the cell cycle. -- Abstract: Prolyl oligopeptidase (POP) is a serine endopeptidase that hydrolyzes post-proline peptide bonds in peptides that are <30 amino acids in length. We recently reported that POP inhibition suppressed the growth of human neuroblastoma cells. The growth suppression was associated with pronounced G{sub 0}/G{sub 1} cell cycle arrest and increased levels of the CDKmore » inhibitor p27{sup kip1} and the tumor suppressor p53. In this study, we investigated the mechanism of POP inhibition-induced cell growth arrest using a human gastric cancer cell line, KATO III cells, which had a p53 gene deletion. POP specific inhibitors, 3-((4-[2-(E)-styrylphenoxy]butanoyl)-L-4-hydroxyprolyl)-thiazolidine (SUAM-14746) and benzyloxycarbonyl-thioprolyl-thioprolinal, or RNAi-mediated POP knockdown inhibited the growth of KATO III cells irrespective of their p53 status. SUAM-14746-induced growth inhibition was associated with G{sub 0}/G{sub 1} cell cycle phase arrest and increased levels of p27{sup kip1} in the nuclei and the pRb2/p130 protein expression. Moreover, SUAM-14746-mediated cell cycle arrest of KATO III cells was associated with an increase in the quiescent G{sub 0} state, defined by low level staining for the proliferation marker, Ki-67. These results indicate that POP may be a positive regulator of cell cycle progression by regulating the exit from and/or reentry into the cell cycle by KATO III cells.« less
Samuel, Temesgen; Fadlalla, Khalda; Turner, Timothy; Yehualaeshet, Teshome E.
2010-01-01
Quercetin is a flavonoid with anticancer properties. In this study, we examined the effects of quercetin on cell cycle, viability and proliferation of cancer cells, either singly or in combination with the microtubule-targeting drugs taxol and nocodazole. Although quercetin induced cell death in a dose dependent manner, 12.5-50μM quercetin inhibited the activity of both taxol and nocodazole to induce G2/M arrest in various cell lines. Quercetin also partially restored drug-induced loss in viability of treated cells for up to 72 hours. This antagonism of microtubule-targeting drugs was accompanied by a delay in cell cycle progression and inhibition of the buildup of cyclin-B1 at the microtubule organizing center of treated cells. However, quercetin did not inhibit the microtubule targeting of taxol or nocodazole. Despite the short-term protection of cells by quercetin, colony formation and clonogenicity of HCT116 cells were still suppressed by quercetin or quercetin-taxol combination. The status of cell adherence to growth matrix was critical in determining the sensitivity of HCT116 cells to quercetin. We conclude that while long-term exposure of cancer cells to quercetin may prevent cell proliferation and survival, the interference of quercetin with cell cycle progression diminishes the efficacy of microtubule-targeting drugs to arrest cells at G2/M. PMID:21058190
Vijayarathna, Soundararajan; Oon, Chern Ein; Chen, Yeng; Kanwar, Jagat R; Sasidharan, Sreenivasan
2017-05-01
Medicinal plants have been accepted as a gold mine, with respect to the diversity of their phytochemicals. Many medicinal plants extracts are potential anticancer agents. Polyalthia longifolia var. angustifolia Thw. (Annonaceae) is one of the most significant native medicinal plants and is found throughout Malaysia. Hence, the present study was intended to assess the anticancer properties of P. longifolia leaf methanolic extract (PLME) and its underlying mechanisms. The Annexin V/PI flow cytometry analysis showed that PLME induces apoptosis in HeLa cells in dose-dependent manner whereas the PI flow cytometric analysis for cell cycle demonstrated the accumulation of cells at sub G0/G1, G0/G1 and G2/M phases. Investigation with JC-1 flow cytometry analysis indicated increase in mitochondria membrane potential depolarisation corresponding to increase in PLME concentrations. PLME was also shown to influence intracellular reactive oxygen species (ROS) by exerting anti-oxidant (half IC 50 ) and pro-oxidant (IC 50 and double IC 50 ) affect against HeLa cells. PLME treatment also displayed DNA damage in HeLa cells in concentration depended fashion. The proteomic profiling array exposed the expression of pro-apoptotic and anti-apoptotic proteins upon PLME treatment at IC 50 concentration in HeLa cells. Pro-apoptotic proteins; BAX, BAD, cytochrome c, caspase-3, p21, p27 and p53 were found to be significantly up-regulated while anti-apoptotic proteins; BCL-2 and BCL-w were found to be significantly down-regulated. This investigation postulated the role of p53 into mediating apoptosis, cell cycle arrest and mitochondrial potential depolarisation by modulating the redox status of HeLa cells. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
NASA Technical Reports Server (NTRS)
Darcy, Eric; Strangways, Brad
2003-01-01
Contents include the following: 1. Introduction: What is the (Floating Potential Probe) FPP? Why was NiMH battery selected? Haw well would crimped seal cell performed in long term vacuum exposure? 2. Verification tests: Battery description. Test methods. Results. Main findings. FPP status.
[Effects of ezrin silencing on pancreatic cancer cell line Panc-1].
Meng, Yun-xiao; Yu, Shuang-ni; Lu, Zhao-hui; Chen, Jie
2012-12-01
To explore the effects of ezrin silencing on pancreatic cancer cell line Panc-1. Pancreatic cancer cell line Panc-1 was transfected with ezrin silencing plasmid. The proliferation and the cell cycle status were determined by CCK-8 assay and flow cytometry analysis, respectively. Cellular membrane protrusions/microvilli formation were visualized by scanning election microscopy. Colony formation assay was used to determine the cell anchor-independent growth ability in vitro. Trans-filter migration and invasion assays were performed with 8 µm pore inserts in a 24-well BioCoat chamber with/without Matrigel. Ezrin silencing decreased cellular protrusions/microvilli formation, anchorage-independent growth, cell migration and invasion, but had no effects on cell proliferation in vitro and cell cycle, in pancreatic cancer cell line Panc-1. Ezrin expression affects the cellular protrusions/microvilli formation, anchorage-independent growth, cell migration and invasion in pancreatic cancer cell line Panc-1.
Luciani, M Gloria; Campregher, Christoph; Fortune, John M; Kunkel, Thomas A; Gasche, Christoph
2007-01-01
Individuals with inflammatory bowel disease are at risk of developing colorectal cancer (CRC). Epidemiologic, animal, and laboratory studies suggest that 5-amino-salicylic acid (5-ASA) protects from the development of CRC by altering cell cycle progression and by inducing apoptosis. Our previous results indicate that 5-ASA improves replication fidelity in colorectal cells, an effect that is active in reducing mutations. In this study, we hypothesized that 5-ASA restrains cell cycle progression by activating checkpoint pathways in colorectal cell lines, which would prevent tumor development and improve genomic stability. CRC cells with different genetic backgrounds such as HT29, HCT116, HCT116(p53-/-), HCT116+chr3, and LoVo were treated with 5-ASA for 2-96 hours. Cell cycle progression, phosphorylation, and DNA binding of cell cycle checkpoint proteins were analyzed. We found that 5-ASA at concentrations between 10 and 40 mmol/L affects cell cycle progression by inducing cells to accumulate in the S phase. This effect was independent of the hMLH1, hMSH2, and p53 status because it was observed to a similar extent in all cell lines under investigation. Moreover, wash-out experiments demonstrated reversibility within 48 hours. Although p53 did not have a causative role, p53 Ser15 was strongly phosphorylated. Proteins involved in the ATM-and-Rad3-related kinase (ATR)-dependent S-phase checkpoint response (Chk1 and Rad17) were also phosphorylated but not ataxia telengectasia mutated kinase. Our data demonstrate that 5-ASA causes cells to reversibly accumulate in S phase and activate an ATR-dependent checkpoint. The activation of replication checkpoint may slow down DNA replication and improve DNA replication fidelity, which increases the maintenance of genomic stability and counteracts carcinogenesis.
Manimaran, Asokan; Buddhan, Rajamanickam; Manoharan, Shanmugam
2017-01-01
Cell-cycle disruption is the major characteristic features of neoplastic transformation and the status of cell-cycle regulators can thus be utilized to assess the prognostic significance in patients with cancer. The PCNA, cyclin D1, CDK4, CDK6 and survivin expression in the buccal mucosa was utilized to evaluate the Emodin efficacy on abnormal cell proliferation during 7,12-dimethylbenz(a)anthracene (DMBA) induced oral carcinogenesis in golden Syrian hamsters. Topical application of DMBA, three times a week for 14 weeks, on the hamsters' buccal pouches developed well differentiated squamous cell carcinoma. Cyclin D1 and PCNA over-expression and up-regulation of CDK4, CDK6 and survivin were noticed in the buccal mucosa of hamsters treated with DMBA alone. Emodin administration (50mg/kg b.w) orally to hamsters treated with DMBA down-regulated the expression of cell proliferation markers in the buccal mucosa. The anti-cell proliferative role of Emodin is owing to its modulating efficacy on cell-cycle markers towards the tumor suppression during DMBA induced oral carcinogenesis.
Fernández, Ignacio; Vijayakumar, Parameswaran; Marques, Carlos; Cancela, M Leonor; Gavaia, Paulo J; Laizé, Vincent
2015-06-01
Vitamin K (VK) acts as a cofactor driving the biological activation of VK-dependent proteins and conferring calcium-binding properties to them. As a result, VK is converted into VK epoxide, which must be recycled by VK epoxide reductases (Vkors) before it can be reused. Although VK has been shown to play a central role in fish development, particularly during skeletogenesis, pathways underlying VK actions are poorly understood, while good and reliable molecular markers for VK cycle/homeostasis are still lacking in fish. In the present work, expression of 2 zebrafish vkor genes was characterized along larval development and in adult tissues through qPCR analysis. Zebrafish cell line ZFB1 was used to evaluate in vitro regulation of vkors and other VK cycle-related genes during mineralization and upon 24 h exposure to 0.16 and 0.8 µM phylloquinone (VK1), 0.032 µM warfarin, or a combination of both molecules. Results showed that zebrafish vkors are differentially expressed during larval development, in adult tissues, and during cell differentiation/mineralization processes. Further, several VK cycle intermediates were differentially expressed in ZFB1 cells exposed to VK1 and/or warfarin. Present work provides data identifying different developmental stages and adult tissues where VK recycling is probably highly required, and shows how genes involved in VK cycle respond to VK nutritional status in skeletal cells. Expression of vkor genes can represent a reliable indicator to infer VK nutritional status in fish, while ZFB1 cells could represent a suitable in vitro tool to get insights into the mechanisms underlying VK action on fish bone.
Lithium-Ion Battery Program Status
NASA Technical Reports Server (NTRS)
Surampudi, S.; Huang, C. K.; Smart, M.; Davies, E.; Perrone, D.; Distefano, S.; Halpert, G.
1996-01-01
The objective of this program is to develop rechargeable Li-ion cells for future NASA missions. Applications that would benefit from this project are: new millenium spacecraft; rovers; landers; astronaut equipment; and planetary orbiters. The approach of this program is: select electrode materials and electrolytes; identify failure modes and mechanisms and enhance cycle life; demonstrate Li-ion cell technology with liquid electrolyte; select candidate polymer electrolytes for Li-ion polymer cells; and develop Li-ion polymer cell technology.
SAFT nickel-cadmium cell performances for GEO and LEO applications
NASA Technical Reports Server (NTRS)
Puig, Olivier
1991-01-01
The following topics are covered in viewgraph format: test matrix and cycling status; test results at 30 percent depth of discharge (DOD); test results at 40 percent DOD; capacity evolution; and dissipated power evolution.
Lu, Yan; Liu, Pengyuan; Van den Bergh, Francoise; Zellmer, Victoria; James, Michael; Wen, Weidong; Grubbs, Clinton J; Lubet, Ronald A; You, Ming
2012-02-01
The epidermal growth factor receptor inhibitor Iressa has shown strong preventive efficacy in the N-butyl-N-(4-hydroxybutyl)-nitrosamine (OH-BBN) model of bladder cancer in the rat. To explore its antitumor mechanism, we implemented a systems biology approach to characterize gene expression and signaling pathways in rat urinary bladder cancers treated with Iressa. Eleven bladder tumors from control rats, seven tumors from rats treated with Iressa, and seven normal bladder epithelia were profiled by the Affymetrix Rat Exon 1.0 ST Arrays. We identified 713 downregulated and 641 upregulated genes in comparing bladder tumors versus normal bladder epithelia. In addition, 178 genes were downregulated and 96 genes were upregulated when comparing control tumors versus Iressa-treated tumors. Two coexpression modules that were significantly correlated with tumor status and treatment status were identified [r = 0.70, P = 2.80 × 10(-15) (bladder tumor vs. normal bladder epithelium) and r = 0.63, P = 2.00 × 10(-42) (Iressa-treated tumor vs. control tumor), respectively]. Both tumor module and treatment module were enriched for genes involved in cell-cycle processes. Twenty-four and twenty-one highly connected hub genes likely to be key drivers in cell cycle were identified in the tumor module and treatment module, respectively. Analysis of microRNA genes on the array chips showed that tumor module and treatment module were significantly associated with expression levels of let-7c (r = 0.54, P = 3.70 × 10(-8) and r = 0.73, P = 1.50 × 10(-65), respectively). These results suggest that let-7c downregulation and its regulated cell-cycle pathway may play an integral role in governing bladder tumor suppression or collaborative oncogenesis and that Iressa exhibits its preventive efficacy on bladder tumorigenesis by upregulating let-7 and inhibiting the cell cycle. Cell culture study confirmed that the increased expression of let-7c decreases Iressa-treated bladder tumor cell growth. The identified hub genes may also serve as pharmacodynamic or efficacy biomarkers in clinical trials of chemoprevention in human bladder cancer. ©2011 AACR.
Cycle life status of SAFT VOS nickel-cadmium cells
NASA Technical Reports Server (NTRS)
Goualard, Jacques
1993-01-01
The SAFT prismatic VOS Ni-Cd cells have been flown in geosynchronous orbit since 1977 and in low earth orbit since 1983. Parallel cycling tests are performed by several space agencies in order to determine the cycle life for a wide range of temperature and depth of discharge (DOD). In low Earth orbit (LEO), the ELAN program is conducted on 24 Ah cells by CNES and ESA at the European Battery Test Center at temperatures ranging from 0 to 27 C and DOD from 10 to 40 percent. Data are presented up to 37,000 cycles. One pack (X-80) has achieved 49,000 cycles at 10 C and 23 percent DOD. The geosynchronous orbit simulation of a high DOD test is conducted by ESA on 3 batteries at 10 C and 70, 90, and 100 percent DOD. Thirty-one eclipse seasons are completed, and no signs of degradation have been found. The Air Force test at CRANE on 24 Ah and 40 Ah cells at 20 C and 80 percent DOD has achieved 19 shadow periods. Life expectancy is discussed. The VOS cell technology could be used for the following: (1) in geosynchronous conditions--15 yrs at 10-15 C and 80 percent DOD; and (2) in low earth orbit--10 yrs at 5-15 C and 25-30 percent DOD.
Signal relay during the life cycle of Dictyostelium.
Mahadeo, Dana C; Parent, Carole A
2006-01-01
A fundamental property of multicellular organisms is signal relay, the process by which information is transmitted from one cell to another. The integration of external information, such as nutritional status or developmental cues, is critical to the function of organisms. In addition, the spatial organizations of multicellular organisms require intricate signal relay mechanisms. Signal relay is remarkably exhibited during the life cycle of the social amoebae Dictyostelium discoideum, a eukaryote that retains a simple way of life, yet it has greatly contributed to our knowledge of the mechanisms cells use to communicate and integrate information. This chapter focuses on the molecules and mechanisms that Dictyostelium employs during its life cycle to relay temporal and spatial cues that are required for survival.
Ambient temperature secondary lithium cells containing inorganic electrolyte
NASA Astrophysics Data System (ADS)
Schlaikjer, Carl R.
The history and current status of rechargeable lithium cells using electrolytes based on liquid sulfur dioxide are reviewed. Three separate approaches currently under development include lithium/lithium dithionite/carbon cells with a supporting electrolyte salt; lithium/cupric chloride cells using sulfur dioxide/lithium tetrachloroaluminate; and several adaptations of a lithium/carbon cell using sulfur dioxide/lithium tetrachloroaluminate in which the discharge reaction involves the incorporation of aluminum into the positive electrode. The latter two chemistries have been studied in prototype hardware. For AA size cells with cupric chloride, 157 Whr/1 at 24 W/1 for 230 cycles was reported. For AA size cells containing 2LiCl-CaCl2-4AlCl3-12SO2, energy densities as high as 265 Whr/liter and 100 Whr/kg have been observed, but, at 26 W/1, for only 10 cycles. The advantages and remaining problems are discussed.
ZHU, JIE; CHEN, MEIJUAN; CHEN, NING; MA, AIZHEN; ZHU, CHUNYAN; ZHAO, RUOLIN; JIANG, MIAO; ZHOU, JING; YE, LIHONG; FU, HAIAN; ZHANG, XU
2015-01-01
Glycyrrhetinic acid (GA) is a natural compound extracted from liquorice, which is often used in traditional Chinese medicine. The purpose of the present study was to investigate the antitumor effect of GA in human non-small cell lung cancer (NSCLC), and its underlying mechanisms in vitro. We have shown that GA suppressed the proliferation of A549 and NCI-H460 cells. Flow cytometric analysis showed that GA arrested cell cycle in G0/G1 phase without inducing apoptosis. Western blot analysis indicated that GA mediated G1-phase cell cycle arrest by upregulation of cyclin-dependent kinase inhibitors (CKIs) (p18, p16, p27 and p21) and inhibition of cyclins (cyclin-D1, -D3 and -E) and cyclin-dependent kinases (CDKs) (CDK4, 6 and 2). GA also maintained pRb phosphorylation status, and inhibited E2F transcription factor 1 (E2F-1) in both cell lines. GA upregulated the unfolded proteins, Bip, PERK and ERP72. Accumulation of unfolded proteins in the endoplasmic reticulum (ER) triggered the unfolded protein response (UPR), which could be the mechanism by which GA inhibited cell proliferation in NSCLC cells. GA then coordinated the induction of ER chaperones, which decreased protein synthesis and induced cell cycle arrest in the G1 phase. This study provides experimental evidence to support the development of GA as a chemotherapeutic agent for NSCLC. PMID:25573651
Xin, Xiu; Wang, Hailong; Han, Lingling; Wang, Mingzhen; Fang, Hui; Hao, Yao; Li, Jiadai; Zhang, Hu; Zheng, Congyi; Shen, Chao
2018-05-01
Viral infection and replication are affected by host cell heterogeneity, but the mechanisms underlying the effects remain unclear. Using single-cell analysis, we investigated the effects of host cell heterogeneity, including cell size, inclusion, and cell cycle, on foot-and-mouth disease virus (FMDV) infection (acute and persistent infections) and replication. We detected various viral genome replication levels in FMDV-infected cells. Large cells and cells with a high number of inclusions generated more viral RNA copies and viral protein and a higher proportion of infectious cells than other cells. Additionally, we found that the viral titer was 10- to 100-fold higher in cells in G 2 /M than those in other cell cycle phases and identified a strong correlation between cell size, inclusion, and cell cycle heterogeneity, which all affected the infection and replication of FMDV. Furthermore, we demonstrated that host cell heterogeneity influenced the adsorption of FMDV due to differences in the levels of FMDV integrin receptors expression. Collectively, these results further our understanding of the evolution of a virus in a single host cell. IMPORTANCE It is important to understand how host cell heterogeneity affects viral infection and replication. Using single-cell analysis, we found that viral genome replication levels exhibited dramatic variability in foot-and-mouth disease virus (FMDV)-infected cells. We also found a strong correlation between heterogeneity in cell size, inclusion number, and cell cycle status and that all of these characteristics affect the infection and replication of FMDV. Moreover, we found that host cell heterogeneity influenced the viral adsorption as differences in the levels of FMDV integrin receptors' expression. This study provided new ideas for the studies of correlation between FMDV infection mechanisms and host cells. Copyright © 2018 American Society for Microbiology.
LUCIANI, M. GLORIA; CAMPREGHER, CHRISTOPH; FORTUNE, JOHN M.; KUNKEL, THOMAS A.; GASCHE, CHRISTOPH
2007-01-01
Background & Aims Individuals with inflammatory bowel disease are at risk of developing colorectal cancer (CRC). Epidemiologic, animal, and laboratory studies suggest that 5-amino-salicylic acid (5-ASA) protects from the development of CRC by altering cell cycle progression and by inducing apoptosis. Our previous results indicate that 5-ASA improves replication fidelity in colorectal cells, an effect that is active in reducing mutations. In this study, we hypothesized that 5-ASA restrains cell cycle progression by activating checkpoint pathways in colorectal cell lines, which would prevent tumor development and improve genomic stability. Methods CRC cells with different genetic backgrounds such as HT29, HCT116, HCT116p53−/−, HCT116+chr3, and LoVo were treated with 5-ASA for 2–96 hours. Cell cycle progression, phosphorylation, and DNA binding of cell cycle checkpoint proteins were analyzed. Results We found that 5-ASA at concentrations between 10 and 40 mmol/L affects cell cycle progression by inducing cells to accumulate in the S phase. This effect was independent of the hMLH1, hMSH2, and p53 status because it was observed to a similar extent in all cell lines under investigation. Moreover, wash-out experiments demonstrated reversibility within 48 hours. Although p53 did not have a causative role, p53 Ser15 was strongly phosphorylated. Proteins involved in the ATM-and-Rad3-related kinase (ATR)-dependent S-phase checkpoint response (Chk1 and Rad17) were also phosphorylated but not ataxia telengectasia mutated kinase. Conclusions Our data demonstrate that 5-ASA causes cells to reversibly accumulate in S phase and activate an ATR-dependent checkpoint. The activation of replication checkpoint may slow down DNA replication and improve DNA replication fidelity, which increases the maintenance of genomic stability and counteracts carcinogenesis. PMID:17241873
Prevention of Human Mammary Carcinogenesis.
1996-07-01
eicosapentaenoic acid (EPA), indole-3-carbinol (13C), 0-carotene (P3-C), (-) epigallocatechin gallate ( EGCG ) and genistein (GEN) effectively down...Alteration in Cell Cycle Progression of 184-B5/HER Cells by (-) Epigallocatechin Gallate ( EGCG ) status % distribution of cellsb, c- ac Sof treatm enta... epigallocatechin gallate ( EGCG ,a green tea polyphenol), indole-3-carbinol (13C,a plant indole) and genistein (GEN,a soy isoflavone) showed differential
Polyoma small T antigen triggers cell death via mitotic catastrophe
Fernando, Arun T Pores; Andrabi, Shaida; Cizmecioglu, Onur; Zhu, Cailei; Livingston, David M.; Higgins, Jonathan M.G; Schaffhausen, Brian S; Roberts, Thomas M
2014-01-01
Polyoma small T antigen (PyST), an early gene product of the polyoma virus, has been shown to cause cell death in a number of mammalian cells in a protein phosphatase 2A (PP2A)-dependent manner. In the current study, using a cell line featuring regulated expression of PyST, we found that PyST arrests cells in mitosis. Live-cell and immunofluorescence studies showed that the majority of the PyST-expressing cells were arrested in prometaphase with almost no cells progressing beyond metaphase. These cells exhibited defects in chromosomal congression, sister chromatid cohesion and spindle positioning, resulting in the activation of the Spindle Assembly Checkpoint (SAC). Prolonged mitotic arrest then led to cell death via mitotic catastrophe. Cell cycle inhibitors that block cells in G1/S prevented PyST-induced death. PyST-induced cell death that occurs during M is not dependent on p53 status. These data suggested, and our results confirmed that, PP2A inhibition could be used to preferentially kill cancer cells with p53 mutations that proliferate normally in the presence of cell cycle inhibitors. PMID:24998850
Schramm, Amelie; Schochter, Fabienne; Friedl, Thomas W P; de Gregorio, Nikolaus; Andergassen, Ulrich; Alunni-Fabbroni, Marianna; Trapp, Elisabeth; Jaeger, Bernadette; Heinrich, Georg; Camara, Oumar; Decker, Thomas; Ober, Angelika; Mahner, Sven; Fehm, Tanja N; Pantel, Klaus; Fasching, Peter A; Schneeweiss, Andreas; Janni, Wolfgang; Rack, Brigitte K
2017-07-01
Use of anthracycline-based chemotherapy in patients with early breast cancer (EBC) has been well-established but is often associated with cardiotoxicity. Based on data suggesting a limited benefit of anthracyclines in human epidermal growth factor receptor 2 (HER2)-negative patients, the Simultaneous Study of Docetaxel Based Anthracycline Free Adjuvant Treatment Evaluation, as well as Life Style Intervention Strategies (SUCCESS) C study randomized patients to either anthracycline-containing or anthracycline-free chemotherapy. Given the proven prognostic value of circulating tumor cells (CTCs) in EBC, we compared the prevalence of CTCs after chemotherapy between both treatment arms for a preliminary efficacy assessment. The SUCCESS C trial (NCT00847444) is an open-label, phase III study randomizing 3547 patients with HER2-negative EBC to either 3 cycles of epirubicin, 5-fluorouracil, and cyclophosphamide followed by 3 cycles of docetaxel (FEC-DOC) or 6 cycles of docetaxel and cyclophosphamide (DOC-C). CTC status was prospectively evaluated in hormone receptor-positive patients at the time of last chemotherapy cycle using the US Food and Drug Administration-approved CellSearch System (Janssen Diagnostics). Data on CTC status were available for 1766 patients. Overall, CTCs were found in 221 (12.5%) patients. Univariate analyses revealed that presence of CTCs at time of last chemotherapy cycle was not significantly associated with tumor or patient characteristics (all P > .1). There was no significant difference with respect to presence of CTCs between patients randomized to FEC-DOC or DOC-C (11.5% vs. 13.6%; P = .18). The comparable prevalence of CTCs at the time of last chemotherapy cycle may indicate that anthracycline-free chemotherapy is equally effective to anthracycline-containing chemotherapy in HER2-negative, hormone receptor-positive EBC. However, efficacy data from the final survival analysis of SUCCESS C have to be awaited to confirm these preliminary findings. Copyright © 2017 Elsevier Inc. All rights reserved.
Plett, P Artur; Abonour, Rafat; Frankovitz, Stacy M; Orschell, Christie M
2004-08-01
Migration, proliferation, and differentiation of bone marrow (BM) hematopoietic stem cells (HSC) are important factors in maintaining hematopoietic homeostasis. Homeostatic control of erythrocytes and lymphocytes is perturbed in humans exposed to microgravity (micro-g), resulting in space flight-induced anemia and immunosuppression. We sought to determine whether any of these anomalies can be explained by micro-g-induced changes in migration, proliferation, and differentiation of human BM CD34+ cells, and whether such changes can begin to explain any of the shifts in hematopoietic homeostasis observed in astronauts. BM CD34+ cells were cultured in modeled micro-g (mmicro-g) using NASA's rotating wall vessels (RWV), or in control cultures at earth gravity for 2 to 18 days. Cells were harvested at different times and CD34+ cells assessed for migration potential, cell-cycle kinetics and regulatory proteins, and maturation status. Culture of BM CD34+ cells in RWV for 2 to 3 days resulted in a significant reduction of stromal cell-derived factor 1 (SDF-1alpha)-directed migration, which correlated with decreased expression of F-actin. Modeled micro-g induced alterations in cell-cycle kinetics that were characterized by prolonged S phase and reduced cyclin A expression. Differentiation of primitive CD34+ cells cultured for 14 to 18 days in RWV favored myeloid cell development at the expense of erythroid development, which was significantly reduced compared to controls. These results illustrate that mmicro-g significantly inhibits the migration potential, cell-cycle progression, and differentiation patterns of primitive BM CD34+ cells, which may contribute to some of the hematologic abnormalities observed in humans during space flight.
Ciuffreda, Ludovica; Del Bufalo, Donatella; Desideri, Marianna; Di Sanza, Cristina; Stoppacciaro, Antonella; Ricciardi, Maria Rosaria; Chiaretti, Sabina; Tavolaro, Simona; Benassi, Barbara; Bellacosa, Alfonso; Foà, Robin; Tafuri, Agostino; Cognetti, Francesco; Anichini, Andrea; Zupi, Gabriella; Milella, Michele
2009-08-01
The Raf/MEK/ERK pathway is an important mediator of tumor cell proliferation and angiogenesis. Here, we investigated the growth-inhibitory and antiangiogenic properties of PD0325901, a novel MEK inhibitor, in human melanoma cells. PD0325901 effects were determined in a panel of melanoma cell lines with different genetic aberrations. PD0325901 markedly inhibited ERK phosphorylation and growth of both BRAF mutant and wild-type melanoma cell lines, with IC(50) in the nanomolar range even in the least responsive models. Growth inhibition was observed both in vitro and in vivo in xenograft models, regardless of BRAF mutation status, and was due to G(1)-phase cell cycle arrest and subsequent induction of apoptosis. Cell cycle (cyclin D1, c-Myc, and p27(KIP1)) and apoptosis (Bcl-2 and survivin) regulators were modulated by PD0325901 at the protein level. Gene expression profiling revealed profound modulation of several genes involved in the negative control of MAPK signaling and melanoma cell differentiation, suggesting alternative, potentially relevant mechanisms of action. Finally, PD0325901 inhibited the production of the proangiogenic factors vascular endothelial growth factor and interleukin 8 at a transcriptional level. In conclusion, PD0325901 exerts potent growth-inhibitory, proapoptotic, and antiangiogenic activity in melanoma lines, regardless of their BRAF mutation status. Deeper understanding of the molecular mechanisms of action of MEK inhibitors will likely translate into more effective treatment strategies for patients experiencing malignant melanoma.
Ciuffreda, Ludovica; Del Bufalo, Donatella; Desideri, Marianna; Di Sanza, Cristina; Stoppacciaro, Antonella; Ricciardi, Maria Rosaria; Chiaretti, Sabina; Tavolaro, Simona; Benassi, Barbara; Bellacosa, Alfonso; Foà, Robin; Tafuri, Agostino; Cognetti, Francesco; Anichini, Andrea; Zupi, Gabriella; Milella, Michele
2009-01-01
The Raf/MEK/ERK pathway is an important mediator of tumor cell proliferation and angiogenesis. Here, we investigated the growth-inhibitory and antiangiogenic properties of PD0325901, a novel MEK inhibitor, in human melanoma cells. PD0325901 effects were determined in a panel of melanoma cell lines with different genetic aberrations. PD0325901 markedly inhibited ERK phosphorylation and growth of both BRAF mutant and wild-type melanoma cell lines, with IC50 in the nanomolar range even in the least responsive models. Growth inhibition was observed both in vitro and in vivo in xenograft models, regardless of BRAF mutation status, and was due to G1-phase cell cycle arrest and subsequent induction of apoptosis. Cell cycle (cyclin D1, c-Myc, and p27KIP1) and apoptosis (Bcl-2 and survivin) regulators were modulated by PD0325901 at the protein level. Gene expression profiling revealed profound modulation of several genes involved in the negative control of MAPK signaling and melanoma cell differentiation, suggesting alternative, potentially relevant mechanisms of action. Finally, PD0325901 inhibited the production of the proangiogenic factors vascular endothelial growth factor and interleukin 8 at a transcriptional level. In conclusion, PD0325901 exerts potent growth-inhibitory, proapoptotic, and antiangiogenic activity in melanoma lines, regardless of their BRAF mutation status. Deeper understanding of the molecular mechanisms of action of MEK inhibitors will likely translate into more effective treatment strategies for patients experiencing malignant melanoma. PMID:19649202
Alabi, Okunola A; Bakare, Adekunle A; Filippin-Monteiro, Fabíola B; Sierra, Jelver A; Creczynski-Pasa, Tânia B
2013-08-01
This study investigated the apoptotic effect of electronic waste on fibroblast cell line. Cells were treated with different concentrations of the leachate for 24h. Cell viability was detected by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) test, nuclear morphology of cells was explored by acridine orange (AO)/ethidium bromide (EB) double staining, mitochondrial membrane potential was evaluated using JC-1 probe while cell cycle analysis was conducted using flow cytometry. The oxidative status was detected using DCFH-DA (dichlorofluorescin diacetate) probe and the relationship between cell death and ROS (reactive oxygen species) was investigated using N-acetylcysteine. Results showed an increased cell death as detected by MTT assay and AO/EB staining. Cell cycle analysis indicated an induction of sub/G1 events while JC-1 probe showed significant disruption of mitochondrial membrane potential. There was significant induction of ROS, while N-acetylcysteine protected the cells from DNA damage. These suggest apoptotic pathway as a possible mechanism of e-waste induced cyto-genotoxicity. Copyright © 2013 Elsevier Inc. All rights reserved.
Xiao, Jian-Ying; Liu, Chao; Sun, Xiao-Han; Yu, Bing-Zhi
2012-02-25
To further test whether protein kinase A (PKA) can affect the mitotic cell cycle, one-cell stage mouse embryos at S phase (22 h after hCG injection) were incubated in M16 medium containing various concentrations of H-89, a PKA inhibitor. With increasing concentrations of H-89 (0-50 μmol/L), the G(2) phase of eggs was decreased and the cleavage rate was accelerated. A concentration of 40 μmol/L H-89 led to all of the mouse eggs entering the M phase of mitosis. Furthermore, to study the role of PKA in regulating the phosphorylation status of S149 and S321 sites of cell division cycle 25B (CDC25B) on one-cell stage fertilized mouse eggs, pBSK-CDC25B-WT, pBSK-CDC25B-S149A, pBSK-CDC25B-S321A and pBSK-CDC25B-S149A/S321A were transcribed into mRNAs in vitro, then mRNAs were microinjected into S phase of mouse fertilized eggs and cultured in M16 medium pretreated with H-89. Then, the cleavage of fertilized eggs, maturation promoting factor (MPF) activity and phosphorylation status of CDC2-Tyr15 were observed. In the presence of 40 μmol/L H-89, the cleavage rate of fertilized eggs in CDC25B-S/A-mRNAs and CDC25B-WT-mRNA injected groups was significantly higher than that in the control groups, and the peak of MPF activity appeared in the CDC25B-S/A-mRNAs and CDC25B-WT-mRNA injected groups earlier than that in the control groups. CDC2-Tyr15 phosphorylation state was consistent with MPF activity. In conclusion, the present study suggests that PKA regulates the early development of mouse embryos by phosphorylation of S149 and S321 of CDC25B, which plays an important role in the regulation of G(2)/M transition in the mitotic cell cycle of fertilized mouse eggs.
Effect of MPS1 Inhibition on Genotoxic Stress Responses in Murine Tumour Cells.
Suzuki, Motofumi; Yamamori, Tohru; Yasui, Hironobu; Inanami, Osamu
2016-06-01
The monopolar spindle 1 (MPS1) is a serine/threonine kinase that plays an important role in spindle assembly checkpoint signaling. To determine the possible relationship between MPS1 inhibition and genotoxic stress responses, herein we examined whether MPS1 inhibition influences cellular susceptibility towards two genotoxic treatments, etoposide and ionizing radiation (IR). Two murine tumour cell lines, SCCVII and EMT6, were used. The effect of genotoxic treatments with or without two novel MPS1 inhibitors, NMS-P715 and AZ3146, on cellular survival, cell-cycle distribution, centrosome status and mitotic catastrophe (MC) was evaluated. MPS1 inhibition sensitized murine tumour cells to etoposide but not to IR. In addition, MPS1 inhibition altered cell-cycle progression and exacerbated centrosome abnormalities, resulting in enhanced MC induced by etoposide but not by IR. MPS1 inhibition promotes the etoposide-induced aberrant mitosis and, consequently, the induction of tumour cell death. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Huang, M-Y; Xuan, F; Liu, W; Cui, H-J
2017-01-19
It is generally known that histone demethylases regulate gene transcription by altering the methylate status on histones, but their roles in cancers and the underlying molecular mechanisms still remain unclear. MYC-induced nuclear antigen (MINA) is reported to be a histone demethylase and highly expressed in many cancers. Here, for the first time, we show that MINA is involved in glioblastoma carcinogenesis and reveal the probable mechanisms of it in cell-cycle control. Kaplan-Meier analysis of progression-free survival showed that high MINA expression was strongly correlated with poor outcome and advancing tumor stage. MINA knockdown significantly repressed the cell proliferation and tumorigenesis abilities of glioblastoma cells in vitro and in vivo that were rescued by overexpressing the full-length MINA afterwards. Microarray analysis after knockdown of MINA revealed that MINA probably regulated glioblastoma carcinogenesis through the predominant cell-cycle pathways. Further investigation showed that MINA deficiency led to a cell-cycle arrest in G1 and G2 phases. And among the downstream genes, we found that cyclins and cyclin-dependent kinases were directly activated by MINA via the demethylation of H3K9me3.
Takamochi, Kazuya; Mogushi, Kaoru; Kawaji, Hideya; Imashimizu, Kota; Fukui, Mariko; Oh, Shiaki; Itoh, Masayoshi; Hayashizaki, Yoshihide; Ko, Weijey; Akeboshi, Masao; Suzuki, Kenji
2017-01-01
18F-fluoro-2-deoxy-glucose (18F-FDG) positron emission tomography (PET) is a functional imaging modality based on glucose metabolism. The correlation between EGFR or KRAS mutation status and the standardized uptake value (SUV) of 18F-FDG PET scanning has not been fully elucidated. Correlations between EGFR or KRAS mutation status and clinicopathological factors including SUVmax were statistically analyzed in 734 surgically resected lung adenocarcinoma patients. Molecular causal relationships between EGFR or KRAS mutation status and glucose metabolism were then elucidated in 62 lung adenocarcinomas using cap analysis of gene expression (CAGE), a method to determine and quantify the transcription initiation activities of mRNA across the genome. EGFR and KRAS mutations were detected in 334 (46%) and 83 (11%) of the 734 lung adenocarcinomas, respectively. The remaining 317 (43%) patients had wild-type tumors for both genes. EGFR mutations were more frequent in tumors with lower SUVmax. In contrast, no relationship was noted between KRAS mutation status and SUVmax. CAGE revealed that 4 genes associated with glucose metabolism (GPI, G6PD, PKM2, and GAPDH) and 5 associated with the cell cycle (ANLN, PTTG1, CIT, KPNA2, and CDC25A) were positively correlated with SUVmax, although expression levels were lower in EGFR-mutated than in wild-type tumors. No similar relationships were noted with KRAS mutations. EGFR-mutated adenocarcinomas are biologically indolent with potentially lower levels of glucose metabolism than wild-type tumors. Several genes associated with glucose metabolism and the cell cycle were specifically down-regulated in EGFR-mutated adenocarcinomas.
Kappa opioid receptors in rat spinal cord vary across the estrous cycle.
Chang, P C; Aicher, S A; Drake, C T
2000-04-07
Kappa opioid receptors (KORs) were immunocytochemically localized in the lumbosacral spinal cord of female rats in different stages of the estrous cycle to examine the influence of hormonal status on receptor density. KOR labeling was primarily in fine processes and a few neuronal cell bodies in the superficial dorsal horn and the dorsolateral funiculus. Quantitative light microscopic densitometry of the superficial dorsal horn revealed that rats in diestrus had significantly lower KOR densities than those in proestrus or estrus. This suggests that female reproductive hormones regulate spinal KOR levels, which may contribute to variations in analgesic effectiveness of KOR agonists across the estrous cycle.
Quan, J; Zhou, L; Qu, J
2015-03-09
Products of the Pim (the proviral integration site for the Moloney murine leukemia virus) family of proto—oncogenes possess serine/threonine kinase activity and belong to the Ca2+/calmodulin—dependent protein kinase group. Pim—3, a member of the Pim family is closely linked to the development of a variety of tumors. However, the role of Pim—3 in human glioblastoma remains unknown. In this study, we elucidated the role of Pim—3 in the growth and apoptosis of glioblastoma cells. Western blotting was used for determination of protein levels, and shRNA was used for Pim—3 knockdown. The MTT assay was used to evaluate cell proliferation and flow cytometry was used to determine cell cycle status and the number of apoptotic cells. A mouse xenograft model was established by injecting nude mice with Pim—3—depleted glioblastoma cells in order to determine tumor growth in vivo. We demonstrated that Pim—3 was highly expressed in human glioblastoma cell lines. We also found that knockdown of Pim—3 by specific shRNA slowed decreased proliferation, induced cell cycle arrest in the G0/G1 phase, and increased apoptosis in glioblastoma cells. Pim—3 knockdown potently inhibited the growth of subcutaneously implanted glioblastoma cells in vivo. We further revealed that Pim—3 knockdown induced growth inhibition by reducing the levels of the anti—apoptotic protein Bcl—xl and cell cycle regulatory proteins, including cyclin D1 and Cdc25C, and increasing the levels of the pro—apoptotic protein Bax.
Davidson, E J; Morris, L S; Scott, I S; Rushbrook, S M; Bird, K; Laskey, R A; Wilson, G E; Kitchener, H C; Coleman, N; Stern, P L
2003-01-27
Vulval intraepithelial neoplasia (VIN) is defined histopathologically by distinctive abnormalities of cellular maturation and differentiation. To investigate the functional properties of VIN, the expression of several proteins involved in the regulation of the cell cycle as well as in situ DNA replication competence was analysed by immunohistochemistry. Snap-frozen vulval biopsies were graded as normal squamous epithelium (n=6), undifferentiated HPV positive VIN 1 (n=3), VIN 2 (n=8) and VIN 3 (n=20). Immunohistochemistry was performed using the following markers: cyclin D1 (expressed in middle/late G1), cyclin B1 (expressed in G2/early M), phosphorylated histone H3 (expressed during mitosis) and minichromosome maintenance (Mcm) proteins 2 and 5 (expressed during the cell cycle, but not in differentiated or quiescent cells). In situ DNA replication competence was used to identify S-phase cells. The percentage of positively stained nuclei in three representative microscopic fields was calculated per biopsy. In normal vulva, the expression of all markers was restricted to the proliferative compartment of the basal layer of the epithelium. In contrast in high-grade VIN, the majority of epithelial cells expressed the Mcm proteins from basal to superficial layer. The detection of cyclins B1 and D1, phospho-histone H3 and in situ DNA replication was also found through the full thickness of these lesions but by a lower proportion of the cells. This is consistent with these markers providing a series of 'snapshots' of the cell cycle status of individual cells. The low-grade VIN showed reduced expression of the cell cycle markers in relation to the level of dysplasia. The combination of these analyses establishes that the majority of VIN cells remain in a functional replicative or prereplicative state of the cell cycle. Clinical application of these analyses may provide a basis for improved diagnosis of VIN.
CD8 apoptosis may be a predictor of T cell number normalization after immune reconstitution in HIV
Lewis, Dorothy E; Gross, Kimber L; Diez, Martine M; Martinez, Maria L; Lukefahr, Helen N; Kozinetz, Claudia A; Arduino, Roberto C
2007-01-01
Background As part of the Houston Vanguard study, a subset of 10 patients randomized to receive IL-2 therapy were compared to 4 patients randomized to not receive IL-2, for markers of T cell activation and death during the first three cycles of IL-2. All patients were treated with combination antiretroviral therapy (ART) and were virally suppressed. The purpose of the study was to examine the role of CD8+ T cell death in responses to ART and IL-2 therapy. Methods Lymphocytes were examined at Day 0, 5 and 30 days during three cycles of IL-2 therapy. CD25, CD38, HLA-DR expression and annexin (cell death) were examined on CD4 and CD8 subpopulations. Follow up studies examined CD4 levels and CD4:CD8 reconstitution after 6 years using both univariant and multivariate analyses. Results Human lymphocytes responded to IL-2 therapy by upregulation of CD25 on CD4+ T cells, leading to an increase in CD4 cell counts. CD8+ T cells did not increase CD25 expression, but upregulated activation antigens (CD38 and DR) and had increased death. At baseline, 7 of the 14 patients had high CD8+ T cell apoptosis (mean 17.0% ± 6.0). We did an exploratory analysis of immune status after six years, and found that baseline CD8+ T cell apoptosis was correlated with CD4 cell count gain beginning two years post enrollment. Patients with low levels of CD8+ T cell apoptosis at baseline (mean 2.2% ± 2.1) had significantly higher CD4 cell counts and more normalized CD4:CD8 ratios than patients with high CD8+ T cell apoptosis (mean CD4 cell counts 1,209 ± 164 vs 754 ± 320 cells/mm3; CD4:CD8 ratios 1.55 vs. 0.70, respectively). Conclusion We postulate that CD8+ T cell apoptosis may reflect inherent activation status, which continues in some patients even though viral replication is suppressed which influences the ability of CD4+ T cells to rebound. Levels of CD8+ T cell apoptosis may therefore be an independent predictor of immune status, which should be shown in a prospective study. PMID:17263884
CD8 apoptosis may be a predictor of T cell number normalization after immune reconstitution in HIV.
Lewis, Dorothy E; Gross, Kimber L; Diez, Martine M; Martinez, Maria L; Lukefahr, Helen N; Kozinetz, Claudia A; Arduino, Roberto C
2007-01-30
As part of the Houston Vanguard study, a subset of 10 patients randomized to receive IL-2 therapy were compared to 4 patients randomized to not receive IL-2, for markers of T cell activation and death during the first three cycles of IL-2. All patients were treated with combination antiretroviral therapy (ART) and were virally suppressed. The purpose of the study was to examine the role of CD8(+) T cell death in responses to ART and IL-2 therapy. Lymphocytes were examined at Day 0, 5 and 30 days during three cycles of IL-2 therapy. CD25, CD38, HLA-DR expression and annexin (cell death) were examined on CD4 and CD8 subpopulations. Follow up studies examined CD4 levels and CD4:CD8 reconstitution after 6 years using both univariant and multivariate analyses. Human lymphocytes responded to IL-2 therapy by upregulation of CD25 on CD4(+) T cells, leading to an increase in CD4 cell counts. CD8(+) T cells did not increase CD25 expression, but upregulated activation antigens (CD38 and DR) and had increased death. At baseline, 7 of the 14 patients had high CD8+ T cell apoptosis (mean 17.0% +/- 6.0). We did an exploratory analysis of immune status after six years, and found that baseline CD8+ T cell apoptosis was correlated with CD4 cell count gain beginning two years post enrollment. Patients with low levels of CD8(+) T cell apoptosis at baseline (mean 2.2% +/- 2.1) had significantly higher CD4 cell counts and more normalized CD4:CD8 ratios than patients with high CD8(+) T cell apoptosis (mean CD4 cell counts 1,209 +/- 164 vs 754 +/- 320 cells/mm(3); CD4:CD8 ratios 1.55 vs. 0.70, respectively). We postulate that CD8(+) T cell apoptosis may reflect inherent activation status, which continues in some patients even though viral replication is suppressed which influences the ability of CD4(+) T cells to rebound. Levels of CD8(+) T cell apoptosis may therefore be an independent predictor of immune status, which should be shown in a prospective study.
Zhou, Wei; Xu, Shilin; Ying, Yi; Zhou, Ruiqing; Chen, Xiaowei
2017-11-01
Myelodysplastic syndromes (MDS) are a group of heterogeneous diseases characterized by poorly formed blood cells. We wanted to elucidate the underlying molecular mechanism to better determine pathogenesis, prognosis, diagnosis, and treatment for patients with MDS. We compared gene expression levels between normal and MDS tissue samples by immunohistochemical analysis. We studied the proliferation, survival, and migration of MDS cells using the EDU assay, colony formation, and transwell assays. We assessed the apoptotic rate and cell cycle status using flow cytometry and Hoechst staining. Finally, we evaluated RNA and protein expressions using polymerase chain reaction and Western blots, respectively. We found that resveratrol suppressed SKM-1 (an advanced MDS cell line) proliferation in a dose-dependent manner. Consistent with this finding, the EDU and colony formation assays also showed that resveratrol inhibited SKM-1 growth. Moreover, flow cytometry and Hoechst 33258 staining demonstrated that resveratrol induced apoptosis and a change in cell cycle status in SKM-1 cells, while the transwell assay showed that resveratrol reduced the migratory ability of SKM-1 cells. Resveratrol also decreased the expression of CCND1 (a gene that encodes the cyclin D1 protein) and increased expressions of KMT2A [lysine (K)-specific methyltransferase 2A] and caspase-3, suggesting that resveratrol exerts its effect by regulating CCND1 in SKM-1 cells. In addition, a combination of resveratrol and the PI3K/AKT inhibitor LY294002 exhibited a stronger inhibitory effect on the SKM-1 cells, compared with resveratrol alone. Our study proved that resveratrol suppresses SKM-1 growth and migration by inhibiting CCND1 expression. This finding provides novel insights into the pathogenesis of MDS and might help develop new diagnosis and treatment for patients with MDS.
Liu, Suxing; Bishop, W Robert; Liu, Ming
2003-08-01
p21(WAF1/Cip1) was initially identified as a cell cycle regulatory protein that can cause cell cycle arrest. It is induced by both p53-dependent and p53-independent mechanisms. This mini-review briefly discusses its currently known functions in apoptosis and drug sensitivity. As an inhibitor of cell proliferation, p21(WAF1/Cip1) plays an important role in drug-induced tumor suppression. Nevertheless, a number of recent studies have shown that p21(WAF1/Cip1) can assume both pro- or anti-apoptotic functions in response to anti-tumor agents depending on cell type and cellular context. This dual role of p21(WAF1/Cip1) in cancer cells complicates using p21(WAF1/Cip1) status to predict response to anti-tumor agents. However, it is possible to develop p21(WAF1/Cip1)-targeted reagents or p21(WAF1/Cip1) gene transfer techniques to have a beneficial effect within a well-defined therapeutic context. Better understanding of the roles of p21(WAF1/Cip1) in tumors should enable a more rational approach to anti-tumor drug design and therapy.
Cheng, Jin-Shiung; Chou, Chiang-Ting; Liu, Yuan-Yuarn; Sun, Wei-Chih; Shieh, Pochuen; Kuo, Daih-Huang; Kuo, Chun-Chi; Jan, Chung-Ren; Liang, Wei-Zhe
2016-05-01
Oleuropein, a phenolic compound found in the olive leaf (Olea europaea), has been shown to have biological activities in different models. However, the effects of oleuropein on Ca(2+) homeostasis, cytotoxicity, cell cycle distribution and ROS signaling in liver cells have not been analyzed. Oleuropein induced [Ca(2+)]i rises only in HepG2 cells but not in AML12, HA22T or HA59T cells due to the different status of 3-hydroxy-3-methylglutaryl-CoA reductase expression. In HepG2 cells, this Ca(2+) signaling response was reduced by removing extracellular Ca(2+), and was inhibited by the store-operated Ca(2+) channel blockers 2-APB and SKF96365. In Ca(2+)-free medium, pretreatment with the ER Ca(2+) pump inhibitor thapsigargin abolished oleuropein-induced [Ca(2+)]i rises. Oleuropein induced cell cycle arrest which was associated with the regulation of p53, p21, CDK1 and cyclin B1 levels. Furthermore, oleuropein elevated intracellular ROS levels but reduced GSH levels. Treatment with the intracellular Ca(2+) chelator BAPTA-AM or the antioxidant NAC partially reversed oleuropein-induced cytotoxicity. Together, in HepG2 cells, oleuropein induced [Ca(2+)]i rises by releasing Ca(2+) from the ER and causing Ca(2+) influx through store-operated Ca(2+) channels. Moreover, oleuropein induced Ca(2+)-associated cytotoxicity that involved ROS signaling and cell cycle arrest. This compound may offer a potential therapy for treatment of human hepatoma. Copyright © 2016 Elsevier Ltd. All rights reserved.
Santha, Sreevidya; Bommareddy, Ajay; Rule, Brittny; Guillermo, Ruth; Kaushik, Radhey S.; Young, Alan; Dwivedi, Chandradhar
2013-01-01
Anticancer efficacy and the mechanism of action of α-santalol, a terpenoid isolated from sandalwood oil, were investigated in human breast cancer cells by using p53 wild-type MCF-7 cells as a model for estrogen receptor(ER)-positive and p53 mutated MDA-MB-231 cells as a model for ER-negative breast cancer. α-Santalol inhibited cell viability and proliferation in a concentration and time-dependent manner in both cells regardless of their ER and/or p53 status. However, α-santalol produced relatively less toxic effect on normal breast epithelial cell line, MCF-10A. It induced G2/M cell cycle arrest and apoptosis in both MCF-7 and MDA-MB-231 cells. Cell cycle arrest induced by α-santalol was associated with changes in the protein levels of BRCA1, Chk1, G2/M regulatory cyclins, Cyclin dependent kinases (CDKs), Cell division cycle 25B (Cdc25B), Cdc25C and Ser-216 phosphorylation of Cdc25C. An up-regulated expression of CDK inhibitor p21 along with suppressed expression of mutated p53 was observed in MDA-MB-231 cells treated with α-santalol. On the contrary, α-santalol did not increase the expression of wild-type p53 and p21 in MCF-7 cells. In addition, α-santalol induced extrinsic and intrinsic pathways of apoptosis in both cells with activation of caspase-8 and caspase-9. It led to the activation of the executioner caspase-6 and caspase-7 in α-santalol-treated MCF-7 cells and caspase-3 and caspase-6 in MDA-MB-231 cells along with strong cleavage of poly(ADP-ribose) polymerase (PARP) in both cells. Taken together, this study for the first time identified strong anti-neoplastic effects of α-santalol against both ER-positive and ER-negative breast cancer cells. PMID:23451128
He, Xiangfei; Sun, Fuguang; Guo, Fengfu; Wang, Kai; Gao, Yisheng; Feng, Yanfei; Song, Bin; Li, Wenzhi; Li, Yang
2017-01-26
Renal cell carcinoma (RCC) is one of the most common kidney cancers worldwide. Although great progressions have been made in the past decades, its morbidity and lethality remain increasing. Long noncoding RNAs (lncRNAs) are demonstrated to play significant roles in the tumorigenesis. This study aimed to investigate the detailed roles of lncRNA FTX in RCC cell proliferation and metastasis. Our results showed that the transcript levels of FTX in both clinical RCC tissues and the cultured RCC cells were significantly upregulated and associated with multiple clinical parameters of RCC patients, including familial status, tumor sizes, lymphatic metastasis, and TNM stages. With cell proliferation assays, colony formation assays, and cell cycle assays, we testified that knockdown of FTX in A498 and ACHIN cells with specific shRNAs inhibited cell proliferation rate, colony formation ability, and arrested cell cycle in the G0/G1 phase. FTX depletion also suppressed cell migration and invasion with Transwell assays and wound-healing assays. These data indicated the pro-oncogenic potential of FTX in RCC, which makes it a latent therapeutic target of RCC diagnosis and treatment in the clinic.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cuneo, Kyle C., E-mail: kcuneo@umich.edu; Morgan, Meredith A.; Davis, Mary A.
2016-06-01
Purpose: Wee1 kinase inhibitors are effective radiosensitizers in cells lacking a G{sub 1} checkpoint. In this study we examined the potential effect of Wee1 kinase inhibition on inducing replication stress in hepatocellular carcinoma (HCC). Methods and Materials: Five independent datasets from the Oncomine database comparing gene expression in HCC compared to normal tissue were combined and specific markers associated with Wee1 sensitivity were analyzed. We then performed a series of in vitro experiments to study the effect of Wee1 inhibition on irradiated HCC cell lines with varying p53 mutational status. Clonogenic survival assays and flow cytometry using anti-γH2AX and phospho-histone H3more » antibodies with propidium iodide were performed to study the effect of AZD1775 on survival, cell cycle, and DNA repair. Additionally, nucleoside enriched medium was used to examine the effect of altering nucleotide pools on Wee1 targeted radiation sensitization. Results: Our analysis of the Oncomine database found high levels of CDK1 and other cell cycle regulators indicative of Wee1 sensitivity in HCC. In our in vitro experiments, treatment with AZD1775 radiosensitized and chemosensitized Hep3B, Huh7, and HepG2 cell lines and was associated with delayed resolution of γH2AX foci and the induction of pan-nuclear γH2AX staining. Wee1 inhibition attenuated radiation-induced G{sub 2} arrest in the Hep3B (TP53 null) and Huh7 (TP53 mutant) cell lines but not in the TP53 wild-type cell line HepG2. Supplementation with nucleosides reversed the radiation-sensitizing effect of AZD1775 and reduced the amount of cells with pan-nuclear γH2AX staining after radiation. Conclusions: Radiation sensitization with Wee1 inhibition occurs in cells regardless of their p53 mutational status. In this study we show for the first time that replication stress via the overconsumption of nucleotides plays an important role in AZD1775-induced radiation sensitization.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cappadone, C., E-mail: concettina.cappadone@unibo.it; Stefanelli, C.; Malucelli, E.
2015-11-13
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of themore » cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.« less
Different effects of two cyclic chalcone analogues on redox status of Jurkat T cells.
Rozmer, Zsuzsanna; Berki, Tímea; Maász, Gábor; Perjési, Pál
2014-12-01
Chalcones are intermediary compounds of the biosynthetic pathway of the naturally flavonoids. Previous studies have demonstrated that chalcones and their conformationally rigid cyclic analogues have tumour cell cytotoxic and chemopreventive effects. It has been shown that equitoxic doses of the two cyclic chalcone analogues (E)-2-(4'-methoxybenzylidene)-(2) and (E)-2-(4'-methylbenzylidene)-1-benzosuberone (3) have different effect on cell cycle progress of the investigated Jurkat cells. It was also found that the compounds affect the cellular thiol status of the treated cells and show intrinsic (non-enzyme-catalyzed) reactivity towards GSH under cell-free conditions. In order to gain new insights into the cytotoxic mechanism of the compounds, effects on the redox status and glutathione level of Jurkat cells were investigated. Detection of intracellular ROS level in Jurkat cells exposed to 2 and 3 was performed using the dichlorofluorescein-assay. Compound 2 did not influence ROS activity either on 1 or 4h exposure; in contrast, chalcone 3 showed to reduce ROS level at both timepoints. The two compounds had different effects on cellular glutathione status as well. Compound 2 significantly increased the oxidized glutathione (GSSG) level showing an interference with the cellular antioxidant defence. On the contrary, chalcone 3 enhanced the reduced glutathione level, indicating enhanced cellular antioxidant activity. To investigate the chalcone-GSH conjugation reactions under cellular conditions, a combination of a RP-HPLC method with electrospray ionization mass spectrometry (ESI-MS) was performed. Chalcone-GSH adducts could not be observed either in the cell supernatant or the cell sediment after deproteinization. The investigations provide further details of dual - cytotoxic and chemopreventive - effects of the cyclic chalcone analogues. Copyright © 2014 Elsevier Ltd. All rights reserved.
A recursive vesicle-based model protocell with a primitive model cell cycle
NASA Astrophysics Data System (ADS)
Kurihara, Kensuke; Okura, Yusaku; Matsuo, Muneyuki; Toyota, Taro; Suzuki, Kentaro; Sugawara, Tadashi
2015-09-01
Self-organized lipid structures (protocells) have been proposed as an intermediate between nonliving material and cellular life. Synthetic production of model protocells can demonstrate the potential processes by which living cells first arose. While we have previously described a giant vesicle (GV)-based model protocell in which amplification of DNA was linked to self-reproduction, the ability of a protocell to recursively self-proliferate for multiple generations has not been demonstrated. Here we show that newborn daughter GVs can be restored to the status of their parental GVs by pH-induced vesicular fusion of daughter GVs with conveyer GVs filled with depleted substrates. We describe a primitive model cell cycle comprising four discrete phases (ingestion, replication, maturity and division), each of which is selectively activated by a specific external stimulus. The production of recursive self-proliferating model protocells represents a step towards eventual production of model protocells that are able to mimic evolution.
Kunwar, A; Jayakumar, S; Srivastava, A K; Priyadarsini, K I
2012-04-01
The factors responsible for the induction of cell death by dimethoxycurcumin (Dimc), a synthetic analog of curcumin, were assessed in human breast carcinoma MCF7 cells. Initial cytotoxic studies with both curcumin and Dimc using MTT assay indicated their comparable effects. Further, the mechanism of action was explored in terms of oxidative stress, mitochondrial dysfunction, and modulation in the expression of proteins involved in cell cycle regulation and apoptosis. Dimc (5-50 μM) caused generation of reactive oxygen species, reduction in glutathione level, and induction of DNA damage. The mitochondrial dysfunction induced by Dimc was evidenced by the reduction in mitochondrial membrane potential and decrease in cellular energy status (ATP/ADP) monitored by HPLC analysis. The observed decrease in ATP was also supported by the significant suppression of different (α, β, γ, and ε) subunits of ATP synthase. The cytotoxic effect of Dimc was further characterized in terms of induction of S-phase cell cycle arrest and apoptosis, and their relative contribution was found to vary with the treatment concentration of Dimc. The S-phase arrest and apoptosis could also be correlated with the changes in the expressions of cell cycle proteins like p53, p21, CDK4, and cyclin-D1 and apoptotic markers like Bax and Bcl-2. Overall, the results demonstrated that Dimc induced cell death in MCF7 cells through S-phase arrest and apoptosis.
Advanced Coal-Based Power Generations
NASA Technical Reports Server (NTRS)
Robson, F. L.
1982-01-01
Advanced power-generation systems using coal-derived fuels are evaluated in two-volume report. Report considers fuel cells, combined gas- and steam-turbine cycles, and magnetohydrodynamic (MHD) energy conversion. Presents technological status of each type of system and analyzes performance of each operating on medium-Btu fuel gas, either delivered via pipeline to powerplant or generated by coal-gasification process at plantsite.
USDA-ARS?s Scientific Manuscript database
Female skeletal responses to ethanol may vary depending on the physiologic status (viz. cycling, pregnancy, lactation). Nonetheless, ethanol-induced oxidative stress appears to be the key event leading to skeletal toxicity. In the current study, we chronically infused EtOH-containing liquid diets ...
USDA-ARS?s Scientific Manuscript database
The mechanisms by which chronic ethanol intake induces bone loss remain largely unclear. Especially in females, skeletal response to ethanol may vary depending on the physiologic status (viz. cycling, pregnancy, lactation). Nonetheless, ethanol-induced oxidative stress appears to be the key event le...
USDA-ARS?s Scientific Manuscript database
The mechanisms by which chronic ethanol intake induces bone loss remain unclear. In females, the skeletal response to ethanol varies depending on physiologic status (viz. cycling, pregnancy, lactation). Ethanol-induced oxidative stress appears to be a key event leading to skeletal toxicity. In the c...
Epigenetics of human papillomaviruses
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johannsen, Eric; Department of Medicine, School of Medicine and Public Health, University of Wisconsin, Madison, WI 53706; McArdle Laboratory for Cancer Research, School of Medicine and Public Health, University of Wisconsin, Madison, WI 53706
Human papilllomaviruses (HPVs) are common human pathogens that infect cutaneous or mucosal epithelia in which they cause warts, self-contained benign lesions that commonly regress. The HPV life cycle is intricately tied to the differentiation of the host epithelium it infects. Mucosotropic HPVs are the most common sexually transmitted pathogen known to mankind. A subset of the mucosotropic HPVs, so-called high risk HPVs, is etiologically associated with numerous cancers of the anogenital tract, most notably the cervix, as well as a growing fraction of head and neck cancers. In these cancers, the HPV genome, which normally exists an a double stranded,more » circular, nuclear plasmid, is commonly found integrated into the host genome and expresses two viral oncogenes, E6 and E7, that are implicated in the development and maintainance of the cancers caused by these high risk HPVs. Numerous studies, primarily on the high risk HPV16, have documented that the methylation status of the viral genome changes not only in the context of the viral life cycle but also in the context of the progressive neoplastic disease that culminates in cancer. In this article, we summarize the knowledge gained from those studies. We also provide the first analysis of available ChIP-seq data on the occupancy of both epigentically modified histones as well as transcription factors on the high risk HPV18 genome in the context of HeLa cells, a cervical cancer-derived cell line that has been the subject of extensive analyses using this technique. - Highlights: • Methylation status of HPV genomes is dynamic. • Changes are seen in both the viral life cycle and neoplasia. • Histone modification status at LCR is predictive of transcription factor occupancy. • Novel transcription factor binding noted by ChIP-seq.« less
Shallwani, Shirin M; Simmonds, Maureen J; Kasymjanova, Goulnar; Spahija, Jadranka
2016-09-01
Our objectives were: (a) to identify predictors of change in health-related quality of life (HRQOL) in patients with advanced non-small cell lung cancer (NSCLC) undergoing chemotherapy; and (b) to characterize symptom status, nutritional status, physical performance and HRQOL in this population and to estimate the extent to which these variables change following two cycles of chemotherapy. A secondary analysis of a longitudinal observational study of 47 patients (24 men and 23 women) with newly diagnosed advanced NSCLC receiving two cycles of first-line chemotherapy was performed. Primary outcomes were changes in HRQOL (physical and mental component summaries (PCS and MCS) of the 36-item Short-Form Health Survey (SF-36)). Predictors in the models included pre-chemotherapy patient-reported symptoms (Schwartz Cancer Fatigue Scale (SCFS) and Lung Cancer Subscale), nutritional screening (Patient-Generated Subjective Global Assessment) and physical performance measures (6-min Walk Test (6MWT), one-minute chair rise test and grip strength). Mean SF-36 PCS score, 6MWT distance and grip strength declined following two cycles of chemotherapy (p<0.05). Multiple linear regression modelling revealed pre-chemotherapy SCFS score and 6MWT distance as the strongest predictors of change in the mental component of HRQOL accounting for 13% and 9% of the variance, respectively. No significant predictors were found for change in the physical component of HRQOL. Pre-chemotherapy 6MWT distance and fatigue severity predicted change in the mental component of HRQOL in patients with advanced NSCLC undergoing chemotherapy, while physical performance declined during treatment. Clinical management of these factors may be useful for HRQOL optimization in this population. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Histone deacetylase inhibitors: current status and overview of recent clinical trials.
Ma, Xujun; Ezzeldin, Hany H; Diasio, Robert B
2009-10-01
Histone deacetylase (HDAC) inhibitors are a new group of anticancer agents that have a potential role in the regulation of gene expression, induction of cell death, apoptosis and cell cycle arrest of cancer cells by altering the acetylation status of chromatin and other non-histone proteins. In clinical trials, HDAC inhibitors have demonstrated promising antitumour activity as monotherapy in cutaneous T-cell lymphoma and other haematological malignancies. In solid tumours, several HDAC inhibitors have been shown to be efficacious as single agents; however, results of most clinical trials were in favour of using HDAC inhibitors either prior to the initiation of chemotherapy or in combination with other treatments. Currently, the molecular basis of response to HDAC inhibitors in patients is not fully understood. In this review, we summarize the current status of HDAC inhibitors, as single agents or in combination with other agents in different phases of clinical trials. In most of the clinical trials, HDAC inhibitors were tolerable and exerted biological or antitumor activity. HDAC inhibitors have been studied in phase I, II and III clinical trials with variable efficacy. The combination of HDAC inhibitors with other anticancer agents including epigenetic or chemotherapeutic agents demonstrated favourable clinical outcome.
GST-M1 is transcribed moreso than AKR7A2 in AFB₁-exposed human monocytes and lymphocytes.
Bahari, Abbas; Mehrzad, Jalil; Mahmoudi, Mahmoud; Bassami, Mohammad Reza; Dehghani, Hesam
2015-01-01
Glutathione-S-transferases (GST) and aldo-keto reductases (AKR) are key aflatoxin (AF)-detoxifying enzymes. In this study, the expression of GST-M1, GST-T1, AKR-7A2, and AKR-7A3 genes in human monocytes and lymphocytes was analyzed after in vitro exposure to 10 or 100 ng AFB1/ml for 2 h. Unlike in pilot studies that showed that all four examined genes were present in HepG2 cells, in lymphocytes and monocytes, only GST-M1 and AKR-7A2 were detected. In fact, the induced expression of both GST-M1 and AKR-7A2 genes in human monocytes was moreso than that seen in AFB1-exposed lymphocytes. In addition, analyses of the effects of the exposures on cell cycle status were performed as, in cells lacking adequate detoxification capacities, it would be expected the cells would arrest at checkpoints in the cell cycle or progress to apoptotic/necrotic states. The results here indicated that only the high dose of AFB1 led to a change in cell cycle profiles and only in the monocytes (i.e. cells in S phase were significantly reduced). In general, the results here strongly suggest that human immune cell lineages appear to be able to increase their expression of AFB1-detoxifying enzymes (albeit to differing degrees) and, as a result, are able to counter potential toxicities from AFB1 and (likely) its metabolites.
Endogenous protein "barcode" for data validation and normalization in quantitative MS analysis.
Lee, Wooram; Lazar, Iulia M
2014-07-01
Quantitative proteomic experiments with mass spectrometry detection are typically conducted by using stable isotope labeling and label-free quantitation approaches. Proteins with housekeeping functions and stable expression level such actin, tubulin, and glyceraldehyde-3-phosphate dehydrogenase are frequently used as endogenous controls. Recent studies have shown that the expression level of such common housekeeping proteins is, in fact, dependent on various factors such as cell type, cell cycle, or disease status and can change in response to a biochemical stimulation. The interference of such phenomena can, therefore, substantially compromise their use for data validation, alter the interpretation of results, and lead to erroneous conclusions. In this work, we advance the concept of a protein "barcode" for data normalization and validation in quantitative proteomic experiments. The barcode comprises a novel set of proteins that was generated from cell cycle experiments performed with MCF7, an estrogen receptor positive breast cancer cell line, and MCF10A, a nontumorigenic immortalized breast cell line. The protein set was selected from a list of ~3700 proteins identified in different cellular subfractions and cell cycle stages of MCF7/MCF10A cells, based on the stability of spectral count data generated with an LTQ ion trap mass spectrometer. A total of 11 proteins qualified as endogenous standards for the nuclear and 62 for the cytoplasmic barcode, respectively. The validation of the protein sets was performed with a complementary SKBR3/Her2+ cell line.
Aerospace nickel-cadmium cell separator qualifications program
NASA Technical Reports Server (NTRS)
Francis, R. W.; Haag, R. L.
1986-01-01
The present space qualified nylon separator, Pellon 2505 ML, is no longer available for aerospace nickel-cadmium (NiCd) cells. As a result of this anticipated unavailability, a joint Government program between the Air Force Space Division and the Naval Research Laboratory was established. Four cell types were procured with both the old qualified and the new unqualified separators. Acceptance, characterization, and life cycling tests are to be performed at the Naval Weapons Support Center, Crane, Ind. (NWSC/Crane). The scheduling and current status of this program are discussed and the progress of testing and available results are projected.
An Immunogram for the Cancer-Immunity Cycle: Towards Personalized Immunotherapy of Lung Cancer.
Karasaki, Takahiro; Nagayama, Kazuhiro; Kuwano, Hideki; Nitadori, Jun-Ichi; Sato, Masaaki; Anraku, Masaki; Hosoi, Akihiro; Matsushita, Hirokazu; Morishita, Yasuyuki; Kashiwabara, Kosuke; Takazawa, Masaki; Ohara, Osamu; Kakimi, Kazuhiro; Nakajima, Jun
2017-05-01
The interaction of immune cells and cancer cells shapes the immunosuppressive tumor microenvironment. For successful cancer immunotherapy, comprehensive knowledge of antitumor immunity as a dynamic spatiotemporal process is required for each individual patient. To this end, we developed an immunogram for the cancer-immunity cycle by using next-generation sequencing. Whole exome sequencing and RNA sequencing were performed in 20 patients with NSCLC (12 with adenocarcinoma, seven with squamous cell carcinoma, and one with large cell neuroendocrine carcinoma). Mutated neoantigens and cancer germline antigens expressed in the tumor were assessed for predicted binding to patients' human leukocyte antigen molecules. The expression of genes related to cancer immunity was assessed and normalized to construct a radar chart composed of eight axes reflecting seven steps in the cancer-immunity cycle. Three immunogram patterns were observed in patients with lung cancer: T-cell-rich, T-cell-poor, and intermediate. The T-cell-rich pattern was characterized by gene signatures of abundant T cells, regulatory T cells, myeloid-derived suppressor cells, checkpoint molecules, and immune-inhibitory molecules in the tumor, suggesting the presence of antitumor immunity dampened by an immunosuppressive microenvironment. The T-cell-poor phenotype reflected lack of antitumor immunity, inadequate dendritic cell activation, and insufficient antigen presentation in the tumor. Immunograms for both the patients with adenocarcinoma and the patients with nonadenocarcinoma tumors included both T-cell-rich and T-cell-poor phenotypes, suggesting that histologic type does not necessarily reflect the cancer immunity status of the tumor. The patient-specific landscape of the tumor microenvironment can be appreciated by using immunograms as integrated biomarkers, which may thus become a valuable resource for optimal personalized immunotherapy. Copyright © 2017 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.
Qi, Zihao; Liu, Mingming; Liu, Yang; Zhang, Meiqin; Yang, Gong
2014-01-01
In the present study, we investigated the in vitro antitumor functions of a synthetic chalcone derivative 4,3',4',5'- tetramethoxychalcone (TMOC) in ovarian cancer cells. We found that TMOC inhibited the proliferation and colony formation of cisplatin sensitive cell line A2780 and resistant cell line A2780/CDDP, as well as ovarian cancer cell line SKOV3 in a time- and dose-dependent manner. Treatment of A2780 cells with TMOC resulted in G0/G1 cell cycle arrest through the down-regulation of cyclin D1 and CDK4, and the up-regulation of p16, p21 and p27 proteins. We demonstrated that TMOC might induce cell apoptosis through suppressing Bcl-2 and Bcl-xL, but enhancing the expression of Bax and the cleavage of PARP-1. Treatment of TMOC also reduced the invasion and migration of A2780 cells. Finally, we found that TMOC inhibited the constitutive activation of STAT3 signaling pathway and induced the expression of the tumor suppressor PTEN regardless of the p53 status in cell lines. These data suggest that TMOC may be developed as a potential chemotherapeutic agent to effectively treat certain cancers including ovarian cancer.
Liu, Yang; Zhang, Meiqin; Yang, Gong
2014-01-01
In the present study, we investigated the in vitro antitumor functions of a synthetic chalcone derivative 4,3′,4′,5′- tetramethoxychalcone (TMOC) in ovarian cancer cells. We found that TMOC inhibited the proliferation and colony formation of cisplatin sensitive cell line A2780 and resistant cell line A2780/CDDP, as well as ovarian cancer cell line SKOV3 in a time- and dose-dependent manner. Treatment of A2780 cells with TMOC resulted in G0/G1 cell cycle arrest through the down-regulation of cyclin D1 and CDK4, and the up-regulation of p16, p21 and p27 proteins. We demonstrated that TMOC might induce cell apoptosis through suppressing Bcl-2 and Bcl-xL, but enhancing the expression of Bax and the cleavage of PARP-1. Treatment of TMOC also reduced the invasion and migration of A2780 cells. Finally, we found that TMOC inhibited the constitutive activation of STAT3 signaling pathway and induced the expression of the tumor suppressor PTEN regardless of the p53 status in cell lines. These data suggest that TMOC may be developed as a potential chemotherapeutic agent to effectively treat certain cancers including ovarian cancer. PMID:25180593
Prognostic value of cell cycle regulatory proteins in muscle-infiltrating bladder cancer.
Galmozzi, Fabia; Rubagotti, Alessandra; Romagnoli, Andrea; Carmignani, Giorgio; Perdelli, Luisa; Gatteschi, Beatrice; Boccardo, Francesco
2006-12-01
The aims of this study were to investigate the expression levels of proteins involved in cell cycle regulation in specimens of bladder cancer and to correlate them with the clinicopathological characteristics, proliferative activity and survival. Eighty-two specimens obtained from patients affected by muscle-invasive bladder cancer were evaluated immunohistochemically for p53, p21 and cyclin D1 expression, as well as for the tumour proliferation index, Ki-67. The statistical analysis included Kaplan-Meier curves with log-rank test and Cox proportional hazards models. In univariate analyses, low Ki-67 proliferation index (P = 0.045) and negative p21 immunoreactivity (P = 0.04) were associated to patient's overall survival (OS), but in multivariate models p21 did not reach statistical significance. When the combinations of the variables were assessed in two separate multivariate models that included tumour stage, grading, lymph node status, vascular invasion and perineural invasion, the combined variables p21/Ki-67 or p21/cyclin D1 expression were independent predictors for OS; in particular, patients with positive p21/high Ki-67 (P = 0.015) or positive p21/negative cyclin D1 (P = 0.04) showed the worst survival outcome. Important alterations in the cell cycle regulatory pathways occur in muscle-invasive bladder cancer and the combined use of cell cycle regulators appears to provide significant prognostic information that could be used to select the patients most suitable for multimodal therapeutic approaches.
Zakraoui, Ons; Marcinkiewicz, Cezary; Aloui, Zohra; Othman, Houcemeddine; Grépin, Renaud; Haoues, Meriam; Essafi, Makram; Srairi-Abid, Najet; Gasmi, Ammar; Karoui, Habib; Pagès, Gilles; Essafi-Benkhadir, Khadija
2017-01-01
Lebein, is an heterodimeric disintegrin isolated from Macrovipera lebetina snake venom that was previously characterized as an inhibitor of ADP-induced platelet aggregation. In this study, we investigated the effect of Lebein on the p53-dependent growth of human colon adenocarcinoma cell lines. We found that Lebein significantly inhibited LS174 (p53wt), HCT116 (p53wt), and HT29 (p53mut) colon cancer cell viability by inducing cell cycle arrest through the modulation of expression levels of the tumor suppression factor p53, cell cycle regulating proteins cyclin D1, CDK2, CDK4, retinoblastoma (Rb), CDK1, and cyclin-dependent kinase inhibitors p21 and p27. Interestingly, Lebein-induced apoptosis of colon cancer cells was dependent on their p53 status. Thus, in LS174 cells, cell death was associated with PARP cleavage and the activation of caspases 3 and 8 while in HCT116 cells, Lebein induced caspase-independent apoptosis through increased expression of apoptosis inducing factor (AIF). In LS174 cells, Lebein triggers the activation of the MAPK ERK1/2 pathway through induction of reactive oxygen species (ROS). It also decreased cell adhesion and migration to fibronectin through down regulation of α5β1 integrin. Moreover, Lebein significantly reduced the expression of two angiogenesis stimulators, Vascular Endothelial Growth Factor (VEGF) and Neuropilin 1 (NRP1). It inhibited the VEGF-induced neovascularization process in the quail embryonic CAM system and blocked the development of human colon adenocarcinoma in nude mice. Overall, our work indicates that Lebein may be useful to design a new therapy against colon cancer. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Thakur, Vijay S.; Gupta, Sanjay
2012-01-01
Green tea polyphenols (GTPs) reactivate epigenetically silenced genes in cancer cells and trigger cell cycle arrest and apoptosis; however, the mechanisms whereby these effects occur are not well understood. We investigated the molecular mechanisms underlying the antiproliferative effects of GTP, which may be similar to those of histone deacetylase (HDAC) inhibitors. Exposure of human prostate cancer LNCaP cells (harboring wild-type p53) and PC-3 cells (lacking p53) with 10–80 μg/ml of GTP for 24 h resulted in dose-dependent inhibition of class I HDAC enzyme activity and its protein expression. GTP treatment causes an accumulation of acetylated histone H3 in total cellular chromatin, resulting in increased accessibility to bind with the promoter sequences of p21/waf1 and Bax, consistent with the effects elicited by an HDAC inhibitor, trichostatin A. GTP treatment also resulted in increased expression of p21/waf1 and Bax at the protein and message levels in these cells. Furthermore, treatment of cells with proteasome inhibitor, MG132 together with GTP prevented degradation of class I HDACs, compared with cells treated with GTP alone, indicating increased proteasomal degradation of class I HDACs by GTP. These alterations were consistent with G0–G1 phase cell cycle arrest and induction of apoptosis in both cell lines. Our findings provide new insight into the mechanisms of GTP action in human prostate cancer cells irrespective of their p53 status and suggest a novel approach to prevention and/or therapy of prostate cancer achieved via HDAC inhibition. PMID:22114073
A little sugar goes a long way: The cell biology of O-GlcNAc
2015-01-01
Unlike the complex glycans decorating the cell surface, the O-linked β-N-acetyl glucosamine (O-GlcNAc) modification is a simple intracellular Ser/Thr-linked monosaccharide that is important for disease-relevant signaling and enzyme regulation. O-GlcNAcylation requires uridine diphosphate–GlcNAc, a precursor responsive to nutrient status and other environmental cues. Alternative splicing of the genes encoding the O-GlcNAc cycling enzymes O-GlcNAc transferase (OGT) and O-GlcNAcase (OGA) yields isoforms targeted to discrete sites in the nucleus, cytoplasm, and mitochondria. OGT and OGA also partner with cellular effectors and act in tandem with other posttranslational modifications. The enzymes of O-GlcNAc cycling act preferentially on intrinsically disordered domains of target proteins impacting transcription, metabolism, apoptosis, organelle biogenesis, and transport. PMID:25825515
Zheng, Jie; Wang, Huan; Yao, Jia; Zou, Xianjin
2014-01-01
PIK3CA is probably the most commonly mutated kinase in several malignant tumors. Activation of class I phosphatidylinositol 3' kinase (PI3K) regulates tumor proliferation, survival, etc. This study sought to identify whether the pan-inhibitor has more antitumor efficacy in breast cancer cells with PIK3CA Mutation or HER2 amplification than basal-like cancer cells. The proliferation of breast cancer cells was measured by MTT assay in the presence of GDC-0941. Afterwards, we determined the visible changes in signaling in the PI3K/AKT/mTOR pathway. Finally, we examined GDC-0941 effects on cell cycle, apoptosis and motility. GDC-0941 exhibited excellent inhibition on three cell lines with PIK3CA mutation or HER2 amplification. In addition, GDC-0941 resulted in decreased Akt activity. GDC-0941 downregulated the key components of the cell cycle machinery, such as cyclin D1, upregulated the apoptotic markers and inhibited cell motility on three cell lines with PIK3CA Mutation or HER2 amplification. Antitumor activity of GDC-0941 treatment amongst tumor cell lines with PIK3CA mutation and HER2 amplification may have clinical utility in patients with these oncogenic alterations.
