Science.gov

Sample records for stem cell-derived cardiac

  1. Quality Metrics for Stem Cell-Derived Cardiac Myocytes

    PubMed Central

    Sheehy, Sean P.; Pasqualini, Francesco; Grosberg, Anna; Park, Sung Jin; Aratyn-Schaus, Yvonne; Parker, Kevin Kit

    2014-01-01

    Summary Advances in stem cell manufacturing methods have made it possible to produce stem cell-derived cardiac myocytes at industrial scales for in vitro muscle physiology research purposes. Although FDA-mandated quality assurance metrics address safety issues in the manufacture of stem cell-based products, no standardized guidelines currently exist for the evaluation of stem cell-derived myocyte functionality. As a result, it is unclear whether the various stem cell-derived myocyte cell lines on the market perform similarly, or whether any of them accurately recapitulate the characteristics of native cardiac myocytes. We propose a multiparametric quality assessment rubric in which genetic, structural, electrophysiological, and contractile measurements are coupled with comparison against values for these measurements that are representative of the ventricular myocyte phenotype. We demonstrated this procedure using commercially available, mass-produced murine embryonic stem cell- and induced pluripotent stem cell-derived myocytes compared with a neonatal mouse ventricular myocyte target phenotype in coupled in vitro assays. PMID:24672752

  2. Pluripotent Stem Cell Derived Cardiomyocytes for Cardiac Repair

    PubMed Central

    Lundy, Scott D.; Gantz, Jay A.; Pagan, Chelsea M.; Filice, Dominic; Laflamme, Michael A.

    2014-01-01

    Opinion Statement The adult mammalian heart has limited capacity for generation, so a major injury such as a myocardial infarction results in the permanent loss of up to one billion cardiomyocytes. The field of cardiac cell therapy aims to replace these lost contractile units with de novo cardiomyocytes to restore lost systolic function and prevent progression to heart failure. Arguably the ideal cell for this application is the human cardiomyocyte itself, which can electromechanically couple with host myocardium and contribute active systolic force. Pluripotent stem cells from both human embryonic or induced pluripotent lineages are attractive sources for cardiomyocytes, and preclinical investigation of these cells is in progress. Recent work has focused on efficient generation and purification of cardiomyocytes, tissue engineering efforts, and examining the consequences of cell transplantation from mechanical, vascular, and electrical standpoints. Here we discuss historical and contemporary aspects of pluripotent stem cell-based cardiac cell therapy, with an emphasis on recent preclinical studies with translational goals. PMID:24838687

  3. Calcium Imaging in Pluripotent Stem Cell-Derived Cardiac Myocytes.

    PubMed

    Walter, Anna; Šarić, Tomo; Hescheler, Jürgen; Papadopoulos, Symeon

    2016-01-01

    The possibility to generate cardiomyocytes (CMs) from disease-specific induced pluripotent stem cells (iPSCs) is a powerful tool for the investigation of various cardiac diseases in vitro. The pathological course of various cardiac conditions, causatively heterogeneous, often converges into disturbed cellular Ca(2+) cycling. The gigantic Ca(2+) channel of the intracellular Ca(2+) store of CMs, the ryanodine receptor type 2 (RyR2), controls Ca(2+) release and therefore plays a crucial role in Ca(2+) cycling of CMs. In the present protocol we describe ways to measure and analyze global as well as local cellular Ca(2+) release events in CMs derived from a patient carrying a CPVT-causing RyR2 mutation.

  4. Pluripotent Stem Cell Derived Cardiac Cells for Myocardial Repair.

    PubMed

    Zhu, Wuqiang; Gao, Ling; Zhang, Jianyi

    2017-02-03

    Human induced pluripotent stem cells (hiPSCs) must be fully differentiated into specific cell types before administration, but conventional protocols for differentiating hiPSCs into cardiomyocytes (hiPSC-CMs), endothelial cells (hiPSC-ECs), and smooth muscle cells (SMCs) are often limited by low yield, purity, and/or poor phenotypic stability. Here, we present novel protocols for generating hiPSC-CMs, -ECs, and -SMCs that are substantially more efficient than conventional methods, as well as a method for combining cell injection with a cytokine-containing patch created over the site of administration. The patch improves both the retention of the injected cells, by sealing the needle track to prevent the cells from being squeezed out of the myocardium, and cell survival, by releasing insulin-like growth factor (IGF) over an extended period. In a swine model of myocardial ischemia-reperfusion injury, the rate of engraftment was more than two-fold greater when the cells were administered with the cytokine-containing patch comparing to the cells without patch, and treatment with both the cells and the patch, but not with the cells alone, was associated with significant improvements in cardiac function and infarct size.

  5. Magnetic Resonance Imaging of Iron Oxide-Labeled Human Embryonic Stem Cell-Derived Cardiac Progenitors

    PubMed Central

    Skelton, Rhys J.P.; Khoja, Suhail; Almeida, Shone; Rapacchi, Stanislas; Han, Fei; Engel, James; Zhao, Peng; Hu, Peng; Stanley, Edouard G.; Elefanty, Andrew G.; Kwon, Murray

    2016-01-01

    Given the limited regenerative capacity of the heart, cellular therapy with stem cell-derived cardiac cells could be a potential treatment for patients with heart disease. However, reliable imaging techniques to longitudinally assess engraftment of the transplanted cells are scant. To address this issue, we used ferumoxytol as a labeling agent of human embryonic stem cell-derived cardiac progenitor cells (hESC-CPCs) to facilitate tracking by magnetic resonance imaging (MRI) in a large animal model. Differentiating hESCs were exposed to ferumoxytol at different time points and varying concentrations. We determined that treatment with ferumoxytol at 300 μg/ml on day 0 of cardiac differentiation offered adequate cell viability and signal intensity for MRI detection without compromising further differentiation into definitive cardiac lineages. Labeled hESC-CPCs were transplanted by open surgical methods into the left ventricular free wall of uninjured pig hearts and imaged both ex vivo and in vivo. Comprehensive T2*-weighted images were obtained immediately after transplantation and 40 days later before termination. The localization and dispersion of labeled cells could be effectively imaged and tracked at days 0 and 40 by MRI. Thus, under the described conditions, ferumoxytol can be used as a long-term, differentiation-neutral cell-labeling agent to track transplanted hESC-CPCs in vivo using MRI. Significance The development of a safe and reproducible in vivo imaging technique to track the fate of transplanted human embryonic stem cell-derived cardiac progenitor cells (hESC-CPCs) is a necessary step to clinical translation. An iron oxide nanoparticle (ferumoxytol)-based approach was used for cell labeling and subsequent in vivo magnetic resonance imaging monitoring of hESC-CPCs transplanted into uninjured pig hearts. The present results demonstrate the use of ferumoxytol labeling and imaging techniques in tracking the location and dispersion of cell grafts

  6. Extracellular Matrix Mediated Maturation of Human Pluripotent Stem Cell Derived Cardiac Monolayer Structure and Electrophysiological Function

    PubMed Central

    Herron, Todd J.; Rocha, Andre Monteiro Da; Campbell, Katherine; Ponce-Balbuena, Daniela; Willis, B. Cicero; Guerrero-Serna, Guadalupe; Liu, Qinghua; Klos, Matt; Musa, Hassan; Zarzoso, Manuel; Bizy, Alexandra; Furness, Jamie; Anumonwo, Justus; Mironov, Sergey; Jalife, José

    2016-01-01

    Background Human pluripotent stem cell-derived cardiomyocyte (hPSC-CMs) monolayers generated to date display an immature embryonic-like functional and structural phenotype that limits their utility for research and cardiac regeneration. In particular, the electrophysiological function of hPSC-CM monolayers and bioengineered constructs used to date are characterized by slow electrical impulse propagation velocity and immature action potential profiles. Methods and Results Here we have identified an optimal extracellular matrix (ECM) for significant electrophysiological and structural maturation of hPSC-CM monolayers. hPSC-CM plated in the optimal ECM combination have impulse propagation velocities ~2X faster than previously reported (43.6±7.0 cm·s−1 n=9) and have mature cardiomyocyte action potential profiles including hyperpolarized diastolic potential and rapid action potential upstroke velocity (146.5±17.7 V/s, N=5 monolayers). In addition the optimal ECM promoted hypertrophic growth of cardiomyocytes and the expression of key mature sarcolemmal (SCN5A, Kir2.1 and Connexin43) and myofilament markers (cTroponin I). The maturation process reported here relies on activation of integrin signaling pathways: neutralization of β1 integrin receptors via blocking antibodies and pharmacological blockade of focal adhesion kinase (FAK) activation prevented structural maturation. Conclusions Maturation of human stem cell derived cardiomyocyte monolayers is achieved in a one week period by plating cardiomyocytes on PDMS coverslips rather than on conventional 2D cell culture formats such as glass coverslips or plastic dishes. Activation of integrin signaling and FAK are essential for significant maturation of human cardiac monolayers. PMID:27069088

  7. Paracrine Engineering of Human Explant-Derived Cardiac Stem Cells to Over-Express Stromal-Cell Derived Factor 1α Enhances Myocardial Repair.

    PubMed

    Tilokee, Everad L; Latham, Nicholas; Jackson, Robyn; Mayfield, Audrey E; Ye, Bin; Mount, Seth; Lam, Buu-Khanh; Suuronen, Erik J; Ruel, Marc; Stewart, Duncan J; Davis, Darryl R

    2016-07-01

    First generation cardiac stem cell products provide indirect cardiac repair but variably produce key cardioprotective cytokines, such as stromal-cell derived factor 1α, which opens the prospect of maximizing up-front paracrine-mediated repair. The mesenchymal subpopulation within explant derived human cardiac stem cells underwent lentiviral mediated gene transfer of stromal-cell derived factor 1α. Unlike previous unsuccessful attempts to increase efficacy by boosting the paracrine signature of cardiac stem cells, cytokine profiling revealed that stromal-cell derived factor 1α over-expression prevented lv-mediated "loss of cytokines" through autocrine stimulation of CXCR4+ cardiac stem cells. Stromal-cell derived factor 1α enhanced angiogenesis and stem cell recruitment while priming cardiac stem cells to readily adopt a cardiac identity. As compared to injection with unmodified cardiac stem cells, transplant of stromal-cell derived factor 1α enhanced cells into immunodeficient mice improved myocardial function and angiogenesis while reducing scarring. Increases in myocardial stromal-cell derived factor 1α content paralleled reductions in myocyte apoptosis but did not influence long-term engraftment or the fate of transplanted cells. Transplantation of stromal-cell derived factor 1α transduced cardiac stem cells increased the generation of new myocytes, recruitment of bone marrow cells, new myocyte/vessel formation and the salvage of reversibly damaged myocardium to enhance cardiac repair after experimental infarction. Stem Cells 2016;34:1826-1835.

  8. Developmental stage-dependent effects of cardiac fibroblasts on function of stem cell-derived engineered cardiac tissues

    PubMed Central

    Liau, Brian; Jackman, Christopher P.; Li, Yanzhen; Bursac, Nenad

    2017-01-01

    We investigated whether the developmental stage of mouse cardiac fibroblasts (CFs) influences the formation and function of engineered cardiac tissues made of mouse embryonic stem cell-derived cardiomyocytes (mESC-CMs). Engineered cardiac tissue patches were fabricated by encapsulating pure mESC-CMs, mESC-CMs + adult CFs, or mESC-CMs + fetal CFs in fibrin-based hydrogel. Tissue patches containing fetal CFs exhibited higher velocity of action potential propagation and contractile force amplitude compared to patches containing adult CFs, while pure mESC-CM patches did not form functional syncytium. The functional improvements in mESC-CM + fetal CF patches were associated with differences in structural remodeling and increased expression of proteins involved in cardiac function. To determine role of paracrine signaling, we cultured pure mESC-CMs within miniature tissue “micro-patches” supplemented with media conditioned by adult or fetal CFs. Fetal CF-conditioned media distinctly enhanced CM spreading and contractile activity, which was shown by pathway inhibitor experiments and Western blot analysis to be mediated via MEK-ERK signaling. In mESC-CM monolayers, CF-conditioned media did not alter CM spreading or MEK-ERK activation. Collectively, our studies show that 3D co-culture of mESC-CMs with embryonic CFs is superior to co-culture with adult CFs for in vitro generation of functional myocardium. Ensuring consistent developmental stages of cardiomyocytes and supporting non-myocytes may be a critical factor for promoting functional maturation of engineered cardiac tissues. PMID:28181589

  9. Cardiac Non-myocyte Cells Show Enhanced Pharmacological Function Suggestive of Contractile Maturity in Stem Cell Derived Cardiomyocyte Microtissues

    PubMed Central

    Ravenscroft, Stephanie M.; Pointon, Amy; Williams, Awel W.; Cross, Michael J.; Sidaway, James E.

    2016-01-01

    The immature phenotype of stem cell derived cardiomyocytes is a significant barrier to their use in translational medicine and pre-clinical in vitro drug toxicity and pharmacological analysis. Here we have assessed the contribution of non-myocyte cells on the contractile function of co-cultured human embryonic stem cell derived cardiomyocytes (hESC-CMs) in spheroid microtissue format. Microtissues were formed using a scaffold free 96-well cell suspension method from hESC-CM cultured alone (CM microtissues) or in combination with human primary cardiac microvascular endothelial cells and cardiac fibroblasts (CMEF microtissues). Contractility was characterized with fluorescence and video-based edge detection. CMEF microtissues displayed greater Ca2+ transient amplitudes, enhanced spontaneous contraction rate and remarkably enhanced contractile function in response to both positive and negative inotropic drugs, suggesting a more mature contractile phenotype than CM microtissues. In addition, for several drugs the enhanced contractile response was not apparent when endothelial cell or fibroblasts from a non-cardiac tissue were used as the ancillary cells. Further evidence of maturity for CMEF microtissues was shown with increased expression of genes that encode proteins critical in cardiac Ca2+ handling (S100A1), sarcomere assembly (telethonin/TCAP) and β-adrenergic receptor signalling. Our data shows that compared with single cell-type cardiomyocyte in vitro models, CMEF microtissues are superior at predicting the inotropic effects of drugs, demonstrating the critical contribution of cardiac non-myocyte cells in mediating functional cardiotoxicity. PMID:27125969

  10. Teratocarcinomas Arising from Allogeneic Induced Pluripotent Stem Cell-Derived Cardiac Tissue Constructs Provoked Host Immune Rejection in Mice

    PubMed Central

    Kawamura, Ai; Miyagawa, Shigeru; Fukushima, Satsuki; Kawamura, Takuji; Kashiyama, Noriyuki; Ito, Emiko; Watabe, Tadashi; Masuda, Shigeo; Toda, Koichi; Hatazawa, Jun; Morii, Eiichi; Sawa, Yoshiki

    2016-01-01

    Transplantation of induced pluripotent stem cell-derived cardiac tissue constructs is a promising regenerative treatment for cardiac failure: however, its tumourigenic potential is concerning. We hypothesised that the tumourigenic potential may be eliminated by the host immune response after allogeneic cell transplantation. Scaffold-free iPSC-derived cardaic tissue sheets of C57BL/6 mouse origin were transplanted into the cardiac surface of syngeneic C57BL/6 mice and allogeneic BALB/c mice with or without tacrolimus injection. Syngeneic mice and tacrolimus-injected immunosuppressed allogeneic mice formed teratocarcinomas with identical phenotypes, characteristic, and time courses, as assessed by imaging tools including 18F-fluorodeoxyglucose-positron emission tomography. In contrast, temporarily immunosuppressed allogeneic mice, following cessation of tacrolimus injection displayed diminished progression of the teratocarcinoma, accompanied by an accumulation of CD4/CD8-positive T cells, and finally achieved complete elimination of the teratocarcinoma. Our results indicated that malignant teratocarcinomas arising from induced pluripotent stem cell-derived cardiac tissue constructs provoked T cell-related host immune rejection to arrest tumour growth in murine allogeneic transplantation models. PMID:26763872

  11. Mouse embryonic stem cell-derived cardiac myocytes in a cell culture dish.

    PubMed

    Glass, Carley; Singla, Reetu; Arora, Anshu; Singla, Dinender K

    2015-01-01

    Embryonic stem (ES) cells are pluripotent stem cells capable of self-renewal and have broad differentiation potential yielding cell types from all three germ layers. In the absence of differentiation inhibitory factors, when cultured in suspension, ES cells spontaneously differentiate and form three-dimensional cell aggregates termed embryoid bodies (EBs). Although various methods exist for the generation of EBs, the hanging drop method offers reproducibility and homogeneity from a predetermined number of ES cells. Herein, we describe the in vitro differentiation of mouse embryonic stem cells into cardiac myocytes using the hanging drop method and immunocytochemistry to identify cardiomyogenic differentiation. In brief, ES cells, placed in droplets on the lid of culture dishes following a 2-day incubation, yield embryoid bodies, which are resuspended and plated. 1-2 weeks following plating of the EBs, spontaneous beating areas can be observed and staining for specific cardiac markers can be achieved.

  12. Pluripotent stem cell derivation and differentiation toward cardiac muscle: novel techniques and advances in patent literature.

    PubMed

    Quattrocelli, Mattia; Thorrez, Lieven; Sampaolesi, Maurilio

    2013-04-01

    Pluripotent stem cells hold unprecedented potential for regenerative medicine, disease modeling and drug screening. Embryonic stem cells (ESCs), standard model for pluripotency studies, have been recently flanked by induced pluripotent stem cells (iPSCs). iPSCs are obtained from somatic cells via epigenetic and transcriptional reprogramming, overcoming ESC-related ethical issues and enabling the possibility of donor-matching pluripotent cell lines. Since the European Court of Justice banned patents involving embryo disaggregation to generate human ESCs, iPSCs can now fuel the willingness of European companies to invest in treatments based on stem cells. Moreover, iPSCs share many unique features of ESCs, such as unlimited self-renewal potential and broad differentiation capability, even though iPSCs seem more susceptible to genomic instability and display epigenetic biases as compared to ESCs. Both ESCs and iPSCs have been intensely investigated for cardiomyocyte production and cardiac muscle regeneration, both in human and animal models. In vitro and in vivo studies are continuously expanding and refining this field via genetic manipulation and cell conditioning, trying to achieve standard and reproducible products, eligible for clinical and biopharmaceutical scopes. This review focuses on the recently growing body of patents, concerning technical advances in production, expansion and cardiac differentiation of ESCs and iPSCs.

  13. Human induced pluripotent stem cell-derived beating cardiac tissues on paper.

    PubMed

    Wang, Li; Xu, Cong; Zhu, Yujuan; Yu, Yue; Sun, Ning; Zhang, Xiaoqing; Feng, Ke; Qin, Jianhua

    2015-11-21

    There is a growing interest in using paper as a biomaterial scaffold for cell-based applications. In this study, we made the first attempt to fabricate a paper-based array for the culture, proliferation, and direct differentiation of human induced pluripotent stem cells (hiPSCs) into functional beating cardiac tissues and create "a beating heart on paper." This array was simply constructed by binding a cured multi-well polydimethylsiloxane (PDMS) mold with common, commercially available paper substrates. Three types of paper material (print paper, chromatography paper and nitrocellulose membrane) were tested for adhesion, proliferation and differentiation of human-derived iPSCs. We found that hiPSCs grew well on these paper substrates, presenting a three-dimensional (3D)-like morphology with a pluripotent property. The direct differentiation of human iPSCs into functional cardiac tissues on paper was also achieved using our modified differentiation approach. The cardiac tissue retained its functional activities on the coated print paper and chromatography paper with a beating frequency of 40-70 beats per min for up to three months. Interestingly, human iPSCs could be differentiated into retinal pigment epithelium on nitrocellulose membrane under the conditions of cardiac-specific induction, indicating the potential roles of material properties and mechanical cues that are involved in regulating stem cell differentiation. Taken together, these results suggest that different grades of paper could offer great opportunities as bioactive, low-cost, and 3D in vitro platforms for stem cell-based high-throughput drug testing at the tissue/organ level and for tissue engineering applications.

  14. Cardiac disease modeling using induced pluripotent stem cell-derived human cardiomyocytes.

    PubMed

    Dell'Era, Patrizia; Benzoni, Patrizia; Crescini, Elisabetta; Valle, Matteo; Xia, Er; Consiglio, Antonella; Memo, Maurizio

    2015-03-26

    Causative mutations and variants associated with cardiac diseases have been found in genes encoding cardiac ion channels, accessory proteins, cytoskeletal components, junctional proteins, and signaling molecules. In most cases the functional evaluation of the genetic alteration has been carried out by expressing the mutated proteins in in-vitro heterologous systems. While these studies have provided a wealth of functional details that have greatly enhanced the understanding of the pathological mechanisms, it has always been clear that heterologous expression of the mutant protein bears the intrinsic limitation of the lack of a proper intracellular environment and the lack of pathological remodeling. The results obtained from the application of the next generation sequencing technique to patients suffering from cardiac diseases have identified several loci, mostly in non-coding DNA regions, which still await functional analysis. The isolation and culture of human embryonic stem cells has initially provided a constant source of cells from which cardiomyocytes (CMs) can be obtained by differentiation. Furthermore, the possibility to reprogram cellular fate to a pluripotent state, has opened this process to the study of genetic diseases. Thus induced pluripotent stem cells (iPSCs) represent a completely new cellular model that overcomes the limitations of heterologous studies. Importantly, due to the possibility to keep spontaneously beating CMs in culture for several months, during which they show a certain degree of maturation/aging, this approach will also provide a system in which to address the effect of long-term expression of the mutated proteins or any other DNA mutation, in terms of electrophysiological remodeling. Moreover, since iPSC preserve the entire patients' genetic context, the system will help the physicians in identifying the most appropriate pharmacological intervention to correct the functional alteration. This article summarizes the current

  15. Induced Pluripotent Stem Cell-derived Cardiomyocytes: Cardiac Applications, Opportunities and Challenges.

    PubMed

    Moreau, Adrien; Boutjdir, Mohamed; Chahine, Mohamed

    2017-03-28

    Chronic diseases are the primary cause of mortality worldwide, accounting for 67% of deaths. One of the major challenges in developing new treatments is the lack of understanding of the exact underlying biological and molecular mechanisms. Chronic cardiovascular diseases are the single most common cause of death worldwide, and sudden deaths due to cardiac arrhythmias account for approximately 50% of all such cases. Traditional genetic screening for genes involved in cardiac disorders is laborious and frequently fails to detect the mutation that explains or causes the disorder. However, when mutations are identified, human induced pluripotent stem cells (hiPSCs) derived from affected patients make it possible to address fundamental research questions directly relevant to human health. As such, hiPSC technology has recently been used to model human diseases and patient-specific hiPSC-derived cardiomyocytes (hiPSC-CMs) thus offer a unique opportunity to investigate potential disease-causing genetic variants in their natural environment. The purpose of this review is to present the current state of knowledge regarding hiPSC-CMs, including their potential, limitations, and challenges and to discuss future prospects.

  16. Human-induced pluripotent stem cell-derived cardiomyocytes for studies of cardiac ion transporters

    PubMed Central

    Fine, Michael; Lu, Fang-Min; Lin, Mei-Jung; Moe, Orson; Wang, Hao-Ran

    2013-01-01

    Human-induced pluripotent stem cells (hiPSCs) can differentiate into functional cardiomyocytes (iCell Cardiomyocytes) with ion channel activities that are remarkably similar to adult cardiomyocytes. Here, we extend this characterization to cardiac ion transporters. Additionally, we document facile molecular biological manipulation of iCell Cardiomyocytes to overexpress and knockdown transporters and regulatory proteins. Na/Ca exchange (NCX1) and Na/K pump currents were recorded via patch clamp, and Na/H and Cl/OH exchanges were recorded via oscillating proton-selective microelectrodes during patch clamp. Flux densities of all transport systems are similar to those of nonrodent adult cardiomyocytes. NCX1 protein and NCX1 currents decline after NCX1 small interfering (si)RNA transfection with similar time courses (τ ≈ 2 days), and an NCX1-Halo fusion protein is internalized after its extracellular labeling by AlexaFluor488 Ligand with a similar time course. Loss of the cardiac regulatory protein phospholemman (PLM) occurs over a longer time course (τ ≈ 60 h) after PLM small interfering RNA transfection. Similar to multiple previous reports for adult cardiomyocytes, Na/K pump currents in iCell Cardiomyocytes are not enhanced by activating cAMP production with either maximal or submaximal cytoplasmic Na and using either forskolin or isoproterenol to activate adenylate cyclases. Finally, we describe Ca influx-dependent changes of iCell Cardiomyocyte capacitance (Cm). Large increases of Cm occur during Ca influx via NCX1, thereby documenting large internal membrane reserves that can fuse to the sarcolemma, and subsequent declines of Cm document active endocytic processes. Together, these results document a great potential of iCell Cardiomyocytes for both short- and long-term studies of cardiac ion transporters and their regulation. PMID:23804202

  17. Embryonic stem cell-derived cardiomyocyte heterogeneity and the isolation of immature and committed cells for cardiac remodeling and regeneration.

    PubMed

    Boheler, Kenneth R; Joodi, Robert N; Qiao, Hui; Juhasz, Ondrej; Urick, Amanda L; Chuppa, Sandra L; Gundry, Rebekah L; Wersto, Robert P; Zhou, Rong

    2011-01-01

    Pluripotent stem cells represent one promising source for cell replacement therapy in heart, but differentiating embryonic stem cell-derived cardiomyocytes (ESC-CMs) are highly heterogeneous and show a variety of maturation states. In this study, we employed an ESC clonal line that contains a cardiac-restricted ncx1 promoter-driven puromycin resistance cassette together with a mass culture system to isolate ESC-CMs that display traits characteristic of very immature CMs. The cells display properties of proliferation, CM-restricted markers, reduced mitochondrial mass, and hypoxia-resistance. Following transplantation into rodent hearts, bioluminescence imaging revealed that immature cells, but not more mature CMs, survived for at least one month following injection. These data and comparisons with more mature cells lead us to conclude that immature hypoxia resistant ESC-CMs can be isolated in mass in vitro and, following injection into heart, form grafts that may mediate long-term recovery of global and regional myocardial contractile function following infarction.

  18. Platelet-derived growth factor receptor-alpha positive cardiac progenitor cells derived from multipotent germline stem cells are capable of cardiomyogenesis in vitro and in vivo.

    PubMed

    Kim, Bang-Jin; Kim, Yong-Hee; Lee, Yong-An; Jung, Sang-Eun; Hong, Yeong Ho; Lee, Eun-Ju; Kim, Byung-Gak; Hwang, Seongsoo; Do, Jeong Tae; Pang, Myung-Geol; Ryu, Buom-Yong

    2017-03-31

    Cardiac cell therapy has the potential to revolutionize treatment of heart diseases, but its success hinders on the development of a stem cell therapy capable of efficiently producing functionally differentiated cardiomyocytes. A key to unlocking the therapeutic application of stem cells lies in understanding the molecular mechanisms that govern the differentiation process. Here we report that a population of platelet-derived growth factor receptor alpha (PDGFRA) cells derived from mouse multipotent germline stem cells (mGSCs) were capable of undergoing cardiomyogenesis in vitro. Cells derived in vitro from PDGFRA positive mGSCs express significantly higher levels of cardiac marker proteins compared to PDGFRA negative mGSCs. Using Pdgfra shRNAs to investigate the dependence of Pdgfra on cardiomyocyte differentiation, we observed that Pdgfra silencing inhibited cardiac differentiation. In a rat myocardial infarction (MI) model, transplantation of a PDGFRAenriched cell population into the rat heart readily underwent functional differentiation into cardiomyocytes and reduced areas of fibrosis associated with MI injury. Together, these results suggest that mGSCs may provide a unique source of cardiac stem/progenitor cells for future regenerative therapy of damaged heart tissue.

  19. Cardiac tissue development for delivery of embryonic stem cell-derived endothelial and cardiac cells in natural matrices.

    PubMed

    Turner, William S; Wang, Xiaoling; Johnson, Scott; Medberry, Christopher; Mendez, Jose; Badylak, Stephen F; McCord, Marian G; McCloskey, Kara E

    2012-11-01

    The packaging and delivery of cells for cardiac regeneration has been explored using a variety biomaterials and delivery methods, but these studies often ignore one or more important design factors critical for rebuilding cardiac tissue. These include the biomaterial architecture, strength and stiffness, cell alignment, and/or incorporation of multiple cell types. In this article, we explore the combinatorial use of decellularized tissues, moldable hydrogels, patterned cell-seeding, and cell-sheet engineering and find that a combination of these methods is optimal in the recreation of transplantable cardiac-like tissue in vivo. We show that decellularized urinary bladder matrix (UBM), that is compliant and suturable, supports the survival of cell cultures but does not allow maintenance of cell-to-cell contacts of transferred cell-sheets (presumably, due to its rough surface). Moreover, the UBM material must be filled with hyaluronan (HA) hydrogels for smoothing rough surfaces and allowing the delivery of greater cell numbers. We additionally incorporated our previously developed "wrinkled" microchip for inducing alignment of cardiac cells with a laser-etched mask for co-seeding patterned "channels" of cells. This article also introduces a novel method of plasma coating for cell-sheet engineering that compares well with electron bean irradiation methods and may be combined with our "wrinkled" surfaces to facilitate the alignment of cardiac cells into sheets. Our data shows that an optimal design for generating cardiac tissue would include (1) decellularized matrix seeded with endothelial cells in a HA layered with (2) prealigned cardiac cell-sheets fabricated using our "wrinkled" microchips and thermo-responsive polymer [poly(N-isopropylacrylamide)] cell sheet transfer system.

  20. Efficient generation of human embryonic stem cell-derived cardiac progenitors based on tissue-specific enhanced green fluorescence protein expression.

    PubMed

    Szebényi, Kornélia; Péntek, Adrienn; Erdei, Zsuzsa; Várady, György; Orbán, Tamás I; Sarkadi, Balázs; Apáti, Ágota

    2015-01-01

    Cardiac progenitor cells (CPCs) are committed to the cardiac lineage but retain their proliferative capacity before becoming quiescent mature cardiomyocytes (CMs). In medical therapy and research, the use of human pluripotent stem cell-derived CPCs would have several advantages compared with mature CMs, as the progenitors show better engraftment into existing heart tissues, and provide unique potential for cardiovascular developmental as well as for pharmacological studies. Here, we demonstrate that the CAG promoter-driven enhanced green fluorescence protein (EGFP) reporter system enables the identification and isolation of embryonic stem cell-derived CPCs. Tracing of CPCs during differentiation confirmed up-regulation of surface markers, previously described to identify cardiac precursors and early CMs. Isolated CPCs express cardiac lineage-specific transcripts, still have proliferating capacity, and can be re-aggregated into embryoid body-like structures (CAG-EGFP(high) rEBs). Expression of troponin T and NKX2.5 mRNA is up-regulated in long-term cultured CAG-EGFP(high) rEBs, in which more than 90% of the cells become Troponin I positive mature CMs. Moreover, about one third of the CAG-EGFP(high) rEBs show spontaneous contractions. The method described here provides a powerful tool to generate expandable cultures of pure human CPCs that can be used for exploring early markers of the cardiac lineage, as well as for drug screening or tissue engineering applications.

  1. Impact of Cell Composition and Geometry on Human Induced Pluripotent Stem Cells-Derived Engineered Cardiac Tissue

    PubMed Central

    Nakane, Takeichiro; Masumoto, Hidetoshi; Tinney, Joseph P.; Yuan, Fangping; Kowalski, William J.; Ye, Fei; LeBlanc, Amanda J.; Sakata, Ryuzo; Yamashita, Jun K.; Keller, Bradley B.

    2017-01-01

    The current study describes a scalable, porous large-format engineered cardiac tissue (LF-ECT) composed of human induced pluripotent stem cells (hiPSCs) derived multiple lineage cardiac cells with varied 3D geometries and cell densities developed towards the goal of scale-up for large animal pre-clinical studies. We explored multiple 15 × 15 mm ECT geometries using molds with rectangular internal staggered posts (mesh, ME), without posts (plain sheet, PS), or long parallel posts (multiple linear bundles, ML) and a gel matrix containing hiPSC-derived cardiomyocytes, endothelial, and vascular mural cells matured in vitro for 14 days. ME-ECTs displayed the lowest dead cell ratio (p < 0.001) and matured into 0.5 mm diameter myofiber bundles with greater 3D cell alignment and higher active stress than PS-ECTs. Increased initial ECT cell number beyond 6 M per construct resulted in reduced cell survival and lower active stress. The 6M-ME-ECTs implanted onto 1 week post-infarct immune tolerant rat hearts engrafted, displayed evidence for host vascular coupling, and recovered myocardial structure and function with reduced scar area. We generated a larger (30 × 30 mm) ME-ECT to confirm scalability. Thus, large-format ECTs generated from hiPSC-derived cardiac cells may be feasible for large animal preclinical cardiac regeneration paradigms. PMID:28368043

  2. Use of Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes (hiPSC-CMs) to Monitor Compound Effects on Cardiac Myocyte Signaling Pathways.

    PubMed

    Guo, Liang; Eldridge, Sandy; Furniss, Mike; Mussio, Jodie; Davis, Myrtle

    2015-09-01

    There is a need to develop mechanism-based assays to better inform risk of cardiotoxicity. Human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) are rapidly gaining acceptance as a biologically relevant in vitro model for use in drug discovery and cardiotoxicity screens. Utilization of hiPSC-CMs for mechanistic investigations would benefit from confirmation of the expression and activity of cellular pathways that are known to regulate cardiac myocyte viability and function. This unit describes an approach to demonstrate the presence and function of signaling pathways in hiPSC-CMs and the effects of treatments on these pathways. We present a workflow that employs protocols to demonstrate protein expression and functional integrity of signaling pathway(s) of interest and to characterize biological consequences of signaling modulation. These protocols utilize a unique combination of structural, functional, and biochemical endpoints to interrogate compound effects on cardiomyocytes.

  3. Use of Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes (hiPSC-CMs) to Monitor Compound Effects on Cardiac Myocyte Signaling Pathways

    PubMed Central

    Furniss, Mike; Mussio, Jodie; Davis, Myrtle

    2015-01-01

    There is a need to develop mechanism-based assays to better inform risk of cardiotoxicity. Human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) are gaining rapid acceptance as a biologically relevant in vitro model for use in drug discovery and cardiotoxicity screens. Utilization of hiPSC-CMs for mechanistic investigations would benefit from confirmation of the expression and activity of cellular pathways that are known to regulate cardiac myocyte viability and function. This unit describes an approach to demonstrate the presence and function of signaling pathway(s) in hiPSC-CMs and the effects of treatments on these pathways. We present a workflow that employs protocols to demonstrate protein expression, functional integrity of signaling pathway(s) of interest and that characterize biological consequences of signaling modulation. These protocols utilize a unique combination of structural, functional and biochemical endpoints to interrogate compound effects on cardiomyocytes. PMID:26331525

  4. Human Stem Cell Derived Cardiomyocytes: An Alternative ...

    EPA Pesticide Factsheets

    Chemical spills and associated deaths in the US has increased 2.6-fold and 16-fold from 1983 to 2012, respectfully. In addition, the number of chemicals to which humans are exposed to in the environment has increased almost 10-fold from 2001 to 2013 within the US. Internationally, a WHO report on the global composite impact of chemicals on health reported that 16% of the total burden of cardiovascular disease was attributed to environmental chemical exposure with 2.5 million deaths per year. Clearly, the cardiovascular system, at all its various developmental and life stages, represents a critical target organ system that can be adversely affected by existing and emerging chemicals (e.g., engineered nanomaterials) in a variety of environmental media. The ability to assess chemical cardiac risk and safety is critically needed but extremely challenging due to the number and categories of chemicals in commerce, as indicated. This presentation\\session will evaluate the use of adult human stem cell derived cardiomyocytes, and existing platforms, as an alternative model to evaluate environmental chemical cardiac toxicity as well as provide key information for the development of predictive adverse outcomes pathways associated with environmental chemical exposures. (This abstract does not represent EPA policy) Rapid and translatable chemical safety screening models for cardiotoxicity current status for informing regulatory decisions, a workshop sponsored by the Society

  5. Nanothin Coculture Membranes with Tunable Pore Architecture and Thermoresponsive Functionality for Transfer-Printable Stem Cell-Derived Cardiac Sheets.

    PubMed

    Ryu, Seungmi; Yoo, Jin; Jang, Yeongseon; Han, Jin; Yu, Seung Jung; Park, Jooyeon; Jung, Seon Yeop; Ahn, Kyung Hyun; Im, Sung Gap; Char, Kookheon; Kim, Byung-Soo

    2015-10-27

    Coculturing stem cells with the desired cell type is an effective method to promote the differentiation of stem cells. The features of the membrane used for coculturing are crucial to achieving the best outcome. Not only should the membrane act as a physical barrier that prevents the mixing of the cocultured cell populations, but it should also allow effective interactions between the cells. Unfortunately, conventional membranes used for coculture do not sufficiently meet these requirements. In addition, cell harvesting using proteolytic enzymes following coculture impairs cell viability and the extracellular matrix (ECM) produced by the cultured cells. To overcome these limitations, we developed nanothin and highly porous (NTHP) membranes, which are ∼20-fold thinner and ∼25-fold more porous than the conventional coculture membranes. The tunable pore size of NTHP membranes at the nanoscale level was found crucial for the formation of direct gap junctions-mediated contacts between the cocultured cells. Differentiation of the cocultured stem cells was dramatically enhanced with the pore size-customized NTHP membrane system compared to conventional coculture methods. This was likely due to effective physical contacts between the cocultured cells and the fast diffusion of bioactive molecules across the membrane. Also, the thermoresponsive functionality of the NTHP membranes enabled the efficient generation of homogeneous, ECM-preserved, highly viable, and transfer-printable sheets of cardiomyogenically differentiated cells. The coculture platform developed in this study would be effective for producing various types of therapeutic multilayered cell sheets that can be differentiated from stem cells.

  6. Concise Review: Pluripotent Stem Cell-Derived Cardiac Cells, A Promising Cell Source for Therapy of Heart Failure: Where Do We Stand?

    PubMed

    Gouadon, Elodie; Moore-Morris, Thomas; Smit, Nicoline W; Chatenoud, Lucienne; Coronel, Ruben; Harding, Sian E; Jourdon, Philippe; Lambert, Virginie; Rucker-Martin, Catherine; Pucéat, Michel

    2016-01-01

    Heart failure is still a major cause of hospitalization and mortality in developed countries. Many clinical trials have tested the use of multipotent stem cells as a cardiac regenerative medicine. The benefit for the patients of this therapeutic intervention has remained limited. Herein, we review the pluripotent stem cells as a cell source for cardiac regeneration. We more specifically address the various challenges of this cell therapy approach. We question the cell delivery systems, the immune tolerance of allogenic cells, the potential proarrhythmic effects, various drug mediated interventions to facilitate cell grafting and, finally, we describe the pathological conditions that may benefit from such an innovative approach. As members of a transatlantic consortium of excellence of basic science researchers and clinicians, we propose some guidelines to be applied to cell types and modes of delivery in order to translate pluripotent stem cell cardiac derivatives into safe and effective clinical trials.