Deng, Shengqiong; Zhao, Qian; Zhen, Lixiao; Zhang, Chuyi; Liu, Cuicui; Wang, Guangxue; Zhang, Lin; Bao, Luer; Lu, Ying; Meng, Lingyu; Lü, Jinhui; Yu, Ping; Lin, Xin; Zhang, Yuzhen; Chen, Yi-Han; Fan, Huimin; Cho, William C.; Liu, Zhongmin; Yu, Zuoren
2017-01-01
Adult heart has limited potential for regeneration after pathological injury due to the limited cell proliferation of cardiomyocytes and the quiescent status of progenitor cells. As such, induction of cell-cycle reentry of cardiomyocytes is one of the key strategies for regeneration of damaged heart. In this study, a subset of miRNAs including miR-708 were identified to be much more abundant in the embryonic and neonatal cardiomyocytes than that in adult rodents. Overexpression of miR-708 promoted cellular proliferation of H9C2 cells or primary cardiomyocytes from neonatal rats or mice in vitro. Lipid nanoparticle delivery of miR-708 promoted myocardial regeneration and heart function recovery in vivo. In addition, miR-708 protected cardiomyocytes against stress-induced apoptosis under hypoxia or isoproterenol treatments. miR-708 inhibited the expression of MAPK14, which has been demonstrated arresting the cell cycle in cardiomyocytes. The cell proliferation-promoting function of miR-708 was dependent at least partly on the expression of MAPK14. These findings strengthen the potential of applying miRNAs to reconstitute lost cardiomyocytes in injured hearts, and may provide a novel miRNA candidate for promoting heart regeneration. PMID:28638481
Targeting survivin as a potential new treatment for chondrosarcoma of bone
de Jong, Y; van Oosterwijk, J G; Kruisselbrink, A B; Briaire-de Bruijn, I H; Agrogiannis, G; Baranski, Z; Cleven, A H G; Cleton-Jansen, A-M; van de Water, B; Danen, E H J; Bovée, J V M G
2016-01-01
Chondrosarcomas are malignant cartilage-forming bone tumors, which are intrinsically resistant to chemo- and radiotherapy, leaving surgical removal as the only curative treatment option. Therefore, our aim was to identify genes involved in chondrosarcoma cell survival that could serve as a target for therapy. siRNA screening for 51 apoptosis-related genes in JJ012 chondrosarcoma cells identified BIRC5, encoding survivin, as essential for chondrosarcoma survival. Using immunohistochemistry, nuclear as well as cytoplasmic survivin expression was analyzed in 207 chondrosarcomas of different subtypes. Nuclear survivin has been implicated in cell-cycle regulation while cytoplasmic localization is important for its anti-apoptotic function. RT–PCR was performed to determine expression of the most common survivin isoforms. Sensitivity to YM155, a survivin inhibitor currently in phase I/II clinical trial for other tumors, was examined in 10 chondrosarcoma cell lines using viability assay, apoptosis assay and cell-cycle analysis. Survivin expression was found in all chondrosarcoma patient samples. Higher expression of nuclear and cytoplasmic survivin was observed with increasing histological grade in central chondrosarcomas. Inhibition of survivin using YM155 showed that especially TP53 mutant cell lines were sensitive, but no caspase 3/7 or PARP cleavage was observed. Rather, YM155 treatment resulted in a block in S phase in two out of three chondrosarcoma cell lines, indicating that survivin is more involved in cell-cycle regulation than in apoptosis. Thus, survivin is important for chondrosarcoma survival and chondrosarcoma patients might benefit from survivin inhibition using YM155, for which TP53 mutational status can serve as a predictive biomarker. PMID:27159675
Loss of p53 induces M-phase retardation following G2 DNA damage checkpoint abrogation.
Minemoto, Yuzuru; Uchida, Sanae; Ohtsubo, Motoaki; Shimura, Mari; Sasagawa, Toshiyuki; Hirata, Masato; Nakagama, Hitoshi; Ishizaka, Yukihito; Yamashita, Katsumi
2003-04-01
Most cell lines that lack functional p53 protein are arrested in the G2 phase of the cell cycle due to DNA damage. When the G2 checkpoint is abrogated, these cells are forced into mitotic catastrophe. A549 lung adenocarcinoma cells, in which p53 was eliminated with the HPV16 E6 gene, exhibited efficient arrest in the G2 phase when treated with adriamycin. Administration of caffeine to G2-arrested cells induced a drastic change in cell phenotype, the nature of which depended on the status of p53. Flow cytometric and microscopic observations revealed that cells that either contained or lacked p53 resumed their cell cycles and entered mitosis upon caffeine treatment. However, transit to the M phase was slower in p53-negative cells than in p53-positive cells. Consistent with these observations, CDK1 activity was maintained at high levels, along with stable cyclin B1, in p53-negative cells. The addition of butyrolactone I, which is an inhibitor of CDK1 and CDK2, to the p53-negative cells reduced the floating round cell population and induced the disappearance of cyclin B1. These results suggest a relationship between the p53 pathway and the ubiquitin-mediated degradation of mitotic cyclins and possible cross-talk between the G2-DNA damage checkpoint and the mitotic checkpoint.
A recursive vesicle-based model protocell with a primitive model cell cycle
Kurihara, Kensuke; Okura, Yusaku; Matsuo, Muneyuki; Toyota, Taro; Suzuki, Kentaro; Sugawara, Tadashi
2015-01-01
Self-organized lipid structures (protocells) have been proposed as an intermediate between nonliving material and cellular life. Synthetic production of model protocells can demonstrate the potential processes by which living cells first arose. While we have previously described a giant vesicle (GV)-based model protocell in which amplification of DNA was linked to self-reproduction, the ability of a protocell to recursively self-proliferate for multiple generations has not been demonstrated. Here we show that newborn daughter GVs can be restored to the status of their parental GVs by pH-induced vesicular fusion of daughter GVs with conveyer GVs filled with depleted substrates. We describe a primitive model cell cycle comprising four discrete phases (ingestion, replication, maturity and division), each of which is selectively activated by a specific external stimulus. The production of recursive self-proliferating model protocells represents a step towards eventual production of model protocells that are able to mimic evolution. PMID:26418735
Hematopoietic Stem Cells: Transcriptional Regulation, Ex Vivo Expansion and Clinical Application
Aggarwal, R.; Lu, J.; Pompili, V.J.; Das, H.
2012-01-01
Maintenance of ex vivo hematopoietic stem cells (HSC) pool and its differentiated progeny is regulated by complex network of transcriptional factors, cell cycle proteins, extracellular matrix, and their microenvironment through an orchestrated fashion. Strides have been made to understand the mechanisms regulating in vivo quiescence and proliferation of HSCs to develop strategies for ex vivo expansion. Ex vivo expansion of HSCs is important to procure sufficient number of stem cells and as easily available source for HSC transplants for patients suffering from hematological disorders and malignancies. Our lab has established a nanofiber-based ex vivo expansion strategy for HSCs, while preserving their stem cell characteristics. Ex vivo expanded cells were also found biologically functional in various disease models. However, the therapeutic potential of expanded stem cells at clinical level still needs to be verified. This review outlines transcriptional factors that regulate development of HSCs and their commitment, genes that regulate cell cycle status, studies that attempt to develop an effective and efficient protocol for ex vivo expansion of HSCs and application of HSC in various non-malignant and malignant disorders. Overall the goal of the current review is to deliver an understanding of factors that are critical in resolving the challenges that limit the expansion of HSCs in vivo and ex vivo. PMID:22082480
2012-01-01
Background Chrysin and its analogues, belongs to flavonoid family and possess potential anti-tumour activity. The aim of this study is to determine the molecular mechanism by which chrysin controls cell growth and induce apoptosis in A375 cells. Methods Effect of chrysin and its analogues on cell viability and cell cycle analysis was determined by MTT assay and flowcytometry. A series of Western blots was performed to determine the effect of chrysin on important cell cycle regulatory proteins (Cdk2, cyclin D1, p53, p21, p27). The fluorimetry and calorimetry based assays was conducted for characterization of chrysin as HDAC inhibitor. The changes in histone tail modification such as acetylation and methylation was studied after chrysin treatment was estimated by immuno-fluorescence and western blot analysis. The expression of Bcl-xL, survivin and caspase-3 was estimated in chrysin treated cells. The effect of chrysin on p21 promoter activity was studied by luciferase and ChIP assays. Results Chrysin cause G1 cell cycle arrest and found to inhibit HDAC-2 and HDAC-8. Chrysin treated cells have shown increase in the levels of H3acK14, H4acK12, H4acK16 and decrease in H3me2K9 methylation. The p21 induction by chrysin treatment was found to be independent of p53 status. The chromatin remodelling at p21WAF1 promoter induces p21 activity, increased STAT-1 expression and epigenetic modifications that are responsible for ultimate cell cycle arrest and apoptosis. Conclusion Chrysin shows in vitro anti-cancer activity that is correlated with induction of histone hyperacetylation and possible recruitment of STAT-1, 3, 5 proteins at STAT (−692 to −684) region of p21 promoter. Our results also support an unexpected action of chrysin on the chromatin organization of p21WAF1 promoter through histone methylation and hyper-acetylation. It proposes previously unknown sequence specific chromatin modulations in the STAT responsive elements for regulating cell cycle progression negatively via the induction of the CDK inhibitor p21WAF1. PMID:22591439
Mannan-MUC1-pulsed dendritic cell immunotherapy: a phase I trial in patients with adenocarcinoma.
Loveland, Bruce E; Zhao, Anne; White, Shane; Gan, Hui; Hamilton, Kate; Xing, Pei-Xiang; Pietersz, Geoffrey A; Apostolopoulos, Vasso; Vaughan, Hilary; Karanikas, Vaios; Kyriakou, Peter; McKenzie, Ian F C; Mitchell, Paul L R
2006-02-01
Tumor antigen-loaded dendritic cells show promise for cancer immunotherapy. This phase I study evaluated immunization with autologous dendritic cells pulsed with mannan-MUC1 fusion protein (MFP) to treat patients with advanced malignancy. Eligible patients had adenocarcinoma expressing MUC1, were of performance status 0 to 1, with no autoimmune disease. Patients underwent leukapheresis to generate dendritic cells by culture ex vivo with granulocyte macrophage colony-stimulating factor and interleukin 4 for 5 days. Dendritic cells were then pulsed overnight with MFP and harvested for reinjection. Patients underwent three cycles of leukapheresis and reinjection at monthly intervals. Patients with clinical benefit were able to continue with dendritic cell-MFP immunotherapy. Ten patients with a range of tumor types were enrolled, with median age of 60 years (range, 33-70 years); eight patients were of performance status 0 and two of performance status 1. Dendritic cell-MFP therapy led to strong T-cell IFNgamma Elispot responses to the vaccine and delayed-type hypersensitivity responses at injection sites in nine patients who completed treatments. Immune responses were sustained at 1 year in monitored patients. Antibody responses were seen in three patients only and were of low titer. Side effects were grade 1 only. Two patients with clearly progressive disease (ovarian and renal carcinoma) at entry were stable after initial therapy and went on to further leukapheresis and dendritic cell-MFP immunotherapy. These two patients have now each completed over 3 years of treatment. Immunization produced T-cell responses in all patients with evidence of tumor stabilization in 2 of the 10 advanced cancer patients treated. These data support further clinical evaluation of this dendritic cell-MFP immunotherapy.
Xue, Kai; Gu, Juan J; Zhang, Qunling; Mavis, Cory; Hernandez-Ilizaliturri, Francisco J; Czuczman, Myron S; Guo, Ye
2016-02-01
Preclinical models of chemotherapy resistance and clinical observations derived from the prospective multicenter phase III collaborative trial in relapsed aggressive lymphoma (CORAL) study demonstrated that primary refractory/relapsed B cell diffuse large B cell lymphoma has a poor clinical outcome with current available second-line treatments. Preclinically, we found that rituximab resistance is associated with a deregulation on the mitochondrial potential rendering lymphoma cells resistant to chemotherapy-induced apoptotic stimuli. There is a dire need to develop agents capable to execute alternative pathways of cell death in an attempt to overcome chemotherapy resistance. Posttranscriptional histone modification plays an important role in regulating gene transcription and is altered by histone acetyltransferases (HATs) and histone deacetylases (HDACs). HDACs regulate several key cellular functions, including cell proliferation, cell cycle, apoptosis, angiogenesis, migration, antigen presentation, and/or immune regulation. Given their influence in multiple regulatory pathways, HDAC inhibition is an attractive strategy to evaluate its anti-proliferation activity in cancer cells. To this end, we studied the anti-proliferation activity and mechanisms of action of suberoylanilide hydroxamic acid (SAHA, vorinostat) in rituximab-chemotherapy-resistant preclinical models. A panel of rituximab-chemotherapy-sensitive (RSCL) and rituximab-chemotherapy-resistant cell lines (RRCL) and primary tumor cells isolated from relapsed/refractory B cell lymphoma patients were exposed to escalating doses of vorinostat. Changes in mitochondrial potential, ATP synthesis, and cell cycle distribution were determined by Alamar blue reduction, Titer-Glo luminescent assays, and flow cytometric, respectively. Protein lysates were isolated from vorinostat-exposed cells, and changes in members of Bcl-2 family, cell cycle regulatory proteins, and the acetylation status of histone H3 were evaluated by Western blotting. Finally, cell lines were pre-exposed to vorinostat for 48 h and subsequently exposed to several chemotherapy agents (cisplatin, etoposide, or gemcitabine); changes in cell viability were determined by CellTiter-Glo(®) luminescence assay (Promega, Fitchburg, WI), and synergistic activity was evaluated using the CalcuSyn software. Vorinostat induced dose-dependent cell death in RRCL and in primary tumor cells. In addition, in vitro exposure of RRCL to vorinostat resulted in an increase in p21 and acetylation of histone H3 leading to G1 cell cycle arrest. Vorinostat exposure resulted in apoptosis in RSCL cell lines but not in RRCL. This finding suggests that in RRCL, vorinostat induces cell death by alternative pathways (i.e., irreversible cell cycle arrest). Of interest, vorinostat was found to reverse acquired chemotherapy resistance in RRCL. Our data suggest that vorinostat is active in RRCL with a known defective apoptotic machinery, it can active alternative cell death pathways. Given the multiple pathways affected by HDAC inhibition, vorinostat can potentially be used to overcome acquired resistant to chemotherapy in aggressive B cell lymphoma.
Chen, Chuangui; Ma, Zhao; Zhang, Hongdian; Liu, Xiaoqiong; Yu, Zhentao
2017-01-01
Background The aim of this study was to elucidate the role of Krüppel-Like factor 4 (KLF4) in cisplatin resistance in esophageal squamous cell carcinoma (ESCC) cells, which may eventually help to improve the treatment efficacy. Material/Methods Human esophageal squamous cell carcinoma (ESCC) cell line CaEs-17, TE-1, EC109, KYSE510, KYSE140, KYSE70, and KYSE30 were selected to detect their sensitivity to cisplatin. 5-Azacytidine-2′-deoxycytidine (5′-Aza-CdR) treatment and methylation-specific PCR (MS-PCR) were used to detect the methylation status for KLF4. Cell viability, apoptosis, and cell cycle were measured using methyl thiazolyl tetrazolium (MTT) assay, Annexin V affinity assay, and flow cytometry, respectively. Results The sensitivity to cisplatin was different in the seven ESCC cell lines, with TE-1 having the lowest sensitivity and KYSE140 having the highest sensitivity. Interestingly, the level of KLF4 was relatively low in TE-1 cells; while it was high in KYSE140 cells. These results suggested that KLF4 may be involved in cisplatin resistance. The promoter region was mostly unmethylated in KYSE140 cells; while it was hypermethylated in TE-1 cells. After treatment with demethylation reagent 5-Aza-CdR, cisplatin sensitivities were significantly increased after upregulation of KLF4, as the IC50 values were significantly decreased in the TE-1 cell treated with 5-Aza-CdR. Furthermore, upregulation of KLF4 induced cell apoptosis and cell cycle arrest at S phase. Conclusions KLF4 enhances the sensitivity of cisplatin to ESCC cells through apoptosis induction and cell cycle arrest. Our data provided a novel insight to the mechanism of cisplatin resistance; overexpression of KLF4 may be a potential therapeutic strategy for cisplatin resistance in human ESCC. PMID:28694421
Chen, Chuangui; Ma, Zhao; Zhang, Hongdian; Liu, Xiaoqiong; Yu, Zhentao
2017-07-11
BACKGROUND The aim of this study was to elucidate the role of Krüppel-Like factor 4 (KLF4) in cisplatin resistance in esophageal squamous cell carcinoma (ESCC) cells, which may eventually help to improve the treatment efficacy. MATERIAL AND METHODS Human esophageal squamous cell carcinoma (ESCC) cell line CaEs-17, TE-1, EC109, KYSE510, KYSE140, KYSE70, and KYSE30 were selected to detect their sensitivity to cisplatin. 5-Azacytidine-2'-deoxycytidine (5'-Aza-CdR) treatment and methylation-specific PCR (MS-PCR) were used to detect the methylation status for KLF4. Cell viability, apoptosis, and cell cycle were measured using methyl thiazolyl tetrazolium (MTT) assay, Annexin V affinity assay, and flow cytometry, respectively. RESULTS The sensitivity to cisplatin was different in the seven ESCC cell lines, with TE-1 having the lowest sensitivity and KYSE140 having the highest sensitivity. Interestingly, the level of KLF4 was relatively low in TE-1 cells; while it was high in KYSE140 cells. These results suggested that KLF4 may be involved in cisplatin resistance. The promoter region was mostly unmethylated in KYSE140 cells; while it was hypermethylated in TE-1 cells. After treatment with demethylation reagent 5-Aza-CdR, cisplatin sensitivities were significantly increased after upregulation of KLF4, as the IC50 values were significantly decreased in the TE-1 cell treated with 5-Aza-CdR. Furthermore, upregulation of KLF4 induced cell apoptosis and cell cycle arrest at S phase. CONCLUSIONS KLF4 enhances the sensitivity of cisplatin to ESCC cells through apoptosis induction and cell cycle arrest. Our data provided a novel insight to the mechanism of cisplatin resistance; overexpression of KLF4 may be a potential therapeutic strategy for cisplatin resistance in human ESCC.
CLUH couples mitochondrial distribution to the energetic and metabolic status.
Wakim, Jamal; Goudenege, David; Perrot, Rodolphe; Gueguen, Naig; Desquiret-Dumas, Valerie; Chao de la Barca, Juan Manuel; Dalla Rosa, Ilaria; Manero, Florence; Le Mao, Morgane; Chupin, Stephanie; Chevrollier, Arnaud; Procaccio, Vincent; Bonneau, Dominique; Logan, David C; Reynier, Pascal; Lenaers, Guy; Khiati, Salim
2017-06-01
Mitochondrial dynamics and distribution are critical for supplying ATP in response to energy demand. CLUH is a protein involved in mitochondrial distribution whose dysfunction leads to mitochondrial clustering, the metabolic consequences of which remain unknown. To gain insight into the role of CLUH on mitochondrial energy production and cellular metabolism, we have generated CLUH-knockout cells using CRISPR/Cas9. Mitochondrial clustering was associated with a smaller cell size and with decreased abundance of respiratory complexes, resulting in oxidative phosphorylation (OXPHOS) defects. This energetic impairment was found to be due to the alteration of mitochondrial translation and to a metabolic shift towards glucose dependency. Metabolomic profiling by mass spectroscopy revealed an increase in the concentration of some amino acids, indicating a dysfunctional Krebs cycle, and increased palmitoylcarnitine concentration, indicating an alteration of fatty acid oxidation, and a dramatic decrease in the concentrations of phosphatidylcholine and sphingomyeline, consistent with the decreased cell size. Taken together, our study establishes a clear function for CLUH in coupling mitochondrial distribution to the control of cell energetic and metabolic status. © 2017. Published by The Company of Biologists Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nakagawa, Yosuke; Takahashi, Akihisa; Kajihara, Atsuhisa
Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggestedmore » that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp53 bearing cancer cells.« less
Impaired hair growth and wound healing in mice lacking thyroid hormone receptors.
Contreras-Jurado, Constanza; García-Serrano, Laura; Martínez-Fernández, Mónica; Ruiz-Llorente, Lidia; Paramio, Jesus M; Aranda, Ana
2014-01-01
Both clinical and experimental observations show that the skin is affected by the thyroidal status. In hypothyroid patients the epidermis is thin and alopecia is common, indicating that thyroidal status might influence not only skin proliferation but also hair growth. We demonstrate here that the thyroid hormone receptors (TRs) mediate these effects of the thyroid hormones on the skin. Mice lacking TRα1 and TRβ (the main thyroid hormone binding isoforms) display impaired hair cycling associated to a decrease in follicular hair cell proliferation. This was also observed in hypothyroid mice, indicating the important role of the hormone-bound receptors in hair growth. In contrast, the individual deletion of either TRα1 or TRβ did not impair hair cycling, revealing an overlapping or compensatory role of the receptors in follicular cell proliferation. In support of the role of the receptors in hair growth, TRα1/TRβ-deficient mice developed alopecia after serial depilation. These mice also presented a wound-healing defect, with retarded re-epithelialization and wound gaping, associated to impaired keratinocyte proliferation. These results reinforce the idea that the thyroid hormone nuclear receptors play an important role on skin homeostasis and suggest that they could be targets for the treatment of cutaneous pathologies.
Liao, Min-Tser; Liu, Wen-Chih; Lin, Fu-Huang; Huang, Ching-Feng; Chen, Shao-Yuan; Liu, Chuan-Chieh; Lin, Shih-Hua; Lu, Kuo-Cheng; Wu, Chia-Chao
2016-07-01
Inflammation, endothelial dysfunction, and mineral bone disease are critical factors contributing to morbidity and mortality in hemodialysis (HD) patients. Physical exercise alleviates inflammation and increases bone density. Here, we investigated the effects of intradialytic aerobic cycling exercise on HD patients. Forty end-stage renal disease patients undergoing HD were randomly assigned to either an exercise or control group. The patients in the exercise group performed a cycling program consisting of a 5-minute warm-up, 20 minutes of cycling at the desired workload, and a 5-minute cool down during 3 HD sessions per week for 3 months. Biochemical markers, inflammatory cytokines, nutritional status, the serum endothelial progenitor cell (EPC) count, bone mineral density, and functional capacity were analyzed. After 3 months of exercise, the patients in the exercise group showed significant improvements in serum albumin levels, the body mass index, inflammatory cytokine levels, and the number of cells positive for CD133, CD34, and kinase insert domain-conjugating receptor. Compared with the exercise group, the patients in the control group showed a loss of bone density at the femoral neck and no increases in EPCs. The patients in the exercise group also had a significantly greater 6-minute walk distance after completing the exercise program. Furthermore, the number of EPCs significantly correlated with the 6-minute walk distance both before and after the 3-month program. Intradialytic aerobic cycling exercise programs can effectively alleviate inflammation and improve nutrition, bone mineral density, and exercise tolerance in HD patients.
Kim, Gyeong-Ji; Jo, Hyeon-Ju; Lee, Kwon-Jai; Choi, Jeong Woo; An, Jeung Hee
2018-05-29
We evaluated oleanolic acid (OA)-induced anti-cancer activity, apoptotic mechanism, cell cycle status, and MAPK kinase signaling in DU145 (prostate cancer), MCF-7 (breast cancer), U87 (human glioblastoma), normal murine liver cell (BNL CL.2) and human foreskin fibroblast cell lines (Hs 68). The IC50 values for OA-induced cytotoxicity were 112.57 in DU145, 132.29 in MCF-7, and 163.60 in U87 cells, respectively. OA did not exhibit toxicity in BNL CL. 2 and Hs 68 cell lines in our experiments. OA, at 100 µg/mL, increased the number of apoptotic cells to 27.0% in DU145, 27.0% in MCF-7, and 15.7% in U87, when compared to control cells. This enhanced apoptosis was due to increases in p53, cytochrome c, Bax, PARP-1 and caspase-3 expression in DU145, MCF-7 and U87 cell lines. OA-treated DU145 cells were arrested in G2 because of the activation of p-AKT, p-JNK, p21 and p27, and the decrease in p-ERK, cyclin B1 and CDK2 expression; OA-treated MCF-7 cells were arrested in G1 owing to the activation of p-JNK, p-ERK, p21, and p27, and the decrease in p-AKT, cyclin D1, CDK4, cyclin E, and CDK2; and OA-treated U87 cells also exhibited G1 phase arrest caused by the increase in p-ERK, p-JNK, p-AKT, p21, and p27, and the decrease in cyclin D1, CDK4, cyclin E and CDK2. Thus, OA arrested the cell cycle at different phases and induced apoptosis in cancer cells. These results suggested that OA possibly altered the expression of the cell cycle regulatory proteins differently in varying types of cancer.
Effect of Nitric Oxide on Neointimal Hyperplasia based on Sex and Hormone Status
Hogg, Melissa E.; Varu, Vinit N.; Vavra, Ashley K.; Popowich, Daniel A.; Banerjee, Monisha N.; Martinez, Janet; Jiang, Qun; Saavedra, Joseph E.; Keefer, Larry K.; Kibbe, Melina R.
2011-01-01
Nitric oxide (NO)-based therapies decrease neointimal hyperplasia; however, studies have only been performed in male animal models. Thus, we sought to evaluate the effect of NO on vascular smooth muscle cells (VSMC) in vitro and neointimal hyperplasia in vivo based on sex and hormone status. In hormone-replete media, male VSMC proliferated at greater rates than female VSMC. In hormone-deplete media, female VSMC proliferated at greater rates than male VSMC. However, in both hormone environments, NO inhibited proliferation and migration to a greater extent in male versus female VSMC. These findings correlated with greater G0/G1 cell cycle arrest and changes in cell cycle protein expression in male versus female VSMC following exposure to NO. Next, the rat carotid artery injury model was performed to assess the effect of NO on neointimal hyperplasia in vivo. Consistent with the in vitro data, NO was significantly more effective at inhibiting neointimal hyperplasia in hormonally intact males versus females using weight-based dosing. An increased weight-based dose of NO in females was able to achieve efficacy equal to that in males. Surprisingly, NO was less effective at inhibiting neointimal hyperplasia in both sexes in castrated animals. In conclusion, these data suggest that NO inhibits neointimal hyperplasia more effectively in males than females and in hormonally-intact compared to castrated rats, indicating that the effect of NO in the vasculature may be sex- and hormone-dependent. PMID:21256959
Maddens, Stéphane; Charruyer, Alexandra; Plo, Isabelle; Dubreuil, Patrice; Berger, Stuart; Salles, Bernard; Laurent, Guy; Jaffrézou, Jean-Pierre
2002-08-15
Previous studies demonstrated that Kit activation confers radioprotection. However, the mechanism by which Kit signaling interferes with cellular response to ionizing radiation (IR) has not been firmly established. Based on the role of the sphingomyelin (SM) cycle apoptotic pathway in IR-induced apoptosis, we hypothesized that one of the Kit signaling components might inhibit IR-induced ceramide production or ceramide-induced apoptosis. Results show that, in both Ba/F3 and 32D murine cell lines transfected with wild-type c-kit, stem cell factor (SCF) stimulation resulted in a significant reduction of IR-induced apoptosis and cytotoxicity, whereas DNA repair remained unaffected. Moreover, SCF stimulation inhibited IR-induced neutral sphingomyelinase (N-SMase) stimulation and ceramide production. The SCF inhibitory effect on SM cycle was not influenced by wortmannin, a phosphoinositide-3 kinase (PI3K) inhibitor. The SCF protective effect was maintained in 32D-KitYF719 cells in which the PI3K/Akt signaling pathway is abolished due to mutation in Kit docking site for PI3K. In contrast, phospholipase C gamma (PLC gamma) inhibition by U73122 totally restored IR-induced N-SMase stimulation, ceramide production, and apoptosis in Kit-activated cells. Moreover, SCF did not protect 32D-KitYF728 cells (lacking a functional docking site for PLC gamma 1), from IR-induced SM cycle. Finally, SCF-induced radioprotection of human CD34(+) bone marrow cells was also inhibited by U73122. Altogether, these results suggest that SCF radioprotection is due to PLC gamma 1-dependent negative regulation of IR-induced N-SMase stimulation. Beyond the scope of Kit-expressing cells, it suggests that PLC gamma 1 status could greatly influence the post-DNA damage cellular response to IR, and perhaps, to other genotoxic agents.
Zhou, Yang; Wang, Li; Liu, Ziqing; Alimohamadi, Sahar; Yin, Chaoying; Liu, Jiandong; Qian, Li
2017-09-26
Cardiomyocytes derived from induced pluripotent stem cells (iPSC-CMs) or directly reprogrammed from non-myocytes (induced cardiomyocytes [iCMs]) are promising sources for heart regeneration or disease modeling. However, the similarities and differences between iPSC-CMs and iCMs are still unknown. Here, we performed transcriptome analyses of beating iPSC-CMs and iCMs generated from cardiac fibroblasts (CFs) of the same origin. Although both iPSC-CMs and iCMs establish CM-like molecular features globally, iPSC-CMs exhibit a relatively hyperdynamic epigenetic status, whereas iCMs exhibit a maturation status that more closely resembles that of adult CMs. Based on gene expression of metabolic enzymes, iPSC-CMs primarily employ glycolysis, whereas iCMs utilize fatty acid oxidation as the main pathway. Importantly, iPSC-CMs and iCMs exhibit different cell-cycle status, alteration of which influenced their maturation. Therefore, our study provides a foundation for understanding the pros and cons of different reprogramming approaches. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting
Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53more » status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.« less
Evaluation of sodium-nickel chloride cells for space applications
NASA Technical Reports Server (NTRS)
Hendel, B.; Dudley, G. J.
1991-01-01
The status of the European Space Agency (ESA) program on sodium nickel chloride batteries is outlined. Additionally, the results of initial tests of two prototype space cells are reported. After 2800 cycles typical of a low-earth orbit (LEO) application without failure, the recharge ratio remained at unity, the round trip energy efficiency remained high (87 percent), and the increase in internal cell resistance was modest. Initial tear-down analysis data show no degradation whatsoever of the beta-alumina electrolyte tubes. The low-rate capacity did, however drop by some 40 percent, which needs further investigation, but overall results are encouraging for future use of this couple in geosynchronous (GEO) and LEO spacecraft.
NASA Technical Reports Server (NTRS)
Baker, C. E.
1977-01-01
The program structure is presented. The activities of the thermochemical cycles program are grouped according to the following categories: (1) specific cycle development, (2) support research and technology, (3) cycle evaluation. Specific objectives and status of on-going activities are discussed. Chemical reaction series for the production of hydrogen are presented. Efficiency and economic evaluations are also discussed.
Donor cell differentiation, reprogramming, and cloning efficiency: elusive or illusive correlation?
Oback, B; Wells, D N
2007-05-01
Compared to other assisted reproductive technologies, mammalian nuclear transfer (NT) cloning is inefficient in generating viable offspring. It has been postulated that nuclear reprogramming and cloning efficiency can be increased by choosing less differentiated cell types as nuclear donors. This hypothesis is mainly supported by comparative mouse cloning experiments using early blastomeres, embryonic stem (ES) cells, and terminally differentiated somatic donor cells. We have re-evaluated these comparisons, taking into account different NT procedures, the use of donor cells from different genetic backgrounds, sex, cell cycle stages, and the lack of robust statistical significance when post-blastocyst development is compared. We argue that while the reprogrammability of early blastomeres appears to be much higher than that of somatic cells, it has so far not been conclusively determined whether differentiation status affects cloning efficiency within somatic donor cell lineages. Copyright (c) 2006 Wiley-Liss, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liao, W.-T.; Center of Excellence for Environmental Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan; Graduate Institute of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan
2010-02-15
Epidemiological evidence indicated that residents, especially cigarette smokers, in arseniasis areas had significantly higher lung cancer risk than those living in non-arseniasis areas. Thus an interaction between arsenite and cigarette smoking in lung carcinogenesis was suspected. In the present study, we investigated the interactions of a tobacco-specific carcinogen 4- (methylnitrosamino)-1-(3-pyridyl)-1-butanone (nicotine-derived nitrosamine ketone, NNK) and arsenite on lung cell transformation. BEAS-2B, an immortalized human lung epithelial cell line, was selected to test the centrosomal abnormalities and colony formation by NNK and arsenite. We found that NNK, alone, could enhance BEAS-2B cell growth at 1-5 muM. Under NNK exposure, arsenite wasmore » able to increase centrosomal abnormality as compared with NNK or arsenite treatment alone. NNK treatment could also reduce arsenite-induced G2/M cell cycle arrest and apoptosis, these cellular effects were found to be correlated with p53 dysfunction. Increased anchorage-independent growth (colony formation) of BEAS-2B cells cotreated with NNK and arsenite was also observed in soft agar. Our present investigation demonstrated that NNK could provide a p53 compromised status. Arsenite would act specifically on this p53 compromised status to induce centrosomal abnormality and colony formation. These findings provided strong evidence on the carcinogenic promotional role of arsenite under tobacco-specific carcinogen co-exposure.« less
Withaferin A activates stress signalling proteins in high risk acute lymphoblastic leukemia
Shi, Li-Huan; Wu, Xi-Jun; Liu, Jun-Shan; Gao, Yin-Bo
2015-01-01
Withaferin A, the principal bio-active component isolated from the Withaniasomnifera, has shown promising anti-leukemic activity in addition to anti-invasive and anti-metastatic activity. The present study demonstrates the effect of withaferin A on the cell cycle status and the phosphorylation/activation of proteins involved in signal transduction in t(4;11) and non-t(4;11) acute lymphoblastic leukemia (ALL) cell lines after treatment with withaferin A. The cells after treatment with the vehicle or 25 μM withaferin A for 1, 2, 4 and 8 h were examined using flow cytometric analysis. The results revealed that withaferin A treatment induced cell growth arrest at the S to G2/M phase transition of the cell cycle. Withaferin A treatment also induced the phosphorylation of stress signalling proteins, including the p38 mitogen-activated protein kinase, the c-Jun N-terminal kinase, c-Jun, the heat shock protein 27 and protein kinase B within 0 to 16 h. These results were observed using multiplex technology and Western blotting analysis. Thus withaferin A induces stress response leading to cell death. Therefore, withaferin A can be a potent therapeutic agent for the treatment of high risk ALL with chromosomal translocation t(4;11). PMID:26884834
Withaferin A activates stress signalling proteins in high risk acute lymphoblastic leukemia.
Shi, Li-Huan; Wu, Xi-Jun; Liu, Jun-Shan; Gao, Yin-Bo
2015-01-01
Withaferin A, the principal bio-active component isolated from the Withaniasomnifera, has shown promising anti-leukemic activity in addition to anti-invasive and anti-metastatic activity. The present study demonstrates the effect of withaferin A on the cell cycle status and the phosphorylation/activation of proteins involved in signal transduction in t(4;11) and non-t(4;11) acute lymphoblastic leukemia (ALL) cell lines after treatment with withaferin A. The cells after treatment with the vehicle or 25 μM withaferin A for 1, 2, 4 and 8 h were examined using flow cytometric analysis. The results revealed that withaferin A treatment induced cell growth arrest at the S to G2/M phase transition of the cell cycle. Withaferin A treatment also induced the phosphorylation of stress signalling proteins, including the p38 mitogen-activated protein kinase, the c-Jun N-terminal kinase, c-Jun, the heat shock protein 27 and protein kinase B within 0 to 16 h. These results were observed using multiplex technology and Western blotting analysis. Thus withaferin A induces stress response leading to cell death. Therefore, withaferin A can be a potent therapeutic agent for the treatment of high risk ALL with chromosomal translocation t(4;11).
QU, YING; ZHOU, CHENFEI; ZHANG, JIANIAN; CAI, QU; LI, JIANFANG; DU, TAO; ZHU, ZHENGGANG; CUI, XIAOJIANG; LIU, BINGYA
2014-01-01
SOX11 is involved in gastrulation and in malignant diseases. The aim of this study was to investigate the role of SOX11 in gastric cancer and its expression pattern and clinical significance. SOX11 overexpression cell model was used to examine in vitro and in vivo the role of SOX11 in cell growth and metastasis. Cell cycle analysis and Annexin V/PI double staining were used to investigate the effect of SOX11 on cell cycle progression and apoptosis. The expression of SOX11 in human gastric cancer was examined by immunohistochemistry. The correlation of SOX11 expression with clinicopathological characteristics and survival of patients was analyzed by Pearson’s χ2 and Kaplan-Meier analyses, respectively. Cox’s proportional hazard model was employed in multivariate analysis. SOX11 overexpression did not inhibit cell growth but strongly suppressed cell migration/invasion in vitro and in vivo. We found a significant correlation between high SOX11 protein levels and Lauren’s classification (intestinal type), differentiation status (high and medium), and early TNM stage. SOX11 is an independent prognostic factor for improved survival in gastric cancer patients. SOX11 was a potential tumor-suppressor and an independent positive prognostic factor in gastric cancer patients with less advanced clinicopathological features. PMID:24604109
Vernardis, Spyros I; Terzoudis, Konstantinos; Panoskaltsis, Nicki; Mantalaris, Athanasios
2017-02-06
Human pluripotent stem cells (hPSCs) are adhesion-dependent cells that require cultivation in colonies to maintain growth and pluripotency. Robust differentiation protocols necessitate single cell cultures that are achieved by use of ROCK (Rho kinase) inhibitors. ROCK inhibition enables maintenance of stem cell phenotype; its effects on metabolism are unknown. hPSCs were exposed to 10 μM ROCK inhibitor for varying exposure times. Pluripotency (TRA-1-81, SSEA3, OCT4, NANOG, SOX2) remained unaffected, until after prolonged exposure (96 hrs). Gas chromatography-mass spectrometry metabolomics analysis identified differences between ROCK-treated and untreated cells as early as 12 hrs. Exposure for 48 hours resulted in reduction in glycolysis, glutaminolysis, the citric acid (TCA) cycle as well as the amino acids pools, suggesting the adaptation of the cells to the new culture conditions, which was also reflected by the expression of the metabolic regulators, mTORC1 and tp53 and correlated with cellular proliferation status. While gene expression and protein levels did not reveal any changes in the physiology of the cells, metabolomics revealed the fluctuating state of the metabolism. The above highlight the usefulness of metabolomics in providing accurate and sensitive information on cellular physiological status, which could lead to the development of robust and optimal stem cell bioprocesses.
Niinemets, Ülo; Bravo, León A; Copolovici, Lucian
2018-07-01
Exposure to recurrent desiccation cycles carries a risk of accumulation of reactive oxygen species that can impair leaf physiological activity upon rehydration, but changes in filmy fern stress status through desiccation and rewatering cycles have been poorly studied. We studied foliage photosynthetic rate and volatile marker compounds characterizing cell wall modifications (methanol) and stress development (lipoxygenase [LOX] pathway volatiles and methanol) through desiccation-rewatering cycles in lower-canopy species Hymenoglossum cruentum and Hymenophyllum caudiculatum, lower- to upper-canopy species Hymenophyllum plicatum and upper-canopy species Hymenophyllum dentatum sampled from a common environment and hypothesized that lower canopy species respond more strongly to desiccation and rewatering. In all species, rates of photosynthesis and LOX volatile emission decreased with progression of desiccation, but LOX emission decreased with a slower rate than photosynthesis. Rewatering first led to an emission burst of LOX volatiles followed by methanol, indicating that the oxidative burst was elicited in the symplast and further propagated to cell walls. Changes in LOX emissions were more pronounced in the upper-canopy species that had a greater photosynthetic activity and likely a greater rate of production of photooxidants. We conclude that rewatering induces the most severe stress in filmy ferns, especially in the upper canopy species. © 2018 John Wiley & Sons Ltd.
Tagami, Keita; Tanda, Shigeru; Tokumura, Hiromi; Yamaguchi, Masaaki
2010-12-01
We report a rare case of a collision between a gastric cancer and a malignant lymphoma with a wide systemic metastasis, combined with esophagus cancer, stomach cancer and malignant lymphoma. A 73-year-old man complained of gross hematuria and swelling of the right testis. Magnetic resonance imaging (MRI) revealed that both testes were swollen with unequal contrast and there were numerous tumors in the retroperitoneal space and pelvis. He was diagnosed with malignant diffuse large B cell lymphoma by immunostaining from the extirpated right testis. He received six cycles of R-CHOP therapy. After the second cycle, partial remission was recognized, but the tumors spread again by the fourth cycle. Thereafter, we performed MTX-HOPE therapy as a salvage therapy for four cycles. During this chemotherapy, he felt epigastralgia; esophagus cancer (squamous cell carcinoma) and stomach cancer (highly-differentiated adenocarcinoma) were found by upper endoscopy. However, the gastrointestinal cancer was inoperable, since the malignant lymphoma was progressive. His general status had been exacerbated, and he died about one year after he was diagnosed with malignant lymphoma. Pathological examination revealed that the adenocarcinoma had partly collided with the malignant lymphoma.
Ma, Cynthia X.; Gao, Feng; Luo, Jingqin; Northfelt, Donald W.; Goetz, Matthew; Forero, Andres; Hoog, Jeremy; Naughton, Michael; Ademuyiwa, Foluso; Suresh, Rama; Anderson, Karen S.; Margenthaler, Julie; Aft, Rebecca; Hobday, Timothy; Moynihan, Timothy; Gillanders, William; Cyr, Amy; Eberlein, Timothy J.; Hieken, Tina; Krontiras, Helen; Guo, Zhanfang; Lee, Michelle V.; Spies, Nicholas C.; Skidmore, Zachary L.; Griffith, Obi L.; Griffith, Malachi; Thomas, Shana; Bumb, Caroline; Vij, Kiran; Bartlett, Cynthia Huang; Koehler, Maria; Al-Kateb, Hussam; Sanati, Souzan; Ellis, Matthew J.
2017-01-01
Purpose Cyclin-dependent kinase (CDK) 4/6 drives cell proliferation in estrogen receptor positive (ER+) breast cancer. This single-arm phase II neoadjuvant trial (NeoPalAna) assessed the anti-proliferative activity of the CDK4/6 inhibitor palbociclib in primary breast cancer as a prelude to adjuvant studies. Experimental Design Eligible patients with clinical stage II/III ER+/HER2- breast cancer received anastrozole 1mg daily for 4 weeks (cycle 0) (with goserelin if premenopausal), followed by adding palbociclib (125mg daily on days 1-21) on cycle 1 day 1 (C1D1) for four 28-day cycles unless C1D15 Ki67>10%, in which case patients went off study due to inadequately response. Anastrozole was continued until surgery, which occurred 3-5 weeks post palbociclib exposure. Later patients received additional 10-12 days of palbociclib (Cycle 5) immediately before surgery. Serial biopsies at baseline, C1D1, C1D15, and surgery were analyzed for Ki67, gene expression and mutation profiles. The primary endpoint was Complete Cell Cycle Arrest (CCCA: central Ki67<2.7%). Results Fifty patients enrolled. The CCCA rate was significantly higher after adding palbociclib to anastrozole (C1D15 87% vs C1D1 26%, p<0.001). Palbociclib enhanced cell cycle control over anastrozole monotherapy regardless of luminal subtype (A vs B) and PIK3CA status with activity observed across a broad range of clinicopathological and mutation profiles. Ki67 recovery at surgery following palbociclib washout was suppressed by cycle 5 palbociclib. Resistance was associated with non-luminal subtypes and persistent E2F-target gene expression. Conclusions Palbociclib is an active anti-proliferative agent for early-stage breast cancer resistant to anastrozole, however, prolonged administration may be necessary to maintain its effect. PMID:28270497
Bertheau, Philippe; Turpin, Elisabeth; Rickman, David S; Espié, Marc; de Reyniès, Aurélien; Feugeas, Jean-Paul; Plassa, Louis-François; Soliman, Hany; Varna, Mariana; de Roquancourt, Anne; Lehmann-Che, Jacqueline; Beuzard, Yves; Marty, Michel; Misset, Jean-Louis; Janin, Anne; de Thé, Hugues
2007-03-01
In breast cancers, only a minority of patients fully benefit from the different chemotherapy regimens currently in use. Identification of markers that could predict the response to a particular regimen would thus be critically important for patient care. In cell lines or animal models, tumor protein p53 (TP53) plays a critical role in modulating the response to genotoxic drugs. TP53 is activated in response to DNA damage and triggers either apoptosis or cell-cycle arrest, which have opposite effects on cell fate. Yet, studies linking TP53 status and chemotherapy response have so far failed to unambiguously establish this paradigm in patients. Breast cancers with a TP53 mutation were repeatedly shown to have a poor outcome, but whether this reflects poor response to treatment or greater intrinsic aggressiveness of the tumor is unknown. In this study we analyzed 80 noninflammatory breast cancers treated by frontline (neoadjuvant) chemotherapy. Tumor diagnoses were performed on pretreatment biopsies, and the patients then received six cycles of a dose-dense regimen of 75 mg/m(2) epirubicin and 1,200 mg/m(2) cyclophosphamide, given every 14 days. After completion of chemotherapy, all patients underwent mastectomies, thus allowing for a reliable assessment of chemotherapy response. The pretreatment biopsy samples were used to determine the TP53 status through a highly efficient yeast functional assay and to perform RNA profiling. All 15 complete responses occurred among the 28 TP53-mutant tumors. Furthermore, among the TP53-mutant tumors, nine out of ten of the highly aggressive basal subtypes (defined by basal cytokeratin [KRT] immunohistochemical staining) experienced complete pathological responses, and only TP53 status and basal subtype were independent predictors of a complete response. Expression analysis identified many mutant TP53-associated genes, including CDC20, TTK, CDKN2A, and the stem cell gene PROM1, but failed to identify a transcriptional profile associated with complete responses among TP53 mutant tumors. In patients with unresponsive tumors, mutant TP53 status predicted significantly shorter overall survival. The 15 patients with responsive TP53-mutant tumors, however, had a favorable outcome, suggesting that this chemotherapy regimen can overcome the poor prognosis generally associated with mutant TP53 status. This study demonstrates that, in noninflammatory breast cancers, TP53 status is a key predictive factor for response to this dose-dense epirubicin-cyclophosphamide regimen and further suggests that the basal subtype is exquisitely sensitive to this association. Given the well-established predictive value of complete responses for long-term survival and the poor prognosis of basal and TP53-mutant tumors treated with other regimens, this chemotherapy could be particularly suited for breast cancer patients with a mutant TP53, particularly those with basal features.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krueger, Sarah A.; Collis, Spencer J.; Joiner, Michael C.
2007-11-15
Purpose: The molecular basis of low-dose hyper-radiosensitivity (HRS) is only partially understood. The aim of this study was to define the roles of ataxia telangiectasia mutated (ATM) activity and the downstream ATM-dependent G{sub 2}-phase cell cycle checkpoint in overcoming HRS and triggering radiation resistance. Methods and Materials: Survival was measured using a high-resolution clonogenic assay. ATM Ser1981 activation was measured by Western blotting. The role of ATM was determined in survival experiments after molecular (siRNA) and chemical (0.4 mM caffeine) inhibition and chemical (20 {mu}g/mL chloroquine, 15 {mu}M genistein) activation 4-6 h before irradiation. Checkpoint responsiveness was assessed in eightmore » cell lines of differing HRS status using flow cytometry to quantify the progression of irradiated (0-2 Gy) G{sub 2}-phase cells entering mitosis, using histone H3 phosphorylation analysis. Results: The dose-response pattern of ATM activation was concordant with the transition from HRS to radioresistance. However, ATM activation did not play a primary role in initiating increased radioresistance. Rather, a relationship was discovered between the function of the downstream ATM-dependent early G{sub 2}-phase checkpoint and the prevalence and overcoming of HRS. Four cell lines that exhibited HRS failed to show low-dose (<0.3-Gy) checkpoint function. In contrast, four HRS-negative cell lines exhibited immediate cell cycle arrest for the entire 0-2-Gy dose range. Conclusion: Overcoming HRS is reliant on the function of the early G{sub 2}-phase checkpoint. These data suggest that clinical exploitation of HRS could be achieved by combining radiotherapy with chemotherapeutic agents that modulate this cell cycle checkpoint.« less
Mammary stem cells and the differentiation hierarchy: current status and perspectives
Visvader, Jane E.; Stingl, John
2014-01-01
The mammary epithelium is highly responsive to local and systemic signals, which orchestrate morphogenesis of the ductal tree during puberty and pregnancy. Based on transplantation and lineage tracing studies, a hierarchy of stem and progenitor cells has been shown to exist among the mammary epithelium. Lineage tracing has highlighted the existence of bipotent mammary stem cells (MaSCs) in situ as well as long-lived unipotent cells that drive morphogenesis and homeostasis of the ductal tree. Moreover, there is accumulating evidence for a heterogeneous MaSC compartment comprising fetal MaSCs, slow-cycling cells, and both long-term and short-term repopulating cells. In parallel, diverse luminal progenitor subtypes have been identified in mouse and human mammary tissue. Elucidation of the normal cellular hierarchy is an important step toward understanding the “cells of origin” and molecular perturbations that drive breast cancer. PMID:24888586
Asl, Leila Kheibarshekan; Dhondt, Stijn; Boudolf, Véronique; Beemster, Gerrit T S; Beeckman, Tom; Inzé, Dirk; Govaerts, Willy; De Veylder, Lieven
2011-08-01
To efficiently capture sunlight for photosynthesis, leaves typically develop into a flat and thin structure. This development is driven by cell division and expansion, but the individual contribution of these processes is currently unknown, mainly because of the experimental difficulties to disentangle them in a developing organ, due to their tight interconnection. To circumvent this problem, we built a mathematic model that describes the possible division patterns and expansion rates for individual epidermal cells. This model was used to fit experimental data on cell numbers and sizes obtained over time intervals of 1 d throughout the development of the first leaf pair of Arabidopsis (Arabidopsis thaliana). The parameters were obtained by a derivative-free optimization method that minimizes the differences between the predicted and experimentally observed cell size distributions. The model allowed us to calculate probabilities for a cell to divide into guard or pavement cells, the maximum size at which it can divide, and its average cell division and expansion rates at each point during the leaf developmental process. Surprisingly, average cell cycle duration remained constant throughout leaf development, whereas no evidence for a maximum cell size threshold for cell division of pavement cells was found. Furthermore, the model predicted that neighboring cells of different sizes within the epidermis expand at distinctly different relative rates, which could be verified by direct observations. We conclude that cell division seems to occur independently from the status of cell expansion, whereas the cell cycle might act as a timer rather than as a size-regulated machinery.
Asl, Leila Kheibarshekan; Dhondt, Stijn; Boudolf, Véronique; Beemster, Gerrit T.S.; Beeckman, Tom; Inzé, Dirk; Govaerts, Willy; De Veylder, Lieven
2011-01-01
To efficiently capture sunlight for photosynthesis, leaves typically develop into a flat and thin structure. This development is driven by cell division and expansion, but the individual contribution of these processes is currently unknown, mainly because of the experimental difficulties to disentangle them in a developing organ, due to their tight interconnection. To circumvent this problem, we built a mathematic model that describes the possible division patterns and expansion rates for individual epidermal cells. This model was used to fit experimental data on cell numbers and sizes obtained over time intervals of 1 d throughout the development of the first leaf pair of Arabidopsis (Arabidopsis thaliana). The parameters were obtained by a derivative-free optimization method that minimizes the differences between the predicted and experimentally observed cell size distributions. The model allowed us to calculate probabilities for a cell to divide into guard or pavement cells, the maximum size at which it can divide, and its average cell division and expansion rates at each point during the leaf developmental process. Surprisingly, average cell cycle duration remained constant throughout leaf development, whereas no evidence for a maximum cell size threshold for cell division of pavement cells was found. Furthermore, the model predicted that neighboring cells of different sizes within the epidermis expand at distinctly different relative rates, which could be verified by direct observations. We conclude that cell division seems to occur independently from the status of cell expansion, whereas the cell cycle might act as a timer rather than as a size-regulated machinery. PMID:21693673
Involvement of thiol-based mechanisms in plant development.
Rouhier, Nicolas; Cerveau, Delphine; Couturier, Jérémy; Reichheld, Jean-Philippe; Rey, Pascal
2015-08-01
Increasing knowledge has been recently gained regarding the redox regulation of plant developmental stages. The current state of knowledge concerning the involvement of glutathione, glutaredoxins and thioredoxins in plant development is reviewed. The control of the thiol redox status is mainly ensured by glutathione (GSH), a cysteine-containing tripeptide and by reductases sharing redox-active cysteines, glutaredoxins (GRXs) and thioredoxins (TRXs). Indeed, thiol groups present in many regulatory proteins and metabolic enzymes are prone to oxidation, ultimately leading to post-translational modifications such as disulfide bond formation or glutathionylation. This review focuses on the involvement of GSH, GRXs and TRXs in plant development. Recent studies showed that the proper functioning of root and shoot apical meristems depends on glutathione content and redox status, which regulate, among others, cell cycle and hormone-related processes. A critical role of GRXs in the formation of floral organs has been uncovered, likely through the redox regulation of TGA transcription factor activity. TRXs fulfill many functions in plant development via the regulation of embryo formation, the control of cell-to-cell communication, the mobilization of seed reserves, the biogenesis of chloroplastic structures, the metabolism of carbon and the maintenance of cell redox homeostasis. This review also highlights the tight relationships between thiols, hormones and carbon metabolism, allowing a proper development of plants in relation with the varying environment and the energy availability. GSH, GRXs and TRXs play key roles during the whole plant developmental cycle via their antioxidant functions and the redox-regulation of signaling pathways. This article is part of a Special Issue entitled Redox regulation of differentiation and de-differentiation. Copyright © 2015 Elsevier B.V. All rights reserved.
Evaluation of Intracellular Signaling Downstream Chimeric Antigen Receptors
Karlsson, Hannah; Svensson, Emma; Gigg, Camilla; Jarvius, Malin; Olsson-Strömberg, Ulla; Savoldo, Barbara; Dotti, Gianpietro; Loskog, Angelica
2015-01-01
CD19-targeting CAR T cells have shown potency in clinical trials targeting B cell leukemia. Although mainly second generation (2G) CARs carrying CD28 or 4-1BB have been investigated in patients, preclinical studies suggest that third generation (3G) CARs with both CD28 and 4-1BB have enhanced capacity. However, little is known about the intracellular signaling pathways downstream of CARs. In the present work, we have analyzed the signaling capacity post antigen stimulation in both 2G and 3G CARs. 3G CAR T cells expanded better than 2G CAR T cells upon repeated stimulation with IL-2 and autologous B cells. An antigen-driven accumulation of CAR+ cells was evident post antigen stimulation. The cytotoxicity of both 2G and 3G CAR T cells was maintained by repeated stimulation. The phosphorylation status of intracellular signaling proteins post antigen stimulation showed that 3G CAR T cells had a higher activation status than 2G. Several proteins involved in signaling downstream the TCR were activated, as were proteins involved in the cell cycle, cell adhesion and exocytosis. In conclusion, 3G CAR T cells had a higher degree of intracellular signaling activity than 2G CARs which may explain the increased proliferative capacity seen in 3G CAR T cells. The study also indicates that there may be other signaling pathways to consider when designing or evaluating new generations of CARs. PMID:26700307
Crybb2 deficiency impairs fertility in female mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gao, Qian; Sun, Li-Li; Department of Laboratory Diagnosis, Changhai Hospital, Second Military Medical University, Shanghai 200433
Highlights: • Crybb2 deletion impaired female fertility. • Crybb2 deletion dramatically affected the production of reproduction-related hormones and hormone response. • Crybb2 deletion impaired follicular development and inhibited the proliferation of granulosa cells. • Crybb2 deletion promoted follicular atresia and apoptosis in granulosa cells. - Abstract: Beta-B2-crystallin (CRYBB2), encoded by Crybb2 gene, is a major protein in the mammalian eye lens that plays an important role in maintaining the transparency of the ocular lens. However, CRYBB2 also plays important roles in many extra-lenticular tissues and organs such as the retina, brain and testis. Our previous studies demonstrated that male Crybb2more » deficient (Crybb2{sup −/−}) mice have reduced fertility compared with wild-type (WT) mice, while female Crybb2{sup −/−} mice exhibited reduced ovary weights and shorter estrous cycle percentages. Here we specifically investigated the role of CRYBB2 in the female reproductive system. Our studies revealed that ovaries from female Crybb2{sup −/−} mice exhibited significantly reduced numbers of primordial, secondary and pre-ovulatory follicles when compared with WT mice, while the rate of atretic follicles was also increased. Additionally, fewer eggs were collected from the oviduct of Crybb2{sup −/−} female mice after superovulation. Estrogen levels were higher in the metestrus and diestrus cycles of female Crybb2{sup −/−} mice, while progesterone levels were lower in diestrus cycles. Furthermore, the expression of survival and cell cycle genes, Bcl-2, Cdk4 and Ccnd2, were significantly decreased in granulosa cells isolated from female Crybb2{sup −/−} mice, consistent with the predominant expression of CRYBB2 in ovarian granulosa cells. Our results reveal a critical role for CRYBB2 in female fertility and specific effects on the proliferation and survival status of ovarian granulosa cells.« less
Cdc7 kinase - a new target for drug development.
Swords, Ronan; Mahalingam, Devalingam; O'Dwyer, Michael; Santocanale, Corrado; Kelly, Kevin; Carew, Jennifer; Giles, Francis
2010-01-01
The cell division cycle 7 (Cdc7) is a serine threonine kinase that is of critical importance in the regulation of normal cell cycle progression. Cdc7 kinase is highly conserved during evolution and much has been learned about its biological roles in humans through the study of lower eukaryotes, particularly yeasts. Two important regulator proteins, Dbf4 and Drf1, bind to and modulate the kinase activity of human Cdc7 which phosphorylates several sites on Mcm2 (minichromosome maintenance protein 2), one of the six subunits of the replicative DNA helicase needed for duplication of the genome. Through regulation of both DNA synthesis and DNA damage response, both key functions in the survival of tumour cells, Cdc7 becomes an attractive target for pharmacological inhibition. There are much data available on the pre-clinical anti-cancer effects of Cdc7 depletion and although there are no available Cdc7 inhibitors in clinical trials as yet, several lead compounds are being optimised for this purpose. In this review, we will address the current status of Cdc7 as an important target for new drug development.
Kuvibidila, Solo; Porretta, Connie; Baliga, Surendra
2014-02-01
Aneuploidy, a condition associated with altered chromosome number, hence DNA index, is frequently seen in many diseases including cancers and affects immunity. Iron, an essential nutrient for humans, modulates the immune function and the proliferation of normal and cancer cells. To determine whether impaired immunity seen in iron-deficient subjects may be related to aneuploidy, we measured spleen cell DNA index, percent of cells in different phases of the cell cycle, plasma and/or supernatant IL-2, IL-10, IL-12, and interferon-gamma in control, pair-fed, iron-deficient, and iron-replete mice (N=20-22/group). The test and control diets differed only in iron content (0.09mmol/kg versus 0.9mmol/kg) and were fed for 68days. Mean levels of hemoglobin and liver iron stores of iron-deficient and iron-replete mice were 40-60% lower than those of control and pair-fed mice (P<0.05). Mean plasma levels of IL-10, interferon-gamma and percent of cells in S+G2/M phases were lower in mice with than in those without aneuploidy (P<0.05). Lowest plasma IL-12 and interferon-gamma concentrations were observed in iron-deficient mice with aneuploidy. Mean percents of cultures with aneuploidy and DNA indexes were higher in iron-deficient and iron-replete than in control and pair-fed mice likely due to delayed cell division (P<0.05). Aneuploidy decreased the concentration of IL-2 and interferon-gamma in baseline cultures while it increased that of interferon-gamma in anti-CD3 treated cultures. Aneuploidic indexes negatively correlated with cytokine levels, percents of cells in S+G2/M phases and indicators of iron status (P<0.05). Although chromosome cytogenetics was not performed, for the first time, we report that increased aneuploidy rate may modulate the immune function during iron-deficiency. Copyright © 2014. Published by Elsevier Ltd.
Analysis of E2F factors during epidermal differentiation.
Chang, Wing Y; Dagnino, Lina
2005-01-01
The multigene E2F family of transcription factors is central in the control of cell cycle progression. The expression and activity of E2F proteins is tightly regulated transcriptionally and posttranslationally as a function of the proliferation and differentiation status of the cell. In this chapter, we review protocols designed to determine E2F mRNA abundance in tissues by in situ hybridization techniques. The ability to culture primary epidermal keratinocytes and maintain them as either undifferentiated or terminally differentiated cells allows the biochemical and molecular characterization of changes in E2F expression and activity. Thus, we also discuss in detail methods to analyze E2F protein abundance by immunoblot and their ability to bind DNA in cultured cells using electrophoretic mobility shift assays.
Tiemessen, Machteld M; Kunzmann, Steffen; Schmidt-Weber, Carsten B; Garssen, Johan; Bruijnzeel-Koomen, Carla A F M; Knol, Edward F; van Hoffen, Els
2003-12-01
Transforming growth factor (TGF)-beta has been demonstrated to play a key role in the regulation of the immune response, mainly by its suppressive function towards cells of the immune system. In humans, the effect of TGF-beta on antigen-specific established memory T cells has not been investigated yet. In this study antigen-specific CD4(+) T cell clones (TCC) were used to determine the effect of TGF-beta on antigen-specific proliferation, the activation status of the T cells and their cytokine production. This study demonstrates that TGF-beta is an adequate suppressor of antigen-specific T cell proliferation, by reducing the cell-cycle rate rather than induction of apoptosis. Addition of TGF-beta resulted in increased CD69 expression and decreased CD25 expression on T cells, indicating that TGF-beta is able to modulate the activation status of in vivo differentiated T cells. On the contrary, the antigen-specific cytokine production was not affected by TGF-beta. Although TGF-beta was suppressive towards the majority of the T cells, insensitivity of a few TCC towards TGF-beta was also observed. This could not be correlated to differential expression of TGF-beta signaling molecules such as Smad3, Smad7, SARA (Smad anchor for receptor activation) and Hgs (hepatocyte growth factor-regulated tyrosine kinase substrate). In summary, TGF-beta has a pronounced inhibitory effect on antigen-specific T cell proliferation without modulating their cytokine production.
Status of the development of rechargeable lithium cells
NASA Technical Reports Server (NTRS)
Halpert, G.; Surampudi, S.; Shen, D.; Huang, C-K.; Narayanan, S.; Vamos, E.; Perrone, D.
1993-01-01
The progress in the development of the ambient temperature lithium - titanium disulfide rechargeable cell under development at the Jet Propulsion Laboratory is described in this paper. Originally aimed at achieving a specific energy of 100 Wh/kg, 'AA' cells have demonstrated 125 Wh/kg at the C/3 discharge rate. The results of evaluating cell design parameters are discussed and cycling test data are also included in the paper. Safety tests results at various over-charge and over discharge conditions and rates proved to be uneventful. The test results of cell with built-in overcharge mechanism proved the concept was feasible. Replacing the lithium foil electrode with a Li(x)C resulted in a capacity at 1mA/cm(exp 2) of 200 mAh/gm and 235 mAh/gm at 0.167 mA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sheu, Tommy; Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas; Heymach, John V.
2014-11-15
Purpose: To retrospectively analyze factors influencing survival in patients with non-small cell lung cancer presenting with ≤3 synchronous metastatic lesions. Methods and Materials: We identified 90 patients presenting between 1998 and 2012 with non-small cell lung cancer and ≤3 metastatic lesions who had received at least 2 cycles of chemotherapy followed by surgery or radiation therapy before disease progression. The median number of chemotherapy cycles before comprehensive local therapy (CLT) (including concurrent chemoradiation as first-line therapy) was 6. Factors potentially affecting overall (OS) or progression-free survival (PFS) were evaluated with Cox proportional hazards regression. Propensity score matching was used to assessmore » the efficacy of CLT. Results: Median follow-up time was 46.6 months. Benefits in OS (27.1 vs 13.1 months) and PFS (11.3 months vs 8.0 months) were found with CLT, and the differences were statistically significant when propensity score matching was used (P ≤ .01). On adjusted analysis, CLT had a statistically significant benefit in terms of OS (hazard ratio, 0.37; 95% confidence interval, 0.20-0.70; P ≤ .01) but not PFS (P=.10). In an adjusted subgroup analysis of patients receiving CLT, favorable performance status (hazard ratio, 0.43; 95% confidence interval, 0.22-0.84; P=.01) was found to predict improved OS. Conclusions: Comprehensive local therapy was associated with improved OS in an adjusted analysis and seemed to favorably influence OS and PFS when factors such as N status, number of metastatic lesions, and disease sites were controlled for with propensity score–matched analysis. Patients with favorable performance status had improved outcomes with CLT. Ultimately, prospective, randomized trials are needed to provide definitive evidence as to the optimal treatment approach for this patient population.« less
Sheu, Tommy; Heymach, John V; Swisher, Stephen G; Rao, Ganesh; Weinberg, Jeffrey S; Mehran, Reza; McAleer, Mary Frances; Liao, Zhongxing; Aloia, Thomas A; Gomez, Daniel R
2014-11-15
To retrospectively analyze factors influencing survival in patients with non-small cell lung cancer presenting with ≤3 synchronous metastatic lesions. We identified 90 patients presenting between 1998 and 2012 with non-small cell lung cancer and ≤3 metastatic lesions who had received at least 2 cycles of chemotherapy followed by surgery or radiation therapy before disease progression. The median number of chemotherapy cycles before comprehensive local therapy (CLT) (including concurrent chemoradiation as first-line therapy) was 6. Factors potentially affecting overall (OS) or progression-free survival (PFS) were evaluated with Cox proportional hazards regression. Propensity score matching was used to assess the efficacy of CLT. Median follow-up time was 46.6 months. Benefits in OS (27.1 vs 13.1 months) and PFS (11.3 months vs 8.0 months) were found with CLT, and the differences were statistically significant when propensity score matching was used (P ≤ .01). On adjusted analysis, CLT had a statistically significant benefit in terms of OS (hazard ratio, 0.37; 95% confidence interval, 0.20-0.70; P ≤ .01) but not PFS (P=.10). In an adjusted subgroup analysis of patients receiving CLT, favorable performance status (hazard ratio, 0.43; 95% confidence interval, 0.22-0.84; P=.01) was found to predict improved OS. Comprehensive local therapy was associated with improved OS in an adjusted analysis and seemed to favorably influence OS and PFS when factors such as N status, number of metastatic lesions, and disease sites were controlled for with propensity score-matched analysis. Patients with favorable performance status had improved outcomes with CLT. Ultimately, prospective, randomized trials are needed to provide definitive evidence as to the optimal treatment approach for this patient population. Copyright © 2014 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Isebaert, Sofie F., E-mail: sofie.isebaert@med.kuleuven.be; Swinnen, Johannes V.; McBride, William H.
2011-09-01
Purpose: During the past decade, many clinical trials with both monoclonal antibodies and small molecules that target the insulin-like growth factor-type 1 receptor (IGF-1R) have been launched. Despite the important role of IGF-1R signaling in radioresistance, studies of such agents in combination with radiotherapy are lagging behind. Therefore, the aim of this study was to investigate the effect of the small molecule IGF-1R kinase inhibitor NVP-AEW541 on the intrinsic radioresistance of prostate cancer cells. Methods and Materials: The effect of NVP-AEW541 on cell proliferation, cell viability, IGF-1R signaling, radiosensitivity, cell cycle distribution, and double strand break repair was determined inmore » three human prostate cancer cell lines (PC3, DU145, 22Rv1). Moreover, the importance of the PTEN pathway status was explored by means of transfection experiments with constitutively active Akt or inactive kinase-dead Akt. Results: NVP-AEW541 inhibited cell proliferation and decreased cell viability in a time-and dose-dependent manner in all three cell lines. Radiosensitization was observed in the PTEN wild-type cell lines DU145 and 22Rv1 but not in the PTEN-deficient PC3 cell line. NVP-AEW541-induced radiosensitization coincided with downregulation of phospho-Akt levels and high levels of residual double strand breaks. The importance of PTEN status in the radiosensitization effect was confirmed by transfection experiments with constitutively active Akt or inactive kinase-dead Akt. Conclusions: NVP-AEW541 enhances the effect of ionizing radiation in PTEN wild-type, but not in PTEN-deficient, prostate cancer cells. Proper patient selection based on the PTEN status of the tumor will be critical to the achievement of optimal results in clinical trials in which the combination of radiotherapy and this IGF-1R inhibitor is being explored.« less
L-glutamine is a key parameter in the immunosuppression phenomenon
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hammami, Ines; Chen, Jingkui; Bronte, Vincenzo
2012-09-07
Highlights: Black-Right-Pointing-Pointer The absence of L-Gln inhibited iNOS activity, but not ARG1 one. Black-Right-Pointing-Pointer MSC-1 cells were able to inhibit Jurkat cell growth, but not their viability. Black-Right-Pointing-Pointer Absence of L-Gln down-regulated central carbon metabolism and L-Arg recycling. Black-Right-Pointing-Pointer Absence of L-Gln deteriorated cell bioenergetic status. Black-Right-Pointing-Pointer L-Gln is crucial for iNOS-mediated immunosuppression activity. -- Abstract: Suppression of tumour-specific T-cell functions by myeloid-derived suppressor cells (MDSCs) is a dominant mechanism of tumour escape. MDSCs express two enzymes, i.e. inducible nitric oxide synthase (iNOS) and arginase (ARG1), which metabolize the semi-essential amino acid L-arginine (L-Arg) whose bioavailability is crucial for T-cellmore » proliferation and functions. Recently, we showed that glutaminolysis supports MDSC maturation process by ensuring the supply of intermediates and energy. In this work, we used an immortalized cell line derived from mouse MDSCs (MSC-1 cell line) to further investigate the role of L-glutamine (L-Gln) in the maintenance of MDSC immunosuppressive activity. Culturing MSC-1 cells in L-Gln-limited medium inhibited iNOS activity, while ARG1 was not affected. MSC-1 cells inhibited Jukat cell growth without any noticeable effect on their viability. The characterization of MSC-1 cell metabolic profile revealed that L-Gln is an important precursor of lactate production via the NADP{sup +}-dependent malic enzyme, which co-produces NADPH. Moreover, the TCA cycle activity was down-regulated in the absence of L-Gln and the cell bioenergetic status was deteriorated accordingly. This strongly suggests that iNOS activity, but not that of ARG1, is related to an enhanced central carbon metabolism and a high bioenergetic status. Taken altogether, our results suggest that the control of glutaminolysis fluxes may represent a valuable target for immunotherapy.« less
Zalc, Antoine; Hayashi, Shinichiro; Auradé, Frédéric; Bröhl, Dominique; Chang, Ted; Mademtzoglou, Despoina; Mourikis, Philippos; Yao, Zizhen; Cao, Yi; Birchmeier, Carmen; Relaix, Frédéric
2014-07-01
A central question in development is to define how the equilibrium between cell proliferation and differentiation is temporally and spatially regulated during tissue formation. Here, we address how interactions between cyclin-dependent kinase inhibitors essential for myogenic growth arrest (p21(cip1) and p57(kip2)), the Notch pathway and myogenic regulatory factors (MRFs) orchestrate the proliferation, specification and differentiation of muscle progenitor cells. We first show that cell cycle exit and myogenic differentiation can be uncoupled. In addition, we establish that skeletal muscle progenitor cells require Notch signaling to maintain their cycling status. Using several mouse models combined with ex vivo studies, we demonstrate that Notch signaling is required to repress p21(cip1) and p57(kip2) expression in muscle progenitor cells. Finally, we identify a muscle-specific regulatory element of p57(kip2) directly activated by MRFs in myoblasts but repressed by the Notch targets Hes1/Hey1 in progenitor cells. We propose a molecular mechanism whereby information provided by Hes/Hey downstream of Notch as well as MRF activities are integrated at the level of the p57(kip2) enhancer to regulate the decision between progenitor cell maintenance and muscle differentiation. © 2014. Published by The Company of Biologists Ltd.
Effects of carbon-ion beams on human pancreatic cancer cell lines that differ in genetic status.
Matsui, Yoshifumi; Asano, Takehide; Kenmochi, Takashi; Iwakawa, Mayumi; Imai, Takashi; Ochiai, Takenori
2004-02-01
The relative biologic effectiveness (RBE) of carbon-ion beams at 3 different linear energy transfer (LET) values (13, 50, and 80 keV/microm) accelerated by the Heavy Ion Medical Accelerator in Chiba on human pancreatic cancer cell lines differing in genetic status was determined. The RBE values were calculated as D10, the dose (Gy) required to reduce the surviving fraction to 10%, relative to X-rays. We also investigated apoptosis and the relationship between D10 and the cell cycle checkpoint using morphologic examination and flow cytometry analysis, respectively. The RBE values calculated by the D10 values ranged from 1.16 to 1.77 for the 13-keV/microm beam and from 1.83 to 2.46 for the 80-keV/microm beam. A correlation between the D10 values of each cell line and intensity of G2/M arrest was observed. In contrast, LET values did not clearly correlate with induction of apoptosis. These results suggest that carbon-ion beam therapy is a promising modality. Elucidation of the mechanisms of G2/M arrest and apoptosis may provide clues to enhancing the effects of radiation on pancreatic cancer.
Avilov, Sergiy; Magnus, Julie; Cusack, Stephen; Naffakh, Nadia
2016-01-01
Influenza viruses are a global health concern because of the permanent threat of novel emerging strains potentially capable of causing pandemics. Viral ribonucleoproteins (vRNPs) containing genomic RNA segments, nucleoprotein oligomers, and the viral polymerase, play a central role in the viral replication cycle. Our knowledge about critical events such as vRNP assembly and interactions with other viral and cellular proteins is poor and could be substantially improved by time lapse imaging of the infected cells. However, such studies are limited by the difficulty to achieve live-cell compatible labeling of active vRNPs. Previously we designed the first unimpaired recombinant influenza WSN-PB2-GFP11 virus allowing fluorescent labeling of the PB2 subunit of the viral polymerase (Avilov et al., J.Virol. 2012). Here, we simultaneously labeled the viral PB2 protein using the above-mentioned strategy, and virus-encoded progeny RNPs through spontaneous incorporation of transiently expressed NP-mCherry fusion proteins during RNP assembly in live infected cells. This dual labeling enabled us to visualize progeny vRNPs throughout the infection cycle and to characterize independently the mobility, oligomerization status and interactions of vRNP components in the nuclei of live infected cells. PMID:26978069
Bioenergetic Impairment in Congenital Muscular Dystrophy Type 1A and Leigh Syndrome Muscle Cells
Fontes-Oliveira, Cibely C.; Steinz, Maarten; Schneiderat, Peter; Mulder, Hindrik; Durbeej, Madeleine
2017-01-01
Skeletal muscle has high energy requirement and alterations in metabolism are associated with pathological conditions causing muscle wasting and impaired regeneration. Congenital muscular dystrophy type 1A (MDC1A) is a severe muscle disorder caused by mutations in the LAMA2 gene. Leigh syndrome (LS) is a neurometabolic disease caused by mutations in genes related to mitochondrial function. Skeletal muscle is severely affected in both diseases and a common feature is muscle weakness that leads to hypotonia and respiratory problems. Here, we have investigated the bioenergetic profile in myogenic cells from MDC1A and LS patients. We found dysregulated expression of genes related to energy production, apoptosis and proteasome in myoblasts and myotubes. Moreover, impaired mitochondrial function and a compensatory upregulation of glycolysis were observed when monitored in real-time. Also, alterations in cell cycle populations in myoblasts and enhanced caspase-3 activity in myotubes were observed. Thus, we have for the first time demonstrated an impairment of the bioenergetic status in human MDC1A and LS muscle cells, which could contribute to cell cycle disturbance and increased apoptosis. Our findings suggest that skeletal muscle metabolism might be a promising pharmacological target in order to improve muscle function, energy efficiency and tissue maintenance of MDC1A and LS patients. PMID:28367954
Ory, Benjamin; Charrier, Céline; Brion, Régis; Blanchard, Frederic; Redini, Françoise; Heymann, Dominique
2014-01-01
Osteosarcoma is the most common primary malignant bone tumour characterized by osteoid production and/or osteolytic lesions of bone. A lack of response to chemotherapeutic treatments shows the importance of exploring new therapeutic methods. Imatinib mesylate (Gleevec, Novartis Pharma), a tyrosine kinase inhibitor, was originally developed for the treatment of chronic myeloid leukemia. Several studies revealed that imatinib mesylate inhibits osteoclast differentiation through the M-CSFR pathway and activates osteoblast differentiation through PDGFR pathway, two key cells involved in the vicious cycle controlling the tumour development. The present study investigated the in vitro effects of imatinib mesylate on the proliferation, apoptosis, cell cycle, and migration ability of five osteosarcoma cell lines (human: MG-63, HOS; rat: OSRGA; mice: MOS-J, POS-1). Imatinib mesylate was also assessed as a curative and preventive treatment in two syngenic osteosarcoma models: MOS-J (mixed osteoblastic/osteolytic osteosarcoma) and POS-1 (undifferentiated osteosarcoma). Imatinib mesylate exhibited a dose-dependent anti-proliferative effect in all cell lines studied. The drug induced a G0/G1 cell cycle arrest in most cell lines, except for POS-1 and HOS cells that were blocked in the S phase. In addition, imatinib mesylate induced cell death and strongly inhibited osteosarcoma cell migration. In the MOS-J osteosarcoma model, oral administration of imatinib mesylate significantly inhibited the tumour development in both preventive and curative approaches. A phospho-receptor tyrosine kinase array kit revealed that PDGFRα, among 7 other receptors (PDFGFRβ, Axl, RYK, EGFR, EphA2 and 10, IGF1R), appears as one of the main molecular targets for imatinib mesylate. In the light of the present study and the literature, it would be particularly interesting to revisit therapeutic evaluation of imatinib mesylate in osteosarcoma according to the tyrosine-kinase receptor status of patients. PMID:24599309
De Pauw, Ines; Lardon, Filip; Van den Bossche, Jolien; Baysal, Hasan; Fransen, Erik; Deschoolmeester, Vanessa; Pauwels, Patrick; Peeters, Marc; Vermorken, Jan Baptist; Wouters, An
2018-06-01
The epidermal growth factor receptor (EGFR, HER1) is a therapeutic target in head and neck squamous cell carcinoma (HNSCC). After initial promising results with EGFR-targeted therapies such as cetuximab, therapeutic resistance has become a major clinical problem, and new treatment options are therefore necessary. Moreover, the relationship between HER receptors, anti-EGFR therapies, and the human papillomavirus (HPV) status in HNSCC is not fully understood. In contrast to first-generation EGFR inhibitors, afatinib irreversibly inhibits multiple HER receptors simultaneously. Therefore, treatment with afatinib might result in a more pronounced therapeutic benefit, even in patients experiencing cetuximab resistance. In this study, the cytotoxic effect of afatinib as single agent and in combination with cisplatin was investigated in cetuximab-sensitive, intrinsically cetuximab-resistant, and acquired cetuximab-resistant HNSCC cell lines with different HPV status under normoxia and hypoxia. Furthermore, the influence of cetuximab resistance, HPV, and hypoxia on the expression of HER receptors was investigated. Our results demonstrated that afatinib was able to establish cytotoxicity in cetuximab-sensitive, intrinsically cetuximab-resistant, and acquired cetuximab-resistant HNSCC cell lines, independent of the HPV status. However, cross-resistance between cetuximab and afatinib might be possible. Treatment with afatinib caused a G 0 /G 1 cell cycle arrest as well as induction of apoptotic cell death. Additive to antagonistic interactions between afatinib and cisplatin could be observed. Neither cetuximab resistance nor HPV status significantly influenced the expression of HER receptors in HNSCC cell lines. In contrast, the expression of EGFR, HER2, and HER3 was significantly altered under hypoxia. Oxygen deficiency is a common characteristic of HNSCC tumors, and these hypoxic tumor regions often contain cells that are more resistant to treatment. However, we observed that afatinib maintained its cytotoxic effect under hypoxia. In conclusion, our preclinical data support the hypothesis that afatinib might be a promising therapeutic strategy to treat patients with HNSCC experiencing intrinsic or acquired cetuximab resistance. © 2018 The Authors. Published by FEBS Press and John Wiley & Sons Ltd.