  7. Functional Characterization of Human Stem Cell-Derived Cardiomyocytes

    PubMed Central

    Kirsch, Authors Glenn E.; Obejero-Paz, Carlos A.; Bruening-Wright, Andrew

    2014-01-01

    Cardiac toxicity is a leading contributor to late-stage attrition in the drug discovery process and to withdrawal of approved from the market. In vitro assays that enable earlier and more accurate testing for cardiac risk provide early stage predictive indicators that aid in mitigating risk. Human cardiomyocytes, the most relevant subjects for early stage testing, are severely limited in supply. But human stem cell-derived cardiomyocytes (SC-hCM) are readily available from commercial sources and are increasingly used in academic research, drug discovery and safety pharmacology. As a result, SC-hCM electrophysiology has become a valuable tool to assess cardiac risk associated with drugs. This unit describes techniques for recording individual currents carried by sodium, calcium and potassium ions, as well as single cell action potentials, and impedance recordings from contracting syncytia of thousands of interconnected cells. PMID:25152802

  8. Cell therapy with embryonic stem cell-derived cardiomyocytes encapsulated in injectable nanomatrix gel enhances cell engraftment and promotes cardiac repair.

    PubMed

    Ban, Kiwon; Park, Hun-Jun; Kim, Sangsung; Andukuri, Adinarayana; Cho, Kyu-Won; Hwang, Jung Wook; Cha, Ho Jin; Kim, Sang Yoon; Kim, Woan-Sang; Jun, Ho-Wook; Yoon, Young-Sup

    2014-10-28

    A significant barrier to the therapeutic use of stem cells is poor cell retention in vivo. Here, we evaluate the therapeutic potential and long-term engraftment of cardiomyocytes (CMs) derived from mouse embryonic stem cells (mESCs) encapsulated in an injectable nanomatrix gel consisting of peptide amphiphiles incorporating cell adhesive ligand Arg-Gly-Asp-Ser (PA-RGDS) in experimental myocardial infarction (MI). We cultured rat neonatal CMs in PA-RGDS for 7 days and found that more than 90% of the CMs survived. Next, we intramyocardially injected mouse CM cell line HL-1 CMs with or without PA-RGDS into uninjured hearts. Histologic examination and flow cytometry analysis of digested heart tissues showed approximately 3-fold higher engraftment in the mice that received CMs with PA-RGDS compared to those without PA-RGDS. We further investigated the therapeutic effects and long-term engraftment of mESC-CMs with PA-RGDS on MI in comparison with PBS control, CM-only, and PA-RGDS only. Echocardiography demonstrated that the CM-only and CM+PA-RGDS groups showed higher cardiac function at week 2 compared to other groups. However, from 3 weeks, higher cardiac function was maintained only in the CM+PA-RGDS group; this was sustained for 12 weeks. Confocal microscopic examination of the cardiac tissues harvested at 14 weeks demonstrated sustained engraftment and integration of mESC-CMs into host myocardium in the CM+PA-RGDS group only. This study for the first time demonstrated that PA-RGDS encapsulation can enhance survival of mESC-derived CMs and improve cardiac function post-MI. This nanomatrix gel-mediated stem cell therapy can be a promising option for treating MI.

  9. Tissue-Mimicking Geometrical Constraints Stimulate Tissue-Like Constitution and Activity of Mouse Neonatal and Human-Induced Pluripotent Stem Cell-Derived Cardiac Myocytes

    PubMed Central

    Pilarczyk, Götz; Raulf, Alexandra; Gunkel, Manuel; Fleischmann, Bernd K.; Lemor, Robert; Hausmann, Michael

    2016-01-01

    The present work addresses the question of to what extent a geometrical support acts as a physiological determining template in the setup of artificial cardiac tissue. Surface patterns with alternating concave to convex transitions of cell size dimensions were used to organize and orientate human-induced pluripotent stem cell (hIPSC)-derived cardiac myocytes and mouse neonatal cardiac myocytes. The shape of the cells, as well as the organization of the contractile apparatus recapitulates the anisotropic line pattern geometry being derived from tissue geometry motives. The intracellular organization of the contractile apparatus and the cell coupling via gap junctions of cell assemblies growing in a random or organized pattern were examined. Cell spatial and temporal coordinated excitation and contraction has been compared on plain and patterned substrates. While the α-actinin cytoskeletal organization is comparable to terminally-developed native ventricular tissue, connexin-43 expression does not recapitulate gap junction distribution of heart muscle tissue. However, coordinated contractions could be observed. The results of tissue-like cell ensemble organization open new insights into geometry-dependent cell organization, the cultivation of artificial heart tissue from stem cells and the anisotropy-dependent activity of therapeutic compounds. PMID:26751484

  10. Metabolomic Profiling of Pompe Disease-Induced Pluripotent Stem Cell-Derived Cardiomyocytes Reveals That Oxidative Stress Is Associated With Cardiac and Skeletal Muscle Pathology.

    PubMed

    Sato, Yohei; Kobayashi, Hiroshi; Higuchi, Takashi; Shimada, Yohta; Ida, Hiroyuki; Ohashi, Toya

    2016-08-18

    : Pompe disease (PD) is a lysosomal storage disease that is caused by a deficiency of the acid α-glucosidase, which results in glycogen accumulation in the lysosome. The major clinical symptoms of PD include skeletal muscle weakness, respiratory failure, and cardiac hypertrophy. Based on its severity and symptom onset, PD is classified into infantile and late-onset forms. Lysosomal accumulation of glycogen can promote many types of cellular dysfunction, such as autophagic dysfunction, endoplasmic reticulum stress, and abnormal calcium signaling within skeletal muscle. However, the disease mechanism underlying PD cardiomyopathy is not fully understood. Several researchers have shown that PD induced pluripotent stem cell (iPSC)-derived cardiomyocytes successfully replicate the disease phenotype and are useful disease models. We have analyzed the metabolomic profile of late-onset PD iPSC-derived cardiomyocytes and found that oxidative stress and mitochondrial dysfunction are likely associated with cardiac complications. Furthermore, we have validated that these disease-specific changes were also observed in the cardiomyocytes and skeletal muscle of a genetically engineered murine PD model. Oxidative stress may contribute to skeletal muscle and cardiomyocyte dysfunction in PD mice; however, NF-E2-related factor 2 was downregulated in cardiomyocytes and skeletal muscle, despite evidence of oxidative stress. We hypothesized that oxidative stress and an impaired antioxidative stress response mechanism may underlie the molecular pathology of late-onset PD.

  11. Engineering a freestanding biomimetic cardiac patch using biodegradable poly(lactic-co-glycolic acid) (PLGA) and human embryonic stem cell-derived ventricular cardiomyocytes (hESC-VCMs).

    PubMed

    Chen, Yin; Wang, Junping; Shen, Bo; Chan, Camie W Y; Wang, Chaoyi; Zhao, Yihua; Chan, Ho N; Tian, Qian; Chen, Yangfan; Yao, Chunlei; Hsing, I-Ming; Li, Ronald A; Wu, Hongkai

    2015-03-01

    Microgrooved thin PLGA film (≈30 μm) is successfully fabricated on a Teflon mold, which could be readily peeled off and is used for the construction of a biomimetic cardiac patch. The contraction of it is studied with optical mapping on transmembrane action potential. Our results suggest that steady-state contraction could be easily established on it under regular electrical stimuli. Besides, the biomimetic cardiac patch recapitulates the anisotropic electrophysiological feature of native cardiac tissue and is much more refractory to premature stimuli than the random one constructed with non-grooved PLGA film, as proved by the reduced incidence of arrhythmia. Considering the good biocompatibility of PLGA as demonstrated in our study and the biodegradability of it, our biomimetic cardiac patch may find applications in the treatment of myocardial infarction. Moreover, the Teflon mold could be applied in the fabrication of various scaffolds with fine features for other tissues.

  12. Structural Phenotyping of Stem Cell-Derived Cardiomyocytes

    PubMed Central

    Pasqualini, Francesco Silvio; Sheehy, Sean Paul; Agarwal, Ashutosh; Aratyn-Schaus, Yvonne; Parker, Kevin Kit

    2015-01-01

    Summary Structural phenotyping based on classical image feature detection has been adopted to elucidate the molecular mechanisms behind genetically or pharmacologically induced changes in cell morphology. Here, we developed a set of 11 metrics to capture the increasing sarcomere organization that occurs intracellularly during striated muscle cell development. To test our metrics, we analyzed the localization of the contractile protein α-actinin in a variety of primary and stem-cell derived cardiomyocytes. Further, we combined these metrics with data mining algorithms to unbiasedly score the phenotypic maturity of human-induced pluripotent stem cell-derived cardiomyocytes. PMID:25733020

  13. Comprehensive proteomic characterization of stem cell-derived extracellular matrices.

    PubMed

    Ragelle, Héloïse; Naba, Alexandra; Larson, Benjamin L; Zhou, Fangheng; Prijić, Miralem; Whittaker, Charles A; Del Rosario, Amanda; Langer, Robert; Hynes, Richard O; Anderson, Daniel G

    2017-06-01

    In the stem-cell niche, the extracellular matrix (ECM) serves as a structural support that additionally provides stem cells with signals that contribute to the regulation of stem-cell function, via reciprocal interactions between cells and components of the ECM. Recently, cell-derived ECMs have emerged as in vitro cell culture substrates to better recapitulate the native stem-cell microenvironment outside the body. Significant changes in cell number, morphology and function have been observed when mesenchymal stem cells (MSC) were cultured on ECM substrates as compared to standard tissue-culture polystyrene (TCPS). As select ECM components are known to regulate specific stem-cell functions, a robust characterization of cell-derived ECM proteomic composition is critical to better comprehend the role of the ECM in directing cellular processes. Here, we characterized and compared the protein composition of ECM produced in vitro by bone marrow-derived MSC, adipose-derived MSC and neonatal fibroblasts from different donors, employing quantitative proteomic methods. Each cell-derived ECM displayed a specific and unique matrisome signature, yet they all shared a common set of proteins. We evaluated the biological response of cells cultured on the different matrices and compared them to cells on standard TCPS. The matrices lead to differential survival and gene-expression profiles among the cell types and as compared to TCPS, indicating that the cell-derived ECMs influence each cell type in a different manner. This general approach to understanding the protein composition of different tissue-specific and cell-derived ECM will inform the rational design of defined systems and biomaterials that recapitulate critical ECM signals for stem-cell culture and tissue engineering.

  14. Stem Cell-Derived Extracellular Vesicles and Immune-Modulation

    PubMed Central

    Burrello, Jacopo; Monticone, Silvia; Gai, Chiara; Gomez, Yonathan; Kholia, Sharad; Camussi, Giovanni

    2016-01-01

    Extra-cellular vesicles (EVs) are bilayer membrane structures enriched with proteins, nucleic acids, and other active molecules and have been implicated in many physiological and pathological processes over the past decade. Recently, evidence suggests EVs to play a more dichotomic role in the regulation of the immune system, whereby an immune response may be enhanced or supressed by EVs depending on their cell of origin and its functional state. EVs derived from antigen (Ag)-presenting cells for instance, have been involved in both innate and acquired (or adaptive) immune responses, as Ag carriers or presenters, or as vehicles for delivering active signaling molecules. On the other hand, tumor and stem cell derived EVs have been identified to exert an inhibitory effect on immune responses by carrying immuno-modulatory effectors, such as transcriptional factors, non-coding RNA (Species), and cytokines. In addition, stem cell-derived EVs have also been reported to impair dendritic cell maturation and to regulate the activation, differentiation, and proliferation of B cells. They have been shown to control natural killer cell activity and to suppress the innate immune response (IIR). Studies reporting the role of EVs on T lymphocyte modulation are controversial. Discrepancy in literature may be due to stem cell culture conditions, methods of EV purification, EV molecular content, and functional state of both parental and target cells. However, mesenchymal stem cell-derived EVs were shown to play a more suppressive role by shifting T cells from an activated to a T regulatory phenotype. In this review, we will discuss how stem cell-derived EVs may contribute toward the modulation of the immune response. Collectively, stem cell-derived EVs mainly exhibit an inhibitory effect on the immune system. PMID:27597941

  15. Stem Cell-Derived Extracellular Vesicles and Immune-Modulation.

    PubMed

    Burrello, Jacopo; Monticone, Silvia; Gai, Chiara; Gomez, Yonathan; Kholia, Sharad; Camussi, Giovanni

    2016-01-01

    Extra-cellular vesicles (EVs) are bilayer membrane structures enriched with proteins, nucleic acids, and other active molecules and have been implicated in many physiological and pathological processes over the past decade. Recently, evidence suggests EVs to play a more dichotomic role in the regulation of the immune system, whereby an immune response may be enhanced or supressed by EVs depending on their cell of origin and its functional state. EVs derived from antigen (Ag)-presenting cells for instance, have been involved in both innate and acquired (or adaptive) immune responses, as Ag carriers or presenters, or as vehicles for delivering active signaling molecules. On the other hand, tumor and stem cell derived EVs have been identified to exert an inhibitory effect on immune responses by carrying immuno-modulatory effectors, such as transcriptional factors, non-coding RNA (Species), and cytokines. In addition, stem cell-derived EVs have also been reported to impair dendritic cell maturation and to regulate the activation, differentiation, and proliferation of B cells. They have been shown to control natural killer cell activity and to suppress the innate immune response (IIR). Studies reporting the role of EVs on T lymphocyte modulation are controversial. Discrepancy in literature may be due to stem cell culture conditions, methods of EV purification, EV molecular content, and functional state of both parental and target cells. However, mesenchymal stem cell-derived EVs were shown to play a more suppressive role by shifting T cells from an activated to a T regulatory phenotype. In this review, we will discuss how stem cell-derived EVs may contribute toward the modulation of the immune response. Collectively, stem cell-derived EVs mainly exhibit an inhibitory effect on the immune system.

  16. Regenerating the injured kidney with human umbilical cord mesenchymal stem cell-derived exosomes.

    PubMed

    Dorronsoro, Akaitz; Robbins, Paul D

    2013-04-25

    Transplantation of adult stem cells is being used to facilitate repair or regeneration of damaged or diseased tissues. However, in many cases, the therapeutic effects of the injected stem cells are mediated by factors secreted by stem cells and not by differentiation of the transplanted stem cells. Recent reports have identified a class of microvesicles, termed exosomes, released by stem cells that are able to confer therapeutic effects on injured renal and cardiac tissue. In this issue of Stem Cell Research & Therapy, Zhou and colleagues demonstrate the ability of exosomes derived from human umbilical cord mesenchymal stem cells (hucMSCs), but not non-stem cell-derived exosomes, to improve acute kidney injury induced by cisplatin in rats. The authors demonstrate that hucMSC exosomes can reduce cisplatin-mediated renal oxidative stress and apoptosis in vivo and increase renal epithelial cell proliferation in culture. These results suggest that stem cell-derived exosomes, which are easy to isolate and safer to use than the parental stem cells, could have significant clinical utility.

  17. Label-free imaging of metabolism and oxidative stress in human induced pluripotent stem cell-derived cardiomyocytes

    PubMed Central

    Datta, Rupsa; Heylman, Christopher; George, Steven C.; Gratton, Enrico

    2016-01-01

    In this work we demonstrate a label-free optical imaging technique to assess metabolic status and oxidative stress in human induced pluripotent stem cell-derived cardiomyocytes by two-photon fluorescence lifetime imaging of endogenous fluorophores. Our results show the sensitivity of this method to detect shifts in metabolism and oxidative stress in the cardiomyocytes upon pathological stimuli of hypoxia and cardiotoxic drugs. This non-invasive imaging technique could prove beneficial for drug development and screening, especially for in vitro cardiac models created from stem cell-derived cardiomyocytes and to study the pathogenesis of cardiac diseases and therapy. PMID:27231614

  18. Label-free imaging of metabolism and oxidative stress in human induced pluripotent stem cell-derived cardiomyocytes.

    PubMed

    Datta, Rupsa; Heylman, Christopher; George, Steven C; Gratton, Enrico

    2016-05-01

    In this work we demonstrate a label-free optical imaging technique to assess metabolic status and oxidative stress in human induced pluripotent stem cell-derived cardiomyocytes by two-photon fluorescence lifetime imaging of endogenous fluorophores. Our results show the sensitivity of this method to detect shifts in metabolism and oxidative stress in the cardiomyocytes upon pathological stimuli of hypoxia and cardiotoxic drugs. This non-invasive imaging technique could prove beneficial for drug development and screening, especially for in vitro cardiac models created from stem cell-derived cardiomyocytes and to study the pathogenesis of cardiac diseases and therapy.

  19. Micropost arrays for measuring stem cell-derived cardiomyocyte contractility

    PubMed Central

    Beussman, Kevin M.; Rodriguez, Marita L.; Leonard, Andrea; Taparia, Nikita; Thompson, Curtis R.; Sniadecki, Nathan J.

    2015-01-01

    Stem cell-derived cardiomyocytes have the potential to be used to study heart disease and maturation, screen drug treatments, and restore heart function. Here, we discuss the procedures involved in using micropost arrays to measure the contractile forces generated by stem cell-derived cardiomyocytes. Cardiomyocyte contractility is needed for the heart to pump blood, so measuring the contractile forces of cardiomyocytes is a straightforward way to assess their function. Microfabrication and soft lithography techniques are utilized to create identical arrays of flexible, silicone microposts from a common master. Micropost arrays are functionalized with extracellular matrix protein to allow cardiomyocytes to adhere to the tips of the microposts. Live imaging is used to capture videos of the deflection of microposts caused by the contraction of the cardiomyocytes. Image analysis code provides an accurate means to quantify these deflections. The contractile forces produced by a beating cardiomyocyte are calculated by modeling the microposts as cantilever beams. We have used this assay to assess techniques for improving the maturation and contractile function of stem cell-derived cardiomyocytes. PMID:26344757

  20. Balancing Ethical Pros and Cons of Stem Cell Derived Gametes.

    PubMed

    Segers, Seppe; Mertes, Heidi; de Wert, Guido; Dondorp, Wybo; Pennings, Guido

    2017-01-13

    In this review we aim to provide an overview of the most important ethical pros and cons of stem cell derived gametes (SCD-gametes), as a contribution to the debate about reproductive tissue engineering. Derivation of gametes from stem cells holds promising applications both for research and for clinical use in assisted reproduction. We explore the ethical issues connected to gametes derived from embryonic stem cells (both patient specific and non-patient specific) as well as those related to gametes derived from induced pluripotent stem cells. The technology of SCD-gametes raises moral concerns of how reproductive autonomy relates to issues of embryo destruction, safety, access, and applications beyond clinical infertility.

  1. Methods for Assessing the Electromechanical Integration of Human Pluripotent Stem Cell-Derived Cardiomyocyte Grafts

    PubMed Central

    Zhu, Wei-Zhong; Filice, Dominic; Palpant, Nathan J.; Laflamme, Michael A.

    2014-01-01

    Cardiomyocytes derived from human pluripotent stem cells show tremendous promise for the replacement of myocardium and contractile function lost to infarction. However, until recently, no methods were available to directly determine whether these stem cell-derived grafts actually couple with host myocardium and fire synchronously following transplantation in either intact or injured hearts. To resolve this uncertainty, our group has developed techniques for the intravital imaging of hearts engrafted with stem cell-derived cardiomyocytes that have been modified to express the genetically encoded protein calcium sensor, GCaMP. When combined with the simultaneously recorded electrocardiogram, this protocol allows one to make quantitative assessments as to the presence and extent of host–graft electrical coupling as well as the timing and pattern of graft activation. As described here, this system has been employed to investigate the electromechanical integration of human embryonic stem cell-derived cardiomyocytes in a guinea pig model of cardiac injury, but analogous approaches should be applicable to other human graft cell types and animal models. PMID:25070341

  2. Methods for assessing the electromechanical integration of human pluripotent stem cell-derived cardiomyocyte grafts.

    PubMed

    Zhu, Wei-Zhong; Filice, Dominic; Palpant, Nathan J; Laflamme, Michael A

    2014-01-01

    Cardiomyocytes derived from human pluripotent stem cells show tremendous promise for the replacement of myocardium and contractile function lost to infarction. However, until recently, no methods were available to directly determine whether these stem cell-derived grafts actually couple with host myocardium and fire synchronously following transplantation in either intact or injured hearts. To resolve this uncertainty, our group has developed techniques for the intravital imaging of hearts engrafted with stem cell-derived cardiomyocytes that have been modified to express the genetically encoded protein calcium sensor, GCaMP. When combined with the simultaneously recorded electrocardiogram, this protocol allows one to make quantitative assessments as to the presence and extent of host-graft electrical coupling as well as the timing and pattern of graft activation. As described here, this system has been employed to investigate the electromechanical integration of human embryonic stem cell-derived cardiomyocytes in a guinea pig model of cardiac injury, but analogous approaches should be applicable to other human graft cell types and animal models.

  3. Electrophysiological Properties of Embryonic Stem Cell-Derived Neurons

    PubMed Central

    Risner-Janiczek, Jessica R.; Ungless, Mark A.; Li, Meng

    2011-01-01

    In vitro generation of functional neurons from embryonic stem (ES) cells and induced pluripotent stem cells offers exciting opportunities for dissecting gene function, disease modelling, and therapeutic drug screening. To realize the potential of stem cells in these biomedical applications, a complete understanding of the cell models of interest is required. While rapid advances have been made in developing the technologies for directed induction of defined neuronal subtypes, most published works focus on the molecular characterization of the derived neural cultures. To characterize the functional properties of these neural cultures, we utilized an ES cell model that gave rise to neurons expressing the green fluorescent protein (GFP) and conducted targeted whole-cell electrophysiological recordings from ES cell-derived neurons. Current-clamp recordings revealed that most neurons could fire single overshooting action potentials; in some cases multiple action potentials could be evoked by depolarization, or occurred spontaneously. Voltage-clamp recordings revealed that neurons exhibited neuronal-like currents, including an outward current typical of a delayed rectifier potassium conductance and a fast-activating, fast-inactivating inward current, typical of a sodium conductance. Taken together, these results indicate that ES cell-derived GFP+ neurons in culture display functional neuronal properties even at early stages of differentiation. PMID:21887381

  4. Comparison of Human Induced Pluripotent Stem-Cell Derived Cardiomyocytes with Human Mesenchymal Stem Cells following Acute Myocardial Infarction

    PubMed Central

    Hassan, Fatemat; Kuppusamy, M. Lakshmi; Kuppusamy, Periannan; Angelos, Mark G.; Khan, Mahmood

    2014-01-01

    Introduction Human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) have recently been shown to express key cardiac proteins and improve in vivo cardiac function when administered following myocardial infarction. However, the efficacy of hiPSC-derived cell therapies, in direct comparison to current, well-established stem cell-based therapies, is yet to be elucidated. The goal of the current study was to compare the therapeutic efficacy of human mesenchymal stem cells (hMSCs) with hiPSC-CMs in mitigating myocardial infarction (MI). Methods Male athymic nude hyrats were subjected to permanent ligation of the left-anterior-descending (LAD) coronary artery to induce acute MI. Four experimental groups were studied: 1) control (non-MI), 2) MI, 3) hMSCs (MI+MSC), and 4) hiPSC-CMs (MI+hiPSC-derived cardiomyocytes). The hiPSC-CMs and hMSCs were labeled with superparamagnetic iron oxide (SPIO) in vitro to track the transplanted cells in the ischemic heart by high-field cardiac MRI. These cells were injected into the ischemic heart 30-min after LAD ligation. Four-weeks after MI, cardiac MRI was performed to track the transplanted cells in the infarct heart. Additionally, echocardiography (M-mode) was performed to evaluate the cardiac function. Immunohistological and western blot studies were performed to assess the cell tracking, engraftment and cardiac fibrosis in the infarct heart tissues. Results Echocardiography data showed a significantly improved cardiac function in the hiPSC-CMs and hMSCs groups, when compared to MI. Immunohistological studies showed expression of connexin-43, α-actinin and myosin heavy chain in engrafted hiPSC-CMs. Cardiac fibrosis was significantly decreased in hiPSC-CMs group when compared to hMSCs or MI groups. Overall, this study demonstrated improved cardiac function with decreased fibrosis with both hiPSC-CMs and hMSCs groups when compared with MI group. PMID:25551230

  5. The effect of PVDF-TrFE scaffolds on stem cell derived cardiovascular cells.

    PubMed

    Hitscherich, Pamela; Wu, Siliang; Gordan, Richard; Xie, Lai-Hua; Arinzeh, Treena; Lee, Eun Jung

    2016-07-01

    Recently, electrospun polyvinylidene fluoride (PVDF) and polyvinylidene fluoride-trifluoroethylene (PVDF-TrFE) scaffolds have been developed for tissue engineering applications. These materials have piezoelectric activity, wherein they can generate electric charge with minute mechanical deformations. Since the myocardium is an electroactive tissue, the unique feature of a piezoelectric scaffold is attractive for cardiovascular tissue engineering applications. In this study, we examined the cytocompatibility and function of pluripotent stem cell derived cardiovascular cells including mouse embryonic stem cell-derived cardiomyocytes (mES-CM) and endothelial cells (mES-EC) on PVDF-TrFE scaffolds. MES-CM and mES-EC adhered well to PVDF-TrFE and became highly aligned along the fibers. When cultured on scaffolds, mES-CM spontaneously contracted, exhibited well-registered sarcomeres and expressed classic cardiac specific markers such as myosin heavy chain, cardiac troponin T, and connexin43. Moreover, mES-CM cultured on PVDF-TrFE scaffolds responded to exogenous electrical pacing and exhibited intracellular calcium handling behavior similar to that of mES-CM cultured in 2D. Similar to cardiomyocytes, mES-EC also demonstrated high viability and maintained a mature phenotype through uptake of low-density lipoprotein and expression of classic endothelial cell markers including platelet endothelial cell adhesion molecule, endothelial nitric oxide synthase, and the arterial specific marker, Notch-1. This study demonstrates the feasibility of PVDF-TrFE scaffold as a candidate material for developing engineered cardiovascular tissues utilizing stem cell-derived cells. Biotechnol. Bioeng. 2016;113: 1577-1585. © 2015 Wiley Periodicals, Inc.

  6. Enriched retinal ganglion cells derived from human embryonic stem cells

    PubMed Central

    Gill, Katherine P.; Hung, Sandy S. C.; Sharov, Alexei; Lo, Camden Y.; Needham, Karina; Lidgerwood, Grace E.; Jackson, Stacey; Crombie, Duncan E.; Nayagam, Bryony A.; Cook, Anthony L.; Hewitt, Alex W.; Pébay, Alice; Wong, Raymond C. B.

    2016-01-01

    Optic neuropathies are characterised by a loss of retinal ganglion cells (RGCs) that lead to vision impairment. Development of cell therapy requires a better understanding of the signals that direct stem cells into RGCs. Human embryonic stem cells (hESCs) represent an unlimited cellular source for generation of human RGCs in vitro. In this study, we present a 45-day protocol that utilises magnetic activated cell sorting to generate enriched population of RGCs via stepwise retinal differentiation using hESCs. We performed an extensive characterization of these stem cell-derived RGCs by examining the gene and protein expressions of a panel of neural/RGC markers. Furthermore, whole transcriptome analysis demonstrated similarity of the hESC-derived RGCs to human adult RGCs. The enriched hESC-RGCs possess long axons, functional electrophysiological profiles and axonal transport of mitochondria, suggestive of maturity. In summary, this RGC differentiation protocol can generate an enriched population of functional RGCs from hESCs, allowing future studies on disease modeling of optic neuropathies and development of cell therapies. PMID:27506453

  7. Cartilage repair using human embryonic stem cell-derived chondroprogenitors.

    PubMed

    Cheng, Aixin; Kapacee, Zoher; Peng, Jiang; Lu, Shibi; Lucas, Robert J; Hardingham, Timothy E; Kimber, Susan J

    2014-11-01

    In initial work, we developed a 14-day culture protocol under potential GMP, chemically defined conditions to generate chondroprogenitors from human embryonic stem cells (hESCs). The present study was undertaken to investigate the cartilage repair capacity of these cells. The chondrogenic protocol was optimized and validated with gene expression profiling. The protocol was also applied successfully to two lines of induced pluripotent stem cells (iPSCs). Chondrogenic cells derived from hESCs were encapsulated in fibrin gel and implanted in osteochondral defects in the patella groove of nude rats, and cartilage repair was evaluated by histomorphology and immunocytochemistry. Genes associated with chondrogenesis were upregulated during the protocol, and pluripotency-related genes were downregulated. Aggregation of chondrogenic cells was accompanied by high expression of SOX9 and strong staining with Safranin O. Culture with PluriSln1 was lethal for hESCs but was tolerated by hESC chondrogenic cells, and no OCT4-positive cells were detected in hESC chondrogenic cells. iPSCs were also shown to generate chondroprogenitors in this protocol. Repaired tissue in the defect area implanted with hESC-derived chondrogenic cells was stained for collagen II with little collagen I, but negligible collagen II was observed in the fibrin-only controls. Viable human cells were detected in the repair tissue at 12 weeks. The results show that chondrogenic cells derived from hESCs, using a chemically defined culture system, when implanted in focal defects were able to promote cartilage repair. This is a first step in evaluating these cells for clinical application for the treatment of cartilage lesions.

  8. Bioengineering Approaches to Mature Human Pluripotent Stem Cell-Derived Cardiomyocytes.

    PubMed

    Sun, Xuetao; Nunes, Sara S

    2017-01-01

    Human pluripotent stem cell-derived cardiomyocytes (hPSC-CM) represent a potential unlimited cell supply for cardiac tissue engineering and possibly regenerative medicine applications. However, hPSC-CMs produced by current protocols are not representative of native adult human cardiomyocytes as they display immature gene expression profile, structure and function. In order to improve hPSC-CM maturity and function, various approaches have been developed, including genetic manipulations to induce gene expression, delivery of biochemical factors, such as triiodothyronine and alpha-adrenergic agonist phenylephrine, induction of cell alignment in 3D tissues, mechanical stress as a mimic of cardiac load and electrical stimulation/pacing or a combination of these. In this mini review, we discuss biomimetic strategies for the maturation for hPSC-CMs with a particular focus on electromechanical conditioning methods.

  9. Bioengineering Approaches to Mature Human Pluripotent Stem Cell-Derived Cardiomyocytes

    PubMed Central

    Sun, Xuetao; Nunes, Sara S.

    2017-01-01

    Human pluripotent stem cell-derived cardiomyocytes (hPSC-CM) represent a potential unlimited cell supply for cardiac tissue engineering and possibly regenerative medicine applications. However, hPSC-CMs produced by current protocols are not representative of native adult human cardiomyocytes as they display immature gene expression profile, structure and function. In order to improve hPSC-CM maturity and function, various approaches have been developed, including genetic manipulations to induce gene expression, delivery of biochemical factors, such as triiodothyronine and alpha-adrenergic agonist phenylephrine, induction of cell alignment in 3D tissues, mechanical stress as a mimic of cardiac load and electrical stimulation/pacing or a combination of these. In this mini review, we discuss biomimetic strategies for the maturation for hPSC-CMs with a particular focus on electromechanical conditioning methods. PMID:28337437

  10. Trophoblast lineage cells derived from human induced pluripotent stem cells

    SciTech Connect

    Chen, Ying; Wang, Kai; Chandramouli, Gadisetti V.R.; Knott, Jason G.; Leach, Richard

    2013-07-12

    Highlights: •Epithelial-like phenotype of trophoblast lineage cells derived from human iPS cells. •Trophoblast lineage cells derived from human iPS cells exhibit trophoblast function. •Trophoblasts from iPS cells provides a proof-of-concept in regenerative medicine. -- Abstract: Background: During implantation, the blastocyst trophectoderm attaches to the endometrial epithelium and continues to differentiate into all trophoblast subtypes, which are the major components of a placenta. Aberrant trophoblast proliferation and differentiation are associated with placental diseases. However, due to ethical and practical issues, there is almost no available cell or tissue source to study the molecular mechanism of human trophoblast differentiation, which further becomes a barrier to the study of the pathogenesis of trophoblast-associated diseases of pregnancy. In this study, our goal was to generate a proof-of-concept model for deriving trophoblast lineage cells from induced pluripotency stem (iPS) cells from human fibroblasts. In future studies the generation of trophoblast lineage cells from iPS cells established from patient’s placenta will be extremely useful for studying the pathogenesis of individual trophoblast-associated diseases and for drug testing. Methods and results: Combining iPS cell technology with BMP4 induction, we derived trophoblast lineage cells from human iPS cells. The gene expression profile of these trophoblast lineage cells was distinct from fibroblasts and iPS cells. These cells expressed markers of human trophoblasts. Furthermore, when these cells were differentiated they exhibited invasive capacity and placental hormone secretive capacity, suggesting extravillous trophoblasts and syncytiotrophoblasts. Conclusion: Trophoblast lineage cells can be successfully derived from human iPS cells, which provide a proof-of-concept tool to recapitulate pathogenesis of patient placental trophoblasts in vitro.

  11. Islet Endothelial Cells Derived From Mouse Embryonic Stem Cells.

    PubMed

    Jain, Neha; Lee, Eun Jung

    2016-01-01

    The islet endothelium comprises a specialized population of islet endothelial cells (IECs) expressing unique markers such as nephrin and α-1 antitrypsin (AAT) that are not found in endothelial cells in surrounding tissues. However, due to difficulties in isolating and maintaining a pure population of these cells, the information on these islet-specific cells is currently very limited. Interestingly, we have identified a large subpopulation of endothelial cells exhibiting IEC phenotype, while deriving insulin-producing cells from mouse embryonic stem cells (mESCs). These cells were identified by the uptake of low-density lipoprotein (LDL) and were successfully isolated and subsequently expanded in endothelial cell culture medium. Further analysis demonstrated that the mouse embryonic stem cell-derived endothelial cells (mESC-ECs) not only express classical endothelial markers, such as platelet endothelial cell adhesion molecule (PECAM1), thrombomodulin, intercellular adhesion molecule-1 (ICAM-1), and endothelial nitric oxide synthase (eNOS) but also IEC-specific markers such as nephrin and AAT. Moreover, mESC-ECs secrete basement membrane proteins such as collagen type IV, laminin, and fibronectin in culture and form tubular networks on a layer of Matrigel, demonstrating angiogenic activity. Further, mESC-ECs not only express eNOS, but also its eNOS expression is glucose dependent, which is another characteristic phenotype of IECs. With the ability to obtain highly purified IECs derived from pluripotent stem cells, it is possible to closely examine the function of these cells and their interaction with pancreatic β-cells during development and maturation in vitro. Further characterization of tissue-specific endothelial cell properties may enhance our ability to formulate new therapeutic angiogenic approaches for diabetes.

  12. Human embryonic stem cells and cardiac repair.

    PubMed

    Zhu, Wei-Zhong; Hauch, Kip D; Xu, Chunhui; Laflamme, Michael A

    2009-01-01

    The muscle lost after a myocardial infarction is replaced with noncontractile scar tissue, often initiating heart failure. Whole-organ cardiac transplantation is the only currently available clinical means of replacing the lost muscle, but this option is limited by the inadequate supply of donor hearts. Thus, cell-based cardiac repair has attracted considerable interest as an alternative means of ameliorating cardiac injury. Because of their tremendous capacity for expansion and unquestioned cardiac potential, pluripotent human embryonic stem cells (hESCs) represent an attractive candidate cell source for obtaining cardiomyocytes and other useful mesenchymal cell types for such therapies. Human embryonic stem cell-derived cardiomyocytes exhibit a committed cardiac phenotype and robust proliferative capacity, and recent testing in rodent infarct models indicates that they can partially remuscularize injured hearts and improve contractile function. Although the latter successes give good reason for optimism, considerable challenges remain in the successful application of hESCs to cardiac repair, including the need for preparations of high cardiac purity, improved methods of delivery, and approaches to overcome immune rejection and other causes of graft cell death. This review will describe the phenotype of hESC-derived cardiomyocytes and preclinical experience with these cells and will consider strategies to overcoming the aforementioned challenges.

  13. Stem cells and exosomes in cardiac repair.

    PubMed

    Singla, Dinender K

    2016-04-01

    Cardiac diseases currently lead in the number of deaths per year, giving rise an interest in transplanting embryonic and adult stem cells as a means to improve damaged tissue from conditions such as myocardial infarction and coronary artery disease. After testing these cells as a treatment option in both animal and human models, it is believed that these cells improve the damaged tissue primarily through the release of autocrine and paracrine factors. Major concerns such as teratoma formation, immune response, difficulty harvesting cells, and limited cell proliferation and differentiation, hinder the routine use of these cells as a treatment option in the clinic. The advent of stem cell-derived exosomes circumvent those concerns, while still providing the growth factors, miRNA, and additional cell protective factors that aid in repairing and regenerating the damaged tissue. These exosomes have been found to be anti-apoptotic, anti-fibrotic, pro-angiogenic, as well as enhance cardiac differentiation, all of which are key to repairing damaged tissue. As such, stem cell derived exosomes are considered to be a potential new and novel approach in the treatment of various cardiac diseases.

  14. Induced pluripotent stem cell-derived cardiomyocytes: boutique science or valuable arrhythmia model?

    PubMed

    Knollmann, Björn C

    2013-03-15

    This article reviews the strengths and limitations of induced pluripotent stem cell-derived cardiomyocytes (iPSC-CM) as models of cardiac arrhythmias. Specifically, the article attempts to answer the following questions: Which clinical arrhythmias can be modeled by iPSC-CM? How well can iPSC-CM model adult ventricular myocytes? What are the strengths and limitations of published iPSC-CM arrhythmia models? What new mechanistic insight has been gained? What is the evidence that would support using iPSC-CM to personalize antiarrhythmic drug therapy? The review also discusses the pros and cons of using the iPSC-CM technology for modeling specific genetic arrhythmia disorders, such as long QT syndrome, Brugada Syndrome, or Catecholaminergic Polymorphic Ventricular Tachycardia.