Antunes, Ricardo F; Brandão, Cláudia; Carvalho, Gonçalo; Girão, Cristina; Arosa, Fernando A
2009-10-01
Red blood cells (RBC) have emerged as a novel regulatory cell type endowed with bioactivities toward activated human T cells. Herein we show that the RBC bioactivities act on intracellular pathways initiated by T cell receptor (TCR)-dependent and -independent stimuli,including IL-2, IL-15, and the mixture of phorbol dibutyrate and ionomycin. The RBC bioactivities preserve the antioxidant status and are capable of rescuing activated T cells from cell death induced by serum deprivation. They are not mediated by glycosylphosphatidylinositol-linked receptors or sialic acids, and kinetic studies revealed that they hasten the entrance into the cell cycle. By using cyclosporine A (CsA) and rapamycin (Rapa) we show that the RBC bioactivities are calcineurin-dependent. Thus, treatment of T cells with CsA, but not Rapa, impaired RBC bioactivities, and preincubation of RBC with CsA completely abolished their bioactivities. We have demonstrated that RBC carry out bioactivities that are sensitive to CsA.
MtDNA depleted PC3 cells exhibit Warburg effect and cancer stem cell features
Li, Xiaoran; Zhong, Yali; Lu, Jie; Axcrona, Karol; Eide, Lars; Syljuåsen, Randi G.; Peng, Qian; Wang, Junbai; Zhang, Hongquan; Goscinski, Mariusz Adam; Kvalheim, Gunnar; Nesland, Jahn M.; Suo, Zhenhe
2016-01-01
Reducing mtDNA content was considered as a critical step in the metabolism restructuring for cell stemness restoration and further neoplastic development. However, the connections between mtDNA depletion and metabolism reprograming-based cancer cell stemness in prostate cancers are still lack of studies. Here, we demonstrated that human CRPC cell line PC3 tolerated high concentration of the mtDNA replication inhibitor ethidium bromide (EtBr) and the mtDNA depletion triggered a universal metabolic remodeling process. Failure in completing that process caused lethal consequences. The mtDNA depleted (MtDP) PC3 cells could be steadily maintained in the special medium in slow cycling status. The MtDP PC3 cells contained immature mitochondria and exhibited Warburg effect. Furthermore, the MtDP PC3 cells were resistant to therapeutic treatments and contained greater cancer stem cell-like subpopulations: CD44+, ABCG2+, side-population and ALDHbright. In conclusion, these results highlight the association of mtDNA content, mitochondrial function and cancer cell stemness features. PMID:27248169
Regulation of replicative senescence by NADP+ -dependent isocitrate dehydrogenase.
Kil, In Sup; Huh, Tae Lin; Lee, Young Sup; Lee, You Mie; Park, Jeen-Woo
2006-01-01
The free radical hypothesis of aging postulates that senescence is due to an accumulation of cellular oxidative damage, caused largely by reactive oxygen species that are produced as by-products of normal metabolic processes. Recently, we demonstrated that the control of cytosolic and mitochondrial redox balance and the cellular defense against oxidative damage is one of the primary functions of cytosolic (IDPc) and mitochondrial NADP+ -dependent isocitrate dehydrogenase (IDPm) by supplying NADPH for antioxidant systems. In this paper, we demonstrate that modulation of IDPc or IDPm activity in IMR-90 cells regulates cellular redox status and replicative senescence. When we examined the regulatory role of IDPc and IDPm against the aging process with IMR-90 cells transfected with cDNA for IDPc or IDPm in sense and antisense orientations, a clear inverse relationship was observed between the amount of IDPc or IDPm expressed in target cells and their susceptibility to senescence, which was reflected by changes in replicative potential, cell cycle, senescence-associated beta-galactosidase activity, expression of p21 and p53, and morphology of cells. Furthermore, lipid peroxidation, oxidative DNA damage, and intracellular peroxide generation were higher and cellular redox status shifted to a prooxidant condition in the cell lines expressing the lower level of IDPc or IDPm. The results suggest that IDPc and IDPm play an important regulatory role in cellular defense against oxidative stress and in the senescence of IMR-90 cells.
Wu, Feng-Hua; Mu, Lei; Li, Xiao-Lan; Hu, Yi-Bing; Liu, Hui; Han, Lin-Tao; Gong, Jian-Ping
2017-10-03
The concept of cancer stem cells has been proposed in various malignancies including colorectal cancer. Recent studies show direct evidence for quiescence slow-cycling cells playing a role in cancer stem cells. There exists an urgent need to isolate and better characterize these slow-cycling cells. In this study, we developed a new model to enrich slow-cycling tumor cells using cell-cycle inducer combined with cell cycle-dependent chemotherapy in vitro and in vivo . Our results show that Short-term exposure of colorectal cancer cells to chemotherapy combined with cell-cycle inducer enriches for a cell-cycle quiescent tumor cell population. Specifically, these slow-cycling tumor cells exhibit increased chemotherapy resistance in vitro and tumorigenicity in vivo . Notably, these cells are stem-cell like and participate in metastatic dormancy. Further exploration indicates that slow-cycling colorectal cancer cells in our model are less sensitive to cytokine-induced-killer cell mediated cytotoxic killing in vivo and in vitro . Collectively, our cell cycle inducer combined chemotherapy exposure model enriches for a slow-cycling, dormant, chemo-resistant tumor cell sub-population that are resistant to cytokine induced killer cell based immunotherapy. Studying unique signaling pathways in dormant tumor cells enriched by cell cycle inducer combined chemotherapy treatment is expected to identify novel therapeutic targets for preventing tumor recurrence.
Wu, Feng-Hua; Mu, Lei; Li, Xiao-Lan; Hu, Yi-Bing; Liu, Hui; Han, Lin-Tao; Gong, Jian-Ping
2017-01-01
The concept of cancer stem cells has been proposed in various malignancies including colorectal cancer. Recent studies show direct evidence for quiescence slow-cycling cells playing a role in cancer stem cells. There exists an urgent need to isolate and better characterize these slow-cycling cells. In this study, we developed a new model to enrich slow-cycling tumor cells using cell-cycle inducer combined with cell cycle-dependent chemotherapy in vitro and in vivo. Our results show that Short-term exposure of colorectal cancer cells to chemotherapy combined with cell-cycle inducer enriches for a cell-cycle quiescent tumor cell population. Specifically, these slow-cycling tumor cells exhibit increased chemotherapy resistance in vitro and tumorigenicity in vivo. Notably, these cells are stem-cell like and participate in metastatic dormancy. Further exploration indicates that slow-cycling colorectal cancer cells in our model are less sensitive to cytokine-induced-killer cell mediated cytotoxic killing in vivo and in vitro. Collectively, our cell cycle inducer combined chemotherapy exposure model enriches for a slow-cycling, dormant, chemo-resistant tumor cell sub-population that are resistant to cytokine induced killer cell based immunotherapy. Studying unique signaling pathways in dormant tumor cells enriched by cell cycle inducer combined chemotherapy treatment is expected to identify novel therapeutic targets for preventing tumor recurrence. PMID:29108242
Azzoli, Christopher G.; Baker, Sherman; Temin, Sarah; Pao, William; Aliff, Timothy; Brahmer, Julie; Johnson, David H.; Laskin, Janessa L.; Masters, Gregory; Milton, Daniel; Nordquist, Luke; Pfister, David G.; Piantadosi, Steven; Schiller, Joan H.; Smith, Reily; Smith, Thomas J.; Strawn, John R.; Trent, David; Giaccone, Giuseppe
2009-01-01
The purpose of this article is to provide updated recommendations for the treatment of patients with stage IV non–small-cell lung cancer. A literature search identified relevant randomized trials published since 2002. The scope of the guideline was narrowed to chemotherapy and biologic therapy. An Update Committee reviewed the literature and made updated recommendations. One hundred sixty-two publications met the inclusion criteria. Recommendations were based on treatment strategies that improve overall survival. Treatments that improve only progression-free survival prompted scrutiny of toxicity and quality of life. For first-line therapy in patients with performance status of 0 or 1, a platinum-based two-drug combination of cytotoxic drugs is recommended. Nonplatinum cytotoxic doublets are acceptable for patients with contraindications to platinum therapy. For patients with performance status of 2, a single cytotoxic drug is sufficient. Stop first-line cytotoxic chemotherapy at disease progression or after four cycles in patients who are not responding to treatment. Stop two-drug cytotoxic chemotherapy at six cycles even in patients who are responding to therapy. The first-line use of gefitinib may be recommended for patients with known epidermal growth factor receptor (EGFR) mutation; for negative or unknown EGFR mutation status, cytotoxic chemotherapy is preferred. Bevacizumab is recommended with carboplatin-paclitaxel, except for patients with certain clinical characteristics. Cetuximab is recommended with cisplatin-vinorelbine for patients with EGFR-positive tumors by immunohistochemistry. Docetaxel, erlotinib, gefitinib, or pemetrexed is recommended as second-line therapy. Erlotinib is recommended as third-line therapy for patients who have not received prior erlotinib or gefitinib. Data are insufficient to recommend the routine third-line use of cytotoxic drugs. Data are insufficient to recommend routine use of molecular markers to select chemotherapy. PMID:19917871
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shim, Ki Shuk; Department of Neonatology, Medical University of Vienna, Waehringer Guertel 18-20, A-1090 Vienna; Rosner, Margit
Bach1 and Bach2 are evolutionarily related members of the BTB-basic region leucine zipper transcription factor family. We found that Bach2 downregulates cell proliferation of N1E-115 cells and negatively affects their potential to differentiate. Nuclear localization of the cyclin-dependent kinase inhibitor p21 is known to arrest cell cycle progression, and cytoplasmic p21 has been shown to promote neuronal differentiation of N1E-115 cells. We found that ectopic Bach2 causes upregulation of p21 expression in the nucleus and in the cytoplasm in undifferentiated N1E-115 cells. In differentiated cells, Bach2 specifically triggers upregulation of cytoplasmic p21. Our data suggest that Bach2 expression could representmore » a switch during the process of neuronal differentiation. Bach2 is not expressed in neuronal precursor cells. It would have negative effects on proliferation and differentiation of these cells. In differentiated neuronal cells Bach2 expression is upregulated, which could allow Bach2 to function as a gatekeeper of the differentiated status.« less
Das, Dipanwita; Sengupta, Isha; Sarkar, Neelakshi; Pal, Ananya; Saha, Debraj; Bandopadhyay, Manikankana; Das, Chandrima; Narayan, Jimmy; Singh, Shivaram Prasad; Chakrabarti, Sekhar; Chakravarty, Runu
2017-01-14
Toll like receptors (TLRs) play an important role in innate immunity and various studies suggest that TLRs play a crucial role in pathogenesis of hepatitis B virus (HBV) infection. The present study aims in looking into the status of crucial host and viral gene expression on inciting TLR7. The transcription of TLR7 pathway signaling molecules and HBV DNA viral load were quantified by Real Time-PCR after stimulation of TLR7 with its imiquimod based ligand, R837. Cell cycle analysis was performed using flow-cytometry. Expression of TLR7 and chief cell cycle regulator governing G1/S transition, p53 was also seen in liver biopsysss samples of CHB patients. HBV induced alteration in histone modifications in HepG2 cells and its restoration on TLR7 activation was determined using western blot. The TLR7 expression remains downregulated in HepG2.2.15 cells and in liver biopsy samples from CHB patients. Interestingly HBV DNA viral load showed an inverse relationship with the TLR7 expression in the biopsy samples. We also evaluated the anti-viral activity of R837, an agonist of TLR7. It was observed that there was a suppression of HBV replication and viral protein production upon TLR7 stimulation. R837 triggers the anti-viral action probably through the Jun N-terminal Kinase (JNK) pathway. We also observed a downregulation of histone H3K9Me3 repression mark upon R837 treatment in HBV replicating HepG2.2.15 cells, mimicking that of un-infected HepG2 cells. Additionally, the G1/S cell cycle arrest introduced by HBV in HepG2.2.15 cells was released upon ligand treatment. The study thus holds a close insight into the changes in hepatocyte micro-environment on TLR7 stimulation in HBV infection.
Gong, Qiaoke; Davis, Molly; Chipitsyna, Galina; Yeo, Charles J; Arafat, Hwyda A
2010-07-01
Pancreatic ductal adenocarcinoma (PDA) is an aggressive malignancy with an annual mortality rate close to its annual incidence. We recently demonstrated that angiotensin II (AngII) type 1 receptor (AT1R) might be involved in PDA angiogenesis. This study evaluated the antiproliferative and proapoptotic effects of an AT1R blocker, losartan, in PDA cells with different p53 mutation status. Cell cycle was analyzed by flow cytometric analysis of DNA content; apoptosis by annexin V-fluorescein isothiocyanate (V-FITC) and terminal deoxytransferase (TdT)-mediated dUTP nick-end labeling staining; messenger RNA and protein by real-time polymerase chain reaction and Western blotting; caspase-3 activity by colorimetric assay; and promoter activity by luciferase assay. Losartan dose-dependently decreased cell survival and increased their preG1 accumulation. It also increased p53, p21, p27, and Bax and reduced Bcl-2 and Bcl-xl expression. In wtp53 cells, losartan increased p53 transcription and activated caspase-3 in both cell lines. However, its proapoptotic effects in mtp53 cells were mainly caspase-3-dependent. Our data describe the involvement of AT1R in PDA cell apoptotic machinery and provide the first evidences that losartan stimulates the proapoptotic signaling pathways regardless of the p53 mutation status. As loss of p53 function is frequently observed in PDA patients, our data suggest AT1R blockade as a novel therapeutic strategy to control PDA growth.
Puszynska, Anna M; O'Shea, Erin K
2017-01-01
The transcription factor RpaA is the master regulator of circadian transcription in cyanobacteria, driving genome-wide oscillations in mRNA abundance. Deletion of rpaA has no effect on viability in constant light conditions, but renders cells inviable in cycling conditions when light and dark periods alternate. We investigated the mechanisms underlying this viability defect, and demonstrate that the rpaA- strain cannot maintain appropriate energy status at night, does not accumulate carbon reserves during the day, and is defective in transcription of genes crucial for utilization of carbohydrate stores at night. Reconstruction of carbon utilization pathways combined with provision of an external carbon source restores energy charge and viability of the rpaA- strain in light/dark cycling conditions. Our observations highlight how a circadian output pathway controls and temporally coordinates essential pathways in carbon metabolism to maximize fitness of cells facing periodic energy limitations. DOI: http://dx.doi.org/10.7554/eLife.23210.001 PMID:28430105
Lal, R; Hillerdal, G N; Shah, R N H; Crosse, B; Thompson, J; Nicolson, M; Vikström, A; Potter, V A; Visseren-Grul, C; Lorenzo, M; D'yachkova, Y; Bourayou, N; Summers, Y J
2015-08-01
To evaluate the feasibility and adherence to home delivery (HD) of pemetrexed maintenance treatment in patients with advanced non-squamous non-small cell lung cancer (nsqNSCLC). Exploratory, prospective, single-arm, Phase II study in advanced nsqNSCLC patients, with an Eastern Cooperative Oncology Group (ECOG) performance status of 0/1 that did not progress after 4 first-line induction cycles of a platinum doublet. The first cycle of pemetrexed (500mg/m(2)) was hospital administered, further cycles were HD until progressive disease or discontinuation. Feasibility was assessed by the adherence rate to HD (probability of reversion to hospital administration or treatment discontinuation due to HD) as primary endpoint, and by health-related quality-of-life (HRQoL: EQ-5D, lung cancer symptom scale [LCSS]), satisfaction with HD, overall survival (OS), and safety. 52 patients (UK & Sweden) received a median of 4 (range 1-19) pemetrexed maintenance cycles. Adherence rate up to Cycle 6 was 98.0% (95% confidence interval [CI]: 86.4%, 99.7%). All but 2 patients remained on HD. 1 patient discontinued after Cycle 1 (patient decision), and 1 after Cycle 6 (non-compliance with oral dexamethasone). 87% (33/38) of the patients preferred home to hospital treatment and in 90% (28/31) of cases, physicians were satisfied with distant management of patients. During HD Cycles 2-4 mean change from baseline ranged from 3.0 to 7.7 for EQ-5D visual analog scale. The 6-month OS rate was 73% (95% CI: 58%, 83%). 1 patient had an HD-related adverse event (device-related infection, Grade 2) and 1 patient died after Cycle 1, before HD, due to a possibly drug-related atypical pneumonia. HD of pemetrexed maintenance treatment in patients with advanced nsqNSCLC was feasible, safe, and preferred by patients, while maintaining HRQoL. Physicians were satisfied with distant patient management. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Yang, Tzi-Peng; Lee, Huei-Jane; Ou, Ting-Tsz; Chang, Ya-Ju; Wang, Chau-Jong
2012-07-11
The polyphenols in mulberry leaf possess the ability to inhibit cell proliferation, invasion, and metastasis of tumors. It was reported that the p53 status plays an important role in switching apoptosis and the cell cycle following adenosine monophosphate-activated protein kinase (AMPK) activation. In this study, we aimed to detect the effect of the mulberry leaf polyphenol extract (MLPE) on inducing cell death in p53-negative (Hep3B) and p53-positive (Hep3B with transfected p53) hepatocellular carcinoma cells and also to clarify the role of p53 in MLPE-treated cells. After treatment of the Hep3B cells with MLPE, apoptosis was induced via the AMPK/PI3K/Akt and Bcl-2 family pathways. Transient transfection of p53 into Hep3B cells led to switching autophagy instead of apoptosis by MLPE treatment. We demonstrated that acridine orange staining and protein expressions of LC-3 and beclin-1 were increased in p53-transfected cells. These results implied induction of apoptosis or autophagy in MLPE-treated hepatocellular carcinoma cells can be due to the p53 status. We also found MLPE can not only activate AMPK but also diminish fatty acid synthase, a molecular target for cancer inhibition. At present, our results indicate MLPE can play an active role in mediating the cell death of hepatocellular carcinoma cells and the p53 might play an important role in regulating the death mechanisms.
McClusky, Leon Mendel
2008-05-01
Using the simple cystic spermatogenesis in the shark testis as a model, we previously reported the relative resistance of immature spermatogonia (stem cell and early-stage spermatogonia) to apoptosis in the normal testis and after spermatoxicant exposure in vivo. Apoptosis was monitored by fluorescence image analysis of living cysts, using the validated acridine orange (AO) vital staining technique. Findings show that FBS simultaneously stimulates both apoptosis and [(3)H]thymidine incorporation in immature spermatogonial clones in a concentration-dependent manner in vitro. Furthermore, androgen inhibits apoptosis and increases cyst viability, more so with 10% FBS than with 1% FBS. All the effects were as a function of spermatogenic activity status but were distinct in early-stage spermatogonial cysts isolated from testes awakening from the previous winter spermatogenic arrest period. Results are discussed in the context of the alternating germ-Sertoli cell population kinetics of early-stage spermatogonial cysts in Squalus acanthias's protracted testicular cycle.
Xu, Yimiao; Diao, Ying; Qi, Shimei; Pan, Xiaolong; Wang, Qi; Xin, Yinqiang; Cao, Xiang; Ruan, Jie; Zhao, Zhihui; Luo, Lan; Liu, Chang; Yin, Zhimin
2013-05-01
DNA damage activates p53 and its downstream target genes, which further leads to apoptosis or survival either by the cell cycle arrest or by DNA repair. In many tumors, the heat shock protein 27 (Hsp27) is expressed at high levels to provide protection against anticancer drugs. However, the roles of Hsp27 in p53-mediated cellular responses to DNA damage are controversial. Here, we investigated the interplay between the phosphorylation status of Hsp27 and p53 in kidney 293A (HEK293A) cells and found that over-expressing phosphorylated Hsp27 mimics (Hsp27-3D) activated p53/p21 in an ATM-dependent manner. In addition, incubation with doxorubicin (Dox), an anticancer drug, induced Hsp27 phosphorylation in human adenocarcinoma cells (MCF-7). In contrast, inhibition of Hsp27 phosphorylation retarded both p53 induction and p21 accumulation, and led to cell apoptosis. Furthermore, phosphorylated Hsp27 increased p53 nuclear importing and its downstream target gene expression such as p21 and MDM2, while de-phosphorylated Hsp27 impeded this procession. Taken together, our data suggest that Hsp27, in its phosphorylated or de-phosphorylated status, plays different roles in regulating p53 pathway and cell survival. Copyright © 2013 Elsevier Inc. All rights reserved.
Laranjeiro, Ricardo; Tamai, T Katherine; Letton, William; Hamilton, Noémie; Whitmore, David
2018-04-01
Studies from a number of model systems have shown that the circadian clock controls expression of key cell cycle checkpoints, thus providing permissive or inhibitory windows in which specific cell cycle events can occur. However, a major question remains: Is the clock actually regulating the cell cycle through such a gating mechanism or, alternatively, is there a coupling process that controls the speed of cell cycle progression? Using our light-responsive zebrafish cell lines, we address this issue directly by synchronizing the cell cycle in culture simply by changing the entraining light-dark (LD) cycle in the incubator without the need for pharmacological intervention. Our results show that the cell cycle rapidly reentrains to a shifted LD cycle within 36 h, with changes in p21 expression and subsequent S phase timing occurring within the first few hours of resetting. Reentrainment of mitosis appears to lag S phase resetting by 1 circadian cycle. The range of entrainment of the zebrafish clock to differing LD cycles is large, from 16 to 32 hour periods. We exploited this feature to explore cell cycle entrainment at both the population and single cell levels. At the population level, cell cycle length is shortened or lengthened under corresponding T-cycles, suggesting that a 1:1 coupling mechanism is capable of either speeding up or slowing down the cell cycle. However, analysis at the single cell level reveals that this, in fact, is not true and that a gating mechanism is the fundamental method of timed cell cycle regulation in zebrafish. Cell cycle length at the single cell level is virtually unaltered with varying T-cycles.
Tamai, T. Katherine; Letton, William; Hamilton, Noémie; Whitmore, David
2018-01-01
Studies from a number of model systems have shown that the circadian clock controls expression of key cell cycle checkpoints, thus providing permissive or inhibitory windows in which specific cell cycle events can occur. However, a major question remains: Is the clock actually regulating the cell cycle through such a gating mechanism or, alternatively, is there a coupling process that controls the speed of cell cycle progression? Using our light-responsive zebrafish cell lines, we address this issue directly by synchronizing the cell cycle in culture simply by changing the entraining light-dark (LD) cycle in the incubator without the need for pharmacological intervention. Our results show that the cell cycle rapidly reentrains to a shifted LD cycle within 36 h, with changes in p21 expression and subsequent S phase timing occurring within the first few hours of resetting. Reentrainment of mitosis appears to lag S phase resetting by 1 circadian cycle. The range of entrainment of the zebrafish clock to differing LD cycles is large, from 16 to 32 hour periods. We exploited this feature to explore cell cycle entrainment at both the population and single cell levels. At the population level, cell cycle length is shortened or lengthened under corresponding T-cycles, suggesting that a 1:1 coupling mechanism is capable of either speeding up or slowing down the cell cycle. However, analysis at the single cell level reveals that this, in fact, is not true and that a gating mechanism is the fundamental method of timed cell cycle regulation in zebrafish. Cell cycle length at the single cell level is virtually unaltered with varying T-cycles. PMID:29444612
Wiedemuth, Ralf; Klink, Barbara; Fujiwara, Mamoru; Schröck, Evelin; Tatsuka, Masaaki; Schackert, Gabriele; Temme, Achim
2016-10-01
The mitotic Aurora B kinase is overexpressed in tumors and various inhibitors for Aurora B are currently under clinical assessments. However, when considering Aurora B kinase inhibitors as anticancer drugs, their mode of action and the role of p53 status as a possible predictive factor for response still needs to be investigated. In this study, we analyzed the effects of selective Aurora B inhibition using AZD1152-HQPA/Barasertib (AZD1152) on HCT116 cells, U87-MG, corresponding isogenic p53-deficient cells and a primary glioblastoma cell line. AZD1152 treatment caused polyploidy and non-apoptotic cell death in all cell lines irrespective of p53 status and was accompanied by poly-merotelic kinetochore-microtubule attachments and DNA damage. In p53 wild-type cells a DNA damage response induced an inefficient pseudo-G1 cell cycle arrest, which was not able to halt ongoing endoreplication of cells. Of note, release of tumor cells from AZD1152 resulted in recovery of aneuploid progenies bearing numerical and structural chromosomal aberrations. Yet, AZD1152 treatment enhanced death receptor TRAIL-R2 levels in all tumor cell lines investigated. A concomitant increase of the activating natural killer (NK) cell ligand MIC A/B in p53-deficient cells and an induction of FAS/CD95 in cells containing p53 rendered AZD1152-treated cells more susceptible for NK-cell-mediated lysis. Our study mechanistically explains a p53-independent mode of action of a chemical Aurora B inhibitor and suggests a potential triggering of antitumoral immune responses, following polyploidization of tumor cells, which might constrain recovery of aneuploid tumor cells. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Intrinsic fluorescence biomarkers in cells treated with chemopreventive drugs
NASA Astrophysics Data System (ADS)
Kirkpatrick, Nathaniel D.; Brands, William R.; Zou, Changping; Brewer, Molly A.; Utzinger, Urs
2005-03-01
Non-invasive monitoring of cellular metabolism offers promising insights into areas ranging from biomarkers for drug activity to cancer diagnosis. Fluorescence spectroscopy can be utilized in order to exploit endogenous fluorophores, typically metabolic co-factors nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FAD), and estimate the redox status of the sample. Fluorescence spectroscopy was applied to follow metabolic changes in epithelial ovarian cells as well as bladder epithelial cancer cells during treatment with a chemopreventive drug that initiates cellular quiescence. Fluorescence signals consistent with NADH, FAD, and tryptophan were measured to monitor cellular activity, redox status, and protein content. Cells were treated with varying concentrations of N-4-(hydroxyphenyl) retinamide (4-HPR) and measured in a stable environment with a sensitive fluorescence spectrometer. A subset of measurements was completed on a low concentration of cells to demonstrate feasibility for medical application such as in bladder or ovary washes. Results suggest that all of the cells responded with similar dose dependence but started at different estimated redox ratio baseline levels correlating with cell cycle, growth inhibition, and apoptosis assays. NADH and tryptophan related fluorescence changed significantly while FAD related fluorescence remained unaltered. Fluorescence data collected from approximately 1000 - 2000 cells, comparable to a bladder or ovary wash, was measurable and useful for future experiments. This study suggests that future intrinsic biomarker measurements may need to be most sensitive to changes in NADH and tryptophan related fluorescence while using FAD related fluorescence to help estimate the baseline redox ratio and predict response to chemopreventive agents.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miao, Xiaobing; Wu, Yaxun; Wang, Yuchan
YB-1 is a multifunctional protein, which has been shown to correlate with resistance to treatment of various tumor types. This study investigated the expression and biologic function of YB-1 in diffuse large B-cell lymphoma (DLBCL). Immunohistochemical analysis showed that the expression statuses of YB-1 and pYB-1{sup S102} were reversely correlated with the clinical outcomes of DLBCL patients. In addition, we found that YB-1 could promote the proliferation of DLBCL cells by accelerating the G1/S transition. Ectopic expression of YB-1 could markedly increase the expression of cell cycle regulators cyclin D1 and cyclin E. Furthermore, we found that adhesion of DLBCLmore » cells to fibronectin (FN) could increase YB-1 phosphorylation at Ser102 and pYB-1{sup S102} nuclear translocation. In addition, overexpression of YB-1 could increase the adhesion of DLBCL cells to FN. Intriguingly, we found that YB-1 overexpression could confer drug resistance through cell-adhesion dependent and independent mechanisms in DLBCL. Silencing of YB-1 could sensitize DLBCL cells to mitoxantrone and overcome cell adhesion-mediated drug resistance (CAM-DR) phenotype in an AKT-dependent manner. - Highlights: • The expression statuses of YB-1 and pYB-1{sup S102} are reversely correlated with outcomes of DLBCL patients. • YB-1 promotes cell proliferation by accelerating G1/S transition in DLBCL. • YB-1 confers drug resistance to mitoxantrone in DLBCL.« less
Espié, Marc; de Reyniès, Aurélien; Feugeas, Jean-Paul; Plassa, Louis-François; Soliman, Hany; Varna, Mariana; de Roquancourt, Anne; Lehmann-Che, Jacqueline; Beuzard, Yves; Marty, Michel; Misset, Jean-Louis; Janin, Anne; de Thé, Hugues
2007-01-01
Background In breast cancers, only a minority of patients fully benefit from the different chemotherapy regimens currently in use. Identification of markers that could predict the response to a particular regimen would thus be critically important for patient care. In cell lines or animal models, tumor protein p53 (TP53) plays a critical role in modulating the response to genotoxic drugs. TP53 is activated in response to DNA damage and triggers either apoptosis or cell-cycle arrest, which have opposite effects on cell fate. Yet, studies linking TP53 status and chemotherapy response have so far failed to unambiguously establish this paradigm in patients. Breast cancers with a TP53 mutation were repeatedly shown to have a poor outcome, but whether this reflects poor response to treatment or greater intrinsic aggressiveness of the tumor is unknown. Methods and Findings In this study we analyzed 80 noninflammatory breast cancers treated by frontline (neoadjuvant) chemotherapy. Tumor diagnoses were performed on pretreatment biopsies, and the patients then received six cycles of a dose-dense regimen of 75 mg/m2 epirubicin and 1,200 mg/m2 cyclophosphamide, given every 14 days. After completion of chemotherapy, all patients underwent mastectomies, thus allowing for a reliable assessment of chemotherapy response. The pretreatment biopsy samples were used to determine the TP53 status through a highly efficient yeast functional assay and to perform RNA profiling. All 15 complete responses occurred among the 28 TP53-mutant tumors. Furthermore, among the TP53-mutant tumors, nine out of ten of the highly aggressive basal subtypes (defined by basal cytokeratin [KRT] immunohistochemical staining) experienced complete pathological responses, and only TP53 status and basal subtype were independent predictors of a complete response. Expression analysis identified many mutant TP53-associated genes, including CDC20, TTK, CDKN2A, and the stem cell gene PROM1, but failed to identify a transcriptional profile associated with complete responses among TP53 mutant tumors. In patients with unresponsive tumors, mutant TP53 status predicted significantly shorter overall survival. The 15 patients with responsive TP53-mutant tumors, however, had a favorable outcome, suggesting that this chemotherapy regimen can overcome the poor prognosis generally associated with mutant TP53 status. Conclusions This study demonstrates that, in noninflammatory breast cancers, TP53 status is a key predictive factor for response to this dose-dense epirubicin–cyclophosphamide regimen and further suggests that the basal subtype is exquisitely sensitive to this association. Given the well-established predictive value of complete responses for long-term survival and the poor prognosis of basal and TP53-mutant tumors treated with other regimens, this chemotherapy could be particularly suited for breast cancer patients with a mutant TP53, particularly those with basal features. PMID:17388661
Insights into Host Cell Modulation and Induction of New Cells by the Corn Smut Ustilago maydis.
Redkar, Amey; Matei, Alexandra; Doehlemann, Gunther
2017-01-01
Many filamentous fungal pathogens induce drastic modulation of host cells causing abnormal infectious structures such as galls, or tumors that arise as a result of re-programming in the original developmental cell fate of a colonized host cell. Developmental consequences occur predominantly with biotrophic phytopathogens. This suggests that these host structures result as an outcome of efficient defense suppression and intimate fungal-host interaction to suit the pathogen's needs for completion of its infection cycle. This mini-review mainly summarizes host cell re-programming that occurs in the Ustilago maydis - maize interaction, in which the pathogen deploys cell-type specific effector proteins with varying activities. The fungus senses the physiological status and identity of colonized host cells and re-directs the endogenous developmental program of its host. The disturbance of host cell physiology and cell fate leads to novel cell shapes, increased cell size, and/or the number of host cells. We particularly highlight the strategies of U. maydis to induce physiologically varied host organs to form the characteristic tumors in both vegetative and floral parts of maize.
Cell cycle regulation in human embryonic stem cells: links to adaptation to cell culture.
Barta, Tomas; Dolezalova, Dasa; Holubcova, Zuzana; Hampl, Ales
2013-03-01
Cell cycle represents not only a tightly orchestrated mechanism of cell replication and cell division but it also plays an important role in regulation of cell fate decision. Particularly in the context of pluripotent stem cells or multipotent progenitor cells, regulation of cell fate decision is of paramount importance. It has been shown that human embryonic stem cells (hESCs) show unique cell cycle characteristics, such as short doubling time due to abbreviated G1 phase; these properties change with the onset of differentiation. This review summarizes the current understanding of cell cycle regulation in hESCs. We discuss cell cycle properties as well as regulatory machinery governing cell cycle progression of undifferentiated hESCs. Additionally, we provide evidence that long-term culture of hESCs is accompanied by changes in cell cycle properties as well as configuration of several cell cycle regulatory molecules.
Ultrastructural changes of goat corpus luteum during the estrous cycle.
Jiang, Yi-Fan; Hsu, Meng-Chieh; Cheng, Chiung-Hsiang; Tsui, Kuan-Hao; Chiu, Chih-Hsien
2016-07-01
The present study was designed to study the ultrastructure of goat corpora lutea (CL, n=10) and structural changes as related to steroidogenic functions during the estrous cycle. The reproduction status of goats was estimated by analyzing serum progesterone concentrations. The CL at various stages was surgically collected. To characterize ultrastructural features associated with steroidogenesis, tissue and cellular structures were studied. Blood supplies were examined based on features of the endothelial cells and capillary structures in the CL. Activated endothelial cells and developing vessels were observed in the early stage, whereas mature endothelial cells, accumulating extracellular matrix fibers, and stabilized vessels were observed in the middle and late stages of assessment. In the late stage of assessment, shrunken goat luteal cells scattered around the capillaries were detected and formed circular regression areas. Features of autophagy and luteal cell apoptosis were noted. In large luteal cells, steroidogenic organelles were present, including microvillar channels, endoplasmic reticulum, and mitochondria. Conformational changes in the endoplasmic reticulum and increased mitochondria with tubular cristae were observed in the early-middle CL transitions. In contrast, mitochondria swelled and the cristae transformed to the lamellar type in the late stage, suggesting that organelle plasticity could contribute to steroidogenesis in goat CL. In conclusion, results suggest angiogenesis occurs in early developing CL and programmed cell death occurred in the late stage of CL assessment in the present study. Structures and quantiles of steroidogenic organelles are correlated with the steroidogenic functions in goats. Copyright © 2016 Elsevier B.V. All rights reserved.
Control of G1 arrest after DNA damage.
Kastan, M B; Kuerbitz, S J
1993-01-01
The temporal relationship between DNA damage and DNA replication may be critical in determining whether the genetic changes necessary for cellular transformation occur after DNA damage. Recent characterization of the mechanisms responsible for alterations in cell-cycle progression after DNA damage in our laboratory have implicated the p53 (tumor suppressor) protein in the G1 arrest that occurs after certain types of DNA damage. In particular, we found that levels of p53 protein increased rapidly and transiently after nonlethal doses of gamma irradiation (XRT) in hematopoietic cells with wild-type, but not mutant, p53 genes. These changes in p53 protein levels were temporally linked to a transient G1 arrest in these cells. Hematopoietic cells with mutant or absent p53 genes did not exhibit this G1 arrest, through they continued to demonstrate a G2 arrest. We recently extended these observations of a tight correlation between the status of the endogenous p53 genes and this G1 arrest after XRT and this cell-cycle alteration after XRT was then established by transfecting cells lacking endogenous p53 genes with a wild-type gene and observing acquisition of the G1 arrest and by transfecting cells processing endogenous wild-type p53 genes with a mutant p53 gene and observing loss of the G1 arrest after XRT. These observations and their significance for our understanding of the mechanisms of DNA damage-induced cellular transformation are discussed. PMID:8013425
Sun, Yanyan; Zhang, Yanli; Wang, Ziyu; Song, Yang; Wang, Feng
2013-01-01
Background Somatic cell nuclear transfer (SCNT) is a promising technique to produce transgenic cloned mammalian, including transgenic goats which may produce Human Lactoferrin (hLF). However, success percentage of SCNT is low, because of gestational and neonatal failure of transgenic embryos. According to the studies on cattle and mice, DNA methylation of some imprinted genes, which plays a vital role in the reprogramming of embryo in NT maybe an underlying mechanism. Methodology/Principal Findings Fibroblast cells were derived from the ear of a two-month-old goat. The vector expressing hLF was constructed and transfected into fibroblasts. G418 selection, EGFP expression, PCR, and cell cycle distribution were applied sequentially to select transgenic cells clones. After NT and embryo transfer, five transgenic cloned goats were obtained from 240 cloned transgenic embryos. These transgenic goats were identified by 8 microsatellites genotyping and southern blot. Of the five transgenic goats, 3 were lived after birth, while 2 were dead during gestation. We compared differential methylation regions (DMR) pattern of two paternally imprinted genes (H19 and IGF2R) of the ear tissues from the lived transgenic goats, dead transgenic goats, and control goats from natural reproduction. Hyper-methylation pattern appeared in cloned aborted goats, while methylation status was relatively normal in cloned lived goats compared with normal goats. Conclusions/Significance In this study, we generated five hLF transgenic cloned goats by SCNT. This is the first time the DNA methylation of lived and dead transgenic cloned goats was compared. The results demonstrated that the methylation status of DMRs of H19 and IGF2R were different in lived and dead transgenic goats and therefore this may be potentially used to assess the reprogramming status of transgenic cloned goats. Understanding the pattern of gene imprinting may be useful to improve cloning techniques in future. PMID:24204972
ERIC Educational Resources Information Center
Yu, Lucy C.; And Others
1993-01-01
Data from 204 female faculty or faculty wives show that family life cycle (number and ages of children) and family migration significantly affect wives' employment status. Only extremely highly educated women initiate family relocation. (SK)
Menstrual Cycle Phase Does Not Predict Political Conservatism
Scott, Isabel M.; Pound, Nicholas
2015-01-01
Recent authors have reported a relationship between women's fertility status, as indexed by menstrual cycle phase, and conservatism in moral, social and political values. We conducted a survey to test for the existence of a relationship between menstrual cycle day and conservatism. 2213 women reporting regular menstrual cycles provided data about their political views. Of these women, 2208 provided information about their cycle date, 1260 provided additional evidence of reliability in self-reported cycle date, and of these, 750 also indicated an absence of hormonal disruptors such as recent hormonal contraception use, breastfeeding or pregnancy. Cycle day was used to estimate day-specific fertility rate (probability of conception); political conservatism was measured via direct self-report and via responses to the "Moral Foundations” questionnaire. We also recorded relationship status, which has been reported to interact with menstrual cycle phase in determining political preferences. We found no evidence of a relationship between estimated cyclical fertility changes and conservatism, and no evidence of an interaction between relationship status and cyclical fertility in determining political attitudes. Our findings were robust to multiple inclusion/exclusion criteria and to different methods of estimating fertility and measuring conservatism. In summary, the relationship between cycle-linked reproductive parameters and conservatism may be weaker or less reliable than previously thought. PMID:25923332
Menstrual cycle phase does not predict political conservatism.
Scott, Isabel M; Pound, Nicholas
2015-01-01
Recent authors have reported a relationship between women's fertility status, as indexed by menstrual cycle phase, and conservatism in moral, social and political values. We conducted a survey to test for the existence of a relationship between menstrual cycle day and conservatism. 2213 women reporting regular menstrual cycles provided data about their political views. Of these women, 2208 provided information about their cycle date, 1260 provided additional evidence of reliability in self-reported cycle date, and of these, 750 also indicated an absence of hormonal disruptors such as recent hormonal contraception use, breastfeeding or pregnancy. Cycle day was used to estimate day-specific fertility rate (probability of conception); political conservatism was measured via direct self-report and via responses to the "Moral Foundations" questionnaire. We also recorded relationship status, which has been reported to interact with menstrual cycle phase in determining political preferences. We found no evidence of a relationship between estimated cyclical fertility changes and conservatism, and no evidence of an interaction between relationship status and cyclical fertility in determining political attitudes. Our findings were robust to multiple inclusion/exclusion criteria and to different methods of estimating fertility and measuring conservatism. In summary, the relationship between cycle-linked reproductive parameters and conservatism may be weaker or less reliable than previously thought.
A map of protein dynamics during cell-cycle progression and cell-cycle exit
Gookin, Sara; Min, Mingwei; Phadke, Harsha; Chung, Mingyu; Moser, Justin; Miller, Iain; Carter, Dylan
2017-01-01
The cell-cycle field has identified the core regulators that drive the cell cycle, but we do not have a clear map of the dynamics of these regulators during cell-cycle progression versus cell-cycle exit. Here we use single-cell time-lapse microscopy of Cyclin-Dependent Kinase 2 (CDK2) activity followed by endpoint immunofluorescence and computational cell synchronization to determine the temporal dynamics of key cell-cycle proteins in asynchronously cycling human cells. We identify several unexpected patterns for core cell-cycle proteins in actively proliferating (CDK2-increasing) versus spontaneously quiescent (CDK2-low) cells, including Cyclin D1, the levels of which we find to be higher in spontaneously quiescent versus proliferating cells. We also identify proteins with concentrations that steadily increase or decrease the longer cells are in quiescence, suggesting the existence of a continuum of quiescence depths. Our single-cell measurements thus provide a rich resource for the field by characterizing protein dynamics during proliferation versus quiescence. PMID:28892491
Cell division cycle 45 promotes papillary thyroid cancer progression via regulating cell cycle.
Sun, Jing; Shi, Run; Zhao, Sha; Li, Xiaona; Lu, Shan; Bu, Hemei; Ma, Xianghua
2017-05-01
Cell division cycle 45 was reported to be overexpressed in some cancer-derived cell lines and was predicted to be a candidate oncogene in cervical cancer. However, the clinical and biological significance of cell division cycle 45 in papillary thyroid cancer has never been investigated. We determined the expression level and clinical significance of cell division cycle 45 using The Cancer Genome Atlas, quantitative real-time polymerase chain reaction, and immunohistochemistry. A great upregulation of cell division cycle 45 was observed in papillary thyroid cancer tissues compared with adjacent normal tissues. Furthermore, overexpression of cell division cycle 45 positively correlates with more advanced clinical characteristics. Silence of cell division cycle 45 suppressed proliferation of papillary thyroid cancer cells via G1-phase arrest and inducing apoptosis. The oncogenic activity of cell division cycle 45 was also confirmed in vivo. In conclusion, cell division cycle 45 may serve as a novel biomarker and a potential therapeutic target for papillary thyroid cancer.
Oback, Björn
2008-07-01
Despite more than a decade of research efforts, farm animal cloning by somatic cell nuclear transfer (SCNT) is still frustratingly inefficient. Inefficiency manifests itself at different levels, which are currently not well integrated. At the molecular level, it leads to widespread genetic, epigenetic and transcriptional aberrations in cloned embryos. At the organismal level, these genome-wide abnormalities compromise development of cloned foetuses and offspring. Specific molecular defects need to be causally linked to specific cloned phenotypes, in order to design specific treatments to correct them. Cloning efficiency depends on the ability of the nuclear donor cell to be fully reprogrammed into an embryonic state and the ability of the enucleated recipient cell to carry out the reprogramming reactions. It has been postulated that reprogrammability of the somatic donor cell epigenome is influenced by its differentiation status. However, direct comparisons between cells of divergent differentiation status within several somatic lineages have found no conclusive evidence for this. Choosing somatic stem cells as donors has not improved cloning efficiency, indicating that donor cell type may be less critical for cloning success. Different recipient cells, on the other hand, vary in their reprogramming ability. In bovine, using zygotes instead of oocytes has increased cloning success. Other improvements in livestock cloning efficiency include better coordinating donor cell type with cell cycle stage and aggregating cloned embryos. In the future, it will be important to demonstrate if these small increases at every step are cumulative, adding up to an integrated cloning protocol with greatly improved efficiency.
NASA Technical Reports Server (NTRS)
Zhang, Ying; Lim, Chang U K.; Williams, Eli S.; Zhou, Junqing; Zhang, Qinming; Fox, Michael H.; Bailey, Susan M.; Liber, Howard L.
2005-01-01
Hypomorphic mutations which lead to decreased function of the NBS1 gene are responsible for Nijmegen breakage syndrome, a rare autosomal recessive hereditary disorder that imparts an increased predisposition to development of malignancy. The NBS1 protein is a component of the MRE11/RAD50/NBS1 complex that plays a critical role in cellular responses to DNA damage and the maintenance of chromosomal integrity. Using small interfering RNA transfection, we have knocked down NBS1 protein levels and analyzed relevant phenotypes in two closely related human lymphoblastoid cell lines with different p53 status, namely wild-type TK6 and mutated WTK1. Both TK6 and WTK1 cells showed an increased level of ionizing radiation-induced mutation at the TK and HPRT loci, impaired phosphorylation of H2AX (gamma-H2AX), and impaired activation of the cell cycle checkpoint regulating kinase, Chk2. In TK6 cells, ionizing radiation-induced accumulation of p53/p21 and apoptosis were reduced. There was a differential response to ionizing radiation-induced cell killing between TK6 and WTK1 cells after NBS1 knockdown; TK6 cells were more resistant to killing, whereas WTK1 cells were more sensitive. NBS1 deficiency also resulted in a significant increase in telomere association that was independent of radiation exposure and p53 status. Our results provide the first experimental evidence that NBS1 deficiency in human cells leads to hypermutability and telomere associations, phenotypes that may contribute to the cancer predisposition seen among patients with this disease.
Pelevina, I I; Aleshchenko, A V; Antoshchina, M M; Kudriashova, O M; Nikonova, M F; Riabchenko, N I; Serebrianyĭ, A M; Iarilin, A A
2013-01-01
Expression of activation (CD69) and proliferation (Ki67) markers, their connection with each other, with the oxidative status (reactive oxygen species--ROS) and with radiosensitivity (determined by micronucleus test) have been studied on stimulated blood lymphocytes from Moscow inhabitants. It was shown that the content of T-lymphocytes with the expressed CD69 and the content of T-lymphocytes with the expressed Ki67 markers correlate (r = 0.571; p = 0.0004). We can suppose that expression of the CD69 marker (24 h after PHA stimulation) is needed for the cell cycle progression, but it is not enough for the high expression of Ki67 markers 48 h after stimulation (DNA synthesis phase). It was discovered that T-lymphocytes with the CD69 marker or T-lymphocytes with the Ki67 marker are connected by the negative correlation with the frequency of irradiated cell with micronucleus (MN) r = -0.487; p = 0.010; r = -0.440; p = 0.008, respectively. So we can suppose that lymphocyte radiosensitivity decreased with the increase of expression activation and proliferation markers. It was shown that radiosensitivity determined by MN test is not connected with the oxidative status determined by the reactive oxygen species content including superoxide anion radicals. It is possible to explain by the fact that the ROS concentration has been determined in non-stimulated lymphocytes, but frequencies of cells with MN - in the stimulated cells 48 h after stimulation. Using separate analysis of individual differences by the studied parameters that were determined in the same people, it was shown that individual differences are high enough in the same cases. For example, the radiosensitivity when cells were irradiated 48 h after stimulation, ROS concentration, cell content with activation and proliferation markers. In conclusion, we can say that we failed to find important correlation between the parameters studied. However, the presence of individual differences in the marker expression, the frequency of MN cells, the oxidative status in the usual inhabitants, typical donors in Moscow, is very important.
Landscape and flux reveal a new global view and physical quantification of mammalian cell cycle
Li, Chunhe; Wang, Jin
2014-01-01
Cell cycles, essential for biological function, have been investigated extensively. However, enabling a global understanding and defining a physical quantification of the stability and function of the cell cycle remains challenging. Based upon a mammalian cell cycle gene network, we uncovered the underlying Mexican hat landscape of the cell cycle. We found the emergence of three local basins of attraction and two major potential barriers along the cell cycle trajectory. The three local basins of attraction characterize the G1, S/G2, and M phases. The barriers characterize the G1 and S/G2 checkpoints, respectively, of the cell cycle, thus providing an explanation of the checkpoint mechanism for the cell cycle from the physical perspective. We found that the progression of a cell cycle is determined by two driving forces: curl flux for acceleration and potential barriers for deceleration along the cycle path. Therefore, the cell cycle can be promoted (suppressed), either by enhancing (suppressing) the flux (representing the energy input) or by lowering (increasing) the barrier along the cell cycle path. We found that both the entropy production rate and energy per cell cycle increase as the growth factor increases. This reflects that cell growth and division are driven by energy or nutrition supply. More energy input increases flux and decreases barrier along the cell cycle path, leading to faster oscillations. We also identified certain key genes and regulations for stability and progression of the cell cycle. Some of these findings were evidenced from experiments whereas others lead to predictions and potential anticancer strategies. PMID:25228772
Identification of Cell Cycle-Regulated Genes by Convolutional Neural Network.
Liu, Chenglin; Cui, Peng; Huang, Tao
2017-01-01
The cell cycle-regulated genes express periodically with the cell cycle stages, and the identification and study of these genes can provide a deep understanding of the cell cycle process. Large false positives and low overlaps are big problems in cell cycle-regulated gene detection. Here, a computational framework called DLGene was proposed for cell cycle-regulated gene detection. It is based on the convolutional neural network, a deep learning algorithm representing raw form of data pattern without assumption of their distribution. First, the expression data was transformed to categorical state data to denote the changing state of gene expression, and four different expression patterns were revealed for the reported cell cycle-regulated genes. Then, DLGene was applied to discriminate the non-cell cycle gene and the four subtypes of cell cycle genes. Its performances were compared with six traditional machine learning methods. At last, the biological functions of representative cell cycle genes for each subtype are analyzed. Our method showed better and more balanced performance of sensitivity and specificity comparing to other machine learning algorithms. The cell cycle genes had very different expression pattern with non-cell cycle genes and among the cell-cycle genes, there were four subtypes. Our method not only detects the cell cycle genes, but also describes its expression pattern, such as when its highest expression level is reached and how it changes with time. For each type, we analyzed the biological functions of the representative genes and such results provided novel insight to the cell cycle mechanisms. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Analysis of DNA methylation and gene expression in radiation-resistant head and neck tumors.
Chen, Xiaofei; Liu, Liang; Mims, Jade; Punska, Elizabeth C; Williams, Kristin E; Zhao, Weiling; Arcaro, Kathleen F; Tsang, Allen W; Zhou, Xiaobo; Furdui, Cristina M
2015-01-01
Resistance to radiation therapy constitutes a significant challenge in the treatment of head and neck squamous cell cancer (HNSCC). Alteration in DNA methylation is thought to play a role in this resistance. Here, we analyzed DNA methylation changes in a matched model of radiation resistance for HNSCC using the Illumina HumanMethylation450 BeadChip. Our results show that compared to radiation-sensitive cells (SCC-61), radiation-resistant cells (rSCC-61) had a significant increase in DNA methylation. After combining these results with microarray gene expression data, we identified 84 differentially methylated and expressed genes between these 2 cell lines. Ingenuity Pathway Analysis revealed ILK signaling, glucocorticoid receptor signaling, fatty acid α-oxidation, and cell cycle regulation as top canonical pathways associated with radiation resistance. Validation studies focused on CCND2, a protein involved in cell cycle regulation, which was identified as hypermethylated in the promoter region and downregulated in rSCC-61 relative to SCC-61 cells. Treatment of rSCC-61 and SCC-61 with the DNA hypomethylating agent 5-aza-2'deoxycitidine increased CCND2 levels only in rSCC-61 cells, while treatment with the control reagent cytosine arabinoside did not influence the expression of this gene. Further analysis of HNSCC data from The Cancer Genome Atlas found increased methylation in radiation-resistant tumors, consistent with the cell culture data. Our findings point to global DNA methylation status as a biomarker of radiation resistance in HNSCC, and suggest a need for targeted manipulation of DNA methylation to increase radiation response in HNSCC.
Cell cycle phases in the unequal mother/daughter cell cycles of Saccharomyces cerevisiae.
Brewer, B J; Chlebowicz-Sledziewska, E; Fangman, W L
1984-11-01
During cell division in the yeast Saccharomyces cerevisiae mother cells produce buds (daughter cells) which are smaller and have longer cell cycles. We performed experiments to compare the lengths of cell cycle phases in mothers and daughters. As anticipated from earlier indirect observations, the longer cell cycle time of daughter cells is accounted for by a longer G1 interval. The S-phase and the G2-phase are of the same duration in mother and daughter cells. An analysis of five isogenic strains shows that cell cycle phase lengths are independent of cell ploidy and mating type.
The Global Regulatory Architecture of Transcription during the Caulobacter Cell Cycle
Zhou, Bo; Schrader, Jared M.; Kalogeraki, Virginia S.; Abeliuk, Eduardo; Dinh, Cong B.; Pham, James Q.; Cui, Zhongying Z.; Dill, David L.; McAdams, Harley H.; Shapiro, Lucy
2015-01-01
Each Caulobacter cell cycle involves differentiation and an asymmetric cell division driven by a cyclical regulatory circuit comprised of four transcription factors (TFs) and a DNA methyltransferase. Using a modified global 5′ RACE protocol, we globally mapped transcription start sites (TSSs) at base-pair resolution, measured their transcription levels at multiple times in the cell cycle, and identified their transcription factor binding sites. Out of 2726 TSSs, 586 were shown to be cell cycle-regulated and we identified 529 binding sites for the cell cycle master regulators. Twenty-three percent of the cell cycle-regulated promoters were found to be under the combinatorial control of two or more of the global regulators. Previously unknown features of the core cell cycle circuit were identified, including 107 antisense TSSs which exhibit cell cycle-control, and 241 genes with multiple TSSs whose transcription levels often exhibited different cell cycle timing. Cumulatively, this study uncovered novel new layers of transcriptional regulation mediating the bacterial cell cycle. PMID:25569173
Indirect-fired gas turbine dual fuel cell power cycle
Micheli, Paul L.; Williams, Mark C.; Sudhoff, Frederick A.
1996-01-01
A fuel cell and gas turbine combined cycle system which includes dual fuel cell cycles combined with a gas turbine cycle wherein a solid oxide fuel cell cycle operated at a pressure of between 6 to 15 atms tops the turbine cycle and is used to produce CO.sub.2 for a molten carbonate fuel cell cycle which bottoms the turbine and is operated at essentially atmospheric pressure. A high pressure combustor is used to combust the excess fuel from the topping fuel cell cycle to further heat the pressurized gas driving the turbine. A low pressure combustor is used to combust the excess fuel from the bottoming fuel cell to reheat the gas stream passing out of the turbine which is used to preheat the pressurized air stream entering the topping fuel cell before passing into the bottoming fuel cell cathode. The CO.sub.2 generated in the solid oxide fuel cell cycle cascades through the system to the molten carbonate fuel cell cycle cathode.
The global regulatory architecture of transcription during the Caulobacter cell cycle.
Zhou, Bo; Schrader, Jared M; Kalogeraki, Virginia S; Abeliuk, Eduardo; Dinh, Cong B; Pham, James Q; Cui, Zhongying Z; Dill, David L; McAdams, Harley H; Shapiro, Lucy
2015-01-01
Each Caulobacter cell cycle involves differentiation and an asymmetric cell division driven by a cyclical regulatory circuit comprised of four transcription factors (TFs) and a DNA methyltransferase. Using a modified global 5' RACE protocol, we globally mapped transcription start sites (TSSs) at base-pair resolution, measured their transcription levels at multiple times in the cell cycle, and identified their transcription factor binding sites. Out of 2726 TSSs, 586 were shown to be cell cycle-regulated and we identified 529 binding sites for the cell cycle master regulators. Twenty-three percent of the cell cycle-regulated promoters were found to be under the combinatorial control of two or more of the global regulators. Previously unknown features of the core cell cycle circuit were identified, including 107 antisense TSSs which exhibit cell cycle-control, and 241 genes with multiple TSSs whose transcription levels often exhibited different cell cycle timing. Cumulatively, this study uncovered novel new layers of transcriptional regulation mediating the bacterial cell cycle.
Measuring cell cycle progression kinetics with metabolic labeling and flow cytometry.
Fleisig, Helen; Wong, Judy
2012-05-22
Precise control of the initiation and subsequent progression through the various phases of the cell cycle are of paramount importance in proliferating cells. Cell cycle division is an integral part of growth and reproduction and deregulation of key cell cycle components have been implicated in the precipitating events of carcinogenesis. Molecular agents in anti-cancer therapies frequently target biological pathways responsible for the regulation and coordination of cell cycle division. Although cell cycle kinetics tend to vary according to cell type, the distribution of cells amongst the four stages of the cell cycle is rather consistent within a particular cell line due to the consistent pattern of mitogen and growth factor expression. Genotoxic events and other cellular stressors can result in a temporary block of cell cycle progression, resulting in arrest or a temporary pause in a particular cell cycle phase to allow for instigation of the appropriate response mechanism. The ability to experimentally observe the behavior of a cell population with reference to their cell cycle progression stage is an important advance in cell biology. Common procedures such as mitotic shake off, differential centrifugation or flow cytometry-based sorting are used to isolate cells at specific stages of the cell cycle. These fractionated, cell cycle phase-enriched populations are then subjected to experimental treatments. Yield, purity and viability of the separated fractions can often be compromised using these physical separation methods. As well, the time lapse between separation of the cell populations and the start of experimental treatment, whereby the fractionated cells can progress from the selected cell cycle stage, can pose significant challenges in the successful implementation and interpretation of these experiments. Other approaches to study cell cycle stages include the use of chemicals to synchronize cells. Treatment of cells with chemical inhibitors of key metabolic processes for each cell cycle stage are useful in blocking the progression of the cell cycle to the next stage. For example, the ribonucleotide reductase inhibitor hydroxyurea halts cells at the G1/S juncture by limiting the supply of deoxynucleotides, the building blocks of DNA. Other notable chemicals include treatment with aphidicolin, a polymerase alpha inhibitor for G1 arrest, treatment with colchicine and nocodazole, both of which interfere with mitotic spindle formation to halt cells in M phase and finally, treatment with the DNA chain terminator 5-fluorodeoxyridine to initiate S phase arrest. Treatment with these chemicals is an effective means of synchronizing an entire population of cells at a particular phase. With removal of the chemical, cells rejoin the cell cycle in unison. Treatment of the test agent following release from the cell cycle blocking chemical ensures that the drug response elicited is from a uniform, cell cycle stage-specific population. However, since many of the chemical synchronizers are known genotoxic compounds, teasing apart the participation of various response pathways (to the synchronizers vs. the test agents) is challenging. Here we describe a metabolic labeling method for following a subpopulation of actively cycling cells through their progression from the DNA replication phase, through to the division and separation of their daughter cells. Coupled with flow cytometry quantification, this protocol enables for measurement of kinetic progression of the cell cycle in the absence of either mechanically- or chemically- induced cellular stresses commonly associated with other cell cycle synchronization methodologies. In the following sections we will discuss the methodology, as well as some of its applications in biomedical research.
The cell cycle as a brake for β-cell regeneration from embryonic stem cells.
El-Badawy, Ahmed; El-Badri, Nagwa
2016-01-13
The generation of insulin-producing β cells from stem cells in vitro provides a promising source of cells for cell transplantation therapy in diabetes. However, insulin-producing cells generated from human stem cells show deficiency in many functional characteristics compared with pancreatic β cells. Recent reports have shown molecular ties between the cell cycle and the differentiation mechanism of embryonic stem (ES) cells, assuming that cell fate decisions are controlled by the cell cycle machinery. Both β cells and ES cells possess unique cell cycle machinery yet with significant contrasts. In this review, we compare the cell cycle control mechanisms in both ES cells and β cells, and highlight the fundamental differences between pluripotent cells of embryonic origin and differentiated β cells. Through critical analysis of the differences of the cell cycle between these two cell types, we propose that the cell cycle of ES cells may act as a brake for β-cell regeneration. Based on these differences, we discuss the potential of modulating the cell cycle of ES cells for the large-scale generation of functionally mature β cells in vitro. Further understanding of the factors that modulate the ES cell cycle will lead to new approaches to enhance the production of functional mature insulin-producing cells, and yield a reliable system to generate bona fide β cells in vitro.
Yar Saglam, Atiye Seda; Yilmaz, Akin; Onen, Hacer Ilke; Alp, Ebru; Kayhan, Handan; Ekmekci, Abdullah
2016-01-01
Histone deacetylases (HDACs) play a major role in the regulation of chromatin structure and gene expression by changing acetylation status of histone and non-histone proteins. MS-275 (entinostat, MS) is a well-known benzamide-based HDACI and Salermide (SAL), a reverse amide compound HDACI, have antiproliferative effects on several human cancer cells. In this study, we aimed to investigate the effects of HDACIs (MS and SAL) alone and/or combined use with EF24 (EF), a novel synthetic curcumin analog, on human pancreatic cancer cell line (BxPC-3). In vitro, BxPC-3 cells were exposed to varying concentrations of MS, SAL with or without EF, and their effects on cell viability, acetylated Histone H3 and H4 levels, cytotoxicity, and cleaved caspase 3 levels, and cell cycle distribution were measured. The viability of BxPC-3 cells decreased significantly after treatment with EF, MS and SAL treatments. MS and SAL treatment increased the acetylation of histone H3 and H4 in a dose dependent manner. MS and SAL alone or combined with EF were increased the number of cells in G1 phase. In addition, treatment with agents significantly decreased the ratio of cell in G2/M phase. There were significant dose-dependent increases at cleaved Caspase 3 levels after MS treatment but not after SAL treatment. Our results showed that HDAC inhibitors (MS and SAL), when combined with EF, may effectively reduce pancreatic cancer cell (BxPC-3) progression and stop the cell cycle at G1 phase. Further molecular analyses are needed to understand the fundamental molecular consequences of HDAC inhibition in pancreas cancer cells.
General fuel cell hybrid synergies and hybrid system testing status
NASA Astrophysics Data System (ADS)
Winkler, Wolfgang; Nehter, Pedro; Williams, Mark C.; Tucker, David; Gemmen, Randy
FCT hybrid power systems offer the highest efficiency and the cleanest emissions of all fossil fuelled power. The engineering for the highest possible efficiency at lowest cost and weight depends on general system architecture issues and the performance of the components. Presented in this paper are system studies which provide direction for the most efficient path toward achieving the most beneficial result for this technology. Ultimately, fuel cell-turbine (FCT) hybrid systems applicable to integrated gasification combined cycle power systems will form the basis for reaching the goals for advanced coal-based power generation. The FCT hybrid power island will also be important for the FutureGen plant and will provide new options for carbon dioxide capture and sequestration as well as power and hydrogen generation. The system studies presented in this paper provide insight to current technology 'benchmarks' versus expected benefits from hybrid applications. Discussion is also presented on the effects of different balance of plant arrangements and approaches. Finally, we discuss the status of US DOE is sponsored projects that are looking to help understand the unique requirements for these systems. One of these projects, Hyper, will provide information on FCT dynamics and will help identify technical needs and opportunities for cycle advancement. The methods studied show promise for effective control of a hybrid system without the direct intervention of isolation valves or check valves in the main pressure loop of the system, which introduce substantial pressure losses, allowing for realization of the full potential efficiency of the hybrid system.
Johard, Helena; Mahdessian, Diana; Fedr, Radek; Marks, Carolyn; Medalová, Jiřina; Souček, Karel; Lundberg, Emma; Linnarsson, Sten; Bryja, Vítězslav; Sekyrova, Petra; Altun, Mikael; Andäng, Michael
2017-01-01
The cell cycle coordinates core functions such as replication and cell division. However, cell-cycle-regulated transcription in the control of non-core functions, such as cell identity maintenance through specific transcription factors (TFs) and signalling pathways remains unclear. Here, we provide a resource consisting of mapped transcriptomes in unsynchronized HeLa and U2OS cancer cells sorted for cell cycle phase by Fucci reporter expression. We developed a novel algorithm for data analysis that enables efficient visualization and data comparisons and identified cell cycle synchronization of Notch signalling and TFs associated with development. Furthermore, the cell cycle synchronizes with the circadian clock, providing a possible link between developmental transcriptional networks and the cell cycle. In conclusion we find that cell cycle synchronized transcriptional patterns are temporally compartmentalized and more complex than previously anticipated, involving genes, which control cell identity and development. PMID:29228002
Hamid, Sharifah; Lim, Kue Peng; Zain, Rosnah Binti; Ismail, Siti Mazlipah; Lau, Shin Hin; Mustafa, Wan Mahadzir Wan; Abraham, M Thomas; Nam, Noor Akmar; Teo, Soo-Hwang; Cheong, Sok Ching
2007-03-01
We have established 3 cell lines ORL-48, -115 and -136 from surgically resected specimens obtained from untreated primary human oral squamous cell carcinomas of the oral cavity. The in vitro growth characteristics, epithelial origin, in vitro anchorage independency, human papilloma-virus (HPV) infection, microsatellite instability status, karyotype and the status of various cell cycle regulators and gatekeepers of these cell lines were investigated. All 3 cell lines grew as monolayers with doubling times ranging between 26.4 and 40.8 h and were immortal. Karyotyping confirmed that these cell lines were of human origin with multiple random losses and gains of entire chromosomes and regions of chromosomes. Immunohistochemistry staining of cytokeratins confirmed the epithelial origin of these cell lines, and the low degree of anchorage independency expressed by these cell lines suggests non-transformed phenotypes. Genetic analysis identified mutations in the p53 gene in all cell lines and hypermethylation of p16INK4a in ORL-48 and -136. Analysis of MDM2 and EGFR expression indicated MDM2 overexpression in ORL-48 and EGFR overexpression in ORL-136 in comparison to the protein levels in normal oral keratinocytes. Analysis of the BAT-26 polyadenine repeat sequence and MLH-1 and MSH-2 repair enzymes demonstrated that all 3 cell lines were microsatellite stable. The role of HPV in driving carcinogenesis in these tumours was negated by the absence of HPV. Finally, analysis of the tissues from which these cell lines were derived indicated that the cell lines were genetically representative of the tumours, and, therefore, are useful tools in the understanding of the molecular changes associated with oral cancers.
Giguère, Sophie S. B.; Guise, Amanda J.; Jean Beltran, Pierre M.; Joshi, Preeti M.; Greco, Todd M.; Quach, Olivia L.; Kong, Jeffery; Cristea, Ileana M.
2016-01-01
Deleted in breast cancer 1 (DBC1) has emerged as an important regulator of multiple cellular processes, ranging from gene expression to cell cycle progression. DBC1 has been linked to tumorigenesis both as an inhibitor of histone deacetylases, HDAC3 and sirtuin 1, and as a transcriptional cofactor for nuclear hormone receptors. However, despite mounting interest in DBC1, relatively little is known about the range of its interacting partners and the scope of its functions. Here, we carried out a functional proteomics-based investigation of DBC1 interactions in two relevant cell types, T cells and kidney cells. Microscopy, molecular biology, biochemistry, and mass spectrometry studies allowed us to assess DBC1 mRNA and protein levels, localization, phosphorylation status, and protein interaction networks. The comparison of DBC1 interactions in these cell types revealed conserved regulatory roles for DBC1 in gene expression, chromatin organization and modification, and cell cycle progression. Interestingly, we observe previously unrecognized DBC1 interactions with proteins encoded by cancer-associated genes. Among these interactions are five components of the SWI/SNF complex, the most frequently mutated chromatin remodeling complex in human cancers. Additionally, we identified a DBC1 interaction with TBL1XR1, a component of the NCoR complex, which we validated by reciprocal isolation. Strikingly, we discovered that DBC1 associates with proteins that regulate the circadian cycle, including DDX5, DHX9, and SFPQ. We validated this interaction by colocalization and reciprocal isolation. Functional assessment of this association demonstrated that DBC1 protein levels are important for regulating CLOCK and BMAL1 protein oscillations in synchronized T cells. Our results suggest that DBC1 is integral to the maintenance of the circadian molecular clock. Furthermore, the identified interactions provide a valuable resource for the exploration of pathways involved in DBC1-associated tumorigenesis. PMID:26657080
Liu, Yong; Liu, Wen-Bin; Liu, Kai-Jun; Ao, Lin; Cao, Jia; Zhong, Julia Li; Liu, Jin-Yi
2016-01-01
The increasing prevalence of extremely low frequency electromagnetic fields (ELF-EMFs) exposure has raised considerable public concern regarding the potential hazardous effects of ELF-EMFs on male reproductive function. Increasing evidence indicates that miRNAs are necessary for spermatogenesis and male fertility. However, the regulation of miRNA expression and the roles of miRNAs in response to ELF-EMFs remain unclear. In our study, mouse spermatocyte-derived GC-2 cells were intermittently exposed to a 50 Hz ELF-EMF for 72 h (5 min on/10 min off) at magnetic field intensities of 1 mT, 2 mT and 3 mT. MiR-26b-5p was differentially expressed in response to different magnetic field intensities of ELF-EMFs. The host gene CTDSP1 showed an unmethylation status in GC-2 cells at different magnetic field intensities of ELF-EMF exposure. MiR-26b-5p had no significant, obvious influence on the cell viability, apoptosis or cell cycle of GC-2 cells. However, the overexpression of miR-26b-5p significantly decreased the percentage of G0/G1 phase cells and slightly increased the percentage of S phase cells compared to the sham group that was exposed to a 50 Hz ELF-EMF. Computational algorithms identified Cyclin D2 (CCND2) as a direct target of miR-26b-5p. MiR-26b-5p and a 50 Hz ELF-EMF altered the expression of CCND2 at both the mRNA and protein levels. Overexpressed miR-26b-5p in GC-2 cells can change the mRNA expression of CCND2 following 50 Hz ELF-EMF at 3 mT. These findings demonstrate that miR-26b-5p could serve as a potential biomarker following 50 Hz ELF-EMF exposure, and miR-26b-5p-CCND2-mediated cell cycle regulation might play a pivotal role in the biological effects of ELF-EMFs.
Effect of KOH concentration on LEO cycle life of IPV nickel-hydrogen flight cell - Update II
NASA Technical Reports Server (NTRS)
Smithrick, John J.; Hall, Stephen W.
1992-01-01
An update of validation test results confirming the breakthrough in LEO cycle life of nickel-hydrogen cells containing 26 percent KOH electrolyte is presented. A breakthrough in the LEO cycle life of individual pressure vessel (IPV) nickel-hydrogen cells has been previously reported. The cycle life of boiler plate cells containing 26 percent potassium hydroxide (KOH) electrolyte was about 40,000 LEO cycles, compared to 3500 cycles for cells containing 31 percent KOH. The cycle regime was a stressful accelerated LEO, which consisted of a 27.5 min charge followed by a 17.5 min discharge (2X normal rate). The depth-of-discharge was 80 percent. Six 48-Ah Hughes recirculation design IPV nickel-hydrogen flight battery cells are being evaluated. Three of the cells contain 26 percent KOH (test cells), and three contain 31 percent KOH (control cells). They are undergoing real time LEO cycle life testing. The cycle regime is a 90-min LEO orbit consisting of a 54-min charge followed by a 36-min discharge. The depth-of-discharge is 80 percent. The cell temperature is maintained at 10 C. The three 31 percent KOH cells failed (cycles 3729, 4165, and 11355). One of the 26 percent KOH cells failed at cycle 15314. The other two 26 percent KOH cells were cycled for over 16,000 cycles during the continuing test.
Singh, N; Lim, R B; Sawyer, M A
2000-07-01
The cell cycle and the cell cycle control system are the engines that drive life. They allow for the processes of cell renewal and the growth of organisms, under controlled conditions. The control system is essential for the monitoring of normal cell growth and replication of genetic material and to ensure that normal, functional daughter cells are produced at completion of each cell cycle. Although certain clinical applications exist which take advantage of the events of the cell cycle, our understanding of its mechanisms and how to manipulate them is infantile. The next decades will continue to see the effort of many researchers focused upon unlocking the mysteries of the cell cycle and the cell cycle control system.
Sadykov, Marat R; Ahn, Jong-Sam; Widhelm, Todd J; Eckrich, Valerie M; Endres, Jennifer L; Driks, Adam; Rutkowski, Gregory E; Wingerd, Kevin L; Bayles, Kenneth W
2017-06-01
Numerous bacteria accumulate poly(3-hydroxybutyrate) (PHB) as an intracellular reservoir of carbon and energy in response to imbalanced nutritional conditions. In Bacillus spp., where PHB biosynthesis precedes the formation of the dormant cell type called the spore (sporulation), the direct link between PHB accumulation and efficiency of sporulation was observed in multiple studies. Although the idea of PHB as an intracellular carbon and energy source fueling sporulation was proposed several decades ago, the mechanisms underlying PHB contribution to sporulation have not been defined. Here, we demonstrate that PHB deficiency impairs Bacillus anthracis sporulation through diminishing the energy status of the cells and by reducing carbon flux into the tricarboxylic acid (TCA) cycle and de novo lipid biosynthesis. Consequently, this metabolic imbalance decreased biosynthesis of the critical components required for spore integrity and resistance, such as dipicolinic acid (DPA) and the spore's inner membrane. Supplementation of the PHB deficient mutant with exogenous fatty acids overcame these sporulation defects, highlighting the importance of the TCA cycle and lipid biosynthesis during sporulation. Combined, the results of this work reveal the molecular mechanisms of PHB contribution to B. anthracis sporulation and provide valuable insight into the metabolic requirements for this developmental process in Bacillus species. © 2017 John Wiley & Sons Ltd.
Shen, Chao-qin; Yan, Ting-Ting; Liu, Wei; Zhu, Xiao-qiang; Tian, Xiang-long; Fu, Xue-liang; Hua, Rong; Zhang, Jun-feng; Huo, Yan-miao; Liu, De-jun; Yang, Jian-yu; Sun, Yong-Wei; Fang, Jing-Yuan; Chen, Hao-Yan; Hong, Jie
2017-01-01
FAM83B (family with sequence similarity 83, member B) seems to emerge as a new class of players involved in the development of a variety of malignant tumors. Yet the molecular mechanisms are not well understood. The present study is intended to investigate the expression and function of FAM83B in pancreatic ductal adenocarcinoma (PDAC). In this study, we found that the expression of FAM83B was significantly increased both in PDAC cell lines and PDAC tumor tissues. FAM83B expression was positively related with advanced clinical stage and poor vital status. Higher FAM83B expression predicted shorter overall survival in PDAC patients, regardless of lymphatic metastasis status and histological differentiation. Actually, FAM83B may act as an independent prognostic indicator as well. What's more, down-regulation of FAM83B in PDAC cells contributed to G0/G1 phase arrest and inhibition of cell proliferation. Finally, a subcutaneous xenograft model indicated that knockdown of FAM83B significantly reduced the tumor volume in vivo. Our findings have provided supporting evidence for the potential molecular biomarker role of FAM83B in PDAC. It's of great interest and broad significance to target FAM83B in PDAC, which may conduce to develop a meaningful and effective strategy in the diagnosis and treatment of PDAC. PMID:29158787
Pathological implications of cell cycle re-entry in Alzheimer disease.
Bonda, David J; Lee, Hyun-pil; Kudo, Wataru; Zhu, Xiongwei; Smith, Mark A; Lee, Hyoung-gon
2010-06-29
The complex neurodegeneration underlying Alzheimer disease (AD), although incompletely understood, is characterised by an aberrant re-entry into the cell cycle in neurons. Pathological evidence, in the form of cell cycle markers and regulatory proteins, suggests that cell cycle re-entry is an early event in AD, which precedes the formation of amyloid-beta plaques and neurofibrillary tangles (NFTs). Although the exact mechanisms that induce and mediate these cell cycle events in AD are not clear, significant advances have been made in further understanding the pathological role of cell cycle re-entry in AD. Importantly, recent studies indicate that cell cycle re-entry is not a consequence, but rather a cause, of neurodegeneration, suggesting that targeting of cell cycle re-entry may provide an opportunity for therapeutic intervention. Moreover, multiple inducers of cell cycle re-entry and their interactions in AD have been proposed. Here, we review the most recent advances in understanding the pathological implications of cell cycle re-entry in AD.
Bach2 is involved in neuronal differentiation of N1E-115 neuroblastoma cells.
Shim, Ki Shuk; Rosner, Margit; Freilinger, Angelika; Lubec, Gert; Hengstschläger, Markus
2006-07-15
Bach1 and Bach2 are evolutionarily related members of the BTB-basic region leucine zipper transcription factor family. We found that Bach2 downregulates cell proliferation of N1E-115 cells and negatively affects their potential to differentiate. Nuclear localization of the cyclin-dependent kinase inhibitor p21 is known to arrest cell cycle progression, and cytoplasmic p21 has been shown to promote neuronal differentiation of N1E-115 cells. We found that ectopic Bach2 causes upregulation of p21 expression in the nucleus and in the cytoplasm in undifferentiated N1E-115 cells. In differentiated cells, Bach2 specifically triggers upregulation of cytoplasmic p21. Our data suggest that Bach2 expression could represent a switch during the process of neuronal differentiation. Bach2 is not expressed in neuronal precursor cells. It would have negative effects on proliferation and differentiation of these cells. In differentiated neuronal cells Bach2 expression is upregulated, which could allow Bach2 to function as a gatekeeper of the differentiated status.
Epigenetic Regulation: A New Frontier for Biomedical Engineers.
Chen, Zhen; Li, Shuai; Subramaniam, Shankar; Shyy, John Y-J; Chien, Shu
2017-06-21
Gene expression in mammalian cells depends on the epigenetic status of the chromatin, including DNA methylation, histone modifications, promoter-enhancer interactions, and noncoding RNA-mediated regulation. The coordinated actions of these multifaceted regulations determine cell development, cell cycle regulation, cell state and fate, and the ultimate responses in health and disease. Therefore, studies of epigenetic modulations are critical for our understanding of gene regulation mechanisms at the molecular, cellular, tissue, and organ levels. The aim of this review is to provide biomedical engineers with an overview of the principles of epigenetics, methods of study, recent findings in epigenetic regulation in health and disease, and computational and sequencing tools for epigenetics analysis, with an emphasis on the cardiovascular system. This review concludes with the perspectives of the application of bioengineering to advance epigenetics and the utilization of epigenetics to translate bioengineering research into clinical medicine.
Clinico-pathological and biological prognostic variables in squamous cell carcinoma of the vulva.
Gadducci, Angiolo; Tana, Roberta; Barsotti, Cecilia; Guerrieri, Maria Elena; Genazzani, Andrea Riccardo
2012-07-01
Several clinical-pathological parameters have been related to survival of patients with invasive squamous cell carcinoma of the vulva, whereas few studies have investigated the ability of biological variables to predict the clinical outcome of these patients. The present paper reviews the literature data on the prognostic relevance of lymph node-related parameters, primary tumor-related parameters, FIGO stage, blood variables, and tissue biological variables. Regarding these latter, the paper takes into account the analysis of DNA content, cell cycle-regulatory proteins, apoptosis-related proteins, epidermal growth factor receptor [EGFR], and proteins that are involved in tumor invasiveness, metastasis and angiogenesis. At present, the lymph node status and FIGO stage according to the new 2009 classification system are the main predictors for vulvar squamous cell carcinoma, whereas biological variables do not have yet a clinical relevance and their role is still investigational. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Hypothalamic mTOR signaling regulates food intake.
Cota, Daniela; Proulx, Karine; Smith, Kathi A Blake; Kozma, Sara C; Thomas, George; Woods, Stephen C; Seeley, Randy J
2006-05-12
The mammalian Target of Rapamycin (mTOR) protein is a serine-threonine kinase that regulates cell-cycle progression and growth by sensing changes in energy status. We demonstrated that mTOR signaling plays a role in the brain mechanisms that respond to nutrient availability, regulating energy balance. In the rat, mTOR signaling is controlled by energy status in specific regions of the hypothalamus and colocalizes with neuropeptide Y and proopiomelanocortin neurons in the arcuate nucleus. Central administration of leucine increases hypothalamic mTOR signaling and decreases food intake and body weight. The hormone leptin increases hypothalamic mTOR activity, and the inhibition of mTOR signaling blunts leptin's anorectic effect. Thus, mTOR is a cellular fuel sensor whose hypothalamic activity is directly tied to the regulation of energy intake.
Kaczmarek, Maria; Trambacz-Oleszak, Sylwia
2016-05-01
The increasing prevalence of negative body perceptions among adolescent girls and the tendency towards wishing to be thinner have become a cultural norm in Western culture. Adolescent girls are particularly vulnerable to developing a negative body image due to physical and sexual changes occurring during puberty. This study aimed to evaluate the association between different measures of body image perceptions and different phases of the menstrual cycle after controlling for weight status and other potential confounders in Polish adolescent girls aged 12-18 years. Three-hundred and thirty participants of a cross-sectional survey conducted in 2009, normally cycling and with no eating disorders, completed a background questionnaire and the Stunkard Figure Rating Scale, and their anthropometric measurements were collected. The dependent outcome variables were measures of body image (actual body image, ideal body image and ideal-self discrepancy) and dichotomous body image perception (satisfied versus dissatisfied) adjusted for other predictor factors: socio-demographic variables, menstrual history and cycle phases, and weight status. One-way ANOVA indicated that weight status, age at menarche and menstrual cycle phase were associated with actual body image and rate of ideal-self discrepancy. Ideal body image was associated with weight status and menstrual cycle phase. General logistic regression models were constructed to evaluate associations of body dissatisfaction and all potential predictor variables. The final selected model of the multiple logistic regression analysis using the backward elimination procedure revealed that adjusted for other factors, negative body image was significantly associated with different phases of the menstrual cycle (p trend=0.033) and increasing body weight status (p trend=0.0007). The likelihood of body dissatisfaction was greatest during the premenstrual phase of the menstrual cycle (OR=2.38; 95% CI 1.06, 5.32) and among girls in obesity class I (OR=8.04; 95% CI 2.37, 27.26). The study confirmed the association between body image dissatisfaction in adolescent girls and different phases of the menstrual cycle after controlling for weight status. The issue of negative body self-image is not only of cognitive, but also of practical value as understanding better the factors contributing to the formation of a negative body image may be instrumental in developing preventive health programmes targeted at young people.