  15. Cryopreservation of Human Pluripotent Stem Cell-derived Cardiomyocytes: Strategies, Challenges, and Future Directions

    PubMed Central

    Preininger, Marcela K.; Singh, Monalisa; Xu, Chunhui

    2017-01-01

    In recent years, human pluripotent stem cell-derived cardiomyocytes (hPSC-CMs) have emerged as a vital cell source for in vitro modeling of genetic cardiovascular disorders, drug screening, and in vivo cardiac regeneration research. Looking forward, the ability to efficiently cryopreserve hPSC-CMs without compromising their normal biochemical and physiologic functions will dramatically facilitate their various biomedical applications. Although working protocols for freezing, storing, and thawing hPSC-CMs have been established, the question remains as to whether they are optimal. In this chapter, we discuss our current understanding of cryopreservation appertaining to hPSC-CMs, and proffer key questions regarding the mechanical, contractile, and regenerative properties of cryopreserved hPSC-CMs. PMID:27837559

  16. Preclinical Studies of Induced Pluripotent Stem Cell-Derived Astrocyte Transplantation in ALS

    DTIC Science & Technology

    2012-10-01

    Pluripotent Stem Cell -Derived Astrocyte Transplantation in ALS PRINCIPAL INVESTIGATOR: Nicholas J. Maragakis, M.D...Pluripotent Stem Cell -Derived Astrocyte Transplantation in ALS 5b. GRANT NUMBER W81XWH-10-1-0520 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d...into astrocytes following transplantation. 15. SUBJECT TERMS Stem Cells , iPS cells , astrocytes, familial ALS 16. SECURITY CLASSIFICATION OF

  17. Single-cell-derived mesenchymal stem cells overexpressing Csx/Nkx2.5 and GATA4 undergo the stochastic cardiomyogenic fate and behave like transient amplifying cells

    SciTech Connect

    Yamada, Yoji; Sakurada, Kazuhiro; Takeda, Yukiji; Gojo, Satoshi; Umezawa, Akihiro . E-mail: umezawa@1985.jukuin.keio.ac.jp

    2007-02-15

    Bone marrow-derived stromal cells can give rise to cardiomyocytes as well as adipocytes, osteocytes, and chondrocytes in vitro. The existence of mesenchymal stem cells has been proposed, but it remains unclear if a single-cell-derived stem cell stochastically commits toward a cardiac lineage. By single-cell marking, we performed a follow-up study of individual cells during the differentiation of 9-15c mesenchymal stromal cells derived from bone marrow cells. Three types of cells, i.e., cardiac myoblasts, cardiac progenitors and multipotent stem cells were differentiated from a single cell, implying that cardiomyocytes are generated stochastically from a single-cell-derived stem cell. We also demonstrated that overexpression of Csx/Nkx2.5 and GATA4, precardiac mesodermal transcription factors, enhanced cardiomyogenic differentiation of 9-15c cells, and the frequency of cardiomyogenic differentiation was increased by co-culturing with fetal cardiomyocytes. Single-cell-derived mesenchymal stem cells overexpressing Csx/Nkx2.5 and GATA4 behaved like cardiac transient amplifying cells, and still retained their plasticity in vivo.

  18. Glial cell derived neurotrophic factor induces spermatogonial stem cell marker genes in chicken mesenchymal stem cells.

    PubMed

    Boozarpour, Sohrab; Matin, Maryam M; Momeni-Moghaddam, Madjid; Dehghani, Hesam; Mahdavi-Shahri, Naser; Sisakhtnezhad, Sajjad; Heirani-Tabasi, Asieh; Irfan-Maqsood, Muhammad; Bahrami, Ahmad Reza

    2016-06-01

    Mesenchymal stem cells (MSCs) are known with the potential of multi-lineage differentiation. Advances in differentiation technology have also resulted in the conversion of MSCs to other kinds of stem cells. MSCs are considered as a suitable source of cells for biotechnology purposes because they are abundant, easily accessible and well characterized cells. Nowadays small molecules are introduced as novel and efficient factors to differentiate stem cells. In this work, we examined the potential of glial cell derived neurotrophic factor (GDNF) for differentiating chicken MSCs toward spermatogonial stem cells. MSCs were isolated and characterized from chicken and cultured under treatment with all-trans retinoic acid (RA) or glial cell derived neurotrophic factor. Expression analysis of specific genes after 7days of RA treatment, as examined by RT-PCR, proved positive for some germ cell markers such as CVH, STRA8, PLZF and some genes involved in spermatogonial stem cell maintenance like BCL6b and c-KIT. On the other hand, GDNF could additionally induce expression of POU5F1, and NANOG as well as other genes which were induced after RA treatment. These data illustrated that GDNF is relatively more effective in diverting chicken MSCs towards Spermatogonial stem cell -like cells in chickens and suggests GDNF as a new agent to obtain transgenic poultry, nevertheless, exploitability of these cells should be verified by more experiments.

  19. Human embryonic stem cell derivation and directed differentiation.

    PubMed

    Trounson, A

    2005-01-01

    Human embryonic stem cells (hESCs) are produced from normal, chromosomally aneuploid and mutant human embryos, which are available from in vitro fertilisation (IVF) for infertility or preimplantation diagnosis. These hESC lines are an important resource for functional genomics, drug screening and eventually cell and gene therapy. The methods for deriving hESCs are well established and repeatable, and are relatively successful, with a ratio of 1:10 to 1:2 hESC lines established to embryos used. hESCs can be formed from morula and blastocyst-stage embryos and from isolated inner cell mass cell (ICM) clusters. The hESCs can be formed and maintained on mouse or human somatic cells in serum-free conditions, and for several passages in cell-free cultures. The hESCs can be transfected with DNA constructs. Their gene expression profiles are being described and immunological characteristics determined. They may be grown indefinitely in culture while maintaining their original karyotype but this must be confirmed from time to time. hESCs spontaneously differentiate in the absence of the appropriate cell feeder layer, when overgrown in culture and when isolated from the ESC colony. All three major embryonic lineages are produced in differentiating attachment cultures and in unattached embryoid bodies. Cell progenitors of interest can be identified by markers, expression of reporter genes and characteristic morphology, and the culture thereafter enriched for further culture to more mature cell types. The most advanced directed differentiation pathways have been developed for neural cells and cardiac muscle cells, but many other cell types including haematopoietic progenitors, endothelial cells, lung alveoli, keratinocytes, pigmented retinal epithelium, neural crest cells and motor neurones, hepatic progenitors and cells that have some markers of gut tissue and pancreatic cells have been produced. The prospects for regenerative medicine are significant and there is much

  20. Excitation–contraction coupling of human induced pluripotent stem cell-derived cardiomyocytes

    PubMed Central

    Kane, Christopher; Couch, Liam; Terracciano, Cesare M. N.

    2015-01-01

    Induced pluripotent stem cell-derived cardiomyocytes (iPSC-CMs) hold enormous potential in many fields of cardiovascular research. Overcoming many of the limitations of their embryonic counterparts, the application of iPSC-CMs ranges from facilitating investigation of familial cardiac disease and pharmacological toxicity screening to personalized medicine and autologous cardiac cell therapies. The main factor preventing the full realization of this potential is the limited maturity of iPSC-CMs, which display a number of substantial differences in comparison to adult cardiomyocytes. Excitation–contraction (EC) coupling, a fundamental property of cardiomyocytes, is often described in iPSC-CMs as being more analogous to neonatal than adult cardiomyocytes. With Ca2+ handling linked, directly or indirectly, to almost all other properties of cardiomyocytes, a solid understanding of this process will be crucial to fully realizing the potential of this technology. Here, we discuss the implications of differences in EC coupling when considering the potential applications of human iPSC-CMs in a number of areas as well as detailing the current understanding of this fundamental process in these cells. PMID:26484342

  1. Integrated Analysis of Contractile Kinetics, Force Generation, and Electrical Activity in Single Human Stem Cell-Derived Cardiomyocytes.

    PubMed

    Kijlstra, Jan David; Hu, Dongjian; Mittal, Nikhil; Kausel, Eduardo; van der Meer, Peter; Garakani, Arman; Domian, Ibrahim J

    2015-12-08

    The quantitative analysis of cardiomyocyte function is essential for stem cell-based approaches for the in vitro study of human cardiac physiology and pathophysiology. We present a method to comprehensively assess the function of single human pluripotent stem cell-derived cardiomyocyte (hPSC-CMs) through simultaneous quantitative analysis of contraction kinetics, force generation, and electrical activity. We demonstrate that statistical analysis of movies of contracting hPSC-CMs can be used to quantify changes in cellular morphology over time and compute contractile kinetics. Using a biomechanical model that incorporates substrate stiffness, we calculate cardiomyocyte force generation at single-cell resolution and validate this approach with conventional traction force microscopy. The addition of fluorescent calcium indicators or membrane potential dyes allows the simultaneous analysis of contractility and calcium handling or action potential morphology. Accordingly, our approach has the potential for broad application in the study of cardiac disease, drug discovery, and cardiotoxicity screening.

  2. Integrated Analysis of Contractile Kinetics, Force Generation, and Electrical Activity in Single Human Stem Cell-Derived Cardiomyocytes

    PubMed Central

    Kijlstra, Jan David; Hu, Dongjian; Mittal, Nikhil; Kausel, Eduardo; van der Meer, Peter; Garakani, Arman; Domian, Ibrahim J.

    2015-01-01

    Summary The quantitative analysis of cardiomyocyte function is essential for stem cell-based approaches for the in vitro study of human cardiac physiology and pathophysiology. We present a method to comprehensively assess the function of single human pluripotent stem cell-derived cardiomyocyte (hPSC-CMs) through simultaneous quantitative analysis of contraction kinetics, force generation, and electrical activity. We demonstrate that statistical analysis of movies of contracting hPSC-CMs can be used to quantify changes in cellular morphology over time and compute contractile kinetics. Using a biomechanical model that incorporates substrate stiffness, we calculate cardiomyocyte force generation at single-cell resolution and validate this approach with conventional traction force microscopy. The addition of fluorescent calcium indicators or membrane potential dyes allows the simultaneous analysis of contractility and calcium handling or action potential morphology. Accordingly, our approach has the potential for broad application in the study of cardiac disease, drug discovery, and cardiotoxicity screening. PMID:26626178

  3. Stem cell-derived exosomes as a therapeutic tool for cardiovascular disease

    PubMed Central

    Suzuki, Etsu; Fujita, Daishi; Takahashi, Masao; Oba, Shigeyoshi; Nishimatsu, Hiroaki

    2016-01-01

    Mesenchymal stem cells (MSCs) have been used to treat patients suffering from acute myocardial infarction (AMI) and subsequent heart failure. Although it was originally assumed that MSCs differentiated into heart cells such as cardiomyocytes, recent evidence suggests that the differentiation capacity of MSCs is minimal and that injected MSCs restore cardiac function via the secretion of paracrine factors. MSCs secrete paracrine factors in not only naked forms but also membrane vesicles including exosomes containing bioactive substances such as proteins, messenger RNAs, and microRNAs. Although the details remain unclear, these bioactive molecules are selectively sorted in exosomes that are then released from donor cells in a regulated manner. Furthermore, exosomes are specifically internalized by recipient cells via ligand-receptor interactions. Thus, exosomes are promising natural vehicles that stably and specifically transport bioactive molecules to recipient cells. Indeed, stem cell-derived exosomes have been successfully used to treat cardiovascular disease (CVD), such as AMI, stroke, and pulmonary hypertension, in animal models, and their efficacy has been demonstrated. Therefore, exosome administration may be a promising strategy for the treatment of CVD. Furthermore, modifications of exosomal contents may enhance their therapeutic effects. Future clinical studies are required to confirm the efficacy of exosome treatment for CVD. PMID:27679686

  4. Transgene Reactivation in Induced Pluripotent Stem Cell Derivatives and Reversion to Pluripotency of Induced Pluripotent Stem Cell-Derived Mesenchymal Stem Cells

    PubMed Central

    Galat, Yekaterina; Perepitchka, Mariana; Jennings, Lawrence J.; Iannaccone, Philip M.; Hendrix, Mary J.C.

    2016-01-01

    Induced pluripotent stem cells (iPSCs) have enormous potential in regenerative medicine and disease modeling. It is now felt that clinical trials should be performed with iPSCs derived with nonintegrative constructs. Numerous studies, however, including those describing disease models, are still being published using cells derived from iPSCs generated with integrative constructs. Our experimental work presents the first evidence of spontaneous transgene reactivation in vitro in several cellular types. Our results show that the transgenes were predominantly silent in parent iPSCs, but in mesenchymal and endothelial iPSC derivatives, the transgenes experienced random upregulation of Nanog and c-Myc. Additionally, we provide evidence of spontaneous secondary reprogramming and reversion to pluripotency in mesenchymal stem cells derived from iPSCs. These findings strongly suggest that the studies, which use cellular products derived from iPSCs generated with retro- or lentiviruses, should be evaluated with consideration of the possibility of transgene reactivation. The in vitro model described here provides insight into the earliest events of culture transformation and suggests the hypothesis that reversion to pluripotency may be responsible for the development of tumors in cell replacement experiments. The main goal of this work, however, is to communicate the possibility of transgene reactivation in retro- or lenti-iPSC derivatives and the associated loss of cellular fidelity in vitro, which may impact the outcomes of disease modeling and related experimentation. PMID:27193052

  5. Comparative gene expression profiling in human-induced pluripotent stem cell--derived cardiocytes and human and cynomolgus heart tissue.

    PubMed

    Puppala, Dinesh; Collis, Leon P; Sun, Sunny Z; Bonato, Vinicius; Chen, Xian; Anson, Blake; Pletcher, Mathew; Fermini, Bernard; Engle, Sandra J

    2013-01-01

    Cardiotoxicity is one of the leading causes of drug attrition. Current in vitro models insufficiently predict cardiotoxicity, and there is a need for alternative physiologically relevant models. Here we describe the gene expression profile of human-induced pluripotent stem cell-derived cardiocytes (iCC) postthaw over a period of 42 days in culture and compare this profile to human fetal and adult as well as adult cynomolgus nonhuman primate (NHP, Macaca fascicularis) heart tissue. Our results indicate that iCC express relevant cardiac markers such as ion channels (SCN5A, KCNJ2, CACNA1C, KCNQ1, and KCNH2), tissue-specific structural markers (MYH6, MYLPF, MYBPC3, DES, TNNT2, and TNNI3), and transcription factors (NKX2.5, GATA4, and GATA6) and lack the expression of stem cell markers (FOXD3, GBX2, NANOG, POU5F1, SOX2, and ZFP42). Furthermore, we performed a functional evaluation of contractility of the iCC and showed functional and pharmacological correlations with myocytes isolated from adult NHP hearts. These results suggest that stem cell-derived cardiocytes may represent a novel in vitro model to study human cardiac toxicity with potential ex vivo and in vivo translation.

  6. Ethical aspects of the use of stem cell derived gametes for reproduction.

    PubMed

    Mertes, Heidi; Pennings, Guido

    2010-09-01

    A lot of interest has been generated by the possibility of deriving gametes from embryonic stem cells and bone marrow stem cells. These stem cell derived gametes may become useful for research and for the treatment of infertility. In this article we consider prospectively the ethical issues that will arise if stem cell derived gametes are used in the clinic, making a distinction between concerns that only apply to embryonic stem cell derived gametes and concerns that are also relevant for gametes derived from adult stem cells. At present, it appears preferable to use non-embryonic stem cells for the derivation of gametes. Adult stem cell derived gametes do not present any problems with regard to the moral status of the human embryo, bypass the safety risks linked to SCNT and do not present any ambiguity or novel problems with regard to informed consent, psychological consequences for the child or genetic parenthood. A remaining ethical concern, however, regards the safety of the procedure in terms of the welfare of the resulting children. This should spark a thorough reflection on how far one must go to accommodate a person's wish to have a genetically related child.

  7. Use of human stem cell derived cardiomyocytes to examine sunitinib mediated cardiotoxicity and electrophysiological alterations

    SciTech Connect

    Cohen, J.D.; Babiarz, J.E.; Abrams, R.M.; Guo, L.; Kameoka, S.; Chiao, E.; Taunton, J.; Kolaja, K.L.

    2011-11-15

    Sunitinib, an oral tyrosine kinase inhibitor approved to treat advanced renal cell carcinoma and gastrointestinal stroma tumor, is associated with clinical cardiac toxicity. Although the precise mechanism of sunitinib cardiotoxicity is not known, both the key metabolic energy regulator, AMP-activated protein kinase (AMPK), and ribosomal S 6 kinase (RSK) have been hypothesized as causative, albeit based on rodent models. To study the mechanism of sunitinib-mediated cardiotoxicity in a human model, induced pluripotent stem cell-derived cardiomyocytes (iPSC-CMs) having electrophysiological and contractile properties of native cardiac tissue were investigated. Sunitinib was cardiotoxic in a dose-dependent manner with an IC{sub 50} in the low micromolar range, observed by a loss of cellular ATP, an increase in oxidized glutathione, and induction of apoptosis in iPSC-CMs. Pretreatment of iPSC-CMs with AMPK activators AICAR or metformin, increased the phosphorylation of pAMPK-T172 and pACC-S79, but only marginally attenuated sunitinib mediated cell death. Furthermore, additional inhibitors of AMPK were not directly cytotoxic to iPSC-CMs up to 250 {mu}M concentrations. Inhibition of RSK with a highly specific, irreversible, small molecule inhibitor (RSK-FMK-MEA) did not induce cytotoxicity in iPSC-CMs below 250 {mu}M. Extensive electrophysiological analysis of sunitinib and RSK-FMK-MEA mediated conduction effects were performed. Taken together, these findings suggest that inhibition of AMPK and RSK are not a major component of sunitinib-induced cardiotoxicity. Although the exact mechanism of cardiotoxicity of sunitinib is not known, it is likely due to inhibition of multiple kinases simultaneously. These data highlight the utility of human iPSC-CMs in investigating the potential molecular mechanisms underlying drug-induced cardiotoxicity. -- Highlights: Black-Right-Pointing-Pointer Cytoxic effect of sunitinib on human stem cell derived cardiomyocytes Black

  8. Lost in translation: pluripotent stem cell-derived hematopoiesis

    PubMed Central

    Ackermann, Mania; Liebhaber, Steffi; Klusmann, Jan-Henning; Lachmann, Nico

    2015-01-01

    Pluripotent stem cells (PSCs) such as embryonic stem cells or induced pluripotent stem cells represent a promising cell type to gain novel insights into human biology. Understanding the differentiation process of PSCs in vitro may allow for the identification of cell extrinsic/intrinsic factors, driving the specification process toward all cell types of the three germ layers, which may be similar to the human in vivo scenario. This would not only lay the ground for an improved understanding of human embryonic development but would also contribute toward the generation of novel cell types used in cell replacement therapies. In this line, especially the developmental process of mesodermal cells toward the hematopoietic lineage is of great interest. Therefore, this review highlights recent progress in the field of hematopoietic specification of pluripotent stem cell sources. In addition, we would like to shed light on emerging factors controlling primitive and definitive hematopoietic development and to highlight recent approaches to improve the differentiation potential of PSC sources toward hematopoietic stem/progenitor cells. While the generation of fully defined hematopoietic stem cells from PSCs remains challenging in vitro, we here underline the instructive role of cell extrinsic factors such as cytokines for the generation of PSC-derived mature hematopoietic cells. Thus, we have comprehensively examined the role of cytokines for the derivation of mature hematopoietic cell types such as macrophages, granulocytes, megakaryocytes, erythrocytes, dendritic cells, and cells of the B- and T-cell lineage. PMID:26174486

  9. Multielectrode Array (MEA) Assay for Profiling Electrophysiological Drug Effects in Human Stem Cell-Derived Cardiomyocytes.

    PubMed

    Clements, Mike

    2016-05-04

    More relevant and reliable preclinical cardiotoxicity tests are required to improve drug safety and reduce the cost of drug development. Human stem cell-derived cardiomyocytes (hSC-CMs) provide a potential model for the development of superior assays for preclinical drug safety screening. One such hSC-CM assay that has shown significant potential for enabling more predictive drug cardiac risk assessment is the MEA assay. The Multi-electrode Array (MEA) assay is an electrophysiology-based technique that uses microelectrodes embedded in the culture surface of each well to measure fluctuations in extracellular field potential (FP) generated from spontaneously beating hSC-CMs. Perturbations to the recorded FP waveform can be used as an unbiased method of predicting the identity of ion channel(s) impacted on drug exposure. Here, a higher throughput MEA assay using hSC-CMs in 48-well MEA plates is described for profiling compound-induced effects on cardiomyocyte electrophysiology. Techniques for preparing hSC-CM monolayers in MEA plates and methods to contextualize MEA assay experimental results are also covered. © 2016 by John Wiley & Sons, Inc.

  10. Chronotropic Biosensing Via Stem-Cell Derived Myocyte Aggregates

    DTIC Science & Technology

    2007-11-02

    Rockville, MD) as previously described [4– 6]. Briefly, embryonic stem cells were cultivated on a feeder- layer of primary mouse embryonic fibroblasts...in DMEM cul- ture medium supplemented with non-essential amino acids, L-glutamine, -mercaptoethanol, 20% fetal calf serum, and 100 IU leukemia...bacteriological petri dishes filled with phosphate-buffered saline (PBS) and cultivated for two days (at C and 5% CO ). The resulting aggregates were

  11. Impairment of mesenchymal stem cells derived from oral leukoplakia.

    PubMed

    Zhang, Zhihui; Song, Jiangyuan; Han, Ying; Mu, Dongdong; Su, Sha; Ji, Xiaoli; Liu, Hongwei

    2015-01-01

    Oral leukoplakia is one of the common precancerous lesions in oral mucosa. To compare the biological characteristics and regenerative capacities of mesenchymal stem cells (MSCs) from oral leukoplakia (epithelial hyperplasia and dysplasia) and normal oral mucosa, MSCs were isolated by enzyme digestion. Then these cells were identified by the expression of MSC related markers, STRO-1, CD105 and CD90, with the absent for the hematopoietic stem cell marker CD34 by flow cytometric detection. The self-renewal ability of MSCs from oral leukoplakia was enhanced, while the multipotent differentiation was descended, compared with MSCs from normal oral mucosa. Fibrin gel was used as a carrier for MSCs transplanted into immunocompromised mice to detect their regenerative capacity. The regenerative capacities of MSCs from oral leukoplakia became impaired partly. Collagen IV (Col IV) and matrix metalloproteinases-9 (MMP-9) were selected to analyze the potential mechanism for the functional changes of MSCs from oral leukoplakia by immunochemical and western blot analysis. The expression of Col IV was decreased and that of MMP-9 was increased by MSCs with the progression of oral leukoplakia, especially in MSCs from epithelial dysplasia. The imbalance between regenerative and metabolic self-regulatory functions of MSCs from oral leukoplakia may be related to the progression of this premalignant disorder.

  12. Endothelial cells derived from human embryonic stem cells

    NASA Astrophysics Data System (ADS)

    Levenberg, Shulamit; Golub, Justin S.; Amit, Michal; Itskovitz-Eldor, Joseph; Langer, Robert

    2002-04-01

    Human embryonic stem cells have the potential to differentiate into various cell types and, thus, may be useful as a source of cells for transplantation or tissue engineering. We describe here the differentiation steps of human embryonic stem cells into endothelial cells forming vascular-like structures. The human embryonic-derived endothelial cells were isolated by using platelet endothelial cell-adhesion molecule-1 (PECAM1) antibodies, their behavior was characterized in vitro and in vivo, and their potential in tissue engineering was examined. We show that the isolated embryonic PECAM1+ cells, grown in culture, display characteristics similar to vessel endothelium. The cells express endothelial cell markers in a pattern similar to human umbilical vein endothelial cells, their junctions are correctly organized, and they have high metabolism of acetylated low-density lipoprotein. In addition, the cells are able to differentiate and form tube-like structures when cultured on matrigel. In vivo, when transplanted into SCID mice, the cells appeared to form microvessels containing mouse blood cells. With further studies, these cells could provide a source of human endothelial cells that could be beneficial for potential applications such as engineering new blood vessels, endothelial cell transplantation into the heart for myocardial regeneration, and induction of angiogenesis for treatment of regional ischemia.

  13. Mesenchymal Stem Cells Derived from Dental Pulp: A Review

    PubMed Central

    Santiago-Osorio, Edelmiro

    2016-01-01

    The mesenchymal stem cells of dental pulp (DPSCs) were isolated and characterized for the first time more than a decade ago as highly clonogenic cells that were able to generate densely calcified colonies. Now, DPSCs are considered to have potential as stem cell source for orthopedic and oral maxillofacial reconstruction, and it has been suggested that they may have applications beyond the scope of the stomatognathic system. To date, most studies have shown that, regardless of their origin in third molars, incisors, or exfoliated deciduous teeth, DPSCs can generate mineralized tissue, an extracellular matrix and structures type dentin, periodontal ligament, and dental pulp, as well as other structures. Different groups worldwide have designed and evaluated new efficient protocols for the isolation, expansion, and maintenance of clinically safe human DPSCs in sufficient numbers for various therapeutics protocols and have discussed the most appropriate route of administration, the possible contraindications to their clinical use, and the parameters to be considered for monitoring their clinical efficacy and proper biological source. At present, DPSC-based therapy is promising but because most of the available evidence was obtained using nonhuman xenotransplants, it is not a mature technology. PMID:26779263

  14. Prospect of Human Pluripotent Stem Cell-Derived Neural Crest Stem Cells in Clinical Application

    PubMed Central

    Zhu, Qian; Lu, Qiqi; Gao, Rong

    2016-01-01

    Neural crest stem cells (NCSCs) represent a transient and multipotent cell population that contributes to numerous anatomical structures such as peripheral nervous system, teeth, and cornea. NCSC maldevelopment is related to various human diseases including pigmentation abnormalities, disorders affecting autonomic nervous system, and malformations of teeth, eyes, and hearts. As human pluripotent stem cells including human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs) can serve as an unlimited cell source to generate NCSCs, hESC/hiPSC-derived NCSCs can be a valuable tool to study the underlying mechanisms of NCSC-associated diseases, which paves the way for future therapies for these abnormalities. In addition, hESC/hiPSC-derived NCSCs with the capability of differentiating to various cell types are highly promising for clinical organ repair and regeneration. In this review, we first discuss NCSC generation methods from human pluripotent stem cells and differentiation mechanism of NCSCs. Then we focus on the clinical application potential of hESC/hiPSC-derived NCSCs on peripheral nerve injuries, corneal blindness, tooth regeneration, pathological melanogenesis, Hirschsprung disease, and cardiac repair and regeneration. PMID:28090209

  15. Human embryonic stem cells derived by somatic cell nuclear transfer.

    PubMed

    Tachibana, Masahito; Amato, Paula; Sparman, Michelle; Gutierrez, Nuria Marti; Tippner-Hedges, Rebecca; Ma, Hong; Kang, Eunju; Fulati, Alimujiang; Lee, Hyo-Sang; Sritanaudomchai, Hathaitip; Masterson, Keith; Larson, Janine; Eaton, Deborah; Sadler-Fredd, Karen; Battaglia, David; Lee, David; Wu, Diana; Jensen, Jeffrey; Patton, Phillip; Gokhale, Sumita; Stouffer, Richard L; Wolf, Don; Mitalipov, Shoukhrat

    2013-06-06

    Reprogramming somatic cells into pluripotent embryonic stem cells (ESCs) by somatic cell nuclear transfer (SCNT) has been envisioned as an approach for generating patient-matched nuclear transfer (NT)-ESCs for studies of disease mechanisms and for developing specific therapies. Past attempts to produce human NT-ESCs have failed secondary to early embryonic arrest of SCNT embryos. Here, we identified premature exit from meiosis in human oocytes and suboptimal activation as key factors that are responsible for these outcomes. Optimized SCNT approaches designed to circumvent these limitations allowed derivation of human NT-ESCs. When applied to premium quality human oocytes, NT-ESC lines were derived from as few as two oocytes. NT-ESCs displayed normal diploid karyotypes and inherited their nuclear genome exclusively from parental somatic cells. Gene expression and differentiation profiles in human NT-ESCs were similar to embryo-derived ESCs, suggesting efficient reprogramming of somatic cells to a pluripotent state.

  16. Therapeutic Potential of Lung Epithelial Progenitor Cells Derived from Embryonic and Induced Pluripotent Stem Cells

    PubMed Central

    Wetsel, Rick A.; Wang, Dachun; Calame, Daniel G.

    2015-01-01

    Embryonic stem (ES) cells derived from preimplantation blastocysts and induced pluripotent stem (iPS) cells generated from somatic cell sources are pluripotent and capable of indefinite expansion in vitro. They provide a possible unlimited source of cells that could be differentiated into lung progenitor cells for potential clinical use in pulmonary regenerative medicine. Because of inherent difficulties in deriving endodermal cells from undifferentiated cell cultures, applications using lung epithelial cells derived from ES and iPS cells have lagged behind similar efforts devoted to other tissues, such as the heart and spinal cord. However, during the past several years, significant advances in culture, differentiation, and purification protocols, as well as in bioengineering methodologies, have fueled enthusiasm for the development of stem cell–based lung therapeutics. This article provides an overview of recent research achievements and discusses future technical challenges that must be met before the promise of stem cell applications for lung disease can be realized. PMID:21226612

  17. Radiation response of mesenchymal stem cells derived from bone marrow and human pluripotent stem cells.

    PubMed

    Islam, Mohammad S; Stemig, Melissa E; Takahashi, Yutaka; Hui, Susanta K

    2015-03-01

    Mesenchymal stem cells (MSCs) isolated from human pluripotent stem cells are comparable with bone marrow-derived MSCs in their function and immunophenotype. The purpose of this exploratory study was comparative evaluation of the radiation responses of mesenchymal stem cells derived from bone marrow- (BMMSCs) and from human embryonic stem cells (hESMSCs). BMMSCs and hESMSCs were irradiated at 0 Gy (control) to 16 Gy using a linear accelerator commonly used for cancer treatment. Cells were harvested immediately after irradiation, and at 1 and 5 days after irradiation. Cell cycle analysis, colony forming ability (CFU-F), differentiation ability, and expression of osteogenic-specific runt-related transcription factor 2 (RUNX2), adipogenic peroxisome proliferator-activated receptor gamma (PPARγ), oxidative stress-specific dismutase-1 (SOD1) and Glutathione peroxidase (GPX1) were analyzed. Irradiation arrested cell cycle progression in BMMSCs and hESMSCs. Colony formation ability of irradiated MSCs decreased in a dose-dependent manner. Irradiated hESMSCs showed higher adipogenic differentiation compared with BMMSCs, together with an increase in the adipogenic PPARγ expression. PPARγ expression was upregulated as early as 4 h after irradiation, along with the expression of SOD1. More than 70% downregulation was found in Wnt3A, Wnt4, Wnt 7A, Wnt10A and Wnt11 in BMMSCs, but not in hESMSCs. hESMSCs are highly proliferative but radiosensitive compared with BMMSCs. Increased PPARγ expression relative to RUNX2 and downregulation of Wnt ligands in irradiated MSCs suggest Wnt mediated the fate determination of irradiated MSCs.

  18. Two dimensional electrophysiological characterization of human pluripotent stem cell-derived cardiomyocyte system

    PubMed Central

    Zhu, Huanqi; Scharnhorst, Kelsey S.; Stieg, Adam Z.; Gimzewski, James K.; Minami, Itsunari; Nakatsuji, Norio; Nakano, Haruko; Nakano, Atsushi

    2017-01-01

    Stem cell-derived cardiomyocytes provide a promising tool for human developmental biology, regenerative therapies, disease modeling, and drug discovery. As human pluripotent stem cell-derived cardiomyocytes remain functionally fetal-type, close monitoring of electrophysiological maturation is critical for their further application to biology and translation. However, to date, electrophysiological analyses of stem cell-derived cardiomyocytes has largely been limited by biologically undefined factors including 3D nature of embryoid body, sera from animals, and the feeder cells isolated from mouse. Large variability in the aforementioned systems leads to uncontrollable and irreproducible results, making conclusive studies difficult. In this report, a chemically-defined differentiation regimen and a monolayer cell culture technique was combined with multielectrode arrays for accurate, real-time, and flexible measurement of electrophysiological parameters in translation-ready human cardiomyocytes. Consistent with their natural counterpart, amplitude and dV/dtmax of field potential progressively increased during the course of maturation. Monolayer culture allowed for the identification of pacemaking cells using the multielectrode array platform and thereby the estimation of conduction velocity, which gradually increased during the differentiation of cardiomyocytes. Thus, the electrophysiological maturation of the human pluripotent stem cell-derived cardiomyocytes in our system recapitulates in vivo development. This system provides a versatile biological tool to analyze human heart development, disease mechanisms, and the efficacy/toxicity of chemicals. PMID:28266620

  19. Maturation of Stem Cell-Derived Beta-cells Guided by the Expression of Urocortin 3

    PubMed Central

    van der Meulen, Talitha; Huising, Mark O.

    2014-01-01

    Type 1 diabetes (T1D) is a devastating disease precipitated by an autoimmune response directed at the insulin-producing beta-cells of the pancreas for which no cure exists. Stem cell-derived beta-cells show great promise for a cure as they have the potential to supply unlimited numbers of cells that could be derived from a patient's own cells, thus eliminating the need for immunosuppression. Current in vitro protocols for the differentiation of stem cell-derived beta-cells can successfully generate pancreatic endoderm cells. In diabetic rodents, such cells can differentiate further along the beta-cell lineage until they are eventually capable of restoring normoglycemia. While these observations demonstrate that stem cell-derived pancreatic endoderm has the potential to differentiate into mature, glucose-responsive beta-cells, the signals that direct differentiation and maturation from pancreatic endoderm onwards remain poorly understood. In this review, we analyze the sequence of events that culminates in the formation of beta-cells during embryonic development. and summarize how current protocols to generate beta-cells have sought to capitalize on this ontogenic template. We place particular emphasis on the current challenges and opportunities which occur in the later stages of beta-cell differentiation and maturation of transplantable stem cell-derived beta-cells. Another focus is on the question how the use of recently identified maturation markers such as urocortin 3 can be instrumental in guiding these efforts. PMID:25148370

  20. Functional identification of neural stem cell-derived oligodendrocytes.

    PubMed

    Grade, Sofia; Agasse, Fabienne; Bernardino, Liliana; Malva, João O

    2012-01-01

    Directing neural stem cells (NSCs) differentiation towards oligodendroglial cell lineage is a crucial step in the endeavor of developing cell replacement-based therapies for demyelinating diseases. Evaluation of NSCs differentiation is mostly performed by methodologies that use fixed cells, like immunocytochemistry, or lysates, like Western blot. On the other hand, electrophysiology allows differentiation studies on living cells, but it is highly time-consuming and endowed with important limitations concerning population studies. Herein, we describe a functional method, based on single cell calcium imaging, which accurately and rapidly distinguishes cell types among NSCs progeny, in living cultures prepared from the major reservoir of NSCs in the postnatal mouse brain, the subventricular zone (SVZ). Indeed, by applying a rational sequence of three stimuli-KCl, histamine, and thrombin-to the heterogeneous SVZ cell population, one can identify each cell phenotype according to its unique calcium signature. Mature oligodendrocytes, the myelin-forming cells of the central nervous system, are the thrombin-responsive cells in SVZ cell culture and display no intracellular calcium increase upon KCl or histamine perfusion. On the other hand, KCl and histamine stimulate neurons and immature cells, respectively. The method described in this chapter is a valuable tool to identify novel pro-oligodendrogenic compounds, which may play an important role in the design of future treatments for demyelinating disorders such as multiple sclerosis.

  1. Human embryonic stem cells: Derivation, culture, and differentiation: A review

    PubMed Central

    Vazin, Tandis; Freed, William J.

    2010-01-01

    The greatest therapeutic promise of human embryonic stem cells (hESC) is to generate specialized cells to replace damaged tissue in patients suffering from various degenerative diseases. However, the signaling mechanisms involved in lineage restriction of ESC to adopt various cellular phenotypes are still under investigation. Furthermore, for progression of hESC-based therapies towards clinical applications, appropriate culture conditions must be developed to generate genetically stable homogenous populations of cells, to hinder possible adverse effects following transplantation. Other critical challenges that must be addressed for successful cell implantation include problems related to survival and functional efficacy of the grafted cells. This review initially describes the derivation of hESC and focuses on recent advances in generation, characterization, and maintenance of these cells. We also give an overview of original and emerging differentiation strategies used to convert hESC to different cell types. Finally, we will discuss transplantation studies of hESC-derived cells with respect to safety and functional recovery. PMID:20714081

  2. Identification of Stem Leydig Cells Derived from Pig Testicular Interstitium

    PubMed Central

    Yu, Shuai; Zhang, Pengfei; Dong, Wuzi; Zeng, Wenxian

    2017-01-01

    Stem Leydig cells (SLCs), located in the testicular interstitial compartment in the mammalian testes, are capable of differentiating to testosterone-synthesizing Leydig cells (LCs), thus providing a new strategy for treating testosterone deficiency. However, no previous reports have identified and cultured SLCs derived from the pig. The aim of the current study was to isolate, identify, and culture SLCs from pigs. Haematoxylin and eosin staining and immunochemical analysis showed that SLCs were present and that PDGFRα was mainly expressed in the pig testicular interstitium, indicating that PDGFRα was a marker for SLCs in the neonatal pig. In addition, reverse transcription-PCR results showed that SLC markers were expressed in primary isolated LCs, indicating that they were putative SLCs. The putative SLCs were subsequently cultured with a testicular fluid of piglets (pTF) medium. Clones formed after 7 days and the cells expressed PDGFRα. However, no clones grew in the absence of pTF, but the cells expressed CYP17A1, indicating that pTF could sustain the features of porcine SLCs. To summarize, we isolated porcine SLCs and identified their basic characteristics. Taken together, these results may help lay the foundation for research in the clinical application of porcine SLCs. PMID:28243257

  3. Effect of stromal-cell-derived factor 1 on stem-cell homing and tissue regeneration in ischaemic cardiomyopathy

    NASA Technical Reports Server (NTRS)

    Askari, Arman T.; Unzek, Samuel; Popovic, Zoran B.; Goldman, Corey K.; Forudi, Farhad; Kiedrowski, Matthew; Rovner, Aleksandr; Ellis, Stephen G.; Thomas, James D.; DiCorleto, Paul E.; Topol, Eric J.; Penn, Marc S.

    2003-01-01

    BACKGROUND: Myocardial regeneration via stem-cell mobilisation at the time of myocardial infarction is known to occur, although the mechanism for stem-cell homing to infarcted tissue subsequently and whether this approach can be used for treatment of ischaemic cardiomyopathy are unknown. We investigated these issues in a Lewis rat model (ligation of the left anterior descending artery) of ischaemic cardiomyopathy. METHODS: We studied the effects of stem-cell mobilisation by use of granulocyte colony-stimulating factor (filgrastim) with or without transplantation of syngeneic cells. Shortening fraction and myocardial strain by tissue doppler imaging were quantified by echocardiography. FINDINGS: Stem-cell mobilisation with filgrastim alone did not lead to engraftment of bone-marrow-derived cells. Stromal-cell-derived factor 1 (SDF-1), required for stem-cell homing to bone marrow, was upregulated immediately after myocardial infarction and downregulated within 7 days. 8 weeks after myocardial infarction, transplantation into the peri-infarct zone of syngeneic cardiac fibroblasts stably transfected to express SDF-1 induced homing of CD117-positive stem cells to injured myocardium after filgrastim administration (control vs SDF-1-expressing cardiac fibroblasts mean 7.2 [SD 3.4] vs 33.2 [6.0] cells/mm2, n=4 per group, p<0.02) resulting in greater left-ventricular mass (1.24 [0.29] vs 1.57 [0.27] g) and better cardiac function (shortening fraction 9.2 [4.9] vs 17.2 [4.2]%, n=8 per group, p<0.05). INTERPRETATION: These findings show that SDF-1 is sufficient to induce therapeutic stem-cell homing to injured myocardium and suggest a strategy for directed stem-cell engraftment into injured tissues. Our findings also indicate that therapeutic strategies focused on stem-cell mobilisation for regeneration of myocardial tissue must be initiated within days of myocardial infarction unless signalling for stem-cell homing is re-established.