Kabani, Sarah; Waterfall, Martin; Matthews, Keith R
2010-01-01
Studies on the cell-cycle of Trypanosoma brucei have revealed several unusual characteristics that differ from the model eukaryotic organisms. However, the inability to isolate homogenous populations of parasites in distinct cell-cycle stages has limited the analysis of trypanosome cell division and complicated the understanding of mutant phenotypes with possible impact on cell-cycle related events. Although hydroxyurea-induced cell-cycle arrest in procyclic and bloodstream forms has been applied recently with success, such block-release protocols can complicate the analysis of cell-cycle regulated events and have the potential to disrupt important cell-cycle checkpoints. An alternative approach based on flow cytometry of parasites stained with Vybrant DyeCycle Orange circumvents this problem, but is restricted to procyclic form parasites. Here, we apply Vybrant Dyecycle Violet staining coupled with flow cytometry to effectively select different cell-cycle stages of bloodstream form trypanosomes. Moreover, the sorted parasites remain viable, although synchrony is rapidly lost. This method enables cell-cycle enrichment of populations of trypanosomes in their mammal infective stage, particularly at the G1 phase.
Kabani, Sarah; Waterfall, Martin; Matthews, Keith R.
2010-01-01
Studies on the cell-cycle of Trypanosoma brucei have revealed several unusual characteristics that differ from the model eukaryotic organisms. However, the inability to isolate homogenous populations of parasites in distinct cell-cycle stages has limited the analysis of trypanosome cell division and complicated the understanding of mutant phenotypes with possible impact on cell-cycle related events. Although hydroxyurea-induced cell-cycle arrest in procyclic and bloodstream forms has been applied recently with success, such block-release protocols can complicate the analysis of cell-cycle regulated events and have the potential to disrupt important cell-cycle checkpoints. An alternative approach based on flow cytometry of parasites stained with Vybrant DyeCycle Orange circumvents this problem, but is restricted to procyclic form parasites. Here, we apply Vybrant Dyecycle Violet staining coupled with flow cytometry to effectively select different cell-cycle stages of bloodstream form trypanosomes. Moreover, the sorted parasites remain viable, although synchrony is rapidly lost. This method enables cell-cycle enrichment of populations of trypanosomes in their mammal infective stage, particularly at the G1 phase. PMID:19729042
Fuel cells for automotive powertrains-A techno-economic assessment
NASA Astrophysics Data System (ADS)
Mock, Peter; Schmid, Stephan A.
With the objective of identifying the hurdles currently preventing a widespread application of fuel cell technology in passenger cars an assessment of technical and economic parameters is carried out. Patent and publication analysis is used to assess current status of fuel cell technology regarding its position on technology life cycle. S-curve methodology leads to the conclusion that further scientific activity is to be expected but for today's low-temperature PEM fuel cell technology might level by 2015. Technical analysis identifies power density and platinum loading as parameters for which further improvements are necessary in order to satisfy future customer needs. A detailed cost evaluation suggests that in future for high production volumes (approx. 1 million vehicles cumulative) significantly lower costs for fuel cell stacks (12-40 kW -1) and systems (35-83 kW -1) will be viable. Reducing costs to such a level will have to be the main focus for upcoming research activities in order to make fuel cell driven road vehicles a competitive alternative.
Alteration of cell cycle progression by Sindbis virus infection
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yi, Ruirong; Saito, Kengo; Isegawa, Naohisa
We examined the impact of Sindbis virus (SINV) infection on cell cycle progression in a cancer cell line, HeLa, and a non-cancerous cell line, Vero. Cell cycle analyses showed that SINV infection is able to alter the cell cycle progression in both HeLa and Vero cells, but differently, especially during the early stage of infection. SINV infection affected the expression of several cell cycle regulators (CDK4, CDK6, cyclin E, p21, cyclin A and cyclin B) in HeLa cells and caused HeLa cells to accumulate in S phase during the early stage of infection. Monitoring SINV replication in HeLa and Veromore » cells expressing cell cycle indicators revealed that SINV which infected HeLa cells during G{sub 1} phase preferred to proliferate during S/G{sub 2} phase, and the average time interval for viral replication was significantly shorter in both HeLa and Vero cells infected during G{sub 1} phase than in cells infected during S/G{sub 2} phase. - Highlights: • SINV infection was able to alter the cell cycle progression of infected cancer cells. • SINV infection can affect the expression of cell cycle regulators. • SINV infection exhibited a preference for the timing of viral replication among the cell cycle phases.« less
Litaker, J R; Pan, J; Cheung, Y; Zhang, D K; Liu, Y; Wong, S C; Wan, T S; Tsao, S W
1998-11-01
Senescence is a specific physiological stage of cells characterized by long population doubling time. It accounts for the inability of normal somatic cells to undergo indefinite cell division. As the number of population doublings increase, cell cycle regulatory mechanisms come into play and signal cells to exit the cell cycle and become senescent. Senescence has been implicated in the aging process and may function as a tumor suppressor mechanism in human cells. The ability to measure the degree of cellular senescence is important in understanding the biological processes regulating cell aging and immortalization. Senescent cells exhibit an enzyme termed senescence-associated histochemical staining. Cells immortalized by viral oncogenes often enter a stage of crisis at the early phase of immortalization. The cells at crisis have a long population doubling time. Cells at the crisis stage resemble senescent cells and the expression of SA- beta-Gal may be used to monitor the process of immortalization. In this study the expression profile of SA-beta-Gal was examined in human ovarian surface epithelial cells (HOSE 6-3) undergoing immortalization by the human papilloma viral oncogene E6 and E7 (HPV E6 and E7). Our results showed a low percentage (12.0%) of HOSE 6-3 cells expressing SA-beta-Gal activity at the pre-crisis stage. The percentage of HOSE 6-3 cells expressing SA-beta-Gal activity was highest (39.2%) at the crisis stage. When HOSE 6-3 cells achieved immortalized status there was a sharp decrease in cells (1. 3%) expressing SA-beta-Gal activity. In addition, an inverse relationship between the expression of SA-beta-Gal activity and telomerase activity was noted in cells undergoing immortalization. The results confirm that the SA-beta-Gal enzyme is a good marker for monitoring the population of cells undergoing senescence at different stages of immortalization and that telomerase activation is a characteristic feature of post-crisis cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ohi, J M
1992-09-01
This report is the first of four volumes that identify and assess the environmental, health, and safety issues involved in using sodium-sulfur (Na/S) battery technology as the energy source in electric and hybrid vehicles that may affect the commercialization of Na/S batteries. This and the other reports on recycling, shipping, and vehicle safety are intended to help the Electric and Hybrid Propulsion Division of the Office of Transportation Technologies in the US Department of Energy (DOE/EHP) determine the direction of its research, development, and demonstration (RD&D) program for Na/S battery technology. The reports review the status of Na/S battery RD&Dmore » and identify potential hazards and risks that may require additional research or that may affect the design and use of Na/S batteries. This volume covers cell design and engineering as the basis of safety for Na/S batteries and describes and assesses the potential chemical, electrical, and thermal hazards and risks of Na/S cells and batteries as well as the RD&D performed, under way, or to address these hazards and risks. The report is based on a review of the literature and on discussions with experts at DOE, national laboratories and agencies, universities, and private industry. Subsequent volumes will address environmental, health, and safety issues involved in shipping cells and batteries, using batteries to propel electric vehicles, and recycling and disposing of spent batteries. The remainder of this volume is divided into two major sections on safety at the cell and battery levels. The section on Na/S cells describes major component and potential failure modes, design, life testing and failure testing, thermal cycling, and the safety status of Na/S cells. The section on batteries describes battery design, testing, and safety status. Additional EH&S information on Na/S batteries is provided in the appendices.« less
Combined radiation and p53 gene therapy of malignant glioma cells.
Badie, B; Goh, C S; Klaver, J; Herweijer, H; Boothman, D A
1999-01-01
More than half of malignant gliomas reportedly have alterations in the p53 tumor suppressor gene. Because p53 plays a key role in the cellular response to DNA-damaging agents, we investigated the role of p53 gene therapy before ionizing radiation in cultured human glioma cells containing normal or mutated p53. Three established human glioma cell lines expressing the wild-type (U87 MG, p53wt) or mutant (A172 and U373 MG, p53mut) p53 gene were transduced by recombinant adenoviral vectors bearing human p53 (Adp53) and Escherichia coli beta-galactosidase genes (AdLacZ, control virus) before radiation (0-20 Gy). Changes in p53, p21, and Bax expression were studied by Western immunoblotting, whereas cell cycle alterations and apoptosis were investigated by flow cytometry and nuclear staining. Survival was assessed by clonogenic assays. Within 48 hours of Adp53 exposure, all three cell lines demonstrated p53 expression at a viral multiplicity of infection of 100. p21, which is a p53-inducible downstream effector gene, was overexpressed, and cells were arrested in the G1 phase. Bax expression, which is thought to play a role in p53-induced apoptosis, did not change with either radiation or Adp53. Apoptosis and survival after p53 gene therapy varied. U87 MG (p53wt) cells showed minimal apoptosis after Adp53, irradiation, or combined treatments. U373 MG (p53mut) cells underwent massive apoptosis and died within 48 hours of Adp53 treatment, independent of irradiation. Surprisingly, A172 (p53mut) cells demonstrated minimal apoptosis after Adp53 exposure; however, unlike U373 MG cells, apoptosis increased with radiation dose. Survival of all three cell lines was reduced dramatically after >10 Gy. Although Adp53 transduction significantly reduced the survival of U373 MG cells and inhibited A172 growth, it had no effect on the U87 MG cell line. Transduction with AdLacZ did not affect apoptosis or cell cycle progression and only minimally affected survival in all cell lines. We conclude that responses to p53 gene therapy are variable among gliomas and most likely depend upon both cellular p53 status and as yet ill-defined downstream pathways involving activation of cell cycle regulatory and apoptotic genes.
Saha, Sukanya; Sadhukhan, Pritam; Sinha, Krishnendu; Agarwal, Namrata; Sil, Parames C
2016-03-01
Mangiferin is a polyphenolic xanthonoid with remarkable antioxidant activity. Oxidative stress plays the key role in tert-butyl hydroperoxide (tBHP) induced renal cell damage. In this scenario, we consider mangiferin, as a safe agent in tBHP induced renal cell death and rationalize its action systematically, in normal human kidney epithelial cells (NKE). NKE cells were exposed to 20 µM mangiferin for 2 h followed by 50 µM tBHP for 18 h. The effect on endogenous ROS production, antioxidant status (antioxidant enzymes and thiols), mitochondrial membrane potential, apoptotic signaling molecules, PI3K mediated signaling cascades and cell cycle progression were examined using various biochemical assays, FACS and immunoblot analyses. tBHP exposure damaged the NKE cells and decreased its viability. It also elevated the intracellular ROS and other oxidative stress-related biomarkers within the cells. However, mangiferin dose dependently, exhibited significant protection against this oxidative cellular damage. Mangiferin inhibited tBHP induced activation of different pro-apoptotic signals and thus protected the renal cells against mitochondrial permeabilization. Further, mangiferin enhanced the expression of cell proliferative signaling cascade molecules, Cyclin d1, NFκB and antioxidant molecules HO-1, SOD2, by PI3K/Akt dependent pathway. However, the inhibitor of PI3K abolished mangiferin's protective activity. Results show Mangiferin maintains the intracellular anti-oxidant status, induces the expression of PI3K and its downstream molecules and shields NKE cells against the tBHP induced cytotoxicity. Mangiferin can be indicated as a therapeutic agent in oxidative stress-mediated renal toxicity. This protective action of mangiferin primarily attributes to its potent antioxidant and antiapoptotic nature.
Saitou, Takashi; Imamura, Takeshi
2016-01-01
Cell cycle progression is strictly coordinated to ensure proper tissue growth, development, and regeneration of multicellular organisms. Spatiotemporal visualization of cell cycle phases directly helps us to obtain a deeper understanding of controlled, multicellular, cell cycle progression. The fluorescent ubiquitination-based cell cycle indicator (Fucci) system allows us to monitor, in living cells, the G1 and the S/G2/M phases of the cell cycle in red and green fluorescent colors, respectively. Since the discovery of Fucci technology, it has found numerous applications in the characterization of the timing of cell cycle phase transitions under diverse conditions and various biological processes. However, due to the complexity of cell cycle dynamics, understanding of specific patterns of cell cycle progression is still far from complete. In order to tackle this issue, quantitative approaches combined with mathematical modeling seem to be essential. Here, we review several studies that attempted to integrate Fucci technology and mathematical models to obtain quantitative information regarding cell cycle regulatory patterns. Focusing on the technological development of utilizing mathematics to retrieve meaningful information from the Fucci producing data, we discuss how the combined methods advance a quantitative understanding of cell cycle regulation. © 2015 Japanese Society of Developmental Biologists.
Cell Cycle Control in the Early Embryonic Development of Aquatic Animal Species
Siefert, Joseph C.; Clowdus, Emily A.; Sansam, Christopher L.
2016-01-01
The cell cycle is integrated with many aspects of embryonic development. Not only is proper control over the pace of cell proliferation important, but also the timing of cell cycle progression is coordinated with transcription, cell migration, and cell differentiation. Due to the ease with which the embryos of aquatic organisms can be observed and manipulated, they have been a popular choice for embryologists throughout history. In the cell cycle field, aquatic organisms have been extremely important because they have played a major role in the discovery and analysis of key regulators of the cell cycle. In particular, the frog Xenopus laevis has been instrumental for understanding how the basic embryonic cell cycle is regulated. More recently, the zebrafish has been used to understand how the cell cycle is remodeled during vertebrate development and how it is regulated during morphogenesis. This review describes how some of the unique strengths of aquatic species have been leveraged for cell cycle research and suggests how species such as Xenopus and zebrafish will continue to reveal the roles of the cell cycle in human biology and disease. PMID:26475527
Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S
2017-11-01
Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.
Klohonatz, Kristin M; Cameron, Ashely D; Hergenreder, Joanna R; da Silveira, Juliano C; Belk, Aeriel D; Veeramachaneni, D N R; Bouma, Gerrit J; Bruemmer, Jason E
2016-12-01
During early pregnancy, the conceptus and mare communicate to establish pregnancy. Cell-secreted vesicles (e.g., exosomes) have been reported in serum. Exosomes contain bioactive materials, such as miRNA, that can mediate cell responses. We hypothesized that a) exosomes are present in mare circulation and quantity varies with pregnancy status, b) exosomes contain miRNAs unique to pregnancy status, and c) miRNAs target pathways in endometrium based upon pregnancy status of the mare. First, serum samples were obtained from mares in a crossover design, with each mare providing samples from a pregnant and nonmated control cycle (n = 3/sample day) on Days 12, 14, 16, and 18 postovulation. Flow cytometry revealed the presence of serum microvesicles in mares in two different-sized populations (greater than or less than 100 nm), validated by transmission electron microscopy. Second, serum was collected on Days 9, 11, and 13 (n = 4/day), and endometrial biopsies were collected on Days 11 and 13 (n = 3/day) from pregnant and nonmated mares. Total RNA from serum exosomes was evaluated with quantitative RT-PCR using equine-specific miRNA sequences. A total of 12 miRNAs were found in different quantities on the specified days. Pathway analysis suggested that miRNAs targeted focal adhesion molecules (FAMs). Transcripts corresponding to FAMs were evaluated in endometrial biopsies. Protein levels and localization for PAK6 and RAF1 were further evaluated. Our data suggest that serum exosomes contain miRNA that differ based upon pregnancy status, and may affect mRNA expression related to focal adhesion pathway in the endometrium, with a potential role in maternal recognition of pregnancy. © 2016 by the Society for the Study of Reproduction, Inc.
Cell cycle arrest in the jewel wasp Nasonia vitripennis in larval diapause.
Shimizu, Yuta; Mukai, Ayumu; Goto, Shin G
2018-04-01
Insects enter diapause to synchronise their life cycle with biotic and abiotic environmental conditions favourable for their development, reproduction, and survival. One of the most noticeable characteristics of diapause is the blockage of ontogeny. Although this blockage should occur with the cessation of cellular proliferation, i.e. cell cycle arrest, it was confirmed only in a few insect species and information on the molecular pathways involved in cell cycle arrest is limited. In the present study, we investigated developmental and cell cycle arrest in diapause larvae of the jewel wasp Nasonia vitripennis. Developmental and cell cycle arrest occur in the early fourth instar larval stage of N. vitripennis under short days. By entering diapause, the S fraction of the cell cycle disappears and approximately 80% and 20% of cells arrest their cell cycle in the G0/G1 and G2 phases, respectively. We further investigated expression of cell cycle regulatory genes and some housekeeping genes to dissect molecular mechanisms underlying the cell cycle arrest. Copyright © 2016 Elsevier Ltd. All rights reserved.
Modelling cell cycle synchronisation in networks of coupled radial glial cells.
Barrack, Duncan S; Thul, Rüdiger; Owen, Markus R
2015-07-21
Radial glial cells play a crucial role in the embryonic mammalian brain. Their proliferation is thought to be controlled, in part, by ATP mediated calcium signals. It has been hypothesised that these signals act to locally synchronise cell cycles, so that clusters of cells proliferate together, shedding daughter cells in uniform sheets. In this paper we investigate this cell cycle synchronisation by taking an ordinary differential equation model that couples the dynamics of intracellular calcium and the cell cycle and extend it to populations of cells coupled via extracellular ATP signals. Through bifurcation analysis we show that although ATP mediated calcium release can lead to cell cycle synchronisation, a number of other asynchronous oscillatory solutions including torus solutions dominate the parameter space and cell cycle synchronisation is far from guaranteed. Despite this, numerical results indicate that the transient and not the asymptotic behaviour of the system is important in accounting for cell cycle synchronisation. In particular, quiescent cells can be entrained on to the cell cycle via ATP mediated calcium signals initiated by a driving cell and crucially will cycle in near synchrony with the driving cell for the duration of neurogenesis. This behaviour is highly sensitive to the timing of ATP release, with release at the G1/S phase transition of the cell cycle far more likely to lead to near synchrony than release during mid G1 phase. This result, which suggests that ATP release timing is critical to radial glia cell cycle synchronisation, may help us to understand normal and pathological brain development. Copyright © 2015 Elsevier Ltd. All rights reserved.
Unraveling Interfaces between Energy Metabolism and Cell Cycle in Plants.
Siqueira, João Antonio; Hardoim, Pablo; Ferreira, Paulo C G; Nunes-Nesi, Adriano; Hemerly, Adriana S
2018-06-19
Oscillation in energy levels is widely variable in dividing and differentiated cells. To synchronize cell proliferation and energy fluctuations, cell cycle-related proteins have been implicated in the regulation of mitochondrial energy-generating pathways in yeasts and animals. Plants have chloroplasts and mitochondria, coordinating the cell energy flow. Recent findings suggest an integrated regulation of these organelles and the nuclear cell cycle. Furthermore, reports indicate a set of interactions between the cell cycle and energy metabolism, coordinating the turnover of proteins in plants. Here, we discuss how cell cycle-related proteins directly interact with energy metabolism-related proteins to modulate energy homeostasis and cell cycle progression. We provide interfaces between cell cycle and energy metabolism-related proteins that could be explored to maximize plant yield. Copyright © 2018 Elsevier Ltd. All rights reserved.
Cannabidiol Reduces Leukemic Cell Size - But Is It Important?
Kalenderoglou, Nikoletta; Macpherson, Tara; Wright, Karen L
2017-01-01
The anti-cancer effect of the plant-derived cannabinoid, cannabidiol, has been widely demonstrated both in vivo and in vitro . However, this body of preclinical work has not been translated into clinical use. Key issues around this failure can be related to narrow dose effects, the cell model used and incomplete efficacy. A model of acute lymphoblastic disease, the Jurkat T cell line, has been used extensively to study the cannabinoid system in the immune system and cannabinoid-induced apoptosis. Using these cells, this study sought to investigate the outcome of those remaining viable cells post-treatment with cannabidiol, both in terms of cell size and tracking any subsequent recovery. The phosphorylation status of the mammalian Target of Rapamycin (mTOR) signaling pathway and the downstream target ribosomal protein S6, were measured. The ability of cannabidiol to exert its effect on cell viability was also evaluated in physiological oxygen conditions. Cannabidiol reduced cell viability incompletely, and slowed the cell cycle with fewer cells in the G2/M phase of the cell cycle. Cannabidiol reduced phosphorylation of mTOR, PKB and S6 pathways related to survival and cell size. The remaining population of viable cells that were cultured in nutrient rich conditions post-treatment were able to proliferate, but did not recover to control cell numbers. However, the proportion of viable cells that were gated as small, increased in response to cannabidiol and normally sized cells decreased. This proportion of small cells persisted in the recovery period and did not return to basal levels. Finally, cells grown in 12% oxygen (physiological normoxia) were more resistant to cannabidiol. In conclusion, these results indicate that cannabidiol causes a reduction in cell size, which persists post-treatment. However, resistance to cannabidiol under physiological normoxia for these cells would imply that cannabidiol may not be useful in the clinic as an anti-leukemic agent.
Cannabidiol Reduces Leukemic Cell Size – But Is It Important?
Kalenderoglou, Nikoletta; Macpherson, Tara; Wright, Karen L.
2017-01-01
The anti-cancer effect of the plant-derived cannabinoid, cannabidiol, has been widely demonstrated both in vivo and in vitro. However, this body of preclinical work has not been translated into clinical use. Key issues around this failure can be related to narrow dose effects, the cell model used and incomplete efficacy. A model of acute lymphoblastic disease, the Jurkat T cell line, has been used extensively to study the cannabinoid system in the immune system and cannabinoid-induced apoptosis. Using these cells, this study sought to investigate the outcome of those remaining viable cells post-treatment with cannabidiol, both in terms of cell size and tracking any subsequent recovery. The phosphorylation status of the mammalian Target of Rapamycin (mTOR) signaling pathway and the downstream target ribosomal protein S6, were measured. The ability of cannabidiol to exert its effect on cell viability was also evaluated in physiological oxygen conditions. Cannabidiol reduced cell viability incompletely, and slowed the cell cycle with fewer cells in the G2/M phase of the cell cycle. Cannabidiol reduced phosphorylation of mTOR, PKB and S6 pathways related to survival and cell size. The remaining population of viable cells that were cultured in nutrient rich conditions post-treatment were able to proliferate, but did not recover to control cell numbers. However, the proportion of viable cells that were gated as small, increased in response to cannabidiol and normally sized cells decreased. This proportion of small cells persisted in the recovery period and did not return to basal levels. Finally, cells grown in 12% oxygen (physiological normoxia) were more resistant to cannabidiol. In conclusion, these results indicate that cannabidiol causes a reduction in cell size, which persists post-treatment. However, resistance to cannabidiol under physiological normoxia for these cells would imply that cannabidiol may not be useful in the clinic as an anti-leukemic agent. PMID:28392768
Solomon, Lauren A; Podder, Shreya; He, Jessica; Jackson-Chornenki, Nicholas L; Gibson, Kristen; Ziliotto, Rachel G; Rhee, Jess; DeKoter, Rodney P
2017-05-15
During macrophage development, myeloid progenitor cells undergo terminal differentiation coordinated with reduced cell cycle progression. Differentiation of macrophages from myeloid progenitors is accompanied by increased expression of the E26 transformation-specific transcription factor PU.1. Reduced PU.1 expression leads to increased proliferation and impaired differentiation of myeloid progenitor cells. It is not understood how PU.1 coordinates macrophage differentiation with reduced cell cycle progression. In this study, we utilized cultured PU.1-inducible myeloid cells to perform genome-wide chromatin immunoprecipitation sequencing (ChIP-seq) analysis coupled with gene expression analysis to determine targets of PU.1 that may be involved in regulating cell cycle progression. We found that genes encoding cell cycle regulators and enzymes involved in lipid anabolism were directly and inducibly bound by PU.1 although their steady-state mRNA transcript levels were reduced. Inhibition of lipid anabolism was sufficient to reduce cell cycle progression in these cells. Induction of PU.1 reduced expression of E2f1 , an important activator of genes involved in cell cycle and lipid anabolism, indirectly through microRNA 223. Next-generation sequencing identified microRNAs validated as targeting cell cycle and lipid anabolism for downregulation. These results suggest that PU.1 coordinates cell cycle progression with differentiation through induction of microRNAs targeting cell cycle regulators and lipid anabolism. Copyright © 2017 American Society for Microbiology.
Montemurro, Chiara; Vadrevu, Suryakiran; Gurlo, Tatyana; Butler, Alexandra E; Vongbunyong, Kenny E; Petcherski, Anton; Shirihai, Orian S; Satin, Leslie S; Braas, Daniel; Butler, Peter C; Tudzarova, Slavica
2017-01-01
Cell replication is a fundamental attribute of growth and repair in multicellular organisms. Pancreatic beta-cells in adults rarely enter cell cycle, hindering the capacity for regeneration in diabetes. Efforts to drive beta-cells into cell cycle have so far largely focused on regulatory molecules such as cyclins and cyclin-dependent kinases (CDKs). Investigations in cancer biology have uncovered that adaptive changes in metabolism, the mitochondrial network, and cellular Ca 2+ are critical for permitting cells to progress through the cell cycle. Here, we investigated these parameters in the replication-competent beta-cell line INS 832/13. Cell cycle synchronization of this line permitted evaluation of cell metabolism, mitochondrial network, and cellular Ca 2+ compartmentalization at key cell cycle stages. The mitochondrial network is interconnected and filamentous at G1/S but fragments during the S and G2/M phases, presumably to permit sorting to daughter cells. Pyruvate anaplerosis peaks at G1/S, consistent with generation of biomass for daughter cells, whereas mitochondrial Ca 2+ and respiration increase during S and G2/M, consistent with increased energy requirements for DNA and lipid synthesis. This synchronization approach may be of value to investigators performing live cell imaging of Ca 2+ or mitochondrial dynamics commonly undertaken in INS cell lines because without synchrony widely disparate data from cell to cell would be expected depending on position within cell cycle. Our findings also offer insight into why replicating beta-cells are relatively nonfunctional secreting insulin in response to glucose. They also provide guidance on metabolic requirements of beta-cells for the transition through the cell cycle that may complement the efforts currently restricted to manipulating cell cycle to drive beta-cells through cell cycle.
International Space Station Lithium-Ion Battery Start-Up
NASA Technical Reports Server (NTRS)
Dalton, Penni J.; North, Tim; Bowens, Ebony; Balcer, Sonia
2017-01-01
International Space Station Lithium-Ion Battery Start-Up.The International Space Station (ISS) primary Electric Power System (EPS) was originally designed to use Nickel-Hydrogen (Ni-H2) batteries to store electrical energy. The electricity for the space station is generated by its solar arrays, which charge batteries during insolation for subsequent discharge during eclipse. The Ni-H2 batteries are designed to operate at a 35 depth of discharge (DOD) maximum during normal operation in a Low Earth Orbit. As the oldest of the 48 Ni-H2 battery Orbital Replacement Units (ORUs) has been cycling since September 2006, these batteries are now approaching their end of useful life. In 2010, the ISS Program began the development of Lithium-Ion (Li-ion) batteries to replace the Ni-H2 batteries and concurrently funded a Li-Ion ORU and cell life testing project. The first set of 6 Li-ion battery replacements were launched in December 2016 and deployed in January 2017. This paper will discuss the Li-ion battery on-orbit start-up and the status of the Li-Ion cell and ORU life cycle testing.
International Space Station Lithium-Ion Battery
NASA Technical Reports Server (NTRS)
Dalton, Penni J.; Schwanbeck, Eugene; North, Tim; Balcer, Sonia
2016-01-01
The International Space Station (ISS) primary Electric Power System (EPS) currently uses Nickel-Hydrogen (Ni-H2) batteries to store electrical energy. The electricity for the space station is generated by its solar arrays, which charge batteries during insolation for subsequent discharge during eclipse. The Ni-H2 batteries are designed to operate at a 35 depth of discharge (DOD) maximum during normal operation in a Low Earth Orbit. Since the oldest of the 48 Ni-H2 battery Orbital Replacement Units (ORUs) has been cycling since September 2006, these batteries are now approaching their end of useful life. In 2010, the ISS Program began the development of Lithium-Ion (Li-Ion) batteries to replace the Ni-H2 batteries and concurrently funded a Li-Ion ORU and cell life testing project. When deployed, they will be the largest Li-Ion batteries ever utilized for a human-rated spacecraft. This paper will include an overview of the ISS Li-Ion battery system architecture, the Li-Ion battery design and development, controls to limit potential hazards from the batteries, and the status of the Li-Ion cell and ORU life cycle testing.
Mancebo Quintana, J M; Mancebo Quintana, S
2012-01-01
The origin of sex is becoming a vexatious issue for Evolutionary Biology. Numerous hypotheses have been proposed, based on the genetic effects of sex, on trophic effects or on the formation of cysts and syncytia. Our approach addresses the change in cell cycle duration which would cause cell fusion. Several results are obtained through graphical and mathematical analysis and computer simulations. (1) In poor environments, cell fusion would be an advantageous strategy, as fusion between cells of different size shortens the cycle of the smaller cell (relative to the asexual cycle), and the majority of mergers would occur between cells of different sizes. (2) The easiest-to-evolve regulation of cell proliferation (sexual/asexual) would be by modifying the checkpoints of the cell cycle. (3) A regulation of this kind would have required the existence of the G2 phase, and sex could thus be the cause of the appearance of this phase. Regarding cell cycle, (4) the exponential curve is the only cell growth curve that has no effect on the optimal cell size in unicellular species; (5) the existence of a plateau with no growth at the end of the cell cycle explains the circadian cell cycle observed in unicellular algae.
A balance of FGF and BMP signals regulates cell cycle exit and Equarin expression in lens cells
Jarrin, Miguel; Pandit, Tanushree; Gunhaga, Lena
2012-01-01
In embryonic and adult lenses, a balance of cell proliferation, cell cycle exit, and differentiation is necessary to maintain physical function. The molecular mechanisms regulating the transition of proliferating lens epithelial cells to differentiated primary lens fiber cells are poorly characterized. To investigate this question, we used gain- and loss-of-function analyses to modulate fibroblast growth factor (FGF) and/or bone morphogenetic protein (BMP) signals in chick lens/retina explants. Here we show that FGF activity plays a key role for proliferation independent of BMP signals. Moreover, a balance of FGF and BMP signals regulates cell cycle exit and the expression of Ccdc80 (also called Equarin), which is expressed at sites where differentiation of lens fiber cells occurs. BMP activity promotes cell cycle exit and induces Equarin expression in an FGF-dependent manner. In contrast, FGF activity is required but not sufficient to induce cell cycle exit or Equarin expression. Furthermore, our results show that in the absence of BMP activity, lens cells have increased cell cycle length or are arrested in the cell cycle, which leads to decreased cell cycle exit. Taken together, these findings suggest that proliferation, cell cycle exit, and early differentiation of primary lens fiber cells are regulated by counterbalancing BMP and FGF signals. PMID:22718906
Cheng, Chao; Ung, Matthew; Grant, Gavin D.; Whitfield, Michael L.
2013-01-01
Cell cycle is a complex and highly supervised process that must proceed with regulatory precision to achieve successful cellular division. Despite the wide application, microarray time course experiments have several limitations in identifying cell cycle genes. We thus propose a computational model to predict human cell cycle genes based on transcription factor (TF) binding and regulatory motif information in their promoters. We utilize ENCODE ChIP-seq data and motif information as predictors to discriminate cell cycle against non-cell cycle genes. Our results show that both the trans- TF features and the cis- motif features are predictive of cell cycle genes, and a combination of the two types of features can further improve prediction accuracy. We apply our model to a complete list of GENCODE promoters to predict novel cell cycle driving promoters for both protein-coding genes and non-coding RNAs such as lincRNAs. We find that a similar percentage of lincRNAs are cell cycle regulated as protein-coding genes, suggesting the importance of non-coding RNAs in cell cycle division. The model we propose here provides not only a practical tool for identifying novel cell cycle genes with high accuracy, but also new insights on cell cycle regulation by TFs and cis-regulatory elements. PMID:23874175
Cycle life test and failure model of nickel-hydrogen cells
NASA Technical Reports Server (NTRS)
Smithrick, J. J.
1983-01-01
Six ampere hour individual pressure vessel nickel hydrogen cells were charge/discharge cycled to failure. Failure as used here is defined to occur when the end of discharge voltage degraded to 0.9 volts. They were cycled under a low earth orbit cycle regime to a deep depth of discharge (80 percent of rated ampere hour capacity). Both cell designs were fabricated by the same manufacturer and represent current state of the art. A failure model was advanced which suggests both cell designs have inadequate volume tolerance characteristics. The limited existing data base at a deep depth of discharge (DOD) was expanded. Two cells of each design were cycled. One COMSAT cell failed at cycle 1712 and the other failed at cycle 1875. For the Air Force/Hughes cells, one cell failed at cycle 2250 and the other failed at cycle 2638. All cells, of both designs, failed due to low end of discharge voltage (0.9 volts). No cell failed due to electrical shorts. After cell failure, three different reconditioning tests (deep discharge, physical reorientation, and open circuit voltage stand) were conducted on all cells of each design. A fourth reconditioning test (electrolyte addition) was conducted on one cell of each design. In addition post cycle cell teardown and failure analysis were performed on the one cell of each design which did not have electrolyte added after failure.
Tang, Yingzhi; Quan, Zhenzhen; Zhang, Zhe; Oliver, Stephen G.; Zhang, Nianshu
2016-01-01
Upon starvation for glucose or any other macronutrient, yeast cells exit from the mitotic cell cycle and acquire a set of characteristics that are specific to quiescent cells to ensure longevity. Little is known about the molecular determinants that orchestrate quiescence entry and lifespan extension. Using starvation-specific gene reporters, we screened a subset of the yeast deletion library representing the genes encoding ‘signaling’ proteins. Apart from the previously characterised Rim15, Mck1 and Yak1 kinases, the SNF1/AMPK complex, the cell wall integrity pathway and a number of cell cycle regulators were shown to be necessary for proper quiescence establishment and for extension of chronological lifespan (CLS), suggesting that entry into quiescence requires the integration of starvation signals transmitted via multiple signaling pathways. The CLS of these signaling mutants, and those of the single, double and triple mutants of RIM15, YAK1 and MCK1 correlates well with the amount of storage carbohydrates but poorly with transition-phase cell cycle status. Combined removal of the glycogen and trehalose biosynthetic genes, especially GSY2 and TPS1, nearly abolishes the accumulation of storage carbohydrates and severely reduces CLS. Concurrent overexpression of GSY2 and TSL1 or supplementation of trehalose to the growth medium ameliorates the severe CLS defects displayed by the signaling mutants (rim15Δyak1Δ or rim15Δmck1Δ). Furthermore, we reveal that the levels of intracellular reactive oxygen species are cooperatively controlled by Yak1, Rim15 and Mck1, and the three kinases mediate the TOR1-regulated accumulation of storage carbohydrates and CLS extension. Our data support the hypothesis that metabolic reprogramming to accumulate energy stores and the activation of anti-oxidant defence systems are coordinated by Yak1, Rim15 and Mck1 kinases to ensure quiescence entry and lifespan extension in yeast. PMID:27923067
Cao, Lu; Tang, Yingzhi; Quan, Zhenzhen; Zhang, Zhe; Oliver, Stephen G; Zhang, Nianshu
2016-12-01
Upon starvation for glucose or any other macronutrient, yeast cells exit from the mitotic cell cycle and acquire a set of characteristics that are specific to quiescent cells to ensure longevity. Little is known about the molecular determinants that orchestrate quiescence entry and lifespan extension. Using starvation-specific gene reporters, we screened a subset of the yeast deletion library representing the genes encoding 'signaling' proteins. Apart from the previously characterised Rim15, Mck1 and Yak1 kinases, the SNF1/AMPK complex, the cell wall integrity pathway and a number of cell cycle regulators were shown to be necessary for proper quiescence establishment and for extension of chronological lifespan (CLS), suggesting that entry into quiescence requires the integration of starvation signals transmitted via multiple signaling pathways. The CLS of these signaling mutants, and those of the single, double and triple mutants of RIM15, YAK1 and MCK1 correlates well with the amount of storage carbohydrates but poorly with transition-phase cell cycle status. Combined removal of the glycogen and trehalose biosynthetic genes, especially GSY2 and TPS1, nearly abolishes the accumulation of storage carbohydrates and severely reduces CLS. Concurrent overexpression of GSY2 and TSL1 or supplementation of trehalose to the growth medium ameliorates the severe CLS defects displayed by the signaling mutants (rim15Δyak1Δ or rim15Δmck1Δ). Furthermore, we reveal that the levels of intracellular reactive oxygen species are cooperatively controlled by Yak1, Rim15 and Mck1, and the three kinases mediate the TOR1-regulated accumulation of storage carbohydrates and CLS extension. Our data support the hypothesis that metabolic reprogramming to accumulate energy stores and the activation of anti-oxidant defence systems are coordinated by Yak1, Rim15 and Mck1 kinases to ensure quiescence entry and lifespan extension in yeast.
Brandmaier, Andrew; Hou, Sheng-Qi; Shen, Wen H
2017-07-21
Continuous and error-free chromosome inheritance through the cell cycle is essential for genomic stability and tumor suppression. However, accumulation of aberrant genetic materials often causes the cell cycle to go awry, leading to malignant transformation. In response to genotoxic stress, cells employ diverse adaptive mechanisms to halt or exit the cell cycle temporarily or permanently. The intrinsic machinery of cycling, resting, and exiting shapes the cellular response to extrinsic stimuli, whereas prevalent disruption of the cell cycle machinery in tumor cells often confers resistance to anticancer therapy. Phosphatase and tensin homolog (PTEN) is a tumor suppressor and a guardian of the genome that is frequently mutated or deleted in human cancer. Moreover, it is increasingly evident that PTEN deficiency disrupts the fundamental processes of genetic transmission. Cells lacking PTEN exhibit cell cycle deregulation and cell fate reprogramming. Here, we review the role of PTEN in regulating the key processes in and out of cell cycle to optimize genomic integrity. Copyright © 2017 Elsevier Ltd. All rights reserved.
O-GlcNAcylation in Cancer Biology: Linking Metabolism and Signaling.
Ferrer, Christina M; Sodi, Valerie L; Reginato, Mauricio J
2016-08-14
The hexosamine biosynthetic pathway (HBP) is highly dependent on multiple metabolic nutrients including glucose, glutamine, and acetyl-CoA. Increased flux through HBP leads to elevated post-translational addition of β-D-N-acetylglucosamine sugars to nuclear and cytoplasmic proteins. Increased total O-GlcNAcylation is emerging as a general characteristic of cancer cells, and recent studies suggest that O-GlcNAcylation is a central communicator of nutritional status to control key signaling and metabolic pathways that regulate multiple cancer cell phenotypes. This review summarizes our current understanding of changes of O-GlcNAc cycling enzymes in cancer, the role of O-GlcNAcylation in tumorigenesis, and the current challenges in targeting this pathway therapeutically. Copyright © 2016 Elsevier Ltd. All rights reserved.
The therapeutic potential of cell cycle targeting in multiple myeloma.
Maes, Anke; Menu, Eline; Veirman, Kim De; Maes, Ken; Vand Erkerken, Karin; De Bruyne, Elke
2017-10-27
Proper cell cycle progression through the interphase and mitosis is regulated by coordinated activation of important cell cycle proteins (including cyclin-dependent kinases and mitotic kinases) and several checkpoint pathways. Aberrant activity of these cell cycle proteins and checkpoint pathways results in deregulation of cell cycle progression, which is one of the key hallmarks of cancer. Consequently, intensive research on targeting these cell cycle regulatory proteins identified several candidate small molecule inhibitors that are able to induce cell cycle arrest and even apoptosis in cancer cells. Importantly, several of these cell cycle regulatory proteins have also been proposed as therapeutic targets in the plasma cell malignancy multiple myeloma (MM). Despite the enormous progress in the treatment of MM the past 5 years, MM still remains most often incurable due to the development of drug resistance. Deregulated expression of the cyclins D is observed in virtually all myeloma patients, emphasizing the potential therapeutic interest of cyclin-dependent kinase inhibitors in MM. Furthermore, other targets have also been identified in MM, such as microtubules, kinesin motor proteins, aurora kinases, polo-like kinases and the anaphase promoting complex/cyclosome. This review will provide an overview of the cell cycle proteins and checkpoint pathways deregulated in MM and discuss the therapeutic potential of targeting proteins or protein complexes involved in cell cycle control in MM.
Preclinical evaluation of olaparib and metformin combination in BRCA1 wildtype ovarian cancer.
Hijaz, M; Chhina, J; Mert, I; Taylor, M; Dar, S; Al-Wahab, Z; Ali-Fehmi, R; Buekers, T; Munkarah, A R; Rattan, R
2016-08-01
BRCA mutated ovarian cancers show increased responsiveness to PARP inhibitors. PARP inhibitors target DNA repair and provide a second hit to BRCA mutated tumors, resulting in "synthetic lethality". We investigated a combination of metformin and olaparib to provide "synthetic lethality" in BRCA intact ovarian cancer cells. Ovarian cancer cell lines (UWB1.289, UWB1.289.BRCA, SKOV3, OVCAR5, A2780 and C200) were treated with a combination of metformin and olaparib. Cell viability was assessed by MTT and colony formation assays. Flow cytometry was used to detect cell cycle events. In vivo studies were performed in SKOV3 or A2780 xenografts in nude mice. Animals were treated with single agent, metformin or olaparib or combination. Molecular downstream effects were examined by immunohistochemistry. Compared to single drug treatment, combination of olaparib and metformin resulted in significant reduction of cell proliferation and colony formation (p<0.001) in ovarian cancer cells. This treatment was associated with a significant S-phase cell cycle arrest (p<0.05). Combination of olaparib and metformin significantly inhibited SKOV3 and A2780 ovarian tumor xenografts which were accompanied with decreased Ki-index (p<0.001). Metformin did not affect DNA damage signaling, while olaparib induced adenosine monophosphate activated kinase activation; that was further potentiated with metformin combination in vivo. Combining PARP inhibitors with metformin enhances its anti-proliferative activity in BRCA mutant ovarian cancer cells. Furthermore, the combination showed significant activity in BRCA intact cancer cells in vitro and in vivo. This is a promising treatment regimen for women with epithelial ovarian cancer irrespective of BRCA status. Copyright © 2016 Elsevier Inc. All rights reserved.
Yan, Tao; Seo, Yuji; Kinsella, Timothy J
2009-11-15
MLH1 is a key DNA mismatch repair (MMR) protein involved in maintaining genomic stability by participating in the repair of endogenous and exogenous mispairs in the daughter strands during S phase. Exogenous mispairs can result following treatment with several classes of chemotherapeutic drugs, as well as with ionizing radiation. In this study, we investigated the role of the MLH1 protein in determining the cellular and molecular responses to prolonged low-dose rate ionizing radiation (LDR-IR), which is similar to the clinical use of cancer brachytherapy. An isogenic pair of MMR(+) (MLH1(+)) and MMR(-) (MLH1(-)) human colorectal cancer HCT116 cells was exposed to prolonged LDR-IR (1.3-17 cGy/h x 24-96 h). The clonogenic survival and gene mutation rates were examined. Cell cycle distribution was analyzed with flow cytometry. Changes in selected DNA damage repair proteins, DNA damage response proteins, and cell death marker proteins were examined with Western blotting. MLH1(+) HCT116 cells showed greater radiosensitivity with enhanced expression of apoptotic and autophagic markers, a reduced HPRT gene mutation rate, and more pronounced cell cycle alterations (increased late-S population and a G(2)/M arrest) following LDR-IR compared with MLH1(-) HCT116 cells. Importantly, a progressive increase in MLH1 protein levels was found in MLH1(+) cells during prolonged LDR-IR, which was temporally correlated with a progressive decrease in Rad51 protein (involved in homologous recombination) levels. MLH1 status significantly affects cellular responses to prolonged LDR-IR. MLH1 may enhance cell radiosensitivity to prolonged LDR-IR through inhibition of homologous recombination (through inhibition of Rad51).
NASA Lewis advanced IPV nickel-hydrogen technology
NASA Technical Reports Server (NTRS)
Smithrick, John J.; Britton, Doris L.
1993-01-01
Individual pressure vessel (IPV) nickel-hydrogen technology was advanced at NASA Lewis and under Lewis contracts. Some of the advancements are as follows: to use 26 percent potassium hydroxide electrolyte to improve cycle life and performance, to modify the state of the art cell design to eliminate identified failure modes and further improve cycle life, and to develop a lightweight nickel electrode to reduce battery mass, hence reduce launch and/or increase satellite payload. A breakthrough in the LEO cycle life of individual pressure vessel nickel-hydrogen battery cells was reported. The cycle life of boiler plate cells containing 26 percent KOH electrolyte was about 40,000 accelerated LEO cycles at 80 percent DOD compared to 3,500 cycles for cells containing 31 percent KOH. Results of the boiler plate cell tests have been validated at NWSC, Crane, Indiana. Forty-eight ampere-hour flight cells containing 26 and 31 percent KOH have undergone real time LEO cycle life testing at an 80 percent DOD, 10 C. The three cells containing 26 percent KOH failed on the average at cycle 19,500. The three cells containing 31 percent KOH failed on the average at cycle 6,400. Validation testing of NASA Lewis 125 Ah advanced design IPV nickel-hydrogen flight cells is also being conducted at NWSC, Crane, Indiana under a NASA Lewis contract. This consists of characterization, storage, and cycle life testing. There was no capacity degradation after 52 days of storage with the cells in the discharged state, on open circuit, 0 C, and a hydrogen pressure of 14.5 psia. The catalyzed wall wick cells have been cycled for over 22,694 cycles with no cell failures in the continuing test. All three of the non-catalyzed wall wick cells failed (cycles 9,588; 13,900; and 20,575). Cycle life test results of the Fibrex nickel electrode has demonstrated the feasibility of an improved nickel electrode giving a higher specific energy nickel-hydrogen cell. A nickel-hydrogen boiler plate cell using an 80 mil thick, 90 percent porous Fibrex nickel electrode has been cycled for 10,000 cycles at 40 percent DOD.
[Educational status and patterns of weight gain in adulthood in Brazil: Estudo Pró-Saúde].
Fonseca, Maria de Jesus Mendes da; França, Rosana de Figueiredo; Faerstein, Eduardo; Werneck, Guilherme Loureiro; Chor, Dóra
2012-11-01
The aim of the present study was to investigate the association between participant and parental educational status (considered as an indicator of socioeconomic status) and participant pattern of weight gain in adulthood. We analyzed data from 2 582 baseline participants (1999) of Estudo Pró-Saúde (Pro-Health Study), a longitudinal investigation of civil servants from a public university in Rio de Janeiro, Brazil. Self-administered questionnaires were used to identify patterns of weight gain in adulthood. Odds ratios (OR) and 95% confidence intervals (95%CI) were estimated for the association between parental and participant educational status and steady weight gain or weight cycling, with stable weight as a reference, using multinomial logistic regression models. For males, lower paternal educational level entailed a chance about 55% lower of weight cycling as compared to stable weight (OR = 0.45; IC95% = 0.26-0.78), whereas lower maternal schooling was related to increased risk of weight cycling, although without reaching statistical significance (OR = 1.68; IC95% = 0.94-3.00). The association between participant educational status and weight history was not statistically significant among men. In women, lower educational status entailed a chance 94% higher of self-reported weight cycling (OR = 1.94; 95% CI = 1.17-3.23), and there was no association between parental educational level and history of weight gain. In this study, changes in weight throughout life, both steady and cyclic, were associated with parental and participant educational status, with major differences between genders.
Palmer, Clovis S; Henstridge, Darren C; Yu, Di; Singh, Amit; Balderson, Brad; Duette, Gabriel; Cherry, Catherine L; Anzinger, Joshua J; Ostrowski, Matias; Crowe, Suzanne M
2016-06-01
Immune cells cycle between a resting and an activated state. Their metabolism is tightly linked to their activation status and, consequently, functions. Ag recognition induces T lymphocyte activation and proliferation and acquisition of effector functions that require and depend on cellular metabolic reprogramming. Likewise, recognition of pathogen-associated molecular patterns by monocytes and macrophages induces changes in cellular metabolism. As obligate intracellular parasites, viruses manipulate the metabolism of infected cells to meet their structural and functional requirements. For example, HIV-induced changes in immune cell metabolism and redox state are associated with CD4(+) T cell depletion, immune activation, and inflammation. In this review, we highlight how HIV modifies immunometabolism with potential implications for cure research and pathogenesis of comorbidities observed in HIV-infected patients, including those with virologic suppression. In addition, we highlight recently described key methods that can be applied to study the metabolic dysregulation of immune cells in disease states. Copyright © 2016 by The American Association of Immunologists, Inc.
Lü, Rui
2017-09-01
Dynamic detection of transient redox changes in living cells and animals has broad implications for human health and disease diagnosis, because intracellular redox homeostasis regulated by reactive oxygen species (ROS) plays important role in cell functions, normal physiological functions and some serious human diseases (e.g., cancer, Alzheimer's disease, diabetes, etc.) usually have close relationship with the intracellular redox status. Small-molecule ROS-responsive fluorescent probes can act as powerful tools for dynamic detection of ROS and redox changes in living cells and animals through fluorescence imaging techniques; and great advances have been achieved recently in the design and synthesis of small-molecule ROS-responsive fluorescent probes. This article highlights up-to-date achievements in designing and using the reaction-based small-molecule fluorescent probes (with high sensitivity and selectivity to ROS and redox cycles) in the dynamic detection of ROS and transient redox changes in living cells and animals through fluorescence imaging. Copyright © 2017. Published by Elsevier Ltd.
Effect of cycling on the lithium/electrolyte interface in organic electrolytes
NASA Technical Reports Server (NTRS)
Surampudi, S.; Shen, D. H.; Huang, C.-K.; Narayanan, S. R.; Attia, A.; Halpert, G.; Peled, E.
1993-01-01
Nondestructive methods such as ac impedance spectroscopy and microcalorimetry are used to study the effect of cell cycling on the lithium/electrolyte interface. The reactivity of both uncycled and cycled lithium towards various electrolytes is examined by measuring the heat evolved from the cells under open-circuit conditions at 25 C by microcalorimetry. Cycled cells at the end of charge/discharge exhibited considerably higher heat output compared with the uncycled cells. After 30 d of storage, the heat output of the cycled cells is similar to that of the uncycled cells. The cell internal resistance increases with cycling, and this is attributed to the degradation of the electrolyte with cycling.
AGR-3/4 Final Data Qualification Report for ATR Cycles 151A through 155B-1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pham, Binh T.
2015-03-01
This report provides the qualification status of experimental data for the entire Advanced Gas Reactor 3/4 (AGR 3/4) fuel irradiation. AGR-3/4 is the third in a series of planned irradiation experiments conducted in the Advanced Test Reactor (ATR) at Idaho National Laboratory (INL) for the AGR Fuel Development and Qualification Program, which supports development of the advanced reactor technology under the INL ART Technology Development Office (TDO). The main objective of AGR-3/4 irradiation is to provide a known source of fission products for subsequent transport through compact matrix and structural graphite materials due to the presence of designed-to-fail fuel particles.more » Full power irradiation of the AGR 3/4 test began on December 14, 2011 (ATR Cycle 151A), and was completed on April 12, 2014 (end of ATR Cycle 155B) after 369.1 effective full power days of irradiation. The AGR-3/4 test was in the reactor core for eight of the ten ATR cycles between 151A and 155B. During the unplanned outage cycle, 153A, the experiment was removed from the ATR northeast flux trap (NEFT) location and stored in the ATR canal. This was to prevent overheating of fuel compacts due to higher than normal ATR power during the subsequent Powered Axial Locator Mechanism cycle, 153B. The AGR 3/4 test was inserted back into the ATR NEFT location during the outage of ATR Cycle 154A on April 26, 2013. Therefore, the AGR-3/4 irradiation data received during these 2 cycles (153A and 153B) are irrelevant and their qualification status isnot included in this report. Additionally, during ATR Cycle 152A the ATR core ran at low power for a short enough duration that the irradiation data are not used for physics and thermal calculations. However, the qualification status of irradiation data for this cycle is still covered in this report. As a result, this report includes data from 8 ATR Cycles: 151A, 151B, 152A, 152B, 154A, 154B, 155A, and 155B, as recorded in the Nuclear Data Management and Analysis System (NDMAS). The AGR 3/4 data streams addressed in this report include thermocouple (TC) temperatures, sweep gas data (flow rates, pressure, and moisture content), and Fission Product Monitoring System (FPMS) data (release rates, release to birth rate ratios [R/Bs], and particle failure counts) for each of the twelve capsules in the AGR 3/4 experiment. During Outage Cycle 155A, fourteen flow meters were installed downstream from fourteen FPMS monitors to measure flows from the monitors; qualification status of these data are also included in the report. The final data qualification status for these data streams is determined by a Data Review Committee (DRC) composed of AGR technical leads, Sitewide Quality Assurance (QA), and NDMAS analysts. For ATR Cycles 151A through 154B, the DRC convened on February 12, 2014, reviewed the data acquisition process, and considered whether the data met the requirements for data collection as specified in QA approved INL ART TDO data collection plans. The DRC also examined the results of NDMAS data testing and statistical analyses, and confirmed the qualification status of the data as given in this report. The qualification status of AGR-3/4 irradiation data during the first six cycles were previously reported in INL/EXT-14-31186 document. This report presents data qualification status for the entire AGR-3/4 irradiation.« less
Nogué-Aliguer, Miquel; Carles, Joan; Arrivi, Antonio; Juan, Oscar; Alonso, Lorenzo; Font, Albert; Mellado, Begoña; Garrido, Pilar; Sáenz, Alberto
2003-05-01
Cisplatin-based combinations are considered to be the standard treatment for advanced transitional cell carcinoma (TCC) of the urothelium. Many of the patients are elderly with concomitant diseases or impaired renal function. We studied the tolerance and activity of the gemcitabine/carboplatin combination as a therapeutic alternative. Patients with locally advanced or metastatic TCC of the urothelium were treated with gemcitabine 1000 mg/m(2) on Days 1 and 8 and carboplatin area under the concentration-time curve 5 on Day 1 every 21 days. Patients with creatinine clearance of 30 mL/min or above and Karnofsky performance status (KPS) scores 60 or above were enrolled. A total of 227 cycles were administered to 41 patients, with an average of 5.5 cycles per patient (range, 1-8 cycles). Creatinine clearance was below 60 mL/min in 54% of patients, KPS was 70 or below in 37% of patients, and 37% of patients were 70 years old or older. Hematologic toxicity was mainly Grade 3/4 neutropenia in 63%, Grade 3/4 thrombocytopenia in 32%, and Grade 3/4 anemia in 54% of patients. There were only three episodes of febrile neutropenia and one death from neutropenic sepsis. Nonhematologic toxicity was mild, with asthenia as the most frequently reported event. We obtained 6 complete and 17 partial responses, for an overall response rate of 56.1% (95% confidence interval [CI], 40.6-71.6%). Progression-free survival was 7.2 months (95% CI, 5.7-8.5) and median survival was 10.1 months (95% CI, 8.8-12.2). The combination of gemcitabine plus carboplatin achieves a similar result to doublets using cisplatin. It has an acceptable toxicity profile and enables patients with impaired renal function and/or poor performance status and elderly patients to be treated. Copyright 2003 American Cancer Society.DOI 10.1002/cncr.10990
Vogl, Ursula; Leitner, Gerda; Dal-Bianco, Assunta; Bojic, Marija; Mitterbauer, Margit; Rabitsch, Werner; Kalhs, Peter; Schulenburg, Axel
2016-05-01
Neurologic complications after allogeneic hematopoietic stem cell transplantation (HSCT) are rare but poorly understood. We present a case report of a 57-year-old-male patient who was diagnosed in 2009 with acute myeloid leukemia (AML). He received two standard induction chemotherapies, as well as a following consolidation. Six months later, an allogeneic HSCT was performed. Shortly after HSCT the patient developed progressive polyneuropathy of the lower legs and hypoesthesia. Five months later a severe dementia followed. All images of the brain and spine showed no specific pathologies. High dose corticosteroids and immunoglobulins did not improve the neurologic symptoms. Due to severe worsening of the neuropsychiatric status and the clinical presentation, chronic inflammatory demyelinating polyneuropathy (CIDP) was suspected. Therefore, the patient received ten cycles of plasmapheresis. The patient showed a significant improvement of the neuropsychiatric symptoms and cognitive status. Immune mediated neuropathies after allogeneic HSCT, such as CIDP, have great variability in symptoms and presentation and are challenging to diagnose and treat. Plasmapheresis is a safe and efficient treatment for patients with unclear persisting autoimmune neuropathy after HSCT.
Verhaak, C M; Smeenk, J M; Eugster, A; van Minnen, A; Kremer, J A; Kraaimaat, F W
2001-09-01
To determine differences in emotional status (anxiety and depression) and marital satisfaction in pregnant and nonpregnant women before and after their first cycle of IVF and intracytoplasmic sperm injection (ICSI). Repeated measurement. Fertility department at a university and a regional hospital. Women entering their first treatment cycle of IVF or ICSI. Questionnaires on psychological factors were administered 3 to 12 days before the start of their first treatment cycle and repeated 3 weeks after the pregnancy test. State anxiety, depression, mood, and marital satisfaction. At pretreatment, the women who became pregnant showed lower levels of depression than those who did not. Higher levels of depression in the pregnant women after the first cycle were due to higher scores on vital aspects of depression, related to signs of early pregnancy. Higher levels of depression in the nonpregnant women were due to a higher score on cognitive aspects of depression. Differences in emotional status between pregnant and nonpregnant women were present before treatment and became more apparent after the first IVF and ICSI cycle. There were no differences in emotional status between the women who underwent IVF and those who underwent ICSI.
Liu, Xiaomin; Zhang, Yingjian; Wang, Ping; Wang, Hongyun; Su, Huanhuan; Zhou, Xin; Zhang, Lamei
2016-07-16
BACKGROUND This study was designed to improve our understanding of the role of miR-18a and its target (connective tissue growth factor (CTGF), which are mediators in HBX-induced hepatocellular carcinoma (HCC). MATERIAL AND METHODS We first investigated the expression of several candidate microRNAs (miRNAs) reported to have been aberrantly expressed between HepG2 and HepG2.2.15, which is characterized by stable HBV infection, while the CTGF is identified as a target of miR-18a. Furthermore, the expression of CTGF evaluated in HepG2 was transfected with HBX, while the HepG2.2.15 was transfected with miR-18a and CTGF siRNA. We examined the cell cycle at the same time. RESULTS We found that the expression of miR-18a was abnormally reduced in the HBV-positive HCC tissue samples compared with HBV-negative HCC samples. Through the use of a luciferase reporter system, we also identified CTGF 3'UTR (1046-1052 bp) as the exact binding site for miR-18a. We also observed a clear increase in CTGF mRNA and protein expression levels in HBV-positive HCC human tissue samples in comparison with the HBV-negative controls, indicating a possible negatively associated relationship between miR-18a and CTGF. Furthermore, we investigated the effect of HBX overexpression on miR-18a and CTGF, as well as the viability and cell cycle status of HepG2 cells. In addition, we found that HBX introduction downregulated miR-18a, upregulated CTGF, elevated the viability, and promoted cell cycle progression. We transfected HepG2.2.15 with miR-18a mimics and CTGF siRNA, finding that upregulated miR-18a and downregulated CTGF suppress the viability and cause cell cycle arrest. CONCLUSIONS Our study shows the role of the CTGF gene as a target of miR-18a, and identifies the function of HBV/HBX/miR-18a/CTGF as a key signaling pathway mediating HBV infection-induced HCC.
Temporal fluxomics reveals oscillations in TCA cycle flux throughout the mammalian cell cycle.
Ahn, Eunyong; Kumar, Praveen; Mukha, Dzmitry; Tzur, Amit; Shlomi, Tomer
2017-11-06
Cellular metabolic demands change throughout the cell cycle. Nevertheless, a characterization of how metabolic fluxes adapt to the changing demands throughout the cell cycle is lacking. Here, we developed a temporal-fluxomics approach to derive a comprehensive and quantitative view of alterations in metabolic fluxes throughout the mammalian cell cycle. This is achieved by combining pulse-chase LC-MS-based isotope tracing in synchronized cell populations with computational deconvolution and metabolic flux modeling. We find that TCA cycle fluxes are rewired as cells progress through the cell cycle with complementary oscillations of glucose versus glutamine-derived fluxes: Oxidation of glucose-derived flux peaks in late G1 phase, while oxidative and reductive glutamine metabolism dominates S phase. These complementary flux oscillations maintain a constant production rate of reducing equivalents and oxidative phosphorylation flux throughout the cell cycle. The shift from glucose to glutamine oxidation in S phase plays an important role in cell cycle progression and cell proliferation. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.
Playing with the cell cycle to build the spinal cord.
Molina, Angie; Pituello, Fabienne
2017-12-01
A fundamental issue in nervous system development and homeostasis is to understand the mechanisms governing the balance between the maintenance of proliferating progenitors versus their differentiation into post-mitotic neurons. Accumulating data suggest that the cell cycle and core regulators of the cell cycle machinery play a major role in regulating this fine balance. Here, we focus on the interplay between the cell cycle and cellular and molecular events governing spinal cord development. We describe the existing links between the cell cycle and interkinetic nuclear migration (INM). We show how the different morphogens patterning the neural tube also regulate the cell cycle machinery to coordinate proliferation and patterning. We give examples of how cell cycle core regulators regulate transcriptionally, or post-transcriptionally, genes involved in controlling the maintenance versus the differentiation of neural progenitors. Finally, we describe the changes in cell cycle kinetics occurring during neural tube patterning and at the time of neuronal differentiation, and we discuss future research directions to better understand the role of the cell cycle in cell fate decisions. Copyright © 2017 Elsevier Inc. All rights reserved.
Comparison of Follicular and Luteal Phase Mucosal Markers of HIV Susceptibility in Healthy Women
Chandra, Neelima; Yousefieh, Nazita; Zalenskaya, Irina; Kimble, Thomas; Asin, Susana; Rollenhagen, Christiane; Anderson, Sharon M.; Herold, Betsy; Mesquita, Pedro M.M.; Richardson-Harman, Nicola; Cunningham, Tina; Schwartz, Jill L.; Doncel, Gustavo F.
2016-01-01
Abstract The purpose of this study was to evaluate differences in vaginal immune cell populations, vaginal tissue gene expression, antimicrobial activity of the cervicovaginal (CV) lavage (CVL), vaginal flora, and p24 antigen production from CV tissues after ex vivo human immunodeficiency virus (HIV) infection between follicular (FOL) and luteal (LUT) phases of the menstrual cycle. CV tissue biopsies, CV secretions, and blood samples were obtained as part of two longitudinal clinical trials of healthy women (CONRAD D11-119 and A12-124 studies). Participants (n = 39) were HIV-seronegative women not using exogenous hormone supplementation, with normal menstrual cycles, who were screened to exclude sexually transmitted and reproductive tract infections. Serum levels of estradiol and progesterone were significantly higher in the LUT versus the FOL phase of the menstrual cycle. Controlling for race, reported contraceptive use/sexual practices, and clinical trial, we found no differences in vaginal tissue immune cell populations and activation status, transcriptomes, inhibition of HIV, herpes simplex virus type 2 and Escherichia coli by the CVL, vaginal pH or Nugent score, or production of p24 antigen after ex vivo infection by HIV-1BaL between CV samples obtained in the FOL phase versus the LUT phase of the menstrual cycle. There were no significant correlations between serum estradiol and progesterone levels and CV endpoints. The hypothesis that the LUT phase of the menstrual cycle represents a more vulnerable stage for mucosal infection with HIV was not supported by data from samples obtained from the lower genital tract (ectocervix and vagina) from these two clinical trials. PMID:26750085
Rep. Tonko, Paul [D-NY-21
2009-06-24
Senate - 12/02/2009 Received in the Senate and Read twice and referred to the Committee on Energy and Natural Resources. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:
Cuello-Carrión, F Darío; Troncoso, Mariana; Guiñazu, Elina; Valdez, Susana R; Fanelli, Mariel A; Ciocca, Daniel R; Kreimann, Erica L
2010-12-01
In breast cancer cell lines, the Na(+)/H(+) exchanger regulator factor 1 (NHERF1) gene is regulated at the transcriptional level by estrogens, the protein expression levels correlate with the presence of estrogen receptors and the effect is blocked by anti-estrogens. However, there is limited information regarding the regulation of NHERF1 by estrogens in normal colon tissue. The NHERF1 protein has an important role in the maintenance of the intestine ultrastructure. NHERF1-deficient mice showed defects in the intestinal microvilli as well as molecular alterations in brush border membrane proteins. Here, we have studied the expression of NHERF1 in normal rat colon and uterus during the reproductive cycle of Wistar rats. We found that NHERF1 expression in rat colon during the estral cycle is modified by estrogen levels: higher expression of NHERF1 was observed during the proestrous and estrous stages and lower expression in diestrous 1 when estrogen levels decreased. In uterus, NHERF1 was expressed in the apical region of the luminal epithelium and glands in all stages of the estral cycle, and in both colon and uterus, the expression was independent of the proliferation status. Our results show that NHERF1 expression is regulated by estrogens in colon during the rat estral cycle.
Cell cycle proteins as promising targets in cancer therapy.
Otto, Tobias; Sicinski, Piotr
2017-01-27
Cancer is characterized by uncontrolled tumour cell proliferation resulting from aberrant activity of various cell cycle proteins. Therefore, cell cycle regulators are considered attractive targets in cancer therapy. Intriguingly, animal models demonstrate that some of these proteins are not essential for proliferation of non-transformed cells and development of most tissues. By contrast, many cancers are uniquely dependent on these proteins and hence are selectively sensitive to their inhibition. After decades of research on the physiological functions of cell cycle proteins and their relevance for cancer, this knowledge recently translated into the first approved cancer therapeutic targeting of a direct regulator of the cell cycle. In this Review, we focus on proteins that directly regulate cell cycle progression (such as cyclin-dependent kinases (CDKs)), as well as checkpoint kinases, Aurora kinases and Polo-like kinases (PLKs). We discuss the role of cell cycle proteins in cancer, the rationale for targeting them in cancer treatment and results of clinical trials, as well as the future therapeutic potential of various cell cycle inhibitors.
Cell cycle nucleic acids, polypeptides and uses thereof
Gordon-Kamm, William J [Urbandale, IA; Lowe, Keith S [Johnston, IA; Larkins, Brian A [Tucson, AZ; Dilkes, Brian R [Tucson, AZ; Sun, Yuejin [Westfield, IN
2007-08-14
The invention provides isolated nucleic acids and their encoded proteins that are involved in cell cycle regulation. The invention further provides recombinant expression cassettes, host cells, transgenic plants, and antibody compositions. The present invention provides methods and compositions relating to altering cell cycle protein content, cell cycle progression, cell number and/or composition of plants.
Zerjatke, Thomas; Gak, Igor A; Kirova, Dilyana; Fuhrmann, Markus; Daniel, Katrin; Gonciarz, Magdalena; Müller, Doris; Glauche, Ingmar; Mansfeld, Jörg
2017-05-30
Cell cycle kinetics are crucial to cell fate decisions. Although live imaging has provided extensive insights into this relationship at the single-cell level, the limited number of fluorescent markers that can be used in a single experiment has hindered efforts to link the dynamics of individual proteins responsible for decision making directly to cell cycle progression. Here, we present fluorescently tagged endogenous proliferating cell nuclear antigen (PCNA) as an all-in-one cell cycle reporter that allows simultaneous analysis of cell cycle progression, including the transition into quiescence, and the dynamics of individual fate determinants. We also provide an image analysis pipeline for automated segmentation, tracking, and classification of all cell cycle phases. Combining the all-in-one reporter with labeled endogenous cyclin D1 and p21 as prime examples of cell-cycle-regulated fate determinants, we show how cell cycle and quantitative protein dynamics can be simultaneously extracted to gain insights into G1 phase regulation and responses to perturbations. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Roy, Debmalya; Sheng, Gao Ying; Herve, Semukunzi; Carvalho, Evandro; Mahanty, Arpan; Yuan, Shengtao; Sun, Li
2017-05-01
A growing interest has emerged in the field of studying the cross-talk between cancer cell cycle and metabolism. In this review, we aimed to present how metabolism and cell cycle are correlated and how cancer cells get energy to drive cell cycle. Cell proliferation and cell death largely depend on the metabolic activity of the cell. Cell cycle proteins, e.g. cyclin D, cyclin dependent kinase (CDK), some pro-apoptotic and anti-apoptotic proteins, and P53 have been shown to be regulated by metabolic crosstalk. Dysregulation of this cross-talk between metabolism and cell cycle leads to degenerative disorder(s) and cancer. It is not fully understood the actual reason of aberration between metabolism and cell cycle, but it is a hallmark of cancer research. Herein, we discussed the role of some regulatory molecules relative of cell cycle and metabolism and highlight how they control the function of each other. We also pointed out, current therapeutic opportunities and some additional crucial therapeutic targets on these fields that could be a breakthrough in cancer research. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Effect of KOH concentration on LEO cycle life of IPV nickel-hydrogen flight cells. An update
NASA Technical Reports Server (NTRS)
Smithrick, John J.; Hall, Stephen W.
1991-01-01
An update of validation test results confirming the breakthrough in LEO cycle life of nickel-hydrogen cells containing 26 percent potassium hydroxide (KOH) electrolyte is presented. A breakthrough in the LEO cycle life of individual pressure vessel nickel-hydrogen cells is reported. The cycle life of boiler plate cells containing 26 percent KOH electrolyte was about 40,000 LEO cycles compared to 3500 cycles for cells containing 31 percent KOH.
Effect of KOH concentration on LEO cycle life of IPV nickel-hydrogen flight cells - An update
NASA Technical Reports Server (NTRS)
Smithrick, John J.; Hall, Stephen W.
1991-01-01
An update of validation test results confirming the breakthrough in LEO cycle life of nickel-hydrogen cells containing 26 percent potassium hydroxide (KOH) electrolyte is presented. A breakthrough in the LEO cycle life of individual pressure vessel nickel-hydrogen cells is reported. The cycle life of boiler plate cells containing 26 percent KOH electrolyte was about 40,000 LEO cycles compared to 3500 cycles for cells containing 31 percent KOH.
Effect of LEO cycling on 125 Ah advanced design IPV nickel-hydrogen flight cells - An update
NASA Technical Reports Server (NTRS)
Smithrick, John J.; Hall, Stephen W.
1991-01-01
An update of validation test results confirming the breakthrough in LEO cycle life of nickel-hydrogen cells containing 26 percent potassium hydroxide (KOH) electrolyte is presented. A breakthrough in the LEO cycle life of individual pressure vessel nickel-hydrogen cells is reported. The cycle life of boiler plate cells containing 26 percent KOH electrolyte was about 40,000 LEO cycles compared to 3500 cycles for cells containing 31 percent KOH.
Exploring the Underlying Mechanisms of the Xenopus laevis Embryonic Cell Cycle.
Zhang, Kun; Wang, Jin
2018-05-31
The cell cycle is an indispensable process in proliferation and development. Despite significant efforts, global quantification and physical understanding are still challenging. In this study, we explored the mechanisms of the Xenopus laevis embryonic cell cycle by quantifying the underlying landscape and flux. We uncovered the Mexican hat landscape of the Xenopus laevis embryonic cell cycle with several local basins and barriers on the oscillation path. The local basins characterize the different phases of the Xenopus laevis embryonic cell cycle, and the local barriers represent the checkpoints. The checkpoint mechanism of the cell cycle is revealed by the landscape basins and barriers. While landscape shape determines the stabilities of the states on the oscillation path, the curl flux force determines the stability of the cell cycle flow. Replication is fundamental for biology of living cells. We quantify the input energy (through the entropy production) as the thermodynamic requirement for initiation and sustainability of single cell life (cell cycle). Furthermore, we also quantify curl flux originated from the input energy as the dynamical requirement for the emergence of a new stable phase (cell cycle). This can provide a new quantitative insight for the origin of single cell life. In fact, the curl flux originated from the energy input or nutrition supply determines the speed and guarantees the progression of the cell cycle. The speed of the cell cycle is a hallmark of cancer. We characterized the quality of the cell cycle by the coherence time and found it is supported by the flux and energy cost. We are also able to quantify the degree of time irreversibility by the cross correlation function forward and backward in time from the stochastic traces in the simulation or experiments, providing a way for the quantification of the time irreversibility and the flux. Through global sensitivity analysis upon landscape and flux, we can identify the key elements for controlling the cell cycle speed. This can help to design an effective strategy for drug discovery against cancer.
Effect of KOH concentration on LEO cycle life of IPV nickel-hydrogen flight cells-update 2
NASA Technical Reports Server (NTRS)
Smithrick, John J.; Hall, Stephen W.
1991-01-01
An update of validation test results confirming the breakthrough in low earth orbit (LEO) cycle life of nickel-hydrogen cells containing 26 percent KOH electrolyte is presented. A breakthrough in the LEO cycle life of individual pressure vessel (IPV nickel-hydrogen cells has been previously reported. The cycle life of boiler plate cells containing 26 percent potassium hydroxide (KOH) electrolyte was about 40 000 LEO cycles compared to 3500 cycles for cells containing 31 percent KOH. This test was conducted at Hughes Aircraft Company under a NASA Lewis contract. The purpose was to investigate the effect of KOH concentration on cycle life. The cycle regime was a stressful accelerated LEO, which consisted of a 27.5 min charge followed by a 17.5 min discharge (2x normal rate). The depth of discharge (DOD) was 80 percent. The cell temperature was maintained at 23 C. The boiler plate test results are in the process of being validated using flight hardware and real time LEO test at the Naval Weapons Support Center (NWSC), Crane, Indiana under a NASA Lewis Contract. Six 48 Ah Hughes recirculation design IPV nickel-hydrogen flight battery cells are being evaluated. Three of the cells contain 26 percent KOH (test cells), and three contain 31 percent KOH (control cells). They are undergoing real time LEO cycle life testing. The cycle regime is a 90-min LEO orbit consisting of a 54-min charge followed by a 36-min discharge. The depth-of-discharge is 80 percent. The cell temperature is maintained at 10 C. The three 31 percent KOH cells failed (cycles 3729, 4165, and 11355). One of the 26 percent KOH cells failed at cycle 15314. The other two 26 percent KOH cells were cycled for over 16600 cycles during the continuing test.
Cell-cycle control in the face of damage--a matter of life or death.
Clarke, Paul R; Allan, Lindsey A
2009-03-01
Cells respond to DNA damage or defects in the mitotic spindle by activating checkpoints that arrest the cell cycle. Alternatively, damaged cells can undergo cell death by the process of apoptosis. The correct balance between these pathways is important for the maintenance of genomic integrity while preventing unnecessary cell death. Although the molecular mechanisms of the cell cycle and apoptosis have been elucidated, the links between them have not been clear. Recent work, however, indicates that common components directly link the regulation of apoptosis with cell-cycle checkpoints operating during interphase, whereas in mitosis, the control of apoptosis is directly coupled to the cell-cycle machinery. These findings shed new light on how the balance between cell-cycle progression and cell death is controlled.
The cell cycle of early mammalian embryos: lessons from genetic mouse models.
Artus, Jérôme; Babinet, Charles; Cohen-Tannoudji, Michel
2006-03-01
Genes coding for cell cycle components predicted to be essential for its regulation have been shown to be dispensable in mice, at the whole organism level. Such studies have highlighted the extraordinary plasticity of the embryonic cell cycle and suggest that many aspects of in vivo cell cycle regulation remain to be discovered. Here, we discuss the particularities of the mouse early embryonic cell cycle and review the mutations that result in cell cycle defects during mouse early embryogenesis, including deficiencies for genes of the cyclin family (cyclin A2 and B1), genes involved in cell cycle checkpoints (Mad2, Bub3, Chk1, Atr), genes involved in ubiquitin and ubiquitin-like pathways (Uba3, Ubc9, Cul1, Cul3, Apc2, Apc10, Csn2) as well as genes the function of which had not been previously ascribed to cell cycle regulation (Cdc2P1, E4F and Omcg1).
Model-Based Analysis of Cell Cycle Responses to Dynamically Changing Environments
Seaton, Daniel D; Krishnan, J
2016-01-01
Cell cycle progression is carefully coordinated with a cell’s intra- and extracellular environment. While some pathways have been identified that communicate information from the environment to the cell cycle, a systematic understanding of how this information is dynamically processed is lacking. We address this by performing dynamic sensitivity analysis of three mathematical models of the cell cycle in Saccharomyces cerevisiae. We demonstrate that these models make broadly consistent qualitative predictions about cell cycle progression under dynamically changing conditions. For example, it is shown that the models predict anticorrelated changes in cell size and cell cycle duration under different environments independently of the growth rate. This prediction is validated by comparison to available literature data. Other consistent patterns emerge, such as widespread nonmonotonic changes in cell size down generations in response to parameter changes. We extend our analysis by investigating glucose signalling to the cell cycle, showing that known regulation of Cln3 translation and Cln1,2 transcription by glucose is sufficient to explain the experimentally observed changes in cell cycle dynamics at different glucose concentrations. Together, these results provide a framework for understanding the complex responses the cell cycle is capable of producing in response to dynamic environments. PMID:26741131
A dual-color marker system for in vivo visualization of cell cycle progression in Arabidopsis.
Yin, Ke; Ueda, Minako; Takagi, Hitomi; Kajihara, Takehiro; Sugamata Aki, Shiori; Nobusawa, Takashi; Umeda-Hara, Chikage; Umeda, Masaaki
2014-11-01
Visualization of the spatiotemporal pattern of cell division is crucial to understand how multicellular organisms develop and how they modify their growth in response to varying environmental conditions. The mitotic cell cycle consists of four phases: S (DNA replication), M (mitosis and cytokinesis), and the intervening G1 and G2 phases; however, only G2/M-specific markers are currently available in plants, making it difficult to measure cell cycle duration and to analyze changes in cell cycle progression in living tissues. Here, we developed another cell cycle marker that labels S-phase cells by manipulating Arabidopsis CDT1a, which functions in DNA replication origin licensing. Truncations of the CDT1a coding sequence revealed that its carboxy-terminal region is responsible for proteasome-mediated degradation at late G2 or in early mitosis. We therefore expressed this region as a red fluorescent protein fusion protein under the S-specific promoter of a histone 3.1-type gene, HISTONE THREE RELATED2 (HTR2), to generate an S/G2 marker. Combining this marker with the G2/M-specific CYCB1-GFP marker enabled us to visualize both S to G2 and G2 to M cell cycle stages, and thus yielded an essential tool for time-lapse imaging of cell cycle progression. The resultant dual-color marker system, Cell Cycle Tracking in Plant Cells (Cytrap), also allowed us to identify root cells in the last mitotic cell cycle before they entered the endocycle. Our results demonstrate that Cytrap is a powerful tool for in vivo monitoring of the plant cell cycle, and thus for deepening our understanding of cell cycle regulation in particular cell types during organ development. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
Kenessey, István; Kói, Krisztina; Horváth, Orsolya; Cserepes, Mihály; Molnár, Dávid; Izsák, Vera; Dobos, Judit; Hegedűs, Balázs
2016-01-01
Background In non-small cell lung cancer (NSCLC) KRAS-mutant status is a negative prognostic and predictive factor. Nitrogen-containing bisphosphonates inhibit prenylation of small G-proteins (e.g. Ras, Rac, Rho) and thus may affect proliferation and migration. In our preclinical work, we investigated the effect of an aminobisphosphonate compound (zoledronic acid) on mutant and wild type KRAS-expressing human NSCLC cell lines. Results We confirmed that zoledronic acid was unable to inhibit the prenylation of mutant K-Ras unlike in the case of wild type K-Ras. In case of in vitro proliferation, the KRAS-mutant human NSCLC cell lines showed resistance to zoledronic acid wild-type KRAS-cells proved to be sensitive. Combinatory application of zoledronic acid enhanced the cytostatic effect of cisplatin. Zoledronic acid did not induce significant apoptosis. In xenograft model, zoledronic acid significantly reduced the weight of wild type KRAS-EGFR-expressing xenograft tumor by decreasing the proliferative capacity. Futhermore, zoledronic acid induced VEGF expression and improved in vivo tumor vascularization. Materials and methods Membrane association of K-Ras was examined by Western-blot. In vitro cell viability, apoptotic cell death and migration were measured in NSCLC lines with different molecular background. The in vivo effect of zoledronic acid was investigated in a SCID mouse subcutaneous xenograft model. Conclusions The in vitro and in vivo inhibitory effect of zoledronic acid was based on the blockade of cell cycle in wild type KRAS-expressing human NSCLC cells. The zoledronic acid induced vascularization supported in vivo cytostatic effect. Our preclinical investigation suggests that patients with wild type KRAS-expressing NSCLC could potentially benefit from aminobisphosphonate therapy. PMID:27780929
Georgieva, Ekaterina; Zhelev, Zhivko; Aoki, Ichio; Bakalova, Rumiana; Higashi, Tatsuya
2016-10-01
The present study describes a new approach for direct imaging of redox status in live cells using paramagnetic spin-probes, which allows evaluation of the level of oxidative stress due to overproduction of superoxide. The method is based on redox cycling of cell/mitochondria-penetrating nitroxide radicals (e.g. mito-TEMPO) and their electron-paramagnetic resonance (EPR) contrast, which makes them useful molecular sensors for analysis of redox status and oxidative stress in cells and tissues. Oxidative stress was induced in normal human lymphocytes by treatment with 2-methoxyestradiol and rotenone (ME/Rot) at different concentrations. This combination provokes mitochondrial dysfunction, which is accompanied by overproduction of superoxide. The EPR measurements were performed in dynamics on X-Band spectrometer after addition of mito-TEMPO to cell suspensions. The intensity of the EPR signal in untreated cells decreased significantly, which indicates a conversion of paramagnetic mito-TEMPO to its non-contrast diamagnetic form (hydroxylamine - mito-TEMPOH) due to reduction. In ME/Rot-treated cells, the signal decreased more slowly and to a lower level with increasing the concentration of ME/Rot. These data indicate an induction of oxidative stress in the cells in a concentration-dependent manner. A very good positive correlation between the intensity of EPR signal of mito-TEMPO and the intracellular level of superoxide was found, analyzed by conventional dihydroethidium test (R=0.9143, p<0.001). In conclusion, our study demonstrated that cell-penetrating paramagnetic spin-probes, such as mito-TEMPO, are valuable tools for EPR imaging of the superoxide level in live cells, as well as for EPR imaging of mitochondrial dysfunction and metabolic activity, accompanied by superoxide imbalance. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Mancebo Quintana, J. M.; Mancebo Quintana, S.