  4. Pluripotent stem cell derived hepatocytes: using materials to define cellular differentiation and tissue engineering

    PubMed Central

    Lucendo-Villarin, B.; Rashidi, H.; Cameron, K.

    2016-01-01

    Pluripotent stem cell derived liver cells (hepatocytes) represent a promising alternative to primary tissue for biological and clinical applications. To date, most hepatocyte maintenance and differentiation systems have relied upon the use of animal derived components. This serves as a significant barrier to large scale production and application of stem cell derived hepatocytes. Recently, the use of defined biologics has overcome those limitations in two-dimensional monolayer culture. In order to improve the cell phenotype further, three-dimensional culture systems have been employed to better mimic the in vivo situation, drawing upon materials chemistry, engineering and biology. In this review we discuss efforts in the field, to differentiate pluripotent stem cells towards hepatocytes under defined conditions. PMID:27746914

  5. Pluripotent stem cell derived hepatocytes: using materials to define cellular differentiation and tissue engineering.

    PubMed

    Lucendo-Villarin, B; Rashidi, H; Cameron, K; Hay, D C

    2016-05-28

    Pluripotent stem cell derived liver cells (hepatocytes) represent a promising alternative to primary tissue for biological and clinical applications. To date, most hepatocyte maintenance and differentiation systems have relied upon the use of animal derived components. This serves as a significant barrier to large scale production and application of stem cell derived hepatocytes. Recently, the use of defined biologics has overcome those limitations in two-dimensional monolayer culture. In order to improve the cell phenotype further, three-dimensional culture systems have been employed to better mimic the in vivo situation, drawing upon materials chemistry, engineering and biology. In this review we discuss efforts in the field, to differentiate pluripotent stem cells towards hepatocytes under defined conditions.

  6. Stem cell derived interneuron transplants as a treatment for schizophrenia: preclinical validation in a rodent model

    PubMed Central

    Donegan, Jennifer J.; Tyson, Jennifer A.; Branch, Sarah Y.; Beckstead, Michael J.; Anderson, Stewart A.; Lodge, Daniel J.

    2016-01-01

    An increasing literature suggests that schizophrenia is associated with a reduction in hippocampal interneuron function. Thus, we posit that stem cell-derived interneuron transplants may be an effective therapeutic strategy to reduce hippocampal hyperactivity and attenuate behavioral deficits in schizophrenia. Here we used a dual-reporter embryonic stem cell line to generate enriched populations of parvalbumin (PV)- or somatostatin (SST)-positive interneurons, which were transplanted into the ventral hippocampus of the methylazoxymethanol (MAM) rodent model of schizophrenia. These interneuron transplants integrate within the existing circuitry, reduce hippocampal hyperactivity, and normalize aberrant dopamine neuron activity. Further, interneuron transplants alleviate behaviors that model negative and cognitive symptoms, including deficits in social interaction and cognitive inflexibility. Interestingly, PV- and SST-enriched transplants produced differential effects on behavior, with PV-enriched populations effectively normalizing all the behaviors examined. These data suggest that stem cell-derived interneuron transplants may represent a novel therapeutic strategy for schizophrenia. PMID:27480492

  7. Autonomous beating rate adaptation in human stem cell-derived cardiomyocytes

    PubMed Central

    Eng, George; Lee, Benjamin W.; Protas, Lev; Gagliardi, Mark; Brown, Kristy; Kass, Robert S.; Keller, Gordon; Robinson, Richard B.; Vunjak-Novakovic, Gordana

    2016-01-01

    The therapeutic success of human stem cell-derived cardiomyocytes critically depends on their ability to respond to and integrate with the surrounding electromechanical environment. Currently, the immaturity of human cardiomyocytes derived from stem cells limits their utility for regenerative medicine and biological research. We hypothesize that biomimetic electrical signals regulate the intrinsic beating properties of cardiomyocytes. Here we show that electrical conditioning of human stem cell-derived cardiomyocytes in three-dimensional culture promotes cardiomyocyte maturation, alters their automaticity and enhances connexin expression. Cardiomyocytes adapt their autonomous beating rate to the frequency at which they were stimulated, an effect mediated by the emergence of a rapidly depolarizing cell population, and the expression of hERG. This rate-adaptive behaviour is long lasting and transferable to the surrounding cardiomyocytes. Thus, electrical conditioning may be used to promote cardiomyocyte maturation and establish their automaticity, with implications for cell-based reduction of arrhythmia during heart regeneration. PMID:26785135

  8. Enhanced Human-Induced Pluripotent Stem Cell Derived Cardiomyocyte Maturation Using a Dual Microgradient Substrate

    PubMed Central

    2016-01-01

    Human-induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CM) raise many possibilities for cardiac research but they exhibit an immature phenotype, which influences experimental outcomes. The aim of our research is to investigate the effects of a topographical gradient substrate on the morphology and function of commercially available hiPSC-CM. The lateral dimensions the microgrooves on the substrate varied from 8 to 100 μm space between the 8 μm grooves on one axis and from ∼5 nm to ∼1 μm in depth on the other axis. Cells were seeded homogeneously across the substrate and according to the manufacturers protocols. At days 4 and 10, measures of eccentricity, elongation, orientation, sarcomere length (SL), and contractility of the hiPSC-CM were taken. Only the deepest and widest region (8–30 μm wide and 0.85–1 μm deep) showed a significantly higher percentage of hiPSC-CM with an increased eccentricity (31.3 ± 6.4%), elongation (10.4 ± 4.3%), and orientation (<10°) (32.1 ± 2.7%) when compared with the control (flat substrate) (15.8 ± 5.0%, 3.4 ± 2.7%, and 10.6 ± 1.1%, respectively). Additionally, during stimulus-induced contraction, the relaxation phase of the twitch was prolonged (400 ms) compared to nonelongated cells (200 ms). These findings support the potential use of dual microgradient substrates to investigate substrate topographies that stimulate migration and/or maturation of hiPSC-CM. PMID:27990488

  9. In-vitro stem cell derived red blood cells for transfusion: are we there yet?

    PubMed

    Kim, Hyun Ok

    2014-03-01

    To date, the use of red blood cells (RBCs) produced from stem cells in vitro has not proved practical for routine transfusion. However, the perpetual and widespread shortage of blood products, problems related to transfusion-transmitted infections, and new emerging pathogens elicit an increasing demand for artificial blood. Worldwide efforts to achieve the goal of RBC production through stem cell research have received vast attention; however, problems with large-scale production and cost effectiveness have yet to prove practical usefulness. Some progress has been made, though, as cord blood stem cells and embryonic stem cells have shown an ability to differentiate and proliferate, and induced pluripotent stem cells have been shown to be an unlimited source for RBC production. However, transfusion of stem cell-derived RBCs still presents a number of challenges to overcome. This paper will summarize an up to date account of research and advances in stem cell-derived RBCs, delineate our laboratory protocol in producing RBCs from cord blood, and introduce the technological developments and limitations to current RBC production practices.

  10. Angiogenic activity mediates bone repair from human pluripotent stem cell-derived osteogenic cells

    PubMed Central

    Zou, Li; Chen, Qingshan; Quanbeck, Zachary; Bechtold, Joan E.; Kaufman, Dan S.

    2016-01-01

    Human pluripotent stem cells provide a standardized resource for bone repair. However, criteria to determine which exogenous cells best heal orthopedic injuries remain poorly defined. We evaluated osteogenic progenitor cells derived from both human embryonic stem cells (hESCs) and induced pluripotent stem cells (hiPSCs). Phenotypic and genotypic analyses demonstrated that these hESCs/hiPSCs are similar in their osteogenic differentiation efficiency and they generate osteogenic cells comparable to osteogenic cells derived from mesenchymal stromal cells (BM-MSCs). However, expression of angiogenic factors, such as vascular endothelial growth factor and basic fibroblast growth factor in these osteogenic progenitor cells are markedly different, suggesting distinct pro-angiogenic potential of these stem cell derivatives. Studies to repair a femur non-union fracture demonstrate only osteogenic progenitor cells with higher pro-angiogenic potential significantly enhance bone repair in vivo. Together, these studies highlight a key role of pro-angiogenic potential of transplanted osteogenic cells for effective cell-mediated bone repair. PMID:26980556

  11. Functional analysis of carboxylesterase in human induced pluripotent stem cell-derived enterocytes.

    PubMed

    Kabeya, Tomoki; Matsumura, Wakana; Iwao, Takahiro; Hosokawa, Masakiyo; Matsunaga, Tamihide

    2017-04-22

    Human carboxylesterase (CES) is a key esterase involved in the metabolism and biotransformation of drugs. Hydrolysis activity in the human small intestine is predominantly mediated by CES2A1 rather than CES1A. In drug development studies, Caco-2 cells are commonly used as a model to predict drug absorption in the human small intestine. However, the expression patterns of CES2A1 and CES1A in Caco-2 cells differ from those in the human small intestine. There are also species-specific differences in CES expression patterns between human and experimental animals. Furthermore, it is difficult to obtain primary human intestinal epithelial cells. Therefore, there is currently no system that can precisely predict features of drug absorption, such as CES-mediated metabolism, in the human intestine. To develop a novel system to evaluate intestinal pharmacokinetics, we analyzed CES expression and function in human induced pluripotent stem (iPS) cell-derived enterocytes. CES2A1 mRNA and protein levels in human iPS cell-derived enterocytes were comparable to Caco-2 cells, whereas CES1A levels were lower in human iPS cell-derived enterocytes compared with Caco-2 cells. p-nitrophenyl acetate hydrolysis in human iPS cell-derived enterocytes was significantly inhibited by the CES2A1-specific inhibitor telmisartan. Hydrolysis levels of the CES2A1-specific substrate aspirin were similar in human iPS cell-derived enterocytes and Caco-2 cells, whereas hydrolysis of the CES1A-specific substrate monoethylglycylxylidine was observed in Caco-2 cells but not in human iPS cell-derived enterocytes. These findings demonstrated that the expression and activity of CES isozymes in human iPS cell-derived enterocytes are more similar to the human small intestine compared with Caco-2 cells.

  12. Xenotransplantation of embryonic stem cell-derived motor neurons into the developing chick spinal cord.

    PubMed

    Wichterle, Hynek; Peljto, Mirza; Nedelec, Stephane

    2009-01-01

    A growing number of specific cell types have been successfully derived from embryonic stem cells (ES cells), including a variety of neural cells. In vitro generated cells need to be extensively characterized to establish functional equivalency with their in vivo counterparts. The ultimate test for the ability of ES cell-derived neurons to functionally integrate into neural networks is transplantation into the developing central nervous system, a challenging technique limited by the poor accessibility of mammalian embryos. Here we describe xenotransplantation of mouse embryonic stem cell-derived motor neurons into the developing chick neural tube as an alternative for testing the ability of in vitro generated neurons to survive, integrate, extend axons, and form appropriate synaptic contacts with functionally relevant targets in vivo. Similar methods can be adapted to study functionality of other mammalian cells, including derivatives of human ES cells.

  13. PIEZO2 is required for mechanotransduction in human stem cell-derived touch receptors.

    PubMed

    Schrenk-Siemens, Katrin; Wende, Hagen; Prato, Vincenzo; Song, Kun; Rostock, Charlotte; Loewer, Alexander; Utikal, Jochen; Lewin, Gary R; Lechner, Stefan G; Siemens, Jan

    2015-01-01

    Human sensory neurons are inaccessible for functional examination, and thus little is known about the mechanisms mediating touch sensation in humans. Here we demonstrate that the mechanosensitivity of human embryonic stem (hES) cell-derived touch receptors depends on PIEZO2. To recapitulate sensory neuron development in vitro, we established a multistep differentiation protocol and generated sensory neurons via the intermediate production of neural crest cells derived from hES cells or human induced pluripotent stem (hiPS) cells. The generated neurons express a distinct set of touch receptor-specific genes and convert mechanical stimuli into electrical signals, their most salient characteristic in vivo. Strikingly, mechanosensitivity is lost after CRISPR/Cas9-mediated PIEZO2 gene deletion. Our work establishes a model system that resembles human touch receptors, which may facilitate mechanistic analysis of other sensory subtypes and provide insight into developmental programs underlying sensory neuron diversity.

  14. Preclinical Studies of Induced Pluripotent Stem Cell-Derived Astrocyte Transplantation in ALS

    DTIC Science & Technology

    2014-12-01

    transporter GLT1, connexin 43, aquaporin 4, the cell surface marker CD44 (a marker of astrocyte precursor identity), and the intermediate filament ... print ] 2. iPSC-Derived GRPs from FUS H517Q ALS do not significantly differ from control iPSC-derived GRP lines One question is whether...Cell-Derived Astrocyte Progenitors Following Spinal Cord Engraftment. Stem Cells Transl Med. 2014 Mar 6. [Epub ahead of print ] (see Appendix) Amanda

  15. Can Human Pluripotent Stem Cell-Derived Cardiomyocytes Advance Understanding of Muscular Dystrophies?

    PubMed

    Kalra, Spandan; Montanaro, Federica; Denning, Chris

    2016-08-30

    Muscular dystrophies (MDs) are clinically and molecularly a highly heterogeneous group of single-gene disorders that primarily affect striated muscles. Cardiac disease is present in several MDs where it is an important contributor to morbidity and mortality. Careful monitoring of cardiac issues is necessary but current management of cardiac involvement does not effectively protect from disease progression and cardiac failure. There is a critical need to gain new knowledge on the diverse molecular underpinnings of cardiac disease in MDs in order to guide cardiac treatment development and assist in reaching a clearer consensus on cardiac disease management in the clinic. Animal models are available for the majority of MDs and have been invaluable tools in probing disease mechanisms and in pre-clinical screens. However, there are recognized genetic, physiological, and structural differences between human and animal hearts that impact disease progression, manifestation, and response to pharmacological interventions. Therefore, there is a need to develop parallel human systems to model cardiac disease in MDs. This review discusses the current status of cardiomyocytes (CMs) derived from human induced pluripotent stem cells (hiPSC) to model cardiac disease, with a focus on Duchenne muscular dystrophy (DMD) and myotonic dystrophy (DM1). We seek to provide a balanced view of opportunities and limitations offered by this system in elucidating disease mechanisms pertinent to human cardiac physiology and as a platform for treatment development or refinement.

  16. Can Human Pluripotent Stem Cell-Derived Cardiomyocytes Advance Understanding of Muscular Dystrophies?

    PubMed Central

    Kalra, Spandan; Montanaro, Federica; Denning, Chris

    2016-01-01

    Muscular dystrophies (MDs) are clinically and molecularly a highly heterogeneous group of single-gene disorders that primarily affect striated muscles. Cardiac disease is present in several MDs where it is an important contributor to morbidity and mortality. Careful monitoring of cardiac issues is necessary but current management of cardiac involvement does not effectively protect from disease progression and cardiac failure. There is a critical need to gain new knowledge on the diverse molecular underpinnings of cardiac disease in MDs in order to guide cardiac treatment development and assist in reaching a clearer consensus on cardiac disease management in the clinic. Animal models are available for the majority of MDs and have been invaluable tools in probing disease mechanisms and in pre-clinical screens. However, there are recognized genetic, physiological, and structural differences between human and animal hearts that impact disease progression, manifestation, and response to pharmacological interventions. Therefore, there is a need to develop parallel human systems to model cardiac disease in MDs. This review discusses the current status of cardiomyocytes (CMs) derived from human induced pluripotent stem cells (hiPSC) to model cardiac disease, with a focus on Duchenne muscular dystrophy (DMD) and myotonic dystrophy (DM1). We seek to provide a balanced view of opportunities and limitations offered by this system in elucidating disease mechanisms pertinent to human cardiac physiology and as a platform for treatment development or refinement. PMID:27854224

  17. Functional Properties of Human Stem Cell-Derived Neurons in Health and Disease

    PubMed Central

    Weick, Jason P.

    2016-01-01

    Stem cell-derived neurons from various source materials present unique model systems to examine the fundamental properties of central nervous system (CNS) development as well as the molecular underpinnings of disease phenotypes. In order to more accurately assess potential therapies for neurological disorders, multiple strategies have been employed in recent years to produce neuronal populations that accurately represent in vivo regional and transmitter phenotypes. These include new technologies such as direct conversion of somatic cell types into neurons and glia which may accelerate maturation and retain genetic hallmarks of aging. In addition, novel forms of genetic manipulations have brought human stem cells nearly on par with those of rodent with respect to gene targeting. For neurons of the CNS, the ultimate phenotypic characterization lies with their ability to recapitulate functional properties such as passive and active membrane characteristics, synaptic activity, and plasticity. These features critically depend on the coordinated expression and localization of hundreds of ion channels and receptors, as well as scaffolding and signaling molecules. In this review I will highlight the current state of knowledge regarding functional properties of human stem cell-derived neurons, with a primary focus on pluripotent stem cells. While significant advances have been made, critical hurdles must be overcome in order for this technology to support progression toward clinical applications. PMID:27274733

  18. Microcircuit formation following transplantation of mouse embryonic stem cell-derived neurons in peripheral nerve.

    PubMed

    Magown, Philippe; Rafuse, Victor F; Brownstone, Robert M

    2017-04-01

    Motoneurons derived from embryonic stem cells can be transplanted in the tibial nerve, where they extend axons to functionally innervate target muscle. Here, we studied spontaneous muscle contractions in these grafts 3 mo following transplantation. One-half of the transplanted grafts generated rhythmic muscle contractions of variable patterns, either spontaneously or in response to brief electrical stimulation. Activity generated by transplanted embryonic stem cell-derived neurons was driven by glutamate and was modulated by muscarinic and GABAergic/glycinergic transmission. Furthermore, rhythmicity was promoted by the same transmitter combination that evokes rhythmic locomotor activity in spinal cord circuits. These results demonstrate that there is a degree of self-assembly of microcircuits in these peripheral grafts involving embryonic stem cell-derived motoneurons and interneurons. Such spontaneous activity is reminiscent of embryonic circuit development in which spontaneous activity is essential for proper connectivity and function and may be necessary for the grafts to form functional connections with muscle.NEW & NOTEWORTHY This manuscript demonstrates that, following peripheral transplantation of neurons derived from embryonic stem cells, the grafts are spontaneously active. The activity is produced and modulated by a number of transmitter systems, indicating that there is a degree of self-assembly of circuits in the grafts.

  19. Drug-loaded nanoparticles induce gene expression in human pluripotent stem cell derivatives

    NASA Astrophysics Data System (ADS)

    Gajbhiye, Virendra; Escalante, Leah; Chen, Guojun; Laperle, Alex; Zheng, Qifeng; Steyer, Benjamin; Gong, Shaoqin; Saha, Krishanu

    2013-12-01

    Tissue engineering and advanced manufacturing of human stem cells requires a suite of tools to control gene expression spatiotemporally in culture. Inducible gene expression systems offer cell-extrinsic control, typically through addition of small molecules, but small molecule inducers typically contain few functional groups for further chemical modification. Doxycycline (DXC), a potent small molecule inducer of tetracycline (Tet) transgene systems, was conjugated to a hyperbranched dendritic polymer (Boltorn H40) and subsequently reacted with polyethylene glycol (PEG). The resulting PEG-H40-DXC nanoparticle exhibited pH-sensitive drug release behavior and successfully controlled gene expression in stem-cell-derived fibroblasts with a Tet-On system. While free DXC inhibited fibroblast proliferation and matrix metalloproteinase (MMP) activity, PEG-H40-DXC nanoparticles maintained higher fibroblast proliferation levels and MMP activity. The results demonstrate that the PEG-H40-DXC nanoparticle system provides an effective tool to controlling gene expression in human stem cell derivatives.Tissue engineering and advanced manufacturing of human stem cells requires a suite of tools to control gene expression spatiotemporally in culture. Inducible gene expression systems offer cell-extrinsic control, typically through addition of small molecules, but small molecule inducers typically contain few functional groups for further chemical modification. Doxycycline (DXC), a potent small molecule inducer of tetracycline (Tet) transgene systems, was conjugated to a hyperbranched dendritic polymer (Boltorn H40) and subsequently reacted with polyethylene glycol (PEG). The resulting PEG-H40-DXC nanoparticle exhibited pH-sensitive drug release behavior and successfully controlled gene expression in stem-cell-derived fibroblasts with a Tet-On system. While free DXC inhibited fibroblast proliferation and matrix metalloproteinase (MMP) activity, PEG-H40-DXC nanoparticles maintained

  20. Negligible immunogenicity of terminally differentiated cells derived from induced pluripotent or embryonic stem cells.

    PubMed

    Araki, Ryoko; Uda, Masahiro; Hoki, Yuko; Sunayama, Misato; Nakamura, Miki; Ando, Shunsuke; Sugiura, Mayumi; Ideno, Hisashi; Shimada, Akemi; Nifuji, Akira; Abe, Masumi

    2013-02-07

    The advantages of using induced pluripotent stem cells (iPSCs) instead of embryonic stem (ES) cells in regenerative medicine centre around circumventing concerns about the ethics of using ES cells and the likelihood of immune rejection of ES-cell-derived tissues. However, partial reprogramming and genetic instabilities in iPSCs could elicit immune responses in transplant recipients even when iPSC-derived differentiated cells are transplanted. iPSCs are first differentiated into specific types of cells in vitro for subsequent transplantation. Although model transplantation experiments have been conducted using various iPSC-derived differentiated tissues and immune rejections have not been observed, careful investigation of the immunogenicity of iPSC-derived tissue is becoming increasingly critical, especially as this has not been the focus of most studies done so far. A recent study reported immunogenicity of iPSC- but not ES-cell-derived teratomas and implicated several causative genes. Nevertheless, some controversy has arisen regarding these findings. Here we examine the immunogenicity of differentiated skin and bone marrow tissues derived from mouse iPSCs. To ensure optimal comparison of iPSCs and ES cells, we established ten integration-free iPSC and seven ES-cell lines using an inbred mouse strain, C57BL/6. We observed no differences in the rate of success of transplantation when skin and bone marrow cells derived from iPSCs were compared with ES-cell-derived tissues. Moreover, we observed limited or no immune responses, including T-cell infiltration, for tissues derived from either iPSCs or ES cells, and no increase in the expression of the immunogenicity-causing Zg16 and Hormad1 genes in regressing skin and teratoma tissues. Our findings suggest limited immunogenicity of transplanted cells differentiated from iPSCs and ES cells.

  1. Multi-cellular interactions sustain long-term contractility of human pluripotent stem cell-derived cardiomyocytes

    PubMed Central

    Burridge, Paul W; Metzler, Scott A; Nakayama, Karina H; Abilez, Oscar J; Simmons, Chelsey S; Bruce, Marc A; Matsuura, Yuka; Kim, Paul; Wu, Joseph C; Butte, Manish; Huang, Ngan F; Yang, Phillip C

    2014-01-01

    Therapeutic delivery of cardiomyocytes derived from human pluripotent stem cells (hPSC-CMs) represents a novel clinical approach to regenerate the injured myocardium. However, poor survival and contractility of these cells are a significant bottleneck to their clinical use. To better understand the role of cell-cell communication in enhancing the phenotype and contractile properties of hPSC-CMs, we developed a three-dimensional (3D) hydrogel composed of hPSC-CMs, human pluripotent stem cell-derived endothelial cells (hPSC-ECs), and/or human amniotic mesenchymal stem cells (hAMSCs). The objective of this study was to examine the role of multi-cellular interactions among hPSC-ECs and hAMSCs on the survival and long-term contractile phenotype of hPSC-CMs in a 3D hydrogel. Quantification of spontaneous contractility of hPSC-CMs in tri-culture demonstrated a 6-fold increase in the area of contractile motion after 6 weeks with characteristic rhythmic contraction frequency, when compared to hPSC-CMs alone (P < 0.05). This finding was supported by a statistically significant increase in cardiac troponin T protein expression in the tri-culture hydrogel construct at 6 weeks, when compared to hPSC-CMs alone (P < 0.001). The sustained hPSC-CM survival and contractility in tri-culture was associated with a significant upregulation in the gene expression of L-type Ca2+ ion channel, Cav1.2, and the inward-rectifier potassium channel, Kir2.1 (P < 0.05), suggesting a role of ion channels in mediating these processes. These findings demonstrate that multi-cellular interactions modulate hPSC-CM phenotype, function, and survival, and they will have important implications in engineering cardiac tissues for treatment of cardiovascular diseases. PMID:25628783

  2. Stem cell-derived nodal-like cardiomyocytes as a novel pharmacologic tool: insights from sinoatrial node development and function.

    PubMed

    Barbuti, Andrea; Robinson, Richard B

    2015-01-01

    Since the first reports on the isolation and differentiation of stem cells, and in particular since the early success in driving these cells down a cardiac lineage, there has been interest in the potential of such preparations in cardiac regenerative therapy. Much of the focus of such research has been on improving mechanical function after myocardial infarction; however, electrophysiologic studies of these preparations have revealed a heterogeneous mix of action potential characteristics, including some described as "pacemaker" or "nodal-like," which in turn led to interest in the therapeutic potential of these preparations in the treatment of rhythm disorders; several proof-of-concept studies have used these cells to create a biologic alternative to electronic pacemakers. Further, there are additional potential applications of a preparation of pacemaker cells derived from stem cells, for example, in high-throughput screens of new chronotropic agents. All such applications require reasonably efficient methods for selecting or enriching the "nodal-like" cells, however, which in turn depends on first defining what constitutes a nodal-like cell since not all pacemaking cells are necessarily of nodal lineage. This review discusses the current state of the field in terms of characterizing sinoatrial-like cardiomyocytes derived from embryonic and induced pluripotent stem cells, markers that might be appropriate based on the current knowledge of the gene program leading to sinoatrial node development, what functional characteristics might be expected and desired based on studies of the sinoatrial node, and recent efforts at enrichment and selection of nodal-like cells.

  3. Structural and functional screening in human induced-pluripotent stem cell-derived cardiomyocytes accurately identifies cardiotoxicity of multiple drug types

    SciTech Connect

    Doherty, Kimberly R. Talbert, Dominique R.; Trusk, Patricia B.; Moran, Diarmuid M.; Shell, Scott A.; Bacus, Sarah

    2015-05-15

    Safety pharmacology studies that evaluate new drug entities for potential cardiac liability remain a critical component of drug development. Current studies have shown that in vitro tests utilizing human induced pluripotent stem cell-derived cardiomyocytes (hiPS-CM) may be beneficial for preclinical risk evaluation. We recently demonstrated that an in vitro multi-parameter test panel assessing overall cardiac health and function could accurately reflect the associated clinical cardiotoxicity of 4 FDA-approved targeted oncology agents using hiPS-CM. The present studies expand upon this initial observation to assess whether this in vitro screen could detect cardiotoxicity across multiple drug classes with known clinical cardiac risks. Thus, 24 drugs were examined for their effect on both structural (viability, reactive oxygen species generation, lipid formation, troponin secretion) and functional (beating activity) endpoints in hiPS-CM. Using this screen, the cardiac-safe drugs showed no effects on any of the tests in our panel. However, 16 of 18 compounds with known clinical cardiac risk showed drug-induced changes in hiPS-CM by at least one method. Moreover, when taking into account the Cmax values, these 16 compounds could be further classified depending on whether the effects were structural, functional, or both. Overall, the most sensitive test assessed cardiac beating using the xCELLigence platform (88.9%) while the structural endpoints provided additional insight into the mechanism of cardiotoxicity for several drugs. These studies show that a multi-parameter approach examining both cardiac cell health and function in hiPS-CM provides a comprehensive and robust assessment that can aid in the determination of potential cardiac liability. - Highlights: • 24 drugs were tested for cardiac liability using an in vitro multi-parameter screen. • Changes in beating activity were the most sensitive in predicting cardiac risk. • Structural effects add in

  4. Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes Afford New Opportunities in Inherited Cardiovascular Disease Modeling

    PubMed Central

    Bayzigitov, Daniel R.; Medvedev, Sergey P.; Dementyeva, Elena V.; Bayramova, Sevda A.; Pokushalov, Evgeny A.; Karaskov, Alexander M.; Zakian, Suren M.

    2016-01-01

    Fundamental studies of molecular and cellular mechanisms of cardiovascular disease pathogenesis are required to create more effective and safer methods of their therapy. The studies can be carried out only when model systems that fully recapitulate pathological phenotype seen in patients are used. Application of laboratory animals for cardiovascular disease modeling is limited because of physiological differences with humans. Since discovery of induced pluripotency generating induced pluripotent stem cells has become a breakthrough technology in human disease modeling. In this review, we discuss a progress that has been made in modeling inherited arrhythmias and cardiomyopathies, studying molecular mechanisms of the diseases, and searching for and testing drug compounds using patient-specific induced pluripotent stem cell-derived cardiomyocytes. PMID:27110425

  5. A Method for Sectioning and Immunohistochemical Analysis of Stem Cell-Derived 3-D Organoids.

    PubMed

    Wiley, Luke A; Beebe, David C; Mullins, Robert F; Stone, Edwin M; Tucker, Budd A

    2016-05-12

    This unit describes a protocol for embedding, sectioning, and immunocytochemical analysis of pluripotent stem cell-derived 3-D organoids. Specifically, we describe a method to embed iPSC-derived retinal cups in low-melt agarose, acquire thick sections using a vibratome tissue slicer, and perform immunohistochemical analysis. This method includes an approach for antibody labeling that minimizes the amount of antibody needed for individual experiments and that utilizes large-volume washing to increase the signal-to-noise ratio, allowing for clean, high-resolution imaging of developing cell types. The universal methods described can be employed regardless of the type of pluripotent stem cell used and 3-D organoid generated. © 2016 by John Wiley & Sons, Inc.

  6. Stem Cells Derived from Tooth Periodontal Ligament Enhance Functional Angiogenesis by Endothelial Cells

    PubMed Central

    Yeasmin, Shamima; Ceccarelli, Jacob; Vigen, Marina; Carrion, Bita; Putnam, Andrew J.; Tarle, Susan A.

    2014-01-01

    In regenerative medicine approaches involving cell therapy, selection of the appropriate cell type is important in that the cells must directly (differentiation) or indirectly (trophic effects) participate in the regenerative response. Regardless of the mode of action of the cells, angiogenesis underlies the success of these approaches. Stem cells derived from tooth tissues, specifically the periodontal ligament of teeth (periodontal ligament stem cells [PDLSCs]), have recently been identified as a good source of multipotent cells for cell therapies. PDLSCs have demonstrated properties similar to mesenchymal stem cells (MSCs), yet, unlike MSCs, their vascular potential has not been previously demonstrated. Thus, the aim of this study was to determine if PDLSCs could modulate angiogenesis. In comparison to MSCs and stem cells derived from tooth pulp tissues (SHEDs), we first determined if PDLSCs released soluble proangiogenic factors with the capacity to induce vessel formation by endothelial cells (ECs). Next, the ability of PDLSCs to modulate angiogenesis was examined through their cotransplantation with ECs in subcutaneous sites of immunocompromised mice. Finally, the stability of the PDLSC-mediated vasculature was determined through evaluation of the maturity and functionality of the vessels formed following PDLSC transplantation. It was determined that PDLSCs produced appreciable levels of vascular endothelial growth factor and basic fibroblast growth factor-2, and additionally, were able to initiate in vitro angiogenesis of ECs comparable to MSC- and SHED-mediated angiogenesis. In vivo cotransplantation of ECs with PDLSCs significantly (>50% increase) enhanced the number of blood vessels formed relative to transplantation of ECs alone. Finally, vessels formed following PDLSC cotransplantation were more mature and less permeable than those formed after transplantation of EC alone. These data demonstrate for the first time that PDLSCs have vascular potential

  7. Stem cells derived from tooth periodontal ligament enhance functional angiogenesis by endothelial cells.

    PubMed

    Yeasmin, Shamima; Ceccarelli, Jacob; Vigen, Marina; Carrion, Bita; Putnam, Andrew J; Tarle, Susan A; Kaigler, Darnell

    2014-04-01

    In regenerative medicine approaches involving cell therapy, selection of the appropriate cell type is important in that the cells must directly (differentiation) or indirectly (trophic effects) participate in the regenerative response. Regardless of the mode of action of the cells, angiogenesis underlies the success of these approaches. Stem cells derived from tooth tissues, specifically the periodontal ligament of teeth (periodontal ligament stem cells [PDLSCs]), have recently been identified as a good source of multipotent cells for cell therapies. PDLSCs have demonstrated properties similar to mesenchymal stem cells (MSCs), yet, unlike MSCs, their vascular potential has not been previously demonstrated. Thus, the aim of this study was to determine if PDLSCs could modulate angiogenesis. In comparison to MSCs and stem cells derived from tooth pulp tissues (SHEDs), we first determined if PDLSCs released soluble proangiogenic factors with the capacity to induce vessel formation by endothelial cells (ECs). Next, the ability of PDLSCs to modulate angiogenesis was examined through their cotransplantation with ECs in subcutaneous sites of immunocompromised mice. Finally, the stability of the PDLSC-mediated vasculature was determined through evaluation of the maturity and functionality of the vessels formed following PDLSC transplantation. It was determined that PDLSCs produced appreciable levels of vascular endothelial growth factor and basic fibroblast growth factor-2, and additionally, were able to initiate in vitro angiogenesis of ECs comparable to MSC- and SHED-mediated angiogenesis. In vivo cotransplantation of ECs with PDLSCs significantly (>50% increase) enhanced the number of blood vessels formed relative to transplantation of ECs alone. Finally, vessels formed following PDLSC cotransplantation were more mature and less permeable than those formed after transplantation of EC alone. These data demonstrate for the first time that PDLSCs have vascular potential

  8. Effects of tacrolimus on morphology, proliferation and differentiation of mesenchymal stem cells derived from gingiva tissue

    PubMed Central

    HA, DONG-HO; YONG, CHUL SOON; KIM, JONG OH; JEONG, JEE-HEON; PARK, JUN-BEOM

    2016-01-01

    Tacrolimus is a 23-membered macrolide lactone with potent immunosuppressive activity that is effective in the prophylaxis of organ rejection following kidney, heart and liver transplantation. Tacrolimus also exerts a variety of actions on bone metabolism. The aim of the present study was to evaluate the effects of different concentrations of tacrolimus on the morphology and viability of human stem cells derived from the gingiva. Gingival-derived stem cells were grown in the presence of tacrolimus at final concentrations ranging from 0.001 to 100 µg/ml. The morphology of the cells was viewed under an inverted microscope and the cell viability was analyzed using Cell Counting kit-8 (CCK-8) on days 1, 3, 5 and 7. Alizarin Red S staining was used to assess mineralization of treated cells. The control group showed spindle-shaped, fibroblast-like morphology and the shapes of the cells in 0.001, 0.01, 0.1, 1 and 10 µg/ml tacrolimus were similar to those of the control group. All groups except the 100 µg/ml group showed increased cell proliferation over time. Cultures grown in the presence of tacrolimus at 0.001, 0.01, 0.1, 1 and 10 µg/ml were not identified to be significantly different compared with the control at days 1, 3 and 5 using the CCK-8 assays. Increased mineralized deposits were noted with increased incubation time. Treatment with tacrolimus from 0.001 to 1 µg/ml led to an increase in mineralization compared with the control group. Within the limits of this study, tacrolimus at the tested concentrations (ranging from 0.001 to 10 µg/ml) did not result in differences in the viability of stem cells derived from gingiva; however it did enhance osteogenic differentiation of the stem cells. PMID:27177273

  9. Expansion and Characterization of Human Embryonic Stem Cell-Derived Osteoblast-Like Cells

    PubMed Central

    Arpornmaeklong, Premjit; Wang, Zhuo; Pressler, Michael J.; Brown, Shelley E.

    2010-01-01

    Abstract Human embryonic stem cells (hESCs) have the potential to serve as a repository of cells for the replacement of damaged or diseased tissues and organs. However, to use hESCs in clinically relevant scenarios, a large number of cells are likely to be required. The aim of this study was to demonstrate an alternative cell culture method to increase the quantity of osteoblast-like cells directly derived from hESCs (hESCs-OS). Undifferentiated hESCs were directly cultivated and serially passaged in osteogenic medium (hESC-OS), and exhibited similar expression patterns of osteoblast-related genes to osteoblast-like cells derived from mesenchymal stem cells derived from hESCs (hESCs-MSCs-OS) and human bone marrow stromal cells (hBMSCs-OS). In comparison to hESCs-MSCs-OS, the hESCs-OS required a shorter expansion time to generate a homogenous population of osteoblast-like cells that did not contain contaminating undifferentiated hESCs. Identification of human specific nuclear antigen (HuNu) in the newly formed bone in calvarial defects verified the role of the transplanted hESCs-OS as active bone forming cells in vivo. Taken together, this study suggests that osteoblast-like cells directly derived from hESCs have the potential to serve as an alternative source of osteoprogenitors for bone tissue engineering strategies. PMID:20698777

  10. Functional astrocyte-neuron lactate shuttle in a human stem cell-derived neuronal network.

    PubMed

    Tarczyluk, Marta A; Nagel, David A; O'Neil, John D; Parri, H Rheinallt; Tse, Erin H Y; Coleman, Michael D; Hill, Eric J

    2013-09-01

    The NT2.D1 cell line is one of the most well-documented embryocarcinoma cell lines, and can be differentiated into neurons and astrocytes. Great focus has also been placed on defining the electrophysiological properties of the neuronal cells, and more recently we have investigated the functional properties of their associated astrocytes. We now show for the first time that human stem cell-derived astrocytes produce glycogen and that co-cultures of these cells demonstrate a functional astrocyte-neuron lactate shuttle (ANLS). The ANLS hypothesis proposes that during neuronal activity, glutamate released into the synaptic cleft is taken up by astrocytes and triggers glucose uptake, which is converted into lactate and released via monocarboxylate transporters for neuronal use. Using mixed cultures of NT2-derived neurons and astrocytes, we have shown that these cells modulate their glucose uptake in response to glutamate. Additionally, we demonstrate that in response to increased neuronal activity and under hypoglycaemic conditions, co-cultures modulate glycogen turnover and increase lactate production. Similar results were also shown after treatment with glutamate, potassium, isoproterenol, and dbcAMP. Together, these results demonstrate for the first time a functional ANLS in a human stem cell-derived co-culture.

  11. A review of human pluripotent stem cell-derived cardiomyocytes for high-throughput drug discovery, cardiotoxicity screening, and publication standards.

    PubMed

    Mordwinkin, Nicholas M; Burridge, Paul W; Wu, Joseph C

    2013-02-01

    Drug attrition rates have increased in past years, resulting in growing costs for the pharmaceutical industry and consumers. The reasons for this include the lack of in vitro models that correlate with clinical results and poor preclinical toxicity screening assays. The in vitro production of human cardiac progenitor cells and cardiomyocytes from human pluripotent stem cells provides an amenable source of cells for applications in drug discovery, disease modeling, regenerative medicine, and cardiotoxicity screening. In addition, the ability to derive human-induced pluripotent stem cells from somatic tissues, combined with current high-throughput screening and pharmacogenomics, may help realize the use of these cells to fulfill the potential of personalized medicine. In this review, we discuss the use of pluripotent stem cell-derived cardiomyocytes for drug discovery and cardiotoxicity screening, as well as current hurdles that must be overcome for wider clinical applications of this promising approach.

  12. Stem Cell-Derived Immature Human Dorsal Root Ganglia Neurons to Identify Peripheral Neurotoxicants

    PubMed Central

    Klima, Stefanie; Karreman, Christiaan; Grinberg, Marianna; Meisig, Johannes; Henry, Margit; Rotshteyn, Tamara; Rahnenführer, Jörg; Blüthgen, Nils; Sachinidis, Agapios; Waldmann, Tanja; Leist, Marcel

    2016-01-01

    Safety sciences and the identification of chemical hazards have been seen as one of the most immediate practical applications of human pluripotent stem cell technology. Protocols for the generation of many desirable human cell types have been developed, but optimization of neuronal models for toxicological use has been astonishingly slow, and the wide, clinically important field of peripheral neurotoxicity is still largely unexplored. A two-step protocol to generate large lots of identical peripheral human neuronal precursors was characterized and adapted to the measurement of peripheral neurotoxicity. High content imaging allowed an unbiased assessment of cell morphology and viability. The computational quantification of neurite growth as a functional parameter highly sensitive to disturbances by toxicants was used as an endpoint reflecting specific neurotoxicity. The differentiation of cells toward dorsal root ganglia neurons was tracked in relation to a large background data set based on gene expression microarrays. On this basis, a peripheral neurotoxicity (PeriTox) test was developed as a first toxicological assay that harnesses the potential of human pluripotent stem cells to generate cell types/tissues that are not otherwise available for the prediction of human systemic organ toxicity. Testing of more than 30 chemicals showed that human neurotoxicants and neurite growth enhancers were correctly identified. Various classes of chemotherapeutic agents causing human peripheral neuropathies were identified, and they were missed when tested on human central neurons. The PeriTox test we established shows the potential of human stem cells for clinically relevant safety testing of drugs in use and of new emerging candidates. Significance The generation of human cells from pluripotent stem cells has aroused great hopes in biomedical research and safety sciences. Neurotoxicity testing is a particularly important application for stem cell-derived somatic cells, as

  13. Neuronal-like cell differentiation of non-adherent bone marrow cell-derived mesenchymal stem cells.

    PubMed

    Wu, Yuxin; Zhang, Jinghan; Ben, Xiaoming

    2013-08-05

    Non-adherent bone marrow cell-derived mesenchymal stem cells from C57BL/6J mice were separated and cultured using the "pour-off" method. Non-adherent bone marrow cell-derived mesenchymal stem cells developed colony-forming unit-fibroblasts, and could be expanded by supplementation with epidermal growth factor. Immunocytochemistry showed that the non-adherent bone marrow cell-derived mesenchymal stem cells exposed to basic fibroblast growth factor/epidermal growth factor/nerve growth factor expressed the neuron specific markers, neurofilament-200 and NeuN, in vitro. Non-adherent bone marrow cell-derived mesenchymal stem cells from β-galactosidase transgenic mice were also transplanted into focal ischemic brain (right corpus striatum) of C57BL/6J mice. At 8 weeks, cells positive for LacZ and β-galactosidase staining were observed in the ischemic tissues, and cells co-labeled with both β-galactosidase and NeuN were seen by double immunohistochemical staining. These findings suggest that the non-adherent bone marrow cell-derived mesenchymal stem cells could differentiate into neuronal-like cells in vitro and in vivo.

  14. Embryonic template-based generation and purification of pluripotent stem cell-derived cardiomyocytes for heart repair.

    PubMed

    Dierickx, Pieterjan; Doevendans, Pieter A; Geijsen, Niels; van Laake, Linda W

    2012-10-01

    Cardiovascular disease remains a leading cause of death in Western countries. Many types of cardiovascular diseases are due to a loss of functional cardiomyocytes, which can result in irreversible cardiac failure. Since the adult human heart has limited regenerative potential, cardiac transplantation is still the only effective therapy to address this cardiomyocyte loss. However, drawbacks, such as immune rejection and insufficient donor availability, are limiting this last-resort solution. Recent developments in the stem cell biology field have improved the potential of cardiac regeneration. Improvements in reprogramming strategies of differentiated adult cells into induced pluripotent stem cells, together with increased efficiency of directed differentiation of pluripotent stem cells toward cardiac myocytes, have brought cell-based heart muscle regeneration a few steps closer to the clinic. In this review, we outline the status of research on cardiac regeneration with a focus on directed differentiation of pluripotent stem cells toward the cardiac lineage.

  15. Partial Reprogramming of Pluripotent Stem Cell-Derived Cardiomyocytes into Neurons.

    PubMed

    Chuang, Wenpo; Sharma, Arun; Shukla, Praveen; Li, Guang; Mall, Moritz; Rajarajan, Kuppusamy; Abilez, Oscar J; Hamaguchi, Ryoko; Wu, Joseph C; Wernig, Marius; Wu, Sean M

    2017-03-22

    Direct reprogramming of somatic cells has been demonstrated, however, it is unknown whether electrophysiologically-active somatic cells derived from separate germ layers can be interconverted. We demonstrate that partial direct reprogramming of mesoderm-derived cardiomyocytes into neurons is feasible, generating cells exhibiting structural and electrophysiological properties of both cardiomyocytes and neurons. Human and mouse pluripotent stem cell-derived CMs (PSC-CMs) were transduced with the neurogenic transcription factors Brn2, Ascl1, Myt1l and NeuroD. We found that CMs adopted neuronal morphologies as early as day 3 post-transduction while still retaining a CM gene expression profile. At week 1 post-transduction, we found that reprogrammed CMs expressed neuronal markers such as Tuj1, Map2, and NCAM. At week 3 post-transduction, mature neuronal markers such as vGlut and synapsin were observed. With single-cell qPCR, we temporally examined CM gene expression and observed increased expression of neuronal markers Dcx, Map2, and Tubb3. Patch-clamp analysis confirmed the neuron-like electrophysiological profile of reprogrammed CMs. This study demonstrates that PSC-CMs are amenable to partial neuronal conversion, yielding a population of cells exhibiting features of both neurons and CMs.

  16. Partial Reprogramming of Pluripotent Stem Cell-Derived Cardiomyocytes into Neurons

    PubMed Central

    Chuang, Wenpo; Sharma, Arun; Shukla, Praveen; Li, Guang; Mall, Moritz; Rajarajan, Kuppusamy; Abilez, Oscar J.; Hamaguchi, Ryoko; Wu, Joseph C.; Wernig, Marius; Wu, Sean M.

    2017-01-01

    Direct reprogramming of somatic cells has been demonstrated, however, it is unknown whether electrophysiologically-active somatic cells derived from separate germ layers can be interconverted. We demonstrate that partial direct reprogramming of mesoderm-derived cardiomyocytes into neurons is feasible, generating cells exhibiting structural and electrophysiological properties of both cardiomyocytes and neurons. Human and mouse pluripotent stem cell-derived CMs (PSC-CMs) were transduced with the neurogenic transcription factors Brn2, Ascl1, Myt1l and NeuroD. We found that CMs adopted neuronal morphologies as early as day 3 post-transduction while still retaining a CM gene expression profile. At week 1 post-transduction, we found that reprogrammed CMs expressed neuronal markers such as Tuj1, Map2, and NCAM. At week 3 post-transduction, mature neuronal markers such as vGlut and synapsin were observed. With single-cell qPCR, we temporally examined CM gene expression and observed increased expression of neuronal markers Dcx, Map2, and Tubb3. Patch-clamp analysis confirmed the neuron-like electrophysiological profile of reprogrammed CMs. This study demonstrates that PSC-CMs are amenable to partial neuronal conversion, yielding a population of cells exhibiting features of both neurons and CMs. PMID:28327614

  17. Importance of being Nernst: Synaptic activity and functional relevance in stem cell-derived neurons

    PubMed Central

    Bradford, Aaron B; McNutt, Patrick M

    2015-01-01

    Functional synaptogenesis and network emergence are signature endpoints of neurogenesis. These behaviors provide higher-order confirmation that biochemical and cellular processes necessary for neurotransmitter release, post-synaptic detection and network propagation of neuronal activity have been properly expressed and coordinated among cells. The development of synaptic neurotransmission can therefore be considered a defining property of neurons. Although dissociated primary neuron cultures readily form functioning synapses and network behaviors in vitro, continuously cultured neurogenic cell lines have historically failed to meet these criteria. Therefore, in vitro-derived neuron models that develop synaptic transmission are critically needed for a wide array of studies, including molecular neuroscience, developmental neurogenesis, disease research and neurotoxicology. Over the last decade, neurons derived from various stem cell lines have shown varying ability to develop into functionally mature neurons. In this review, we will discuss the neurogenic potential of various stem cells populations, addressing strengths and weaknesses of each, with particular attention to the emergence of functional behaviors. We will propose methods to functionally characterize new stem cell-derived neuron (SCN) platforms to improve their reliability as physiological relevant models. Finally, we will review how synaptically active SCNs can be applied to accelerate research in a variety of areas. Ultimately, emphasizing the critical importance of synaptic activity and network responses as a marker of neuronal maturation is anticipated to result in in vitro findings that better translate to efficacious clinical treatments. PMID:26240679

  18. Isolation, Characterization, and Multipotent Differentiation of Mesenchymal Stem Cells Derived from Meniscal Debris

    PubMed Central

    Fu, Weili; Xie, Xing; Li, Qi; Chen, Gang; Zhang, Chenghao; Tang, Xin

    2016-01-01

    This study aimed to culture and characterize mesenchymal stem cells derived from meniscal debris. Cells in meniscal debris from patients with meniscal injury were isolated by enzymatic digestion, cultured in vitro to the third passage, and analyzed by light microscopy to observe morphology and growth. Third-passage cultures were also analyzed for immunophenotype and ability to differentiate into osteogenic, adipogenic, and chondrogenic lineages. After 4-5 days in culture, cells showed a long fusiform shape and adhered to the plastic walls. After 10–12 days, cell clusters and colonies were observed. Third-passage cells showed uniform morphology and good proliferation. They expressed CD44, CD90, and CD105 but were negative for CD34 and CD45. Cultures induced to differentiate via osteogenesis became positive for Alizarin Red staining as well as alkaline phosphatase activity. Cultures induced to undergo adipogenesis were positive for Oil Red O staining. Cultures induced to undergo chondrogenesis were positive for staining with Toluidine Blue, Alcian Blue, and type II collagen immunohistochemistry, indicating cartilage-specific matrix. These results indicate that the cells we cultured from meniscal debris are mesenchymal stem cells capable of differentiating along three lineages. These stem cells may be valuable source for meniscal regeneration. PMID:28044083

  19. Potential Therapies by Stem Cell-Derived Exosomes in CNS Diseases: Focusing on the Neurogenic Niche

    PubMed Central

    Luarte, Alejandro; Bátiz, Luis Federico; Wyneken, Ursula; Lafourcade, Carlos

    2016-01-01

    Neurodegenerative disorders are one of the leading causes of death and disability and one of the biggest burdens on health care systems. Novel approaches using various types of stem cells have been proposed to treat common neurodegenerative disorders such as Alzheimer's Disease, Parkinson's Disease, or stroke. Moreover, as the secretome of these cells appears to be of greater benefit compared to the cells themselves, the extracellular components responsible for its therapeutic benefit have been explored. Stem cells, as well as most cells, release extracellular vesicles such as exosomes, which are nanovesicles able to target specific cell types and thus to modify their function by delivering proteins, lipids, and nucleic acids. Exosomes have recently been tested in vivo and in vitro as therapeutic conveyors for the treatment of diseases. As such, they could be engineered to target specific populations of cells within the CNS. Considering the fact that many degenerative brain diseases have an impact on adult neurogenesis, we discuss how the modulation of the adult neurogenic niches may be a therapeutic target of stem cell-derived exosomes. These novel approaches should be examined in cellular and animal models to provide better, more effective, and specific therapeutic tools in the future. PMID:27195011

  20. Human pluripotent stem cell-derived neural constructs for predicting neural toxicity.

    PubMed

    Schwartz, Michael P; Hou, Zhonggang; Propson, Nicholas E; Zhang, Jue; Engstrom, Collin J; Santos Costa, Vitor; Jiang, Peng; Nguyen, Bao Kim; Bolin, Jennifer M; Daly, William; Wang, Yu; Stewart, Ron; Page, C David; Murphy, William L; Thomson, James A

    2015-10-06

    Human pluripotent stem cell-based in vitro models that reflect human physiology have the potential to reduce the number of drug failures in clinical trials and offer a cost-effective approach for assessing chemical safety. Here, human embryonic stem (ES) cell-derived neural progenitor cells, endothelial cells, mesenchymal stem cells, and microglia/macrophage precursors were combined on chemically defined polyethylene glycol hydrogels and cultured in serum-free medium to model cellular interactions within the developing brain. The precursors self-assembled into 3D neural constructs with diverse neuronal and glial populations, interconnected vascular networks, and ramified microglia. Replicate constructs were reproducible by RNA sequencing (RNA-Seq) and expressed neurogenesis, vasculature development, and microglia genes. Linear support vector machines were used to construct a predictive model from RNA-Seq data for 240 neural constructs treated with 34 toxic and 26 nontoxic chemicals. The predictive model was evaluated using two standard hold-out testing methods: a nearly unbiased leave-one-out cross-validation for the 60 training compounds and an unbiased blinded trial using a single hold-out set of 10 additional chemicals. The linear support vector produced an estimate for future data of 0.91 in the cross-validation experiment and correctly classified 9 of 10 chemicals in the blinded trial.

  1. Accurate prediction of drug-induced liver injury using stem cell-derived populations.

    PubMed

    Szkolnicka, Dagmara; Farnworth, Sarah L; Lucendo-Villarin, Baltasar; Storck, Christopher; Zhou, Wenli; Iredale, John P; Flint, Oliver; Hay, David C

    2014-02-01

    Despite major progress in the knowledge and management of human liver injury, there are millions of people suffering from chronic liver disease. Currently, the only cure for end-stage liver disease is orthotopic liver transplantation; however, this approach is severely limited by organ donation. Alternative approaches to restoring liver function have therefore been pursued, including the use of somatic and stem cell populations. Although such approaches are essential in developing scalable treatments, there is also an imperative to develop predictive human systems that more effectively study and/or prevent the onset of liver disease and decompensated organ function. We used a renewable human stem cell resource, from defined genetic backgrounds, and drove them through developmental intermediates to yield highly active, drug-inducible, and predictive human hepatocyte populations. Most importantly, stem cell-derived hepatocytes displayed equivalence to primary adult hepatocytes, following incubation with known hepatotoxins. In summary, we have developed a serum-free, scalable, and shippable cell-based model that faithfully predicts the potential for human liver injury. Such a resource has direct application in human modeling and, in the future, could play an important role in developing renewable cell-based therapies.

  2. Induced Pluripotent Stem Cell Derived Mesenchymal Stem Cells for Attenuating Age-Related Bone Loss

    DTIC Science & Technology

    2012-07-01

    into anabolic therapies for osteoporosis .1 Mesenchymal stem cell (MSC) differentiation towards the bone forming osteoblastic lineage decreases as a...research into anabolic therapies for osteoporosis .1 Mesenchymal stem cell (MSC) differentiation towards the bone forming osteoblastic lineage decreases...13. SUPPLEMENTARY NOTES 14. ABSTRACT Osteoporosis , both age-related and post-menopausal, is a huge health problem in the United States and indeed

  3. Optical control of muscle function by transplantation of stem cell-derived motor neurons in mice.

    PubMed

    Bryson, J Barney; Machado, Carolina Barcellos; Crossley, Martin; Stevenson, Danielle; Bros-Facer, Virginie; Burrone, Juan; Greensmith, Linda; Lieberam, Ivo

    2014-04-04

    Damage to the central nervous system caused by traumatic injury or neurological disorders can lead to permanent loss of voluntary motor function and muscle paralysis. Here, we describe an approach that circumvents central motor circuit pathology to restore specific skeletal muscle function. We generated murine embryonic stem cell-derived motor neurons that express the light-sensitive ion channel channelrhodopsin-2, which we then engrafted into partially denervated branches of the sciatic nerve of adult mice. These engrafted motor neurons not only reinnervated lower hind-limb muscles but also enabled their function to be restored in a controllable manner using optogenetic stimulation. This synthesis of regenerative medicine and optogenetics may be a successful strategy to restore muscle function after traumatic injury or disease.

  4. Maturation of Induced Pluripotent Stem Cell Derived Hepatocytes by 3D-Culture

    PubMed Central

    Gieseck III, Richard L.; Hannan, Nicholas R. F.; Bort, Roque; Hanley, Neil A.; Drake, Rosemary A. L.; Cameron, Grant W. W.; Wynn, Thomas A.; Vallier, Ludovic

    2014-01-01

    Induced pluripotent stem cell derived hepatocytes (IPSC-Heps) have the potential to reduce the demand for a dwindling number of primary cells used in applications ranging from therapeutic cell infusions to in vitro toxicology studies. However, current differentiation protocols and culture methods produce cells with reduced functionality and fetal-like properties compared to adult hepatocytes. We report a culture method for the maturation of IPSC-Heps using 3-Dimensional (3D) collagen matrices compatible with high throughput screening. This culture method significantly increases functional maturation of IPSC-Heps towards an adult phenotype when compared to conventional 2D systems. Additionally, this approach spontaneously results in the presence of polarized structures necessary for drug metabolism and improves functional longevity to over 75 days. Overall, this research reveals a method to shift the phenotype of existing IPSC-Heps towards primary adult hepatocytes allowing such cells to be a more relevant replacement for the current primary standard. PMID:24466060

  5. Replication of Human Noroviruses in Stem Cell-Derived Human Enteroids

    PubMed Central

    Ettayebi, Khalil; Crawford, Sue E.; Murakami, Kosuke; Broughman, James R.; Karandikar, Umesh; Tenge, Victoria R.; Neill, Frederick H.; Blutt, Sarah E.; Zeng, Xi-Lei; Qu, Lin; Kou, Baijun; Opekun, Antone R.; Burrin, Douglas; Graham, David Y.; Ramani, Sasirekha; Atmar, Robert L.

    2016-01-01

    The major barrier to research and development of effective interventions for human noroviruses (HuNoVs) has been the lack of a robust and reproducible in vitro cultivation system. HuNoVs are the leading cause of gastroenteritis worldwide. We report successful cultivation of multiple HuNoV strains in enterocytes in stem cell-derived, nontransformed human intestinal enteroid monolayer cultures. Bile, a critical factor of the intestinal milieu, is required for strain-dependent HuNoV replication. Lack of appropriate histoblood group antigen expression in intestinal cells restricts virus replication, and infectivity is abrogated by inactivation (e.g., irradiation, heating) and serum neutralization. This culture system recapitulates the human intestinal epithelium, permits human host-pathogen studies of previously noncultivatable pathogens, and allows the assessment of methods to prevent and treat HuNoV infections. PMID:27562956

  6. Application potential of mesenchymal stem cells derived from Wharton's jelly in liver tissue engineering.

    PubMed

    Zhang, Lei; Zhao, Yong-Hen; Guan, Zheng; Ye, Jun-Song; de Isla, Natalia; Stoltz, Jean-François

    2015-01-01

    The shortage of organ resource has been limiting the application of liver transplantation. Bioartificial liver construction is increasingly focused as a replacement treatment. To product a bioartificial liver, three elements must be considered: seeding cells, scaffold and bioreactor. Recent studies have shown that several methods can successfully differentiate MSC (mesenchymal stem cells) derived from Wharton's jelly into hepatocyte, such as stimulating MSC by cytokines and growth factors, direct and indirect co-culture MSC with hepatocytes, or promote MSC differentiation by 3-dimensional matrix. In some cases, differentiation of MSC into hepatocytes can also be an alternative approach for whole organ transplantation in treatment of acute and chronic liver diseases. In this review, the characterization of MSC from Wharton's jelly, their potential of application in liver tissue engineering on base of decellularized scaffold, their status of banking and their preclinical work performed will be discussed.

  7. Engineering adolescence: maturation of human pluripotent stem cell-derived cardiomyocytes.

    PubMed

    Yang, Xiulan; Pabon, Lil; Murry, Charles E

    2014-01-31

    The discovery of human pluripotent stem cells (hPSCs), including both human embryonic stem cells and human-induced pluripotent stem cells, has opened up novel paths for a wide range of scientific studies. The capability to direct the differentiation of hPSCs into functional cardiomyocytes has provided a platform for regenerative medicine, development, tissue engineering, disease modeling, and drug toxicity testing. Despite exciting progress, achieving the optimal benefits has been hampered by the immature nature of these cardiomyocytes. Cardiac maturation has long been studied in vivo using animal models; however, finding ways to mature hPSC cardiomyocytes is only in its initial stages. In this review, we discuss progress in promoting the maturation of the hPSC cardiomyocytes, in the context of our current knowledge of developmental cardiac maturation and in relation to in vitro model systems such as rodent ventricular myocytes. Promising approaches that have begun to be examined in hPSC cardiomyocytes include long-term culturing, 3-dimensional tissue engineering, mechanical loading, electric stimulation, modulation of substrate stiffness, and treatment with neurohormonal factors. Future studies will benefit from the combinatorial use of different approaches that more closely mimic nature's diverse cues, which may result in broader changes in structure, function, and therapeutic applicability.

  8. Human pluripotent stem cell-derived limbal epithelial stem cells on bioengineered matrices for corneal reconstruction.

    PubMed

    Mikhailova, Alexandra; Ilmarinen, Tanja; Ratnayake, Anjula; Petrovski, Goran; Uusitalo, Hannu; Skottman, Heli; Rafat, Mehrdad

    2016-05-01

    Corneal epithelium is renewed by limbal epithelial stem cells (LESCs), a type of tissue-specific stem cells located in the limbal palisades of Vogt at the corneo-scleral junction. Acute trauma or inflammatory disorders of the ocular surface can destroy these stem cells, leading to limbal stem cell deficiency (LSCD) - a painful and vision-threatening condition. Treating these disorders is often challenging and complex, especially in bilateral cases with extensive damage. Human pluripotent stem cells (hPSCs) provide new opportunities for corneal reconstruction using cell-based therapy. Here, we investigated the use of hPSC-derived LESC-like cells on bioengineered collagen matrices in serum-free conditions, aiming for clinical applications to reconstruct the corneal epithelium and partially replace the damaged stroma. Differentiation of hPSCs towards LESC-like cells was directed using small-molecule induction followed by maturation in corneal epithelium culture medium. After four to five weeks of culture, differentiated cells were seeded onto bioengineered matrices fabricated as transparent membranes of uniform thickness, using medical-grade porcine collagen type I and a hybrid cross-linking technology. The bioengineered matrices were fully transparent, with high water content and swelling capacity, and parallel lamellar microstructure. Cell proliferation of hPSC-LESCs was significantly higher on bioengineered matrices than on collagen-coated control wells after two weeks of culture, and LESC markers p63 and cytokeratin 15, along with proliferation marker Ki67 were expressed even after 30 days in culture. Overall, hPSC-LESCs retained their capacity to self-renew and proliferate, but were also able to terminally differentiate upon stimulation, as suggested by protein expression of cytokeratins 3 and 12. We propose the use of bioengineered collagen matrices as carriers for the clinically-relevant hPSC-derived LESC-like cells, as a novel tissue engineering approach for

  9. Electric impedance of human embryonic stem cell-derived retinal pigment epithelium.

    PubMed

    Onnela, Niina; Savolainen, Virpi; Juuti-Uusitalo, Kati; Vaajasaari, Hanna; Skottman, Heli; Hyttinen, Jari

    2012-02-01

    The barrier properties of epithelium are conventionally defined by transepithelial resistance (TER). TER provides information about the tightness of the epithelium. Electrical impedance spectroscopy (EIS) provides additional information regarding cell membrane properties, such as changes in electric capacitance and possible parallel or serial pathways that may correlate with the morphology of the cell layer. This study presents EIS of retinal pigment epithelial (RPE) cell model of the putative RPE differentiated from human embryonic stem cells (hESC-RPE). The generally utilized RPE cell model, ARPE-19, was used as immature control. The measured EIS was analyzed by fitting an equivalent electrical circuit model describing the resistive and capacitive properties of the RPE. Our results indicated that TER of hESC-RPE cells was close to the values of human RPE presented in the literature. This provides evidence that the stem cell-derived RPE in vitro can reach high-barrier function. Furthermore, hESC-RPE cells produced impedance spectra that can be modeled by the equivalent circuit of one time constant. ARPE-19 cells produced low-barrier properties, that is, an impedance spectra that suggested poor maturation of ARPE-19 cells. To conclude, EIS could give us means for non-invasively estimating the functionality and maturation of differentiated-RPE cells.

  10. Human Embryonic Stem Cell-Derived Cardiomyocytes Regenerate Non-Human Primate Hearts

    PubMed Central

    Chong, James J.H.; Yang, Xiulan; Don, Creighton W.; Minami, Elina; Liu, Yen-Wen; Weyers, Jill J; Mahoney, William M.; Van Biber, Benjamin; Cook, Savannah M.; Palpant, Nathan J; Gantz, Jay; Fugate, James A.; Muskheli, Veronica; Gough, G. Michael; Vogel, Keith W.; Astley, Cliff A.; Hotchkiss, Charlotte E.; Baldessari, Audrey; Pabon, Lil; Reinecke, Hans; Gill, Edward A.; Nelson, Veronica; Kiem, Hans-Peter; Laflamme, Michael A.; Murry, Charles E.

    2014-01-01

    Pluripotent stem cells provide a potential solution to current epidemic rates of heart failure 1 by providing human cardiomyocytes to support heart regeneration 2. Studies of human embryonic stem cell-derived cardiomyocytes (hESC-CMs) in small animal models have shown favorable effects of this treatment 3–7. It remains unknown, however, whether clinical scale hESC-CMs transplantation is feasible, safe or can provide large-scale myocardial regeneration. Here we show that hESC-CMs can be produced at a clinical scale (>1 billion cells/batch) and cryopreserved with good viability. Using a non-human primate (NHP) model of myocardial ischemia-reperfusion, we show that that cryopreservation and intra-myocardial delivery of 1 billion hESC-CMs generates significant remuscularization of the infarcted heart. The hESC-CMs showed progressive but incomplete maturation over a three-month period. Grafts were perfused by host vasculature, and electromechanical junctions between graft and host myocytes were present within 2 weeks of engraftment. Importantly, grafts showed regular calcium transients that were synchronized to the host electrocardiogram, indicating electromechanical coupling. In contrast to small animal models 7, non-fatal ventricular arrhythmias were observed in hESC-CM engrafted primates. Thus, hESC-CMs can remuscularize substantial amounts of the infarcted monkey heart. Comparable remuscularization of a human heart should be possible, but potential arrhythmic complications need to be overcome. PMID:24776797

  11. Long Term Liver Engraftment of Functional Hepatocytes Obtained from Germline Cell-Derived Pluripotent Stem Cells

    PubMed Central

    Fagoonee, Sharmila; Famulari, Elvira Smeralda; Silengo, Lorenzo; Tolosano, Emanuela; Altruda, Fiorella

    2015-01-01

    One of the major hurdles in liver gene and cell therapy is availability of ex vivo-expanded hepatocytes. Pluripotent stem cells are an attractive alternative. Here, we show that hepatocyte precursors can be isolated from male germline cell-derived pluripotent stem cells (GPSCs) using the hepatoblast marker, Liv2, and induced to differentiate into hepatocytes in vitro. These cells expressed hepatic-specific genes and were functional as demonstrated by their ability to secrete albumin and produce urea. When transplanted in the liver parenchyma of partially hepatectomised mice, Liv2-sorted cells showed regional and heterogeneous engraftment in the injected lobe. Moreover, approximately 50% of Y chromosome-positive, GPSC-derived cells were found in the female livers, in the region of engraftment, even one month after cell injection. This is the first study showing that Liv2-sorted GPSCs-derived hepatocytes can undergo long lasting engraftment in the mouse liver. Thus, GPSCs might offer promise for regenerative medicine. PMID:26323094

  12. Mitochondrial gene replacement in human pluripotent stem cell-derived neural progenitors.

    PubMed

    Iyer, S; Xiao, E; Alsayegh, K; Eroshenko, N; Riggs, M J; Bennett, J P; Rao, R R

    2012-05-01

    Human pluripotent stem cell-derived neural progenitor (hNP) cells are an excellent resource for understanding early neural development and neurodegenerative disorders. Given that many neurodegenerative disorders can be correlated with defects in the mitochondrial genome, optimal utilization of hNP cells requires an ability to manipulate and monitor changes in the mitochondria. Here, we describe a novel approach that uses recombinant human mitochondrial transcription factor A (rhTFAM) protein to transfect and express a pathogenic mitochondrial genome (mtDNA) carrying the G11778A mutation associated with Leber's hereditary optic neuropathy (LHON) disease, into dideoxycytidine (ddC)-treated hNPs. Treatment with ddC reduced endogenous mtDNA and gene expression, without loss of hNP phenotypic markers. Entry of G11778A mtDNA complexed with the rhTFAM was observed in mitochondria of ddC-hNPs. Expression of the pathogenic RNA was confirmed by restriction enzyme analysis of the SfaN1-digested cDNA. On the basis of the expression of neuron-specific class III beta-tubulin, neuronal differentiation occurred. Our results show for the first time that pathogenic mtDNA can be introduced and expressed into hNPs without loss of phenotype or neuronal differentiation potential. This mitochondrial gene replacement technology allows for creation of in vitro stem cell-based models useful for understanding neuronal development and treatment of neurodegenerative disorders.

  13. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts.

    PubMed

    Chong, James J H; Yang, Xiulan; Don, Creighton W; Minami, Elina; Liu, Yen-Wen; Weyers, Jill J; Mahoney, William M; Van Biber, Benjamin; Cook, Savannah M; Palpant, Nathan J; Gantz, Jay A; Fugate, James A; Muskheli, Veronica; Gough, G Michael; Vogel, Keith W; Astley, Cliff A; Hotchkiss, Charlotte E; Baldessari, Audrey; Pabon, Lil; Reinecke, Hans; Gill, Edward A; Nelson, Veronica; Kiem, Hans-Peter; Laflamme, Michael A; Murry, Charles E

    2014-06-12

    Pluripotent stem cells provide a potential solution to current epidemic rates of heart failure by providing human cardiomyocytes to support heart regeneration. Studies of human embryonic-stem-cell-derived cardiomyocytes (hESC-CMs) in small-animal models have shown favourable effects of this treatment. However, it remains unknown whether clinical-scale hESC-CM transplantation is feasible, safe or can provide sufficient myocardial regeneration. Here we show that hESC-CMs can be produced at a clinical scale (more than one billion cells per batch) and cryopreserved with good viability. Using a non-human primate model of myocardial ischaemia followed by reperfusion, we show that cryopreservation and intra-myocardial delivery of one billion hESC-CMs generates extensive remuscularization of the infarcted heart. The hESC-CMs showed progressive but incomplete maturation over a 3-month period. Grafts were perfused by host vasculature, and electromechanical junctions between graft and host myocytes were present within 2 weeks of engraftment. Importantly, grafts showed regular calcium transients that were synchronized to the host electrocardiogram, indicating electromechanical coupling. In contrast to small-animal models, non-fatal ventricular arrhythmias were observed in hESC-CM-engrafted primates. Thus, hESC-CMs can remuscularize substantial amounts of the infarcted monkey heart. Comparable remuscularization of a human heart should be possible, but potential arrhythmic complications need to be overcome.

  14. Engineered Microenvironments for the Maturation and Observation of Human Embryonic Stem Cell Derived Cardiomyocytes

    NASA Astrophysics Data System (ADS)

    Salick, Max R.

    The human heart is a dynamic system that undergoes substantial changes as it develops and adapts to the body's growing needs. To better understand the physiology of the heart, researchers have begun to produce immature heart muscle cells, or cardiomyocytes, from pluripotent stem cell sources with remarkable efficiency. These stem cell-derived cardiomyocytes hold great potential in the understanding and treatment of heart disease; however, even after prolonged culture, these cells continue to exhibit an immature phenotype, as indicated by poor sarcomere organization and calcium handling, among other features. The lack of maturation that is observed in these cardiomyocytes greatly limits their applicability towards drug screening, disease modeling, and cell therapy applications. The mechanical environment surrounding a cell has been repeatedly shown to have a large impact on that cell's behavior. For this reason, we have implemented micropatterning methods to mimic the level of alignment that occurs in the heart in vivo in order to study how this alignment may help the cells to produce a more mature sarcomere phenotype. It was discovered that the level of sarcomere organization of a cardiomyocyte can be strongly influenced by the micropattern lane geometry on which it adheres. Steps were taken to optimize this micropattern platform, and studies of protein organization, gene expression, and myofibrillogenesis were conducted. Additionally, a set of programs was developed to provide quantitative analysis of the level of sarcomere organization, as well as to assist with several other tissue engineering applications.

  15. Engraftment of embryonic stem cell-derived myogenic progenitors in a dominant model of muscular dystrophy.

    PubMed

    Darabi, Radbod; Baik, June; Clee, Mark; Kyba, Michael; Tupler, Rossella; Perlingeiro, Rita C R

    2009-11-01

    Muscular dystrophies (MDs) consist of a genetically heterogeneous group of disorders, recessive or dominant, characterized by progressive skeletal muscle weakening. To date, no effective treatment is available. Experimental strategies pursuing muscle regeneration through the transplantation of stem cell preparations have brought hope to patients affected by this disorder. Efficacy has been demonstrated in recessive MD models through contribution of wild-type nuclei to the muscle fiber heterokaryon; however, to date, there has been no study investigating the efficacy of a cell therapy in a dominant model of MD. We have recently demonstrated that Pax3-induced embryonic stem (ES) cell-derived myogenic progenitors are able to engraft and improve muscle function in mdx mice, a recessive mouse model for Duchenne MD. To assess whether this therapeutic effect can be extended to a dominant type of muscle disorder, here we transplanted these cells into FRG1 transgenic mice, a dominant model that has been associated with facioscapulohumeral muscular dystrophy. Our results show that Pax3-induced ES-derived myogenic progenitors are capable of significant engraftment after intramuscular or systemic transplantation into Frg1 mice. Analyses of contractile parameters revealed functional improvement in treated muscles of male mice, but not females, which are less severely affected. This study is the first to use Frg1 transgenic mice to assess muscle regeneration as well as to support the use of a cell-based therapy for autosomal dominant types of MD.

  16. Engraftment of embryonic stem cell-derived myogenic progenitors in a dominant model of muscular dystrophy

    PubMed Central

    Darabi, Radbod; Baik, June; Clee, Mark; Kyba, Michael; Tupler, Rossella; Perlingeiro, Rita C.R.

    2009-01-01

    Muscular dystrophies (MD) consist of a genetically heterogeneous group of disorders, recessive or dominant, characterized by progressive skeletal muscle weakening. To date, no effective treatment is available. Experimental strategies pursuing muscle regeneration through the transplantation of stem cell preparations have brought hope to patients affected by this disorder. Efficacy has been demonstrated in recessive MD models through contribution of wild-type nuclei to the muscle fiber heterokaryon, however to date, there has been no study investigating the efficacy of a cell therapy in a dominant model of MD. We have recently demonstrated that Pax3-induced embryonic stem (ES) cell- derived myogenic progenitors are able to engraft and improve muscle function in mdx mice, a recessive mouse model for Duchenne MD. To assess whether this therapeutic effect can be extended to a dominant type of muscle disorder, here we transplanted these cells into FRG1 transgenic mice, a dominant model that has been associated with Facioscapulohumeral muscular dystrophy. Our results show that Pax3-induced ES-derived myogenic progenitors are capable of significant engraftment after intramuscular or systemic transplantation into Frg1 mice. Analyses of contractile parameters revealed functional improvement in treated muscles of male mice, but not females, which are less severely affected. This study is the first to use Frg1 transgenic mice to assess muscle regeneration as well as to support the use of a cell-based therapy for autosomal dominant types of MD. PMID:19682990

  17. Human embryonic stem cell-derived neuronal cells form spontaneously active neuronal networks in vitro.

    PubMed

    Heikkilä, Teemu J; Ylä-Outinen, Laura; Tanskanen, Jarno M A; Lappalainen, Riikka S; Skottman, Heli; Suuronen, Riitta; Mikkonen, Jarno E; Hyttinen, Jari A K; Narkilahti, Susanna

    2009-07-01

    The production of functional human embryonic stem cell (hESC)-derived neuronal cells is critical for the application of hESCs in treating neurodegenerative disorders. To study the potential functionality of hESC-derived neurons, we cultured and monitored the development of hESC-derived neuronal networks on microelectrode arrays. Immunocytochemical studies revealed that these networks were positive for the neuronal marker proteins beta-tubulin(III) and microtubule-associated protein 2 (MAP-2). The hESC-derived neuronal networks were spontaneously active and exhibited a multitude of electrical impulse firing patterns. Synchronous bursts of electrical activity similar to those reported for hippocampal neurons and rodent embryonic stem cell-derived neuronal networks were recorded from the differentiated cultures until up to 4 months. The dependence of the observed neuronal network activity on sodium ion channels was examined using tetrodotoxin (TTX). Antagonists for the glutamate receptors NMDA [D(-)-2-amino-5-phosphonopentanoic acid] and AMPA/kainate [6-cyano-7-nitroquinoxaline-2,3-dione], and for GABAA receptors [(-)-bicuculline methiodide] modulated the spontaneous electrical activity, indicating that pharmacologically susceptible neuronal networks with functional synapses had been generated. The findings indicate that hESC-derived neuronal cells can generate spontaneously active networks with synchronous communication in vitro, and are therefore suitable for use in developmental and drug screening studies, as well as for regenerative medicine.