2012-01-01
The origin of sex is becoming a vexatious issue for Evolutionary Biology. Numerous hypotheses have been proposed, based on the genetic effects of sex, on trophic effects or on the formation of cysts and syncytia. Our approach addresses the change in cell cycle duration which would cause cell fusion. Several results are obtained through graphical and mathematical analysis and computer simulations. (1) In poor environments, cell fusion would be an advantageous strategy, as fusion between cells of different size shortens the cycle of the smaller cell (relative to the asexual cycle), and the majority of mergers would occur between cells of different sizes. (2) The easiest-to-evolve regulation of cell proliferation (sexual/asexual) would be by modifying the checkpoints of the cell cycle. (3) A regulation of this kind would have required the existence of the G2 phase, and sex could thus be the cause of the appearance of this phase. Regarding cell cycle, (4) the exponential curve is the only cell growth curve that has no effect on the optimal cell size in unicellular species; (5) the existence of a plateau with no growth at the end of the cell cycle explains the circadian cell cycle observed in unicellular algae. PMID:22666626
Cell Cycle Regulation of Stem Cells by MicroRNAs.
Mens, Michelle M J; Ghanbari, Mohsen
2018-06-01
MicroRNAs (miRNAs) are a class of small non-coding RNA molecules involved in the regulation of gene expression. They are involved in the fine-tuning of fundamental biological processes such as proliferation, differentiation, survival and apoptosis in many cell types. Emerging evidence suggests that miRNAs regulate critical pathways involved in stem cell function. Several miRNAs have been suggested to target transcripts that directly or indirectly coordinate the cell cycle progression of stem cells. Moreover, previous studies have shown that altered expression levels of miRNAs can contribute to pathological conditions, such as cancer, due to the loss of cell cycle regulation. However, the precise mechanism underlying miRNA-mediated regulation of cell cycle in stem cells is still incompletely understood. In this review, we discuss current knowledge of miRNAs regulatory role in cell cycle progression of stem cells. We describe how specific miRNAs may control cell cycle associated molecules and checkpoints in embryonic, somatic and cancer stem cells. We further outline how these miRNAs could be regulated to influence cell cycle progression in stem cells as a potential clinical application.
Flegel, Kerry; Grushko, Olga; Bolin, Kelsey; Griggs, Ellen; Buttitta, Laura
2016-07-01
Robust and synchronous repression of E2F-dependent gene expression is critical to the proper timing of cell cycle exit when cells transition to a postmitotic state. Previously NuA4 was suggested to act as a barrier to proliferation in Drosophila by repressing E2F-dependent gene expression. Here we show that NuA4 activity is required for proper cell cycle exit and the repression of cell cycle genes during the transition to a postmitotic state in vivo However, the delay of cell cycle exit caused by compromising NuA4 is not due to additional proliferation or effects on E2F activity. Instead NuA4 inhibition results in slowed cell cycle progression through late S and G2 phases due to aberrant activation of an intrinsic p53-independent DNA damage response. A reduction in NuA4 function ultimately produces a paradoxical cell cycle gene expression program, where certain cell cycle genes become derepressed in cells that are delayed during the G2 phase of the final cell cycle. Bypassing the G2 delay when NuA4 is inhibited leads to abnormal mitoses and results in severe tissue defects. NuA4 physically and genetically interacts with components of the E2F complex termed D: rosophila, R: bf, E: 2F A: nd M: yb/ M: ulti-vulva class B: (DREAM/MMB), and modulates a DREAM/MMB-dependent ectopic neuron phenotype in the posterior wing margin. However, this effect is also likely due to the cell cycle delay, as simply reducing Cdk1 is sufficient to generate a similar phenotype. Our work reveals that the major requirement for NuA4 in the cell cycle in vivo is to suppress an endogenous DNA damage response, which is required to coordinate proper S and G2 cell cycle progression with differentiation and cell cycle gene expression. Copyright © 2016 by the Genetics Society of America.
Flegel, Kerry; Grushko, Olga; Bolin, Kelsey; Griggs, Ellen; Buttitta, Laura
2016-01-01
Robust and synchronous repression of E2F-dependent gene expression is critical to the proper timing of cell cycle exit when cells transition to a postmitotic state. Previously NuA4 was suggested to act as a barrier to proliferation in Drosophila by repressing E2F-dependent gene expression. Here we show that NuA4 activity is required for proper cell cycle exit and the repression of cell cycle genes during the transition to a postmitotic state in vivo. However, the delay of cell cycle exit caused by compromising NuA4 is not due to additional proliferation or effects on E2F activity. Instead NuA4 inhibition results in slowed cell cycle progression through late S and G2 phases due to aberrant activation of an intrinsic p53-independent DNA damage response. A reduction in NuA4 function ultimately produces a paradoxical cell cycle gene expression program, where certain cell cycle genes become derepressed in cells that are delayed during the G2 phase of the final cell cycle. Bypassing the G2 delay when NuA4 is inhibited leads to abnormal mitoses and results in severe tissue defects. NuA4 physically and genetically interacts with components of the E2F complex termed Drosophila, Rbf, E2F and Myb/Multi-vulva class B (DREAM/MMB), and modulates a DREAM/MMB-dependent ectopic neuron phenotype in the posterior wing margin. However, this effect is also likely due to the cell cycle delay, as simply reducing Cdk1 is sufficient to generate a similar phenotype. Our work reveals that the major requirement for NuA4 in the cell cycle in vivo is to suppress an endogenous DNA damage response, which is required to coordinate proper S and G2 cell cycle progression with differentiation and cell cycle gene expression. PMID:27184390
DOE Office of Scientific and Technical Information (OSTI.GOV)
Argaw, Takele; Wilson, Carolyn A., E-mail: carolyn.wilson@fda.hhs.gov
Previously, we found that mutation of glutamine to proline in the endoproteolytic cleavage signal of the PERV-C envelope (RQKK to RPKK) resulted in non-infectious vectors. Here, we show that RPKK results in a non-infectious vector when placed in not only a PERV envelope, but also the envelope of a related gammaretrovirus, FeLV-B. The amino acid substitutions do not prevent envelope precursor cleavage, viral core and genome assembly, or receptor binding. Rather, the mutations result in the formation of hyperglycosylated glycoprotein and a reduction in the reverse transcribed minus strand synthesis and undetectable 2-LTR circular DNA in cells exposed to vectorsmore » with these mutated envelopes. Our findings suggest novel functions associated with the cleavage signal sequence that may affect trafficking through the glycosylation machinery of the cell. Further, the glycosylation status of the envelope appears to impact post-binding events of the viral life cycle, either membrane fusion, internalization, or reverse transcription. - Highlights: • Env cleavage signal impacts infectivity of gammaretroviruses. • Non-infectious mutants have hyper-glycosylated envelope that bind target cells. • Non-infectious mutants have defects in the formation of the double-stranded DNA. • Env cleavage motif has functions beyond cleavage of the env precursor.« less
Scratch2 prevents cell cycle re-entry by repressing miR-25 in postmitotic primary neurons.
Rodríguez-Aznar, Eva; Barrallo-Gimeno, Alejandro; Nieto, M Angela
2013-03-20
During the development of the nervous system the regulation of cell cycle, differentiation, and survival is tightly interlinked. Newly generated neurons must keep cell cycle components under strict control, as cell cycle re-entry leads to neuronal degeneration and death. However, despite their relevance, the mechanisms controlling this process remain largely unexplored. Here we show that Scratch2 is involved in the control of the cell cycle in neurons in the developing spinal cord of the zebrafish embryo. scratch2 knockdown induces postmitotic neurons to re-enter mitosis. Scratch2 prevents cell cycle re-entry by maintaining high levels of the cycle inhibitor p57 through the downregulation of miR-25. Thus, Scratch2 appears to safeguard the homeostasis of postmitotic primary neurons by preventing cell cycle re-entry.
An extensive program of periodic alternative splicing linked to cell cycle progression
Dominguez, Daniel; Tsai, Yi-Hsuan; Weatheritt, Robert; Wang, Yang; Blencowe, Benjamin J; Wang, Zefeng
2016-01-01
Progression through the mitotic cell cycle requires periodic regulation of gene function at the levels of transcription, translation, protein-protein interactions, post-translational modification and degradation. However, the role of alternative splicing (AS) in the temporal control of cell cycle is not well understood. By sequencing the human transcriptome through two continuous cell cycles, we identify ~1300 genes with cell cycle-dependent AS changes. These genes are significantly enriched in functions linked to cell cycle control, yet they do not significantly overlap genes subject to periodic changes in steady-state transcript levels. Many of the periodically spliced genes are controlled by the SR protein kinase CLK1, whose level undergoes cell cycle-dependent fluctuations via an auto-inhibitory circuit. Disruption of CLK1 causes pleiotropic cell cycle defects and loss of proliferation, whereas CLK1 over-expression is associated with various cancers. These results thus reveal a large program of CLK1-regulated periodic AS intimately associated with cell cycle control. DOI: http://dx.doi.org/10.7554/eLife.10288.001 PMID:27015110
Analysis of growth of tetraploid nuclei in roots of Vicia faba.
Bansal, J; Davidson, D
1978-03-01
Growth of nuclei of a marked population of cells was determined from G1 to prophase in roots of Vicia faba. The cells were marked by inducing them to become tetraploid by treatment with 0.002% colchicine for 1 hr. Variation in nuclear volume is large; it is established in early G1 and maintained through interphase and into prophase. One consequence of this variation is that there is considerable overlap between volumes of nuclei of different ages in the cell cycle; nuclear volume, we suggest, cannot be used as an accurate indicator of the age of the cell in its growth cycle. Nuclei exhibit considerable variation in their growth rate through the cell cycle. Of the marked population of cells, about 65% had completed a cell cycle 14--15 hr after they were formed. These tetraploid nuclei have a cell cycle duration similar to that of fast cycling diploid cells of the same roots. Since they do complete a cell cycle, at least 65% of the nuclei studied must come from rapidly proliferating cells, showing that variability in nuclear volumes must be present in growing cells and cannot be attributed solely to the presence, in our samples, of non-cycling cells.
Flow cytometry analysis of cell cycle and specific cell synchronization with butyrate
USDA-ARS?s Scientific Manuscript database
Synchronized cells have been invaluable in many kinds of cell cycle and cell proliferation studies. Butyrate induces cell cycle arrest and apoptosis in MDBK cells. The possibility of using butyrate-blocked cells to obtain synchronized cells was explored and the properties of butyrate-induced cell ...
Proteomic Analysis and Functional Studies of Baicalin on Proteins Associated with Skin Cancer.
Li, Dan; Lin, Bingjiang; Yusuf, Nabiha; Burns, Erin M; Yu, Xiuqin; Luo, Dan; Min, Wei
2017-01-01
Abundant evidence supports the key role of ultraviolet radiation (UVR) in skin cancer development. The human skin, especially the epidermal layer, is the main defense against UV radiation. Baicalin is a major bioactive component of Scutellaria baicalensis Georgi, a plant which has been found to exhibit antitumor activity. The anticarcinogenic mechanism of baicalin is not completely understood. We have reported that baicalin inhibited UVB-induced photo-damage and apoptosis in HaCaT cells (human skin keratinocytes). The aim of the present study is to investigate the cellular gene targets responsible for baicalin's antitumor activity by performing two-dimensional electrophoresis liquid chromatography-mass spectrometry/mass spectrometry (2-DE LC-MS/MS) with HaCaT cells following UVB and baicalin exposure. Two-DE for protein separation was performed, followed by matrix-assisted laser desorption/ionization mass spectrometry and database searches. Nucleophosmin (NPM)-specific siRNA was designed and synthesized, and the small interfering RNA was transfected into skin squamous cancer A431 cells to knockdown the NPM expression. Proliferation and cell cycle status were assessed by CCK8 and flow cytometric analyses, respectively. We have identified 38 protein spots that are differentially expressed in HaCaT cells exposed to baicalin and/or UVB irradiation These proteins are involved in detoxification, proliferation, metabolism, cytoskeleton and motility. In particular, we found several proteins that have been linked to tumor progression and resistance, such as NPM. Baicalin treatment reduced the cellular proliferation rate and induced arrest during the S-phase of the cell cycle in A431 cells. NPM1 silencing significantly enhanced the effect of baicalin. Our data indicated that baicalin results in the significant inhibition of tumor growth in the A431 cell line, which may be associated with the regulation of the NPM gene expression.
Targeting Aurora Kinase with MK-0457 Inhibits Ovarian Cancer Growth
Lin, Yvonne G.; Immaneni, Anand; Merritt, William M.; Mangala, Lingegowda S.; Kim, SeungWook; Shahzad, Mian M.K.; Tsang, Yvonne T.M.; Armaiz-Pena, Guillermo N.; Lu, Chunhua; Kamat, Aparna A.; Han, Liz Y.; Spannuth, WhitneyA.; Nick, Alpa M.; Landen, Charles N.; Wong, Kwong K.; Gray, Michael J.; Coleman, Robert L.; Bodurka, Diane C.; Brinkley, William R.; Sood, Anil K.
2009-01-01
Purpose The Aurora kinase family plays pivotal roles in mitotic integrity and cell cycle.We sought to determine the effects of inhibiting Aurora kinase on ovarian cancer growth in an orthotopic mouse model using a small molecule pan-Aurora kinase inhibitor, MK-0457. Experimental Design We examined cell cycle regulatory effects and ascertained the therapeutic efficacy of Aurora kinase inhibition both alone and combined with docetaxel using both in vitro and in vivo ovarian cancer models. Results In vitro cytotoxicity assays with HeyA8 and SKOV3ip1 cells revealed >10-fold greater docetaxel cytotoxicity in combination with MK-0457. After in vivo dose kinetics were determined using phospho-histone H3 status, therapy experiments with the chemosensitive HeyA8 and SKOV3ip1as well as the chemoresistant HeyA8-MDR and A2780-CP20 models showed that Aurora kinase inhibition alone significantly reduced tumor burden compared with controls (P values < 0.01). Combination treatment with docetaxel resulted in significantly improved reduction in tumor growth beyond that afforded by docetaxel alone (P ≤ 0.03). Proliferating cell nuclear antigen immunohistochemistry revealed that MK-0457 alone and in combination with docetaxel significantly reduced cellular proliferation (P values < 0.001). Compared with controls, treatment with MK-0457 alone and in combination with docetaxel also significantly increased tumor cell apoptosis by ∼3-fold (P < 0.01). Remarkably, compared with docetaxel monotherapy, MK-0457 combined with docetaxel resulted in significantly increased tumor cell apoptosis. Conclusions Aurora kinase inhibition significantly reduces tumor burden and cell proliferation and increases tumor cell apoptosis in this preclinical orthotopic model of ovarian cancer. The role of Aurora kinase inhibition in ovarian cancer merits further investigation in clinical trials. PMID:18765535
Effect of KOH concentration on LEO cycle life of IPV nickel-hydrogen flight battery cells
NASA Technical Reports Server (NTRS)
Smithrick, John J.; Hall, Stephen W.
1990-01-01
A breakthrough in low earth orbit (LEO) cycle life of individual pressure vessel (IPV) nickel hydrogen battery cells was reported. The cycle life of boiler plate cells containing 26 percent potassium hydroxide (KOH) electrolyte was about 40,000 LEO cycles compared to 3500 cycles for cells containing 31 percent KOH. The effect of KOH concentration on cycle life was studied. The cycle regime was a stressful accelerated LEO, which consisted of a 27.5 min charge followed by a 17.5 min charge (2 x normal rate). The depth of discharge (DOD) was 80 percent. The cell temperature was maintained at 23 C. The next step is to validate these results using flight hardware and a real time LEO test. NASA Lewis has a contract with the Naval Weapons Support Center (NWSC), Crane, Indiana, to validate the boiler plate test results. Six 48 A-hr Hughes recirculation design IPV nickel-hydrogen flight battery cells are being evaluated. Three of the cells contain 26 percent KOH (test cells) and three contain 31 percent KOH (control cells). They are undergoing real time LEO cycle life testing. The cycle regime is a 90-min LEO orbit consisting of a 54-min charge followed by a 36-min discharge. The depth-of-discharge is 80 percent. The cell temperature is maintained at 10 C. The cells were cycled for over 8000 cycles in the continuing test. There were no failures for the cells containing 26 percent KOH. There was two failures, however, for the cells containing 31 percent KOH.
Effect of KOH concentration on LEO cycle life of IPV nickel-hydrogen flight battery cells
NASA Technical Reports Server (NTRS)
Smithrick, John J.; Hall, Stephen W.
1990-01-01
A breakthrough in the low-earth-orbit (LEO) cycle life of individual pressure vessel (IPV) nickel hydrogen battery cells is reported. The cycle life of boiler plate cells containing 26 percent potassium hydroxide (KOH) electrolyte was about 40,000 LEO cycles compared to 3500 cycles for cells containing 31 percent KOH. The effect of KOH concentration on cycle life was studied. The cycle regime was a stressful accelerated LEO, which consisted of a 27.5 min charge followed by a 17.5 min charge (2 x normal rate). The depth of discharge (DOD) was 80 percent. The cell temperature was maintained at 23 C. The next step is to validate these results using flight hardware and real time LEO test. NASA Lewis has a contract with the Naval Weapons Support Center (NWSC), Crane, Indiana to validate the boiler plate test results. Six 48 A-hr Hughes recirculation design IPV nickel-hydrogen flight battery cells are being evaluated. Three of the cells contain 26 percent KOH (test cells) and three contain 31 percent KOH (control cells). They are undergoing real time LEO cycle life testing. The cycle regime is a 90-min LEO orbit consisting of a 54-min charge followed by a 36-min discharge. The depth-of-discharge is 80 percent. The cell temperature is maintained at 10 C. The cells were cycled for over 8000 cycles in the continuing test. There were no failures for the cells containing 26 percent KOH. There were two failures, however, for the cells containing 31 percent KOH.
García García, Tránsito; Ventroux, Magali; Derouiche, Abderahmane; Bidnenko, Vladimir; Correia Santos, Sara; Henry, Céline; Mijakovic, Ivan; Noirot-Gros, Marie-Françoise; Poncet, Sandrine
2018-01-01
Bacillus subtilis cells can adopt different life-styles in response to various environmental cues, including planktonic cells during vegetative growth, sessile cells during biofilm formation and sporulation. While switching life-styles, bacteria must coordinate the progression of their cell cycle with their physiological status. Our current understanding of the regulatory pathways controlling the decision-making processes and triggering developmental switches highlights a key role of protein phosphorylation. The regulatory mechanisms that integrate the bacterial chromosome replication status with sporulation involve checkpoint proteins that target the replication initiator DnaA or the kinase phosphorelay controlling the master regulator Spo0A. B. subtilis YabA is known to interact with DnaA to prevent over-initiation of replication during vegetative growth. Here, we report that YabA is phosphorylated by YabT, a Ser/Thr kinase expressed during sporulation and biofilm formation. The phosphorylation of YabA has no effect on replication initiation control but hyper-phosphorylation of YabA leads to an increase in sporulation efficiency and a strong inhibition of biofilm formation. We also provide evidence that YabA phosphorylation affects the level of Spo0A-P in cells. These results indicate that YabA is a multifunctional protein with a dual role in regulating replication initiation and life-style switching, thereby providing a potential mechanism for cross-talk and coordination of cellular processes during adaptation to environmental change. PMID:29619013
García García, Tránsito; Ventroux, Magali; Derouiche, Abderahmane; Bidnenko, Vladimir; Correia Santos, Sara; Henry, Céline; Mijakovic, Ivan; Noirot-Gros, Marie-Françoise; Poncet, Sandrine
2018-01-01
Bacillus subtilis cells can adopt different life-styles in response to various environmental cues, including planktonic cells during vegetative growth, sessile cells during biofilm formation and sporulation. While switching life-styles, bacteria must coordinate the progression of their cell cycle with their physiological status. Our current understanding of the regulatory pathways controlling the decision-making processes and triggering developmental switches highlights a key role of protein phosphorylation. The regulatory mechanisms that integrate the bacterial chromosome replication status with sporulation involve checkpoint proteins that target the replication initiator DnaA or the kinase phosphorelay controlling the master regulator Spo0A. B. subtilis YabA is known to interact with DnaA to prevent over-initiation of replication during vegetative growth. Here, we report that YabA is phosphorylated by YabT, a Ser/Thr kinase expressed during sporulation and biofilm formation. The phosphorylation of YabA has no effect on replication initiation control but hyper-phosphorylation of YabA leads to an increase in sporulation efficiency and a strong inhibition of biofilm formation. We also provide evidence that YabA phosphorylation affects the level of Spo0A-P in cells. These results indicate that YabA is a multifunctional protein with a dual role in regulating replication initiation and life-style switching, thereby providing a potential mechanism for cross-talk and coordination of cellular processes during adaptation to environmental change.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Arcangeletti, Maria-Cristina, E-mail: mariacristina.arcangeletti@unipr.it; Germini, Diego; Rodighiero, Isabella
2013-05-25
Suitable host cell metabolic conditions are fundamental for the effective development of the human cytomegalovirus (HCMV) lytic cycle. Indeed, several studies have demonstrated the ability of this virus to interfere with cell cycle regulation, mainly by blocking proliferating cells in G1 or G1/S. In the present study, we demonstrate that HCMV deregulates the cell cycle of THP-1 macrophages (a cell line irreversibly arrested in G0) by pushing them into S and G2 phases. Moreover, we show that HCMV infection of THP-1 macrophages leads to Toll-like receptor 4 (TLR4) activation. Since various studies have indicated TLR4 to be involved in promotingmore » cell proliferation, here we investigate the possible role of TLR4 in the observed HCMV-induced cell cycle perturbation. Our data strongly support TLR4 as a mediator of HCMV-triggered cell cycle activation in THP-1 macrophages favouring, in turn, the development of an efficient viral lytic cycle. - Highlights: ► We studied HCMV infection impact on THP-1 macrophage cell cycle. ► We analysed the role played by Toll-like receptor (TLR) 4 upon HCMV infection. ► HCMV pushes THP-1 macrophages (i.e. resting cells) to re-enter the cell cycle. ► TLR4 pathway inhibition strongly affects the effectiveness of HCMV replication. ► TLR4 pathway inhibition significantly decreases HCMV-induced cell cycle re-entry.« less
Effects of age, socioeconomic status, and menstrual cycle on pulmonary response to ozone
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seal, E. Jr.; McDonnell, W.F.; House, D.E.
The purpose of this study was to investigate the effects of age, socioeconomic status, and menstrual cycle phase on the pulmonary response to ozone exposure. Three hundred seventy-two healthy white and black young adults, between the ages of 18 and 35 y, were exposed only once to 0.0, 0.12, 0.18, 0.24, 0.30, or 0.40 ppm ozone for 2.3 h. Prior to and after exposure, pulmonary function tests were obtained. Prior to exposure, each subject completed a personal and family-history questionnaire. The response to this questionnaire were used to investigate age, socioeconomic status, and menstrual cycle phase effects on pulmonary responsivenessmore » to ozone. We concluded that the ages of subjects, within the age range studied, had an effect on responsiveness (i.e., decrements in forced expiratory volume in 1 s decreased as the subjects` ages decreased). Socioeconomic status, as reflected by education of fathers, also appeared to affect forced expiratory volume in 1-s responsiveness to ozone, with the middle socioeconomic group being the most responsive. The phase of menstrual cycle did not have an impact on individual responsiveness to ozone. 14 refs., 4 figs.« less
Loponen, Heidi; Ylikoski, Jukka; Albrecht, Jeffrey H.; Pirvola, Ulla
2011-01-01
Sensory hair cells and supporting cells of the mammalian inner ear are quiescent cells, which do not regenerate. In contrast, non-mammalian supporting cells have the ability to re-enter the cell cycle and produce replacement hair cells. Earlier studies have demonstrated cyclin D1 expression in the developing mouse supporting cells and its downregulation along maturation. In explant cultures of the mouse utricle, we have here focused on the cell cycle control mechanisms and proliferative potential of adult supporting cells. These cells were forced into the cell cycle through adenoviral-mediated cyclin D1 overexpression. Ectopic cyclin D1 triggered robust cell cycle re-entry of supporting cells, accompanied by changes in p27Kip1 and p21Cip1 expressions. Main part of cell cycle reactivated supporting cells were DNA damaged and arrested at the G2/M boundary. Only small numbers of mitotic supporting cells and rare cells with signs of two successive replications were found. Ectopic cyclin D1-triggered cell cycle reactivation did not lead to hyperplasia of the sensory epithelium. In addition, a part of ectopic cyclin D1 was sequestered in the cytoplasm, reflecting its ineffective nuclear import. Combined, our data reveal intrinsic barriers that limit proliferative capacity of utricular supporting cells. PMID:22073316
Loponen, Heidi; Ylikoski, Jukka; Albrecht, Jeffrey H; Pirvola, Ulla
2011-01-01
Sensory hair cells and supporting cells of the mammalian inner ear are quiescent cells, which do not regenerate. In contrast, non-mammalian supporting cells have the ability to re-enter the cell cycle and produce replacement hair cells. Earlier studies have demonstrated cyclin D1 expression in the developing mouse supporting cells and its downregulation along maturation. In explant cultures of the mouse utricle, we have here focused on the cell cycle control mechanisms and proliferative potential of adult supporting cells. These cells were forced into the cell cycle through adenoviral-mediated cyclin D1 overexpression. Ectopic cyclin D1 triggered robust cell cycle re-entry of supporting cells, accompanied by changes in p27(Kip1) and p21(Cip1) expressions. Main part of cell cycle reactivated supporting cells were DNA damaged and arrested at the G2/M boundary. Only small numbers of mitotic supporting cells and rare cells with signs of two successive replications were found. Ectopic cyclin D1-triggered cell cycle reactivation did not lead to hyperplasia of the sensory epithelium. In addition, a part of ectopic cyclin D1 was sequestered in the cytoplasm, reflecting its ineffective nuclear import. Combined, our data reveal intrinsic barriers that limit proliferative capacity of utricular supporting cells.
Slow-cycling stem cells in hydra contribute to head regeneration
Govindasamy, Niraimathi; Murthy, Supriya; Ghanekar, Yashoda
2014-01-01
ABSTRACT Adult stem cells face the challenge of maintaining tissue homeostasis by self-renewal while maintaining their proliferation potential over the lifetime of an organism. Continuous proliferation can cause genotoxic/metabolic stress that can compromise the genomic integrity of stem cells. To prevent stem cell exhaustion, highly proliferative adult tissues maintain a pool of quiescent stem cells that divide only in response to injury and thus remain protected from genotoxic stress. Hydra is a remarkable organism with highly proliferative stem cells and ability to regenerate at whole animal level. Intriguingly, hydra does not display consequences of high proliferation, such as senescence or tumour formation. In this study, we investigate if hydra harbours a pool of slow-cycling stem cells that could help prevent undesirable consequences of continuous proliferation. Hydra were pulsed with the thymidine analogue 5-ethynyl-2′-deoxyuridine (EdU) and then chased in the absence of EdU to monitor the presence of EdU-retaining cells. A significant number of undifferentiated cells of all three lineages in hydra retained EdU for about 8–10 cell cycles, indicating that these cells did not enter cell cycle. These label-retaining cells were resistant to hydroxyurea treatment and were predominantly in the G2 phase of cell cycle. Most significantly, similar to mammalian quiescent stem cells, these cells rapidly entered cell division during head regeneration. This study shows for the first time that, contrary to current beliefs, cells in hydra display heterogeneity in their cell cycle potential and the slow-cycling cells in this population enter cell cycle during head regeneration. These results suggest an early evolution of slow-cycling stem cells in multicellular animals. PMID:25432513
Sierra, Crystal S.; Haase, Steven B.
2016-01-01
The pathogenic yeast Cryptococcus neoformans causes fungal meningitis in immune-compromised patients. Cell proliferation in the budding yeast form is required for C. neoformans to infect human hosts, and virulence factors such as capsule formation and melanin production are affected by cell-cycle perturbation. Thus, understanding cell-cycle regulation is critical for a full understanding of virulence factors for disease. Our group and others have demonstrated that a large fraction of genes in Saccharomyces cerevisiae is expressed periodically during the cell cycle, and that proper regulation of this transcriptional program is important for proper cell division. Despite the evolutionary divergence of the two budding yeasts, we found that a similar percentage of all genes (~20%) is periodically expressed during the cell cycle in both yeasts. However, the temporal ordering of periodic expression has diverged for some orthologous cell-cycle genes, especially those related to bud emergence and bud growth. Genes regulating DNA replication and mitosis exhibited a conserved ordering in both yeasts, suggesting that essential cell-cycle processes are conserved in periodicity and in timing of expression (i.e. duplication before division). In S. cerevisiae cells, we have proposed that an interconnected network of periodic transcription factors (TFs) controls the bulk of the cell-cycle transcriptional program. We found that temporal ordering of orthologous network TFs was not always maintained; however, the TF network topology at cell-cycle commitment appears to be conserved in C. neoformans. During the C. neoformans cell cycle, DNA replication genes, mitosis genes, and 40 genes involved in virulence are periodically expressed. Future work toward understanding the gene regulatory network that controls cell-cycle genes is critical for developing novel antifungals to inhibit pathogen proliferation. PMID:27918582
AS160 controls eukaryotic cell cycle and proliferation by regulating the CDK inhibitor p21.
Gongpan, Pianchou; Lu, Yanting; Wang, Fang; Xu, Yuhui; Xiong, Wenyong
2016-07-02
AS160 (TBC1D4) has been implicated in multiple biological processes. However, the role and the mechanism of action of AS160 in the regulation of cell proliferation remain unclear. In this study, we demonstrated that AS160 knockdown led to blunted cell proliferation in multiple cell types, including fibroblasts and cancer cells. The results of cell cycle analysis showed that these cells were arrested in the G1 phase. Intriguingly, this inhibition of cell proliferation and the cell cycle arrest caused by AS160 depletion were glucose independent. Moreover, AS160 silencing led to a marked upregulation of the expression of the cyclin-dependent kinase inhibitor p21. Furthermore, whereas AS160 overexpression resulted in p21 downregulation and rescued the arrested cell cycle in AS160-depeleted cells, p21 silencing rescued the inhibited cell cycle and proliferation in the cells. Thus, our results demonstrated that AS160 regulates glucose-independent eukaryotic cell proliferation through p21-dependent control of the cell cycle, and thereby revealed a molecular mechanism of AS160 modulation of cell cycle and proliferation that is of general physiological significance.
van Rijnberk, Lotte M.; van der Horst, Suzanne E. M.; van den Heuvel, Sander; Ruijtenberg, Suzan
2017-01-01
Development, tissue homeostasis and tumor suppression depend critically on the correct regulation of cell division. Central in the cell division process is the decision whether to enter the next cell cycle and commit to going through the S and M phases, or to remain temporarily or permanently arrested. Cell cycle studies in genetic model systems could greatly benefit from visualizing cell cycle commitment in individual cells without the need of fixation. Here, we report the development and characterization of a reporter to monitor cell cycle entry in the nematode C. elegans. This reporter combines the mcm-4 promoter, to reveal Rb/E2F-mediated transcriptional control, and a live-cell sensor for CDK-activity. The CDK sensor was recently developed for use in human cells and consists of a DNA Helicase fragment fused to eGFP. Upon phosphorylation by CDKs, this fusion protein changes in localization from the nucleus to the cytoplasm. The combined regulation of transcription and subcellular localization enabled us to visualize the moment of cell cycle entry in dividing seam cells during C. elegans larval development. This reporter is the first to reflect cell cycle commitment in C. elegans and will help further genetic studies of the mechanisms that underlie cell cycle entry and exit. PMID:28158315
Chandler-Brown, Devon; Schmoller, Kurt M; Winetraub, Yonatan; Skotheim, Jan M
2017-09-25
Although it has long been clear that cells actively regulate their size, the molecular mechanisms underlying this regulation have remained poorly understood. In budding yeast, cell size primarily modulates the duration of the cell-division cycle by controlling the G1/S transition known as Start. We have recently shown that the rate of progression through Start increases with cell size, because cell growth dilutes the cell-cycle inhibitor Whi5 in G1. Recent phenomenological studies in yeast and bacteria have shown that these cells add an approximately constant volume during each complete cell cycle, independent of their size at birth. These results seem to be in conflict, as the phenomenological studies suggest that cells measure the amount they grow, rather than their size, and that size control acts over the whole cell cycle, rather than specifically in G1. Here, we propose an integrated model that unifies the adder phenomenology with the molecular mechanism of G1/S cell-size control. We use single-cell microscopy to parameterize a full cell-cycle model based on independent control of pre- and post-Start cell-cycle periods. We find that our model predicts the size-independent amount of cell growth during the full cell cycle. This suggests that the adder phenomenon is an emergent property of the independent regulation of pre- and post-Start cell-cycle periods rather than the consequence of an underlying molecular mechanism measuring a fixed amount of growth. Copyright © 2017 Elsevier Ltd. All rights reserved.
Life cycle development of obesity and its determinants in six European countries.
Cavaco, Sandra; Eriksson, Tor; Skalli, Ali
2014-07-01
This paper empirically examines the effect of parents' and individuals' own socioeconomic status on overweight and obesity, and investigates how this effect changes over the life cycle. The impact of individuals' health behaviours on their obesity status later in life is also studied. We use data from Denmark, Finland, France, Greece, the Netherlands and the U.K. in which 4595 individuals aged 50-65 are surveyed and where individuals' height and weight at different ages (25, 35, 45 and current age) are available. We perform "repeated cross-sections" analyses as well as dynamic probit analyses of the individuals' obesity histories. We contribute to the literature by examining the role of a variety of obesity determinants over the whole life cycle, not only over a certain portion of individuals' lives. Key findings are: (i) parents' socioeconomic status predicts obesity in early adulthood whereas the individual's own socioeconomic status as adult is more important in explaining obesity at later stages of the life cycle, (ii) changes in obesity status are associated with changes in health behaviours, (iii) obesity in late adulthood is strongly and positively correlated with overweight and obesity in younger ages, and (iv) cross-country differences in obesity and overweight largely remain after controlling for parental and childhood factors and individuals' health behaviours. Copyright © 2014 Elsevier B.V. All rights reserved.
Impedance measurements on a spiral-wound nickel/metal hydride cell cycled in a simulated Leo orbit
NASA Technical Reports Server (NTRS)
Reid, Margaret A.
1993-01-01
A spiral-wound size C cell was cycled at 25 C in a low earth orbit (LEO) regime at 50 percent depth of discharge (DOD) with approximately five percent over-charge. The nominal capacity was 3.5 AH. The cell was cycled for 2000 cycles. Capacity checks and impedance measurements over the complete range of state of charge were made upon receipt and after 500, 1000, and 2000 cycles. The capacity of the cell was essentially unchanged until after the impedance measurements at 2000 cycles. Only small changes in the impedance parameters were observed, but there was somewhat more scatter in the data after 2000 cycles. When the cell was returned to LEO cycling after 2000 cycles, only 38 percent of the capacity could be obtained. It is believed that the cell failed because of an equipment failure at the end of the final impedance measurements which allowed an over-discharge.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ding, Li; College of Life Sciences, Hainan Normal University, Haikou, Hainan 571158; Huang, Yong
2014-03-07
Highlights: • TGEV N protein reduces cell viability by inducing cell cycle arrest and apoptosis. • TGEV N protein induces cell cycle arrest and apoptosis by regulating p53 signaling. • TGEV N protein plays important roles in TGEV-induced cell cycle arrest and apoptosis. - Abstract: Our previous studies showed that TGEV infection could induce cell cycle arrest and apoptosis via activation of p53 signaling in cultured host cells. However, it is unclear which viral gene causes these effects. In this study, we investigated the effects of TGEV nucleocapsid (N) protein on PK-15 cells. We found that TGEV N protein suppressedmore » cell proliferation by causing cell cycle arrest at the S and G2/M phases and apoptosis. Characterization of various cellular proteins that are involved in regulating cell cycle progression demonstrated that the expression of N gene resulted in an accumulation of p53 and p21, which suppressed cyclin B1, cdc2 and cdk2 expression. Moreover, the expression of TGEV N gene promoted translocation of Bax to mitochondria, which in turn caused the release of cytochrome c, followed by activation of caspase-3, resulting in cell apoptosis in the transfected PK-15 cells following cell cycle arrest. Further studies showed that p53 inhibitor attenuated TGEV N protein induced cell cycle arrest at S and G2/M phases and apoptosis through reversing the expression changes of cdc2, cdk2 and cyclin B1 and the translocation changes of Bax and cytochrome c induced by TGEV N protein. Taken together, these results demonstrated that TGEV N protein might play an important role in TGEV infection-induced p53 activation and cell cycle arrest at the S and G2/M phases and apoptosis occurrence.« less
Jóźwik, Agnieszka; Landowski, Jerzy; Bidzan, Leszek; Fülop, Tamas; Bryl, Ewa; Witkowski, Jacek M.
2012-01-01
Alzheimer's disease (AD) is the most frequent form of dementia among elderly. Despite the vast amount of literature on non-specific immune mechanisms in AD there is still little information about the potential antigen-specific immune response in this pathology. It is known that early stages of AD include β-amyloid (Aβ)- reactive antibodies production and inflammatory response. Despite some evidence gathered proving cellular immune response background in AD pathology, the specific reactions of CD4+ and CD8+ cells remain unknown as the previous investigations yielded conflicting results. Here we investigated the CD4+CD28+ population of human peripheral blood T cells and showed that soluble β-amyloids alone were unable to stimulate these cells to proliferate significantly, resulting only in minor, probably antigen-specific, proliferative response. On the other hand, the exposure of in vitro pre-stimulated lymphocytes to soluble Aβ peptides significantly enhanced the proliferative response of these cells which had also lead to increased levels of TNF, IL-10 and IL-6. We also proved that Aβ peptide-enhanced proliferative response of CD4+CD28+ cells is autonomous and independent from disease status while being associated with the initial, ex vivo activation status of the CD4+ cells. In conclusion, we suggest that the effect of Aβ peptides on the immune system of AD patients does not depend on the specific reactivity to Aβ epitope(s), but is rather a consequence of an unspecific modulation of the cell cycle dynamics and cytokine production by T cells, occurring simultaneously in a huge proportion of Aβ peptide-exposed T lymphocytes and affecting the immune system performance. PMID:22428008
Weaver, Alice N; Burch, M Benjamin; Cooper, Tiffiny S; Della Manna, Deborah L; Wei, Shi; Ojesina, Akinyemi I; Rosenthal, Eben L; Yang, Eddy S
2016-09-01
Oral squamous cell carcinoma (OSCC) is a cancer subtype that lacks validated prognostic and therapeutic biomarkers, and human papillomavirus status has not proven beneficial in predicting patient outcomes. A gene expression pathway analysis was conducted using OSCC patient specimens to identify molecular targets that may improve management of this disease. RNA was isolated from 19 OSCCs treated surgically at the University of Alabama at Birmingham (UAB; Birmingham, AL) and evaluated using the NanoString nCounter system. Results were confirmed using the oral cavity subdivision of the Head and Neck Squamous Cell Carcinoma Cancer (HNSCC) study generated by The Cancer Genome Atlas (TCGA) Research Network. Further characterization of the in vitro phenotype produced by Notch pathway activation in HNSCC cell lines included gene expression, proliferation, cell cycle, migration, invasion, and radiosensitivity. In both UAB and TCGA samples, Notch pathway upregulation was significantly correlated with patient mortality status and with expression of the proinvasive gene FGF1 In vitro Notch activation in HNSCC cells increased transcription of FGF1 and induced a marked increase in cell migration and invasion, which was fully abrogated by FGF1 knockdown. These results reveal that increased Notch pathway signaling plays a role in cancer progression and patient outcomes in OSCC. Accordingly, the Notch-FGF interaction should be further studied as a prognostic biomarker and potential therapeutic target for OSCC. Patients with squamous cell carcinoma of the oral cavity who succumb to their disease are more likely to have upregulated Notch signaling, which may mediate a more invasive phenotype through increased FGF1 transcription. Mol Cancer Res; 14(9); 883-91. ©2016 AACR. ©2016 American Association for Cancer Research.
A single cyclin–CDK complex is sufficient for both mitotic and meiotic progression in fission yeast
Gutiérrez-Escribano, Pilar; Nurse, Paul
2015-01-01
The dominant model for eukaryotic cell cycle control proposes that cell cycle progression is driven by a succession of CDK complexes with different substrate specificities. However, in fission yeast it has been shown that a single CDK complex generated by the fusion of the Cdc13 cyclin with the CDK protein Cdc2 can drive the mitotic cell cycle. Meiosis is a modified cell cycle programme in which a single S-phase is followed by two consecutive rounds of chromosome segregation. Here we systematically analyse the requirements of the different fission yeast cyclins for meiotic cell cycle progression. We also show that a single Cdc13–Cdc2 complex, in the absence of the other cyclins, can drive the meiotic cell cycle. We propose that qualitatively different CDK complexes are not absolutely required for cell cycle progression either during mitosis or meiosis, and that a single CDK complex can drive both cell cycle programmes. PMID:25891897
Danielsen, T.; Hvidsten, M.; Stokke, T.; Solberg, K.; Rofstad, E. K.
1998-01-01
Hypoxia has been shown to induce accumulation of p53 and of hypophosphorylated retinoblastoma protein (pRb) in tumour cells. In this study, the cell cycle dependence of p53 accumulation and pRb hypophosphorylation in four human melanoma cell lines that are wild type for p53 was investigated using two-parameter flow cytometry measurements of p53 or pRb protein content and DNA content. The hypoxia-induced increase in p53 protein was higher in S-phase than in G1 and G2 phases in all cell lines. The accumulation of p53 in S-phase during hypoxia was not related to hypoxia-induced apoptosis or substantial cell cycle specific cell inactivation during the first 24 h of reoxygenation. pRb was hypophosphorylated in all cell cycle phases by hypoxia treatment. The results did not support a direct link between p53 and pRb during hypoxia because p53 was induced in a cell cycle-specific manner, whereas no cell cycle-dependent differences in pRb hypophosphorylation were detected. Only a fraction of the cell populations (0.60+/-0.10) showed hypophosphorylated pRb. Thus, pRb is probably not the only mediator of the hypoxia-induced cell cycle block seen in all cells and all cell cycle phases. Moreover, the cell cycle-dependent induction of p53 by hypoxia suggests that the primary function of p53 accumulation during hypoxia is other than to arrest the cells. Images Figure 4 Figure 7 PMID:9862563
Nuclear receptor TLX regulates cell cycle progression in neural stem cells of the developing brain.
Li, Wenwu; Sun, Guoqiang; Yang, Su; Qu, Qiuhao; Nakashima, Kinichi; Shi, Yanhong
2008-01-01
TLX is an orphan nuclear receptor that is expressed exclusively in vertebrate forebrains. Although TLX is known to be expressed in embryonic brains, the mechanism by which it influences neural development remains largely unknown. We show here that TLX is expressed specifically in periventricular neural stem cells in embryonic brains. Significant thinning of neocortex was observed in embryonic d 14.5 TLX-null brains with reduced nestin labeling and decreased cell proliferation in the germinal zone. Cell cycle analysis revealed both prolonged cell cycles and increased cell cycle exit in TLX-null embryonic brains. Increased expression of a cyclin-dependent kinase inhibitor p21 and decreased expression of cyclin D1 provide a molecular basis for the deficiency of cell cycle progression in embryonic brains of TLX-null mice. Furthermore, transient knockdown of TLX by in utero electroporation led to precocious cell cycle exit and differentiation of neural stem cells followed by outward migration. Together these results indicate that TLX plays an important role in neural development by regulating cell cycle progression and exit of neural stem cells in the developing brain.
Nuclear Receptor TLX Regulates Cell Cycle Progression in Neural Stem Cells of the Developing Brain
Li, Wenwu; Sun, Guoqiang; Yang, Su; Qu, Qiuhao; Nakashima, Kinichi; Shi, Yanhong
2008-01-01
TLX is an orphan nuclear receptor that is expressed exclusively in vertebrate forebrains. Although TLX is known to be expressed in embryonic brains, the mechanism by which it influences neural development remains largely unknown. We show here that TLX is expressed specifically in periventricular neural stem cells in embryonic brains. Significant thinning of neocortex was observed in embryonic d 14.5 TLX-null brains with reduced nestin labeling and decreased cell proliferation in the germinal zone. Cell cycle analysis revealed both prolonged cell cycles and increased cell cycle exit in TLX-null embryonic brains. Increased expression of a cyclin-dependent kinase inhibitor p21 and decreased expression of cyclin D1 provide a molecular basis for the deficiency of cell cycle progression in embryonic brains of TLX-null mice. Furthermore, transient knockdown of TLX by in utero electroporation led to precocious cell cycle exit and differentiation of neural stem cells followed by outward migration. Together these results indicate that TLX plays an important role in neural development by regulating cell cycle progression and exit of neural stem cells in the developing brain. PMID:17901127
Cell cycle gene expression under clinorotation
NASA Astrophysics Data System (ADS)
Artemenko, Olga
2016-07-01
Cyclins and cyclin-dependent kinase (CDK) are main regulators of the cell cycle of eukaryotes. It's assumes a significant change of their level in cells under microgravity conditions and by other physical factors actions. The clinorotation use enables to determine the influence of gravity on simulated events in the cell during the cell cycle - exit from the state of quiet stage and promotion presynthetic phase (G1) and DNA synthesis phase (S) of the cell cycle. For the clinorotation effect study on cell proliferation activity is the necessary studies of molecular mechanisms of cell cycle regulation and development of plants under altered gravity condition. The activity of cyclin D, which is responsible for the events of the cell cycle in presynthetic phase can be controlled by the action of endogenous as well as exogenous factors, but clinorotation is one of the factors that influence on genes expression that regulate the cell cycle.These data can be used as a model for further research of cyclin - CDK complex for study of molecular mechanisms regulation of growth and proliferation. In this investigation we tried to summarize and analyze known literature and own data we obtained relatively the main regulators of the cell cycle in altered gravity condition.
KOH concentration effect on cycle life of nickel-hydrogen cells
NASA Technical Reports Server (NTRS)
Lim, Hong S.; Verzwyvelt, S. A.
1987-01-01
A cycle life test of Ni/H2 cells containing electrolytes of various KOH concentrations and a sintered type nickel electrode was carried out at 23 C using a 45 min accelerated low Earth orbit (LEO) cycle regime at 80 percent depth of discharge. One of three cells containing 26 percent KOH has achieved over 28,000 cycles, and the other two 19,000 cycles, without a sign of failure. Two other cells containing 31 percent KOH electrolyte, which is the concentration presently used in aerospace cells, failed after 2,979 and 3,620 cycles. This result indicates that the cycle life of the present type of Ni/H2 cells may be extended by a factor of 5 to 10 simply by lowering the KOH concentration. Long cycle life of a Ni/H2 battery at high depth-of-discharge operation is desired, particularly for an LEO spacecraft application. Typically, battery life of about 30,000 cycles is required for a five year mission in an LEO. Such a cycle life with presently available cells can be assured only at a very low depth-of-discharge operation. Results of testing already show that the cycle life of an Ni/H2 cell is tremendously improved by simply using an electrolyte of low KOH concentration.
The alpha-fetoprotein (AFP) third domain: a search for AFP interaction sites of cell cycle proteins.
Mizejewski, G J
2016-09-01
The carboxy-terminal third domain of alpha-fetoprotein (AFP-3D) is known to harbor binding and/or interaction sites for hydrophobic ligands, receptors, and binding proteins. Such reports have established that AFP-3D consists of amino acid (AA) sequence stretches on the AFP polypeptide that engages in protein-to-protein interactions with various ligands and receptors. Using a computer software program specifically designed for such interactions, the present report identified AA sequence fragments on AFP-3D that could potentially interact with a variety of cell cycle proteins. The cell cycle proteins identified were (1) cyclins, (2) cyclin-dependent kinases, (3) cell cycle-associated proteins (inhibitors, checkpoints, initiators), and (4) ubiquitin ligases. Following detection of the AFP-3D to cell cycle protein interaction sites, the computer-derived AFP localization AA sequences were compared and aligned with previously reported hydrophobic ligand and receptor interaction sites on AFP-3D. A literature survey of the association of cell cycle proteins with AFP showed both positive relationships and correlations. Previous reports of experimental AFP-derived peptides effects on various cell cycle proteins served to confirm and verify the present computer cell cycle protein identifications. Cell cycle protein interactions with AFP-CD peptides have been reported in cultured MCF-7 breast cancer cells subjected to mRNA microarray analysis. After 7 days in culture with MCF-7 cells, the AFP-derived peptides were shown to downregulate cyclin E, SKP2, checkpoint suppressors, cyclin-dependent kinases, and ubiquitin ligases that modulate cyclin E/CdK2 transition from the G1 to the S-phase of the cell cycle. Thus, the experimental data on AFP-CD interaction with cell cycle proteins were consistent with the "in silico" findings.
Analyzing the dynamics of cell cycle processes from fixed samples through ergodic principles
Wheeler, Richard John
2015-01-01
Tools to analyze cyclical cellular processes, particularly the cell cycle, are of broad value for cell biology. Cell cycle synchronization and live-cell time-lapse observation are widely used to analyze these processes but are not available for many systems. Simple mathematical methods built on the ergodic principle are a well-established, widely applicable, and powerful alternative analysis approach, although they are less widely used. These methods extract data about the dynamics of a cyclical process from a single time-point “snapshot” of a population of cells progressing through the cycle asynchronously. Here, I demonstrate application of these simple mathematical methods to analysis of basic cyclical processes—cycles including a division event, cell populations undergoing unicellular aging, and cell cycles with multiple fission (schizogony)—as well as recent advances that allow detailed mapping of the cell cycle from continuously changing properties of the cell such as size and DNA content. This includes examples using existing data from mammalian, yeast, and unicellular eukaryotic parasite cell biology. Through the ongoing advances in high-throughput cell analysis by light microscopy, electron microscopy, and flow cytometry, these mathematical methods are becoming ever more important and are a powerful complementary method to traditional synchronization and time-lapse cell cycle analysis methods. PMID:26543196
Angular-dependent light scattering from cancer cells in different phases of the cell cycle.
Lin, Xiaogang; Wan, Nan; Weng, Lingdong; Zhou, Yong
2017-10-10
Cancer cells in different phases of the cell cycle result in significant differences in light scattering properties. In order to harvest cancer cells in particular phases of the cell cycle, we cultured cancer cells through the process of synchronization. Flow cytometric analysis was applied to check the results of cell synchronization and prepare for light scattering measurements. Angular-dependent light scattering measurements of cancer cells arrested in the G1, S, and G2 phases have been performed. Based on integral calculations for scattering intensities from 5° to 10° and from 110° to 150°, conclusions have been reached. Clearly, the sizes of the cancer cells in different phases of the cell cycle dominated the forward scatter. Accompanying the increase of cell size with the progression of the cell cycle, the forward scattering intensity also increased. Meanwhile, the DNA content of cancer cells in every phase of the cell cycle is responsible for light scattering at large scatter angles. The higher the DNA content of cancer cells was, the greater the positive effect on the high-scattering intensity. As expected, understanding the relationships between the light scattering from cancer cells and cell cycles will aid in the development of cancer diagnoses. Also, it may assist in the guidance of antineoplastic drugs clinically.
Papillary renal cell carcinoma: a clinicopathological and whole-genome exon sequencing study
Liu, Kunpeng; Ren, Yuan; Pang, Lijuan; Qi, Yan; Jia, Wei; Tao, Lin; Hu, Zhengyan; Zhao, Jin; Zhang, Haijun; Li, Li; Yue, Haifeng; Han, Juan; Liang, Weihua; Hu, Jianming; Zou, Hong; Yuan, Xianglin; Li, Feng
2015-01-01
Papillary renal cell carcinoma (PRCC) represents the second most common histological subtype of RCC, and comprises 2 subtypes. Prognosis for type 1 PRCC is relatively good, whereas type 2 PRCC is associated with poor clinical outcomes. The aim of the present study was to evaluate the clinicopathological and mutations characteristics of PRCC. Hence, we reported on 13 cases of PRCC analyzed using whole-exome sequencing. Histologically, type 2 PRCC showed a higher nuclear grade and lymphovascular invasion rate versus type 1 PRCC (P < 0.05). Immunostaining revealed type 1 PRCC had higher CK7 and lower Top IIα expression rates (P < 0.05). Whole-exome sequencing data analysis revealed that the mutational statuses of 373 genes (287 missense, 69 silent, 6 nonsense, and 11 synonymous mutations) differed significantly between PRCC and normal renal tissues (P < 0.05). Functional enrichment analysis was used to classify the 287 missense-mutated genes into 11 biological process clusters (comprised of 61 biological processes) and 5 pathways, involved in cell adhesion, microtubule-based movement, the cell cycle, polysaccharide biosynthesis, muscle cell development and differentiation, cell death, and negative regulation. Associated pathways included the ATP-binding cassette transporter, extracellular matrix-receptor interaction, lysosome, complement and coagulation cascades, and glyoxylate and dicarboxylate metabolism pathways. The missense mutation status of 19 genes differed significantly between the groups (P < 0.05), and alterations in the EEF1D, RFNG, GPR142, and RAB37 genes were located in different chromosomal regions in type 1 and 2 PRCC. These mutations may contribute to future studies on pathogenic mechanisms and targeted therapy of PRCC. PMID:26339402
Hudik, Elodie; Yoshioka, Yasushi; Domenichini, Séverine; Bourge, Mickaël; Soubigout-Taconnat, Ludivine; Mazubert, Christelle; Yi, Dalong; Bujaldon, Sandrine; Hayashi, Hiroyuki; De Veylder, Lieven; Bergounioux, Catherine; Benhamed, Moussa; Raynaud, Cécile
2014-01-01
The majority of research on cell cycle regulation is focused on the nuclear events that govern the replication and segregation of the genome between the two daughter cells. However, eukaryotic cells contain several compartmentalized organelles with specialized functions, and coordination among these organelles is required for proper cell cycle progression, as evidenced by the isolation of several mutants in which both organelle function and overall plant development were affected. To investigate how chloroplast dysfunction affects the cell cycle, we analyzed the crumpled leaf (crl) mutant of Arabidopsis (Arabidopsis thaliana), which is deficient for a chloroplastic protein and displays particularly severe developmental defects. In the crl mutant, we reveal that cell cycle regulation is altered drastically and that meristematic cells prematurely enter differentiation, leading to reduced plant stature and early endoreduplication in the leaves. This response is due to the repression of several key cell cycle regulators as well as constitutive activation of stress-response genes, among them the cell cycle inhibitor SIAMESE-RELATED5. One unique feature of the crl mutant is that it produces aplastidic cells in several organs, including the root tip. By investigating the consequence of the absence of plastids on cell cycle progression, we showed that nuclear DNA replication occurs in aplastidic cells in the root tip, which opens future research prospects regarding the dialogue between plastids and the nucleus during cell cycle regulation in higher plants. PMID:25037213
Afuakwah, Charles; Welbury, Richard
2015-11-01
Clinical guidelines recommend an individual is given a caries risk status based on analysis of defined clinical and social criteria before implementing a tailored preventive plan. Improve documentation of caries risk assessment (CRA) in a general dental practice setting, using a systems-based approach to quality improvement methods. Investigate the impact of quality improvement efforts on subsequent design and delivery of preventive care. Identify barriers to delivery of CRA and provision of preventive care. Data for patients aged 0-16 years was collected over two cycles using standard audit methodology. The first cycle was a retrospective analysis (n = 400) using random sampling. The second cycle a prospective analysis (n = 513) using consecutive sampling over a 15-week period. Five staff meetings with feedback occurred between cycles. In cycle one, no specific CRA system was identified. CRA status was not stated widely, risk factors were not analysed and there was variation with respect to the prescription and delivery of preventive strategies. These discrepancies were demonstrable for all four participating dentists and at all ages. In cycle two, 100% recorded CRA. All risk factors were analysed and individual caries risk was correctly annotated. There was 100% compliance with the protocol for preventive plans. The use of CRA improved documentation of caries risk status. This has improved subsequent prescription of age specific evidence-based preventive care appropriate to the risk status of that individual. Barriers were identified to the delivery of CRA and the provision of comprehensive preventive care by the dentists and other healthcare professionals.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gabrielson, Marike; Reizer, Edwin; Stål, Olle
An increasing body of evidence is pointing towards mitochondrial regulation of the cell cycle. In a previous study of HER2-positive tumours we could demonstrate a common loss in the gene encoding for the mitochondrial transporter SLC25A43 and also a significant relation between SLC25A43 protein expression and S-phase fraction. Here, we investigated the consequence of suppressed SLC25A43 expression on cell cycle progression and proliferation in breast epithelial cells. In the present study, we suppressed SLC25A43 using siRNA in immortalised non-cancerous breast epithelial MCF10A cells and HER2-positive breast cancer cells BT-474. Viability, apoptosis, cell proliferation rate, cell cycle phase distribution, and nuclearmore » Ki-67 and p21, were assessed by flow cytometry. Cell cycle related gene expressions were analysed using real-time PCR. We found that SLC25A43 knockdown in MCF10A cells significantly inhibited cell cycle progression during G{sub 1}-to-S transition, thus significantly reducing the proliferation rate and fraction of Ki-67 positive MCF10A cells. In contrast, suppressed SLC25A43 expression in BT-474 cells resulted in a significantly increased proliferation rate together with an enhanced G{sub 1}-to-S transition. This was reflected by an increased fraction of Ki-67 positive cells and reduced level of nuclear p21. In line with our previous results, we show a role for SLC25A43 as a regulator of cell cycle progression and proliferation through a putative mitochondrial checkpoint. These novel data further strengthen the connection between mitochondrial function and the cell cycle, both in non-malignant and in cancer cells. - Highlights: • Proposed cell cycle regulation through the mitochondrial transporter SLC25A43. • SLC25A43 alters cell proliferation rate and cell cycle progression. • Suppressed SLC25A43 influences transcription of cell cycle regulatory genes.« less
Zhang, Jia-Hua; He, Yan-Li; Zhu, Rui; Du, Wen; Xiao, Jun-Hua
2017-06-01
Chronic myeloid leukemia is characterized by the presence of the reciprocal translocation t(9;22) and the BCR/ABL oncogene. The BCR/ABL oncogene activates multiple signaling pathways and involves the dysregulation of oncogenes during the progression of chronic myeloid leukemia. The cell division cycle protein 6, an essential regulator of DNA replication, is elevated in some human cancer cells. However, the expression of cell division cycle protein 6 in chronic myeloid leukemia and the underlying regulatory mechanism remain to be elucidated. In this study, our data showed that cell division cycle protein 6 expression was significantly upregulated in primary chronic myeloid leukemia cells and the chronic myeloid leukemia cell line K562 cells, as compared to the normal bone marrow mononuclear cells. BCR/ABL kinase inhibitor STI571 or BCR/ABL small interfering RNA could significantly downregulate cell division cycle protein 6 messenger RNA expression in K562 cells. Moreover, phosphoinositide 3-kinase/AKT pathway inhibitor LY294002 and Janus kinase/signal transducer and activator of transcription pathway inhibitor AG490 could downregulate cell division cycle protein 6 expression in K562 cells, but not RAS/mitogen-activated protein kinase pathway inhibitor PD98059 had such effect. Cell division cycle protein 6 gene silencing by small interfering RNA effectively resulted in decrease of proliferation, increase of apoptosis, and arrest of cell cycle in K562 cells. These findings have demonstrated that cell division cycle protein 6 overexpression may contribute to the high proliferation and low apoptosis in chronic myeloid leukemia cells and can be regulated by BCR/ABL signal transduction through downstream phosphoinositide 3-kinase/Akt and Janus kinase/signal transducer and activator of transcription pathways, suggesting cell division cycle protein 6 as a potential therapeutic target in chronic myeloid leukemia.
Modeling Bi-modality Improves Characterization of Cell Cycle on Gene Expression in Single Cells
Danaher, Patrick; Finak, Greg; Krouse, Michael; Wang, Alice; Webster, Philippa; Beechem, Joseph; Gottardo, Raphael
2014-01-01
Advances in high-throughput, single cell gene expression are allowing interrogation of cell heterogeneity. However, there is concern that the cell cycle phase of a cell might bias characterizations of gene expression at the single-cell level. We assess the effect of cell cycle phase on gene expression in single cells by measuring 333 genes in 930 cells across three phases and three cell lines. We determine each cell's phase non-invasively without chemical arrest and use it as a covariate in tests of differential expression. We observe bi-modal gene expression, a previously-described phenomenon, wherein the expression of otherwise abundant genes is either strongly positive, or undetectable within individual cells. This bi-modality is likely both biologically and technically driven. Irrespective of its source, we show that it should be modeled to draw accurate inferences from single cell expression experiments. To this end, we propose a semi-continuous modeling framework based on the generalized linear model, and use it to characterize genes with consistent cell cycle effects across three cell lines. Our new computational framework improves the detection of previously characterized cell-cycle genes compared to approaches that do not account for the bi-modality of single-cell data. We use our semi-continuous modelling framework to estimate single cell gene co-expression networks. These networks suggest that in addition to having phase-dependent shifts in expression (when averaged over many cells), some, but not all, canonical cell cycle genes tend to be co-expressed in groups in single cells. We estimate the amount of single cell expression variability attributable to the cell cycle. We find that the cell cycle explains only 5%–17% of expression variability, suggesting that the cell cycle will not tend to be a large nuisance factor in analysis of the single cell transcriptome. PMID:25032992
Dedov, Vadim N; Dedova, Irina V; Nicholson, Garth A
2004-04-01
Starvation arrests cultured mammalian cells in the G(1) restriction point of the cell cycle, whereas cancer cells generally lose the regulatory control of the cell cycle. Human lymphocytes, infected with Epstein-Barr virus (EBV), also lose their cell cycle control and produce immortal lymphoblastoid cell lines. We show that during starvation, EBV-lymphoblasts override the cell cycle arrest in the G(1) restriction point and continue cell division. Simultaneously, starvation activates apoptosis in an approximately half of the daughter cells in each cell generation. Continuos cell division and partial removal of cells by apoptosis results in stabilization of viable cell numbers, where a majority of viable cells are in the G(1) phase of the cell cycle. In contrast to starvation, anticancer drug etoposide activates apoptosis indiscriminately in all EBV-lymphoblasts and convertes all the viable cells into apoptotic. We conclude that the removal of surplus cells by apoptosis may represent a survival mechanism of transformed (i.e., cancer) cell population in nutrient restricted conditions, whereas nontransformed mammalian cells are arrested in the G(1) restriction point of the cell cycle.
[Effects of methyl tertiary butyl ether on cell cycle and cell apoptosis].
Zhou, W; Huang, G; Zhang, H; Ye, S
2000-07-01
To explore the effects of the new gasoline additive, methyl tertiary butyl ether (MTBE) on cell cycle and cell apoptosis. Flow cytometry was used to evaluate the effect of MTBE (1, 2, 4 microl/ml, 24 h) on NIH/3T3 cell cycles; and the effect of MTBE on Hela cell apoptosis was evaluated by detecting cell survival using crystal violet staining. Flow cytometry showed that MTBE could change NIH/3T3 cell cycles, decrease the number of cells in S stage, and arrest cells at G(2) + M stage. The results suggested that MTBE could affect NIH/3T3 cell cycles and induce cell proliferation. This situation existed 48 hours after the treatment, and cell cycles came back normal 96 hours after the treatment. By detecting cell survival using crystal violet staining, we found that MTBE could inhibit the apoptosis of Hela cells which was induced by tumor necrosis factor (TNF)alpha and cycloheximide. MTBE's carcinogenicity to animals may relate to induction of cell proliferation and inhibition of cell apoptosis.
KOH concentration effect on the cycle life of nickel-hydrogen cells. 4: Results of failure analyse
NASA Technical Reports Server (NTRS)
Lim, H. S.; Verzwyvelt, S. A.
1989-01-01
Effects of KOH concentrations on failure modes and mechanisms of nickel-hydrogen cells were studied using long cycled boiler plate cells containing electrolytes of various KOH concentrations ranging 21 to 36 percent. Life of these cells were up to 40,000 cycles in an accelerated low earth orbit (LEO) cycle regime at 80 percent depth of discharge. An interim life test results were reported earlier in J. Power Sources, 22, 213-220, 1988. The results of final life test, end-of-life cell performance, and teardown analyses are discussed. These teardown analyses included visual observations, measurements of nickel electrode capacity in an electrolyte-flooded cell, dimensional changes of cell components, SEM studies on cell cross section, BET surface area and pore volume distribution in cycled nickel electrodes, and chemical analyses. Cycle life of a nickel-hydrogen cell was improved tremendously as KOH concentration was decreased from 36 to 31 percent and from 31 to 26 percent while effect of further concentration decrease was complicated as described in our earlier report. Failure mode of high concentration (31 to 36 percent) cells was gradual capacity decrease, while that of low concentration (21 to 26 percent) cells was mainly formation of a soft short. Long cycled (25,000 to 40,000 cycles) nickel electrodes were expanded more than 50 percent of the initial value, but no correlation was found between this expansion and measured capacity. All electrodes cycled in low concentration (21 to 26 percent) cells had higher capacity than those cycled in high concentration (31 to 36 percent) cells.
The cell-cycle interactome: a source of growth regulators?
Blomme, Jonas; Inzé, Dirk; Gonzalez, Nathalie
2014-06-01
When plants develop, cell proliferation and cell expansion are tightly controlled in order to generate organs with a determinate final size such as leaves. Several studies have demonstrated the importance of the cell proliferation phase for leaf growth, illustrating that cell-cycle regulation is crucial for correct leaf development. A large and complex set of interacting proteins that constitute the cell-cycle interactome controls the transition from one cell-cycle phase to another. Here, we review the current knowledge on cell-cycle regulators from this interactome affecting final leaf size when their expression is altered, mainly in Arabidopsis. In addition to the description of mutants of CYCLIN-DEPENDENT KINASES (CDKs), CYCLINS (CYCs), and their transcriptional and post-translational regulators, a phenotypic analysis of gain- and loss-of-function mutants for 27 genes encoding proteins that interact with cell-cycle proteins is presented. This compilation of information shows that when cell-cycle-related genes are mis-expressed, leaf growth is often altered and that, seemingly, three main trends appear to be crucial in the regulation of final organ size by cell-cycle-related genes: (i) cellular compensation; (ii) gene dosage; and (iii) correct transition through the G2/M phase by ANAPHASE PROMOTING COMPLEX/CYCLOSOME (APC/C) activation. In conclusion, this meta-analysis shows that the cell-cycle interactome is enriched in leaf growth regulators, and illustrates the potential to identify new leaf growth regulators among putative new cell-cycle regulators. © The Author 2013. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Epigenetic Regulation of Centromere Chromatin Stability by Dietary and Environmental Factors.
Hernández-Saavedra, Diego; Strakovsky, Rita S; Ostrosky-Wegman, Patricia; Pan, Yuan-Xiang
2017-11-01
The centromere is a genomic locus required for the segregation of the chromosomes during cell division. This chromosomal region together with pericentromeres has been found to be susceptible to damage, and thus the perturbation of the centromere could lead to the development of aneuploidic events. Metabolic abnormalities that underlie the generation of cancer include inflammation, oxidative stress, cell cycle deregulation, and numerous others. The micronucleus assay, an early clinical marker of cancer, has been shown to provide a reliable measure of genotoxic damage that may signal cancer initiation. In the current review, we will discuss the events that lead to micronucleus formation and centromeric and pericentromeric chromatin instability, as well transcripts emanating from these regions, which were previously thought to be inactive. Studies were selected in PubMed if they reported the effects of nutritional status (macro- and micronutrients) or environmental toxicant exposure on micronucleus frequency or any other chromosomal abnormality in humans, animals, or cell models. Mounting evidence from epidemiologic, environmental, and nutritional studies provides a novel perspective on the origination of aneuploidic events. Although substantial evidence exists describing the role that nutritional status and environmental toxicants have on the generation of micronuclei and other nuclear aberrations, limited information is available to describe the importance of macro- and micronutrients on centromeric and pericentromeric chromatin stability. Moving forward, studies that specifically address the direct link between nutritional status, excess, or deficiency and the epigenetic regulation of the centromere will provide much needed insight into the nutritional and environmental regulation of this chromosomal region and the initiation of aneuploidy. © 2017 American Society for Nutrition.
Huang, Ming-Bo; Gonzalez, Ruben R; Lillard, James; Bond, Vincent C
2017-02-14
Discovery and development of a novel anticancer PEG-SMR-Clu peptide to prevent breast cancer metastasis. How breast cancer cells and primary mammary epithelial cells interact and communicate with each other to promote tumorigenesis and how to prevent tumor metastasis has long been a concern of researchers. Cancer cells secrete exosomes containing proteins and RNA. These factors can influence tumor development by directly targeting cancer cells and tumor stroma. In this study, we determined the effects of a peptide as an inhibitor of exosome secretion on breast tumors. We developed a peptide derived from the Secretion Modification Region (SMR) of HIV-1 Nef protein that was modified with PEG on the N-terminus and with a Clusterin (Clu)-binding peptide on the C-terminus. Attachment of PEG to the SMR peptide, termed PEGylation, offers improved water solubility and stability as well as reduced clearance through the kidneys, leading to a longer circulation time. The 12-mer Clu-binding peptide plays multiple roles in tumor development and metastasis. The Clu peptide can be detected by antibody in vivo, thus it has the potential to be used to monitor tumor status and treatment efficacy in animal studies and eventually in cancer patients. PEG-SMRwt-Clu and PEG-SMRwt peptides inhibited the growth of both of MCF-7 (estrogen responsive, ER+) and MDA-MD-231 (estrogen non-responsive, ER-) human breast cancer cells in a dose and time-dependent manner, without inducing cytotoxic effects. The SMRwt peptide, combined with paclitaxel, induced G2/M phase cell cycle arrest on MCF-7 and MDA-MB-231 cells but did not promote apoptosis. PEG-SMRwt-Clu peptide treatment blocked exosome release from both MCF-7 and MDA-MB-231 cells. This effect was blocked by knockdown of the chaperone protein mortalin by either antibody or siRNA. MCF-7 and MDA-MB-231 breast tumor cells were treated with PEG-SMR-Clu peptide alone and in combination with paclitaxel and cisplatin. Cell proliferation and viabilty were determined via cell cycle analysis using Cellometer imaging cytometry, Annexin V and MTT assays. The effects of the PEG-SMR-Clu peptide on tumor exosome release were determined by testing isolated exosome fractions, for (i) expression of CD63 and Alix proteins by Western blotting, (ii) NanoSight nanoparticle tracking analysis (NTA 10) to measure exosomes size and concentration, and (iii) measurement of acetylcholinesterase (AchE) for exosome specific enzyme activity. PEG-SMRwt-CLU peptides inhibited the growth of human breast cancer cells and blocked tumor exosome release in vitro. The peptide alone did not cause increased cytotoxicity or apoptosis induction, but did cause cell cycle G2/M phase arrest in both estrogen responsive and non-responsive breast cancer cells. These data suggest a potential therapeutic value of SMR to prevent breast cancer metastasis and as an adjuvant for the chemotherapeutic treatment of human breast cancer.
Performance of Li-Ion Cells Under Battery Voltage Charge Control
NASA Technical Reports Server (NTRS)
Rao, Gopalakrishna M.; Vaidyanathan, Hari; Day, John H. (Technical Monitor)
2001-01-01
A study consisting of electrochemical characterization and Low-Earth-Orbit (LEO) cycling of Li-Ion cells from three vendors was initiated in 1999 to determine the cycling performance and to infuse the new technology in the future NASA missions. The 8-cell batteries included in this evaluation are prismatic cells manufactured by Mine Safety Appliances Company (MSA), cylindrical cells manufactured by SAFT and prismatic cells manufactured by Yardney Technical Products, Inc. (YTP). The three batteries were cycle tested in the LEO regime at 40% depth of discharge, and under a charge control technique that consists of battery voltage clamp with a current taper. The initial testing was conducted at 20 C; however, the batteries were cycled also intermittently at low temperatures. YTP 20 Ah cells consisted of mixed-oxide (Co and Ni) positive, graphitic carbon negative, LIPF6 salt mixed with organic carbonate solvents. The battery voltage clamp was 32 V. The low temperature cycling tests started after 4575 cycles at 20 C. The cells were not capable of cycling. at low temperature since the charge acceptance at battery level was poor. There was a cell in the battery that showed too high an end-of-charge (EOC) voltage thereby limiting the ability to charge the rest of the cells in the battery. The battery has completed 6714 cycles. SAFT 12 Ah cells consisted of mixed-oxide (Co and NO positive, graphitic carbon negative, LiPF6 salt mixed with organic carbonate solvents. The battery voltage clamp was for 30.8 V. The low temperature cycling tests started after 4594 cycles at 20 C. A cell that showed low end of discharge (EOD) and EOC voltages and three other cells that showed higher EOC voltages limited the charge acceptance at the selected voltage limit during charge. The cells were capable of cycling at 10 C and 0 C but the charge voltage limit had to be increased to 34.3 V (4.3 V per cell). The low temperature cycling may have induced poor chargeability since the voltage had to be increased to achieve the required charge input. The battery has completed 6226 cycles. MSA 10 Ah cells consisted of Co oxide positive, graphitic carbon negative, LiPF6 salt mixed with organic carbonate solvents. The battery voltage clamp was 30.8 V. The low temperature cycling tests were started after 2182 cycles at 20 C. The cells were capable of cycling at 10 C and 0 C. Like SAFT, the voltage limit on charge had to be increased to 36 V (4.5 V per cell). There was a cell (cell S/N 13) in the battery that showed poor performance features such as low EOD voltage and high EOC voltage. The battery has completed 3441 cycles. A reconditioning procedure that consisted of C15 charge to a taper current of C/100 and C/20 discharge improved the voltage behavior of SAFT and MSA cells with no significant effect on YTP cells. We have demonstrated that the charge operation with VT clamp at battery rather than at cell level is feasible for onboard Li-Ion battery operation.
1975-01-01
A wide variety of inhibitors (drugs, antibiotics, and antimetabolites) will block cell division within an ongoing cell cycle in autotrophic cultures of Chlamydomonas reinhardtii. To determine when during the cell cycle a given inhibitor is effective in preventing cell division, a technique is described which does not rely on the use of synchronous cultures. The technique permits the measurement of transition points, the cell cycle stage at which the subsequent cell division becomes insensitive to the effects of an inhibitor. A map of transition points in the cell cycle reveals that they are grouped into two broad periods, the second and fourth quarters. In general, inhibitors which block organellar DNA, RNA, and protein synthesis have second-quarter transition points, while those which inhibit nuclear cytoplasmic macromolecular synthesis have fourth-quarter transition points. The specific grouping of these transition points into two periods suggests that the synthesis of organellar components is completed midway through the cell cycle and that the synthesis of nonorganellar components required for cell division is not completed until late in the cell cycle. PMID:1176526
Viral exploitation of the MEK/ERK pathway - A tale of vaccinia virus and other viruses.
Bonjardim, Cláudio A
2017-07-01
The VACV replication cycle is remarkable in the sense that it is performed entirely in the cytoplasmic compartment of vertebrate cells, due to its capability to encode enzymes required either for regulating the macromolecular precursor pool or the biosynthetic processes. Although remarkable, this gene repertoire is not sufficient to confer the status of a free-living microorganism to the virus, and, consequently, the virus relies heavily on the host to successfully generate its progeny. During the complex virus-host interaction, viruses must deal not only with the host pathways to accomplish their temporal demands but also with pathways that counteract viral infection, including the inflammatory, innate and acquired immune responses. This review focuses on VACV and other DNA or RNA viruses that stimulate the MEK (MAPK - Mitogen Activated Protein Kinase)/ERK- Extracellular signal-Regulated Kinase) pathway as part of their replication cycle. Copyright © 2016 Elsevier Inc. All rights reserved.
Identification of Primary Transcriptional Regulation of Cell Cycle-Regulated Genes upon DNA Damage
Zhou, Tong; Chou, Jeff; Mullen, Thomas E.; Elkon, Rani; Zhou, Yingchun; Simpson, Dennis A.; Bushel, Pierre R.; Paules, Richard S.; Lobenhofer, Edward K.; Hurban, Patrick; Kaufmann, William K.
2007-01-01
The changes in global gene expression in response to DNA damage may derive from either direct induction or repression by transcriptional regulation or indirectly by synchronization of cells to specific cell cycle phases, such as G1 or G2. We developed a model that successfully estimated the expression levels of >400 cell cycle-regulated genes in normal human fibroblasts based on the proportions of cells in each phase of the cell cycle. By isolating effects on the gene expression associated with the cell cycle phase redistribution after genotoxin treatment, the direct transcriptional target genes were distinguished from genes for which expression changed secondary to cell synchronization. Application of this model to ionizing radiation (IR)-treated normal human fibroblasts identified 150 of 406 cycle-regulated genes as putative direct transcriptional targets of IR-induced DNA damage. Changes in expression of these genes after IR treatment derived from both direct transcriptional regulation and cell cycle synchronization. PMID:17404513
The Yeast Cyclin-Dependent Kinase Routes Carbon Fluxes to Fuel Cell Cycle Progression.
Ewald, Jennifer C; Kuehne, Andreas; Zamboni, Nicola; Skotheim, Jan M
2016-05-19
Cell division entails a sequence of processes whose specific demands for biosynthetic precursors and energy place dynamic requirements on metabolism. However, little is known about how metabolic fluxes are coordinated with the cell division cycle. Here, we examine budding yeast to show that more than half of all measured metabolites change significantly through the cell division cycle. Cell cycle-dependent changes in central carbon metabolism are controlled by the cyclin-dependent kinase (Cdk1), a major cell cycle regulator, and the metabolic regulator protein kinase A. At the G1/S transition, Cdk1 phosphorylates and activates the enzyme Nth1, which funnels the storage carbohydrate trehalose into central carbon metabolism. Trehalose utilization fuels anabolic processes required to reliably complete cell division. Thus, the cell cycle entrains carbon metabolism to fuel biosynthesis. Because the oscillation of Cdk activity is a conserved feature of the eukaryotic cell cycle, we anticipate its frequent use in dynamically regulating metabolism for efficient proliferation. Copyright © 2016 Elsevier Inc. All rights reserved.
Sun, Dawei; Han, Shen; Liu, Chao; Zhou, Rui; Sun, Weihai; Zhang, Zhijun; Qu, Jianjun
2016-04-11
BACKGROUND The objective of this study was to explore the role of miR-199a-5p in the development of thyroid cancer, including its anti-proliferation effect and downstream signaling pathway. MATERIAL AND METHODS We conducted qRT-PCR analysis to detect the expressions of several microRNAs in 42 follicular thyroid carcinoma patients and 42 controls. We identified CTGF as target of miR-491, and viability and cell cycle status were determined in FTC-133 cells transfected with CTGF siRNA, miR-199a mimics, or inhibitors. RESULTS We identified an underexpression of miR-199a-5p in follicular thyroid carcinoma tissue samples compared with controls. Then we confirmed CTGF as a target of miR-199a-5p thyroid cells by using informatics analysis and luciferase reporter assay. Additionally, we found that mRNA and protein expression levels of CTGF were both clearly higher in malignant tissues than in benign tissues. miR-199a-5p mimics and CTGF siRNA similarly downregulated the expression of CTGF, and reduced the viability of FTC-133 cells by arresting the cell cycle in G0 phase. Transfection of miR-199a-5p inhibitors increased the expression of CTGF and promoted the viability of the cells by increasing the fraction of cells in G2/M and S phases. CONCLUSIONS Our study proves that the CTGF gene is a target of miR-199a-5p, demonstrating the negatively related association between CTGF and miR-199a. These findings suggest that miR-199a-5p might be a novel therapeutic target in the treatment of follicular thyroid carcinoma.