  18. Cardiac regeneration using pluripotent stem cells--progression to large animal models.

    PubMed

    Chong, James J H; Murry, Charles E

    2014-11-01

    Pluripotent stem cells (PSCs) have indisputable cardiomyogenic potential and therefore have been intensively investigated as a potential cardiac regenerative therapy. Current directed differentiation protocols are able to produce high yields of cardiomyocytes from PSCs and studies in small animal models of cardiovascular disease have proven sustained engraftment and functional efficacy. Therefore, the time is ripe for cardiac regenerative therapies using PSC derivatives to be tested in large animal models that more closely resemble the hearts of humans. In this review, we discuss the results of our recent study using human embryonic stem cell derived cardiomyocytes (hESC-CM) in a non-human primate model of ischemic cardiac injury. Large scale remuscularization, electromechanical coupling and short-term arrhythmias demonstrated by our hESC-CM grafts are discussed in the context of other studies using adult stem cells for cardiac regeneration.

  19. Guided migration of neural stem cells derived from human embryonic stem cells by an electric field.

    PubMed

    Feng, Jun-Feng; Liu, Jing; Zhang, Xiu-Zhen; Zhang, Lei; Jiang, Ji-Yao; Nolta, Jan; Zhao, Min

    2012-02-01

    Small direct current (DC) electric fields (EFs) guide neurite growth and migration of rodent neural stem cells (NSCs). However, this could be species dependent. Therefore, it is critical to investigate how human NSCs (hNSCs) respond to EF before any possible clinical attempt. Aiming to characterize the EF-stimulated and guided migration of hNSCs, we derived hNSCs from a well-established human embryonic stem cell line H9. Small applied DC EFs, as low as 16 mV/mm, induced significant directional migration toward the cathode. Reversal of the field polarity reversed migration of hNSCs. The galvanotactic/electrotactic response was both time and voltage dependent. The migration directedness and distance to the cathode increased with the increase of field strength. (Rho-kinase) inhibitor Y27632 is used to enhance viability of stem cells and has previously been reported to inhibit EF-guided directional migration in induced pluripotent stem cells and neurons. However, its presence did not significantly affect the directionality of hNSC migration in an EF. Cytokine receptor [C-X-C chemokine receptor type 4 (CXCR4)] is important for chemotaxis of NSCs in the brain. The blockage of CXCR4 did not affect the electrotaxis of hNSCs. We conclude that hNSCs respond to a small EF by directional migration. Applied EFs could potentially be further exploited to guide hNSCs to injured sites in the central nervous system to improve the outcome of various diseases.

  20. Towards Personalized Regenerative Cell Therapy: Mesenchymal Stem Cells Derived from Human Induced Pluripotent Stem Cells.

    PubMed

    Lin, Lin; Bolund, Lars; Luo, Yonglun

    2016-01-01

    Mesenchymal stem cells (MSCs) are adult stem cells with the capacity of self-renewal and multilineage differentiation, and can be isolated from several adult tissues. However, isolating MSCs from adult tissues for cell therapy is hampered by the invasive procedure, the rarity of the cells and their attenuated proliferation capacity when cultivated and expanded in vitro. Human MSCs derived from induced pluripotent stem cells (iPSC-MSCs) have now evolved as a promising alternative cell source for MSCs and regenerative medicine. Several groups, including ours, have reported successful derivation of functional iPSC-MSCs and applied these cells in MSC-based therapeutic testing. Still, the current experience and understanding of iPSC-MSCs with respect to production methods, safety and efficacy are primitive. In this review, we highlight the methodological progress in iPSC-MSC research, describing the importance of choosing the right sources of iPSCs, iPSC reprogramming methods, iPSC culture systems, embryoid body intermediates, pathway inhibitors, basal medium, serum, growth factors and culture surface coating. We also highlight some progress in the application of iPSC-MSCs in direct cell therapy, tissue engineering and gene therapy.

  1. Resolving the "egg supply problem" in human embryonic stem cell derivation through technical means--a legal and ethical analysis.

    PubMed

    Hammond, Natasha; Holm, Søren

    2008-03-01

    This paper seeks to briefly discuss the legal and ethical problems connected to scientific developments in the field of human embryonic stem cell derivation aimed at solving the "egg supply problem" in stem cell research. The legal situation is discussed in respect of the UK's current regulatory regime, proposed reform and the Oviedo Convention. The scientific developments which are examined are chimeric embryos, in vitro maturation of oocytes, derivation of stem cell lines in connection with pre-implantation genetic diagnosis and the derivation of oocytes from existing stem cell lines.

  2. G-protein Coupled Receptor Signaling in Pluripotent Stem Cell-derived Cardiovascular Cells: Implications for Disease Modeling

    PubMed Central

    Dolatshad, Nazanin F.; Hellen, Nicola; Jabbour, Richard J.; Harding, Sian E.; Földes, Gabor

    2015-01-01

    Human pluripotent stem cell derivatives show promise as an in vitro platform to study a range of human cardiovascular diseases. A better understanding of the biology of stem cells and their cardiovascular derivatives will help to understand the strengths and limitations of this new model system. G-protein coupled receptors (GPCRs) are key regulators of stem cell maintenance and differentiation and have an important role in cardiovascular cell signaling. In this review, we will therefore describe the state of knowledge concerning the regulatory role of GPCRs in both the generation and function of pluripotent stem cell derived-cardiomyocytes, -endothelial, and -vascular smooth muscle cells. We will consider how far the in vitro disease models recapitulate authentic GPCR signaling and provide a useful basis for discovery of disease mechanisms or design of therapeutic strategies. PMID:26697426

  3. Transplantation of Embryonic and Induced Pluripotent Stem Cell-Derived 3D Retinal Sheets into Retinal Degenerative Mice

    PubMed Central

    Assawachananont, Juthaporn; Mandai, Michiko; Okamoto, Satoshi; Yamada, Chikako; Eiraku, Mototsugu; Yonemura, Shigenobu; Sasai, Yoshiki; Takahashi, Masayo

    2014-01-01

    Summary In this article, we show that mouse embryonic stem cell- or induced pluripotent stem cell-derived 3D retinal tissue developed a structured outer nuclear layer (ONL) with complete inner and outer segments even in an advanced retinal degeneration model (rd1) that lacked ONL. We also observed host-graft synaptic connections by immunohistochemistry. This study provides a “proof of concept” for retinal sheet transplantation therapy for advanced retinal degenerative diseases. PMID:24936453

  4. Functional Evaluation of Biological Neurotoxins in Networked Cultures of Stem Cell-derived Central Nervous System Neurons

    DTIC Science & Technology

    2015-02-05

    derived 5a. CONTRACT NUMBER central nervous system neurons 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Hubbard, K, Beske, PH...numbers CBM.THRTOX.01.10.RC.023 and CBM.THRTOX.01.RC.014). 14. ABSTRACT See reprint. 15. SUBJECT TERMS embryonic stem cells, stem cell-derived neurons ...botulinum neurotoxin detection, electrophysiology, synapse, neuronal networks, glutamatergic synapse, GABAergic synapse 16. SECURITY CLASSIFICATION

  5. Insulin - producing cells derived from stem cells: recent progress and future directions

    PubMed Central

    Santana, A; Enseñat - Waser, R; Arribas, Maria Isabel; Reig, J A; Roche, E

    2006-01-01

    Type 1 diabetes is characterized by the selective destruction of pancreatic β-cells caused by an autoimmune attack. Type 2 diabetes is a more complex pathology which, in addition to β-cell loss caused by apoptotic programs, includes β-cell dedifferentiation and peripheric insulin resistance. β-Cells are responsible for insulin production, storage and secretion in accordance to the demanding concentrations of glucose and fatty acids. The absence of insulin results in death and therefore diabetic patients require daily injections of the hormone for survival. However, they cannot avoid the appearance of secondary complications affecting the peripheral nerves as well as the eyes, kidneys and cardiovascular system. These afflictions are caused by the fact that external insulin injection does not mimic the tight control that pancreaticderived insulin secretion exerts on the body’s glycemia. Restoration of damaged β-cells by transplantation from exogenous sources or by endocrine pancreas regeneration would be ideal therapeutic options. In this context, stem cells of both embryonic and adult origin (including β-cell/islet progenitors) offer some interesting alternatives, taking into account the recent data indicating that these cells could be the building blocks from which insulin secreting cells could be generated in vitro under appropriate culture conditions. Although in many cases insulin-producing cells derived from stem cells have been shown to reverse experimentally induced diabetes in animal models, several concerns need to be solved before finding a definite medical application. These refer mainly to the obtainment of a cell population as similar as possible to pancreatic β-cells, and to the problems related with the immune compatibility and tumor formation. This review will summarize the different approaches that have been used to obtain insulin-producing cells from embryonic and adult stem cells, and the main problems that hamper the clinical

  6. Fetal stromal niches enhance human embryonic stem cell-derived hematopoietic differentiation and globin switch.

    PubMed

    Lee, King Yiu; Fong, Benny Shu Pan; Tsang, Kam Sze; Lau, Tze Kin; Ng, Pak Cheung; Lam, Audrey Carmen; Chan, Kathy Yuen Yee; Wang, Chi Chiu; Kung, Hsiang Fu; Li, Chi Kong; Li, Karen

    2011-01-01

    Hematopoiesis during mammalian embryonic development has been perceived as a migratory phenomenon, from the yolk sac blood island to the aorta-gonad-mesonephros (AGM) region, fetal liver (FL), and subsequently, the fetal bone marrow. In this study, we investigated the effects of primary stromal cells from fetal hematopoietic niches and their conditioned media (CM), applied singly or in sequential orders, on induction of human embryonic stem cells, H1, H9, and H14 lines, to hematopoietic cells. Our results demonstrated that stromal support of FL, AGM + FL, and AGM + FL + fetal bone marrow significantly increased the proliferation of embryoid bodies (EB) at day 18 of hematopoietic induction in the presence of thrombopoietin, stem cell factor, and Flt-3 ligand. AGM + FL also increased hematopoietic colony-forming unit (CFU) formation. CM did not enhance EB proliferation but CM of FL and AGM + FL significantly increased the density of total CFU and early erythroid (burst-forming unit) progenitors. Increased commitment to the hematopoietic lineage was demonstrated by enhanced expressions of CD45, alpha-, beta-, and gamma-globins in CFU at day 32, compared with EB at day 18. CM of FL significantly increased these globin expressions, indicating enhanced switches from embryonic to fetal and adult erythropoiesis. Over 50% and 10% of cells derived from CFU expressed CD45 and beta-globin proteins, respectively. Expressions of hematopoietic regulatory genes (Bmi-1, β-Catenin, Hox B4, GATA-1) were increased in EB or CFU cultures supported by FL or sequential CM. Our study has provided a strategy for derivation of hematopoietic cells from embryonic stem cells under the influence of primary hematopoietic niches and CM, particularly the FL.

  7. Induced pluripotent stem cell-derived neuron as a human model for testing environmentally induced developmental neurotoxicity

    EPA Science Inventory

    Induced pluripotent stem cell-derived neurons as a human model for testing environmentally induced developmental neurotoxicity Ingrid L. Druwe1, Timothy J. Shafer2, Kathleen Wallace2, Pablo Valdivia3 ,and William R. Mundy2. 1University of North Carolina, Curriculum in Toxicology...

  8. Species-dependent differences of embryonic stem cell-derived neural stem cells after Interferon gamma treatment

    PubMed Central

    Walter, Janine; Dihné, Marcel

    2012-01-01

    Pluripotent stem cell (pSC)-derived, neural stem cells (NSCs) are actually extensively explored in the field of neuroregeneration and to clarify disease mechanisms or model neurological diseases in vitro. Regarding the latter, proliferation and differentiation of pSC-derived NSCs are investigated under the influence of a variety of different substances among them key players of inflammation. However, results generated on a murine genetic background are not always representative for the human situation which increasingly leads to the application of human cell culture systems derived from human pSCs. We investigated here, if the recently described interferon gamma (IFNγ)-induced dysregulated neural phenotype characterized by simultaneous expression of glial and neuronal markers on murine NSCs (Walter et al., 2011, 2012) can also be found on a human genetic background. For this purpose, we performed experiments with human embryonic stem cell-derived NSCs. We could show that the IFNγ-induced dysregulated neural phenotype cannot be induced in human NSCs. This difference occurs, although typical genes like signal transducers and activators of transcription 1 (Stat 1) or interferon regulatory factor 9 (IRF-9) are similarly regulated by IFNγ in both, murine and human populations. These results illustrate that fundamental differences between murine and human neural populations exist in vitro, independent of anatomical system-related properties. PMID:23162429

  9. Evaluation of Stem Cell-Derived Red Blood Cells as a Transfusion Product Using a Novel Animal Model.

    PubMed

    Shah, Sandeep N; Gelderman, Monique P; Lewis, Emily M A; Farrel, John; Wood, Francine; Strader, Michael Brad; Alayash, Abdu I; Vostal, Jaroslav G

    2016-01-01

    Reliance on volunteer blood donors can lead to transfusion product shortages, and current liquid storage of red blood cells (RBCs) is associated with biochemical changes over time, known as 'the storage lesion'. Thus, there is a need for alternative sources of transfusable RBCs to supplement conventional blood donations. Extracorporeal production of stem cell-derived RBCs (stemRBCs) is a potential and yet untapped source of fresh, transfusable RBCs. A number of groups have attempted RBC differentiation from CD34+ cells. However, it is still unclear whether these stemRBCs could eventually be effective substitutes for traditional RBCs due to potential differences in oxygen carrying capacity, viability, deformability, and other critical parameters. We have generated ex vivo stemRBCs from primary human cord blood CD34+ cells and compared them to donor-derived RBCs based on a number of in vitro parameters. In vivo, we assessed stemRBC circulation kinetics in an animal model of transfusion and oxygen delivery in a mouse model of exercise performance. Our novel, chronically anemic, SCID mouse model can evaluate the potential of stemRBCs to deliver oxygen to tissues (muscle) under resting and exercise-induced hypoxic conditions. Based on our data, stem cell-derived RBCs have a similar biochemical profile compared to donor-derived RBCs. While certain key differences remain between donor-derived RBCs and stemRBCs, the ability of stemRBCs to deliver oxygen in a living organism provides support for further development as a transfusion product.

  10. Spatiotemporal recapitulation of central nervous system development by murine embryonic stem cell-derived neural stem/progenitor cells.

    PubMed

    Okada, Yohei; Matsumoto, Arifumi; Shimazaki, Takuya; Enoki, Ryosuke; Koizumi, Amane; Ishii, Seiji; Itoyama, Yasuto; Sobue, Gen; Okano, Hideyuki

    2008-12-01

    Neural stem/progenitor cells (NS/PCs) can generate a wide variety of neural cells. However, their fates are generally restricted, depending on the time and location of NS/PC origin. Here we demonstrate that we can recapitulate the spatiotemporal regulation of central nervous system (CNS) development in vitro by using a neurosphere-based culture system of embryonic stem (ES) cell-derived NS/PCs. This ES cell-derived neurosphere system enables the efficient derivation of highly neurogenic fibroblast growth factor-responsive NS/PCs with early temporal identities and high cell-fate plasticity. Over repeated passages, these NS/PCs exhibit temporal progression, becoming epidermal growth factor-responsive gliogenic NS/PCs with late temporal identities; this change is accompanied by an alteration in the epigenetic status of the glial fibrillary acidic protein promoter, similar to that observed in the developing brain. Moreover, the rostrocaudal and dorsoventral spatial identities of the NS/PCs can be successfully regulated by sequential administration of several morphogens. These NS/PCs can differentiate into early-born projection neurons, including cholinergic, catecholaminergic, serotonergic, and motor neurons, that exhibit action potentials in vitro. Finally, these NS/PCs differentiate into neurons that form synaptic contacts with host neurons after their transplantation into wild-type and disease model animals. Thus, this culture system can be used to obtain specific neurons from ES cells, is a simple and powerful tool for investigating the underlying mechanisms of CNS development, and is applicable to regenerative treatment for neurological disorders.

  11. Stem cell sources for cardiac regeneration.

    PubMed

    Roccio, M; Goumans, M J; Sluijter, J P G; Doevendans, P A

    2008-03-01

    Cell-based cardiac repair has the ambitious aim to replace the malfunctioning cardiac muscle developed after myocardial infarction, with new contractile cardiomyocytes and vessels. Different stem cell populations have been intensively studied in the last decade as a potential source of new cardiomyocytes to ameliorate the injured myocardium, compensate for the loss of ventricular mass and contractility and eventually restore cardiac function. An array of cell types has been explored in this respect, including skeletal muscle, bone marrow derived stem cells, embryonic stem cells (ESC) and more recently cardiac progenitor cells. The best-studied cell types are mouse and human ESC cells, which have undisputedly been demonstrated to differentiate into cardiomyocyte and vascular lineages and have been of great help to understand the differentiation process of pluripotent cells. However, due to their immunogenicity, risk of tumor development and the ethical challenge arising from their embryonic origin, they do not provide a suitable cell source for a regenerative therapy approach. A better option, overcoming ethical and allogenicity problems, seems to be provided by bone marrow derived cells and by the recently identified cardiac precursors. This report will overview current knowledge on these different cell types and their application in cardiac regeneration and address issues like implementation of delivery methods, including tissue engineering approaches that need to be developed alongside.

  12. Multipotent Stem Cells in Cardiac Regeneration

    PubMed Central

    Karra, Ravi; Wu, Sean M.

    2008-01-01

    Summary The potential for stem cells to ameliorate or cure heart diseases has galvanized a cadre of cardiovascular translational and clinical scientists to take a “first-in-man” approach using autologous stem cells from a variety of tissues. However, recent clinical trial data show that when these cells are given by intracoronary infusion or direct myocardial injection, limited improvement in heart function occurs with no evidence of cardiomyogenesis. These studies illustrate the great need to understand the logic of cell-lineage commitment and the principles of cardiac differentiation. Recent identification of stem/progenitor cells of embryological origin with intrinsic competence to differentiate into multiple lineages within the heart offers new possibilities for cardiac regeneration. When combined with developments in nuclear reprogramming and provided that tumor risks and other challenges of embryonic cell transplantation can be overcome, the prospect of achieving autologous, cardiomyogenic, stem cell-based therapy may be within reach. PMID:18307403

  13. Cardiac Regeneration and Stem Cells

    PubMed Central

    Zhang, Yiqiang; Mignone, John; MacLellan, W. Robb

    2015-01-01

    After decades of believing the heart loses the ability to regenerate soon after birth, numerous studies are now reporting that the adult heart may indeed be capable of regeneration, although the magnitude of new cardiac myocyte formation varies greatly. While this debate has energized the field of cardiac regeneration and led to a dramatic increase in our understanding of cardiac growth and repair, it has left much confusion in the field as to the prospects of regenerating the heart. Studies applying modern techniques of genetic lineage tracing and carbon-14 dating have begun to establish limits on the amount of endogenous regeneration after cardiac injury, but the underlying cellular mechanisms of this regeneration remained unclear. These same studies have also revealed an astonishing capacity for cardiac repair early in life that is largely lost with adult differentiation and maturation. Regardless, this renewed focus on cardiac regeneration as a therapeutic goal holds great promise as a novel strategy to address the leading cause of death in the developed world. PMID:26269526

  14. ROCK Inhibition Extends Passage of Pluripotent Stem Cell-Derived Retinal Pigmented Epithelium.

    PubMed

    Croze, Roxanne H; Buchholz, David E; Radeke, Monte J; Thi, William J; Hu, Qirui; Coffey, Peter J; Clegg, Dennis O

    2014-09-01

    Human embryonic stem cells (hESCs) offer a potentially unlimited supply of cells for emerging cell-based therapies. Unfortunately, the process of deriving distinct cell types can be time consuming and expensive. In the developed world, age-related macular degeneration (AMD) is the leading cause of blindness in the elderly, with more than 7.2 million people afflicted in the U.S. alone. Both hESC-derived retinal pigmented epithelium (hESC-RPE) and induced pluripotent stem cell-derived RPE (iPSC-RPE) are being developed for AMD therapies by multiple groups, but their potential for expansion in culture is limited. To attempt to overcome this passage limitation, we examined the involvement of Rho-associated, coiled-coil protein kinase (ROCK) in hESC-RPE and iPSC-RPE culture. We report that inhibiting ROCK1/2 with Y-27632 allows extended passage of hESC-RPE and iPSC-RPE. Microarray analysis suggests that ROCK inhibition could be suppressing an epithelial-to-mesenchymal transition through various pathways. These include inhibition of key ligands of the transforming growth factor-β pathway (TGFB1 and GDF6) and Wnt signaling. Two important processes are affected, allowing for an increase in hESC-RPE expansion. First, ROCK inhibition promotes proliferation by inducing multiple components that are involved in cell cycle progression. Second, ROCK inhibition affects many pathways that could be converging to suppress RPE-to-mesenchymal transition. This allows hESC-RPE to remain functional for an extended but finite period in culture.

  15. Potential of laryngeal muscle regeneration using induced pluripotent stem cell-derived skeletal muscle cells.

    PubMed

    Dirja, Bayu Tirta; Yoshie, Susumu; Ikeda, Masakazu; Imaizumi, Mitsuyoshi; Nakamura, Ryosuke; Otsuki, Koshi; Nomoto, Yukio; Wada, Ikuo; Hazama, Akihiro; Omori, Koichi

    2016-01-01

    Conclusion Induced pluripotent stem (iPS) cells may be a new potential cell source for laryngeal muscle regeneration in the treatment of vocal fold atrophy after recurrent laryngeal nerve paralysis. Objectives Unilateral vocal fold paralysis can lead to degeneration, atrophy, and loss of force of the thyroarytenoid muscle. At present, there are some treatments such as thyroplasty, arytenoid adduction, and vocal fold injection. However, such treatments cannot restore reduced mass of the thyroarytenoid muscle. iPS cells have been recognized as supplying a potential resource for cell transplantation. The aim of this study was to assess the effectiveness of the use of iPS cells for the regeneration of laryngeal muscle through the evaluation of both in vitro and in vivo experiments. Methods Skeletal muscle cells were generated from tdTomato-labeled iPS cells using embryoid body formation. Differentiation into skeletal muscle cells was analyzed by gene expression and immunocytochemistry. The tdTomato-labeled iPS cell-derived skeletal muscle cells were transplanted into the left atrophied thyroarytenoid muscle. To evaluate the engraftment of these cells after transplantation, immunohistochemistry was performed. Results The tdTomato-labeled iPS cells were successfully differentiated into skeletal muscle cells through an in vitro experiment. These cells survived in the atrophied thyroarytenoid muscle after transplantation.

  16. Modeling Doxorubicin-Induced Cardiotoxicity in Human Pluripotent Stem Cell Derived-Cardiomyocytes

    PubMed Central

    Maillet, Agnes; Tan, Kim; Chai, Xiaoran; Sadananda, Singh N.; Mehta, Ashish; Ooi, Jolene; Hayden, Michael R.; Pouladi, Mahmoud A.; Ghosh, Sujoy; Shim, Winston; Brunham, Liam R.

    2016-01-01

    Doxorubicin is a highly efficacious anti-cancer drug but causes cardiotoxicity in many patients. The mechanisms of doxorubicin-induced cardiotoxicity (DIC) remain incompletely understood. We investigated the characteristics and molecular mechanisms of DIC in human pluripotent stem cell-derived cardiomyocytes (hPSC-CMs). We found that doxorubicin causes dose-dependent increases in apoptotic and necrotic cell death, reactive oxygen species production, mitochondrial dysfunction and increased intracellular calcium concentration. We characterized genome-wide changes in gene expression caused by doxorubicin using RNA-seq, as well as electrophysiological abnormalities caused by doxorubicin with multi-electrode array technology. Finally, we show that CRISPR-Cas9-mediated disruption of TOP2B, a gene implicated in DIC in mouse studies, significantly reduces the sensitivity of hPSC-CMs to doxorubicin-induced double stranded DNA breaks and cell death. These data establish a human cellular model of DIC that recapitulates many of the cardinal features of this adverse drug reaction and could enable screening for protective agents against DIC as well as assessment of genetic variants involved in doxorubicin response. PMID:27142468

  17. Induced Pluripotent Stem Cell Derived Macrophages as a Cellular System to Study Salmonella and Other Pathogens

    PubMed Central

    Hale, Christine; Yeung, Amy; Goulding, David; Pickard, Derek; Alasoo, Kaur; Powrie, Fiona; Dougan, Gordon; Mukhopadhyay, Subhankar

    2015-01-01

    A number of pathogens, including several human-restricted organisms, persist and replicate within macrophages (Mφs) as a key step in pathogenesis. The mechanisms underpinning such host-restricted intracellular adaptations are poorly understood, in part, due to a lack of appropriate model systems. Here we explore the potential of human induced pluripotent stem cell derived macrophages (iPSDMs) to study such pathogen interactions. We show iPSDMs express a panel of established Mφ-specific markers, produce cytokines, and polarise into classical and alternative activation states in response to IFN-γ and IL-4 stimulation, respectively. iPSDMs also efficiently phagocytosed inactivated bacterial particles as well as live Salmonella Typhi and S. Typhimurium and were able to kill these pathogens. We conclude that iPSDMs can support productive Salmonella infection and propose this as a flexible system to study host/pathogen interactions. Furthermore, iPSDMs can provide a flexible and practical cellular platform for assessing host responses in multiple genetic backgrounds. PMID:25946027

  18. Efficient Generation of Human Embryonic Stem Cell-Derived Corneal Endothelial Cells by Directed Differentiation

    PubMed Central

    McCabe, Kathryn L.; Kunzevitzky, Noelia J.; Chiswell, Brian P.; Xia, Xin; Goldberg, Jeffrey L.; Lanza, Robert

    2015-01-01

    Aim To generate human embryonic stem cell derived corneal endothelial cells (hESC-CECs) for transplantation in patients with corneal endothelial dystrophies. Materials and Methods Feeder-free hESC-CECs were generated by a directed differentiation protocol. hESC-CECs were characterized by morphology, expression of corneal endothelial markers, and microarray analysis of gene expression. Results hESC-CECs were nearly identical morphologically to primary human corneal endothelial cells, expressed Zona Occludens 1 (ZO-1) and Na+/K+ATPaseα1 (ATPA1) on the apical surface in monolayer culture, and produced the key proteins of Descemet’s membrane, Collagen VIIIα1 and VIIIα2 (COL8A1 and 8A2). Quantitative PCR analysis revealed expression of all corneal endothelial pump transcripts. hESC-CECs were 96% similar to primary human adult CECs by microarray analysis. Conclusion hESC-CECs are morphologically similar, express corneal endothelial cell markers and express a nearly identical complement of genes compared to human adult corneal endothelial cells. hESC-CECs may be a suitable alternative to donor-derived corneal endothelium. PMID:26689688

  19. Stretch Injury of Human Induced Pluripotent Stem Cell Derived Neurons in a 96 Well Format

    PubMed Central

    Sherman, Sydney A.; Phillips, Jack K.; Costa, J. Tighe; Cho, Frances S.; Oungoulian, Sevan R.; Finan, John D.

    2016-01-01

    Traumatic brain injury (TBI) is a major cause of mortality and morbidity with limited therapeutic options. Traumatic axonal injury (TAI) is an important component of TBI pathology. It is difficult to reproduce TAI in animal models of closed head injury, but in vitro stretch injury models reproduce clinical TAI pathology. Existing in vitro models employ primary rodent neurons or human cancer cell line cells in low throughput formats. This in vitro neuronal stretch injury model employs human induced pluripotent stem cell-derived neurons (hiPSCNs) in a 96 well format. Silicone membranes were attached to 96 well plate tops to create stretchable, culture substrates. A custom-built device was designed and validated to apply repeatable, biofidelic strains and strain rates to these plates. A high content approach was used to measure injury in a hypothesis-free manner. These measurements are shown to provide a sensitive, dose-dependent, multi-modal description of the response to mechanical insult. hiPSCNs transition from healthy to injured phenotype at approximately 35% Lagrangian strain. Continued development of this model may create novel opportunities for drug discovery and exploration of the role of human genotype in TAI pathology. PMID:27671211

  20. Increasing doublecortin expression promotes migration of human embryonic stem cell-derived neurons.

    PubMed

    Filipovic, Radmila; Santhosh Kumar, Saranya; Fiondella, Chris; Loturco, Joseph

    2012-09-01

    Human embryonic stem cell-derived neuronal progenitors (hNPs) provide a potential source for cellular replacement following neurodegenerative diseases. One of the greatest challenges for future neuron replacement therapies will be to control extensive cell proliferation and stimulate cell migration of transplanted cells. The doublecortin (DCX) gene encodes the protein DCX, a microtubule-associated protein essential for the migration of neurons in the human brain. In this study, we tested whether increasing the expression of DCX in hNPs would favorably alter their proliferation and migration. Migration and proliferation of hNPs was compared between hNPs expressing a bicistronic DCX/IRES-GFP transgene and those expressing a green fluorescent protein (GFP) transgene introduced by piggyBac-mediated transposition. The DCX-transfected hNPs showed a significant decrease in their proliferation and migrated significantly further on two different substrates, Matrigel and brain slices. Additionally, a dense network of nestin-positive (+) and vimentin+ fibers were found to extend from neurospheres transplanted onto brain slices, and this fiber growth was increased from neurospheres containing DCX-transfected hNPs. In summary, our results show that increased DCX expression inhibits proliferation and promotes migration of hNPs.

  1. Generation of induced pluripotent stem cell-derived mice by reprogramming of a mature NKT cell.

    PubMed

    Ren, Yue; Dashtsoodol, Nyambayar; Watarai, Hiroshi; Koseki, Haruhiko; Quan, Chengshi; Taniguchi, Masaru

    2014-10-01

    NKT cells are characterized by their expression of an NKT-cell-specific invariant antigen-receptor α chain encoded by Vα14Jα18 gene segments. These NKT cells bridge the innate and acquired immune systems to mediate effective and augmented responses; however, the limited number of NKT cells in vivo hampers their analysis. Here, two lines of induced pluripotent stem cell-derived mice (NKT-iPSC-derived mice) were generated by reprogramming of mature NKT cells, where one harbors both rearranged Vα14Jα18 and Vβ7 genes and the other carries rearranged Vα14Jα18 on both alleles but germline Vβ loci. The analysis of NKT-iPSC-derived mice showed a significant increase in NKT cell numbers with relatively normal frequencies of functional subsets, but significantly enhanced in some cases, and acquired functional NKT cell maturation in peripheral lymphoid organs. NKT-iPSC-derived mice also showed normal development of other immune cells except for the absence of γδT cells and disturbed development of conventional CD4 αβT cells. These results suggest that the NKT-iPSC-derived mice are a better model for NKT cell development and function study rather than transgenic mouse models reported previously and also that the presence of a pre-rearranged Vα14Jα18 in the natural chromosomal context favors the developmental fate of NKT cells.

  2. Reversal of diabetes with insulin-producing cells derived in vitro from human pluripotent stem cells.

    PubMed

    Rezania, Alireza; Bruin, Jennifer E; Arora, Payal; Rubin, Allison; Batushansky, Irina; Asadi, Ali; O'Dwyer, Shannon; Quiskamp, Nina; Mojibian, Majid; Albrecht, Tobias; Yang, Yu Hsuan Carol; Johnson, James D; Kieffer, Timothy J

    2014-11-01

    Transplantation of pancreatic progenitors or insulin-secreting cells derived from human embryonic stem cells (hESCs) has been proposed as a therapy for diabetes. We describe a seven-stage protocol that efficiently converts hESCs into insulin-producing cells. Stage (S) 7 cells expressed key markers of mature pancreatic beta cells, including MAFA, and displayed glucose-stimulated insulin secretion similar to that of human islets during static incubations in vitro. Additional characterization using single-cell imaging and dynamic glucose stimulation assays revealed similarities but also notable differences between S7 insulin-secreting cells and primary human beta cells. Nevertheless, S7 cells rapidly reversed diabetes in mice within 40 days, roughly four times faster than pancreatic progenitors. Therefore, although S7 cells are not fully equivalent to mature beta cells, their capacity for glucose-responsive insulin secretion and rapid reversal of diabetes in vivo makes them a promising alternative to pancreatic progenitor cells or cadaveric islets for the treatment of diabetes.

  3. Tomosyn Negatively Regulates Arginine Vasopressin Secretion in Embryonic Stem Cell-Derived Neurons

    PubMed Central

    Takeuchi, Seiji; Iwama, Shintaro; Takagi, Hiroshi; Kiyota, Atsushi; Nakashima, Kohtaro; Izumida, Hisakazu; Fujisawa, Haruki; Iwata, Naoko; Suga, Hidetaka; Watanabe, Takashi; Kaibuchi, Kozo; Oiso, Yutaka; Arima, Hiroshi; Sugimura, Yoshihisa

    2016-01-01

    Arginine vasopressin (AVP) is secreted via exocytosis; however, the precise molecular mechanism underlying the exocytosis of AVP remains to be elucidated. To better understand the mechanisms of AVP secretion, in our study we have identified proteins that bind with a 25 kDa synaptosomal-associated protein (SNAP25). SNAP25 plays a crucial role in exocytosis, in the posterior pituitary. Embryonic stem (ES) cell-derived AVP neurons were established to investigate the functions of the identified proteins. Using glutathione S-transferase (GST)-pulldown assays and proteomic analyses, we identified tomosyn-1 (syntaxin-binding protein 5) as a SNAP25-binding protein in the posterior pituitary. Coimmunoprecipitation assays indicated that tomosyn formed N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) complexes with SNAP25 and syntaxin1. Immunohistochemistry showed that tomosyn localized to the posterior pituitary. Mouse ES cells self-differentiated into AVP neurons (mES-AVP) that expressed tomosyn and two transmembrane SNARE proteins, including SNAP25 and syntaxin1. KCl increased AVP secretion in mES-AVP, and overexpression of tomosyn-1 reduced KCl-stimulated AVP secretion. Downregulation of tomosyn-1 with siRNA increased KCl-stimulated AVP secretion. These results suggested that tomosyn-1 negatively regulated AVP secretion in mES-AVP and further suggest the possibility of using mES-AVP culture systems to evaluate the role of synaptic proteins from AVP neurons. PMID:27732637

  4. Process Extension from Embryonic Stem Cell-Derived Motor Neurons through Synthetic Extracellular Matrix Mimics

    NASA Astrophysics Data System (ADS)

    McKinnon, Daniel Devaud

    This thesis focuses on studying the extension of motor axons through synthetic poly(ethylene glycol) PEG hydrogels that have been modified with biochemical functionalities to render them more biologically relevant. Specifically, the research strategy is to encapsulate embryonic stem cell-derived motor neurons (ESMNs) in synthetic PEG hydrogels crosslinked through three different chemistries providing three mechanisms for dynamically tuning material properties. First, a covalently crosslinked, enzymatically degradable hydrogel is developed and exploited to study the biophysical dynamics of axon extension and matrix remodeling. It is demonstrated that dispersed motor neurons require a battery of adhesive peptides and growth factors to maintain viability and extend axons while those in contact with supportive neuroglial cells do not. Additionally, cell-degradable crosslinker peptides and a soft modulus mimicking that of the spinal cord are requirements for axon extension. However, because local degradation of the hydrogel results in a cellular environment significantly different than that of the bulk, enzymatically degradable peptide crosslinkers were replaced with reversible covalent hydrazone bonds to study the effect of hydrogel modulus on axon extension. This material is characterized in detail and used to measure forces involved in axon extension. Finally, a hydrogel with photocleavable linkers incorporated into the network structure is exploited to explore motor axon response to physical channels. This system is used to direct the growth of motor axons towards co-cultured myotubes, resulting in the formation of an in vitro neural circuit.

  5. Mitochondrial Toxicity of Perfluorooctane Sulfonate in Mouse Embryonic Stem Cell-Derived Cardiomyocytes.

    PubMed

    Tang, Lei-Lei; Wang, Jia-Dan; Xu, Ting-Ting; Zhao, Zhe; Zheng, Jia-Jie; Ge, Ren-Shan; Zhu, Dan-Yan

    2017-03-10

    Perfluorooctane sulfonate (PFOS) is a persistent organic contaminant that may cause cardiotoxicity in animals and humans. However, little is known about the underlying mechanism by which it affects the organelle toxicity in cardiomyocytes during the cardiogenesis. Our previous proteomic study showed that differences of protein expression mainly existed in mitochondria of cardiomyocytes differentiated from embryonic stem (ES) cells after exposure to PFOS. Here, we focused on mitochondrial toxicity of PFOS in ES cell-derived cardiomyocytes. The cardiomyogenesis from ES cells in vitro was inhibited, and the expression of L-type Ca(2+) channel (LTCC) was decreased to interrupt [Ca(2+)]c transient amplitude in cardiomyocytes after PFOS treatment. Transmission electron microscope revealed that swollen mitochondrion with vacuole in PFOS-treated cells. Meanwhile, mitochondrial transmembrane potential (ΔYm) was declined and ATP production was lowered. These changes were related to the increased EGFR phosphorylation, activated Rictor signaling, then mediated HK2 binding to mitochondrial membrane. Furthermore, PFOS reduced the interaction of IP3R-Grp75-VDAC and accumulated intracellular fatty acids by activating Rictor, thereby attenuating PGC-1a and Mfn2 expressions, then destroying mitochondria-associated endoplasmic reticulum membrane (MAM), which resulted in the decrease of [Ca(2+)]mito transient amplitude triggered by ATP. In conclusion, mitochondrial structure damages and abnormal Ca(2+) shuttle were the important aspects in PFOS-induced cardiomyocytes toxicity from ES cells by activating Rictor signaling pathway.

  6. In vitro patterning of pluripotent stem cell-derived intestine recapitulates in vivo human development

    PubMed Central

    Tsai, Yu-Hwai; Nattiv, Roy; Dedhia, Priya H.; Nagy, Melinda S.; Chin, Alana M.; Thomson, Matthew; Klein, Ophir D.

    2017-01-01

    ABSTRACT The intestine plays a central role in digestion, nutrient absorption and metabolism, with individual regions of the intestine having distinct functional roles. Many examples of region-specific gene expression in the adult intestine are known, but how intestinal regional identity is established during development is a largely unresolved issue. Here, we have identified several genes that are expressed in a region-specific manner in the developing human intestine. Using human embryonic stem cell-derived intestinal organoids, we demonstrate that the duration of exposure to active FGF and WNT signaling controls regional identity. Short-term exposure to FGF4 and CHIR99021 (a GSK3β inhibitor that stabilizes β-catenin) resulted in organoids with gene expression patterns similar to developing human duodenum, whereas longer exposure resulted in organoids similar to ileum. When region-specific organoids were transplanted into immunocompromised mice, duodenum-like organoids and ileum-like organoids retained their regional identity, demonstrating that regional identity of organoids is stable after initial patterning occurs. This work provides insights into the mechanisms that control regional specification of the developing human intestine and provides new tools for basic and translational research. PMID:27927684

  7. Automated Electrophysiological and Pharmacological Evaluation of Human Pluripotent Stem Cell-Derived Cardiomyocytes

    PubMed Central

    Rajamohan, Divya; Kalra, Spandan; Duc Hoang, Minh; George, Vinoj; Staniforth, Andrew; Russell, Hugh; Yang, Xuebin

    2016-01-01

    Automated planar patch clamp systems are widely used in drug evaluation studies because of their ability to provide accurate, reliable, and reproducible data in a high-throughput manner. Typically, CHO and HEK tumorigenic cell lines overexpressing single ion channels are used since they can be harvested as high-density, homogenous, single-cell suspensions. While human pluripotent stem cell-derived cardiomyocytes (hPSC-CMs) are physiologically more relevant, these cells are fragile, have complex culture requirements, are inherently heterogeneous, and are expensive to produce, which has restricted their use on automated patch clamp (APC) devices. Here, we used high efficiency differentiation protocols to produce cardiomyocytes from six different hPSC lines for analysis on the Patchliner (Nanion Technologies GmbH) APC platform. We developed a two-step cell preparation protocol that yielded cell catch rates and whole-cell breakthroughs of ∼80%, with ∼40% of these cells allowing electrical activity to be recorded. The protocol permitted formation of long-lasting (>15 min), high quality seals (>2 GΩ) in both voltage- and current-clamp modes. This enabled density of sodium, calcium, and potassium currents to be evaluated, along with dose–response curves to their respective channel inhibitors, tetrodotoxin, nifedipine, and E-4031. Thus, we show the feasibility of using the Patchliner platform for automated evaluation of the electrophysiology and pharmacology of hPSC-CMs, which will enable considerable increase in throughput for reliable and efficient drug evaluation. PMID:26906236

  8. Embryonic stem cell-derived M2-like macrophages delay cutaneous wound healing.

    PubMed

    Dreymueller, Daniela; Denecke, Bernd; Ludwig, Andreas; Jahnen-Dechent, Willi

    2013-01-01

    In adults, repair of deeply injured skin wounds results in the formation of scar tissue, whereas in embryos wounds heal almost scar-free. Macrophages are important mediators of wound healing and secrete cytokines and tissue remodeling enzymes. In contrast to host defense mediated by inflammatory M1 macrophages, wound healing and tissue repair involve regulatory M2/M2-like macrophages. Embryonic/fetal macrophages are M2-like, and this may promote scar-free wound healing. In the present study, we asked whether atopical application of ex vivo generated, embryonic stem cell-derived macrophages (ESDM) improve wound healing in mice. ESDM were tested side by side with bone marrow-derived macrophages (BMDM). Compared to BMDM, ESDM resembled a less inflammatory and more M2-like macrophage subtype as indicated by their reduced responsiveness to lipopolysaccharide, reduced expression of Toll-like receptors, and reduced bacterial phagocytosis. Despite this anti-inflammatory phenotype in cell culture, ESDM prolonged the healing of deep skin wounds even more than BMDM. Healed wounds had more scar formation compared to wounds receiving BMDM or cell-free treatment. Our data indicate that atopical application of ex vivo generated macrophages is not a suitable cell therapy of dermal wounds.

  9. Functional Neurons Generated from T Cell-Derived Induced Pluripotent Stem Cells for Neurological Disease Modeling

    PubMed Central

    Matsumoto, Takuya; Fujimori, Koki; Andoh-Noda, Tomoko; Ando, Takayuki; Kuzumaki, Naoko; Toyoshima, Manabu; Tada, Hirobumi; Imaizumi, Kent; Ishikawa, Mitsuru; Yamaguchi, Ryo; Isoda, Miho; Zhou, Zhi; Sato, Shigeto; Kobayashi, Tetsuro; Ohtaka, Manami; Nishimura, Ken; Kurosawa, Hiroshi; Yoshikawa, Takeo; Takahashi, Takuya; Nakanishi, Mahito; Ohyama, Manabu; Hattori, Nobutaka; Akamatsu, Wado; Okano, Hideyuki

    2016-01-01

    Summary Modeling of neurological diseases using induced pluripotent stem cells (iPSCs) derived from the somatic cells of patients has provided a means of elucidating pathogenic mechanisms and performing drug screening. T cells are an ideal source of patient-specific iPSCs because they can be easily obtained from samples. Recent studies indicated that iPSCs retain an epigenetic memory relating to their cell of origin that restricts their differentiation potential. The classical method of differentiation via embryoid body formation was not suitable for T cell-derived iPSCs (TiPSCs). We developed a neurosphere-based robust differentiation protocol, which enabled TiPSCs to differentiate into functional neurons, despite differences in global gene expression between TiPSCs and adult human dermal fibroblast-derived iPSCs. Furthermore, neurons derived from TiPSCs generated from a juvenile patient with Parkinson's disease exhibited several Parkinson's disease phenotypes. Therefore, we conclude that TiPSCs are a useful tool for modeling neurological diseases. PMID:26905201

  10. FUS affects circular RNA expression in murine embryonic stem cell-derived motor neurons

    PubMed Central

    Errichelli, Lorenzo; Dini Modigliani, Stefano; Laneve, Pietro; Colantoni, Alessio; Legnini, Ivano; Capauto, Davide; Rosa, Alessandro; De Santis, Riccardo; Scarfò, Rebecca; Peruzzi, Giovanna; Lu, Lei; Caffarelli, Elisa; Shneider, Neil A.; Morlando, Mariangela; Bozzoni, Irene

    2017-01-01

    The RNA-binding protein FUS participates in several RNA biosynthetic processes and has been linked to the pathogenesis of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia. Here we report that FUS controls back-splicing reactions leading to circular RNA (circRNA) production. We identified circRNAs expressed in in vitro-derived mouse motor neurons (MNs) and determined that the production of a considerable number of these circRNAs is regulated by FUS. Using RNAi and overexpression of wild-type and ALS-associated FUS mutants, we directly correlate the modulation of circRNA biogenesis with alteration of FUS nuclear levels and with putative toxic gain of function activities. We also demonstrate that FUS regulates circRNA biogenesis by binding the introns flanking the back-splicing junctions and that this control can be reproduced with artificial constructs. Most circRNAs are conserved in humans and specific ones are deregulated in human-induced pluripotent stem cell-derived MNs carrying the FUSP525L mutation associated with ALS. PMID:28358055

  11. In vitro patterning of pluripotent stem cell-derived intestine recapitulates in vivo human development.

    PubMed

    Tsai, Yu-Hwai; Nattiv, Roy; Dedhia, Priya H; Nagy, Melinda S; Chin, Alana M; Thomson, Matthew; Klein, Ophir D; Spence, Jason R

    2017-03-15

    The intestine plays a central role in digestion, nutrient absorption and metabolism, with individual regions of the intestine having distinct functional roles. Many examples of region-specific gene expression in the adult intestine are known, but how intestinal regional identity is established during development is a largely unresolved issue. Here, we have identified several genes that are expressed in a region-specific manner in the developing human intestine. Using human embryonic stem cell-derived intestinal organoids, we demonstrate that the duration of exposure to active FGF and WNT signaling controls regional identity. Short-term exposure to FGF4 and CHIR99021 (a GSK3β inhibitor that stabilizes β-catenin) resulted in organoids with gene expression patterns similar to developing human duodenum, whereas longer exposure resulted in organoids similar to ileum. When region-specific organoids were transplanted into immunocompromised mice, duodenum-like organoids and ileum-like organoids retained their regional identity, demonstrating that regional identity of organoids is stable after initial patterning occurs. This work provides insights into the mechanisms that control regional specification of the developing human intestine and provides new tools for basic and translational research.

  12. FUS affects circular RNA expression in murine embryonic stem cell-derived motor neurons.

    PubMed

    Errichelli, Lorenzo; Dini Modigliani, Stefano; Laneve, Pietro; Colantoni, Alessio; Legnini, Ivano; Capauto, Davide; Rosa, Alessandro; De Santis, Riccardo; Scarfò, Rebecca; Peruzzi, Giovanna; Lu, Lei; Caffarelli, Elisa; Shneider, Neil A; Morlando, Mariangela; Bozzoni, Irene

    2017-03-30

    The RNA-binding protein FUS participates in several RNA biosynthetic processes and has been linked to the pathogenesis of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia. Here we report that FUS controls back-splicing reactions leading to circular RNA (circRNA) production. We identified circRNAs expressed in in vitro-derived mouse motor neurons (MNs) and determined that the production of a considerable number of these circRNAs is regulated by FUS. Using RNAi and overexpression of wild-type and ALS-associated FUS mutants, we directly correlate the modulation of circRNA biogenesis with alteration of FUS nuclear levels and with putative toxic gain of function activities. We also demonstrate that FUS regulates circRNA biogenesis by binding the introns flanking the back-splicing junctions and that this control can be reproduced with artificial constructs. Most circRNAs are conserved in humans and specific ones are deregulated in human-induced pluripotent stem cell-derived MNs carrying the FUS(P525L) mutation associated with ALS.

  13. Anti-aging effects of vitamin C on human pluripotent stem cell-derived cardiomyocytes.

    PubMed

    Kim, Yoon Young; Ku, Seung-Yup; Huh, Yul; Liu, Hung-Ching; Kim, Seok Hyun; Choi, Young Min; Moon, Shin Yong

    2013-10-01

    Human pluripotent stem cells (hPSCs) have arisen as a source of cells for biomedical research due to their developmental potential. Stem cells possess the promise of providing clinicians with novel treatments for disease as well as allowing researchers to generate human-specific cellular metabolism models. Aging is a natural process of living organisms, yet aging in human heart cells is difficult to study due to the ethical considerations regarding human experimentation as well as a current lack of alternative experimental models. hPSC-derived cardiomyocytes (CMs) bear a resemblance to human cardiac cells and thus hPSC-derived CMs are considered to be a viable alternative model to study human heart cell aging. In this study, we used hPSC-derived CMs as an in vitro aging model. We generated cardiomyocytes from hPSCs and demonstrated the process of aging in both human embryonic stem cell (hESC)- and induced pluripotent stem cell (hiPSC)-derived CMs. Aging in hESC-derived CMs correlated with reduced membrane potential in mitochondria, the accumulation of lipofuscin, a slower beating pattern, and the downregulation of human telomerase RNA (hTR) and cell cycle regulating genes. Interestingly, the expression of hTR in hiPSC-derived CMs was not significantly downregulated, unlike in hESC-derived CMs. In order to delay aging, vitamin C was added to the cultured CMs. When cells were treated with 100 μM of vitamin C for 48 h, anti-aging effects, specifically on the expression of telomere-related genes and their functionality in aging cells, were observed. Taken together, these results suggest that hPSC-derived CMs can be used as a unique human cardiomyocyte aging model in vitro and that vitamin C shows anti-aging effects in this model.

  14. Methods for human embryonic stem cells derived cardiomyocytes cultivation, genetic manipulation, and transplantation.

    PubMed

    Arbel, Gil; Caspi, Oren; Huber, Irit; Gepstein, Amira; Weiler-Sagie, Michal; Gepstein, Lior

    2010-01-01

    A decade has passed since the initial derivation of human embryonic stem cells (hESC). The ensuing years have witnessed a significant progress in the development of methodologies allowing cell cultivation, differentiation, genetic manipulation, and in vivo transplantation. Specifically, the potential to derive human cardiomyocytes from the hESC lines, which can be used for several basic and applied cardiovascular research areas including in the emerging field of cardiac regenerative medicine, attracted significant attention from the scientific community. This resulted in the development of protocols for the cultivation of hESC and their successful differentiation toward the cardiomyocyte lineage fate. In this chapter, we will describe in detail methods related to the cultivation, genetic manipulation, selection, and in vivo transplantation of hESC-derived cardiomyocytes.

  15. Cardiomyocyte MEA data analysis (CardioMDA)--a novel field potential data analysis software for pluripotent stem cell derived cardiomyocytes.

    PubMed

    Pradhapan, Paruthi; Kuusela, Jukka; Viik, Jari; Aalto-Setälä, Katriina; Hyttinen, Jari

    2013-01-01

    Cardiac safety pharmacology requires in-vitro testing of all drug candidates before clinical trials in order to ensure they are screened for cardio-toxic effects which may result in severe arrhythmias. Micro-electrode arrays (MEA) serve as a complement to current in-vitro methods for drug safety testing. However, MEA recordings produce huge volumes of data and manual analysis forms a bottleneck for high-throughput screening. To overcome this issue, we have developed an offline, semi-automatic data analysis software, 'Cardiomyocyte MEA Data Analysis (CardioMDA)', equipped with correlation analysis and ensemble averaging techniques to improve the accuracy, reliability and throughput rate of analysing human pluripotent stem cell derived cardiomyocyte (CM) field potentials. With the program, true field potential and arrhythmogenic complexes can be distinguished from one another. The averaged field potential complexes, analysed using our software to determine the field potential duration, were compared with the analogous values obtained from manual analysis. The reliability of the correlation analysis algorithm, evaluated using various arrhythmogenic and morphology changing signals, revealed a mean sensitivity and specificity of 99.27% and 94.49% respectively, in determining true field potential complexes. The field potential duration of the averaged waveforms corresponded well to the manually analysed data, thus demonstrating the reliability of the software. The software has also the capability to create overlay plots for signals recorded under different drug concentrations in order to visualize and compare the magnitude of response on different ion channels as a result of drug treatment. Our novel field potential analysis platform will facilitate the analysis of CM MEA signals in semi-automated way and provide a reliable means of efficient and swift analysis for cardiomyocyte drug or disease model studies.

  16. Proarrhythmia Risk Assessment in Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes Using the Maestro MEA Platform.

    PubMed

    Qu, Yusheng; Vargas, Hugo M

    2015-09-01

    Evaluation of stem cell-derived cardiomyocytes (SC-CM) using multi-electrode array (MEA) has attracted attention as a novel model to detect drug-induced arrhythmia. An experiment was conducted to determine if MEA recording from human induced pluripotent SC-CM (hiPSC-CM) could assess proarrhythmic risk. Ten hERG blockers, 4 Na(+) blockers, and 1 IKs blocker were evaluated blindly. Eight drugs are associated with Torsades de Pointes (TdP) and 4 are not. Multiple parameters, including field potential duration (FPD), Na(+) slope, Na(+) amplitude, beat rate (BR), and early after-depolarization (EAD) were recorded. Minimum effective concentrations (MEC) that elicited a significant change were calculated. Our results determined that FPD and EAD were unable to distinguish torsadogenic from benign compounds, Na(+) slope and amplitude could not differentiate Na(+) channel blockade from hERG blockade, BR had an inconsistent response to pharmacological treatment, and that hiPSC-CM were, in general, insensitive to IKs inhibition. A ratio was calculated that relates MEC for evoking FPD prolongation, or triggering EAD, to the human therapeutic unbound Cmax (MEC/Cmax). The key finding was that the ratio was sensitive, but specificity was low. Consistently, the ratio had high positive predictive value and low negative predictive value. In conclusion, MEA recordings of hiPSC-CM were sensitive for FPD and EAD detection, but unable to distinguish agents with low- and high-risk for TdPs. Although some published reports suggested great potential for MEA recordings in hSC-CM to assess preclinical cardiac toxicity, the current evaluation implies that this model would have a high false-positive rate in regard to proarrhythmic risk.

  17. Evaluation of the Cardiotoxicity of Mitragynine and Its Analogues Using Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes

    PubMed Central

    Wu, Jianjun; Jamil, Mohd Fadzly Amar; Tan, Mei Lan; Adenan, Mohd Ilham; Wong, Philip; Shim, Winston

    2014-01-01

    Introduction Mitragynine is a major bioactive compound of Kratom, which is derived from the leave extracts of Mitragyna speciosa Korth or Mitragyna speciosa (M. speciosa), a medicinal plant from South East Asia used legally in many countries as stimulant with opioid-like effects for the treatment of chronic pain and opioid-withdrawal symptoms. Fatal incidents with Mitragynine have been associated with cardiac arrest. In this study, we determined the cardiotoxicity of Mitragynine and other chemical constituents isolated using human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs). Methods and Results The rapid delayed rectifier potassium current (IKr), L-type Ca2+ current (ICa,L) and action potential duration (APD) were measured by whole cell patch-clamp. The expression of KCNH2 and cytotoxicity was determined by real-time PCR and Caspase activity measurements. After significant IKr suppression by Mitragynine (10 µM) was confirmed in hERG-HEK cells, we systematically examined the effects of Mitragynine and other chemical constituents in hiPSC-CMs. Mitragynine, Paynantheine, Speciogynine and Speciociliatine, dosage-dependently (0.1∼100 µM) suppressed IKr in hiPSC-CMs by 67% ∼84% with IC50 ranged from 0.91 to 2.47 µM. Moreover, Mitragynine (10 µM) significantly prolonged APD at 50 and 90% repolarization (APD50 and APD90) (439.0±11.6 vs. 585.2±45.5 ms and 536.0±22.6 vs. 705.9±46.1 ms, respectively) and induced arrhythmia, without altering the L-type Ca2+ current. Neither the expression,and intracellular distribution of KCNH2/Kv11.1, nor the Caspase 3 activity were significantly affected by Mitragynine. Conclusions Our study indicates that Mitragynine and its analogues may potentiate Torsade de Pointes through inhibition of IKr in human cardiomyocytes. PMID:25535742

  18. Increasing the physical size and nucleation status of human pluripotent stem cell-derived ventricular cardiomyocytes by cell fusion.

    PubMed

    Kong, Chi-Wing; Chen, Shuxun; Geng, Lin; Shum, Angie Man-Yee; Sun, Dong; Li, Ronald A

    2017-03-01

    Human pluripotent stem cell-derived cardiomyocytes (hPSC-CMs) provide an unlimited source of donor cells for potential cardiac regenerative therapies. However, hPSC-CMs are immature. For instance, hPSC-CMs are only 1/10 of the physical size of their adult counterparts; the majority are mono- rather than bi- or multi-nucleated, which is an evolutionary adaptive feature in metabolically active cells such as adult CMs. Here, we attempted to increase the physical size and nucleation status of hPSC-derived ventricular (V) cardiomyocytes (hPSC-VCMs) using chemically-induced cell fusion, and examined the subsequent functional effects. Polyethylene glycol (PEG) was employed to fuse a 1:1 mixture of lentiviral vectors LV-MLC2v-GFP- or -tdTomato-labeled hPSC-VCMs, such that hPSC-VCMs fused syncytia (FS) were identified as doubly GFP(+)/tdTomato(+) multi-nucleated cells. These microscopically-identified FS were doubled in size as gauged by their capacitance when compared to the control mononucleated hPSC-VCMs using patch-clamp analysis. Reduced automaticity or action potential (AP) firing rate and moderately prolonged AP duration were observed in FS from day 6 post-fusion induction. However, Ca(2+) handling, mitochondrial biogenesis and the extent of apoptosis were not significantly altered. We conclude that larger, multi-nucleated hPSC-VCMs FS can be created by chemically-induced cell fusion but global maturation requires additional triggering cues.

  19. High-throughput multi-parameter profiling of electrophysiological drug effects in human embryonic stem cell derived cardiomyocytes using multi-electrode arrays.

    PubMed

    Clements, Mike; Thomas, Nick

    2014-08-01

    Human stem cell derived cardiomyocytes (hESC-CM) provide a potential model for development of improved assays for pre-clinical predictive drug safety screening. We have used multi-electrode array (MEA) analysis of hESC-CM to generate multi-parameter data to profile drug impact on cardiomyocyte electrophysiology using a panel of 21 compounds active against key cardiac ion channels. Our study is the first to apply multi-parameter phenotypic profiling and clustering techniques commonly used for high-content imaging and microarray data to the analysis of electrophysiology data obtained by MEA analysis. Our data show good correlations with previous studies in stem cell derived cardiomyocytes and demonstrate improved specificity in compound risk assignment over convention single-parametric approaches. These analyses indicate great potential for multi-parameter MEA data acquired from hESC-CM to enable drug electrophysiological liabilities to be assessed in pre-clinical cardiotoxicity assays, facilitating informed decision making and liability management at the optimum point in drug development.

  20. Comparison of mesenchymal stem cells derived from gingival tissue and periodontal ligament in different incubation conditions.

    PubMed

    Yang, Hao; Gao, Li-Na; An, Ying; Hu, Cheng-Hu; Jin, Fang; Zhou, Jun; Jin, Yan; Chen, Fa-Ming

    2013-09-01

    Gingival tissue-derived mesenchymal stem cells (MSCs) were recently identified and characterized as having multipotential differentiation and immunomodulatory properties in vitro and in vivo, and they represent new postnatal stem cell types for cytotherapy and regenerative medicine. However, the utility of gingival MSCs (GMSCs) as alternatives to periodontal ligament stem cells (PDLSCs), which have been demonstrated to be effective but with limited cell availability and reduced clinical feasibility, for periodontal regeneration in a previously diseased/inflamed environment remains obscure. In this study, patient-matched human GMSCs and PDLSCs were evaluated in terms of their colony-forming ability, proliferative capacity, cell surface epitopes, multi-lineage differentiation potentials, and related gene expression when incubated in different designed culture conditions, with or without the presence of inflammatory cytokines. An in vivo ectopic transplantation model using transplants from inflammatory cytokine-treated or untreated cells was applied to assess bone formation. We found that cells derived from both tissues expressed MSC markers, including CD146, CD105, CD90, CD29, and STRO-1. Both cells successfully differentiated under osteogenic, adipogenic, and chondrogenic microenvironments; PDLSCs displayed a more effective differentiation potential in all of the incubation conditions compared to GMSCs (P < 0.01). Although inflammatory cytokine-treated GMSCs and PDLSCs are inferior to normally cultured, patient and tissue-matched cells in terms of their osteogenic capacity and regenerative potential (P < 0.05), they retain the capacity for osteoblastic and adipose differentiation, as well as ectopic bone formation, similar to what has been demonstrated for other MSCs. Interestingly, GMSCs exhibited fewer inflammation-related changes in terms of osteogenic potential in vitro and bone formation in vivo compared to PDLSCs (P < 0.01). These results suggest

  1. Cardiac stem cell therapy: Have we put too much hype in which cell type to use?

    PubMed

    Ye, Jianqin; Yeghiazarians, Yerem

    2015-09-01

    Injection of various stem cells has been tested with the hopes of improving cardiac function after a myocardial infarction (MI). However, there is continued controversy as to which cell type is best for repair. Due to technical differences in cell isolation, processing, delivery, and cardiac functional assessment by various investigators, it has been difficult to directly compare the results of different cells. Using same techniques to evaluate the efficacy of different cell types, we have separately delivered bone marrow cells (BMCs), cardiospheres (CSs), CS-derived Sca-1(+)/CD45(-) cells, human embryonic stem cell-derived cardiomyocytes, and BMC extract into infarcted murine myocardium and found that all of these treatments reduce infarct size and improve cardiac function post-MI similarly without one regimen being superior to another. The beneficial effects appear to be via paracrine influences. Different progenitors lead to improved cardiac function post-MI, but it is premature to hype any specific cell type at this time.

  2. Stem Cell Technology in Cardiac Regeneration: A Pluripotent Stem Cell Promise.

    PubMed

    Duelen, Robin; Sampaolesi, Maurilio

    2017-01-27

    Despite advances in cardiovascular biology and medical therapy, heart disorders are the leading cause of death worldwide. Cell-based regenerative therapies become a promising treatment for patients affected by heart failure, but also underline the need for reproducible results in preclinical and clinical studies for safety and efficacy. Enthusiasm has been tempered by poor engraftment, survival and differentiation of the injected adult stem cells. The crucial challenge is identification and selection of the most suitable stem cell type for cardiac regenerative medicine. Human pluripotent stem cells (PSCs) have emerged as attractive cell source to obtain cardiomyocytes (CMs), with potential applications, including drug discovery and toxicity screening, disease modelling and innovative cell therapies. Lessons from embryology offered important insights into the development of stem cell-derived CMs. However, the generation of a CM population, uniform in cardiac subtype, adult maturation and functional properties, is highly recommended. Moreover, hurdles regarding tumorigenesis, graft cell death, immune rejection and arrhythmogenesis need to be overcome in clinical practice. Here we highlight the recent progression in PSC technologies for the regeneration of injured heart. We review novel strategies that might overcome current obstacles in heart regenerative medicine, aiming at improving cell survival and functional integration after cell transplantation.

  3. Ion channelopathies in human induced pluripotent stem cell derived cardiomyocytes: a dynamic clamp study with virtual IK1

    PubMed Central

    Meijer van Putten, Rosalie M. E.; Mengarelli, Isabella; Guan, Kaomei; Zegers, Jan G.; van Ginneken, Antoni C. G.; Verkerk, Arie O.; Wilders, Ronald

    2015-01-01

    Human induced pluripotent stem cell derived cardiomyocytes (hiPSC-CMs) are widely used in studying basic mechanisms of cardiac arrhythmias that are caused by ion channelopathies. Unfortunately, the action potential profile of hiPSC-CMs—and consequently the profile of individual membrane currents active during that action potential—differs substantially from that of native human cardiomyocytes, largely due to almost negligible expression of the inward rectifier potassium current (IK1). In the present study, we attempted to “normalize” the action potential profile of our hiPSC-CMs by inserting a voltage dependent in silico IK1 into our hiPSC-CMs, using the dynamic clamp configuration of the patch clamp technique. Recordings were made from single hiPSC-CMs, using the perforated patch clamp technique at physiological temperature. We assessed three different models of IK1, with different degrees of inward rectification, and systematically varied the magnitude of the inserted IK1. Also, we modified the inserted IK1 in order to assess the effects of loss- and gain-of-function mutations in the KCNJ2 gene, which encodes the Kir2.1 protein that is primarily responsible for the IK1 channel in human ventricle. For our experiments, we selected spontaneously beating hiPSC-CMs, with negligible IK1 as demonstrated in separate voltage clamp experiments, which were paced at 1 Hz. Upon addition of in silico IK1 with a peak outward density of 4–6 pA/pF, these hiPSC-CMs showed a ventricular-like action potential morphology with a stable resting membrane potential near −80 mV and a maximum upstroke velocity >150 V/s (n = 9). Proarrhythmic action potential changes were observed upon injection of both loss-of-function and gain-of-function IK1, as associated with Andersen–Tawil syndrome type 1 and short QT syndrome type 3, respectively (n = 6). We conclude that injection of in silico IK1 makes the hiPSC-CM a more reliable model for investigating mechanisms underlying cardiac

  4. Analysis of Signaling Endosome Composition and Dynamics Using SILAC in Embryonic Stem Cell-Derived Neurons*

    PubMed Central

    Debaisieux, Solène; Encheva, Vesela; Chakravarty, Probir; Snijders, Ambrosius P.; Schiavo, Giampietro

    2016-01-01

    Neurons require efficient transport mechanisms such as fast axonal transport to ensure neuronal homeostasis and survival. Neurotrophins and their receptors are conveyed via fast axonal retrograde transport of signaling endosomes to the soma, where they elicit transcriptional responses. Despite the essential roles of signaling endosomes in neuronal differentiation and survival, little is known about their molecular identity, dynamics, and regulation. Gaining a better mechanistic understanding of these organelles and their kinetics is crucial, given the growing evidence linking vesicular trafficking deficits to neurodegeneration. Here, we exploited an affinity purification strategy using the binding fragment of tetanus neurotoxin (HCT) conjugated to monocrystalline iron oxide nanoparticles (MIONs), which in motor neurons, is transported in the same carriers as neurotrophins and their receptors. To quantitatively assess the molecular composition of HCT-containing signaling endosomes, we have developed a protocol for triple Stable Isotope Labeling with Amino acids in Cell culture (SILAC) in embryonic stem cell-derived motor neurons. After HCT internalization, retrograde carriers were magnetically isolated at different time points and subjected to mass-spectrometry and Gene Ontology analyses. This purification strategy is highly specific, as confirmed by the presence of essential regulators of fast axonal transport in the make-up of these organelles. Our results indicate that signaling endosomes undergo a rapid maturation with the acquisition of late endosome markers following a specific time-dependent kinetics. Strikingly, signaling endosomes are specifically enriched in proteins known to be involved in neurodegenerative diseases and neuroinfection. Moreover, we highlighted the presence of novel components, whose precise temporal recruitment on signaling endosomes might be essential for proper sorting and/or transport of these organelles. This study provides the first

  5. Induced Pluripotent Stem Cell-Derived Natural Killer Cells for Treatment of Ovarian Cancer.

    PubMed

    Hermanson, David L; Bendzick, Laura; Pribyl, Lee; McCullar, Valarie; Vogel, Rachel Isaksson; Miller, Jeff S; Geller, Melissa A; Kaufman, Dan S

    2016-01-01

    Natural killer (NK) cells can provide effective immunotherapy for ovarian cancer. Here, we evaluated the ability of NK cells isolated from peripheral blood (PB) and NK cells derived from induced pluripotent stem cell (iPSC) to mediate killing of ovarian cancer cells in a mouse xenograft model. A mouse xenograft model was used to evaluate the intraperitoneal delivery of three different NK cell populations: iPSC-derived NK cells, PB-NK cells that had been activated and expanded in long-term culture, and overnight activated PB-NK cells that were isolated through CD3/CD19 depletion of PB B and T cells. Bioluminescent imaging was used to monitor tumor burden of luciferase expressing tumor lines. Tumors were allowed to establish prior to administering NK cells via intraperitoneal injection. These studies demonstrate a single dose of any of the three NK cell populations significantly reduced tumor burden. When mice were given three doses of either iPSC-NK cells or expanded PB-NK cells, the median survival improved from 73 days in mice untreated to 98 and 97 days for treated mice, respectively. From these studies, we conclude iPSC-derived NK cells mediate antiovarian cancer killing at least as well as PB-NK cells, making these cells a viable resource for immunotherapy for ovarian cancer. Due to their ability to be easily differentiated into NK cells and their long-term expansion potential, iPSCs can be used to produce large numbers of well-defined NK cells that can be banked and used to treat a large number of patients including treatment with multiple doses if necessary.

  6. Evaluation of Stem Cell-Derived Red Blood Cells as a Transfusion Product Using a Novel Animal Model

    PubMed Central

    Lewis, Emily M. A.; Farrel, John; Wood, Francine; Strader, Michael Brad; Alayash, Abdu I.; Vostal, Jaroslav G.

    2016-01-01

    Reliance on volunteer blood donors can lead to transfusion product shortages, and current liquid storage of red blood cells (RBCs) is associated with biochemical changes over time, known as ‘the storage lesion’. Thus, there is a need for alternative sources of transfusable RBCs to supplement conventional blood donations. Extracorporeal production of stem cell-derived RBCs (stemRBCs) is a potential and yet untapped source of fresh, transfusable RBCs. A number of groups have attempted RBC differentiation from CD34+ cells. However, it is still unclear whether these stemRBCs could eventually be effective substitutes for traditional RBCs due to potential differences in oxygen carrying capacity, viability, deformability, and other critical parameters. We have generated ex vivo stemRBCs from primary human cord blood CD34+ cells and compared them to donor-derived RBCs based on a number of in vitro parameters. In vivo, we assessed stemRBC circulation kinetics in an animal model of transfusion and oxygen delivery in a mouse model of exercise performance. Our novel, chronically anemic, SCID mouse model can evaluate the potential of stemRBCs to deliver oxygen to tissues (muscle) under resting and exercise-induced hypoxic conditions. Based on our data, stem cell-derived RBCs have a similar biochemical profile compared to donor-derived RBCs. While certain key differences remain between donor-derived RBCs and stemRBCs, the ability of stemRBCs to deliver oxygen in a living organism provides support for further development as a transfusion product. PMID:27959920

  7. Potent Paracrine Effects of human induced Pluripotent Stem Cell-derived Mesenchymal Stem Cells Attenuate Doxorubicin-induced Cardiomyopathy

    PubMed Central

    Zhang, Yuelin; Liang, Xiaoting; Liao, Songyan; Wang, Weixin; Wang, Junwen; Li, Xiang; Ding, Yue; Liang, Yingmin; Gao, Fei; Yang, Mo; Fu, Qingling; Xu, Aimin; Chai, Yuet-Hung; He, Jia; Tse, Hung-Fat; Lian, Qizhou

    2015-01-01

    Transplantation of bone marrow mesenchymal stem cells (BM-MSCs) can protect cardiomyocytes against anthracycline-induced cardiomyopathy (AIC) through paracrine effects. Nonetheless the paracrine effects of human induced pluripotent stem cell-derived MSCs (iPSC-MSCs) on AIC are poorly understood. In vitro studies reveal that doxorubicin (Dox)-induced reactive oxidative stress (ROS) generation and cell apoptosis in neonatal rat cardiomyocytes (NRCMs) are significantly reduced when treated with conditioned medium harvested from BM-MSCs (BM-MSCs-CdM) or iPSC-MSCs (iPSC-MSCs-CdM). Compared with BM-MSCs-CdM, NRCMs treated with iPSC-MSCs-CdM exhibit significantly less ROS and cell apoptosis in a dose-dependent manner. Transplantation of BM-MSCs-CdM or iPSC-MSCs-CdM into mice with AIC remarkably attenuated left ventricular (LV) dysfunction and dilatation. Compared with BM-MSCs-CdM, iPSC-MSCs-CdM treatment showed better alleviation of heart failure, less cardiomyocyte apoptosis and fibrosis. Analysis of common and distinct cytokines revealed that macrophage migration inhibitory factor (MIF) and growth differentiation factor-15 (GDF-15) were uniquely overpresented in iPSC-MSC-CdM. Immunodepletion of MIF and GDF-15 in iPSC-MSCs-CdM dramatically decreased cardioprotection. Injection of GDF-15/MIF cytokines could partially reverse Dox-induced heart dysfunction. We suggest that the potent paracrine effects of iPSC-MSCs provide novel “cell-free” therapeutic cardioprotection against AIC, and that MIF and GDF-15 in iPSC-MSCs-CdM are critical for these enhanced cardioprotective effects. PMID:26057572

  8. Long-term culture of mouse embryonic stem cell-derived adherent neurospheres and functional neurons.

    PubMed

    Hayashi, Mirian A F; Guerreiro, Juliano R; Cassola, Antonio C; Lizier, Nelson F; Kerkis, Alexandre; Camargo, Antonio C M; Kerkis, Irina

    2010-12-01

    Innumerous protocols, using the mouse embryonic stem (ES) cells as model for in vitro study of neurons functional properties and features, have been developed. Most of these protocols are short lasting, which, therefore, does not allow a careful analysis of the neurons maturation, aging, and death processes. We describe here a novel and efficient long-lasting protocol for in vitro ES cells differentiation into neuronal cells. It consists of obtaining embryoid bodies, followed by induction of neuronal differentiation with retinoic acid of nonadherent embryoid bodies (three-dimensional model), which further allows their adherence and formation of adherent neurospheres (AN, bi-dimensional model). The AN can be maintained for at least 12 weeks in culture under repetitive mechanical splitting, providing a constant microenvironment (in vitro niche) for the neuronal progenitor cells avoiding mechanical dissociation of AN. The expression of neuron-specific proteins, such as nestin, sox1, beta III-tubulin, microtubule-associated protein 2, neurofilament medium protein, Tau, neuronal nuclei marker, gamma-aminobutyric acid, and 5-hydroxytryptamine, were confirmed in these cells maintained during 3 months under several splitting. Additionally, expression pattern of microtubule-associated proteins, such as lissencephaly (Lis1) and nuclear distribution element-like (Ndel1), which were shown to be essential for differentiation and migration of neurons during embryogenesis, was also studied. As expected, both proteins were expressed in undifferentiated ES cells, AN, and nonrosette neurons, although presenting different spatial distribution in AN. In contrast to previous studies, using cultured neuronal cells derived from embryonic and adult tissues, only Ndel1 expression was observed in the centrosome region of early neuroblasts from AN. Mature neurons, obtained from ES cells in this work, display ionic channels and oscillations of membrane electrical potential typical of

  9. Cardiac stem cell aging and heart failure.

    PubMed

    Cesselli, Daniela; Aleksova, Aneta; Mazzega, Elisa; Caragnano, Angela; Beltrami, Antonio Paolo

    2017-01-19

    A side effect of the medical improvements of the last centuries is the progressive aging of the world population, which is estimated to reach the impressive number of 2 billion people with more than 65 years by 2050. As a consequence, age-related diseases, such as heart failure, will affect more and more patients in the next years. To understand the biological bases of these diseases will be a crucial task in order to find better treatments, and possibly slow age-related morbidity and mortality. Cardiac stem cells have been at the center of a heated debate and their potential involvement in cardiac homeostasis has been questioned. In this review, we summarize evidence obtained by independent groups, on different animal models and humans, that strongly support the important role played by immature, cardiac resident cells in the cardioprotection against heart failure.

  10. Silencing stem cell factor attenuates stemness and inhibits migration of cancer stem cells derived from Lewis lung carcinoma cells.

    PubMed

    Wang, Li; Wang, JianTao; Li, Zhixi; Liu, YanYang; Jiang, Ming; Li, Yan; Cao, Dan; Zhao, Maoyuan; Wang, Feng; Luo, Feng

    2016-06-01

    Stem cell factor (SCF) plays an important role in tumor growth and metastasis. However, the function of SCF in regulating stemness and migration of cancer stem cells (CSCs) remains largely undefined. Here, we report that non-adhesive culture system can enrich and expand CSCs derived from Lewis lung carcinoma (LLC) cells and that the expression level of SCF in CSCs was higher than those in LLC cells. Silencing SCF via short hairpin (sh) RNA lentivirus transduction attenuated sphere formation and inhibited expressions of stemness genes, ALDH1, Sox2, and Oct4 of CSCs in vitro and in vivo. Moreover, SCF-silenced CSCs inhibited the migration and epithelial-mesenchymal transition, with decreased expression of N-cadherin, Vimentin, and increased expression of E-cadherin in vitro and in vivo. Finally, SCF-short hairpin RNA (shRNA) lentivirus transduction suppressed tumorigenicity of CSCs. Taken together, our findings unraveled an important role of SCF in CSCs derived from LLC cells. SCF might serve as a novel target for lung cancer therapy.

  11. Potent tumor tropism of induced pluripotent stem cells and induced pluripotent stem cell-derived neural stem cells in the mouse intracerebral glioma model.

    PubMed

    Yamazoe, Tomohiro; Koizumi, Shinichiro; Yamasaki, Tomohiro; Amano, Shinji; Tokuyama, Tsutomu; Namba, Hiroki

    2015-01-01

    Although neural and mesenchymal stem cells have been well-known to have a strong glioma tropism, this activity in induced pluripotent stem cells (iPSCs) has not yet been fully studied. In the present study, we tested tumor tropic activity of mouse iPSCs and neural stem cells derived from the iPSC (iPS-NSCs) using in vitro Matrigel invasion chamber assay and in vivo mouse intracranial tumor model. Both iPSC and iPS-NSC had a similar potent in vitro tropism for glioma conditioned media. The migrated iPSCs to the gliomas kept expressing Nanog-GFP gene, suggesting no neuronal or glial differentiation. iPSCs or iPS-NSCs labeled with 5-bromo-2-deoxyuridine were intracranially implanted in the contralateral hemisphere to the GL261 glioma cell implantation in the allogeneic C57BL/6 mouse. Active migration of both stem cells was observed 7 days after implantation. Again, the iPSCs located in the tumor area expressed Nanog-GFP gene, suggesting that the migrated cells were still iPSCs. These findings demonstrated that both iPSCs and iPS-NSCs had potent glioma tropism and could be candidates as vehicles in stem cell-based glioma therapy.