The immuno-pathological conversions of canine demodicosis.
Singh, Shanker K; Dimri, Umesh
2014-06-16
Canine demodicosis is a common but exigent noncontagious parasitic dermatosis caused by overpopulation of the host-specific follicular mites of various Demodex species. Receptivity of dogs to demodicosis and progression of the clinical disease are influenced by numerous factors including; genetic defect, alteration of skin's structure and biochemistry, immunological disorders, hormonal status, breed, age, nutritional status, oxidative stress, length of hair coat, stage of oestrus cycle, parturition, endoparasitism and debilitating diseases. Of these, the immune status is thought to be the most significant. Thus, in the present review we intended to edify the immuno-pathological conversions of canine demodicosis. Generalized demodicosis requires a cutaneous environment that is ecologically and immunologically favorable for extreme colonization of demodectic mites. Demodex canis mites can down regulate the CD4+ T cells; possibly by an increased rate of apoptosis or immunological exhaustion of CD4+ T cells. An increased apoptosis of peripheral leukocytes confers progression of the clinical manifestations. Mites induced elevation of TGF-β and inhibition of TNF-α mRNA expression might be a key factor for revealing the difference in the mechanism of onset between localized and generalized demodicosis. Moreover, an elevated serum level of IL-10 could be accountable for the recurrence as well as occurrence of demodicosis in dogs. Over production of reactive oxygen species can corroborate immunological discrepancies in dogs with demodicosis. Copyright © 2014 Elsevier B.V. All rights reserved.
Bright monomeric near-infrared fluorescent proteins as tags and biosensors for multiscale imaging
Shcherbakova, Daria M.; Baloban, Mikhail; Emelyanov, Alexander V.; Brenowitz, Michael; Guo, Peng; Verkhusha, Vladislav V.
2016-01-01
Monomeric near-infrared (NIR) fluorescent proteins (FPs) are in high demand as protein tags and components of biosensors for deep-tissue imaging and multicolour microscopy. We report three bright and spectrally distinct monomeric NIR FPs, termed miRFPs, engineered from bacterial phytochrome, which can be used as easily as GFP-like FPs. miRFPs are 2–5-fold brighter in mammalian cells than other monomeric NIR FPs and perform well in protein fusions, allowing multicolour structured illumination microscopy. miRFPs enable development of several types of NIR biosensors, such as for protein–protein interactions, RNA detection, signalling cascades and cell fate. We demonstrate this by engineering the monomeric fluorescence complementation reporters, the IκBα reporter for NF-κB pathway and the cell cycle biosensor for detection of proliferation status of cells in culture and in animals. miRFPs allow non-invasive visualization and detection of biological processes at different scales, from super-resolution microscopy to in vivo imaging, using the same probes. PMID:27539380
Schorpp, Kenji; Rothenaigner, Ina; Maier, Julia; Traenkle, Bjoern; Rothbauer, Ulrich; Hadian, Kamyar
2016-10-01
Many screening hits show relatively poor quality regarding later efficacy and safety. Therefore, small-molecule screening efforts shift toward high-content analysis providing more detailed information. Here, we describe a novel screening approach to identify cell cycle modulators with low toxicity by combining the Cell Cycle Chromobody (CCC) technology with the CytoTox-Glo (CTG) cytotoxicity assay. The CCC technology employs intracellularly functional single-domain antibodies coupled to a fluorescent protein (chromobodies) to visualize the cell cycle-dependent redistribution of the proliferating cell nuclear antigen (PCNA) in living cells. This image-based cell cycle analysis was combined with determination of dead-cell protease activity in cell culture supernatants by the CTG assay. We adopted this multiplex approach to high-throughput format and screened 960 Food and Drug Administration (FDA)-approved drugs. By this, we identified nontoxic compounds, which modulate different cell cycle stages, and validated selected hits in diverse cell lines stably expressing CCC. Additionally, we independently validated these hits by flow cytometry as the current state-of-the-art format for cell cycle analysis. This study demonstrates that CCC imaging is a versatile high-content screening approach to identify cell cycle modulators, which can be multiplexed with cytotoxicity assays for early elimination of toxic compounds during screening. © 2016 Society for Laboratory Automation and Screening.
Wani, Willayat Yousuf; Kandimalla, Ramesh J L; Sharma, Deep Raj; Kaushal, Alka; Ruban, Anand; Sunkaria, Aditya; Vallamkondu, Jayalakshmi; Chiarugi, Alberto; Reddy, P Hemachandra; Gill, Kiran Dip
2017-07-01
In the previous study, we demonstrated that dichlorvos induces oxidative stress in dopaminergic neuronal cells and subsequent caspase activation mediates apoptosis. In the present study, we evaluated the effect and mechanism of dichlorvos induced oxidative stress on cell cycle activation in NGF-differentiated PC12 cells. Dichlorvos exposure resulted in oxidative DNA damage along with activation of cell cycle machinery in differentiated PC12 cells. Dichlorvos exposed cells exhibited an increased expression of p53, cyclin-D1, pRb and decreased expression of p21suggesting a re-entry of differentiated cells into the cell cycle. Cell cycle analysis of dichlorvos exposed cells revealed a reduction of cells in the G 0 /G 1 phase of the cell cycle (25%), and a concomitant increase of cells in S phase (30%) and G2/M phase (43.3%) compared to control PC12 cells. Further, immunoblotting of cytochrome c, Bax, Bcl-2 and cleaved caspase-3 revealed that dichlorvos induces a caspase-dependent cell death in PC12 cells. These results suggest that Dichlorvos exposure has the potential to generate oxidative stress which evokes activation of cell cycle machinery leading to apoptotic cell death via cytochrome c release from mitochondria and subsequent caspase-3 activation in differentiated PC12 cells. Copyright © 2016 Elsevier B.V. All rights reserved.
Ondracka, Andrej; Dudin, Omaya; Ruiz-Trillo, Iñaki
2018-06-18
Coordination of the cell division cycle with the growth of the cell is critical to achieve cell size homeostasis [1]. Mechanisms coupling the cell division cycle with cell growth have been described across diverse eukaryotic taxa [2-4], but little is known about how these processes are coordinated in organisms that undergo more complex life cycles, such as coenocytic growth. Coenocytes (multinucleate cells formed by sequential nuclear divisions without cytokinesis) are commonly found across the eukaryotic kingdom, including in animal and plant tissues and several lineages of unicellular eukaryotes [5]. Among the organisms that form coenocytes are ichthyosporeans, a lineage of unicellular holozoans that are of significant interest due to their phylogenetic placement as one of the closest relatives of animals [6]. Here, we characterize the coenocytic cell division cycle in the ichthyosporean Sphaeroforma arctica. We observe that, in laboratory conditions, S. arctica cells undergo a uniform and easily synchronizable coenocytic cell cycle, reaching up to 128 nuclei per cell before cellularization and release of daughter cells. Cycles of nuclear division occur synchronously within the coenocyte and in regular time intervals (11-12 hr). We find that the growth of cell volume is dependent on concentration of nutrients in the media; in contrast, the rate of nuclear division cycles is constant over a range of nutrient concentrations. Together, the results suggest that nuclear division cycles in the coenocytic growth of S. arctica are driven by a timer, which ensures periodic and synchronous nuclear cycles independent of the cell size and growth. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Real-time tracking of cell cycle progression during CD8+ effector and memory T-cell differentiation
Kinjyo, Ichiko; Qin, Jim; Tan, Sioh-Yang; Wellard, Cameron J.; Mrass, Paulus; Ritchie, William; Doi, Atsushi; Cavanagh, Lois L.; Tomura, Michio; Sakaue-Sawano, Asako; Kanagawa, Osami; Miyawaki, Atsushi; Hodgkin, Philip D.; Weninger, Wolfgang
2015-01-01
The precise pathways of memory T-cell differentiation are incompletely understood. Here we exploit transgenic mice expressing fluorescent cell cycle indicators to longitudinally track the division dynamics of individual CD8+ T cells. During influenza virus infection in vivo, naive T cells enter a CD62Lintermediate state of fast proliferation, which continues for at least nine generations. At the peak of the anti-viral immune response, a subpopulation of these cells markedly reduces their cycling speed and acquires a CD62Lhi central memory cell phenotype. Construction of T-cell family division trees in vitro reveals two patterns of proliferation dynamics. While cells initially divide rapidly with moderate stochastic variations of cycling times after each generation, a slow-cycling subpopulation displaying a CD62Lhi memory phenotype appears after eight divisions. Phenotype and cell cycle duration are inherited by the progeny of slow cyclers. We propose that memory precursors cell-intrinsically modulate their proliferative activity to diversify differentiation pathways. PMID:25709008
Real-time tracking of cell cycle progression during CD8+ effector and memory T-cell differentiation.
Kinjyo, Ichiko; Qin, Jim; Tan, Sioh-Yang; Wellard, Cameron J; Mrass, Paulus; Ritchie, William; Doi, Atsushi; Cavanagh, Lois L; Tomura, Michio; Sakaue-Sawano, Asako; Kanagawa, Osami; Miyawaki, Atsushi; Hodgkin, Philip D; Weninger, Wolfgang
2015-02-24
The precise pathways of memory T-cell differentiation are incompletely understood. Here we exploit transgenic mice expressing fluorescent cell cycle indicators to longitudinally track the division dynamics of individual CD8(+) T cells. During influenza virus infection in vivo, naive T cells enter a CD62L(intermediate) state of fast proliferation, which continues for at least nine generations. At the peak of the anti-viral immune response, a subpopulation of these cells markedly reduces their cycling speed and acquires a CD62L(hi) central memory cell phenotype. Construction of T-cell family division trees in vitro reveals two patterns of proliferation dynamics. While cells initially divide rapidly with moderate stochastic variations of cycling times after each generation, a slow-cycling subpopulation displaying a CD62L(hi) memory phenotype appears after eight divisions. Phenotype and cell cycle duration are inherited by the progeny of slow cyclers. We propose that memory precursors cell-intrinsically modulate their proliferative activity to diversify differentiation pathways.
Identification of Cell Cycle-regulated Genes in Fission YeastD⃞
Peng, Xu; Karuturi, R. Krishna Murthy; Miller, Lance D.; Lin, Kui; Jia, Yonghui; Kondu, Pinar; Wang, Long; Wong, Lim-Soon; Liu, Edison T.; Balasubramanian, Mohan K.; Liu, Jianhua
2005-01-01
Cell cycle progression is both regulated and accompanied by periodic changes in the expression levels of a large number of genes. To investigate cell cycle-regulated transcriptional programs in the fission yeast Schizosaccharomyces pombe, we developed a whole-genome oligonucleotide-based DNA microarray. Microarray analysis of both wild-type and cdc25 mutant cell cultures was performed to identify transcripts whose levels oscillated during the cell cycle. Using an unsupervised algorithm, we identified 747 genes that met the criteria for cell cycle-regulated expression. Peaks of gene expression were found to be distributed throughout the entire cell cycle. Furthermore, we found that four promoter motifs exhibited strong association with cell cycle phase-specific expression. Examination of the regulation of MCB motif-containing genes through the perturbation of DNA synthesis control/MCB-binding factor (DSC/MBF)-mediated transcription in arrested synchronous cdc10 mutant cell cultures revealed a subset of functional targets of the DSC/MBF transcription factor complex, as well as certain gene promoter requirements. Finally, we compared our data with those for the budding yeast Saccharomyces cerevisiae and found ∼140 genes that are cell cycle regulated in both yeasts, suggesting that these genes may play an evolutionarily conserved role in regulation of cell cycle-specific processes. Our complete data sets are available at http://giscompute.gis.a-star.edu.sg/~gisljh/CDC. PMID:15616197
Pariona-Llanos, Ricardo; Pavani, Raphael Souza; Reis, Marcelo; Noël, Vincent; Silber, Ariel Mariano; Armelin, Hugo Aguirre; Cano, Maria Isabel Nogueira; Elias, Maria Carolina
2015-01-01
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is a classical metabolic enzyme involved in energy production and plays a role in additional nuclear functions, including transcriptional control, recognition of misincorporated nucleotides in DNA and maintenance of telomere structure. Here, we show that the recombinant protein T. cruzi GAPDH (rTcGAPDH) binds single-stranded telomeric DNA. We demonstrate that the binding of GAPDH to telomeric DNA correlates with the balance between oxidized and reduced forms of nicotinamide adenine dinucleotides (NAD+/NADH). We observed that GAPDH-telomere association and NAD+/NADH balance changed throughout the T. cruzi life cycle. For example, in replicative epimastigote forms of T. cruzi, which show similar intracellular concentrations of NAD+ and NADH, GAPDH binds to telomeric DNA in vivo and this binding activity is inhibited by exogenous NAD+. In contrast, in the T. cruzi non-proliferative trypomastigote forms, which show higher NAD+ concentration, GAPDH was absent from telomeres. In addition, NAD+ abolishes physical interaction between recombinant GAPDH and synthetic telomere oligonucleotide in a cell free system, mimicking exogenous NAD+ that reduces GAPDH-telomere interaction in vivo. We propose that the balance in the NAD+/NADH ratio during T. cruzi life cycle homeostatically regulates GAPDH telomere association, suggesting that in trypanosomes redox status locally modulates GAPDH association with telomeric DNA.
Pariona-Llanos, Ricardo; Pavani, Raphael Souza; Reis, Marcelo; Noël, Vincent; Silber, Ariel Mariano; Armelin, Hugo Aguirre; Cano, Maria Isabel Nogueira; Elias, Maria Carolina
2015-01-01
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is a classical metabolic enzyme involved in energy production and plays a role in additional nuclear functions, including transcriptional control, recognition of misincorporated nucleotides in DNA and maintenance of telomere structure. Here, we show that the recombinant protein T. cruzi GAPDH (rTcGAPDH) binds single-stranded telomeric DNA. We demonstrate that the binding of GAPDH to telomeric DNA correlates with the balance between oxidized and reduced forms of nicotinamide adenine dinucleotides (NAD+/NADH). We observed that GAPDH-telomere association and NAD+/NADH balance changed throughout the T. cruzi life cycle. For example, in replicative epimastigote forms of T. cruzi, which show similar intracellular concentrations of NAD+ and NADH, GAPDH binds to telomeric DNA in vivo and this binding activity is inhibited by exogenous NAD+. In contrast, in the T. cruzi non-proliferative trypomastigote forms, which show higher NAD+ concentration, GAPDH was absent from telomeres. In addition, NAD+ abolishes physical interaction between recombinant GAPDH and synthetic telomere oligonucleotide in a cell free system, mimicking exogenous NAD+ that reduces GAPDH-telomere interaction in vivo. We propose that the balance in the NAD+/NADH ratio during T. cruzi life cycle homeostatically regulates GAPDH telomere association, suggesting that in trypanosomes redox status locally modulates GAPDH association with telomeric DNA. PMID:25775131
Proctor, Christine M; Freeman, Elizabeth W; Brown, Janine L
2010-01-01
The North American African (Loxodonta africana) elephant population is not self-sustaining, in part because of a high rate of abnormal ovarian activity. About 12% of adult females exhibit irregular cycles and 31% do not cycle at all. Our earlier work revealed a relationship between dominance status and ovarian acyclicity, with dominant females being more likely to not cycle normally. One theory is that dominant females may be expending more energy to maintaining peace within the captive herd than for supporting reproduction. The goal of this study was to determine if there was a relationship among dominance status, serum cortisol concentrations, and ovarian acyclicity. We hypothesized that adrenal glucocorticoid activity would be increased in dominant, noncycling elephants as compared with subdominant individuals. Blood samples were collected weekly over a 2-year period in 81 females of known dominance and cyclicity status, and analyzed for cortisol. Based on a path analysis model (Reticular Action Model Or Near Approximation [RAMONA]), noncycling, dominant African elephant females did not have higher mean serum cortisol concentrations, or exhibit more variability (i.e., coefficient of variation, standard deviation) in cortisol secretion. This study suggests that alterations in adrenal activity are not related to dominance status nor contribute directly to acyclicity in captive African elephants.
Esteras, Noemí; Bartolomé, Fernando; Alquézar, Carolina; Antequera, Desireé; Muñoz, Úrsula; Carro, Eva; Martín-Requero, Ángeles
2012-09-01
Cumulative evidence indicates that aberrant re-expression of many cell cycle-related proteins and inappropriate neuronal cell cycle control are critical events in Alzheimer's disease (AD) pathogenesis. Evidence of cell cycle activation in post-mitotic neurons has also been observed in murine models of AD, despite the fact that most of these mice do not show massive loss of neuronal bodies. Dysfunction of the cell cycle appears to affect cells other than neurons, as peripheral cells, such as lymphocytes and fibroblasts from patients with AD, show an altered response to mitogenic stimulation. We sought to determine whether cell cycle disturbances are present simultaneously in both brain and peripheral cells from the amyloid precursor protein (APP)/presenilin 1 (PS1) mouse model of AD, in order to validate the use of peripheral cells from patients not only to study cell cycle abnormalities as a pathogenic feature of AD, but also as a means to test novel therapeutic approaches. By using cell cycle pathway-specific RT(2)Profiler™ PCR Arrays, we detected changes in a number of cell cycle-related genes in brain as well as in lymphocytes from APP/PS1 mice. Moreover, we found enhanced 5'-bromo-2'-deoxyuridine incorporation into DNA in lymphocytes from APP/PS1 mice, and increased expression of the cell proliferation marker proliferating cell nuclear antigen (PCNA), and the cyclin-dependent kinase (CDK) inhibitor Cdkn2a, as detected by immunohistochemistry in cortical neurons of the APP/PS1 mice. Taken together, the cell cycle-related changes in brain and blood cells reported here support the mitosis failure hypothesis in AD and validate the use of peripheral cells as surrogate tissue to study the molecular basis of AD pathogenesis. © 2012 The Authors. European Journal of Neuroscience © 2012 Federation of European Neuroscience Societies and Blackwell Publishing Ltd.
hua Yu, Jing; yu Liu, Chun; bin Zheng, Gui; Zhang, Li Ying; hui Yan, Ming; yan Zhang, Wen; ying Meng, Xian; fang Yu, Xiao
2013-01-01
Objective: PAB induced various cancer cell apoptosis, cell cycle arrest and senescence. But in cell line murine fibrosarcoma L929, PAB did not induce apoptosis, but autophagy, therefore it was thought by us as a good model to research the relationship of cell cycle arrest, autophagy and senescence bypass apoptosis. Methods: Inhibitory ratio was assessed by 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) analysis. Phase contrast microscopy visualized cell morphology. Hoechst 33258 staining for nuclear change, propidium iodode (PI) staining for cell cycle, monodansylcadaverine (MDC) staining for autophagy, and rodanmine 123 staining for mitochondrial membrane potential (MMP) were measured by fluorescence microscopy or flowcytometry. Apoptosis was determined by DNA ladder test. Protein kinase C (PKC) activity was detected by PKC assay kit. SA-β-galactosidase assay was used to detect senescence. Protein expression was examined by western blot. Results: PAB inhibited L929 cell growth in time-and dose-dependent manner. At 12 h, 80 μmol/L PAB induced obvious mitotic arrest; at 24 h, PAB began to induce autophagy; at 36 h, cell-treated with PAB slip into G1 cell cycle; and 3 d PAB induced senescence. In time sequence PAB induced firstly cell cycle arrest, then autophagy, then slippage into G1 phase, lastly senescence. Senescent cells had high level of autophagy, inhibiting autophagy led to apoptosis, and no senescence. PAB activated PKC activity to induce cell cycle arrest, autophagy and senescence, inhibiting PKC activity suppressed cell cycle arrest, autophagy and senescence. Conclusion: PAB induced cell cycle arrest, autophagy and senescence in murine fibrosarcoma L929 cell through PKC. PMID:23630435
Rethinking cell-cycle-dependent gene expression in Schizosaccharomyces pombe.
Cooper, Stephen
2017-11-01
Three studies of gene expression during the division cycle of Schizosaccharomyces pombe led to the proposal that a large number of genes are expressed at particular times during the S. pombe cell cycle. Yet only a small fraction of genes proposed to be expressed in a cell-cycle-dependent manner are reproducible in all three published studies. In addition to reproducibility problems, questions about expression amplitudes, cell-cycle timing of expression, synchronization artifacts, and the problem with methods for synchronizing cells must be considered. These problems and complications prompt the idea that caution should be used before accepting the conclusion that there are a large number of genes expressed in a cell-cycle-dependent manner in S. pombe.
Molecular machinery of signal transduction and cell cycle regulation in Plasmodium.
Koyama, Fernanda C; Chakrabarti, Debopam; Garcia, Célia R S
2009-05-01
The regulation of the Plasmodium cell cycle is not understood. Although the Plasmodium falciparum genome is completely sequenced, about 60% of the predicted proteins share little or no sequence similarity with other eukaryotes. This feature impairs the identification of important proteins participating in the regulation of the cell cycle. There are several open questions that concern cell cycle progression in malaria parasites, including the mechanism by which multiple nuclear divisions is controlled and how the cell cycle is managed in all phases of their complex life cycle. Cell cycle synchrony of the parasite population within the host, as well as the circadian rhythm of proliferation, are striking features of some Plasmodium species, the molecular basis of which remains to be elucidated. In this review we discuss the role of indole-related molecules as signals that modulate the cell cycle in Plasmodium and other eukaryotes, and we also consider the possible role of kinases in the signal transduction and in the responses it triggers.
The Abbreviated Pluripotent Cell Cycle
Kapinas, Kristina; Grandy, Rodrigo; Ghule, Prachi; Medina, Ricardo; Becker, Klaus; Pardee, Arthur; Zaidi, Sayyed K.; Lian, Jane; Stein, Janet; van Wijnen, Andre; Stein, Gary
2013-01-01
Human embryonic stem cells and induced pluripotent stem cells proliferate rapidly and divide symmetrically producing equivalent progeny cells. In contrast, lineage committed cells acquire an extended symmetrical cell cycle. Self-renewal of tissue-specific stem cells is sustained by asymmetric cell division where one progeny cell remains a progenitor while the partner progeny cell exits the cell cycle and differentiates. There are three principal contexts for considering the operation and regulation of the pluripotent cell cycle: temporal, regulatory andstructural. The primary temporal context that the pluripotent self-renewal cell cycle of human embryonic stem cells (hESCs) is a short G1 period without reducing periods of time allocated to S phase, G2, and mitosis. The rules that govern proliferation in hESCs remain to be comprehensively established. However, several lines of evidence suggest a key role for the naïve transcriptome of hESCs, which is competent to stringently regulate the ESC cell cycle. This supports the requirements of pluripotent cells to self propagate while suppressing expression of genes that confer lineage commitment and/or tissue specificity. However, for the first time, we consider unique dimensions to the architectural organization and assembly of regulatory machinery for gene expression in nuclear microenviornments that define parameters of pluripotency. From both fundamental biological and clinical perspectives, understanding control of the abbreviated embryonic stem cell cycle can provide options to coordinate control of proliferation versus differentiation. Wound healing, tissue engineering, and cell-based therapy to mitigate developmental aberrations illustrate applications that benefit from knowledge of the biology of the pluripotent cell cycle. PMID:22552993
Proteomic analysis of the bacterial cell cycle
Grünenfelder, Björn; Rummel, Gabriele; Vohradsky, Jiri; Röder, Daniel; Langen, Hanno; Jenal, Urs
2001-01-01
A global approach was used to analyze protein synthesis and stability during the cell cycle of the bacterium Caulobacter crescentus. Approximately one-fourth (979) of the estimated C. crescentus gene products were detected by two-dimensional gel electrophoresis, 144 of which showed differential cell cycle expression patterns. Eighty-one of these proteins were identified by mass spectrometry and were assigned to a wide variety of functional groups. Pattern analysis revealed that coexpression groups were functionally clustered. A total of 48 proteins were rapidly degraded in the course of one cell cycle. More than half of these unstable proteins were also found to be synthesized in a cell cycle-dependent manner, establishing a strong correlation between rapid protein turnover and the periodicity of the bacterial cell cycle. This is, to our knowledge, the first evidence for a global role of proteolysis in bacterial cell cycle control. PMID:11287652
Zheng, Yingfeng; Murphy, Leigh C.
2016-01-01
Cell cycle progression is tightly controlled by several kinase families including Cyclin-Dependent Kinases, Polo-Like Kinases, and Aurora Kinases. A large amount of data show that steroid hormone receptors and various components of the cell cycle, including cell cycle regulated kinases, interact, and this often results in altered transcriptional activity of the receptor. Furthermore, steroid hormones, through their receptors, can also regulate the transcriptional expression of genes that are required for cell cycle regulation. However, emerging data suggest that steroid hormone receptors may have roles in cell cycle progression independent of their transcriptional activity. The following is a review of how steroid receptors and their coregulators can regulate or be regulated by the cell cycle machinery, with a particular focus on roles independent of transcription in G2/M. PMID:26778927
1996-01-01
Expression of the bcl-2 gene has been shown to effectively confer resistance to programmed cell death under a variety of circumstances. However, despite a wealth of literature describing this phenomenon, very little is known about the mechanism of resistance. In the experiments described here, we show that bcl-2 gene expression can result in an inhibition of cell division cycle progression. These findings are based upon the analysis of cell cycle distribution, cell cycle kinetics, and relative phosphorylation of the retinoblastoma tumor suppressor protein, using primary tissues in vivo, ex vivo, and in vitro, as well as continuous cell lines. The effects of bcl-2 expression on cell cycle progression appear to be focused at the G1 to S phase transition, which is a critical control point in the decision between continued cell cycle progression or the induction programmed cell death. In all systems tested, bcl-2 expression resulted in a substantial 30-60% increase in the length of G1 phase; such an increase is very substantial in the context of other regulators of cell cycle progression. Based upon our findings, and the related findings of others, we propose a mechanism by which bcl-2 expression might exert its well known inhibition of programmed cell death by regulating the kinetics of cell cycle progression at a critical control point. PMID:8642331
Targeted Approaches to Overcoming Endocrine Resistance in Breast Cancer
2011-08-01
NM_001012271 BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog AF053305 CDC20 Cell division cycle 20 homolog BG256659 CDC25B Cell division cycle...by benzimidazoles 1 homolog), BIRC5/ Survivin, CDCA8 (cell division cycle-associated protein 8), AURKB (aurora kinase B), CDC25B (cell division cycle
Circadian clock regulation of the cell cycle in the zebrafish intestine.
Peyric, Elodie; Moore, Helen A; Whitmore, David
2013-01-01
The circadian clock controls cell proliferation in a number of healthy tissues where cell renewal and regeneration are critical for normal physiological function. The intestine is an organ that typically undergoes regular cycles of cell division, differentiation and apoptosis as part of its role in digestion and nutrient absorption. The aim of this study was to explore circadian clock regulation of cell proliferation and cell cycle gene expression in the zebrafish intestine. Here we show that the zebrafish gut contains a directly light-entrainable circadian pacemaker, which regulates the daily timing of mitosis. Furthermore, this intestinal clock controls the expression of key cell cycle regulators, such as cdc2, wee1, p21, PCNA and cdk2, but only weakly influences cyclin B1, cyclin B2 and cyclin E1 expression. Interestingly, food deprivation has little impact on circadian clock function in the gut, but dramatically reduces cell proliferation, as well as cell cycle gene expression in this tissue. Timed feeding under constant dark conditions is able to drive rhythmic expression not only of circadian clock genes, but also of several cell cycle genes, suggesting that food can entrain the clock, as well as the cell cycle in the intestine. Rather surprisingly, we found that timed feeding is critical for high amplitude rhythms in cell cycle gene expression, even when zebrafish are maintained on a light-dark cycle. Together these results suggest that the intestinal clock integrates multiple rhythmic cues, including light and food, to function optimally.
Circadian Clock Regulation of the Cell Cycle in the Zebrafish Intestine
Peyric, Elodie; Moore, Helen A.; Whitmore, David
2013-01-01
The circadian clock controls cell proliferation in a number of healthy tissues where cell renewal and regeneration are critical for normal physiological function. The intestine is an organ that typically undergoes regular cycles of cell division, differentiation and apoptosis as part of its role in digestion and nutrient absorption. The aim of this study was to explore circadian clock regulation of cell proliferation and cell cycle gene expression in the zebrafish intestine. Here we show that the zebrafish gut contains a directly light-entrainable circadian pacemaker, which regulates the daily timing of mitosis. Furthermore, this intestinal clock controls the expression of key cell cycle regulators, such as cdc2, wee1, p21, PCNA and cdk2, but only weakly influences cyclin B1, cyclin B2 and cyclin E1 expression. Interestingly, food deprivation has little impact on circadian clock function in the gut, but dramatically reduces cell proliferation, as well as cell cycle gene expression in this tissue. Timed feeding under constant dark conditions is able to drive rhythmic expression not only of circadian clock genes, but also of several cell cycle genes, suggesting that food can entrain the clock, as well as the cell cycle in the intestine. Rather surprisingly, we found that timed feeding is critical for high amplitude rhythms in cell cycle gene expression, even when zebrafish are maintained on a light-dark cycle. Together these results suggest that the intestinal clock integrates multiple rhythmic cues, including light and food, to function optimally. PMID:24013905
Léger, Karolin; Hopp, Ann-Katrin; Fey, Monika; Hottiger, Michael O
2016-08-02
ADP-ribosylation is involved in a variety of biological processes, many of which are chromatin-dependent and linked to important functions during the cell cycle. However, any study on ADP-ribosylation and the cell cycle faces the problem that synchronization with chemical agents or by serum starvation and subsequent growth factor addition already activates ADP-ribosylation by itself. Here, we investigated the functional contribution of ARTD1 in cell cycle re-entry and G1/S cell cycle progression using T24 urinary bladder carcinoma cells, which synchronously re-enter the cell cycle after splitting without any additional stimuli. In synchronized cells, ARTD1 knockdown, but not inhibition of its enzymatic activity, caused specific down-regulation of cyclin E during cell cycle re-entry and G1/S progression through alterations of the chromatin composition and histone acetylation, but not of other E2F-1 target genes. Although Cdk2 formed a functional complex with the residual cyclin E, p27(Kip 1) protein levels increased in G1 upon ARTD1 knockdown most likely due to inappropriate cyclin E-Cdk2-induced phosphorylation-dependent degradation, leading to decelerated G1/S progression. These results provide evidence that ARTD1 regulates cell cycle re-entry and G1/S progression via cyclin E expression and p27(Kip 1) stability independently of its enzymatic activity, uncovering a novel cell cycle regulatory mechanism.
JavanMoghadam, Sonia; Weihua, Zhang; Hunt, Kelly K.; Keyomarsi, Khandan
2016-01-01
ABSTRACT Estrogen receptor alpha (ERα) has been implicated in several cell cycle regulatory events and is an important predictive marker of disease outcome in breast cancer patients. Here, we aimed to elucidate the mechanism through which ERα influences proliferation in breast cancer cells. Our results show that ERα protein is cell cycle-regulated in human breast cancer cells and that the presence of 17-β-estradiol (E2) in the culture medium shortened the cell cycle significantly (by 4.5 hours, P < 0.05) compared with unliganded conditions. The alterations in cell cycle duration were observed in the S and G2/M phases, whereas the G1 phase was indistinguishable under liganded and unliganded conditions. In addition, ERα knockdown in MCF-7 cells accelerated mitotic exit, whereas transfection of ERα-negative MDA-MB-231 cells with exogenous ERα significantly shortened the S and G2/M phases (by 9.1 hours, P < 0.05) compared with parental cells. Finally, treatment of MCF-7 cells with antiestrogens revealed that tamoxifen yields a slower cell cycle progression through the S and G2/M phases than fulvestrant does, presumably because of the destabilizing effect of fulvestrant on ERα protein. Together, these results show that ERα modulates breast cancer cell proliferation by regulating events during the S and G2/M phases of the cell cycle in a ligand-dependent fashion. These results provide the rationale for an effective treatment strategy that includes a cell cycle inhibitor in combination with a drug that lowers estrogen levels, such as an aromatase inhibitor, and an antiestrogen that does not result in the degradation of ERα, such as tamoxifen. PMID:27049344
JavanMoghadam, Sonia; Weihua, Zhang; Hunt, Kelly K; Keyomarsi, Khandan
2016-06-17
Estrogen receptor alpha (ERα) has been implicated in several cell cycle regulatory events and is an important predictive marker of disease outcome in breast cancer patients. Here, we aimed to elucidate the mechanism through which ERα influences proliferation in breast cancer cells. Our results show that ERα protein is cell cycle-regulated in human breast cancer cells and that the presence of 17-β-estradiol (E2) in the culture medium shortened the cell cycle significantly (by 4.5 hours, P < 0.05) compared with unliganded conditions. The alterations in cell cycle duration were observed in the S and G2/M phases, whereas the G1 phase was indistinguishable under liganded and unliganded conditions. In addition, ERα knockdown in MCF-7 cells accelerated mitotic exit, whereas transfection of ERα-negative MDA-MB-231 cells with exogenous ERα significantly shortened the S and G2/M phases (by 9.1 hours, P < 0.05) compared with parental cells. Finally, treatment of MCF-7 cells with antiestrogens revealed that tamoxifen yields a slower cell cycle progression through the S and G2/M phases than fulvestrant does, presumably because of the destabilizing effect of fulvestrant on ERα protein. Together, these results show that ERα modulates breast cancer cell proliferation by regulating events during the S and G2/M phases of the cell cycle in a ligand-dependent fashion. These results provide the rationale for an effective treatment strategy that includes a cell cycle inhibitor in combination with a drug that lowers estrogen levels, such as an aromatase inhibitor, and an antiestrogen that does not result in the degradation of ERα, such as tamoxifen.
High-throughput synchronization of mammalian cell cultures by spiral microfluidics.
Lee, Wong Cheng; Bhagat, Ali Asgar S; Lim, Chwee Teck
2014-01-01
The development of mammalian cell cycle synchronization techniques has greatly advanced our understanding of many cellular regulatory events and mechanisms specific to different phases of the cell cycle. In this chapter, we describe a high-throughput microfluidic-based approach for cell cycle synchronization. By exploiting the relationship between cell size and its phase in the cell cycle, large numbers of synchronized cells can be obtained by size fractionation in a spiral microfluidic channel. Protocols for the synchronization of primary cells such as mesenchymal stem cells, and immortal cell lines such as Chinese hamster ovarian cells (CHO-CD36) and HeLa cells are provided as examples.
Sanchez-Alvarez, Miguel; Zhang, Qifeng; Finger, Fabian; Wakelam, Michael J. O.; Bakal, Chris
2015-01-01
We show that phospholipid anabolism does not occur uniformly during the metazoan cell cycle. Transition to S-phase is required for optimal mobilization of lipid precursors, synthesis of specific phospholipid species and endoplasmic reticulum (ER) homeostasis. Average changes observed in whole-cell phospholipid composition, and total ER lipid content, upon stimulation of cell growth can be explained by the cell cycle distribution of the population. TORC1 promotes phospholipid anabolism by slowing S/G2 progression. The cell cycle stage-specific nature of lipid biogenesis is dependent on p53. We propose that coupling lipid metabolism to cell cycle progression is a means by which cells have evolved to coordinate proliferation with cell and organelle growth. PMID:26333836
Sanchez-Alvarez, Miguel; Zhang, Qifeng; Finger, Fabian; Wakelam, Michael J O; Bakal, Chris
2015-09-01
We show that phospholipid anabolism does not occur uniformly during the metazoan cell cycle. Transition to S-phase is required for optimal mobilization of lipid precursors, synthesis of specific phospholipid species and endoplasmic reticulum (ER) homeostasis. Average changes observed in whole-cell phospholipid composition, and total ER lipid content, upon stimulation of cell growth can be explained by the cell cycle distribution of the population. TORC1 promotes phospholipid anabolism by slowing S/G2 progression. The cell cycle stage-specific nature of lipid biogenesis is dependent on p53. We propose that coupling lipid metabolism to cell cycle progression is a means by which cells have evolved to coordinate proliferation with cell and organelle growth. © 2015 The Authors.
Ruijtenberg, Suzan; van den Heuvel, Sander
2016-01-01
ABSTRACT Cell proliferation and differentiation show a remarkable inverse relationship. Precursor cells continue division before acquiring a fully differentiated state, while terminal differentiation usually coincides with proliferation arrest and permanent exit from the division cycle. Mechanistic insight in the temporal coordination between cell cycle exit and differentiation has come from studies of cells in culture and genetic animal models. As initially described for skeletal muscle differentiation, temporal coordination involves mutual antagonism between cyclin-dependent kinases that promote cell cycle entry and transcription factors that induce tissue-specific gene expression. Recent insights highlight the contribution of chromatin-regulating complexes that act in conjunction with the transcription factors and determine their activity. In particular SWI/SNF chromatin remodelers contribute to dual regulation of cell cycle and tissue-specific gene expression during terminal differentiation. We review the concerted regulation of the cell cycle and cell type-specific transcription, and discuss common mutations in human cancer that emphasize the clinical importance of proliferation versus differentiation control. PMID:26825227
NASA Astrophysics Data System (ADS)
Lipman, Timothy E.
2011-11-01
Electric vehicles (EVs) of various types are experiencing a commercial renaissance but of uncertain ultimate success. Many new electric-drive models are being introduced by different automakers with significant technical improvements from earlier models, particularly with regard to further refinement of drivetrain systems and important improvements in battery and fuel cell systems. The various types of hybrid and all-electric vehicles can offer significant greenhouse gas (GHG) reductions when compared to conventional vehicles on a full fuel-cycle basis. In fact, most EVs used under most condition are expected to significantly reduce lifecycle GHG emissions. This paper reviews the current technology status of EVs and compares various estimates of their potential to reduce GHGs on a fuel cycle basis. In general, various studies show that battery powered EVs reduce GHGs by a widely disparate amount depending on the type of powerplant used and the particular region involved, among other factors. Reductions typical of the United States would be on the order of 20-50%, depending on the relative level of coal versus natural gas and renewables in the powerplant feedstock mix. However, much deeper reductions of over 90% are possible for battery EVs running on renewable or nuclear power sources. Plug-in hybrid vehicles running on gasoline can reduce emissions by 20-60%, and fuel cell EV reduce GHGs by 30-50% when running on natural gas-derived hydrogen and up to 95% or more when the hydrogen is made (and potentially compressed) using renewable feedstocks. These are all in comparison to what is usually assumed to be a more advanced gasoline vehicle "baseline" of comparison, with some incremental improvements by 2020 or 2030. Thus, the emissions from all of these EV types are highly variable depending on the details of how the electric fuel or hydrogen is produced.
Khan, Iftekhar; Morris, Stephen; Hackshaw, Allan; Lee, Siow-Ming
2015-01-01
Objective To assess the cost-effectiveness of erlotinib versus supportive care (placebo) overall and within a predefined rash subgroup in elderly patients with advanced non-small-cell lung cancer who are unfit for chemotherapy and receive only active supportive care due to their poor performance status or presence of comorbidities. Setting Between 2005 and 2009, a total of 670 patients with non-small cell lung cancer (NSCLC) were randomised across 78 hospital sites (centres) in the UK. Participants 670 patients with pathologically confirmed stage IIIb-IV NSCLC, unfit for chemotherapy, predominantly poor performance status (>2 on Eastern Cooperative Oncology Group, ECOG) and estimated life expectancy of at least 8 weeks. Patients were followed until disease progression or death, including a subgroup of patients who developed first cycle rash. Interventions Patients were randomised (1:1) to receive best supportive care plus oral placebo or erlotinib (150 mg/day) until disease progression, toxicity or death. Primary outcome Overall survival (OS). Secondary outcomes Progression-free survival (PFS), tumour response and quality adjusted life years (QALY), including within prespecified subgroups. Results The mean incremental cost per QALY in all patients was £202 571/QALY. The probability of cost-effectiveness of erlotinib in all patients was <10% at thresholds up to £100 000. However, within the rash subgroup, the incremental cost/QALY was £56 770/QALY with a probability of cost-effectiveness of about 80% for cost-effectiveness thresholds between £50 000 to £60 000. Conclusions Erlotinib has about 80% chance of being cost-effective at thresholds between £50 000–£60 000 in a subset of elderly poor performance patients with NSCLC unfit for chemotherapy who develop first cycle (28 days) rash. Erlotinib is potentially cost-effective for this population, for which few treatment options apart from best supportive care are available. Trial registration number (ISCRTN): 77383050. PMID:26137881
Redox Changes During the Cell Cycle in the Embryonic Root Meristem of Arabidopsis thaliana.
de Simone, Ambra; Hubbard, Rachel; de la Torre, Natanael Viñegra; Velappan, Yazhini; Wilson, Michael; Considine, Michael J; Soppe, Wim J J; Foyer, Christine H
2017-12-20
The aim of this study was to characterize redox changes in the nuclei and cytosol occurring during the mitotic cell cycle in the embryonic roots of germinating Arabidopsis seedlings, and to determine how redox cycling was modified in mutants with a decreased capacity for ascorbate synthesis. Using an in vivo reduction-oxidation (redox) reporter (roGFP2), we show that transient oxidation of the cytosol and the nuclei occurred at G1 in the synchronized dividing cells of the Arabidopsis root apical meristem, with reduction at G2 and mitosis. This redox cycle was absent from low ascorbate mutants in which nuclei were significantly more oxidized than controls. The cell cycle-dependent increase in nuclear size was impaired in the ascorbate-deficient mutants, which had fewer cells per unit area in the root proliferation zone. The transcript profile of the dry seeds and size of the imbibed seeds was strongly influenced by low ascorbate but germination, dormancy release and seed aging characteristics were unaffected. These data demonstrate the presence of a redox cycle within the plant cell cycle and that the redox state of the nuclei is an important factor in cell cycle progression. Controlled oxidation is a key feature of the early stages of the plant cell cycle. However, sustained mild oxidation restricts nuclear functions and impairs progression through the cell cycle leading to fewer cells in the root apical meristem. Antioxid. Redox Signal. 27, 1505-1519.
Mungun, Harr-Keshauve; Li, Shuzhen; Zhang, Yue; Huang, Songming; Jia, Zhanjun; Ding, Guixia; Zhang, Aihua
2018-01-01
Dihydroartemisinin (DHA) is a semisynthetic derivative of artemisinin and has been used as an antimalarial drug. Recently, roles of artemisinin and its derivatives in treating diseases besides antimalarial effect were documented. Thus, this study was undertaken to investigate the role of DHA in indoxyl sulfate (IS)-promoted cell cycle progression in glomerular mesangial cells, as well as the potential mechanisms. Under the basal condition, DHA significantly retarded the cell cycle progression as shown by decreased cell percentage in S phase and increased cell percentage in G1/G0 phases in line with reduced cell cycle proteins cyclin A2 and cyclin D1. Interestingly, DHA also inactivated the COX-2/mPGES-1/PGE 2 cascade which has been shown to play a critical role in promoting the mesangial cell cycle progression by our previous studies. Next, we investigated the role of DHA in IS-triggered cell cycle progression in this mesangial cell line. As expected, DHA treatment significantly retarded IS-induced cell cycle progression and inhibited the activation of COX-2/mPGES-1/PGE 2 cascade induced by IS. In summary, these data indicated that DHA inhibited the cell cycle progression in glomerular mesangial cells under normal condition or IS challenge possibly through the inhibition of COX-2/mPGES-1/PGE 2 cascade, suggesting a potential of DHA in treating glomerular diseases with mesangial cell proliferation.
Functional kinomics identifies candidate therapeutic targets in head and neck cancer
Moser, Russell; Xu, Chang; Kao, Michael; Annis, James; Lerma, Luisa Angelica; Schaupp, Christopher M.; Gurley, Kay E.; Jang, In Sock; Biktasova, Asel; Yarbrough, Wendell G.; Margolin, Adam A.; Grandori, Carla; Kemp, Christopher J.; Méndez, Eduardo
2014-01-01
Purpose To identify novel therapeutic drug targets for p53 mutant head and neck squamous cell carcinoma (HNSCC). Experimental Design RNAi kinome viability screens were performed on HNSCC cells including autologous pairs from primary tumor and recurrent/metastatic lesions, and in parallel on murine squamous cell carcinoma (MSCC) cells derived from tumors of inbred mice bearing germline mutations in Trp53, and p53 regulatory genes: Atm, Prkdc, and p19Arf. Cross-species analysis of cell lines stratified by p53 mutational status and metastatic phenotype was utilized to select 38 kinase targets. Both primary and secondary RNAi validation assays were performed on additional HNSCC cell lines to credential these kinase targets utilizing multiple phenotypic endpoints. Kinase targets were also examined via chemical inhibition utilizing a panel of kinase inhibitors. A preclinical study was conducted on the WEE1 kinase inhibitor, MK-1775. Results Our functional kinomics approach identified novel survival kinases in HNSCC involved in G2/M cell cycle checkpoint, SFK, PI3K and FAK pathways. RNAi mediated knockdown and chemical inhibition of the WEE1 kinase with a specific inhibitor, MK-1775, had a significant effect on both viability and apoptosis. Sensitivity to the MK-1775 kinase inhibitor is in part determined by p53 mutational status, and due to unscheduled mitotic entry. MK-1775 displays single-agent activity and potentiates the efficacy of cisplatin in a p53 mutant HNSCC xenograft model. Conclusions WEE1 kinase is a potential therapeutic drug target for HNSCC. This study supports the application of a functional kinomics strategy to identify novel therapeutic targets for cancer. PMID:25125259
Functional kinomics identifies candidate therapeutic targets in head and neck cancer.
Moser, Russell; Xu, Chang; Kao, Michael; Annis, James; Lerma, Luisa Angelica; Schaupp, Christopher M; Gurley, Kay E; Jang, In Sock; Biktasova, Asel; Yarbrough, Wendell G; Margolin, Adam A; Grandori, Carla; Kemp, Christopher J; Méndez, Eduardo
2014-08-15
To identify novel therapeutic drug targets for p53-mutant head and neck squamous cell carcinoma (HNSCC). RNAi kinome viability screens were performed on HNSCC cells, including autologous pairs from primary tumor and recurrent/metastatic lesions, and in parallel on murine squamous cell carcinoma (MSCC) cells derived from tumors of inbred mice bearing germline mutations in Trp53, and p53 regulatory genes: Atm, Prkdc, and p19(Arf). Cross-species analysis of cell lines stratified by p53 mutational status and metastatic phenotype was used to select 38 kinase targets. Both primary and secondary RNAi validation assays were performed on additional HNSCC cell lines to credential these kinase targets using multiple phenotypic endpoints. Kinase targets were also examined via chemical inhibition using a panel of kinase inhibitors. A preclinical study was conducted on the WEE1 kinase inhibitor, MK-1775. Our functional kinomics approach identified novel survival kinases in HNSCC involved in G2-M cell-cycle checkpoint, SFK, PI3K, and FAK pathways. RNAi-mediated knockdown and chemical inhibition of the WEE1 kinase with a specific inhibitor, MK-1775, had a significant effect on both viability and apoptosis. Sensitivity to the MK-1775 kinase inhibitor is in part determined by p53 mutational status, and due to unscheduled mitotic entry. MK-1775 displays single-agent activity and potentiates the efficacy of cisplatin in a p53-mutant HNSCC xenograft model. WEE1 kinase is a potential therapeutic drug target for HNSCC. This study supports the application of a functional kinomics strategy to identify novel therapeutic targets for cancer. ©2014 American Association for Cancer Research.
Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H
1997-05-01
To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P < 0.05). Apoptotic cells were identified from routinely stained sections and by terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P < 0.05). The proliferating cell nuclear antigen index, defined similarly to the TI, was 56.4 +/- 16.3% in category A, and it was significantly higher than that in category B (P < 0.05). The immunohistochemically detected expression of p21CIP1/WAP1 did not differ between the two categories, while Bax-positive tumor cells were more frequently detected in category A. These results indicate that (1) expression of a mutated p53 gene attenuates apoptotic cell death of gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.
A genome-wide resource of cell cycle and cell shape genes of fission yeast
Hayles, Jacqueline; Wood, Valerie; Jeffery, Linda; Hoe, Kwang-Lae; Kim, Dong-Uk; Park, Han-Oh; Salas-Pino, Silvia; Heichinger, Christian; Nurse, Paul
2013-01-01
To identify near complete sets of genes required for the cell cycle and cell shape, we have visually screened a genome-wide gene deletion library of 4843 fission yeast deletion mutants (95.7% of total protein encoding genes) for their effects on these processes. A total of 513 genes have been identified as being required for cell cycle progression, 276 of which have not been previously described as cell cycle genes. Deletions of a further 333 genes lead to specific alterations in cell shape and another 524 genes result in generally misshapen cells. Here, we provide the first eukaryotic resource of gene deletions, which describes a near genome-wide set of genes required for the cell cycle and cell shape. PMID:23697806
Systems-level feedback regulation of cell cycle transitions in Ostreococcus tauri.
Kapuy, Orsolya; Vinod, P K; Bánhegyi, Gábor; Novák, Béla
2018-05-01
Ostreococcus tauri is the smallest free-living unicellular organism with one copy of each core cell cycle genes in its genome. There is a growing interest in this green algae due to its evolutionary origin. Since O. tauri is diverged early in the green lineage, relatively close to the ancestral eukaryotic cell, it might hold a key phylogenetic position in the eukaryotic tree of life. In this study, we focus on the regulatory network of its cell division cycle. We propose a mathematical modelling framework to integrate the existing knowledge of cell cycle network of O. tauri. We observe that feedback loop regulation of both G1/S and G2/M transitions in O. tauri is conserved, which can make the transition bistable. This is essential to make the transition irreversible as shown in other eukaryotic organisms. By performing sequence analysis, we also predict the presence of the Greatwall/PP2A pathway in the cell cycle of O. tauri. Since O. tauri cell cycle machinery is conserved, the exploration of the dynamical characteristic of the cell division cycle will help in further understanding the regulation of cell cycle in higher eukaryotes. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Revealing the cellular localization of STAT1 during the cell cycle by super-resolution imaging
Gao, Jing; Wang, Feng; Liu, Yanhou; Cai, Mingjun; Xu, Haijiao; Jiang, Junguang; Wang, Hongda
2015-01-01
Signal transducers and activators of transcription (STATs) can transduce cytokine signals and regulate gene expression. The cellular localization and nuclear trafficking of STAT1, a representative of the STAT family with multiple transcriptional functions, is tightly related with transcription process, which usually happens in the interphase of the cell cycle. However, these priority questions regarding STAT1 distribution and localization at the different cell-cycle stages remain unclear. By using direct stochastic optical reconstruction microscopy (dSTORM), we found that the nuclear expression level of STAT1 increased gradually as the cell cycle carried out, especially after EGF stimulation. Furthermore, STAT1 formed clusters in the whole cell during the cell cycle, with the size and the number of clusters also increasing significantly from G1 to G2 phase, suggesting that transcription and other cell-cycle related activities can promote STAT1 to form more and larger clusters for fast response to signals. Our work reveals that the cellular localization and clustering distribution of STAT1 are associated with the cell cycle, and further provides an insight into the mechanism of cell-cycle regulated STAT1 signal transduction. PMID:25762114
Serial Charging Test on High Capacity Li-Ion Cells for the Orbiter Advanced Hydraulic Power System
NASA Technical Reports Server (NTRS)
Jeevarajan, Judith A.; Irlbeck, Brad
2006-01-01
Although it looks like module level voltage drives the cutoff for charge, the actual cutoff is due to unbalanced cell voltages that drive the module voltage up. Individual cell voltage drives the cutoff for discharge Low resistance cells are the first to reach the low-voltage cutoff Cell-to-Cell voltage differences are generally small and show similar trends for each cycle Increase for a distinct window during charge and at the end of discharge Increase in max to min cell voltage difference with time/cycles Decrease in max to min cell voltage difference during high current pulses with time/cycles Individual cell voltage trends (with respect to other cells) are very repeatable from cycle to cycle, although voltage slowly degrades with time/cycles (resistance growth) Much more difference observed near end of discharge Little change in order of cell voltage (cell with highest voltage to cell with lowest voltage) Temp sensor on the side of cell (between 2 cells) shows much greater rise during discharge than for single cell tests (18 C vs 5 C) Conclusion: Serial Charging of this string of cells is feasible as it has only a minor impact on useful capacity
Cell cycle gene expression networks discovered using systems biology: Significance in carcinogenesis
Scott, RE; Ghule, PN; Stein, JL; Stein, GS
2015-01-01
The early stages of carcinogenesis are linked to defects in the cell cycle. A series of cell cycle checkpoints are involved in this process. The G1/S checkpoint that serves to integrate the control of cell proliferation and differentiation is linked to carcinogenesis and the mitotic spindle checkpoint with the development of chromosomal instability. This paper presents the outcome of systems biology studies designed to evaluate if networks of covariate cell cycle gene transcripts exist in proliferative mammalian tissues including mice, rats and humans. The GeneNetwork website that contains numerous gene expression datasets from different species, sexes and tissues represents the foundational resource for these studies (www.genenetwork.org). In addition, WebGestalt, a gene ontology tool, facilitated the identification of expression networks of genes that co-vary with key cell cycle targets, especially Cdc20 and Plk1 (www.bioinfo.vanderbilt.edu/webgestalt). Cell cycle expression networks of such covariate mRNAs exist in multiple proliferative tissues including liver, lung, pituitary, adipose and lymphoid tissues among others but not in brain or retina that have low proliferative potential. Sixty-three covariate cell cycle gene transcripts (mRNAs) compose the average cell cycle network with p = e−13 to e−36. Cell cycle expression networks show species, sex and tissue variability and they are enriched in mRNA transcripts associated with mitosis many of which are associated with chromosomal instability. PMID:25808367
Sun, Pei; Wu, Haoyang; Huang, Jiali; Xu, Ying; Yang, Feng; Zhang, Qi; Xu, Xingang
2018-05-22
Porcine epidemic diarrhea virus (PEDV), an enteropathogenic Alphacoronavirus, has caused enormous economic losses in the swine industry. p53 protein exists in a wide variety of animal cells, which is involved in cell cycle regulation, apoptosis, cell differentiation and other biological functions. In this study, we investigated the effects of PEDV infection on the cell cycle of Vero cells and p53 activation. The results demonstrated that PEDV infection induces cell cycle arrest at G0/G1 phase in Vero cells, while UV-inactivated PEDV does not cause cell cycle arrest. PEDV infection up-regulates the levels of p21, cdc2, cdk2, cdk4, Cyclin A protein and down-regulates Cyclin E protein. Further research results showed that inhibition of p53 signaling pathway can reverse the cell cycle arrest in G0/G1 phase induced by PEDV infection and cancel out the up-regulation of p21 and corresponding Cyclin/cdk mentioned above. In addition, PEDV infection of the cells synchronized in various stages of cell cycle showed that viral subgenomic RNA and virus titer were higher in the cells released from G0/G1 phase synchronized cells than that in the cells released from the G1/S phase and G2/M phase synchronized or asynchronous cells after 18 h p.i.. This is the first report to demonstrate that the p53-dependent pathway plays an important role in PEDV induced cell cycle arrest and beneficially contributes to viral infection. Copyright © 2018 Elsevier B.V. All rights reserved.
Miao, Xin; Koch, Gilbert; Ait-Oudhia, Sihem; Straubinger, Robert M.; Jusko, William J.
2016-01-01
Combinations of gemcitabine and trabectedin exert modest synergistic cytotoxic effects on two pancreatic cancer cell lines. Here, systems pharmacodynamic (PD) models that integrate cellular response data and extend a prototype model framework were developed to characterize dynamic changes in cell cycle phases of cancer cell subpopulations in response to gemcitabine and trabectedin as single agents and in combination. Extensive experimental data were obtained for two pancreatic cancer cell lines (MiaPaCa-2 and BxPC-3), including cell proliferation rates over 0–120 h of drug exposure, and the fraction of cells in different cell cycle phases or apoptosis. Cell cycle analysis demonstrated that gemcitabine induced cell cycle arrest in S phase, and trabectedin induced transient cell cycle arrest in S phase that progressed to G2/M phase. Over time, cells in the control group accumulated in G0/G1 phase. Systems cell cycle models were developed based on observed mechanisms and were used to characterize both cell proliferation and cell numbers in the sub G1, G0/G1, S, and G2/M phases in the control and drug-treated groups. The proposed mathematical models captured well both single and joint effects of gemcitabine and trabectedin. Interaction parameters were applied to quantify unexplainable drug-drug interaction effects on cell cycle arrest in S phase and in inducing apoptosis. The developed models were able to identify and quantify the different underlying interactions between gemcitabine and trabectedin, and captured well our large datasets in the dimensions of time, drug concentrations, and cellular subpopulations. PMID:27895579
NASA Technical Reports Server (NTRS)
Callender, E. David; Steinbacher, Jody
1989-01-01
This is the fifth of five volumes on Information System Life-Cycle and Documentation Standards. This volume provides a well organized, easily used standard for management control and status reports used in monitoring and controlling the management, development, and assurance of informations systems and software, hardware, and operational procedures components, and related processes.
Nowak, A K; Cook, A M; McDonnell, A M; Millward, M J; Creaney, J; Francis, R J; Hasani, A; Segal, A; Musk, A W; Turlach, B A; McCoy, M J; Robinson, B W S; Lake, R A
2015-12-01
Data from murine models suggest that CD40 activation may synergize with cytotoxic chemotherapy. We aimed to determine the maximum tolerated dose (MTD) and toxicity profile and to explore immunological biomarkers of the CD40-activating antibody CP-870,893 with cisplatin and pemetrexed in patients with malignant pleural mesothelioma (MPM). Eligible patients had confirmed MPM, ECOG performance status 0-1, and measurable disease. Patients received cisplatin 75 mg/m(2) and pemetrexed 500 mg/m(2) on day 1 and CP-870,893 on day 8 of a 21-day cycle for maximum 6 cycles with up to 6 subsequent cycles single-agent CP-870,893. Immune cell subset changes were examined weekly by flow cytometry. Fifteen patients were treated at three dose levels. The MTD of CP-870,893 was 0.15 mg/kg, and was exceeded at 0.2 mg/kg with one grade 4 splenic infarction and one grade 3 confusion and hyponatraemia. Cytokine release syndrome (CRS) occurred in most patients (80%) following CP-870,893. Haematological toxicities were consistent with cisplatin and pemetrexed chemotherapy. Six partial responses (40%) and 9 stable disease (53%) as best response were observed. The median overall survival was 16.5 months; the median progression-free survival was 6.3 months. Three patients survived beyond 30 months. CD19+ B cells decreased over 6 cycles of chemoimmunotherapy (P < 0.001) with a concomitant increase in the proportion of CD27+ memory B cells (P < 0.001) and activated CD86+CD27+ memory B cells (P < 0.001), as an immunopharmacodynamic marker of CD40 activation. CP-870,893 with cisplatin and pemetrexed is safe and tolerable at 0.15 mg/kg, although most patients experience CRS. While objective response rates are similar to chemotherapy alone, three patients achieved long-term survival. ACTRN12609000294257. © The Author 2015. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Nickel-iron battery system safety
NASA Technical Reports Server (NTRS)
Saltat, R. C.
1984-01-01
The generated flow rates of gaseous hydrogen and gaseous oxygen from an electrical vehicle nickel-iron battery system were determined and used to evaluate the flame quenching capabilities of several candidate devices to prevent flame propagation within batteries having central watering/venting systems. The battery generated hydrogen and oxygen gases were measured for a complete charge and discharge cycle. The data correlates well with accepted theory during strong overcharge conditions indicating that the measurements are valid for other portions of the cycle. Tests confirm that the gas mixture in the cells is always flammable regardless of the battery status. The literature indicated that a conventional flame arrestor would not be effective over the broad spectrum of gassing conditions presented by a nickel-iron battery. Four different types of protective devices were evaluated. A foam-metal arrestor design was successful in quenching gaseous hydrogen and gaseous oxygen flames, however; the application of this flame arrestor to individual cell or module protection in a battery is problematic. A possible rearrangement of the watering/venting system to accept the partial protection of simple one-way valves is presented which, in combination with the successful foam-metal arrestor as main vent protection, could result in a significant improvement in battery protection.
Cell cycle pathway dysregulation in human keratinocytes during chronic exposure to low arsenite.
Al-Eryani, Laila; Waigel, Sabine; Jala, Venkatakrishna; Jenkins, Samantha F; States, J Christopher
2017-09-15
Arsenic is naturally prevalent in the earth's crust and widely distributed in air and water. Chronic low arsenic exposure is associated with several cancers in vivo, including skin cancer, and with transformation in vitro of cell lines including immortalized human keratinocytes (HaCaT). Arsenic also is associated with cell cycle dysregulation at different exposure levels in multiple cell lines. In this work, we analyzed gene expression in HaCaT cells to gain an understanding of gene expression changes contributing to transformation at an early time point. HaCaT cells were exposed to 0 or 100nM NaAsO 2 for 7weeks. Total RNA was purified and analyzed by microarray hybridization. Differential expression with fold change≥|1.5| and p-value≤0.05 was determined using Partek Genomic Suite™ and pathway and network analyses using MetaCore™ software (FDR≤0.05). Cell cycle analysis was performed using flow cytometry. 644 mRNAs were differentially expressed. Cell cycle/cell cycle regulation pathways predominated in the list of dysregulated pathways. Genes involved in replication origin licensing were enriched in the network. Cell cycle assay analysis showed an increase in G2/M compartment in arsenite-exposed cells. Arsenite exposure induced differential gene expression indicating dysregulation of cell cycle control, which was confirmed by cell cycle analysis. The results suggest that cell cycle dysregulation is an early event in transformation manifested in cells unable to transit G2/M efficiently. Further study at later time points will reveal additional changes in gene expression related to transformation processes. Copyright © 2017 Elsevier Inc. All rights reserved.
Kikuchi, Hidetomo; Yuan, Bo; Yuhara, Eisuke; Imai, Masahiko; Furutani, Ryota; Fukushima, Shin; Hazama, Shingo; Hirobe, Chieko; Ohyama, Kunio; Takagi, Norio; Toyoda, Hiroo
2014-08-01
We have demonstrated that an extract from the ripe fruit of Vitex angus-castus (Vitex), might be a promising anticancer candidate. In order to further provide a molecular rationale for clinical development in anticancer therapy, a detailed mechanism underlying the efficacy of Vitex against HL-60 cells was investigated. Vitex induced a dose- and time-dependent decrease in cell viability associated with induction of apoptosis and G(2)/M cell cycle arrest, both of which were suppressed by the addition of SB203580, an inhibitor for p38 MAPK. Furthermore, SB203580 significantly suppressed Vitex-induced phosphorylation of histone H3, a downstream molecule of p38 MAPK known to be involved in apoptosis induction in tumor cells. Notably, Vitex induced upregulation of intracellular ATP, known to bind its binding pocket inside activated p38 MAPK and to be required for the activation of p38 MAPK pathway. These results, thus, suggest that upregulation of intracellular ATP and phosphorylation of histone H3 are closely associated with the activation of p38 MAPK pathway, consequently contributing to Vitex-mediated cytotoxicity. Intriguingly, a significant decrease of intracellular ROS levels and downregulation of expression level of gp91(phox), an important component of NADPH oxidase, were observed in Vitex-treated cells. A greater decline in ROS levels along with enhanced apoptosis was observed after treatment with Vitex in combination with SnPP, an inhibitor specific for HO-1. Since NADPH oxidase and HO-1 are closely correlated to redox status associated with intracellular ROS levels, the two enzymes are suggested to be implicated in Vitex-mediated cytotoxicity in HL-60 cells by regulating ROS generation. We also suggest that activation of the p38 MAPK pathway may be dependent on the alterations of intracellular ATP levels, rather than that of intracellular ROS levels. These results may have important implications for appropriate clinical uses of Vitex and provide novel insights into the interaction between Vitex and other conventional drugs capable of affecting intracellular redox status.
NASA Astrophysics Data System (ADS)
Armitage, Mark
Ionizing radiation can have several different effects on cells, some are almost instantaneous such as the generation of DNA damage, other cellular responses take a matter of minutes or hours - DNA repair protein induction/activation, and others may take months or even years to be manifested - carcinogenesis. Human epithelial cell lines derived from both normal, non-neoplastic tissues and from a malignant source were cultured in order to examine several effects of ionizing radiation on such cell types. Cells not from a malignant source were previously immortalized by viral infection or by transfection with viral sequences. Simian virus 40 immortalised uroepithelial cells (SV-HUC) were found to be approximately a factor of two fold more radioresistant than cells of malignant origin (T24) in terms of unrepaired clastogenic damage i.e. assessment of micronuclei levels following irradiation. SV-HUC lines unlike T24 cells are non-tumourigenic when inoculated into nude athymic mice. SV-HUC lines proved very resistant to full oncogenic transformation using radiation and chemical carcinogens. However, morphological alterations and decreased anchorage dependant growth was observed in post carcinogen treated cells after appropriate cell culture conditions were utilized. The progression from this phenotype to a fully tumourigenic one was not recorded in this study. The ability of ionizing radiation to induce increased levels of the nuclear phosphoprotein p53 was also assessed using several different cell lines. SV- HUC and T24 cell lines failed to exhibit any increased p53 stabilization following irradiation. One cell line, a human papilloma virus transformed line (HPV) did show an approximate two fold increase of the wild type p53 protein after treatment with radiation. Only the cell line HPV showed any cell cycle delay, resulting in accumulation of cells in the G2/M compartment in post irradiation cell cycle analysis. The status of p53 was also assessed i.e. wild type or mutant conformation in all the above cells lines and two other control lines HOS (a human osteosarcoma cell line) and H Tori-3 (SV40 immortalised thyroid epithelial cells).
Architecture and inherent robustness of a bacterial cell-cycle control system.
Shen, Xiling; Collier, Justine; Dill, David; Shapiro, Lucy; Horowitz, Mark; McAdams, Harley H
2008-08-12
A closed-loop control system drives progression of the coupled stalked and swarmer cell cycles of the bacterium Caulobacter crescentus in a near-mechanical step-like fashion. The cell-cycle control has a cyclical genetic circuit composed of four regulatory proteins with tight coupling to processive chromosome replication and cell division subsystems. We report a hybrid simulation of the coupled cell-cycle control system, including asymmetric cell division and responses to external starvation signals, that replicates mRNA and protein concentration patterns and is consistent with observed mutant phenotypes. An asynchronous sequential digital circuit model equivalent to the validated simulation model was created. Formal model-checking analysis of the digital circuit showed that the cell-cycle control is robust to intrinsic stochastic variations in reaction rates and nutrient supply, and that it reliably stops and restarts to accommodate nutrient starvation. Model checking also showed that mechanisms involving methylation-state changes in regulatory promoter regions during DNA replication increase the robustness of the cell-cycle control. The hybrid cell-cycle simulation implementation is inherently extensible and provides a promising approach for development of whole-cell behavioral models that can replicate the observed functionality of the cell and its responses to changing environmental conditions.
Differential responses of EGFR-/AGT-expressing cells to the "combi-triazene" SMA41.
Matheson, Stephanie L; McNamee, James P; Jean-Claude, Bertrand J
2003-01-01
Previous studies have demonstrated enhanced potency associated with the binary [DNA/epidermal growth factor receptor (EGFR)] targeting properties of SMA41 (a chimeric 3-(alkyl)-1,2,3-triazene linked to a 4-anilinoquinazoline backbone) in the A431 (epidermal carcinoma of the vulva) cell line. We now report on the dependence of its antiproliferative effects (e.g. DNA damage, cell survival) on the EGFR and the DNA repair protein O6-alkylguanine DNA alkyltransferase (AGT) contents of 12 solid tumor cell lines, two of which, NIH3T3 and NIH3T3 HER14 (engineered to overexpress EGFR), were isogenic. Receptor type specificity was determined using ELISA for competitive binding, as well as growth factor-stimulation assays. DNA damage was studied using single-cell microelectrophoresis (comet) assays, and levels of EGFR were determined by Western blotting. The effects of SMA41 on the cell cycle of NIH3T3 cells were investigated using univariate flow cytometry. Studies of receptor type specificity showed that SMA41: (a) preferentially inhibited the kinase activity of EGFR over those of Src, insulin receptor and protein kinase C (PKC, a serine/threonine kinase), (b) induced stronger inhibition of growth stimulated with EGF than of growth stimulated with platelet-derived growth factor (PDGF) or fetal bovine serum (FBS). Despite the EGFR specificity of SMA41, there was an absence of a linear correlation between the EGFR status of our solid tumor cell lines and levels of DNA damage induced by the alkylating component. Similarly, EGFR levels did not correlate with IC(50) values. The antiproliferative activities of SMA41 correlated more with the AGT status of these cells and paralleled those of the clinical triazene temozolomide (TEM). However, throughout the panel, tumor cell sensitivity to SMA41 was consistently stronger than to its closest analogue TEM. Experiments performed with the isogenic cells showed that SMA41 was capable of inducing twofold higher levels of DNA damage in the EGFR transfectant and delayed cell entry to G(2)/M in both cell types. When the cells were starved and growth-stimulated with FBS (conditions under which both cell types were growth-stimulated), in contrast to TEM, SMA41 and its hydrolytic metabolite SMA52 exhibited approximately nine- and threefold stronger inhibition of growth of the EGFR transfectant. These results suggest that, in addition to its ability to induce DNA damage and cell cycle perturbations, SMA41 is capable of selectively targeting the cells with a growth advantage conferred by EGFR transfection. When compared with the monoalkyltriazene prodrug TEM, its potency may be further enhanced by its ability to hydrolyze to another signal transduction inhibitor (SMA52) plus a DNA alkylating agent that may further contribute to chemosensitivity. Thus, our new "combi-targeting" strategy may well represent a tandem approach to selectively blocking receptor tyrosine kinase-mediated growth signaling while inducing significant levels of cytotoxic DNA lesions in refractory tumors.
Mir, Riyaz A; Bele, Aditya; Mirza, Sameer; Srivastava, Shashank; Olou, Appolinaire A; Ammons, Shalis A; Kim, Jun Hyun; Gurumurthy, Channabasavaiah B; Qiu, Fang; Band, Hamid; Band, Vimla
2015-12-28
Ecdysoneless (ECD) is an evolutionarily conserved protein whose germ line deletion is embryonic lethal. Deletion of Ecd in cells causes cell cycle arrest, which is rescued by exogenous ECD, demonstrating a requirement of ECD for normal mammalian cell cycle progression. However, the exact mechanism by which ECD regulates cell cycle is unknown. Here, we demonstrate that ECD protein levels and subcellular localization are invariant during cell cycle progression, suggesting a potential role of posttranslational modifications or protein-protein interactions. Since phosphorylated ECD was recently shown to interact with the PIH1D1 adaptor component of the R2TP cochaperone complex, we examined the requirement of ECD phosphorylation in cell cycle progression. Notably, phosphorylation-deficient ECD mutants that failed to bind to PIH1D1 in vitro fully retained the ability to interact with the R2TP complex and yet exhibited a reduced ability to rescue Ecd-deficient cells from cell cycle arrest. Biochemical analyses demonstrated an additional phosphorylation-independent interaction of ECD with the RUVBL1 component of the R2TP complex, and this interaction is essential for ECD's cell cycle progression function. These studies demonstrate that interaction of ECD with RUVBL1, and its CK2-mediated phosphorylation, independent of its interaction with PIH1D1, are important for its cell cycle regulatory function. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Mir, Riyaz A.; Bele, Aditya; Mirza, Sameer; Srivastava, Shashank; Olou, Appolinaire A.; Ammons, Shalis A.; Kim, Jun Hyun; Gurumurthy, Channabasavaiah B.; Qiu, Fang; Band, Hamid
2015-01-01
Ecdysoneless (ECD) is an evolutionarily conserved protein whose germ line deletion is embryonic lethal. Deletion of Ecd in cells causes cell cycle arrest, which is rescued by exogenous ECD, demonstrating a requirement of ECD for normal mammalian cell cycle progression. However, the exact mechanism by which ECD regulates cell cycle is unknown. Here, we demonstrate that ECD protein levels and subcellular localization are invariant during cell cycle progression, suggesting a potential role of posttranslational modifications or protein-protein interactions. Since phosphorylated ECD was recently shown to interact with the PIH1D1 adaptor component of the R2TP cochaperone complex, we examined the requirement of ECD phosphorylation in cell cycle progression. Notably, phosphorylation-deficient ECD mutants that failed to bind to PIH1D1 in vitro fully retained the ability to interact with the R2TP complex and yet exhibited a reduced ability to rescue Ecd-deficient cells from cell cycle arrest. Biochemical analyses demonstrated an additional phosphorylation-independent interaction of ECD with the RUVBL1 component of the R2TP complex, and this interaction is essential for ECD's cell cycle progression function. These studies demonstrate that interaction of ECD with RUVBL1, and its CK2-mediated phosphorylation, independent of its interaction with PIH1D1, are important for its cell cycle regulatory function. PMID:26711270
Arachidonic acid induces macrophage cell cycle arrest through the JNK signaling pathway.
Shen, Ziying; Ma, Yunqing; Ji, Zhonghao; Hao, Yang; Yan, Xuan; Zhong, Yuan; Tang, Xiaochun; Ren, Wenzhi
2018-02-09
Arachidonic acid (AA) has potent pro-apoptotic effects on cancer cells at a low concentration and on macrophages at a very high concentration. However, the effects of AA on the macrophage cell cycle and related signaling pathways have not been fully investigated. Herein we aim to observe the effect of AA on macrophages cell cycle. AA exposure reduced the viability and number of macrophages in a dose- and time-dependent manner. The reduction in RAW264.7 cell viability was not caused by apoptosis, as indicated by caspase-3 and activated caspase-3 detection. Further research illustrated that AA exposure induced RAW264.7 cell cycle arrested at S phase, and some cell cycle-regulated proteins were altered accordingly. Moreover, JNK signaling was stimulated by AA, and the stimulation was partially reversed by a JNK signaling inhibitor in accordance with cell cycle-related factors. In addition, nuclear and total Foxo1/3a and phosphorylated Foxo1/3a were elevated by AA in a dose- and time-dependent manner, and this elevation was suppressed by the JNK signaling inhibitor. Our study demonstrated that AA inhibits macrophage viability by inducing S phase cell cycle arrest. The JNK signaling pathway and the downstream FoxO transcription factors are involved in AA-induced RAW264.7 cell cycle arrest.
Carén, Helena; Stricker, Stefan H.; Bulstrode, Harry; Gagrica, Sladjana; Johnstone, Ewan; Bartlett, Thomas E.; Feber, Andrew; Wilson, Gareth; Teschendorff, Andrew E.; Bertone, Paul; Beck, Stephan; Pollard, Steven M.
2015-01-01
Summary Glioblastoma (GBM) is an aggressive brain tumor whose growth is driven by stem cell-like cells. BMP signaling triggers cell-cycle exit and differentiation of GBM stem cells (GSCs) and, therefore, might have therapeutic value. However, the epigenetic mechanisms that accompany differentiation remain poorly defined. It is also unclear whether cell-cycle arrest is terminal. Here we find only a subset of GSC cultures exhibit astrocyte differentiation in response to BMP. Although overtly differentiated non-cycling astrocytes are generated, they remain vulnerable to cell-cycle re-entry and fail to appropriately reconfigure DNA methylation patterns. Chromatin accessibility mapping identified loci that failed to alter in response to BMP and these were enriched in SOX transcription factor-binding motifs. SOX transcription factors, therefore, may limit differentiation commitment. A similar propensity for cell-cycle re-entry and de-differentiation was observed in GSC-derived oligodendrocyte-like cells. These findings highlight significant obstacles to BMP-induced differentiation as therapy for GBM. PMID:26607953
NASA Astrophysics Data System (ADS)
Li, Fei; Subramanian, Kartik; Chen, Minghan; Tyson, John J.; Cao, Yang
2016-06-01
The asymmetric cell division cycle in Caulobacter crescentus is controlled by an elaborate molecular mechanism governing the production, activation and spatial localization of a host of interacting proteins. In previous work, we proposed a deterministic mathematical model for the spatiotemporal dynamics of six major regulatory proteins. In this paper, we study a stochastic version of the model, which takes into account molecular fluctuations of these regulatory proteins in space and time during early stages of the cell cycle of wild-type Caulobacter cells. We test the stochastic model with regard to experimental observations of increased variability of cycle time in cells depleted of the divJ gene product. The deterministic model predicts that overexpression of the divK gene blocks cell cycle progression in the stalked stage; however, stochastic simulations suggest that a small fraction of the mutants cells do complete the cell cycle normally.
Cell Cycle Deregulation in the Neurons of Alzheimer’s Disease
Moh, Calvin; Kubiak, Jacek Z.; Bajic, Vladan P.; Zhu, Xiongwei; Smith, Mark A.
2018-01-01
The cell cycle consists of four main phases: G1, S, G2, and M. Most cells undergo these cycles up to 40–60 times in their life. However, neurons remain in a nondividing, nonreplicating phase, G0. Neurons initiate but do not complete cell division, eventually entering apoptosis. Research has suggested that like cancer, Alzheimer’s disease (AD) involves dysfunction in neuronal cell cycle reentry, leading to the development of the two-hit hypothesis of AD. The first hit is abnormal cell cycle reentry, which typically results in neuronal apoptosis and prevention of AD. However, with the second hit of chronic oxidative damage preventing apoptosis, neurons gain “immortality” analogous to tumor cells. Once both of these hits are activated, AD can develop and produce senile plaques and neurofibrillary tangles throughout brain tissue. In this review, we propose a mechanism for neuronal cell cycle reentry and the development of AD. PMID:21630160
Hu, Shen; Le, Zhang; Krylov, Sergey; Dovichi, Norman J
2003-07-15
Study of cell cycle-dependent protein expression is important in oncology, stem cell research, and developmental biology. In this paper, we report the first protein fingerprint from a single cell with known phase in the cell cycle. To determine that phase, we treated HT-29 colon cancer cells with Hoescht 33342, a vital nuclear stain. A microscope was used to measure the fluorescence intensity from one treated cell; in this form of image cytometry, the fluorescence intensity is proportional to the cell's DNA content, which varies in a predictable fashion during the cell cycle. To generate the protein fingerprint, the cell was aspirated into the separation capillary and lysed. Proteins were fluorescently labeled with 3-(2-furoylquinoline-2-carboxaldehyde, separated by capillary sieving electrophoresis, and detected by laser-induced fluorescence. This form of electrophoresis is the capillary version of SDS-PAGE. The single-cell electropherogram partially resolved approximately 25 components in a 30-min separation, and the dynamic range of the detector exceeded 5000. There was a large cell-to-cell variation in protein expression, averaging 40% relative standard deviation across the electropherogram. The dominant source of variation was the phase of the cell in the cell cycle; on average, approximately 60% of the cell-to-cell variance in protein expression was associated with the cell cycle. Cells in the G1 and G2/M phases of the cell cycle had 27 and 21% relative standard deviations in protein expression, respectively. Cells in the G2/M phase generated signals that were twice the amplitude of the signals generated by G1 phase cells, as expected for cells that are soon to divide into two daughter cells. When electropherograms were normalized to total protein content, the expression of only one component was dependent on cell cycle at the 99% confidence limit. That protein is tentatively identified as cytokeratin 18 in a companion paper.
Chen, Wei-Li; Harris, Deshea L; Joyce, Nancy C
2005-11-01
Contact inhibition is an important mechanism for maintaining corneal endothelium in a non-replicative state. Protein tyrosine phosphatases (PTPs) play a role in regulating the integrity of cell-cell contacts, differentiation, and growth. In this study, we aimed to evaluate whether phosphatases are involved in the maintenance of contact-dependent inhibition of proliferation in corneal endothelial cells and to identify candidate PTPs that are expressed in these cells and might be involved in regulation of contact inhibition. Confluent cultures of rat corneal endothelial cells or endothelium in ex vivo corneas were treated with the general phosphatase inhibitor, sodium orthovanadate (SOV). Immunocytochemistry (ICC) evaluated the effect of SOV on cell-cell contacts by staining for ZO-1, and on cell cycle progression by staining for Ki67. Transverse sections of rat cornea and cultured rat corneal endothelial cells were used to test for expression of the candidate PTPs: PTP-mu, PTP-LAR, PTP1B, SHP-1, SHP-2, and PTEN using ICC and either Western blots or RT-PCR. ZO-1 staining demonstrated that SOV induced a time-dependent release of cell-cell contacts in confluent cultures of corneal endothelial cells and in the endothelium of ex vivo corneas. Staining for Ki67 indicated that SOV promoted limited cell cycle progression in the absence of serum. PTP-mu, PTP1B, SHP-1, SHP-2, and PTEN, but not PTP-LAR, were expressed in rat corneal endothelial cells in situ and in culture. The subcellular location of PTP-mu and PTP1B differed in subconfluent and confluent cells, while that of SHP-1, SHP-2, and PTEN was similar, regardless of confluent status. Western blots confirmed the expression of PTP1B, SHP-1, SHP-2, and PTEN. RT-PCR confirmed expression of PTP-mu mRNA. Phosphatases are involved in regulation of junctional integrity and of cell proliferation in corneal endothelial cells. PTP-mu, PTP1B, SHP-1, SHP-2, and PTEN are expressed in rat corneal endothelium and may be involved in regulation of contact inhibition in these normally non-proliferating cells.
Cell cycle-dependent induction of autophagy, mitophagy and reticulophagy.
Tasdemir, Ezgi; Maiuri, M Chiara; Tajeddine, Nicolas; Vitale, Ilio; Criollo, Alfredo; Vicencio, José Miguel; Hickman, John A; Geneste, Olivier; Kroemer, Guido
2007-09-15
When added to cells, a variety of autophagy inducers that operate through distinct mechanisms and target different organelles for autophagic destruction (mitochondria in mitophagy, endoplasmic reticulum in reticulophagy) rarely induce autophagic vacuolization in more than 50% or the cells. Here we show that this heterogeneity may be explained by cell cycle-specific effects. The BH3 mimetic ABT737, lithium, rapamycin, tunicamycin or nutrient depletion stereotypically induce autophagy preferentially in the G(1) and S phases of the cell cycle, as determined by simultaneous monitoring of cell cycle markers and the cytoplasmic aggregation of GFP-LC3 in autophagic vacuoles. These results point to a hitherto neglected crosstalk between autophagic vacuolization and cell cycle regulation.
Repressive histone methylation regulates cardiac myocyte cell cycle exit.
El-Nachef, Danny; Oyama, Kyohei; Wu, Yun-Yu; Freeman, Miles; Zhang, Yiqiang; Robb MacLellan, W
2018-05-22
Mammalian cardiac myocytes (CMs) stop proliferating soon after birth and subsequent heart growth comes from hypertrophy, limiting the adult heart's regenerative potential after injury. The molecular events that mediate CM cell cycle exit are poorly understood. To determine the epigenetic mechanisms limiting CM cycling in adult CMs (ACMs) and whether trimethylation of lysine 9 of histone H3 (H3K9me3), a histone modification associated with repressed chromatin, is required for the silencing of cell cycle genes, we developed a transgenic mouse model where H3K9me3 is specifically removed in CMs by overexpression of histone demethylase, KDM4D. Although H3K9me3 is found across the genome, its loss in CMs preferentially disrupts cell cycle gene silencing. KDM4D binds directly to cell cycle genes and reduces H3K9me3 levels at these promotors. Loss of H3K9me3 preferentially leads to increased cell cycle gene expression resulting in enhanced CM cycling. Heart mass was increased in KDM4D overexpressing mice by postnatal day 14 (P14) and continued to increase until 9-weeks of age. ACM number, but not size, was significantly increased in KDM4D expressing hearts, suggesting CM hyperplasia accounts for the increased heart mass. Inducing KDM4D after normal development specifically in ACMs resulted in increased cell cycle gene expression and cycling. We demonstrated that H3K9me3 is required for CM cell cycle exit and terminal differentiation in ACMs. Depletion of H3K9me3 in adult hearts prevents and reverses permanent cell cycle exit and allows hyperplastic growth in adult hearts in vivo. Copyright © 2017. Published by Elsevier Ltd.
The life cycle of Phaeocystis (Prymnesiophycaea): evidence and hypotheses
NASA Astrophysics Data System (ADS)
Rousseau, V.; Vaulot, D.; Casotti, R.; Cariou, V.; Lenz, J.; Gunkel, J.; Baumann, M.
1994-04-01
The present paper reviews the literature related to the life cycle of the prymnesiophyte Phaeocystis and its controlling factors and proposes novel hypotheses based on unpublished observations in culture and in the field. We chiefly refer to P. globosa Scherffel as most of the observations concern this species. P. globosa exhibits a complex alternation between several types of free-living cells (non-motile, flagellates, microzoopores and possibly macrozoospores) and colonies for which neither forms nor pathways have been completely identified and described. The different types of Phaeocystis cells were reappraised on the basis of existing microscopic descriptions complemented by unpublished flow cytometric investigations. This analysis revealed the existence of at least three different types of free-living cells identified on the basis of a combination of size, motility and ploidy characteristics: non-motile cells, flagellates and microzoospores. Their respective function within Phaeocystis life cycle, and in particular their involvement in colony formation is not completely understood. Observational evidence shows that Phaeocystis colonies are initiated at the early stage of their bloom each by one free-living cell. The mechanisms controlling this cellular transformation are still uncertain due to the lack of information on the overwintering Phaeocystis fomms and on the cell type responsible for colony induction. The existence of haploid microzoospores released from senescent colonies gives however some support to sexuality involvement at some stages of colony formation. Once colonies are formed, at least two mechanisms were identified as responsible of the spreading of colony form: colony multiplication by colonial division or budding and induction of new colony from colonial cells released in the external medium after colony disruption. The latter mechanism was clearly identified, involving at least two successive cell differentiations in the following sequence: motility development, subsequent flagella loss and settlement to a surface, mucus secretion and colony formation, colonial cell division and colony growth. Aggregate formation, cell motility development and subsequent emigration from the colonies, release of non-motile cells after colony lysis on the other hand, were identified as characteristics for termination of Phaeocystis colony development. These pathways were shown to occur similarly in natural environments. In the early stages of the bloom however, many recently-formed colonies were found on the setae of Chaetoceros spp, suggesting this diatom could play a key-rôle in Phaeocystis bloom inception. Analysis of the possible environmental factors regulating the transition between the different phases of the life cycle, suggested that nutrient status and requirement of a substrate for attachment of free-living cells would be essential for initiation of the colonial form. Physical constraints obviously would be important in determining colony shape and fragmentation although autogenic factors cannot be excluded. Some evidence exists that nutrients regulate colony division, while temperature and nutrient stress would stimulate cell emigration from the colonies.
Kawasaki, M; Sasaki, K; Satoh, T; Kurose, A; Kamada, T; Furuya, T; Murakami, T; Todoroki, T
1997-01-01
We have demonstrated a method for the in situ determination of the cell cycle phases of TIG-7 fibroblasts using a laser scanning cytometer (LSC) which has not only a function equivalent to flow cytometry (FCM) but also has a capability unique in itself. LSC allows a more detailed analysis of the cell cycle in cells stained with propidium iodide (PI) than FCM. With LSC it is possible to discriminate between mitotic cells and G2 cells, between post-mitotic cells and G1 cells, and between quiescent cells and cycling cells in a PI fluorescence peak (chromatin condensation) vs. fluorescence value (DNA content) cytogram for cells stained with PI. These were amply confirmed by experiments using colcemid and adriamycin. We were able to identify at least six cell subpopulations for PI stained cells using LSC; namely G1, S, G2, M, postmitotic and quiescent cell populations. LSC analysis facilitates the monitoring of effects of drugs on the cell cycle.
Checkpoints couple transcription network oscillator dynamics to cell-cycle progression.
Bristow, Sara L; Leman, Adam R; Simmons Kovacs, Laura A; Deckard, Anastasia; Harer, John; Haase, Steven B
2014-09-05
The coupling of cyclin dependent kinases (CDKs) to an intrinsically oscillating network of transcription factors has been proposed to control progression through the cell cycle in budding yeast, Saccharomyces cerevisiae. The transcription network regulates the temporal expression of many genes, including cyclins, and drives cell-cycle progression, in part, by generating successive waves of distinct CDK activities that trigger the ordered program of cell-cycle events. Network oscillations continue autonomously in mutant cells arrested by depletion of CDK activities, suggesting the oscillator can be uncoupled from cell-cycle progression. It is not clear what mechanisms, if any, ensure that the network oscillator is restrained when progression in normal cells is delayed or arrested. A recent proposal suggests CDK acts as a master regulator of cell-cycle processes that have the potential for autonomous oscillatory behavior. Here we find that mitotic CDK is not sufficient for fully inhibiting transcript oscillations in arrested cells. We do find that activation of the DNA replication and spindle assembly checkpoints can fully arrest the network oscillator via overlapping but distinct mechanisms. Further, we demonstrate that the DNA replication checkpoint effector protein, Rad53, acts to arrest a portion of transcript oscillations in addition to its role in halting cell-cycle progression. Our findings indicate that checkpoint mechanisms, likely via phosphorylation of network transcription factors, maintain coupling of the network oscillator to progression during cell-cycle arrest.
Regulation of the Embryonic Cell Cycle During Mammalian Preimplantation Development.
Palmer, N; Kaldis, P
2016-01-01
The preimplantation development stage of mammalian embryogenesis consists of a series of highly conserved, regulated, and predictable cell divisions. This process is essential to allow the rapid expansion and differentiation of a single-cell zygote into a multicellular blastocyst containing cells of multiple developmental lineages. This period of development, also known as the germinal stage, encompasses several important developmental transitions, which are accompanied by dramatic changes in cell cycle profiles and dynamics. These changes are driven primarily by differences in the establishment and enforcement of cell cycle checkpoints, which must be bypassed to facilitate the completion of essential cell cycle events. Much of the current knowledge in this area has been amassed through the study of knockout models in mice. These mouse models are powerful experimental tools, which have allowed us to dissect the relative dependence of the early embryonic cell cycles on various aspects of the cell cycle machinery and highlight the extent of functional redundancy between members of the same gene family. This chapter will explore the ways in which the cell cycle machinery, their accessory proteins, and their stimuli operate during mammalian preimplantation using mouse models as a reference and how this allows for the usually well-defined stages of the cell cycle to be shaped and transformed during this unique and critical stage of development. © 2016 Elsevier Inc. All rights reserved.
Lee, Youngjoo; Han, Ji-Youn; Moon, Sung Ho; Nam, Byung-Ho; Lim, Kun Young; Lee, Geon Kook; Kim, Heung Tae; Yun, Tak; An, Hye Jin; Lee, Jin Soo
2017-10-01
Concurrent chemoradiotherapy (CCRT) is the standard care for stage III non-small cell lung cancer (NSCLC) patients; however, a more effective regimen is needed to improve the outcome by better controlling occult metastases. We conducted two parallel randomized phase II studies to incorporate erlotinib or irinotecan-cisplatin (IP) into CCRT for stage III NSCLC depending on epidermal growth factor receptor (EGFR) mutation status. Patients with EGFR-mutant tumors were randomized to receive three cycles of erlotinib first and then either CCRT with erlotinib followed by erlotinib (arm A) or CCRT with IP only (arm B). Patients with EGFR unknown or wild-type tumors were randomized to receive either three cycles of IP before (arm C) or after CCRT with IP (arm D). Seventy-three patients were screened and the study was closed early because of slow accrual after 59 patients were randomized. Overall, there were seven patients in arm A, five in arm B, 22 in arm C, and 25 in arm D. The response rate was 71.4% and 80.0% for arm A and B, and 70.0% and 73.9% for arm C and D. The median overall survival (OS) was 39.3 months versus 31.2 months for arm A and B (p=0.442), and 16.3 months versus 25.3 months for arm C and D (p=0.050). Patients with sensitive EGFR mutations had significantly longer OS than EGFR-wild patients (74.8 months vs. 25.3 months, p=0.034). There were no unexpected toxicities. Combined-modality treatment by molecular diagnostics is feasible in stage III NSCLC. EGFR-mutant patients appear to be a distinct subset with longer survival.
Lim, Eun-A; Lee, Haeyoung; Bae, Eunmi; Lim, Jaeok; Shin, Young Kee; Choi, Sang-Eun
2016-01-01
As targeted therapy becomes increasingly important, diagnostic techniques for identifying targeted biomarkers have also become an emerging issue. The study aims to evaluate the cost-effectiveness of treating patients as guided by epidermal growth factor receptor (EGFR) mutation status compared with a no-testing strategy that is the current clinical practice in South Korea. A cost-utility analysis was conducted to compare an EGFR mutation testing strategy with a no-testing strategy from the Korean healthcare payer's perspective. The study population consisted of patients with stage 3b and 4 lung adenocarcinoma. A decision tree model was employed to select the appropriate treatment regimen according to the results of EGFR mutation testing and a Markov model was constructed to simulate disease progression of advanced non-small cell lung cancer. The length of a Markov cycle was one month, and the time horizon was five years (60 cycles). In the base case analysis, the testing strategy was a dominant option. Quality-adjusted life-years gained (QALYs) were 0.556 and 0.635, and total costs were $23,952 USD and $23,334 USD in the no-testing and testing strategy respectively. The sensitivity analyses showed overall robust results. The incremental cost-effectiveness ratios (ICERs) increased when the number of patients to be treated with erlotinib increased, due to the high cost of erlotinib. Treating advanced adenocarcinoma based on EGFR mutation status has beneficial effects and saves the cost compared to no testing strategy in South Korea. However, the cost-effectiveness of EGFR mutation testing was heavily affected by the cost-effectiveness of the targeted therapy.
Takeoka, Hiroaki; Yamada, Kazuhiko; Naito, Yoshiko; Matsuo, Norikazu; Ishii, Hidenobu; Tokito, Takaaki; Azuma, Koichi; Ichiki, Masao; Hoshino, Tomoaki
2018-06-01
The combination of platinum-doublet chemotherapy with bevacizumab has been established as a first-line treatment option in non-elderly patients with non-squamous (non-sq) non-small cell lung cancer (NSCLC). However, the safety and efficacy of this regimen have not yet been fully established in elderly patients. Chemo-naïve patients with non-sq NSCLC, aged ≥75 years, having a good performance status (Eastern Cooperative Oncology Group performance status 0-1) and adequate organ function were considered eligible. Patients received carboplatin (area under the curve=5 mg/ml/min), pemetrexed (500 mg/m 2 ), and bevacizumab (15 mg/kg) every 3 weeks for up to 4 cycles, followed by maintenance bevacizumab. The primary endpoint was the objective response rate (ORR; target=50%, threshold=30%; Simon's two-stage design), and the secondary endpoints were safety, progression-free survival (PFS), and overall survival (OS). Twelve patients were enrolled from June 2013 to July 2017. The study was closed because of slow patient accrual. The median patient age was 80 years. Eleven patients (92%) completed 4 cycles of induction chemotherapy. Seven patients achieved a partial response (PR), yielding an ORR of 58%. The median PFS was 8.4 [95% confidence interval (CI)=4.4-10.5] months, and the median OS was 33.9 (95%CI=13.2-43.3) months. Toxicities were generally mild and consistent with previous reports. There were no treatment-related deaths. A regimen comprising carboplatin and pemetrexed plus bevacizumab followed by maintenance bevacizumab is feasible and potentially efficacious in elderly patients with non-sq NSCLC. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Yao, Mu; Xie, Chanlu; Kiang, Mei-Yee; Teng, Ying; Harman, David; Tiffen, Jessamy; Wang, Qian; Sved, Paul; Bao, Shisan; Witting, Paul; Holst, Jeff; Dong, Qihan
2015-10-27
Cell cycle re-entry of quiescent cancer cells has been proposed to be involved in cancer progression and recurrence. Cytosolic phospholipase A2α (cPLA2α) is an enzyme that hydrolyzes membrane glycerophospholipids to release arachidonic acid and lysophospholipids that are implicated in cancer cell proliferation. The aim of this study was to determine the role of cPLA2α in cell cycle re-entry of quiescent prostate cancer cells. When PC-3 and LNCaP cells were rendered to a quiescent state, the active form of cPLA2α with a phosphorylation at Ser505 was lower compared to their proliferating state. Conversely, the phospho-cPLA2α levels were resurgent during the induction of cell cycle re-entry. Pharmacological inhibition of cPLA2α with Efipladib upon induction of cell cycle re-entry inhibited the re-entry process, as manifested by refrained DNA synthesis, persistent high proportion of cells in G0/G1 and low percentage of cells in S and G2/M phases, together with a stagnant recovery of Ki-67 expression. Simultaneously, Efipladib prohibited the emergence of Skp2 while maintained p27 at a high level in the nuclear compartment during cell cycle re-entry. Inhibition of cPLA2α also prevented an accumulation of cyclin D1/CDK4, cyclin E/CDK2, phospho-pRb, pre-replicative complex proteins CDC6, MCM7, ORC6 and DNA synthesis-related protein PCNA during induction of cell cycle re-entry. Moreover, a pre-treatment of the prostate cancer cells with Efipladib during induction of cell cycle re-entry subsequently compromised their tumorigenic capacity in vivo. Hence, cPLA2α plays an important role in cell cycle re-entry by quiescent prostate cancer cells.
D'Angelo, Barbara; Astarita, Carlo; Boffo, Silvia; Massaro-Giordano, Mina; Antonella Ianuzzi, Carmelina; Caporaso, Antonella; Macaluso, Marcella; Giordano, Antonio
2017-01-01
Cell cycle reactivation in adult neurons is an early hallmark of neurodegeneration. The lipopolysaccharide (LPS) is a well-known pro-inflammatory factor that provokes neuronal cell death via glial cells activation. The retinoblastoma (RB) family includes RB1/p105, retinoblastoma-like 1 (RBL1/p107), and retinoblastoma-like 2 (Rb2/p130). Several studies have indicated that RB proteins exhibit tumor suppressor activities, and play a central role in cell cycle regulation. In this study, we assessed LPS-mediated inflammatory effect on cell cycle reactivation and apoptosis of neuronally differentiated cells. Also, we investigated whether the LPS-mediated inflammatory response can influence the function and expression of RB proteins. Our results showed that LPS challenges triggered cell cycle reactivation of differentiated neuronal cells, indicated by an accumulation of cells in S and G2/M phase. Furthermore, we found that LPS treatment also induced apoptotic death of neurons. Interestingly, we observed that LPS-mediated inflammatory effect on cell cycle re-entry and apoptosis was concomitant with the aberrant expression of RBL1/p107 and RB1/p105. To the best of our knowledge, our study is the first to indicate a role of LPS in inducing cell cycle re-entry and/or apoptosis of differentiated neuronal cells, perhaps through mechanisms altering the expression of specific members of RB family proteins. This study provides novel information on the biology of post-mitotic neurons and could help in identifying novel therapeutic targets to prevent de novo cell cycle reactivation and/or apoptosis of neurons undergoing neurodegenerative processes.
Kremers, Stef P. J.; de Bruijn, Gert-Jan; Visscher, Tommy L. S.; Deeg, Dorly J. H.; Thomése, G. C. Fleur; Visser, Marjolein; van Mechelen, Willem; Brug, Johannes
2012-01-01
The objective of this cross-sectional study was to investigate differences in associations between crime rates, cycling, and weight status between people living in low and high socioeconomic status (SES) neighbourhoods. In total, 470 participants in the Longitudinal Aging Study Amsterdam were included (age: 63–70 y). Body height and weight were measured using a stadiometer and calibrated weight scale, respectively. Cycling behaviour was assessed in a face-to-face interview, and neighbourhood crime rates were assessed using data from police reports. Men residing in high SES neighbourhoods cycled more than males residing in low SES neighbourhoods. Cycling was negatively related to crime rates among both men and women living in low SES neighbourhoods. Among men living in low SES neighbourhoods, more cycling was associated with lower BMI. Interventions aiming to prevent obesity in older people may consider aiming at increasing bicycle use in lower SES neighbourhoods, but neighbourhood safety issues should be considered. PMID:22523503
Gray, Joshua P; Karandrea, Shpetim; Burgos, Delaine Zayasbazan; Jaiswal, Anil A; Heart, Emma A
2016-11-16
NQO1 (NAD(P)H-quinone oxidoreductase 1) reduces quinones and xenobiotics to less-reactive compounds via 2-electron reduction, one feature responsible for the role of NQO1 in antioxidant defense in several tissues. In contrast, NADPH cytochrome P450 oxidoreductase (CYP450OR), catalyzes the 1-electron reduction of quinones and xenobiotics, resulting in enhanced superoxide formation. However, to date, the roles of NQO1 and CYP450OR in pancreatic β-cell metabolism under basal conditions and oxidant challenge have not been characterized. Using NQO1 inhibition, over-expression and knock out, we have demonstrated that, in addition to protection of β-cells from toxic concentrations of the redox cycling quinone menadione, NQO1 also regulates the basal level of reduced-to-oxidized nucleotides, suggesting other role(s) beside that of an antioxidant enzyme. In contrast, over-expression of NADPH cytochrome P450 oxidoreductase (CYP450OR) resulted in enhanced redox cycling activity and decreased cellular viability, consistent with the enhanced generation of superoxide and H 2 O 2 . Basal expression of NQO1 and CYP450OR was comparable in isolated islets and liver. However, NQO1, but not CYP450OR, was strongly induced in β-cells exposed to menadione. NQO1 and CYP450OR exhibited a reciprocal preference for reducing equivalents in β-cells: while CYP450OR preferentially utilized NADPH, NQO1 primarily utilized NADH. Together, these results demonstrate that NQO1 and CYP450OR reciprocally regulate oxidant metabolism in pancreatic β-cells. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Survivin safeguards chromosome numbers and protects from aneuploidy independently from p53
2014-01-01
Background Survivin, a member of the inhibitor of apoptosis (IAP) gene family, has a dual role in mitosis and in apoptosis. It is abundantly expressed in every human tumor, compared with normal tissues. During mitosis Survivin assembles with the chromosomal passenger complex and regulates chromosomal segregation. Here, we aim to explore whether interference with the mitotic function of Survivin is linked to p53-mediated G1 cell cycle arrest and affects chromosomal stability. Methods In this study, we used HCT116, SBC-2, and U87-MG and generated corresponding isogenic p53-deficient cells. Retroviral vectors were used to stably knockdown Survivin. The resulting phenotype, in particular the mechanisms of cell cycle arrest and of initiation of aneuploidy, were investigated by Western Blot analysis, confocal laser scan microscopy, proliferation assays, spectral karyotyping and RNAi. Results In all cell lines Survivin-RNAi did not induce instant apoptosis but caused polyplodization irrespective of p53 status. Strikingly, polyploidization after knockdown of Survivin resulted in merotelic kinetochore spindle assemblies, γH2AX-foci, and DNA damage response (DDR), which was accompanied by a transient p53-mediated G1-arrest. That p53 wild type cells specifically arrest due to DNA damage was shown by simultaneous inhibition of ATM and DNA-PK, which abolished induction of p21waf/cip. Cytogenetic analysis revealed chromosomal aberrations indicative for DNA double strand break repair by the mechanism of non-homologous end joining (NHEJ), only in Survivin-depleted cells. Conclusion Our findings suggest that Survivin plays an essential role in proper amphitelic kinetochore-spindle assembly and that constraining Survivin’s mitotic function results in polyploidy and aneuploidy which cannot be controlled by p53. Therefore, Survivin critically safeguards chromosomal stability independently from p53. PMID:24886358
Cables1 controls p21/Cip1 protein stability by antagonizing proteasome subunit alpha type 3.
Shi, Z; Li, Z; Li, Z J; Cheng, K; Du, Y; Fu, H; Khuri, F R
2015-05-07
The cyclin-dependent kinase (CDK) inhibitor 1A, p21/Cip1, is a vital cell cycle regulator, dysregulation of which has been associated with a large number of human malignancies. One critical mechanism that controls p21 function is through its degradation, which allows the activation of its associated cell cycle-promoting kinases, CDK2 and CDK4. Thus delineating how p21 is stabilized and degraded will enhance our understanding of cell growth control and offer a basis for potential therapeutic interventions. Here we report a novel regulatory mechanism that controls the dynamic status of p21 through its interaction with Cdk5 and Abl enzyme substrate 1 (Cables1). Cables1 has a proposed role as a tumor suppressor. We found that upregulation of Cables1 protein was correlated with increased half-life of p21 protein, which was attributed to Cables1/p21 complex formation and supported by their co-localization in the nucleus. Mechanistically, Cables1 interferes with the proteasome (Prosome, Macropain) subunit alpha type 3 (PSMA3) binding to p21 and protects p21 from PSMA3-mediated proteasomal degradation. Moreover, silencing of p21 partially reverses the ability of Cables1 to induce cell death and inhibit cell proliferation. In further support of a potential pathophysiological role of Cables1, the expression level of Cables1 is tightly associated with p21 in both cancer cell lines and human lung cancer patient tumor samples. Together, these results suggest Cables1 as a novel p21 regulator through maintaining p21 stability and support the model that the tumor-suppressive function of Cables1 occurs at least in part through enhancing the tumor-suppressive activity of p21.
Gray, Joshua P.; Karandrea, Shpetim; Burgos, Delaine Zayasbazan; Jaiswal, Anil A; Heart, Emma A.
2017-01-01
NQO1 (NAD(P)H-quinone oxidoreductase 1) reduces quinones and xenobiotics to less-reactive compounds via 2-electron reduction, one feature responsible for the role of NQO1 in antioxidant defense in several tissues. In contrast, NADPH cytochrome P450 oxidoreductase (CYP450OR), catalyzes the 1-electron reduction of quinones and xenobiotics, resulting in enhanced superoxide formation. However, to date, the roles of NQO1 and CYP450OR in pancreatic β-cell metabolism under basal conditions and oxidant challenge have not been characterized. Using NQO1 inhibition, over-expression and knock out, we have demonstrated that, in addition to protection of β-cells from toxic concentrations of the redox cycling quinone menadione, NQO1 also regulates the basal level of reduced-to-oxidized nucleotides, suggesting other role(s) beside that of an antioxidant enzyme. In contrast, over-expression of NADPH cytochrome P450 oxidoreductase (CYP450OR) resulted in enhanced redox cycling activity and decreased cellular viability, consistent with the enhanced generation of superoxide and H2O2. Basal expression of NQO1 and CYP450OR was comparable in isolated islets and liver. However, NQO1, but not CYP450OR, was strongly induced in β-cells exposed to menadione. NQO1 and CYP450OR exhibited a reciprocal preference for reducing equivalents in β-cells: while CYP450OR preferentially utilized NADPH, NQO1 primarily utilized NADH. Together, these results demonstrate that NQO1 and CYP450OR reciprocally regulate oxidant metabolism in pancreatic β-cells. PMID:27558805
Wang, Kunning; Liang, Qiaoyi; Li, Xiaoxing; Tsoi, Ho; Zhang, Jingwan; Wang, Hua; Go, Minnie Y Y; Chiu, Philip W Y; Ng, Enders K W; Sung, Joseph J Y; Yu, Jun
2016-01-01
Background Using the promoter methylation assay, we have shown that MDGA2 (MAM domain containing glycosylphosphatidylinositol anchor 2) is preferentially methylated in gastric cancer. We analysed its biological effects and prognostic significance in gastric cancer. Methods MDGA2 methylation status was evaluated by combined bisulfite restriction analysis and bisulfite genomic sequencing. The effects of MDGA2 re-expression or knockdown on cell proliferation, apoptosis and the cell cycle were determined. MDGA2 interacting protein was identified by mass spectrometry and MDGA2-related cancer pathways by reporter activity and PCR array analyses. The clinical impact of MDGA2 was assessed in 218 patients with gastric cancer. Results MDGA2 was commonly silenced in gastric cancer cells (10/11) and primary gastric cancers due to promoter hypermethylation. MDGA2 significantly inhibited cell proliferation by causing G1–S cell cycle arrest and inducing cell apoptosis in vitro, and suppressed xenograft tumour growth in both subcutaneous and orthotopic xenograft mouse models (both p<0.001). The anti-tumorigenic effect of MDGA2 was mediated through direct stabilising of DNA methyltransferase 1 associated protein 1 (DMAP1), which played a tumour suppressive role in gastric cancer. This interaction activated their downstream key elements of p53/p21 signalling cascades. Moreover, promoter methylation of MDGA2 was detected in 62.4% (136/218) of gastric cancers. Multivariate analysis showed that patients with MDGA2 hypermethylation had a significantly decreased survival (p=0.005). Kaplan–Meier survival curves showed that MDGA2 hypermethylation was significantly associated with shortened survival in patients with early gastric cancer. Conclusions MDGA2 is a critical tumour suppressor in gastric carcinogenesis; its hypermethylation is an independent prognostic factor in patients with gastric cancer. PMID:26206665
Ayaydin, Ferhan; Kotogány, Edit; Ábrahám, Edit; Horváth, Gábor V
2017-01-01
Deepening our knowledge on the regulation of the plant cell division cycle depends on techniques that allow for the enrichment of cell populations in defined cell cycle phases. Synchronization of cell division can be achieved using different plant tissues; however, well-established cell suspension cultures provide large amount of biological sample for further analyses. Here, we describe the methodology of the establishment, propagation, and analysis of a Medicago sativa suspension culture that can be used for efficient synchronization of the cell division. A novel 5-ethynyl-2'-deoxyuridine (EdU)-based method is used for the estimation of cell fraction that enters DNA synthesis phase of the cell cycle and we also demonstrate the changes in the phosphorylation level of Medicago sativa retinoblastoma-related protein (MsRBR1) during cell cycle progression.
Nucleosome architecture throughout the cell cycle
Deniz, Özgen; Flores, Oscar; Aldea, Martí; Soler-López, Montserrat; Orozco, Modesto
2016-01-01
Nucleosomes provide additional regulatory mechanisms to transcription and DNA replication by mediating the access of proteins to DNA. During the cell cycle chromatin undergoes several conformational changes, however the functional significance of these changes to cellular processes are largely unexplored. Here, we present the first comprehensive genome-wide study of nucleosome plasticity at single base-pair resolution along the cell cycle in Saccharomyces cerevisiae. We determined nucleosome organization with a specific focus on two regulatory regions: transcription start sites (TSSs) and replication origins (ORIs). During the cell cycle, nucleosomes around TSSs display rearrangements in a cyclic manner. In contrast to gap (G1 and G2) phases, nucleosomes have a fuzzier organization during S and M phases, Moreover, the choreography of nucleosome rearrangements correlate with changes in gene expression during the cell cycle, indicating a strong association between nucleosomes and cell cycle-dependent gene functionality. On the other hand, nucleosomes are more dynamic around ORIs along the cell cycle, albeit with tighter regulation in early firing origins, implying the functional role of nucleosomes on replication origins. Our study provides a dynamic picture of nucleosome organization throughout the cell cycle and highlights the subsequent impact on transcription and replication activity. PMID:26818620
Cell reprogramming modelled as transitions in a hierarchy of cell cycles
NASA Astrophysics Data System (ADS)
Hannam, Ryan; Annibale, Alessia; Kühn, Reimer
2017-10-01
We construct a model of cell reprogramming (the conversion of fully differentiated cells to a state of pluripotency, known as induced pluripotent stem cells, or iPSCs) which builds on key elements of cell biology viz. cell cycles and cell lineages. Although reprogramming has been demonstrated experimentally, much of the underlying processes governing cell fate decisions remain unknown. This work aims to bridge this gap by modelling cell types as a set of hierarchically related dynamical attractors representing cell cycles. Stages of the cell cycle are characterised by the configuration of gene expression levels, and reprogramming corresponds to triggering transitions between such configurations. Two mechanisms were found for reprogramming in a two level hierarchy: cycle specific perturbations and a noise induced switching. The former corresponds to a directed perturbation that induces a transition into a cycle-state of a different cell type in the potency hierarchy (mainly a stem cell) whilst the latter is a priori undirected and could be induced, e.g. by a (stochastic) change in the cellular environment. These reprogramming protocols were found to be effective in large regimes of the parameter space and make specific predictions concerning reprogramming dynamics which are broadly in line with experimental findings.
Early induction of c-Myc is associated with neuronal cell death.
Lee, Hyun-Pil; Kudo, Wataru; Zhu, Xiongwei; Smith, Mark A; Lee, Hyoung-gon
2011-11-14
Neuronal cell cycle activation has been implicated in neurodegenerative diseases such as Alzheimer's disease, while the initiating mechanism of cell cycle activation remains to be determined. Interestingly, our previous studies have shown that cell cycle activation by c-Myc (Myc) leads to neuronal cell death which suggests Myc might be a key regulator of cell cycle re-entry mediated neuronal cell death. However, the pattern of Myc expression in the process of neuronal cell death has not been addressed. To this end, we examined Myc induction by the neurotoxic agents camptothecin and amyloid-β peptide in a differentiated SH-SY5Y neuronal cell culture model. Myc expression was found to be significantly increased following either treatment and importantly, the induction of Myc preceded neuronal cell death suggesting it is an early event of neuronal cell death. Since ectopic expression of Myc in neurons causes the cell cycle activation and neurodegeneration in vivo, the current data suggest that induction of Myc by neurotoxic agents or other disease factors might be a key mediator in cell cycle activation and consequent cell death that is a feature of neurodegenerative diseases. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko
2018-05-24
Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
Radojewski, Mateusz; Podgórski, Tomasz; Pospieszna, Barbara; Kryściak, Jakub; Śliwicka, Ewa; Karolkiewicz, Joanna
2018-06-01
The aim of the study was to evaluate the impact of the competitive phase on physiological and metabolic indices and selected markers of skeletal muscle damage in male volleyball players. The study group consisted of 24 young male volleyball players. During the study, participants underwent two series of measurements, before and after the competitive phase of the annual training cycle. In both study terms, players performed an incremental treadmill running test to determine their ventilatory threshold and maximal oxygen uptake. Venous and capillary blood samples were taken for biochemical analysis. There was no significant difference in the physical fitness level, values of biochemical variables and the level of antioxidant status in the surveyed athletes between the two study terms. Significant changes within skeletal muscle damage markers were observed between the beginning and the end of the competitive period: an increase in the concentration of cellular DNA damage products (8-hydroxy-2'-deoxyguanosine; p < 0.0001) and a decrease in muscle activity of creatine kinase (p<0.05). In spite of the increment in cell damage markers, the unaffected level of physiological and biochemical markers may indicate that the experienced cell destruction did not negatively affect the level of physical fitness. When designing the annual training plan, coaches and athletes need to take into consideration that temporary physiological states - oxidative stress and inflammation - may be required to attain training adaptation.
Fuel Cell Technology Status Analysis | Hydrogen and Fuel Cells | NREL
Technology Status Analysis Fuel Cell Technology Status Analysis Get Involved Fuel cell developers interested in collaborating with NREL on fuel cell technology status analysis should send an email to NREL's Technology Validation Team at techval@nrel.gov. NREL's analysis of fuel cell technology provides objective
Yano, Shuya; Miwa, Shinji; Mii, Sumiyuki; Hiroshima, Yukihiko; Uehara, Fuminaru; Kishimoto, Hiroyuki; Tazawa, Hiroshi; Zhao, Ming; Bouvet, Michael; Fujiwara, Toshiyoshi; Hoffman, Robert M
2015-01-01
The phase of the cell cycle can determine whether a cancer cell can respond to a given drug. We previously reported monitoring of real-time cell cycle dynamics of cancer cells throughout a live tumor, intravitally in live mice, using a fluorescence ubiquitination-based cell-cycle indicator (FUCCI). Approximately 90% of cancer cells in the center and 80% of total cells of an established tumor are in G0/G1 phase. Longitudinal real-time imaging demonstrated that cytotoxic agents killed only proliferating cancer cells at the surface and, in contrast, had little effect on quiescent cancer cells, which are the vast majority of an established tumor. Moreover, resistant quiescent cancer cells restarted cycling after cessation of chemotherapy. These results suggested why most drugs currently in clinical use, which target cancer cells in S/G2/M, are mostly ineffective on solid tumors. In the present report, we used FUCCI imaging and Gelfoam® collagen-sponge-gel histoculture, to demonstrate in real time, that the cell-cycle phase distribution of cancer cells in Gelfoam® and in vivo tumors is highly similar, whereby only the surface cells proliferate and interior cells are quiescent in G0/G1. This is in contrast to 2D culture where most cancer cells cycle. Similarly, the cancer cells responded similarly to toxic chemotherapy in Gelfoam® culture as in vivo, and very differently than cancer cells in 2D culture which were much more chemosensitive. Gelfoam® culture of FUCCI-expressing cancer cells offers the opportunity to image the cell cycle of cancer cells continuously and to screen for novel effective therapies to target quiescent cells, which are the majority in a tumor and which would have a strong probability to be effective in vivo.
Kuypers, Nicholas J.; Bankston, Andrew N.; Howard, Russell M.; Beare, Jason E.
2016-01-01
Oligodendrocyte (OL) loss contributes to the functional deficits underlying diseases with a demyelinating component. Remyelination by oligodendrocyte progenitor cells (OPCs) can restore these deficits. To understand the role that microRNAs (miRNAs) play in remyelination, 2′,3′-cyclic-nucleotide 3′-phosphodiesterase-EGFP+ mice were treated with cuprizone, and OPCs were sorted from the corpus callosum. Microarray analysis revealed that Sfmbt2 family miRNAs decreased during cuprizone treatment. One particular Sfmbt2 miRNA, miR-297c-5p, increased during mouse OPC differentiation in vitro and during callosal development in vivo. When overexpressed in both mouse embryonic fibroblasts and rat OPCs (rOPCs), cell cycle analysis revealed that miR-297c-5p promoted G1/G0 arrest. Additionally, miR-297c-5p transduction increased the number of O1+ rOPCs during differentiation. Luciferase reporter assays confirmed that miR-297c-5p targets cyclin T2 (CCNT2), the regulatory subunit of positive transcription elongation factor b, a complex that inhibits OL maturation. Furthermore, CCNT2-specific knockdown promoted rOPC differentiation while not affecting cell cycle status. Together, these data support a dual role for miR-297c-5p as both a negative regulator of OPC proliferation and a positive regulator of OL maturation via its interaction with CCNT2. SIGNIFICANCE STATEMENT This work describes the role of oligodendrocyte progenitor cell (OPC) microRNAs (miRNAs) during remyelination and development in vivo and differentiation in vitro. This work highlights the importance of miRNAs to OPC biology and describes miR-297c-5p, a novel regulator of OPC function. In addition, we identified CCNT2 as a functional target, thus providing a mechanism by which miR-297c-5p imparts its effects on differentiation. These data are important, given our lack of understanding of OPC miRNA regulatory networks and their potential clinical value. Therefore, efforts to understand the role of miR-297c-5p in pathological conditions and its potential for facilitating repair may provide future therapeutic strategies to treat demyelination. PMID:26843650
Wagner, Ines; Wang, Heng; Weissert, Philipp M; Straube, Werner L; Shevchenko, Anna; Gentzel, Marc; Brito, Goncalo; Tazaki, Akira; Oliveira, Catarina; Sugiura, Takuji; Shevchenko, Andrej; Simon, András; Drechsel, David N; Tanaka, Elly M
2017-03-27
Limb amputation in the newt induces myofibers to dedifferentiate and re-enter the cell cycle to generate proliferative myogenic precursors in the regeneration blastema. Here we show that bone morphogenetic proteins (BMPs) and mature BMPs that have been further cleaved by serum proteases induce cell cycle entry by dedifferentiating newt muscle cells. Protease-activated BMP4/7 heterodimers that are present in serum strongly induced myotube cell cycle re-entry with protease cleavage yielding a 30-fold potency increase of BMP4/7 compared with canonical BMP4/7. Inhibition of BMP signaling via muscle-specific dominant-negative receptor expression reduced cell cycle entry in vitro and in vivo. In vivo inhibition of serine protease activity depressed cell cycle re-entry, which in turn was rescued by cleaved-mimic BMP. This work identifies a mechanism of BMP activation that generates blastema cells from differentiated muscle. Copyright © 2017 Elsevier Inc. All rights reserved.
Duplication of the genome in normal and cancer cell cycles.
Bandura, Jennifer L; Calvi, Brian R
2002-01-01
It is critical to discover the mechanisms of normal cell cycle regulation if we are to fully understand what goes awry in cancer cells. The normal eukaryotic cell tightly regulates the activity of origins of DNA replication so that the genome is duplicated exactly once per cell cycle. Over the last ten years much has been learned concerning the cell cycle regulation of origin activity. It is now clear that the proteins and cell cycle mechanisms that control origin activity are largely conserved from yeast to humans. Despite this conservation, the composition of origins of DNA replication in higher eukaryotes remains ill defined. A DNA consensus for predicting origins has yet to emerge, and it is of some debate whether primary DNA sequence determines where replication initiates. In this review we outline what is known about origin structure and the mechanism of once per cell cycle DNA replication with an emphasis on recent advances in mammalian cells. We discuss the possible relevance of these regulatory pathways for cancer biology and therapy.
Kim, MunJu; Reed, Damon; Rejniak, Katarzyna A.
2014-01-01
Cyclin-dependent kinases (CDKs) are vital in regulating cell cycle progression, and, thus, in highly proliferating tumor cells CDK inhibitors are gaining interest as potential anticancer agents. Clonogenic assay experiments are frequently used to determine drug efficacy against the survival and proliferation of cancer cells. While the anticancer mechanisms of drugs are usually described at the intracellular single-cell level, the experimental measurements are sampled from the entire cancer cell population. This approach may lead to discrepancies between the experimental observations and theoretical explanations of anticipated drug mechanisms. To determine how individual cell responses to drugs that inhibit CDKs affect the growth of cancer cell populations, we developed a spatially explicit hybrid agent-based model. In this model, each cell is equipped with internal cell cycle regulation mechanisms, but it is also able to interact physically with its neighbors. We model cell cycle progression, focusing on the G1 and G2/M cell cycle checkpoints, as well as on related essential components, such as CDK1, CDK2, cell size, and DNA damage. We present detailed studies of how the emergent properties (e.g., cluster formation) of an entire cell population depend on altered physical and physiological parameters. We analyze the effects of CDK1 and CKD2 inhibitors on population growth, time-dependent changes in cell cycle distributions, and the dynamic evolution of spatial cell patterns. We show that cell cycle inhibitors that cause cell arrest at different cell cycle phases are not necessarily synergistically super-additive. Finally, we demonstrate that the physical aspects of cell population growth, such as the formation of tight cell clusters versus dispersed colonies, alter the efficacy of cell cycle inhibitors, both in 2D and 3D simulations. This finding may have implications for interpreting the treatment efficacy results of in vitro experiments, in which treatment is applied before the cells can grow to produce clusters, especially because in vivo tumors, in contrast, form large masses before they are detected and treated. PMID:24607745
Effects of karanjin on cell cycle arrest and apoptosis in human A549, HepG2 and HL-60 cancer cells.
Guo, Jian-Ru; Chen, Qian-Qian; Lam, Christopher Wai-Kei; Zhang, Wei
2015-07-26
We have investigated the potential anticancer effects of karanjin, a principal furanoflavonol constituent of the Chinese medicine Fordia cauliflora, using cytotoxic assay, cell cycle arrest, and induction of apoptosis in three human cancer cell lines (A549, HepG2 and HL-60 cells). MTT cytotoxic assay showed that karanjin could inhibit the proliferation and viability of all three cancer cells. The induction of cell cycle arrest was observed via a PI (propidium iodide)/RNase Staining Buffer detection kit and analyzed by flow cytometry: karanjin could dose-dependently induce cell cycle arrest at G2/M phase in the three cell lines. Cell apoptosis was assessed by Annexin V-FITC/PI staining: all three cancer cells treated with karanjin exhibited significantly increased apoptotic rates, especially in the percentage of late apoptosis cells. Karanjin can induce cancer cell death through cell cycle arrest and enhance apoptosis. This compound may be effective clinically for cancer pharmacotherapy.
Pramila, Tata; Wu, Wei; Miles, Shawna; Noble, William Stafford; Breeden, Linda L
2006-08-15
Transcription patterns shift dramatically as cells transit from one phase of the cell cycle to another. To better define this transcriptional circuitry, we collected new microarray data across the cell cycle of budding yeast. The combined analysis of these data with three other cell cycle data sets identifies hundreds of new highly periodic transcripts and provides a weighted average peak time for each transcript. Using these data and phylogenetic comparisons of promoter sequences, we have identified a late S-phase-specific promoter element. This element is the binding site for the forkhead protein Hcm1, which is required for its cell cycle-specific activity. Among the cell cycle-regulated genes that contain conserved Hcm1-binding sites, there is a significant enrichment of genes involved in chromosome segregation, spindle dynamics, and budding. This may explain why Hcm1 mutants show 10-fold elevated rates of chromosome loss and require the spindle checkpoint for viability. Hcm1 also induces the M-phase-specific transcription factors FKH1, FKH2, and NDD1, and two cell cycle-specific transcriptional repressors, WHI5 and YHP1. As such, Hcm1 fills a significant gap in our understanding of the transcriptional circuitry that underlies the cell cycle.
Bai, Bing; Sikron, Noga; Gendler, Tanya; Kazachkova, Yana; Barak, Simon; Grafi, Gideon; Khozin-Goldberg, Inna; Fait, Aaron
2012-01-01
Seeds in the seed bank experience diurnal cycles of imbibition followed by complete dehydration. These conditions pose a challenge to the regulation of germination. The effect of recurring hydration-dehydration (Hy-Dh) cycles were tested on seeds from four Arabidopsis thaliana accessions [Col-0, Cvi, C24 and Ler]. Diurnal Hy-Dh cycles had a detrimental effect on the germination rate and on the final percentage of germination in Col-0, Cvi and C24 ecotypes, but not in the Ler ecotype, which showed improved vigor following the treatments. Membrane permeability measured by ion conductivity was generally increased following each Hy-Dh cycle and was correlated with changes in the redox status represented by the GSSG/GSH (oxidized/reduced glutathione) ratio. Among the ecotypes, Col-0 seeds displayed the highest membrane permeability, whilst Ler was characterized by the greatest increase in electrical conductivity following Hy-Dh cycles. Following Dh 2 and Dh 3, the respiratory activity of Ler seeds significantly increased, in contrast to the other ecotypes, indicative of a dramatic shift in metabolism. These differences were associated with accession-specific content and patterns of change of (i) cell wall-related laminaribiose and mannose; (ii) fatty acid composition, specifically of the unsaturated oleic acid and α-linoleic acid; and (iii) asparagine, ornithine and the related polyamine putrescine. Furthermore, in the Ler ecotype the content of the tricarboxylic acid (TCA) cycle intermediates fumarate, succinate and malate increased in response to dehydration, in contrast to a decrease in the other three ecotypes. These findings provide a link between seed respiration, energy metabolism, fatty acid β-oxidation, nitrogen mobilization and membrane permeability and the improved germination of Ler seeds following Hy-Dh cycles.
Analyzing the dynamics of cell cycle processes from fixed samples through ergodic principles.
Wheeler, Richard John
2015-11-05
Tools to analyze cyclical cellular processes, particularly the cell cycle, are of broad value for cell biology. Cell cycle synchronization and live-cell time-lapse observation are widely used to analyze these processes but are not available for many systems. Simple mathematical methods built on the ergodic principle are a well-established, widely applicable, and powerful alternative analysis approach, although they are less widely used. These methods extract data about the dynamics of a cyclical process from a single time-point "snapshot" of a population of cells progressing through the cycle asynchronously. Here, I demonstrate application of these simple mathematical methods to analysis of basic cyclical processes--cycles including a division event, cell populations undergoing unicellular aging, and cell cycles with multiple fission (schizogony)--as well as recent advances that allow detailed mapping of the cell cycle from continuously changing properties of the cell such as size and DNA content. This includes examples using existing data from mammalian, yeast, and unicellular eukaryotic parasite cell biology. Through the ongoing advances in high-throughput cell analysis by light microscopy, electron microscopy, and flow cytometry, these mathematical methods are becoming ever more important and are a powerful complementary method to traditional synchronization and time-lapse cell cycle analysis methods. © 2015 Wheeler. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Environmental tests of metallization systems for terrestrial photovoltaic cells
NASA Technical Reports Server (NTRS)
Alexander, P., Jr.
1985-01-01
Seven different solar cell metallization systems were subjected to temperature cycling tests and humidity tests. Temperature cycling excursions were -50 deg C to 150 deg C per cycle. Humidity conditions were 70 deg C at 98% relative humidity. The seven metallization systems were: Ti/Ag, Ti/Pd/Ag, Ti/Pd/Cu, Ni/Cu, Pd/Ni/Solder, Cr/Pd/Ag, and thick film Ag. All metallization systems showed a slight to moderate decrease in cell efficiencies after subjection to 1000 temperature cycles. Six of the seven metallization systems also evidenced slight increases in cell efficiencies after moderate numbers of cycles, generally less than 100 cycles. The copper based systems showed the largest decrease in cell efficiencies after temperature cycling. All metallization systems showed moderate to large decreases in cell efficiencies after 123 days of humidity exposure. The copper based systems again showed the largest decrease in cell efficiencies after humidity exposure. Graphs of the environmental exposures versus cell efficiencies are presented for each metallization system, as well as environmental exposures versus fill factors or series resistance.
Shedding Light on the Nature of Seminal Round Cells
Palermo, Gianpiero D.; Neri, Queenie V.; Cozzubbo, Tyler; Cheung, Stephanie; Pereira, Nigel; Rosenwaks, Zev
2016-01-01
Introduction In this investigation we assess the incidence of round cells (RCs) in semen samples in our infertile patient population and their significance on intracytoplasmic sperm injection (ICSI) cycle outcomes. We also evaluate the usefulness of RCs as indicators of bacterial infection and highlight the origin of this cell-type, as well as its role in the human ejaculate. Patients and Methods In a prospective fashion, a total of 4,810 ejaculated samples were included in the study during a period of 24 months. RCs were characterized for white blood cell (WBC) components versus exfoliated germ cells by testing for multiple markers of ploidy as well as protamine assays. Cases displaying ≥ 2 x 106/ml RCs were screened for bacteria. Raw specimens containing RC were processed by peroxidase and other leukocyte assays, specific stains for protamines were used to identify spermiogenic stage, aneuploidy (FISH) assessment was carried out, and the presence of various Sertoli-cell cytoplasmic remnants was analyzed to identify and characterize immature germ cells. The effect of RC on clinical outcome was assessed in specimens used for ICSI. Results The average age of the men involved was 39.2 ± 7 years. Semen samples had a mean concentration of 40.7 ± 31 x 106/ml, motility of 42.6 ± 35%, and morphology of 2.3 ± 2%. RCs were identified in 261 specimens, representing a proportion of 5.4%. Men with RCs had comparable age but lower sperm concentration and morphology than the control group (P<0.001). The aneuploidy rate of 4.3% in RCs group was remarkably higher than the control group (2.3%; P<0.001). Sperm aneuploidy rate positively correlated with the number of RCs (P<0.001). Of 44 men, 17 of them in 18 cycles had up to 1.9 x 106/ml RCs without affecting fertilization and clinical pregnancy rates when compared to controls (n = 365 cycles). In 27 men undergoing 33 ICSI cycles with ≥ 2 x 106/ml RCs, the fertilization rate trended lower and the miscarriage rate was significantly increased (P = 0.05). There was lack of correlation between RC and bacteriological growth. Specific markers indicated that seminal RCs are mostly immature germ cells encased in the remnants of Sertoli cell cytoplasm. Moreover, their modest protamine content and their haploid status confirm that they are post-meiotic. Sequential observation in the same man showed that RC episodes were followed by an amelioration of semen parameters, and interestingly, the episodic occurrence of RCs often coincides with flu season peaks. Conclusions Seminal RCs are not a marker of infectiousness but rather a transient indicator of spermatogenic insult that possibly occurs in most men following a mild and transient ailment such as the flu. PMID:26982590
Cell cycle-tailored targeting of metastatic melanoma: Challenges and opportunities.
Haass, Nikolas K; Gabrielli, Brian
2017-07-01
The advent of targeted therapies of metastatic melanoma, such as MAPK pathway inhibitors and immune checkpoint antagonists, has turned dermato-oncology from the "bad guy" to the "poster child" in oncology. Current targeted therapies are effective, although here is a clear need to develop combination therapies to delay the onset of resistance. Many antimelanoma drugs impact on the cell cycle but are also dependent on certain cell cycle phases resulting in cell cycle phase-specific drug insensitivity. Here, we raise the question: Have combination trials been abandoned prematurely as ineffective possibly only because drug scheduling was not optimized? Firstly, if both drugs of a combination hit targets in the same melanoma cell, cell cycle-mediated drug insensitivity should be taken into account when planning combination therapies, timing of dosing schedules and choice of drug therapies in solid tumors. Secondly, if the combination is designed to target different tumor cell subpopulations of a heterogeneous tumor, one drug effective in a particular subpopulation should not negatively impact on the other drug targeting another subpopulation. In addition to the role of cell cycle stage and progression on standard chemotherapeutics and targeted drugs, we discuss the utilization of cell cycle checkpoint control defects to enhance chemotherapeutic responses or as targets themselves. We propose that cell cycle-tailored targeting of metastatic melanoma could further improve therapy outcomes and that our real-time cell cycle imaging 3D melanoma spheroid model could be utilized as a tool to measure and design drug scheduling approaches. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Transcriptome changes and cAMP oscillations in an archaeal cell cycle.
Baumann, Anke; Lange, Christian; Soppa, Jörg
2007-06-11
The cell cycle of all organisms includes mass increase by a factor of two, replication of the genetic material, segregation of the genome to different parts of the cell, and cell division into two daughter cells. It is tightly regulated and typically includes cell cycle-specific oscillations of the levels of transcripts, proteins, protein modifications, and signaling molecules. Until now cell cycle-specific transcriptome changes have been described for four eukaryotic species ranging from yeast to human, but only for two prokaryotic species. Similarly, oscillations of small signaling molecules have been identified in very few eukaryotic species, but not in any prokaryote. A synchronization procedure for the archaeon Halobacterium salinarum was optimized, so that nearly 100% of all cells divide in a time interval that is 1/4th of the generation time of exponentially growing cells. The method was used to characterize cell cycle-dependent transcriptome changes using a genome-wide DNA microarray. The transcript levels of 87 genes were found to be cell cycle-regulated, corresponding to 3% of all genes. They could be clustered into seven groups with different transcript level profiles. Cluster-specific sequence motifs were detected around the start of the genes that are predicted to be involved in cell cycle-specific transcriptional regulation. Notably, many cell cycle genes that have oscillating transcript levels in eukaryotes are not regulated on the transcriptional level in H. salinarum. Synchronized cultures were also used to identify putative small signaling molecules. H. salinarum was found to contain a basal cAMP concentration of 200 microM, considerably higher than that of yeast. The cAMP concentration is shortly induced directly prior to and after cell division, and thus cAMP probably is an important signal for cell cycle progression. The analysis of cell cycle-specific transcriptome changes of H. salinarum allowed to identify a strategy of transcript level regulation that is different from all previously characterized species. The transcript levels of only 3% of all genes are regulated, a fraction that is considerably lower than has been reported for four eukaryotic species (6%-28%) and for the bacterium C. crescentus (19%). It was shown that cAMP is present in significant concentrations in an archaeon, and the phylogenetic profile of the adenylate cyclase indicates that this signaling molecule is widely distributed in archaea. The occurrence of cell cycle-dependent oscillations of the cAMP concentration in an archaeon and in several eukaryotic species indicates that cAMP level changes might be a phylogenetically old signal for cell cycle progression.
Ecdysone signaling induces two phases of cell cycle exit in Drosophila cells
Guo, Yongfeng; Flegel, Kerry; Kumar, Jayashree; McKay, Daniel J.
2016-01-01
ABSTRACT During development, cell proliferation and differentiation must be tightly coordinated to ensure proper tissue morphogenesis. Because steroid hormones are central regulators of developmental timing, understanding the links between steroid hormone signaling and cell proliferation is crucial to understanding the molecular basis of morphogenesis. Here we examined the mechanism by which the steroid hormone ecdysone regulates the cell cycle in Drosophila. We find that a cell cycle arrest induced by ecdysone in Drosophila cell culture is analogous to a G2 cell cycle arrest observed in the early pupa wing. We show that in the wing, ecdysone signaling at the larva-to-puparium transition induces Broad which in turn represses the cdc25c phosphatase String. The repression of String generates a temporary G2 arrest that synchronizes the cell cycle in the wing epithelium during early pupa wing elongation and flattening. As ecdysone levels decline after the larva-to-puparium pulse during early metamorphosis, Broad expression plummets, allowing String to become re-activated, which promotes rapid G2/M progression and a subsequent synchronized final cell cycle in the wing. In this manner, pulses of ecdysone can both synchronize the final cell cycle and promote the coordinated acquisition of terminal differentiation characteristics in the wing. PMID:27737823
DNA replication checkpoint promotes G1-S transcription by inactivating the MBF repressor Nrm1
de Bruin, R. A. M.; Kalashnikova, T. I.; Aslanian, A.; Wohlschlegel, J.; Chahwan, C.; Yates, J. R.; Russell, P.; Wittenberg, C.
2008-01-01
The cell cycle transcriptional program imposes order on events of the cell-cycle and is a target for signals that regulate cell-cycle progression, including checkpoints required to maintain genome integrity. Neither the mechanism nor functional significance of checkpoint regulation of the cell-cycle transcription program are established. We show that Nrm1, an MBF-specific transcriptional repressor acting at the transition from G1 to S phase of the cell cycle, is at the nexus between the cell cycle transcriptional program and the DNA replication checkpoint in fission yeast. Phosphorylation of Nrm1 by the Cds1 (Chk2) checkpoint protein kinase, which is activated in response to DNA replication stress, promotes its dissociation from the MBF transcription factor. This leads to the expression of genes encoding components that function in DNA replication and repair pathways important for cell survival in response to arrested DNA replication. PMID:18682565
Zhan, Ming; Riordon, Daniel R.; Yan, Bin; Tarasova, Yelena S.; Bruweleit, Sarah; Tarasov, Kirill V.; Li, Ronald A.; Wersto, Robert P.; Boheler, Kenneth R.
2012-01-01
Embryonic stem cells (ESCs) are pluripotent and have unlimited self-renewal capacity. Although pluripotency and differentiation have been examined extensively, the mechanisms responsible for self-renewal are poorly understood and are believed to involve an unusual cell cycle, epigenetic regulators and pluripotency-promoting transcription factors. Here we show that B-MYB, a cell cycle regulated phosphoprotein and transcription factor critical to the formation of inner cell mass, is central to the transcriptional and co-regulatory networks that sustain normal cell cycle progression and self-renewal properties of ESCs. Phenotypically, B-MYB is robustly expressed in ESCs and induced pluripotent stem cells (iPSCs), and it is present predominantly in a hypo-phosphorylated state. Knockdown of B-MYB results in functional cell cycle abnormalities that involve S, G2 and M phases, and reduced expression of critical cell cycle regulators like ccnb1 and plk1. By conducting gene expression profiling on control and B-MYB deficient cells, ChIP-chip experiments, and integrative computational analyses, we unraveled a highly complex B-MYB-mediated transcriptional network that guides ESC self-renewal. The network encompasses critical regulators of all cell cycle phases and epigenetic regulators, pluripotency transcription factors, and differentiation determinants. B-MYB along with E2F1 and c-MYC preferentially co-regulate cell cycle target genes. B-MYB also co-targets genes regulated by OCT4, SOX2 and NANOG that are significantly associated with stem cell differentiation, embryonic development, and epigenetic control. Moreover, loss of B-MYB leads to a breakdown of the transcriptional hierarchy present in ESCs. These results coupled with functional studies demonstrate that B-MYB not only controls and accelerates cell cycle progression in ESCs it contributes to fate decisions and maintenance of pluripotent stem cell identity. PMID:22936984
Zhan, Ming; Riordon, Daniel R; Yan, Bin; Tarasova, Yelena S; Bruweleit, Sarah; Tarasov, Kirill V; Li, Ronald A; Wersto, Robert P; Boheler, Kenneth R
2012-01-01
Embryonic stem cells (ESCs) are pluripotent and have unlimited self-renewal capacity. Although pluripotency and differentiation have been examined extensively, the mechanisms responsible for self-renewal are poorly understood and are believed to involve an unusual cell cycle, epigenetic regulators and pluripotency-promoting transcription factors. Here we show that B-MYB, a cell cycle regulated phosphoprotein and transcription factor critical to the formation of inner cell mass, is central to the transcriptional and co-regulatory networks that sustain normal cell cycle progression and self-renewal properties of ESCs. Phenotypically, B-MYB is robustly expressed in ESCs and induced pluripotent stem cells (iPSCs), and it is present predominantly in a hypo-phosphorylated state. Knockdown of B-MYB results in functional cell cycle abnormalities that involve S, G2 and M phases, and reduced expression of critical cell cycle regulators like ccnb1 and plk1. By conducting gene expression profiling on control and B-MYB deficient cells, ChIP-chip experiments, and integrative computational analyses, we unraveled a highly complex B-MYB-mediated transcriptional network that guides ESC self-renewal. The network encompasses critical regulators of all cell cycle phases and epigenetic regulators, pluripotency transcription factors, and differentiation determinants. B-MYB along with E2F1 and c-MYC preferentially co-regulate cell cycle target genes. B-MYB also co-targets genes regulated by OCT4, SOX2 and NANOG that are significantly associated with stem cell differentiation, embryonic development, and epigenetic control. Moreover, loss of B-MYB leads to a breakdown of the transcriptional hierarchy present in ESCs. These results coupled with functional studies demonstrate that B-MYB not only controls and accelerates cell cycle progression in ESCs it contributes to fate decisions and maintenance of pluripotent stem cell identity.
Su, Jingjing; Zhou, Houguang; Tao, Yinghong; Guo, Zhuangli; Zhang, Shuo; Zhang, Yu; Huang, Yanyan; Tang, Yuping; Hu, Renming; Dong, Qiang
2015-01-01
Cell cycle processes play a vital role in vascular endothelial proliferation and dysfunction. Cell division cycle protein 14 (Cdc14) is an important cell cycle regulatory phosphatase. Previous studies in budding yeast demonstrated that Cdc14 could trigger the inactivation of mitotic cyclin-dependent kinases (Cdks), which are required for mitotic exit and cytokinesis. However, the exact function of human Cdc14 (hCdc14) in cell cycle regulation during vascular diseases is yet to be elucidated. There are two HCdc14 homologs: hCdc14A and hCdc14B. In the current study, we investigated the potential role of hCdc14A in high glucose-, free fatty acids (FFAs)-, and hypoxia-induced injury in cultured human brain vascular endothelial cells (HBVECs). Data revealed that high glucose, FFA, and hypoxia down-regulated hCdc14A expression remarkably, and also affected the expression of other cell cycle-related proteins such as cyclin B, cyclin D, cyclin E, and p53. Furthermore, the combined addition of the three stimuli largely blocked cell cycle progression, decreased cell proliferation, and increased apoptosis. We also determined that hCdc14A was localized mainly to centrosomes during interphase and spindles during mitosis using confocal microscopy, and that it could affect the expression of other cycle-related proteins. More importantly, the overexpression of hCdc14A accelerated cell cycle progression, enhanced cell proliferation, and promoted neoplastic transformation, whereas the knockdown of hCdc14A using small interfering RNA produced the opposite effects. Therefore, these findings provide novel evidence that hCdc14A might be involved in cell cycle regulation in cultured HBVECs during high glucose-, FFA-, and hypoxia-induced injury. Copyright © 2014 Elsevier Inc. All rights reserved.
Role of senescence and mitotic catastrophe in cancer therapy
2010-01-01
Senescence and mitotic catastrophe (MC) are two distinct crucial non-apoptotic mechanisms, often triggered in cancer cells and tissues in response to anti-cancer drugs. Chemotherapeuticals and myriad other factors induce cell eradication via these routes. While senescence drives the cells to a state of quiescence, MC drives the cells towards death during the course of mitosis. The senescent phenotype distinguishes tumor cells that survived drug exposure but lost the ability to form colonies from those that recover and proliferate after treatment. Although senescent cells do not proliferate, they are metabolically active and may secrete proteins with potential tumor-promoting activities. The other anti-proliferative response of tumor cells is MC that is a form of cell death that results from abnormal mitosis and leads to the formation of interphase cells with multiple micronuclei. Different classes of cytotoxic agents induce MC, but the pathways of abnormal mitosis differ depending on the nature of the inducer and the status of cell-cycle checkpoints. In this review, we compare the two pathways and mention that they are activated to curb the growth of tumors. Altogether, we have highlighted the possibilities of the use of senescence targeting drugs, mitotic kinases and anti-mitotic agents in fabricating novel strategies in cancer control. PMID:20205872
Two inhibitory systems and CKIs regulate cell cycle exit of mammalian cardiomyocytes after birth
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tane, Shoji; Okayama, Hitomi; Ikenishi, Aiko
Mammalian cardiomyocytes actively proliferate during embryonic stages, following which they exit their cell cycle after birth, and the exit is maintained. Previously, we showed that two inhibitory systems (the G1-phase inhibitory system: repression of cyclin D1 expression; the M-phase inhibitory system: inhibition of CDK1 activation) maintain the cell cycle exit of mouse adult cardiomyocytes. We also showed that two CDK inhibitors (CKIs), p21{sup Cip1} and p27{sup Kip1}, regulate the cell cycle exit in a portion of postnatal cardiomyocytes. It remains unknown whether the two inhibitory systems are involved in the cell cycle exit of postnatal cardiomyocytes and whether p21{sup Cip1}more » and p27{sup Kip1} also inhibit entry to M-phase. Here, we showed that more than 40% of cardiomyocytes entered an additional cell cycle by induction of cyclin D1 expression at postnatal stages, but M-phase entry was inhibited in the majority of cardiomyocytes. Marked cell cycle progression and endoreplication were observed in cardiomyocytes of p21{sup Cip1} knockout mice at 4 weeks of age. In addition, tri- and tetranucleated cardiomyocytes increased significantly in p21{sup Cip1} knockout mice. These data showed that the G1-phase inhibitory system and two CKIs (p21{sup Cip1} and p27{sup Kip1}) inhibit entry to an additional cell cycle in postnatal cardiomyocytes, and that the M-phase inhibitory system and p21{sup Cip1} inhibit M-phase entry of cardiomyocytes which have entered the additional cell cycle. - Highlights: • Many postnatal cardiomyocytes entered an additional cell cycle by cyclin D1 induction. • The majority of cardiomyocytes could not enter M-phase after cyclin D1 induction. • Cell cycle progressed markedly in p21{sup Cip1} knockout mice after postnatal day 14. • Tri- and tetranucleated cardiomyocytes increased in p21{sup Cip1} knockout mice.« less
Dynamics of Human Telomerase Holoenzyme Assembly and Subunit Exchange across the Cell Cycle*
Vogan, Jacob M.; Collins, Kathleen
2015-01-01
Human telomerase acts on telomeres during the genome synthesis phase of the cell cycle, accompanied by its concentration in Cajal bodies and transient colocalization with telomeres. Whether the regulation of human telomerase holoenzyme assembly contributes to the cell cycle restriction of telomerase function is unknown. We investigated the steady-state levels, assembly, and exchange dynamics of human telomerase subunits with quantitative in vivo cross-linking and other methods. We determined the physical association of telomerase subunits in cells blocked or progressing through the cell cycle as synchronized by multiple protocols. The total level of human telomerase RNA (hTR) was invariant across the cell cycle. In vivo snapshots of telomerase holoenzyme composition established that hTR remains bound to human telomerase reverse transcriptase (hTERT) throughout all phases of the cell cycle, and subunit competition assays suggested that hTERT-hTR interaction is not readily exchangeable. In contrast, the telomerase holoenzyme Cajal body-associated protein, TCAB1, was released from hTR in mitotic cells coincident with TCAB1 delocalization from Cajal bodies. This telomerase holoenzyme disassembly was reversible with cell cycle progression without any change in total TCAB1 protein level. Consistent with differential cell cycle regulation of hTERT-hTR and TCAB1-hTR protein-RNA interactions, overexpression of hTERT or TCAB1 had limited if any influence on hTR assembly of the other subunit. Overall, these findings revealed a cell cycle regulation that disables human telomerase association with telomeres while preserving the co-folded hTERT-hTR ribonucleoprotein catalytic core. Studies here, integrated with previous work, led to a unifying model for telomerase subunit assembly and trafficking in human cells. PMID:26170453
Distinguishing between stochasticity and determinism: Examples from cell cycle duration variability.
Pearl Mizrahi, Sivan; Sandler, Oded; Lande-Diner, Laura; Balaban, Nathalie Q; Simon, Itamar
2016-01-01
We describe a recent approach for distinguishing between stochastic and deterministic sources of variability, focusing on the mammalian cell cycle. Variability between cells is often attributed to stochastic noise, although it may be generated by deterministic components. Interestingly, lineage information can be used to distinguish between variability and determinism. Analysis of correlations within a lineage of the mammalian cell cycle duration revealed its deterministic nature. Here, we discuss the sources of such variability and the possibility that the underlying deterministic process is due to the circadian clock. Finally, we discuss the "kicked cell cycle" model and its implication on the study of the cell cycle in healthy and cancerous tissues. © 2015 WILEY Periodicals, Inc.
Nepal, Saroj; Shrestha, Anup; Park, Pil-Hoon
2015-09-05
Adiponectin and leptin, both produced from adipose tissue, cause cell cycle arrest and progression, respectively in cancer cells. Ubiquitin specific protease-2 (USP-2), a deubiquitinating enzyme, is known to impair proteasome-induced degradation of cyclin D1, a critical cell cycle regulator. Herein, we investigated the effects of these adipokines on USP-2 expression and its potential role in the modulation of cell cycle. Treatment with globular adiponectin (gAcrp) decreased, whereas leptin increased USP-2 expression both in human hepatoma and breast cancer cells. In addition, overexpression or gene silencing of USP-2 affected cyclin D1 expression and cell cycle progression/arrest by adipokines. Adiponectin and leptin also modulated in vitro proteasomal activity, which was partially dependent on USP-2 expression. Taken together, our results reveal that modulation of USP-2 expression plays a crucial role in cell cycle regulation by adipokines. Thus, USP-2 would be a promising therapeutic target for the modulation of cancer cell growth by adipokines. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Hoose, Scott A.; Duran, Camille; Malik, Indranil; Eslamfam, Shabnam; Shasserre, Samantha C.; Downing, S. Sabina; Hoover, Evelyn M.; Dowd, Katherine E.; Smith, Roger; Polymenis, Michael
2012-01-01
Screening chemical libraries to identify compounds that affect overall cell proliferation is common. However, in most cases, it is not known whether the compounds tested alter the timing of particular cell cycle transitions. Here, we evaluated an FDA-approved drug library to identify pharmaceuticals that alter cell cycle progression in yeast, using DNA content measurements by flow cytometry. This approach revealed strong cell cycle effects of several commonly used pharmaceuticals. We show that the antilipemic gemfibrozil delays initiation of DNA replication, while cells treated with the antidepressant fluoxetine severely delay progression through mitosis. Based on their effects on cell cycle progression, we also examined cell proliferation in the presence of both compounds. We discovered a strong suppressive interaction between gemfibrozil and fluoxetine. Combinations of interest among diverse pharmaceuticals are difficult to identify, due to the daunting number of possible combinations that must be evaluated. The novel interaction between gemfibrozil and fluoxetine suggests that identifying and combining drugs that show cell cycle effects might streamline identification of drug combinations with a pronounced impact on cell proliferation. PMID:22567160
Hoose, Scott A; Duran, Camille; Malik, Indranil; Eslamfam, Shabnam; Shasserre, Samantha C; Downing, S Sabina; Hoover, Evelyn M; Dowd, Katherine E; Smith, Roger; Polymenis, Michael
2012-01-01
Screening chemical libraries to identify compounds that affect overall cell proliferation is common. However, in most cases, it is not known whether the compounds tested alter the timing of particular cell cycle transitions. Here, we evaluated an FDA-approved drug library to identify pharmaceuticals that alter cell cycle progression in yeast, using DNA content measurements by flow cytometry. This approach revealed strong cell cycle effects of several commonly used pharmaceuticals. We show that the antilipemic gemfibrozil delays initiation of DNA replication, while cells treated with the antidepressant fluoxetine severely delay progression through mitosis. Based on their effects on cell cycle progression, we also examined cell proliferation in the presence of both compounds. We discovered a strong suppressive interaction between gemfibrozil and fluoxetine. Combinations of interest among diverse pharmaceuticals are difficult to identify, due to the daunting number of possible combinations that must be evaluated. The novel interaction between gemfibrozil and fluoxetine suggests that identifying and combining drugs that show cell cycle effects might streamline identification of drug combinations with a pronounced impact on cell proliferation.
Cell cycle re-entry sensitizes podocytes to injury induced death.
Hagen, Manuel; Pfister, Eva; Kosel, Andrea; Shankland, Stuart; Pippin, Jeffrey; Amann, Kerstin; Daniel, Christoph
2016-07-17
Podocytes are terminally differentiated renal cells, lacking the ability to regenerate by proliferation. However, during renal injury, podocytes re-enter into the cell cycle but fail to divide. Earlier studies suggested that re-entry into cell cycle results in loss of podocytes, but a direct evidence for this is lacking. Therefore, we established an in vitro model to test the consequences of re-entry into the cell cycle on podocyte survival. A mouse immortalized podocyte cell line was differentiated to non-permissive podocytes and stimulated with e.g. growth factors. Stimulated cells were analyzed for mRNA-expression or stained for cell cycle analysis using flow cytometry and immunocytofluorescence microscopy. After stimulation to re-entry into cell cycle, podocytes were stressed with puromycin aminonucleoside (PAN) and analyzed for survival. During permissive stage more than 40% of immortalized podocytes were in the S-phase. In contrast, S-phase in non-permissive differentiated podocytes was reduced to 5%. Treatment with b-FGF dose dependently induced re-entry into cell cycle increasing the number of podocytes in the S-phase to 10.7% at an optimal bFGF dosage of 10 ng/ml. Forty eight hours after stimulation with bFGF the number of bi-nucleated podocytes significantly increased. A secondary injury stimulus significantly reduced podocyte survival preferentially in bi-nucleated podocytes In conclusion, stimulation of podocytes using bFGF was able to induce re-entry of podocytes into the cell cycle and to sensitize the cells for cell death by secondary injuries. Therefore, this model is appropriate for testing new podocyte protective substances that can be used for therapy.
Susceptibility of Hep3B cells in different phases of cell cycle to tBid.
Ma, Shi-Hong; Chen, George G; Ye, Caiguo; Leung, Billy C S; Ho, Rocky L K; Lai, Paul B S
2011-01-01
tBid is a pro-apoptotic molecule. Apoptosis inducers usually act in a cell cycle-specific fashion. The aim of this study was to elucidate whether effect of tBid on hepatocellular carcinoma (HCC) Hep3B cells was cell cycle phase specific. We synchronized Hep3B cells at G0/G1, S or G2/M phases by chemicals or flow sorting and tested the susceptibility of the cells to recombinant tBid. Cell viability was measured by MTT assay and apoptosis by TUNEL. The results revealed that tBid primarily targeted the cells at G0/G1 phase of cell cycle, and it also increased the cells at the G2/M phase. 5-Fluorouracil (5-FU), on the other hand, arrested Hep3B cells at the G0/G1 phase, but significantly reduced cells at G2/M phase. The levels of cell cycle-related proteins and caspases were altered in line with the change in the cell cycle. The combination of tBid with 5-FU caused more cells to be apoptotic than either agent alone. Therefore, the complementary effect of tBid and 5-FU on different phases of the cell cycle may explain their synergistric effect on Hep3B cells. The elucidation of the phase-specific effect of tBid points to a possible therapeutic option that combines different phase specific agents to overcome resistance of HCC. Copyright © 2010 Elsevier B.V. All rights reserved.
Thermal stress cycling of GaAs solar cells
NASA Technical Reports Server (NTRS)
Francis, Robert W.
1987-01-01
Thermal stress cycling was performed on gallium arsenide solar cells to investigate their electrical, mechanical, and structural integrity. Cells were cycled under low Earth orbit (LEO) simulated temperature conditions in vacuum. Cell evaluations consisted of power output values, spectral response, optical microscopy and ion microprobe mass analysis, and depth profiles on both front surface inter-grid areas and metallization contact grid lines. Cells were examined for degradation after 500, 5,000, 10,000 and 15,245 thermal cycles. No indication of performance degradation was found for any vendor's cell lot.
Effect of LEO cycling on 125 Ah advanced design IPV nickel-hydrogen flight cells. An update
NASA Technical Reports Server (NTRS)
Smithrick, John J.; Hall, Stephen W.
1991-01-01
Validation testing of the NASA Lewis 125 Ah advanced design individual pressure vessel (IPV) nickel-hydrogen flight cells was conducted. Work consisted of characterization, storage, and cycle life testing. There was no capacity degradation after 52 days of storage with the cells in the discharged state, an open circuit, 0 C, and a hydrogen pressure of 14.5 psia. The catalyzed wall wick cells were cycled for over 11,000 cycles with no cell failures in the continuing test. One of the noncatalyzed wall wick cells failed.
Goldman, Stewart; Yamada, Tohru; Beattie, Craig W.; Bressler, Linda; Pacini, Michael; Pollack, Ian F.; Fisher, Paul Graham; Packer, Roger J.; Dunkel, Ira J.; Dhall, Girish; Wu, Shengjie; Onar, Arzu; Boyett, James M.; Fouladi, Maryam
2016-01-01
Background p53 is a promising target in human cancer. p28 is a cell-penetrating peptide that preferentially enters cancer cells and binds to both wild-type and mutant p53 protein, inhibiting COP1-mediated ubiquitination and proteasomal degradation. This results in increased levels of p53, which induces cell cycle arrest at G2/M. We conducted a phase I study to determine the maximum-tolerated dose (MTD) and describe the dose-limiting toxicities (DLTs) and pharmacokinetics (PKs) of p28 in children. Methods Children aged 3–21 years with recurrent or progressive central nervous system tumors were eligible. Intravenous p28 was administered 3 times weekly for 4 consecutive weeks of a 6-week cycle at 4.16 mg/kg/dose (the adult recommended phase II dose) using a rolling-6 study design. Expression status of p53 was characterized by immunohistochemistry, and serum PK parameters were established on the second dose. Results Of the 18 eligible patients enrolled in the study, 12 completed the DLT monitoring period and were evaluable for toxicity. p28 was well-tolerated; 7 participants received ≥2 courses, and the most common adverse event attributed to the drug was transient grade 1 infusion-related reaction. PK analysis revealed a profile similar to adults; however, an increased area under the curve was observed in pediatric patients. High p53 expression in tumor cell nuclei was observed in 6 of 12 available tissue samples. There were no objective responses; 2 participants remained stable on the study for >4 cycles. Conclusions This phase I study demonstrated that p28 is well-tolerated in children with recurrent CNS malignancies at the adult recommended phase II dose. PMID:27022131
Hassan, Hanaa A; Serag, Hanaa M; Qadir, Makwan S; Ramadan, Mohamed Fawzy
2017-10-01
Cape gooseberry (Physalis peruviana) fruit is highly nutritious with high content of health-promoting compounds including minerals, phenolic compounds, as well as vitamins A and C. Physalis peruviana fruits were used as mutagenic, antispasmodic, anticoagulant, and antileucemis agents. The objective of the present work was to study the role of cape gooseberry juice (CG) as a natural modulator agent for adverse aspects associated with hepatocellular carcinoma (HCC). The results recorded that HCC rats had a significant disturbance in blood indices. An elevation in serum level of the inflammatory (TNF-ά, CRP, and Argenase), hepatic apoptotic markers (P53, Bax, and Caspase 3) and a reduction of Blc2% were recorded in HCC rats. The results exhibited the significant disturbance and arrest in hepatic cell cycle (% of M1: SubG1 phase, M2: G0/1 phase of diploid cycle, M3: S phase, and M4: G2/M phase) as well as liver cell viability status in HCC rats. Numerous histopathological alterations were detected in hepatic tissues of HCC rats such as inflammation, damage of hepatocytes, dilated congested central vein with degenerated endothelial cells and congested blood sinusoids in addition to collagen fibers in hepatocytes and central vein indicating hepatic fibrosis. The tested parameters were little improved upon treatment of HCC rats with Adriamycin (ADR, Doxorubicin is a generic name of a drug). HCC rats received CG showed an improvement in all tested parameters. The effects of CG were through down regulation of p53 expression and up-regulation of Bcl2 domain protected hepatic structure from extensive damage. CG plus ADR exhibited an enhanced antitumor impact in HCC and this combination might have an important value in the treatment of HCC. CG was more effective than ADR, and it has a remarkable role in the management of hepatic disorders besides its success as a chemo-sensitizer for ADR treatment of hepatocellular carcinoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Regulation of callus status and cell-suspending culture in naked seed oat (Avena nuda).
Cui, L; Fan, Y
1998-01-01
The original calli were obtained by inducing culture of mature embryos of naked seed oat on N6 medium. The original calli were white-colored tumor forms, soft outside and hard inside. These kinds of calli are easy to differentiate into plantlets, and they are not the friable type. Friable embryogenic calli could be obtained by cycled regulated culture on IM1-IM4 medium for 7-8 months from the original calli. They became vigorous, lightish yellow in color, with small grainy forms. Well-separated and fast-growing suspending cell lines have been obtained from the above-mentioned embryogenic calli in the liquid medium. Regenerated plants have been obtained for this kind of suspension line by culturing on the medium for differentiation. The surviving percentage for such plantlets was over 95% after planting in the soil.
Exploring a Link Between NF-KB and G2/M Cell Cycle Arrest in Breast Cancer Cells
2005-04-01
studies with esophageal squamous cell carcinom a lines have shown that IR induced p21waf1/ ciP ’ and a G2 cell cycle arrest that could als o be...i AD Award Number : DAMD17-02-1-062 3 TITLE : Exploring a Link Between NF-KB and G 2 /M Cell Cycle Arres t in Breast Cancer Cell s PRINCIPAL...Mar 2005 ) 4 . TITLE AND SUBTITL E Exploring a Link Between NF-kB and G 2 /M Cell Cycle Arres t in Breast Cancer Cells 5. FUND/NG NUMBERS DAMD17-02-1
Temporal remodeling of the cell cycle accompanies differentiation in the Drosophila germline.