  12. Stem cell-derived vascular endothelial cells and their potential application in regenerative medicine

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Although a 'vascular stem cell' population has not been identified or generated, vascular endothelial and mural cells (smooth muscle cells and pericytes) can be derived from currently known pluripotent stem cell sources, including human embryonic stem cells and induced pluripotent stem cells. We rev...

  13. Isolation and Assessment of Mesenchymal Stem Cells Derived From Bone Marrow: Histologic and Histomorphometric Study in a Canine Periodontal Defect.

    PubMed

    Paknejad, Mojgan; Eslaminejad, Mohamadreza Baghaban; Ghaedi, Baharak; Rokn, Amir-Reza; Khorsand, Afshin; Etemad-Moghadam, Shahroo; Alaeddini, Mojgan; Dehghan, Mohammad Mehdi; Moslemi, Neda; Nowzari, Hessam

    2015-06-01

    The aim of the present study was to investigate an isolation procedure to culture mesenchymal stem cells derived from bone marrow and evaluate their potential in periodontal regeneration. Potential stem cells from bone marrow, aspirated from the iliac crest of nine mongrel canines 1 to 2 years of age, were cultivated. After the examination of surface epitopes of the isolated cells, the total RNA from osteogenic, adipogenic, and chondrogenic cell cultures were analyzed by reverse transcription polymerase chain reaction (RT-PCR) to confirm stem cell gene expressions. 2 × 10(7) mL of the stem cells were loaded on 0.2 mL of anorganic bovine bone mineral (ABBM) granules. In each animal, bilateral acute/chronic intrabony periodontal defects were created surgically and by placement of ligatures around the cervical aspect of the teeth. At week 5, after flap debridement, the bilateral defects were randomly assigned to 2 treatment groups: the control group received ABBM, and the test group received BMSCs-loaded ABBM. Eight weeks after transplantation, regenerative parameters were analyzed histologically and histometrically. The RNA expressions confirmed the cultivation of mesenchymal stem cell. More new cementum and periodontal ligament (PDL) were measured in the test group (cementum: 3.33 ± 0.94 vs 2.03 ± 1.30, P = 0.027; PDL: 2.69 ± 0.73 vs 1.53 ± 1.21, P = 0.026). New bone formation was similar in both groups (2.70 ± 0.86 vs 1.99 ± 1.31; P = 0.193). Mesenchymal stem cells derived from bone marrow should be considered a promising technique for use in patients with periodontal attachment loss and merits further investigations.

  14. Tumor tropism of intravenously injected human-induced pluripotent stem cell-derived neural stem cells and their gene therapy application in a metastatic breast cancer model.

    PubMed

    Yang, Jing; Lam, Dang Hoang; Goh, Sally Sallee; Lee, Esther Xingwei; Zhao, Ying; Tay, Felix Chang; Chen, Can; Du, Shouhui; Balasundaram, Ghayathri; Shahbazi, Mohammad; Tham, Chee Kian; Ng, Wai Hoe; Toh, Han Chong; Wang, Shu

    2012-05-01

    Human pluripotent stem cells can serve as an accessible and reliable source for the generation of functional human cells for medical therapies. In this study, we used a conventional lentiviral transduction method to derive human-induced pluripotent stem (iPS) cells from primary human fibroblasts and then generated neural stem cells (NSCs) from the iPS cells. Using a dual-color whole-body imaging technology, we demonstrated that after tail vein injection, these human NSCs displayed a robust migratory capacity outside the central nervous system in both immunodeficient and immunocompetent mice and homed in on established orthotopic 4T1 mouse mammary tumors. To investigate whether the iPS cell-derived NSCs can be used as a cellular delivery vehicle for cancer gene therapy, the cells were transduced with a baculoviral vector containing the herpes simplex virus thymidine kinase suicide gene and injected through tail vein into 4T1 tumor-bearing mice. The transduced NSCs were effective in inhibiting the growth of the orthotopic 4T1 breast tumor and the metastatic spread of the cancer cells in the presence of ganciclovir, leading to prolonged survival of the tumor-bearing mice. The use of iPS cell-derived NSCs for cancer gene therapy bypasses the sensitive ethical issue surrounding the use of cells derived from human fetal tissues or human embryonic stem cells. This approach may also help to overcome problems associated with allogeneic transplantation of other types of human NSCs.

  15. Stem cell-derived interneuron transplants as a treatment for schizophrenia: preclinical validation in a rodent model.

    PubMed

    Donegan, J J; Tyson, J A; Branch, S Y; Beckstead, M J; Anderson, S A; Lodge, D J

    2016-08-02

    An increasing literature suggests that schizophrenia is associated with a reduction in hippocampal interneuron function. Thus, we posit that stem cell-derived interneuron transplants may be an effective therapeutic strategy to reduce hippocampal hyperactivity and attenuate behavioral deficits in schizophrenia. Here we used a dual-reporter embryonic stem cell line to generate enriched populations of parvalbumin (PV)- or somatostatin (SST)-positive interneurons, which were transplanted into the ventral hippocampus of the methylazoxymethanol rodent model of schizophrenia. These interneuron transplants integrate within the existing circuitry, reduce hippocampal hyperactivity and normalize aberrant dopamine neuron activity. Further, interneuron transplants alleviate behaviors that model negative and cognitive symptoms, including deficits in social interaction and cognitive inflexibility. Interestingly, PV- and SST-enriched transplants produced differential effects on behavior, with PV-enriched populations effectively normalizing all the behaviors examined. These data suggest that the stem cell-derived interneuron transplants may represent a novel therapeutic strategy for schizophrenia.Molecular Psychiatry advance online publication, 2 August 2016; doi:10.1038/mp.2016.121.

  16. Cardiac regeneration: stem cells and beyond.

    PubMed

    Moerkamp, A T; Goumans, Marie-Jose

    2012-01-01

    After myocardial infarction, the lost healthy myocardium is replaced by non-contractile scar tissue which may lead to the development of heart failure and death. There is no curative therapy for the irreversible myocardial cell loss. This review will give an overview of the current options to restore the contractile force of the heart: the different stem cell sources as therapeutic agents in cardiac repair as well as more novel approaches like the activation of endogenous cell populations, the use of paracrine factors and engineered heart tissue.

  17. In vitro culture of isolated primary hepatocytes and stem cell-derived hepatocyte-like cells for liver regeneration.

    PubMed

    Hu, Chenxia; Li, Lanjuan

    2015-08-01

    Various liver diseases result in terminal hepatic failure, and liver transplantation, cell transplantation and artificial liver support systems are emerging as effective therapies for severe hepatic disease. However, all of these treatments are limited by organ or cell resources, so developing a sufficient number of functional hepatocytes for liver regeneration is a priority. Liver regeneration is a complex process regulated by growth factors (GFs), cytokines, transcription factors (TFs), hormones, oxidative stress products, metabolic networks, and microRNA. It is well-known that the function of isolated primary hepatocytes is hard to maintain; when cultured in vitro, these cells readily undergo dedifferentiation, causing them to lose hepatocyte function. For this reason, most studies focus on inducing stem cells, such as embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), hepatic progenitor cells (HPCs), and mesenchymal stem cells (MSCs), to differentiate into hepatocyte-like cells (HLCs) in vitro. In this review, we mainly focus on the nature of the liver regeneration process and discuss how to maintain and enhance in vitro hepatic function of isolated primary hepatocytes or stem cell-derived HLCs for liver regeneration. In this way, hepatocytes or HLCs may be applied for clinical use for the treatment of terminal liver diseases and may prolong the survival time of patients in the near future.

  18. Monitoring the Differentiation and Migration Patterns of Neural Cells Derived from Human Embryonic Stem Cells Using a Microfluidic Culture System

    PubMed Central

    Lee, Nayeon; Park, Jae Woo; Kim, Hyung Joon; Yeon, Ju Hun; Kwon, Jihye; Ko, Jung Jae; Oh, Seung-Hun; Kim, Hyun Sook; Kim, Aeri; Han, Baek Soo; Lee, Sang Chul; Jeon, Noo Li; Song, Jihwan

    2014-01-01

    Microfluidics can provide unique experimental tools to visualize the development of neural structures within a microscale device, which is followed by guidance of neurite growth in the axonal isolation compartment. We utilized microfluidics technology to monitor the differentiation and migration of neural cells derived from human embryonic stem cells (hESCs). We co-cultured hESCs with PA6 stromal cells, and isolated neural rosette-like structures, which subsequently formed neurospheres in suspension culture. Tuj1-positive neural cells, but not nestin-positive neural precursor cells (NPCs), were able to enter the microfluidics grooves (microchannels), suggesting that neural cell-migratory capacity was dependent upon neuronal differentiation stage. We also showed that bundles of axons formed and extended into the microchannels. Taken together, these results demonstrated that microfluidics technology can provide useful tools to study neurite outgrowth and axon guidance of neural cells, which are derived from human embryonic stem cells. PMID:24938227

  19. Galactosylated collagen matrix enhanced in vitro maturation of human embryonic stem cell-derived hepatocyte-like cells.

    PubMed

    Ghodsizadeh, Arefeh; Hosseinkhani, Hossein; Piryaei, Abbas; Pournasr, Behshad; Najarasl, Mostafa; Hiraoka, Yosuke; Baharvand, Hossein

    2014-05-01

    Due to their important biomedical applications, functional human embryonic stem cell-derived hepatocyte-like cells (hESC-HLCs) are an attractive topic in the field of stem cell differentiation. Here, we have initially differentiated hESCs into functional hepatic endoderm (HE) and continued the differentiation by replating them onto galactosylated collagen (GC) and collagen matrices. The differentiation of hESC-HE cells into HLCs on GC substrate showed significant up-regulation of hepatic-specific genes such as ALB, HNF4α, CYP3A4, G6P, and ASGR1. There was more albumin secretion and urea synthesis, as well as more cytochrome p450 activity, in differentiated HLCs on GC compared to the collagen-coated substrate. These results suggested that GC substrate has the potential to be used for in vitro maturation of hESC-HLCs.

  20. Monitoring the differentiation and migration patterns of neural cells derived from human embryonic stem cells using a microfluidic culture system.

    PubMed

    Lee, Nayeon; Park, Jae Woo; Kim, Hyung Joon; Yeon, Ju Hun; Kwon, Jihye; Ko, Jung Jae; Oh, Seung-Hun; Kim, Hyun Sook; Kim, Aeri; Han, Baek Soo; Lee, Sang Chul; Jeon, Noo Li; Song, Jihwan

    2014-06-01

    Microfluidics can provide unique experimental tools to visualize the development of neural structures within a microscale device, which is followed by guidance of neurite growth in the axonal isolation compartment. We utilized microfluidics technology to monitor the differentiation and migration of neural cells derived from human embryonic stem cells (hESCs). We co-cultured hESCs with PA6 stromal cells, and isolated neural rosette-like structures, which subsequently formed neurospheres in suspension culture. Tuj1-positive neural cells, but not nestin-positive neural precursor cells (NPCs), were able to enter the microfluidics grooves (microchannels), suggesting that neural cell-migratory capacity was dependent upon neuronal differentiation stage. We also showed that bundles of axons formed and extended into the microchannels. Taken together, these results demonstrated that microfluidics technology can provide useful tools to study neurite outgrowth and axon guidance of neural cells, which are derived from human embryonic stem cells.

  1. High-Throughput Single-Cell Derived Sphere Formation for Cancer Stem-Like Cell Identification and Analysis

    NASA Astrophysics Data System (ADS)

    Chen, Yu-Chih; Ingram, Patrick N.; Fouladdel, Shamileh; McDermott, Sean P.; Azizi, Ebrahim; Wicha, Max S.; Yoon, Euisik

    2016-06-01

    Considerable evidence suggests that many malignancies are driven by a cellular compartment that displays stem cell properties. Cancer stem-like cells (CSCs) can be identified by expression of cell surface markers or enzymatic activity, but these methods are limited by phenotypic heterogeneity and plasticity of CSCs. An alternative phenotypic methodology based on in-vitro sphere formation has been developed, but it is typically labor-intensive and low-throughput. In this work, we present a 1,024-microchamber microfluidic platform for single-cell derived sphere formation. Utilizing a hydrodynamic capturing scheme, more than 70% of the microchambers capture only one cell, allowing for monitoring of sphere formation from heterogeneous cancer cell populations for identification of CSCs. Single-cell derived spheres can be retrieved and dissociated for single-cell analysis using a custom 96-gene panel to probe heterogeneity within the clonal CSC spheres. This microfluidic platform provides reliable and high-throughput sphere formation for CSC identification and downstream clonal analysis.

  2. High-Throughput Single-Cell Derived Sphere Formation for Cancer Stem-Like Cell Identification and Analysis

    PubMed Central

    Chen, Yu-Chih; Ingram, Patrick N.; Fouladdel, Shamileh; McDermott, Sean P.; Azizi, Ebrahim; Wicha, Max S.; Yoon, Euisik

    2016-01-01

    Considerable evidence suggests that many malignancies are driven by a cellular compartment that displays stem cell properties. Cancer stem-like cells (CSCs) can be identified by expression of cell surface markers or enzymatic activity, but these methods are limited by phenotypic heterogeneity and plasticity of CSCs. An alternative phenotypic methodology based on in-vitro sphere formation has been developed, but it is typically labor-intensive and low-throughput. In this work, we present a 1,024-microchamber microfluidic platform for single-cell derived sphere formation. Utilizing a hydrodynamic capturing scheme, more than 70% of the microchambers capture only one cell, allowing for monitoring of sphere formation from heterogeneous cancer cell populations for identification of CSCs. Single-cell derived spheres can be retrieved and dissociated for single-cell analysis using a custom 96-gene panel to probe heterogeneity within the clonal CSC spheres. This microfluidic platform provides reliable and high-throughput sphere formation for CSC identification and downstream clonal analysis. PMID:27292795

  3. Optimization of surface-immobilized extracellular matrices for the proliferation of neural progenitor cells derived from induced pluripotent stem cells.

    PubMed

    Komura, Takashi; Kato, Koichi; Konagaya, Shuhei; Nakaji-Hirabayashi, Tadashi; Iwata, Hiroo

    2015-11-01

    Neural progenitor cells derived from induced pluripotent stem cells have been considered as a potential source for cell-transplantation therapy of central nervous disorders. However, efficient methods to expand neural progenitor cells are further required for their clinical applications. In this study, a protein array was fabricated with nine extracellular matrices and used to screen substrates suitable for the expansion of neural progenitor cells derived from mouse induced pluripotent stem cells. The results showed that neural progenitor cells efficiently proliferated on substrates with immobilized laminin-1, laminin-5, or Matrigel. Based on this result, further attempts were made to develop clinically compliant substrates with immobilized polypeptides that mimic laminin-1, one of the most effective extracellular matrices as identified in the array-based screening. We used here recombinant DNA technology to prepare polypeptide containing the globular domain 3 of laminin-1 and immobilized it onto glass-based substrates. Our results showed that neural progenitor cells selectively proliferated on substrate with the immobilized polypeptide while maintaining their differentiated state.

  4. Region-Specific Integration of Embryonic Stem Cell-Derived Neuronal Precursors into a Pre-Existing Neuronal Circuit

    PubMed Central

    Neuser, Franziska; Polack, Martin; Annaheim, Christine; Tucker, Kerry L.; Korte, Martin

    2013-01-01

    Enduring reorganization is accepted as a fundamental process of adult neural plasticity. The most dramatic example of this reorganization is the birth and continuously occurring incorporation of new neurons into the pre-existing network of the adult mammalian hippocampus. Based on this phenomenon we transplanted murine embryonic stem (ES)-cell derived neuronal precursors (ESNPs) into murine organotypic hippocampal slice cultures (OHC) and examined their integration. Using a precise quantitative morphological analysis combined with a detailed electrophysiology, we show a region-specific morphological integration of transplanted ESNPs into different subfields of the hippocampal tissue, resulting in pyramidal neuron-like embryonic stem cell-derived neurons (ESNs) in the Cornu Ammonis (CA1 and CA3) and granule neuron-like ESNs in the dentate gyrus (DG), respectively. Subregion specific structural maturation was accompanied by the development of dendritic spines and the generation of excitatory postsynaptic currents (EPSCs). This cell type specific development does not depend upon NMDA-receptor-dependent synaptic transmission. The presented integration approach was further used to determine the cell-autonomous function of the pan-neurotrophin receptor p75 (P75NTR), as a possible negative regulator of ESN integration. By this means we used p75NTR-deficient ESNPs to study their integration into a WT organotypic environment. We show here that p75NTR is not necessary for integration per se but plays a suppressing role in dendritic development. PMID:23840491

  5. Tubular Cardiac Tissues Derived from Human Induced Pluripotent Stem Cells Generate Pulse Pressure In Vivo

    PubMed Central

    Seta, Hiroyoshi; Matsuura, Katsuhisa; Sekine, Hidekazu; Yamazaki, Kenji; Shimizu, Tatsuya

    2017-01-01

    Human induced pluripotent stem (iPS) cell-derived cardiac cells provide the possibility to fabricate cardiac tissues for transplantation. However, it remains unclear human bioengineered cardiac tissues function as a functional pump in vivo. Human iPS cells induced to cardiomyocytes in suspension were cultured on temperature-responsive dishes to fabricate cardiac cell sheets. Two pairs of triple-layered sheets were transplanted to wrap around the inferior vena cava (IVC) of nude rats. At 4 weeks after transplantation, inner pressure changes in the IVC were synchronized with electrical activations of the graft. Under 80 pulses per minute electrical stimulation, the inner pressure changes at 8 weeks increased to 9.1 ± 3.2 mmHg, which were accompanied by increases in the baseline inner pressure of the IVC. Immunohistochemical analysis revealed that 0.5-mm-thick cardiac troponin T-positive cardiac tissues, which contained abundant human mitochondria, were clearly engrafted lamellar around the IVC and surrounded by von Willebrand factor-positive capillary vessels. The mRNA expression of several contractile proteins in cardiac tissues at 8 weeks in vivo was significantly upregulated compared with those at 4 weeks. We succeeded in generating pulse pressure by tubular human cardiac tissues in vivo. This technology might lead to the development of a bioengineered heart assist pump. PMID:28358136

  6. Isolation and Characterization of Pluripotent Human Spermatogonial Stem Cell-Derived Cells

    PubMed Central

    Kossack, Nina; Meneses, Juanito; Shefi, Shai; Nguyen, Ha Nam; Chavez, Shawn; Nicholas, Cory; Gromoll, Joerg; Turek, Paul J; Reijo-Pera, Renee A

    2009-01-01

    Several reports have documented the derivation of pluripotent cells (multipotent germline stem cells) from spermatogonial stem cells obtained from the adult mouse testis. These spermatogonia-derived stem cells express embryonic stem cell markers and differentiate to the three primary germ layers, as well as the germline. Data indicate that derivation may involve reprogramming of endogenous spermatogonia in culture. Here, we report the derivation of human multipotent germline stem cells (hMGSCs) from a testis biopsy. The cells express distinct markers of pluripotency, form embryoid bodies that contain derivatives of all three germ layers, maintain a normal XY karyotype, are hypomethylated at the H19 locus, and express high levels of telomerase. Teratoma assays indicate the presence of human cells 8 weeks post-transplantation but limited teratoma formation. Thus, these data suggest the potential to derive pluripotent cells from human testis biopsies but indicate a need for novel strategies to optimize hMGSC culture conditions and reprogramming. PMID:18927477

  7. Nitric Oxide-cGMP-PKG Pathway Acts on Orai1 to Inhibit the Hypertrophy of Human Embryonic Stem Cell-Derived Cardiomyocytes.

    PubMed

    Wang, Y; Li, Z C; Zhang, P; Poon, E; Kong, C W; Boheler, K R; Huang, Y; Li, R A; Yao, X

    2015-10-01

    Cardiac hypertrophy is an abnormal enlargement of heart muscle. It frequently results in congestive heart failure, which is a leading cause of human death. Previous studies demonstrated that the nitric oxide (NO), cyclic GMP (cGMP), and protein kinase G (PKG) signaling pathway can inhibit cardiac hypertrophy and thus improve cardiac function. However, the underlying mechanisms are not fully understood. Here, based on the human embryonic stem cell-derived cardiomyocyte (hESC-CM) model system, we showed that Orai1, the pore-forming subunit of store-operated Ca(2+) entry (SOCE), is the downstream effector of PKG. Treatment of hESC-CMs with an α-adrenoceptor agonist phenylephrine (PE) caused a marked hypertrophy, which was accompanied by an upregulation of Orai1. Moreover, suppression of Orai1 expression/activity using Orai1-siRNAs or a dominant-negative construct Orai1(G98A) inhibited the hypertrophy, suggesting that Orai1-mediated SOCE is indispensable for the PE-induced hypertrophy of hESC-CMs. In addition, the hypertrophy was inhibited by NO and cGMP via activating PKG. Importantly, substitution of Ala for Ser(34) in Orai1 abolished the antihypertrophic effects of NO, cGMP, and PKG. Furthermore, PKG could directly phosphorylate Orai1 at Ser(34) and thus prevent Orai1-mediated SOCE. Together, we conclude that NO, cGMP, and PKG inhibit the hypertrophy of hESC-CMs via PKG-mediated phosphorylation on Orai1-Ser-34. These results provide novel mechanistic insights into the action of cGMP-PKG-related antihypertrophic agents, such as NO donors and sildenafil.

  8. Focus on Extracellular Vesicles: Therapeutic Potential of Stem Cell-Derived Extracellular Vesicles.

    PubMed

    Zhang, Bin; Yeo, Ronne Wee Yeh; Tan, Kok Hian; Lim, Sai Kiang

    2016-02-06

    The intense research focus on stem and progenitor cells could be attributed to their differentiation potential to generate new cells to replace diseased or lost cells in many highly intractable degenerative diseases, such as Alzheimer disease, multiple sclerosis, and heart diseases. However, experimental and clinical studies have increasingly attributed the therapeutic efficacy of these cells to their secretion. While stem and progenitor cells secreted many therapeutic molecules, none of these molecules singly or in combination could recapitulate the functional effects of stem cell transplantations. Recently, it was reported that extracellular vesicles (EVs) could recapitulate the therapeutic effects of stem cell transplantation. Based on the observations reported thus far, the prevailing hypothesis is that stem cell EVs exert their therapeutic effects by transferring biologically active molecules such as proteins, lipids, mRNA, and microRNA from the stem cells to injured or diseased cells. In this respect, stem cell EVs are similar to EVs from other cell types. They are both primarily vehicles for intercellular communication. Therefore, the differentiating factor is likely due to the composition of their cargo. The cargo of EVs from different cell types are known to include a common set of proteins and also proteins that reflect the cell source of the EVs and the physiological or pathological state of the cell source. Hence, elucidation of the stem cell EV cargo would provide an insight into the multiple physiological or biochemical changes necessary to affect the many reported stem cell-based therapeutic outcomes in a variety of experimental models and clinical trials.

  9. Stromal cell-derived factor-1 mediates changes of bone marrow stem cells during the bone repair process.

    PubMed

    Okada, Kiyotaka; Kawao, Naoyuki; Yano, Masato; Tamura, Yukinori; Kurashimo, Shinzi; Okumoto, Katsumi; Kojima, Kotarou; Kaji, Hiroshi

    2016-01-01

    Osteoblasts, osteoclasts, chondrocytes, and macrophages that participate in the bone repair process are derived from hematopoietic stem cells (HSCs) and mesenchymal stem cells (MSCs). However, the roles of these stem cells during the repair of injured bone tissue are still unclear. In the present study, we examined the effects of bone defect on HSCs and MSCs in bone marrow and spleen in 75 mice and its mechanism. We analyzed the HSC and MSC populations in these tissues of a mouse with femoral bone damage by using flow cytometry. The number of HSCs in the bone marrow of mice with damaged femurs was significantly lower than the number of these cells in the bone marrow of the contralateral intact femurs on day 2 after injury. Meanwhile, the number of MSCs in the bone marrow of mice with damaged femurs was significantly higher than that of the contralateral femurs. Both intraperitoneal administration of AMD3100, a C-X-C chemokine receptor 4 (CXCR4) antagonist, and local treatment with an anti-stromal cell-derived factor-1 (SDF-1) antibody blunted the observed decrease in HSC and increase in MSC populations within the bone marrow of injured femurs. In conclusion, the present study revealed that there is a concurrent decrease and increase in the numbers of HSCs and MSCs, respectively, in the bone marrow during repair of mouse femoral bone damage. Furthermore, the SDF-1/CXCR4 system was implicated as contributing to the changes in these stem cell populations upon bone injury.

  10. Stem cell-derived vasculature: A potent and multidimensional technology for basic research, disease modeling, and tissue engineering

    PubMed Central

    Lowenthal, Justin; Gerecht, Sharon

    2016-01-01

    Proper blood vessel networks are necessary for constructing and re-constructing tissues, promoting wound healing, and delivering metabolic necessities throughout the body. Conversely, an understanding of vascular dysfunction has provided insight into the pathogenesis and progression of diseases both common and rare. Recent advances in stem cell-based regenerative medicine – including advances in stem cell technologies and related progress in bioscaffold design and complex tissue engineering – have allowed rapid advances in the field of vascular biology, leading in turn to more advanced modeling of vascular pathophysiology and improved engineering of vascularized tissue constructs. In this review we examine recent advances in the field of stem cell-derived vasculature, providing an overview of stem cell technologies as a source for vascular cell types and then focusing on their use in three primary areas: studies of vascular development and angiogenesis, improved disease modeling, and the engineering of vascularized constructs for tissue-level modeling and cell-based therapies. PMID:26427871

  11. Effect of age on pro-inflammatory miRNAs contained in mesenchymal stem cell-derived extracellular vesicles.

    PubMed

    Fafián-Labora, J; Lesende-Rodriguez, I; Fernández-Pernas, P; Sangiao-Alvarellos, S; Monserrat, L; Arntz, O J; Loo, F J Van de; Mateos, J; Arufe, M C

    2017-03-06

    Stem cells possess significant age-dependent differences in their immune-response profile. These differences were analysed by Next-Generation Sequencing of six age groups from bone marrow mesenchymal stem cells. A total of 9,628 genes presenting differential expression between age groups were grouped into metabolic pathways. We focused our research on young, pre-pubertal and adult groups, which presented the highest amount of differentially expressed genes related to inflammation mediated by chemokine and cytokine signalling pathways compared with the newborn group, which was used as a control. Extracellular vesicles extracted from each group were characterized by nanoparticle tracking and flow cytometry analysis, and several micro-RNAs were verified by quantitative real-time polymerase chain reaction because of their relationship with the pathway of interest. Since miR-21-5p showed the highest statistically significant expression in extracellular vesicles from mesenchymal stem cells of the pre-pubertal group, we conducted a functional experiment inhibiting its expression and investigating the modulation of Toll-Like Receptor 4 and their link to damage-associated molecular patterns. Together, these results indicate for the first time that mesenchymal stem cell-derived extracellular vesicles have significant age-dependent differences in their immune profiles.

  12. Effect of age on pro-inflammatory miRNAs contained in mesenchymal stem cell-derived extracellular vesicles

    PubMed Central

    Fafián-Labora, J.; Lesende-Rodriguez, I.; Fernández-Pernas, P.; Sangiao-Alvarellos, S.; Monserrat, L.; Arntz, O. J.; Loo, F. J. Van de; Mateos, J.; Arufe, M. C.

    2017-01-01

    Stem cells possess significant age-dependent differences in their immune-response profile. These differences were analysed by Next-Generation Sequencing of six age groups from bone marrow mesenchymal stem cells. A total of 9,628 genes presenting differential expression between age groups were grouped into metabolic pathways. We focused our research on young, pre-pubertal and adult groups, which presented the highest amount of differentially expressed genes related to inflammation mediated by chemokine and cytokine signalling pathways compared with the newborn group, which was used as a control. Extracellular vesicles extracted from each group were characterized by nanoparticle tracking and flow cytometry analysis, and several micro-RNAs were verified by quantitative real-time polymerase chain reaction because of their relationship with the pathway of interest. Since miR-21-5p showed the highest statistically significant expression in extracellular vesicles from mesenchymal stem cells of the pre-pubertal group, we conducted a functional experiment inhibiting its expression and investigating the modulation of Toll-Like Receptor 4 and their link to damage-associated molecular patterns. Together, these results indicate for the first time that mesenchymal stem cell-derived extracellular vesicles have significant age-dependent differences in their immune profiles. PMID:28262816

  13. A basis for comparison: sensitive authentication of stem cell derived RPE using physiological responses of intact RPE monolayers

    PubMed Central

    Miyagishima, Kiyoharu J.; Wan, Qin; Miller, Sheldon S.; Bharti, Kapil

    2017-01-01

    The retinal pigment epithelium (RPE) is a monolayer of highly specialized cells that help maintain the chemical composition of its surrounding subretinal and choroidal extracellular spaces. Retinal cells (photoreceptors in particular), RPE, and choroidal endothelial cells together help ensure a homeostatically stable metabolic environment with exquisitely sensitive functional responses to light. Aging and disease of the RPE impairs its supportive functions contributing to the progressive loss of photoreceptors and vision. The prevalence of RPE associated retinal degenerations has prompted researchers to develop new therapies aimed at replacing the affected RPE with induced pluripotent stem cell (iPSC) or embryonic stem cell (ESC) derived RPE. Despite recent attempts to characterize stem cell derived RPE and to truly authenticate RPE for clinical applications, there remains a significant unmet need to explore the heterogeneity resulting from donor to donor variation as well as the variations inherent in the current processes of cell manufacture. Additionally, it remains unknown whether the starting cell type influences the resulting RPE phenotype following reprogramming and differentiation. To address these questions, we performed a comprehensive evaluation (genomic, structural, and functional) of 15 iPSC derived RPE originating from different donors and tissues and compiled a reference data set for the authentication of iPSC-derived RPE and RPE derived from other stem cell sources. PMID:28286868

  14. Slow-Adhering Stem Cells Derived from Injured Skeletal Muscle Have Improved Regenerative Capacity

    DTIC Science & Technology

    2011-08-01

    levels represent a major determi- nant in the regenerative capacity of muscle stem cells. Mol Biol Cell 2009, 20:509–520 43. Quintero AJ, Wright VJ, Fu...injury on their characteristics and engraftment potential has yet to be described. In the present study, slow-adhering stem cells (SASCs) from both...laceration-injured and control noninjured skeletal muscles in mice were iso- lated and studied. Migration and proliferation rates, multidifferentiation

  15. Mouse embryonic stem cell-derived cells reveal niches that support neuronal differentiation in the adult rat brain.

    PubMed

    Maya-Espinosa, Guadalupe; Collazo-Navarrete, Omar; Millán-Aldaco, Diana; Palomero-Rivero, Marcela; Guerrero-Flores, Gilda; Drucker-Colín, René; Covarrubias, Luis; Guerra-Crespo, Magdalena

    2015-02-01

    A neurogenic niche can be identified by the proliferation and differentiation of its naturally residing neural stem cells. However, it remains unclear whether "silent" neurogenic niches or regions suitable for neural differentiation, other than the areas of active neurogenesis, exist in the adult brain. Embryoid body (EB) cells derived from embryonic stem cells (ESCs) are endowed with a high potential to respond to specification and neuralization signals of the embryo. Hence, to identify microenvironments in the postnatal and adult rat brain with the capacity to support neuronal differentiation, we transplanted dissociated EB cells to conventional neurogenic and non-neurogenic regions. Our results show a neuronal differentiation pattern of EB cells that was dependent on the host region. Efficient neuronal differentiation of EB cells occurred within an adjacent region to the rostral migratory stream. EB cell differentiation was initially patchy and progressed toward an even distribution along the graft by 15-21 days post-transplantation, giving rise mostly to GABAergic neurons. EB cells in the striatum displayed a lower level of neuronal differentiation and derived into a significant number of astrocytes. Remarkably, when EB cells were transplanted to the striatum of adult rats after a local ischemic stroke, increased number of neuroblasts and neurons were observed. Unexpectedly, we determined that the adult substantia nigra pars compacta, considered a non-neurogenic area, harbors a robust neurogenic environment. Therefore, neurally uncommitted cells derived from ESCs can detect regions that support neuronal differentiation within the adult brain, a fundamental step for the development of stem cell-based replacement therapies.

  16. Human Stem Cell-Derived Endothelial-Hepatic Platform for Efficacy Testing of Vascular-Protective Metabolites from Nutraceuticals.

    PubMed

    Narmada, Balakrishnan Chakrapani; Goh, Yeek Teck; Li, Huan; Sinha, Sanjay; Yu, Hanry; Cheung, Christine

    2017-03-01

    Atherosclerosis underlies many cardiovascular and cerebrovascular diseases. Nutraceuticals are emerging as a therapeutic moiety for restoring vascular health. Unlike small-molecule drugs, the complexity of ingredients in nutraceuticals often confounds evaluation of their efficacy in preclinical evaluation. It is recognized that the liver is a vital organ in processing complex compounds into bioactive metabolites. In this work, we developed a coculture system of human pluripotent stem cell-derived endothelial cells (hPSC-ECs) and human pluripotent stem cell-derived hepatocytes (hPSC-HEPs) for predicting vascular-protective effects of nutraceuticals. To validate our model, two compounds (quercetin and genistein), known to have anti-inflammatory effects on vasculatures, were selected. We found that both quercetin and genistein were ineffective at suppressing inflammatory activation by interleukin-1β owing to limited metabolic activity of hPSC-ECs. Conversely, hPSC-HEPs demonstrated metabolic capacity to break down both nutraceuticals into primary and secondary metabolites. When hPSC-HEPs were cocultured with hPSC-ECs to permit paracrine interactions, the continuous turnover of metabolites mitigated interleukin-1β stimulation on hPSC-ECs. We observed significant reductions in inflammatory gene expressions, nuclear translocation of nuclear factor κB, and interleukin-8 production. Thus, integration of hPSC-HEPs could accurately reproduce systemic effects involved in drug metabolism in vivo to unravel beneficial constituents in nutraceuticals. This physiologically relevant endothelial-hepatic platform would be a great resource in predicting the efficacy of complex nutraceuticals and mechanistic interrogation of vascular-targeting candidate compounds. Stem Cells Translational Medicine 2017;6:851-863.

  17. Stem cell-derived models to improve mechanistic understanding and prediction of human drug induced liver injury

    PubMed Central

    Goldring, Christopher; Antoine, Daniel J.; Bonner, Frank; Crozier, Jonathan; Denning, Chris; Fontana, Robert J.; Hanley, Neil A.; Hay, David C.; Ingelman-Sundberg, Magnus; Juhila, Satu; Kitteringham, Neil; Silva-Lima, Beatriz; Norris, Alan; Pridgeon, Chris; Ross, James A.; Sison Young, Rowena; Tagle, Danilo; Tornesi, Belen; van de Water, Bob; Weaver, Richard J.; Zhang, Fang; Park, B. Kevin

    2016-01-01

    Current preclinical drug testing does not predict some forms of adverse drug reactions in humans. Efforts at improving predictability of drug-induced tissue injury in humans include using stem cell technology to generate human cells for screening for adverse effects of drugs in humans. The advent of induced pluripotent stem cells means that it may ultimately be possible to develop personalised toxicology to determine inter-individual susceptibility to adverse drug reactions. However, the complexity of idiosyncratic drug-induced liver injury (DILI) means that no current single cell model, whether of primary liver tissue origin, from liver cell lines, or derived from stem cells, adequately emulates what is believed to occur during human DILI. Nevertheless, a single cell model of a human hepatocyte which emulates key features of a hepatocyte is likely to be valuable in assessing potential chemical risk; furthermore understanding how to generate a relevant hepatocyte will also be critical to efforts to build complex multicellular models of the liver. Currently, hepatocyte-like cells differentiated from stem cells still fall short of recapitulating the full mature hepatocellular phenotype. Therefore, we convened a number of experts from the areas of preclinical and clinical hepatotoxicity and safety assessment, from industry, academia and regulatory bodies, to specifically explore the application of stem cells in hepatotoxicity safety assessment, and to make recommendations for the way forward. In this short review, we particularly discuss the importance of benchmarking stem cell-derived hepatocyte-like cells to their terminally-differentiated human counterparts using defined phenotyping, to make sure the cells are relevant and comparable between labs, and outline why this process is essential before the cells are introduced into chemical safety assessment. PMID:27775817

  18. Stem cell-derived models to improve mechanistic understanding and prediction of human drug-induced liver injury.

    PubMed

    Goldring, Christopher; Antoine, Daniel J; Bonner, Frank; Crozier, Jonathan; Denning, Chris; Fontana, Robert J; Hanley, Neil A; Hay, David C; Ingelman-Sundberg, Magnus; Juhila, Satu; Kitteringham, Neil; Silva-Lima, Beatriz; Norris, Alan; Pridgeon, Chris; Ross, James A; Young, Rowena Sison; Tagle, Danilo; Tornesi, Belen; van de Water, Bob; Weaver, Richard J; Zhang, Fang; Park, B Kevin

    2017-02-01

    Current preclinical drug testing does not predict some forms of adverse drug reactions in humans. Efforts at improving predictability of drug-induced tissue injury in humans include using stem cell technology to generate human cells for screening for adverse effects of drugs in humans. The advent of induced pluripotent stem cells means that it may ultimately be possible to develop personalized toxicology to determine interindividual susceptibility to adverse drug reactions. However, the complexity of idiosyncratic drug-induced liver injury means that no current single-cell model, whether of primary liver tissue origin, from liver cell lines, or derived from stem cells, adequately emulates what is believed to occur during human drug-induced liver injury. Nevertheless, a single-cell model of a human hepatocyte which emulates key features of a hepatocyte is likely to be valuable in assessing potential chemical risk; furthermore, understanding how to generate a relevant hepatocyte will also be critical to efforts to build complex multicellular models of the liver. Currently, hepatocyte-like cells differentiated from stem cells still fall short of recapitulating the full mature hepatocellular phenotype. Therefore, we convened a number of experts from the areas of preclinical and clinical hepatotoxicity and safety assessment, from industry, academia, and regulatory bodies, to specifically explore the application of stem cells in hepatotoxicity safety assessment and to make recommendations for the way forward. In this short review, we particularly discuss the importance of benchmarking stem cell-derived hepatocyte-like cells to their terminally differentiated human counterparts using defined phenotyping, to make sure the cells are relevant and comparable between labs, and outline why this process is essential before the cells are introduced into chemical safety assessment. (Hepatology 2017;65:710-721).

  19. Cardiac Aging – Getting to the Stem of the Problem

    PubMed Central

    Hariharan, Nirmala; Sussman, Mark A.

    2015-01-01

    Cardiac aging is a heterogeneous process caused by a combination of stochastic