Hinnant, Taylor D; Alvarez, Arturo A; Ables, Elizabeth T
2017-09-01
Development of multicellular organisms relies upon the coordinated regulation of cellular differentiation and proliferation. Growing evidence suggests that some molecular regulatory pathways associated with the cell cycle machinery also dictate cell fate; however, it remains largely unclear how the cell cycle is remodeled in concert with cell differentiation. During Drosophila oogenesis, mature oocytes are created through a series of precisely controlled division and differentiation steps, originating from a single tissue-specific stem cell. Further, germline stem cells (GSCs) and their differentiating progeny remain in a predominantly linear arrangement as oogenesis proceeds. The ability to visualize the stepwise events of differentiation within the context of a single tissue make the Drosophila ovary an exceptional model for study of cell cycle remodeling. To describe how the cell cycle is remodeled in germ cells as they differentiate in situ, we used the Drosophila Fluorescence Ubiquitin-based Cell Cycle Indicator (Fly-FUCCI) system, in which degradable versions of GFP::E2f1 and RFP::CycB fluorescently label cells in each phase of the cell cycle. We found that the lengths of the G1, S, and G2 phases of the cell cycle change dramatically over the course of differentiation, and identified the 4/8-cell cyst as a key developmental transition state in which cells prepare for specialized cell cycles. Our data suggest that the transcriptional activator E2f1, which controls the transition from G1 to S phase, is a key regulator of mitotic divisions in the early germline. Our data support the model that E2f1 is necessary for proper GSC proliferation, self-renewal, and daughter cell development. In contrast, while E2f1 degradation by the Cullin 4 (Cul4)-containing ubiquitin E3 ligase (CRL4) is essential for developmental transitions in the early germline, our data do not support a role for E2f1 degradation as a mechanism to limit GSC proliferation or self-renewal. Taken together, these findings provide further insight into the regulation of cell proliferation and the acquisition of differentiated cell fate, with broad implications across developing tissues. Copyright © 2017 Elsevier Inc. All rights reserved.
Banyai, Gabor; Baïdi, Feriel; Coudreuse, Damien; Szilagyi, Zsolt
2016-01-01
Cell proliferation is regulated by cyclin-dependent kinases (Cdks) and requires the periodic expression of particular gene clusters in different cell cycle phases. However, the interplay between the networks that generate these transcriptional oscillations and the core cell cycle machinery remains largely unexplored. In this work, we use a synthetic regulable Cdk1 module to demonstrate that periodic expression is governed by quantitative changes in Cdk1 activity, with different clusters directly responding to specific activity levels. We further establish that cell cycle events neither participate in nor interfere with the Cdk1-driven transcriptional program, provided that cells are exposed to the appropriate Cdk1 activities. These findings contrast with current models that propose self-sustained and Cdk1-independent transcriptional oscillations. Our work therefore supports a model in which Cdk1 activity serves as a quantitative platform for coordinating cell cycle transitions with the expression of critical genes to bring about proper cell cycle progression. PMID:27045731
Panetta, J C; Evans, W E; Cheok, M H
2006-01-01
The antimetabolite mercaptopurine (MP) is widely used to treat childhood acute lymphoblastic leukaemia (ALL). To study the dynamics of MP on the cell cycle, we incubated human T-cell leukaemia cell lines (Molt-4 sensitive and resistant subline and P12 resistant) with 10 μM MP and measured total cell count, cell cycle distribution, percent viable, percent apoptotic, and percent dead cells serially over 72 h. We developed a mathematical model of the cell cycle dynamics after treatment with MP and used it to show that the Molt-4 sensitive controls had a significantly higher rate of cells entering apoptosis (2.7-fold, P<0.00001) relative to the resistant cell lines. Additionally, when treated with MP, the sensitive cell line showed a significant increase in the rate at which cells enter apoptosis compared to its controls (2.4-fold, P<0.00001). Of note, the resistant cell lines had a higher rate of antimetabolite incorporation into the DNA of viable cells (>1.4-fold, P<0.01). Lastly, in contrast to the other cell lines, the Molt-4 resistant subline continued to cycle, though at a rate slower relative to its control, rather than proceed to apoptosis. This led to a larger S-phase block in the Molt-4 resistant cell line, but not a higher rate of cell death. Gene expression of apoptosis, cell cycle, and repair genes were consistent with mechanistic dynamics described by the model. In summary, the mathematical model provides a quantitative assessment to compare the cell cycle effects of MP in cells with varying degrees of MP resistance. PMID:16333308
Contact guidance is cell cycle-dependent.
Pourfarhangi, Kamyar Esmaeili; De La Hoz, Edgar Cardenas; Cohen, Andrew R; Gligorijevic, Bojana
2018-09-01
Cancer cell migration is essential for metastasis, during which cancer cells move through the tumor and reach the blood vessels. In vivo , cancer cells are exposed to contact guidance and chemotactic cues. Depending on the strength of such cues, cells will migrate in a random or directed manner. While similar cues may also stimulate cell proliferation, it is not clear whether cell cycle progression affects migration of cancer cells and whether this effect is different in random versus directed migration. In this study, we tested the effect of cell cycle progression on contact guided migration in 2D and 3D environments, in the breast carcinoma cell line, FUCCI-MDA-MB-231. The results were quantified from live cell microscopy images using the open source lineage editing and validation image analysis tools (LEVER). In 2D, cells were placed inside 10 μ m-wide microchannels to stimulate contact guidance, with or without an additional chemotactic gradient of the soluble epidermal growth factor. In 3D, contact guidance was modeled by aligned collagen fibers. In both 2D and 3D, contact guidance was cell cycle-dependent, while the addition of the chemo-attractant gradient in 2D increased cell velocity and persistence in directionally migrating cells, regardless of their cell cycle phases. In both 2D and 3D contact guidance, cells in the G1 phase of the cell cycle outperformed cells in the S/G2 phase in terms of migration persistence and instantaneous velocity. These data suggest that in the presence of contact guidance cues in vivo , breast carcinoma cells in the G1 phase of the cell cycle may be more efficient in reaching the neighboring vasculature.
2008-10-01
cell cycle progression in most cell types. Mouse embryos develop normally until mid gestation without all interphase Cdks 28. Pertinent to the...Ciemerych and P. Sicinski, "Cell cycle in mouse development ," 24(17), 2877 (2005). Ref Type: Journal 5 K. Coulonval, et al., "Phosphorylations of...34 Development 135(20), 3389 (2008). Ref Type: Journal 30 J. P. Tassan, et al., "Cell cycle analysis of the activity, subcellular localization, and subunit
The Cell Cycle: An Activity Using Paper Plates to Represent Time Spent in Phases of the Cell Cycle
ERIC Educational Resources Information Center
Scherer, Yvette D.
2014-01-01
In this activity, students are given the opportunity to combine skills in math and geometry for a biology lesson in the cell cycle. Students utilize the data they collect and analyze from an online onion-root-tip activity to create a paper-plate time clock representing a 24-hour cell cycle. By dividing the paper plate into appropriate phases of…
NASA Astrophysics Data System (ADS)
Van Dolah, Frances M.; Leighfield, Tod A.; Kamykowski, Daniel; Kirkpatrick, Gary J.
2008-01-01
As a component of the ECOHAB Florida Regional Field Program, this study addresses cell cycle behavior and its importance to bloom formation of the Florida red tide dinoflagellate, Karenia brevis. The cell cycle of K. brevis was first studied by flow cytometry in laboratory batch cultures, and a laboratory mesocosm column, followed by field populations over the 5-year course of the ECOHAB program. Under all conditions studied, K. brevis displayed diel phased cell division with S-phase beginning a minimum of 6 h after the onset of light and continuing for 12-14 h. Mitosis occurred during the dark, and was generally completed by the start of the next day. The timing of cell cycle phases relative to the diel cycle did not differ substantially in bloom populations displaying radically different growth rates ( μmin 0.17-0.55) under different day lengths and temperature conditions. The rhythm of cell cycle progression is independent from the rhythm controlling vertical migration, as similar cell cycle distributions are found at all depths of the water column in field samples. The implications of these findings are discussed in light of our current understanding of the dinoflagellate cell cycle and the development of improved models for K. brevis bloom growth.
Kuritz, K; Stöhr, D; Pollak, N; Allgöwer, F
2017-02-07
Cyclic processes, in particular the cell cycle, are of great importance in cell biology. Continued improvement in cell population analysis methods like fluorescence microscopy, flow cytometry, CyTOF or single-cell omics made mathematical methods based on ergodic principles a powerful tool in studying these processes. In this paper, we establish the relationship between cell cycle analysis with ergodic principles and age structured population models. To this end, we describe the progression of a single cell through the cell cycle by a stochastic differential equation on a one dimensional manifold in the high dimensional dataspace of cell cycle markers. Given the assumption that the cell population is in a steady state, we derive transformation rules which transform the number density on the manifold to the steady state number density of age structured population models. Our theory facilitates the study of cell cycle dependent processes including local molecular events, cell death and cell division from high dimensional "snapshot" data. Ergodic analysis can in general be applied to every process that exhibits a steady state distribution. By combining ergodic analysis with age structured population models we furthermore provide the theoretic basis for extensions of ergodic principles to distribution that deviate from their steady state. Copyright © 2016 Elsevier Ltd. All rights reserved.
Laggner, Maria; Pollreisz, Andreas; Schmidinger, Gerald; Schmidt-Erfurth, Ursula; Chen, Ying-Ting
2017-01-01
Limbal stem cells (LSC) account for homeostasis and regeneration of corneal epithelium. Solar ultraviolet A (UVA) is the major source causing oxidative damage in the ocular surface. Autophagy, a lysosomal degradation mechanism, is essential for physiologic function and stress defense of stem cells. PAX6, a master transcription factor governing corneal homeostasis by regulating cell cycle and cell fate of LSC, responds to oxidative stress by nucleocytoplasmic shuttling. Impaired autophagy and deregulated PAX6 have been reported in oxidative stress-related ocular surface disorders. We hypothesize a functional role for autophagy and PAX6 in LSC’s stress response to UVA. Therefore, human LSC colonies were irradiated with a sub-lethal dose of UVA and autophagic activity and intracellular reactive oxygen species (ROS) were measured by CYTO-ID assay and CM-H2DCFDA live staining, respectively. Following UVA irradiation, the percentage of autophagic cells significantly increased in LSC colonies while intracellular ROS levels remained unaffected. siRNA-mediated knockdown (KD) of ATG7 abolished UVA-induced autophagy and led to an excessive accumulation of ROS. Upon UVA exposure, LSCs displayed nuclear-to-cytoplasmic translocation of PAX6, while ATG7KD or antioxidant pretreatment largely attenuated the intracellular trafficking event. Immunofluorescence showing downregulation of proliferative marker PCNA and induction of cell cycle regulator p21 indicates cell cycle arrest in UVA-irradiated LSC. Abolishing autophagy, adenoviral-assisted restoration of nuclear PAX6 or antioxidant pretreatment abrogated the UVA-induced cell cycle arrest. Adenoviral expression of an ectopic PAX gene, PAX7, did not affect UVA cell cycle response. Furthermore, knocking down PAX6 attenuated the cell cycle progression of irradiated ATG7KD LSC by de-repressing p21 expression. Collectively, our data suggest a crosstalk between autophagy and PAX6 in regulating cell cycle response of ocular progenitors under UVA stress. Autophagy deficiency leads to impaired intracellular trafficking of PAX6, perturbed redox balance and uncurbed cell cycle progression in UVA-stressed LSCs. The coupling of autophagic machinery and PAX6 in cell cycle regulation represents an attractive therapeutic target for hyperproliferative ocular surface disorders associated with solar radiation. PMID:28700649
Lithium Ion Testing at NSWC Crane in Support of NASA Goddard Space Flight Center
NASA Technical Reports Server (NTRS)
Brown, Harry; Jung, David; Lee, Leonine
2010-01-01
This viewgraph presentation reviews Lithium Ion Cell testing at the Naval Surface Warfare Center in Crane, India. The contents include: 1) Quallion 15 Ahr Lithium-Ion Cells, LEO Life Cycle Test; 2) Lithion 50 Ahr Lithium-Ion Cells, LEO Life Cycle Test; 3) ABSL 5 Ahr Lithium-Ion Battery, LRO-LLO Life Cycle Test, SDO-GEO Life Cycle Test; and 4) A123 40 Ahr Lithium-Ion Battery, GPM Life Cycle Test, MMS Life Cycle Test.
"Constructing" the Cell Cycle in 3D
ERIC Educational Resources Information Center
Koc, Isil; Turan, Merve
2012-01-01
The cycle of duplication and division, known as the "cell cycle," is the essential mechanism by which all living organisms reproduce. This activity allows students to develop an understanding of the main events that occur during the typical eukaryotic cell cycle mostly in the process of mitotic phase that divides the duplicated genetic material…
Muñoz-Huerta, Rafael F.; Guevara-Gonzalez, Ramon G.; Contreras-Medina, Luis M.; Torres-Pacheco, Irineo; Prado-Olivarez, Juan; Ocampo-Velazquez, Rosalia V.
2013-01-01
Nitrogen (N) plays a key role in the plant life cycle. It is the main plant mineral nutrient needed for chlorophyll production and other plant cell components (proteins, nucleic acids, amino acids). Crop yield is affected by plant N status. Thus, the optimization of nitrogen fertilization has become the object of intense research due to its environmental and economic impact. This article focuses on reviewing current methods and techniques used to determine plant N status. Kjeldahl digestion and Dumas combustion have been used as reference methods for N determination in plants, but they are destructive and time consuming. By using spectroradiometers, reflectometers, imagery from satellite sensors and digital cameras, optical properties have been measured to estimate N in plants, such as crop canopy reflectance, leaf transmittance, chlorophyll and polyphenol fluorescence. High correlation has been found between optical parameters and plant N status, and those techniques are not destructive. However, some drawbacks include chlorophyll saturation, atmospheric and soil interference, and the high cost of instruments. Electrical properties of plant tissue have been used to estimate quality in fruits, and water content in plants, as well as nutrient deficiency, which suggests that they have potential for use in plant N determination. PMID:23959242
Morphogenesis checkpoint kinase Swe1 is the executor of lipolysis-dependent cell-cycle progression.
Chauhan, Neha; Visram, Myriam; Cristobal-Sarramian, Alvaro; Sarkleti, Florian; Kohlwein, Sepp D
2015-03-10
Cell growth and division requires the precise duplication of cellular DNA content but also of membranes and organelles. Knowledge about the cell-cycle-dependent regulation of membrane and storage lipid homeostasis is only rudimentary. Previous work from our laboratory has shown that the breakdown of triacylglycerols (TGs) is regulated in a cell-cycle-dependent manner, by activation of the Tgl4 lipase by the major cyclin-dependent kinase Cdc28. The lipases Tgl3 and Tgl4 are required for efficient cell-cycle progression during the G1/S (Gap1/replication phase) transition, at the onset of bud formation, and their absence leads to a cell-cycle delay. We now show that defective lipolysis activates the Swe1 morphogenesis checkpoint kinase that halts cell-cycle progression by phosphorylation of Cdc28 at tyrosine residue 19. Saturated long-chain fatty acids and phytosphingosine supplementation rescue the cell-cycle delay in the Tgl3/Tgl4 lipase-deficient strain, suggesting that Swe1 activity responds to imbalanced sphingolipid metabolism, in the absence of TG degradation. We propose a model by which TG-derived sphingolipids are required to activate the protein phosphatase 2A (PP2A(Cdc55)) to attenuate Swe1 phosphorylation and its inhibitory effect on Cdc28 at the G1/S transition of the cell cycle.
Cell Cycle Related Differentiation of Bone Marrow Cells into Lung Cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dooner, Mark; Aliotta, Jason M.; Pimental, Jeffrey
2007-12-31
Green-fluorescent protein (GFP) labeled marrow cells transplanted into lethally irradiated mice can be detected in the lungs of transplanted mice and have been shown to express lung specific proteins while lacking the expression of hematopoietic markers. We have studied marrow cells induced to transit cell cycle by exposure to IL-3, IL-6, IL-11 and steel factor at different times of culture corresponding to different phases of cell cycle. We have found that marrow cells at the G1/S interface have a 3-fold increase in cells which assume a lung phenotype and that this increase is no longer seen in late S/G2. Thesemore » cells have been characterized as GFP{sup +} CD45{sup -} and GFP{sup +} cytokeratin{sup +}. Thus marrow cells with the capacity to convert into cells with a lung phenotype after transplantation show a reversible increase with cytokine induced cell cycle transit. Previous studies have shown the phenotype of bone marrow stem cells fluctuates reversibly as these cells traverse cell cycle, leading to a continuum model of stem cell regulation. The present studies indicate that marrow stem cell production of nonhematopoietic cells also fluctuates on a continuum.« less
Cell-cycle dynamics of chromosomal organisation at single-cell resolution
Nagano, Takashi; Lubling, Yaniv; Várnai, Csilla; Dudley, Carmel; Leung, Wing; Baran, Yael; Mendelson-Cohen, Netta; Wingett, Steven; Fraser, Peter; Tanay, Amos
2017-01-01
Summary Chromosomes in proliferating metazoan cells undergo dramatic structural metamorphoses every cell cycle, alternating between highly condensed mitotic structures facilitating chromosome segregation, and decondensed interphase structures accommodating transcription, gene silencing and DNA replication. Here we use single-cell Hi-C to study chromosome conformations in thousands of individual cells, and discover a continuum of cis-interaction profiles that finely position individual cells along the cell cycle. We show that chromosomal compartments, topological associated domains (TADs), contact insulation and long-range loops, all defined by bulk Hi-C maps, are governed by distinct cell-cycle dynamics. In particular, DNA replication correlates with build-up of compartments and reduction in TAD insulation, while loops are generally stable from G1 through S and G2. Whole-genome 3D structural models reveal a radial architecture of chromosomal compartments with distinct epigenomic signatures. Our single-cell data thereby allow for re-interpretation of chromosome conformation maps through the prism of the cell cycle. PMID:28682332
Orchestration of DNA Damage Checkpoint Dynamics across the Human Cell Cycle.
Chao, Hui Xiao; Poovey, Cere E; Privette, Ashley A; Grant, Gavin D; Chao, Hui Yan; Cook, Jeanette G; Purvis, Jeremy E
2017-11-22
Although molecular mechanisms that prompt cell-cycle arrest in response to DNA damage have been elucidated, the systems-level properties of DNA damage checkpoints are not understood. Here, using time-lapse microscopy and simulations that model the cell cycle as a series of Poisson processes, we characterize DNA damage checkpoints in individual, asynchronously proliferating cells. We demonstrate that, within early G1 and G2, checkpoints are stringent: DNA damage triggers an abrupt, all-or-none cell-cycle arrest. The duration of this arrest correlates with the severity of DNA damage. After the cell passes commitment points within G1 and G2, checkpoint stringency is relaxed. By contrast, all of S phase is comparatively insensitive to DNA damage. This checkpoint is graded: instead of halting the cell cycle, increasing DNA damage leads to slower S phase progression. In sum, we show that a cell's response to DNA damage depends on its exact cell-cycle position and that checkpoints are phase-dependent, stringent or relaxed, and graded or all-or-none. Copyright © 2017 Elsevier Inc. All rights reserved.
Fu, Yujie; Kadioglu, Onat; Wiench, Benjamin; Wei, Zuofu; Gao, Chang; Luo, Meng; Gu, Chengbo; Zu, Yuangang; Efferth, Thomas
2015-04-15
The low abundant cajanin stilbene acid (CSA) from Pigeon Pea (Cajanus cajan) has been shown to kill estrogen receptor α positive cancer cells in vitro and in vivo. Downstream effects such as cell cycle and apoptosis-related mechanisms have not been analyzed yet. We analyzed the activity of CSA by means of flow cytometry (cell cycle distribution, mitochondrial membrane potential, MMP), confocal laser scanning microscopy (MMP), DNA fragmentation assay (apoptosis), Western blotting (Bax and Bcl-2 expression, caspase-3 activation) as well as mRNA microarray hybridization and Ingenuity pathway analysis. CSA induced G2/M arrest and apoptosis in a concentration-dependent manner from 8.88 to 14.79 µM. The MMP broke down, Bax was upregulated, Bcl-2 downregulated and caspase-3 activated. Microarray profiling revealed that CSA affected BRCA-related DNA damage response and cell cycle-regulated chromosomal replication pathways. CSA inhibited breast cancer cells by DNA damage and cell cycle-related signaling pathways leading to cell cycle arrest and apoptosis. Copyright © 2015 Elsevier GmbH. All rights reserved.
NASA Astrophysics Data System (ADS)
Liu, T.; Fang, Y.; Zhang, C. P.; Chen, P.; Wang, C. Z.; Kang, H. X.; Shen, B. J.; Liang, J.; Fu, X. B.
2014-09-01
This study investigated the effect of low-level laser irradiation (LLLI) on the cell cycle and proliferative activity of cultured myoblasts, and sought to elucidate the possible cellular mechanism by which LLLI promotes the regeneration of skeletal muscle in vivo. Primary myoblasts isolated from rat hindlegs were irradiated with helium-neon laser light at different energy densities. Distributions of cell-cycle subpopulations and the expression of cell-cycle regulatory proteins in myoblasts were assessed using flow cytometric analysis and western blot assay. It was found that laser irradiation stimulated cell-cycle entry; induced the expression of cyclin A and cyclin D; and increased cell proliferation index and bromodeoxyuridine incorporation as compared to the unirradiated control cells, indicating LLLI augmented the number of proliferative myoblasts in the S phase and G2/M phase of the cell cycle. These results suggest that LLLI at certain fluxes and wavelengths could activate quiescent myoblasts, leading to cell division and facilitating new myofiber formation. This could contribute to the improvement of skeletal muscle regeneration following trauma and myopathic diseases.
Emanuele, Michael J; Ciccia, Alberto; Elia, Andrew E H; Elledge, Stephen J
2011-06-14
The anaphase-promoting complex/cyclosome (APC/C) is a cell cycle-regulated E3 ubiquitin ligase that controls the degradation of substrate proteins at mitotic exit and throughout the G1 phase. We have identified an APC/C substrate and cell cycle-regulated protein, KIAA0101/PAF15. PAF15 protein levels peak in the G2/M phase of the cell cycle and drop rapidly at mitotic exit in an APC/C- and KEN-box-dependent fashion. PAF15 associates with proliferating cell nuclear antigen (PCNA), and depletion of PAF15 decreases the number of cells in S phase, suggesting a role for it in cell cycle regulation. Following irradiation, PAF15 colocalized with γH2AX foci at sites of DNA damage through its interaction with PCNA. Finally, PAF15 depletion led to an increase in homologous recombination-mediated DNA repair, and overexpression caused sensitivity to UV-induced DNA damage. We conclude that PAF15 is an APC/C-regulated protein involved in both cell cycle progression and the DNA damage response.
The impact of p53 on the early stage replication of retrovirus.
Kinnetz, Michaela; Alghamdi, Faris; Racz, Michael; Hu, Wenwei; Shi, Binshan
2017-08-09
The function of p53 in cancer biology has been studied extensively, but its role in anti-retrovirus infection has been elusive for many years. The restriction of retrovirus early stage replication by p53 was investigated in this study. VSV-G pseudotyped retrovirus with GFP reporter gene was used to infect both HCT116 p53 +/+ cells and its isogenic p53 knockout HCT116 p53 -/- cells. The infection was detected by flow cytometry. Reverse transcription products were quantified by real time PCR. Mutation analysis was performed after 1-LTR cycle and 2-LTR cycle DNA were amplified and PCR products were sequenced. Transcription and translation of cyclin-dependent kinase inhibitor 1 (p21 Cip1 ) and SAM domain and HD domain-containing protein 1 (SAMHD1) were analyzed by TaqMan PCR and Western blot experiments. siRNA experiment was applied to study the role of p53 downstream gene p21 Cip1 in the restriction of retrovirus infection. It was found that the block of retrovirus infection in non-cycling cells was significantly attenuated in HCT116 p53 -/- cells when compared to HCT116 p53 +/+ cells. It was found that both late reverse transcription products and viral 2-LTR cycle DNA were significantly increased in infected non-cycling HCT116 p53 -/- cells. Furthermore, the mutation frequency detected in 1-LTR DNA from HCT116 p53 +/+ cells were significantly decreased in comparison to HCT116 p53 -/- cells. A higher number of insertion and deletion mutations were detected in the joint region of 2-LTR cycle DNA in infected p53 +/+ cells. Cell cycle analysis showed retrovirus infection promoted host cell replication. Higher levels of mRNA and protein of p21 Cip1 were found in HCT116 p53 +/+ cells in comparison to the HCT116 p53 -/- cells. Furthermore, knockdown of p21 Cip1 in non-cycling HCT116 p53 +/+ cells significantly increased the infection. The results of this study showed that p53 is an important restriction factor that interferes with retrovirus infection in its early stage of replication. Our results suggested that p53 mediates the inhibition of retrovirus infection in non-cycling cells through it downstream gene p21 Cip1 , and p53 also functions to influence formation of 1-LTR cycle and 2-LTR cycle DNA.
Berrak, Özge; Akkoç, Yunus; Arısan, Elif Damla; Çoker-Gürkan, Ajda; Obakan-Yerlikaya, Pınar; Palavan-Ünsal, Narçin
2016-02-01
Bcl-2 protein has been contributed with number of genes which are involved in oncogenesis. Among the many targets of Bcl-2, NFκB have potential role in induction of cell cycle arrest. Curcumin has potential therapeutic effects against breast cancer through multiple signaling pathways. In this study, we investigated the role of curcumin in induction of cell cycle arrest via regulating of NFκB and polyamine biosynthesis in wt and Bcl-2+ MCF-7 cells. To examine the effect of curcumin on cell cycle regulatory proteins, PI3K/Akt, NFκB pathways and polyamine catabolism, we performed immunoblotting assay. In addition, cell cycle analysis was performed by flow cytometry. The results indicated that curcumin induced cell cycle arrest at G2/M phase by downregulation of cyclin B1 and Cdc2 and inhibited colony formation in MCF-7wt cells. However, Bcl-2 overexpression prevented the inhibition of cell cycle associated proteins after curcumin treatment. The combination of LY294002, PI3K inhibitor, and curcumin induced cell cycle arrest by decreasing CDK4, CDK2 and cyclin E2 in Bcl-2+ MCF-7 cells. Moreover, LY294002 further inhibited the phosphorylation of Akt in Bcl-2+ MCF-7 cells. Curcumin could suppress the nuclear transport of NFκB through decreasing the interaction of P-IκB-NFκB. The combination of wedelolactone, NFκB inhibitor, and curcumin acted different on SSAT expression in wt MCF-7 and Bcl-2+ MCF-7 cells. NFκB inhibition increased the SSAT after curcumin treatment in Bcl-2 overexpressed MCF-7 cells. Inhibition of NFκB activity as well as suppression of ROS generation with NAC resulted in the partial relief of cells from G2/M checkpoint after curcumin treatment in wt MCF-7 cells. In conclusion, the potential role of curcumin in induction of cell cycle arrest is related with NFκB-regulated polyamine biosynthesis. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Elongator complex is critical for cell cycle progression and leaf patterning in Arabidopsis.
Xu, Deyang; Huang, Weihua; Li, Yang; Wang, Hua; Huang, Hai; Cui, Xiaofeng
2012-03-01
The mitotic cell cycle in higher eukaryotes is of pivotal importance for organ growth and development. Here, we report that Elongator, an evolutionarily conserved histone acetyltransferase complex, acts as an important regulator of mitotic cell cycle to promote leaf patterning in Arabidopsis. Mutations in genes encoding Elongator subunits resulted in aberrant cell cycle progression, and the altered cell division affects leaf polarity formation. The defective cell cycle progression is caused by aberrant DNA replication and increased DNA damage, which activate the DNA replication checkpoint to arrest the cell cycle. Elongator interacts with proliferating cell nuclear antigen (PCNA) and is required for efficient histone 3 (H3) and H4 acetylation coupled with DNA replication. Levels of chromatin-bound H3K56Ac and H4K5Ac known to associate with replicons during DNA replication were reduced in the mutants of both Elongator and chromatin assembly factor 1 (CAF-1), another protein complex that physically interacts with PCNA for DNA replication-coupled chromatin assembly. Disruptions of CAF-1 also led to severe leaf polarity defects, which indicated that Elongator and CAF-1 act, at least partially, in the same pathway to promote cell cycle progression. Collectively, our results demonstrate that Elongator is an important regulator of mitotic cell cycle, and the Elongator pathway plays critical roles in promoting leaf polarity formation. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.
Intermittent Stem Cell Cycling Balances Self-Renewal and Senescence of the C. elegans Germ Line.
Cinquin, Amanda; Chiang, Michael; Paz, Adrian; Hallman, Sam; Yuan, Oliver; Vysniauskaite, Indre; Fowlkes, Charless C; Cinquin, Olivier
2016-04-01
Self-renewing organs often experience a decline in function in the course of aging. It is unclear whether chronological age or external factors control this decline, or whether it is driven by stem cell self-renewal-for example, because cycling cells exhaust their replicative capacity and become senescent. Here we assay the relationship between stem cell cycling and senescence in the Caenorhabditis elegans reproductive system, defining this senescence as the progressive decline in "reproductive capacity," i.e. in the number of progeny that can be produced until cessation of reproduction. We show that stem cell cycling diminishes remaining reproductive capacity, at least in part through the DNA damage response. Paradoxically, gonads kept under conditions that preclude reproduction keep cycling and producing cells that undergo apoptosis or are laid as unfertilized gametes, thus squandering reproductive capacity. We show that continued activity is in fact beneficial inasmuch as gonads that are active when reproduction is initiated have more sustained early progeny production. Intriguingly, continued cycling is intermittent-gonads switch between active and dormant states-and in all likelihood stochastic. Other organs face tradeoffs whereby stem cell cycling has the beneficial effect of providing freshly-differentiated cells and the detrimental effect of increasing the likelihood of cancer or senescence; stochastic stem cell cycling may allow for a subset of cells to preserve proliferative potential in old age, which may implement a strategy to deal with uncertainty as to the total amount of proliferation to be undergone over an organism's lifespan.
Animal Models for Studying the In Vivo Functions of Cell Cycle CDKs.
Risal, Sanjiv; Adhikari, Deepak; Liu, Kui
2016-01-01
Multiple Cdks (Cdk4, Cdk6, and Cdk2) and a mitotic Cdk (Cdk1) are involved in cell cycle progression in mammals. Cyclins, Cdk inhibitors, and phosphorylations (both activating and inhibitory) at different cellular levels tightly modulate the activities of these kinases. Based on the results of biochemical studies, it was long believed that different Cdks functioned at specific stages during cell cycle progression. However, deletion of all three interphase Cdks in mice affected cell cycle entry and progression only in certain specialized cells such as hematopoietic cells, beta cells of the pancreas, pituitary lactotrophs, and cardiomyocytes. These genetic experiments challenged the prevailing biochemical model and established that Cdks function in a cell-specific, but not a stage-specific, manner during cell cycle entry and the progression of mitosis. Recent in vivo studies have further established that Cdk1 is the only Cdk that is both essential and sufficient for driving the resumption of meiosis during mouse oocyte maturation. These genetic studies suggest a minimal-essential cell cycle model in which Cdk1 is the central regulator of cell cycle progression. Cdk1 can compensate for the loss of the interphase Cdks by forming active complexes with A-, B-, E-, and D-type Cyclins in a stepwise manner. Thus, Cdk1 plays an essential role in both mitosis and meiosis in mammals, whereas interphase Cdks are dispensable.
Distinct mechanisms act in concert to mediate cell cycle arrest.
Toettcher, Jared E; Loewer, Alexander; Ostheimer, Gerard J; Yaffe, Michael B; Tidor, Bruce; Lahav, Galit
2009-01-20
In response to DNA damage, cells arrest at specific stages in the cell cycle. This arrest must fulfill at least 3 requirements: it must be activated promptly; it must be sustained as long as damage is present to prevent loss of genomic information; and after the arrest, cells must re-enter into the appropriate cell cycle phase to ensure proper ploidy. Multiple molecular mechanisms capable of arresting the cell cycle have been identified in mammalian cells; however, it is unknown whether each mechanism meets all 3 requirements or whether they act together to confer specific functions to the arrest. To address this question, we integrated mathematical models describing the cell cycle and the DNA damage signaling networks and tested the contributions of each mechanism to cell cycle arrest and re-entry. Predictions from this model were then tested with quantitative experiments to identify the combined action of arrest mechanisms in irradiated cells. We find that different arrest mechanisms serve indispensable roles in the proper cellular response to DNA damage over time: p53-independent cyclin inactivation confers immediate arrest, whereas p53-dependent cyclin downregulation allows this arrest to be sustained. Additionally, p21-mediated inhibition of cyclin-dependent kinase activity is indispensable for preventing improper cell cycle re-entry and endoreduplication. This work shows that in a complex signaling network, seemingly redundant mechanisms, acting in a concerted fashion, can achieve a specific cellular outcome.
Mavri-Damelin, Demetra; Eaton, Simon; Damelin, Leonard H; Rees, Myrddin; Hodgson, Humphrey J F; Selden, Clare
2007-01-01
A possible cell source for a bio-artificial liver is the human hepatblastoma-derived cell line HepG2 as it confers many hepatocyte functions, however, the urea cycle is not maintained resulting in the lack of ammonia detoxification via this cycle. We investigated urea cycle activity in HepG2 cells at both a molecular and biochemical level to determine the causes for the lack of urea cycle expression, and subsequently addressed reinstatement of the cycle by gene transfer. Metabolic labelling studies showed that urea production from 15N-ammonium chloride was not detectable in HepG2 conditioned medium, nor could 14C-labelled urea cycle intermediates be detected. Gene expression data from HepG2 cells revealed that although expression of three urea cycle genes Carbamoyl Phosphate Synthase I, Arginosuccinate Synthetase and Arginosuccinate Lyase was evident, Ornithine Transcarbamylase and Arginase I expression were completely absent. These results were confirmed by Western blot for arginase I, where no protein was detected. Radiolabelled enzyme assays showed that Ornithine Transcarbamylase functional activity was missing but that Carbamoyl Phosphate Synthase I, Arginosuccinate Synthetase and Arginosuccinate Lyase were functionally expressed at levels comparable to cultured primary human hepatocytes. To restore the urea cycle, HepG2 cells were transfected with full length Ornithine Transcarbamylase and Arginase I cDNA constructs under a CMV promoter. Co-transfected HepG2 cells displayed complete urea cycle activity, producing both labelled urea and urea cycle intermediates. This strategy could provide a cell source capable of urea synthesis, and hence ammonia detoxificatory function, which would be useful in a bio-artificial liver.
Cell cycle re-entry sensitizes podocytes to injury induced death
Hagen, Manuel; Pfister, Eva; Kosel, Andrea; Shankland, Stuart; Pippin, Jeffrey; Amann, Kerstin; Daniel, Christoph
2016-01-01
ABSTRACT Podocytes are terminally differentiated renal cells, lacking the ability to regenerate by proliferation. However, during renal injury, podocytes re-enter into the cell cycle but fail to divide. Earlier studies suggested that re-entry into cell cycle results in loss of podocytes, but a direct evidence for this is lacking. Therefore, we established an in vitro model to test the consequences of re-entry into the cell cycle on podocyte survival. A mouse immortalized podocyte cell line was differentiated to non-permissive podocytes and stimulated with e.g. growth factors. Stimulated cells were analyzed for mRNA-expression or stained for cell cycle analysis using flow cytometry and immunocytofluorescence microscopy. After stimulation to re-entry into cell cycle, podocytes were stressed with puromycin aminonucleoside (PAN) and analyzed for survival. During permissive stage more than 40% of immortalized podocytes were in the S-phase. In contrast, S-phase in non-permissive differentiated podocytes was reduced to 5%. Treatment with b-FGF dose dependently induced re-entry into cell cycle increasing the number of podocytes in the S-phase to 10.7% at an optimal bFGF dosage of 10 ng/ml. Forty eight hours after stimulation with bFGF the number of bi-nucleated podocytes significantly increased. A secondary injury stimulus significantly reduced podocyte survival preferentially in bi-nucleated podocytes In conclusion, stimulation of podocytes using bFGF was able to induce re-entry of podocytes into the cell cycle and to sensitize the cells for cell death by secondary injuries. Therefore, this model is appropriate for testing new podocyte protective substances that can be used for therapy. PMID:27232327
Periasamy, Vaiyapuri Subbarayan; Athinarayanan, Jegan; Alshatwi, Ali A
2016-05-01
Aluminum oxide nanoparticles (Al2 O3 -NPs) are important ceramic materials that have been used in a variety of commercial and industrial applications. However, the impact of acute and chronic exposure to Al2 O3 -NPs on the environment and on human health has not been well studied. In this investigation, we evaluated the cytotoxic effects of Al2 O3 -NPs on human mesenchymal stem cells (hMSCs) by using a cell viability assay and observing cellular morphological changes, analyzing cell cycle progression, and monitoring the expression of cell cycle response genes (PCNA, EGR1, E2F1, CCND1, CCNC, CCNG1, and CYCD3). The Al2 O3 -NPs reduced hMSC viability in a dose- and time-dependent manner. Nuclear condensation and fragmentation, chromosomal DNA fragmentation, and cytoplasmic vacuolization were observed in Al2 O3 -NP-exposed cells. The nuclear morphological changes indicated that Al2 O3 -NPs alter cell cycle progression and gene expression. The cell cycle distribution revealed that Al2 O3 -NPs cause cell cycle arrest in the sub-G0-G1 phase, and this is associated with a reduction in the cell population in the G2/M and G0/G1 phases. Moreover, Al2 O3 -NPs induced the upregulation of cell cycle response genes, including EGR1, E2F1, and CCND1. Our results suggested that exposure to Al2 O3 -NPs could cause acute cytotoxic effects in hMSCs through cell cycle regulatory genes. © 2015 International Union of Biochemistry and Molecular Biology, Inc.
From egg to gastrula: How the cell cycle is remodeled during the Drosophila mid-blastula transition
Farrell, Jeffrey A.; O’Farrell, Patrick H.
2015-01-01
Many, if not most, embryos begin development with extremely short cell cycles that exhibit unusually rapid DNA replication and no gap phases. The commitment to the cell cycle in the early embryo appears to preclude many other cellular processes which only emerge as the cell cycle slows, at a major embryonic transition known as the mid-blastula transition (MBT) just prior to gastrulation. As reviewed here, genetic and molecular studies in Drosophila have identified changes that extend S phase and introduce a post-replicative gap phase, G2, to slow the cell cycle. While many mysteries remain about the upstream regulators of these changes, we review the core mechanisms of the change in cell cycle regulation and discuss advances in our understanding of how these might be timed and triggered. Finally, we consider how the elements of this program may be conserved or changed in other organisms. PMID:25195504
Destructive physical analysis results of Ni/H2 cells cycled in LEO regime
NASA Technical Reports Server (NTRS)
Lim, Hong S.; Zelter, Gabriela R.; Smithrick, John J.; Hall, Stephen W.
1991-01-01
Six 48-Ah individual pressure vessel (IPV) Ni/H2 cells containing 26 and 31 percent KOH electrolyte were life cycle tested in low Earth orbit. All three cells containing 31 percent KOH failed (3729, 4165, and 11,355 cycles), while those with 26 percent KOH were cycled over 14,000 times in the continuing test. Destructive physical analysis (DPA) of the failed cells included visual inspections, measurements of electrode thickness, scanning electron microscopy, chemical analysis, and measurements of nickel electrode capacity in an electrolyte flooded cell. The cycling failure was due to a decrease of nickel electrode capacity. As possible causes of the capacity decrease, researchers observed electrode expansion, rupture, and corrosion of the nickel electrode substrate, active material redistribution, and accumulation of electrochemically undischargeable active material with cycling.
Blagosklonny, Mikhail V
2012-03-01
Cell cycle arrest is not yet senescence. When the cell cycle is arrested, an inappropriate growth-promotion converts an arrest into senescence (geroconversion). By inhibiting the growth-promoting mTOR pathway, rapamycin decelerates geroconversion of the arrested cells. And as a striking example, while causing arrest, p53 may decelerate or suppress geroconversion (in some conditions). Here I discuss the meaning of geroconversion and also the terms gerogenes, gerossuppressors, gerosuppressants, gerogenic pathways, gero-promoters, hyperfunction and feedback resistance, regenerative potential, hypertrophy and secondary atrophy, pro-gerogenic and gerogenic cells.
Capacity decline of ambient temperature secondary lithium battery
NASA Technical Reports Server (NTRS)
Shen, D. H.; Subbarao, S.; Nakamura, B. J.; Yen, S. P. S.; Bankston, C. P.
1988-01-01
The use of ambient temperature secondary lithium cells is limited primarily because of the poor cycle life performance. Much of the cell capacity is irreversibly lost upon cycling. Studies have been undertaken to understand the problem of capacity decline. Experimental Li-TiS2 cells were fabricated and tested for their cycle life performance. Cells were disassembled at different stages of cycle life, and cell active components were analyzed by various analytical techniques. The results of this study indicate that all the cell's active components/materials are undergoing degradation. Details of the experiments carried out and the results obtained are described.
Xi, Z; Yao, M; Li, Y; Xie, C; Holst, J; Liu, T; Cai, S; Lao, Y; Tan, H; Xu, H-X; Dong, Q
2016-06-02
Cell cycle re-entry by quiescent cancer cells is an important mechanism for cancer progression. While high levels of c-MYC expression are sufficient for cell cycle re-entry, the modality to block c-MYC expression, and subsequent cell cycle re-entry, is limited. Using reversible quiescence rendered by serum withdrawal or contact inhibition in PTEN(null)/p53(WT) (LNCaP) or PTEN(null)/p53(mut) (PC-3) prostate cancer cells, we have identified a compound that is able to impede cell cycle re-entry through c-MYC. Guttiferone K (GUTK) blocked resumption of DNA synthesis and preserved the cell cycle phase characteristics of quiescent cells after release from the quiescence. In vehicle-treated cells, there was a rapid increase in c-MYC protein levels upon release from the quiescence. However, this increase was inhibited in the presence of GUTK with an associated acceleration in c-MYC protein degradation. The inhibitory effect of GUTK on cell cycle re-entry was significantly reduced in cells overexpressing c-MYC. The protein level of FBXW7, a subunit of E3 ubiquitin ligase responsible for degradation of c-MYC, was reduced upon the release from the quiescence. In contrast, GUTK stabilized FBXW7 protein levels during release from the quiescence. The critical role of FBXW7 was confirmed using siRNA knockdown, which impaired the inhibitory effect of GUTK on c-MYC protein levels and cell cycle re-entry. Administration of GUTK, either in vitro prior to transplantation or in vivo, suppressed the growth of quiescent prostate cancer cell xenografts. Furthermore, elevation of FBXW7 protein levels and reduction of c-MYC protein levels were found in the xenografts of GUTK-treated compared with vehicle-treated mice. Hence, we have identified a compound that is capable of impeding cell cycle re-entry by quiescent PTEN(null)/p53(WT) and PTEN(null)/p53(mut) prostate cancer cells likely by promoting c-MYC protein degradation through stabilization of FBXW7. Its usage as a clinical modality to prevent prostate cancer progression should be further evaluated.
Understanding cell cycle and cell death regulation provides novel weapons against human diseases.
Wiman, K G; Zhivotovsky, B
2017-05-01
Cell division, cell differentiation and cell death are the three principal physiological processes that regulate tissue homoeostasis in multicellular organisms. The growth and survival of cells as well as the integrity of the genome are regulated by a complex network of pathways, in which cell cycle checkpoints, DNA repair and programmed cell death have critical roles. Disruption of genomic integrity and impaired regulation of cell death may both lead to uncontrolled cell growth. Compromised cell death can also favour genomic instability. It is becoming increasingly clear that dysregulation of cell cycle and cell death processes plays an important role in the development of major disorders such as cancer, cardiovascular disease, infection, inflammation and neurodegenerative diseases. Research achievements in these fields have led to the development of novel approaches for treatment of various conditions associated with abnormalities in the regulation of cell cycle progression or cell death. A better understanding of how cellular life-and-death processes are regulated is essential for this development. To highlight these important advances, the Third Nobel Conference entitled 'The Cell Cycle and Cell Death in Disease' was organized at Karolinska Institutet in 2016. In this review we will summarize current understanding of cell cycle progression and cell death and discuss some of the recent advances in therapeutic applications in pathological conditions such as cancer, neurological disorders and inflammation. © 2017 The Association for the Publication of the Journal of Internal Medicine.
Establishment of Homozygote Mutant Human Embryonic Stem Cells by Parthenogenesis.
Epsztejn-Litman, Silvina; Cohen-Hadad, Yaara; Aharoni, Shira; Altarescu, Gheona; Renbaum, Paul; Levy-Lahad, Ephrat; Schonberger, Oshrat; Eldar-Geva, Talia; Zeligson, Sharon; Eiges, Rachel
2015-01-01
We report on the derivation of a diploid 46(XX) human embryonic stem cell (HESC) line that is homozygous for the common deletion associated with Spinal muscular atrophy type 1 (SMA) from a pathenogenetic embryo. By characterizing the methylation status of three different imprinted loci (MEST, SNRPN and H19), monitoring the expression of two parentally imprinted genes (SNRPN and H19) and carrying out genome-wide SNP analysis, we provide evidence that this cell line was established from the activation of a mutant oocyte by diploidization of the entire genome. Therefore, our SMA parthenogenetic HESC (pHESC) line provides a proof-of-principle for the establishment of diseased HESC lines without the need for gene manipulation. As mutant oocytes are easily obtained and readily available during preimplantation genetic diagnosis (PGD) cycles, this approach should provide a powerful tool for disease modelling and is especially advantageous since it can be used to induce large or complex mutations in HESCs, including gross DNA alterations and chromosomal rearrangements, which are otherwise hard to achieve.
Tan, Heng Kean; Moad, Ahmed Ismail Hassan; Tan, Mei Lan
2014-01-01
The mammalian target of rapamycin (mTOR) kinase plays an important role in regulating cell growth and cell cycle progression in response to cellular signals. It is a key regulator of cell proliferation and many upstream activators and downstream effectors of mTOR are known to be deregulated in various types of cancers. Since the mTOR signalling pathway is commonly activated in human cancers, many researchers are actively developing inhibitors that target key components in the pathway and some of these drugs are already on the market. Numerous preclinical investigations have also suggested that some herbs and natural phytochemicals, such as curcumin, resveratrol, timosaponin III, gallic acid, diosgenin, pomegranate, epigallocatechin gallate (EGCC), genistein and 3,3'-diindolylmethane inhibit the mTOR pathway either directly or indirectly. Some of these natural compounds are also in the clinical trial stage. In this review, the potential anti-cancer and chemopreventive activities and the current status of clinical trials of these phytochemicals are discussed.
Inhibition of NEDD8-activating enzyme: a novel approach for the treatment of acute myeloid leukemia.
Swords, Ronan T; Kelly, Kevin R; Smith, Peter G; Garnsey, James J; Mahalingam, Devalingam; Medina, Ernest; Oberheu, Kelli; Padmanabhan, Swaminathan; O'Dwyer, Michael; Nawrocki, Steffan T; Giles, Francis J; Carew, Jennifer S
2010-05-06
NEDD8 activating enzyme (NAE) has been identified as an essential regulator of the NEDD8 conjugation pathway, which controls the degradation of many proteins with important roles in cell-cycle progression, DNA damage, and stress responses. Here we report that MLN4924, a novel inhibitor of NAE, has potent activity in acute myeloid leukemia (AML) models. MLN4924 induced cell death in AML cell lines and primary patient specimens independent of Fms-like tyrosine kinase 3 expression and stromal-mediated survival signaling and led to the stabilization of key NAE targets, inhibition of nuclear factor-kappaB activity, DNA damage, and reactive oxygen species generation. Disruption of cellular redox status was shown to be a key event in MLN4924-induced apoptosis. Administration of MLN4924 to mice bearing AML xenografts led to stable disease regression and inhibition of NEDDylated cullins. Our findings indicate that MLN4924 is a highly promising novel agent that has advanced into clinical trials for the treatment of AML.
A Slowed Cell Cycle Stabilizes the Budding Yeast Genome.
Vinton, Peter J; Weinert, Ted
2017-06-01
During cell division, aberrant DNA structures are detected by regulators called checkpoints that slow division to allow error correction. In addition to checkpoint-induced delay, it is widely assumed, though rarely shown, that merely slowing the cell cycle might allow more time for error detection and correction, thus resulting in a more stable genome. Fidelity by a slowed cell cycle might be independent of checkpoints. Here we tested the hypothesis that a slowed cell cycle stabilizes the genome, independent of checkpoints, in the budding yeast Saccharomyces cerevisiae We were led to this hypothesis when we identified a gene ( ERV14 , an ER cargo membrane protein) that when mutated, unexpectedly stabilized the genome, as measured by three different chromosome assays. After extensive studies of pathways rendered dysfunctional in erv14 mutant cells, we are led to the inference that no particular pathway is involved in stabilization, but rather the slowed cell cycle induced by erv14 stabilized the genome. We then demonstrated that, in genetic mutations and chemical treatments unrelated to ERV14 , a slowed cell cycle indeed correlates with a more stable genome, even in checkpoint-proficient cells. Data suggest a delay in G2/M may commonly stabilize the genome. We conclude that chromosome errors are more rarely made or are more readily corrected when the cell cycle is slowed (even ∼15 min longer in an ∼100-min cell cycle). And, some chromosome errors may not signal checkpoint-mediated responses, or do not sufficiently signal to allow correction, and their correction benefits from this "time checkpoint." Copyright © 2017 by the Genetics Society of America.
Achieving Precision Death with Cell-Cycle Inhibitors that Target DNA Replication and Repair.
Lin, Aimee Bence; McNeely, Samuel C; Beckmann, Richard P
2017-07-01
All cancers are characterized by defects in the systems that ensure strict control of the cell cycle in normal tissues. The consequent excess tissue growth can be countered by drugs that halt cell division, and, indeed, the majority of chemotherapeutics developed during the last century work by disrupting processes essential for the cell cycle, particularly DNA synthesis, DNA replication, and chromatid segregation. In certain contexts, the efficacy of these classes of drugs can be impressive, but because they indiscriminately block the cell cycle of all actively dividing cells, their side effects severely constrain the dose and duration with which they can be administered, allowing both normal and malignant cells to escape complete growth arrest. Recent progress in understanding how cancers lose control of the cell cycle, coupled with comprehensive genomic profiling of human tumor biopsies, has shown that many cancers have mutations affecting various regulators and checkpoints that impinge on the core cell-cycle machinery. These defects introduce unique vulnerabilities that can be exploited by a next generation of drugs that promise improved therapeutic windows in patients whose tumors bear particular genomic aberrations, permitting increased dose intensity and efficacy. These developments, coupled with the success of new drugs targeting cell-cycle regulators, have led to a resurgence of interest in cell-cycle inhibitors. This review in particular focuses on the newer strategies that may facilitate better therapeutic targeting of drugs that inhibit the various components that safeguard the fidelity of the fundamental processes of DNA replication and repair. Clin Cancer Res; 23(13); 3232-40. ©2017 AACR . ©2017 American Association for Cancer Research.
Segmentation and classification of cell cycle phases in fluorescence imaging.
Ersoy, Ilker; Bunyak, Filiz; Chagin, Vadim; Cardoso, M Christina; Palaniappan, Kannappan
2009-01-01
Current chemical biology methods for studying spatiotemporal correlation between biochemical networks and cell cycle phase progression in live-cells typically use fluorescence-based imaging of fusion proteins. Stable cell lines expressing fluorescently tagged protein GFP-PCNA produce rich, dynamically varying sub-cellular foci patterns characterizing the cell cycle phases, including the progress during the S-phase. Variable fluorescence patterns, drastic changes in SNR, shape and position changes and abundance of touching cells require sophisticated algorithms for reliable automatic segmentation and cell cycle classification. We extend the recently proposed graph partitioning active contours (GPAC) for fluorescence-based nucleus segmentation using regional density functions and dramatically improve its efficiency, making it scalable for high content microscopy imaging. We utilize surface shape properties of GFP-PCNA intensity field to obtain descriptors of foci patterns and perform automated cell cycle phase classification, and give quantitative performance by comparing our results to manually labeled data.
Cell cycle control, checkpoint mechanisms, and genotoxic stress.
Shackelford, R E; Kaufmann, W K; Paules, R S
1999-01-01
The ability of cells to maintain genomic integrity is vital for cell survival and proliferation. Lack of fidelity in DNA replication and maintenance can result in deleterious mutations leading to cell death or, in multicellular organisms, cancer. The purpose of this review is to discuss the known signal transduction pathways that regulate cell cycle progression and the mechanisms cells employ to insure DNA stability in the face of genotoxic stress. In particular, we focus on mammalian cell cycle checkpoint functions, their role in maintaining DNA stability during the cell cycle following exposure to genotoxic agents, and the gene products that act in checkpoint function signal transduction cascades. Key transitions in the cell cycle are regulated by the activities of various protein kinase complexes composed of cyclin and cyclin-dependent kinase (Cdk) molecules. Surveillance control mechanisms that check to ensure proper completion of early events and cellular integrity before initiation of subsequent events in cell cycle progression are referred to as cell cycle checkpoints and can generate a transient delay that provides the cell more time to repair damage before progressing to the next phase of the cycle. A variety of cellular responses are elicited that function in checkpoint signaling to inhibit cyclin/Cdk activities. These responses include the p53-dependent and p53-independent induction of Cdk inhibitors and the p53-independent inhibitory phosphorylation of Cdk molecules themselves. Eliciting proper G1, S, and G2 checkpoint responses to double-strand DNA breaks requires the function of the Ataxia telangiectasia mutated gene product. Several human heritable cancer-prone syndromes known to alter DNA stability have been found to have defects in checkpoint surveillance pathways. Exposures to several common sources of genotoxic stress, including oxidative stress, ionizing radiation, UV radiation, and the genotoxic compound benzo[a]pyrene, elicit cell cycle checkpoint responses that show both similarities and differences in their molecular signaling. Images Figure 3 PMID:10229703
Tulina, Natalia M; Chen, Wen-Feng; Chen, Jung Hsuan; Sowcik, Mallory; Sehgal, Amita
2014-02-25
Adult stem cells maintain tissue integrity and function by renewing cellular content of the organism through regulated mitotic divisions. Previous studies showed that stem cell activity is affected by local, systemic, and environmental cues. Here, we explore a role of environmental day-night cycles in modulating cell cycle progression in populations of adult stem cells. Using a classic stem cell system, the Drosophila spermatogonial stem cell niche, we reveal daily rhythms in division frequencies of germ-line and somatic stem cells that act cooperatively to produce male gametes. We also examine whether behavioral sleep-wake cycles, which are driven by the environmental day-night cycles, regulate stem cell function. We find that flies lacking the sleep-promoting factor Sleepless, which maintains normal sleep in Drosophila, have increased germ-line stem cell (GSC) division rates, and this effect is mediated, in part, through a GABAergic signaling pathway. We suggest that alterations in sleep can influence the daily dynamics of GSC divisions.
Positive Feedback Keeps Duration of Mitosis Temporally Insulated from Upstream Cell-Cycle Events.
Araujo, Ana Rita; Gelens, Lendert; Sheriff, Rahuman S M; Santos, Silvia D M
2016-10-20
Cell division is characterized by a sequence of events by which a cell gives rise to two daughter cells. Quantitative measurements of cell-cycle dynamics in single cells showed that despite variability in G1-, S-, and G2 phases, duration of mitosis is short and remarkably constant. Surprisingly, there is no correlation between cell-cycle length and mitotic duration, suggesting that mitosis is temporally insulated from variability in earlier cell-cycle phases. By combining live cell imaging and computational modeling, we showed that positive feedback is the molecular mechanism underlying the temporal insulation of mitosis. Perturbing positive feedback gave rise to a sluggish, variable entry and progression through mitosis and uncoupled duration of mitosis from variability in cell cycle length. We show that positive feedback is important to keep mitosis short, constant, and temporally insulated and anticipate it might be a commonly used regulatory strategy to create modularity in other biological systems. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Electrochemical impedance spectroscopy of lithium-titanium disulfide rechargeable cells
NASA Technical Reports Server (NTRS)
Narayanan, S. R.; Shen, D. H.; Surampudi, S.; Attia, A. I.; Halpert, G.
1993-01-01
The two-terminal alternating current impedance of Li/TiS2 rechargeable cells was studied as a function of frequency, state-of-charge, and extended cycling. Analysis based on a plausible equivalent circuit model for the Li/TiS2 cell leads to evaluation of kinetic parameters for the various physicochemical processes occurring at the electrode/electrolyte interfaces. To investigate the causes of cell degradation during extended cycling, the parameters evaluated for cells cycled 5 times were compared with the parameters of cells cycled over 600 times. The findings are that the combined ohmic resistance of the electrolyte and electrodes suffers a tenfold increase after extended cycling, while the charge-transfer resistance and diffusional impedance at the TiS2/electrolyte interface are not significantIy affected. The results reflect the morphological change and increase in area of the anode due to cycling. The study also shows that overdischarge of a cathode-limited cell causes a decrease in the diffusion coefficient of the lithium ion in the cathode.
Walsby, Elisabeth J.; Coles, Steven J.; Knapper, Steven; Burnett, Alan K.
2011-01-01
Background Topoisomerase II is essential for the maintenance of DNA integrity and the survival of proliferating cells. Topoisomerase II poisons, including etoposide and doxorubicin, inhibit enzyme-mediated DNA ligation causing the accumulation of double-stranded breaks and have been front-line drugs for the treatment of leukemia for many years. Voreloxin is a first-in-class anti-cancer quinolone derivative that intercalates DNA and inhibits topoisomerase II. The efficacy and mechanisms of action of voreloxin in acute myeloid leukaemia were addressed in this study. Design and Methods Primary acute myeloid leukemia blasts (n = 88) and myeloid cell lines were used in vitro to study voreloxin through viability assays to assess cell killing and synergy with other drugs. Apoptosis and cell cycling were assessed by flow cytometry. DNA relaxation assays were utilized to determine that voreloxin was active on topoisomerase II. Results The mean lethal dose 50% (LD50) (± standard deviation) of voreloxin for primary acute myeloid leukemia blasts was 2.30 μM (± 1.87). Synergy experiments between voreloxin and cytarabine identified synergism in 22 of 25 primary acute myeloid leukemia samples tested, with a mean combination index of 0.79. Apoptosis was shown to increase in a dose-dependent manner. Furthermore, voreloxin was active in the p53-null K562 cell line suggesting that the action of voreloxin is not affected by p53 status. The action of voreloxin on topoisomerase II was confirmed using a DNA relaxation assay. Conclusions Voreloxin may provide an interesting addition to the cache of drugs available for the treatment of acute myeloid leukemia, a disease with a poor long-term survival. In addition to its potent action as a single agent in dividing cells, the synergy we demonstrated between voreloxin and cytarabine recommends further investigation of this topoisomerase II inhibitor. PMID:21134979
Nanosecond pulsed electric fields and the cell cycle
NASA Astrophysics Data System (ADS)
Mahlke, Megan A.
Exposure to nanosecond pulsed electrical fields (nsPEFs) can cause poration of external and internal cell membranes, DNA damage, and disassociation of cytoskeletal components, all of which are capable of disrupting a cell's ability to replicate. The phase of the cell cycle at the time of exposure is linked to differential sensitivities to nsPEFs across cell lines, as DNA structure, membrane elasticity, and cytoskeletal structure change dramatically during the cell cycle. Additionally, nsPEFs are capable of activating cell cycle checkpoints, which could lead to apoptosis or slow population growth. NsPEFs are emerging as a method for treating tumors via apoptotic induction; therefore, investigating the relevance of nsPEFs and the cell cycle could translate into improved efficacy in tumor treatment. Populations of Jurkat and Chinese Hamster Ovary (CHO) cells were examined post-exposure (10 ns pulse trains at 150kV/cm) by analysis of DNA content via propidium iodide staining and flow cytometric analysis at various time points (1, 6, and 12h post-exposure) to determine population distribution in cell cycle phases. Additionally, CHO and Jurkat cells were synchronized in G1/S and G2/M phases, pulsed, and analyzed to evaluate the role of cell cycle phase in survival of nsPEFs. CHO populations appeared similar to sham populations post-nsPEFs but exhibited arrest in the G1 phase at 6h after exposure. Jurkat cells exhibited increased cell death after nsPEFs compared to CHO cells but did not exhibit checkpoint arrest at any observed time point. The G1/S phase checkpoint is partially controlled by the action of p53; the lack of an active p53 response in Jurkat cells could contribute to their ability to pass this checkpoint and resist cell cycle arrest. Both cell lines exhibited increased sensitivity to nsPEFs in G2/M phase. Live imaging of CHO cells after nsPEF exposure supports the theory of G1/S phase arrest, as a reduced number of cells undergo mitosis within 24 h when compared to sham treated cells. CHO cells undergoing mitosis after exposure also exhibit improper separation of chromatids which could indicate loss of function of the mitotic spindle checkpoint. Activation and loss of function of checkpoints in CHO but not Jurkat cells after nsPEF exposure suggests that activation of cell cycle checkpoints could be important in defining the character of cell line specific recovery after nsPEF exposure. Moreover, the increased sensitivity in G2/M phase exhibited by both cell lines indicates that cell cycle phase is an important consideration during nsPEF exposure, particularly when aiming to induce apoptosis.
Senescence-associated microRNAs target cell cycle regulatory genes in normal human lung fibroblasts.
Markopoulos, Georgios S; Roupakia, Eugenia; Tokamani, Maria; Vartholomatos, George; Tzavaras, Theodore; Hatziapostolou, Maria; Fackelmayer, Frank O; Sandaltzopoulos, Raphael; Polytarchou, Christos; Kolettas, Evangelos
2017-10-01
Senescence recapitulates the ageing process at the cell level. A senescent cell stops dividing and exits the cell cycle. MicroRNAs (miRNAs) acting as master regulators of transcription, have been implicated in senescence. In the current study we investigated and compared the expression of miRNAs in young versus senescent human fibroblasts (HDFs), and analysed the role of mRNAs expressed in replicative senescent HFL-1 HDFs. Cell cycle analysis confirmed that HDFs accumulated in G 1 /S cell cycle phase. Nanostring analysis of isolated miRNAs from young and senescent HFL-1 showed that a distinct set of 15 miRNAs were significantly up-regulated in senescent cells including hsa-let-7d-5p, hsa-let-7e-5p, hsa-miR-23a-3p, hsa-miR-34a-5p, hsa-miR-122-5p, hsa-miR-125a-3p, hsa-miR-125a-5p, hsa-miR-125b-5p, hsa-miR-181a-5p, hsa-miR-221-3p, hsa-miR-222-3p, hsa-miR-503-5p, hsa-miR-574-3p, hsa-miR-574-5p and hsa-miR-4454. Importantly, pathway analysis of miRNA target genes down-regulated during replicative senescence in a public RNA-seq data set revealed a significant high number of genes regulating cell cycle progression, both G 1 /S and G 2 /M cell cycle phase transitions and telomere maintenance. The reduced expression of selected miRNA targets, upon replicative and oxidative-stress induced senescence, such as the cell cycle effectors E2F1, CcnE, Cdc6, CcnB1 and Cdc25C was verified at the protein and/or RNA levels. Induction of G1/S cell cycle phase arrest and down-regulation of cell cycle effectors correlated with the up-regulation of miR-221 upon both replicative and oxidative stress-induced senescence. Transient expression of miR-221/222 in HDFs promoted the accumulation of HDFs in G1/S cell cycle phase. We propose that miRNAs up-regulated during replicative senescence may act in concert to induce cell cycle phase arrest and telomere erosion, establishing a senescent phenotype. Copyright © 2017 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Kyung-Mi; Yun, Ji Ho; Lee, Dong Hwa
2015-04-17
We demonstrate that chikusetsusaponin IVa methyl ester (CME), a triterpenoid saponin from the root of Achyranthes japonica, has an anticancer activity. We investigate its molecular mechanism in depth in HCT116 cells. CME reduces the amount of β-catenin in nucleus and inhibits the binding of β-catenin to specific DNA sequences (TCF binding elements, TBE) in target gene promoters. Thus, CME appears to decrease the expression of cell cycle regulatory proteins such as Cyclin D1, as a representative target for β-catenin, as well as CDK2 and CDK4. As a result of the decrease of the cell cycle regulatory proteins, CME inhibits cellmore » proliferation by arresting the cell cycle at the G0/G1 phase. Therefore, we suggest that CME as a novel Wnt/β-catenin inhibitor can be a putative agent for the treatment of colorectal cancers. - Highlights: • CME inhibits cell proliferation in HCT116 cells. • CME increases cell cycle arrest at G0/G1 phase and apoptosis. • CME attenuates cyclin D1 and regulates cell cycle regulatory proteins. • CME inhibits β-catenin translocation to nucleus.« less
Cell cycle dependent changes in the plasma membrane organization of mammalian cells.
Denz, Manuela; Chiantia, Salvatore; Herrmann, Andreas; Mueller, Peter; Korte, Thomas; Schwarzer, Roland
2017-03-01
Lipid membranes are major structural elements of all eukaryotic and prokaryotic organisms. Although many aspects of their biology have been studied extensively, their dynamics and lateral heterogeneity are still not fully understood. Recently, we observed a cell-to-cell variability in the plasma membrane organization of CHO-K1 cells (Schwarzer et al., 2014). We surmised that cell cycle dependent changes of the individual cells from our unsynchronized cell population account for this phenomenon. In the present study, this hypothesis was tested. To this aim, CHO-K1 cells were arrested in different cell cycle phases by chemical treatments, and the order of their plasma membranes was determined by various fluorescent lipid analogues using fluorescence lifetime imaging microscopy. Our experiments exhibit significant differences in the membrane order of cells arrested in the G2/M or S phase compared to control cells. Our single-cell analysis also enabled the specific selection of mitotic cells, which displayed a significant increase of the membrane order compared to the control. In addition, the lipid raft marker GPImYFP was used to study the lateral organization of cell cycle arrested cells as well as mitotic cells and freely cycling samples. Again, significant differences were found between control and arrested cells and even more pronounced between control and mitotic cells. Our data demonstrate a direct correlation between cell cycle progression and plasma membrane organization, underlining that cell-to-cell heterogeneities of membrane properties have to be taken into account in cellular studies especially at the single-cell level. Copyright © 2016 Elsevier B.V. All rights reserved.
Features of the Phosphatidylinositol Cycle and its Role in Signal Transduction.
Epand, Richard M
2017-08-01
The phosphatidylinositol cycle (PI-cycle) has a central role in cell signaling. It is the major pathway for the synthesis of phosphatidylinositol and its phosphorylated forms. In addition, some lipid intermediates of the PI-cycle, including diacylglycerol and phosphatidic acid, are also important lipid signaling agents. The PI-cycle has some features that are important for the understanding of its role in the cell. As a cycle, the intermediates will be regenerated. The PI-cycle requires a large amount of metabolic energy. There are different steps of the cycle that occur in two different membranes, the plasma membrane and the endoplasmic reticulum. In order to complete the PI-cycle lipid must be transferred between the two membranes. The role of the Nir proteins in the process has recently been elucidated. The lipid intermediates of the PI-cycle are normally highly enriched with 1-stearoyl-2-arachidonoyl molecular species in mammals. This enrichment will be retained as long as the intermediates are segregated from other lipids of the cell. However, there is a significant fraction (>15 %) of lipids in the PI-cycle of normal cells that have other acyl chains. Phosphatidylinositol largely devoid of arachidonoyl chains are found in cancer cells. Phosphatidylinositol species with less unsaturation will not be as readily converted to phosphatidylinositol-3,4,5-trisphosphate, the lipid required for the activation of Akt with resulting effects on cell proliferation. Thus, the cyclical nature of the PI-cycle, its dependence on acyl chain composition and its requirement for lipid transfer between two membranes, explain many of the biological properties of this cycle.
Breaking the Intergenerational Cycle of Disadvantage: The Three Generation Approach
Johnson, Sara B.; Goodman, Elizabeth
2016-01-01
Health disparities in the United States related to socioeconomic status are persistent and pervasive. This review highlights how social disadvantage, particularly low socioeconomic status and the health burden it brings, is passed from 1 generation to the next. First, we review current frameworks for understanding the intergenerational transmission of health disparities and provide 4 illustrative examples relevant to child health, development, and well-being. Second, the leading strategy to break the cycle of poverty in young families in the United States, the 2-generation approach, is reviewed. Finally, we propose a new 3-generation approach that must combine with the 2-generation approach to interrupt the intergenerational cycle of disadvantage and eliminate health disparities. PMID:27244844
Development of single-cell protectors for sealed silver-zinc cells
NASA Technical Reports Server (NTRS)
Lear, J. W.; Donovan, R. L.; Imamura, M. S.
1978-01-01
Three design approaches to cell-level protection were developed, fabricated, and tested. These systems are referred to as the single-cell protector (SCP), multiplexed-cell protector(MCP). To evaluate the systems 18-cell battery packs without cell level control were subjected to cycle life test. A total of five batteries were subjected to simulate synchronous orbit cycling at 40% depth of discharge at 22C. Batteries without cell-level protection failed between 345 and 255 cycles. Cell failure in the cell level protected batteries occurred between 412 and 540. It was determined that the cell-level monitoring and protection is necessary to attain the long cycle life of a AgZn battery. The best method of providing control and protection of the AgZn cells depends on the specific application and capability of the user.
The Slow Cycling Phenotype: A Growing Problem for Treatment Resistance in Melanoma.
Ahn, Antonio; Chatterjee, Aniruddha; Eccles, Michael R
2017-06-01
Treatment resistance in metastatic melanoma is a longstanding issue. Current targeted therapy regimes in melanoma largely target the proliferating cancer population, leaving slow-cycling cancer cells undamaged. Consequently, slow-cycling cells are enriched upon drug therapy and can remain in the body for years until acquiring proliferative potential that triggers cancer relapse. Here we overview the molecular mechanisms of slow-cycling cells that underlie treatment resistance in melanoma. Three main areas of molecular reprogramming are discussed that mediate slow cycling and treatment resistance. First, a low microphthalmia-associated transcription factor (MITF) dedifferentiated state activates various signaling pathways. This includes WNT5A, EGFR, as well as other signaling activators, such as AXL and NF-κB. Second, the chromatin-remodeling factor Jumonji/ARID domain-containing protein 1B (JARID1B, KDM5B ) orchestrates and maintains slow cycling and treatment resistance in a small subpopulation of melanoma cells. Finally, a shift in metabolic state toward oxidative phosphorylation has been demonstrated to regulate treatment resistance in slow-cycling cells. Elucidation of the underlying processes of slow cycling and its utilization by melanoma cells may reveal new vulnerable characteristics as therapeutic targets. Moreover, combining current therapies with targeting slow-cycling subpopulations of melanoma cells may allow for more durable and greater treatment responses. Mol Cancer Ther; 16(6); 1002-9. ©2017 AACR . ©2017 American Association for Cancer Research.
Anti-bacterial activity of Achatina CRP and its mechanism of action.
Mukherjee, Sandip; Barman, Soma; Mandal, Narayan Chandra; Bhattacharya, Shelley
2014-07-01
The physiological role of C-reactive protein (CRP), the classical acute-phase protein, is not well documented, despite many reports on biological effects of CRP in vitro and in model systems in vivo. It has been suggested that CRP protects mice against lethal toxicity of bacterial infections by implementing immunological responses. In Achatina fulica CRP is a constitutive multifunctional protein in haemolymph and considered responsible for their survival in the environment for millions of years. The efficacy of Achatina CRP (ACRP) was tested against both Salmonella typhimurium and Bacillus subtilis infections in mice where endogenous CRP level is negligible even after inflammatory stimulus. Further, growth curves of the bacteria revealed that ACRP (50 microg/mL) is bacteriostatic against gram negative salmonellae and bactericidal against gram positive bacilli. ACRP induced energy crises in bacterial cells, inhibited key carbohydrate metabolic enzymes such as phosphofructokinase in glycolysis, isocitrate dehydrogenase in TCA cycle, isocitrate lyase in glyoxylate cycle and fructose-1,6-bisphosphatase in gluconeogenesis. ACRP disturbed the homeostasis of cellular redox potential as well as reduced glutathione status, which is accompanied by an enhanced rate of lipid peroxidation. Annexin V-Cy3/CFDA dual staining clearly showed ACRP induced apoptosis-like death in bacterial cell population. Moreover, immunoblot analyses also indicated apoptosis-like death in ACRP treated bacterial cells, where activation of poly (ADP-ribose) polymerase-1 (PARP) and caspase-3 was noteworthy. It is concluded that metabolic impairment by ACRP in bacterial cells is primarily due to generation of reactive oxygen species and ACRP induced anti-bacterial effect is mediated by metabolic impairment leading to apoptosis-like death in bacterial cells.
Irons, R D
1981-01-01
A detailed description of flow cytofluorometric DNA cell cycle analysis is presented. A number of studies by the author and other investigators are reviewed in which a method is developed for the analysis of cell cycle phase in bone marrow of experimental animals. Bone marrow cell cycle analysis is a sensitive indicator of changes in bone marrow proliferative activity occurring early in chemically-induced myelotoxicity. Cell cycle analysis, used together with other hematologic methods, has revealed benzene-induced toxicity in proliferating bone marrow cells to be cycle specific, appearing to affect a population in late S phase which then accumulate in G2/M. PMID:7016521
Cook, Matthew S.; Munger, Steven C.; Nadeau, Joseph H.; Capel, Blanche
2011-01-01
Human germ cell tumors show a strong sensitivity to genetic background similar to Dnd1Ter/Ter mutant mice, where testicular teratomas arise only on the 129/SvJ genetic background. The introduction of the Bax mutation onto mixed background Dnd1Ter/Ter mutants, where teratomas do not typically develop, resulted in a high incidence of teratomas. However, when Dnd1Ter/Ter; Bax–/– double mutants were backcrossed to C57BL/6J, no tumors arose. Dnd1Ter/Ter germ cells show a strong downregulation of male differentiation genes including Nanos2. In susceptible strains, where teratomas initiate around E15.5-E17.5, many mutant germ cells fail to enter mitotic arrest in G0 and do not downregulate the pluripotency markers NANOG, SOX2 and OCT4. We show that DND1 directly binds a group of transcripts that encode negative regulators of the cell cycle, including p27Kip1 and p21Cip1. P27Kip1 and P21Cip1 protein are both significantly decreased in Dnd1Ter/Ter germ cells on all strain backgrounds tested, strongly suggesting that DND1 regulates mitotic arrest in male germ cells through translational regulation of cell cycle genes. Nonetheless, in C57BL/6J mutants, germ cells arrest prior to M-phase of the cell cycle and downregulate NANOG, SOX2 and OCT4. Consistent with their ability to rescue cell cycle arrest, C57BL/6J germ cells overexpress negative regulators of the cell cycle relative to 129/SvJ. This work suggests that reprogramming of pluripotency in germ cells and prevention of tumor formation requires cell cycle arrest, and that differences in the balance of cell cycle regulators between 129/SvJ and C57BL/6 might underlie differences in tumor susceptibility. PMID:21115610
2006-08-01
Gerontologist). Physical activity (PA) plays a major role in the health and functioning of older adults , yet few older adults engage in recommended...receiving 4-8 cycles of adjuvant BC chemotherapy. Older women trended towards greater declines in functional status from baseline to cycle 4. Age ...of Health (PI: Kathryn Schmitz, PhD), as well as two submitted foundation grants. 15. SUBJECT TERMS Breast Cancer, Aging , Chemotherapy, Symptom
Comparative analyses identify molecular signature of MRI-classified SVZ-associated glioblastoma
Lin, Chin-Hsing Annie; Rhodes, Christopher T.; Lin, ChenWei; Phillips, Joanna J.; Berger, Mitchel S.
2017-01-01
ABSTRACT Glioblastoma (GBM) is a highly aggressive brain cancer with limited therapeutic options. While efforts to identify genes responsible for GBM have revealed mutations and aberrant gene expression associated with distinct types of GBM, patients with GBM are often diagnosed and classified based on MRI features. Therefore, we seek to identify molecular representatives in parallel with MRI classification for group I and group II primary GBM associated with the subventricular zone (SVZ). As group I and II GBM contain stem-like signature, we compared gene expression profiles between these 2 groups of primary GBM and endogenous neural stem progenitor cells to reveal dysregulation of cell cycle, chromatin status, cellular morphogenesis, and signaling pathways in these 2 types of MRI-classified GBM. In the absence of IDH mutation, several genes associated with metabolism are differentially expressed in these subtypes of primary GBM, implicating metabolic reprogramming occurs in tumor microenvironment. Furthermore, histone lysine methyltransferase EZH2 was upregulated while histone lysine demethylases KDM2 and KDM4 were downregulated in both group I and II primary GBM. Lastly, we identified 9 common genes across large data sets of gene expression profiles among MRI-classified group I/II GBM, a large cohort of GBM subtypes from TCGA, and glioma stem cells by unsupervised clustering comparison. These commonly upregulated genes have known functions in cell cycle, centromere assembly, chromosome segregation, and mitotic progression. Our findings highlight altered expression of genes important in chromosome integrity across all GBM, suggesting a common mechanism of disrupted fidelity of chromosome structure in GBM. PMID:28278055
Inhibition of E2F1 activity and cell cycle progression by arsenic via retinoblastoma protein.
Sheldon, Lynn A
2017-01-01
The regulation of cell cycle progression by steroid hormones and growth factors is important for maintaining normal cellular processes including development and cell proliferation. Deregulated progression through the G1/S and G2/M cell cycle transitions can lead to uncontrolled cell proliferation and cancer. The transcription factor E2F1, a key cell cycle regulator, targets genes encoding proteins that regulate cell cycle progression through the G1/S transition as well as proteins important in DNA repair and apoptosis. E2F1 expression and activity is inhibited by inorganic arsenic (iAs) that has a dual role as a cancer therapeutic and as a toxin that leads to diseases including cancer. An understanding of what underlies this dichotomy will contribute to understanding how to use iAs as a more effective therapeutic and also how to treat cancers that iAs promotes. Here, we show that quiescent breast adenocarcinoma MCF-7 cells treated with 17-β estradiol (E2) progress through the cell cycle, but few cells treated with E2 + iAs progress from G1 into S-phase due to a block in cell cycle progression. Our data support a model in which iAs inhibits the dissociation of E2F1 from the tumor suppressor, retinoblastoma protein (pRB) due to changes in pRB phosphorylation which leads to decreased E2F1 transcriptional activity. These findings present an explanation for how iAs can disrupt cell cycle progression through E2F1-pRB and has implications for how iAs acts as a cancer therapeutic as well as how it may promote tumorigenesis through decreased DNA repair.
Multiparameter Cell Cycle Analysis.
Jacobberger, James W; Sramkoski, R Michael; Stefan, Tammy; Woost, Philip G
2018-01-01
Cell cycle cytometry and analysis are essential tools for studying cells of model organisms and natural populations (e.g., bone marrow). Methods have not changed much for many years. The simplest and most common protocol is DNA content analysis, which is extensively published and reviewed. The next most common protocol, 5-bromo-2-deoxyuridine S phase labeling detected by specific antibodies, is also well published and reviewed. More recently, S phase labeling using 5'-ethynyl-2'-deoxyuridine incorporation and a chemical reaction to label substituted DNA has been established as a basic, reliable protocol. Multiple antibody labeling to detect epitopes on cell cycle regulated proteins, which is what this chapter is about, is the most complex of these cytometric cell cycle assays, requiring knowledge of the chemistry of fixation, the biochemistry of antibody-antigen reactions, and spectral compensation. However, because this knowledge is relatively well presented methodologically in many papers and reviews, this chapter will present a minimal Methods section for one mammalian cell type and an extended Notes section, focusing on aspects that are problematic or not well described in the literature. Most of the presented work involves how to segment the data to produce a complete, progressive, and compartmentalized cell cycle analysis from early G1 to late mitosis (telophase). A more recent development, using fluorescent proteins fused with proteins or peptides that are degraded by ubiquitination during specific periods of the cell cycle, termed "Fucci" (fluorescent, ubiquitination-based cell cycle indicators) provide an analysis similar in concept to multiple antibody labeling, except in this case cells can be analyzed while living and transgenic organisms can be created to perform cell cycle analysis ex or in vivo (Sakaue-Sawano et al., Cell 132:487-498, 2007). This technology will not be discussed.
Progranulin regulates neurogenesis in the developing vertebrate retina.
Walsh, Caroline E; Hitchcock, Peter F
2017-09-01
We evaluated the expression and function of the microglia-specific growth factor, Progranulin-a (Pgrn-a) during developmental neurogenesis in the embryonic retina of zebrafish. At 24 hpf pgrn-a is expressed throughout the forebrain, but by 48 hpf pgrn-a is exclusively expressed by microglia and/or microglial precursors within the brain and retina. Knockdown of Pgrn-a does not alter the onset of neurogenic programs or increase cell death, however, in its absence, neurogenesis is significantly delayed-retinal progenitors fail to exit the cell cycle at the appropriate developmental time and postmitotic cells do not acquire markers of terminal differentiation, and microglial precursors do not colonize the retina. Given the link between Progranulin and cell cycle regulation in peripheral tissues and transformed cells, we analyzed cell cycle kinetics among retinal progenitors following Pgrn-a knockdown. Depleting Pgrn-a results in a significant lengthening of the cell cycle. These data suggest that Pgrn-a plays a dual role during nervous system development by governing the rate at which progenitors progress through the cell cycle and attracting microglial progenitors into the embryonic brain and retina. Collectively, these data show that Pgrn-a governs neurogenesis by regulating cell cycle kinetics and the transition from proliferation to cell cycle exit and differentiation. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc. Develop Neurobiol 77: 1114-1129, 2017. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc.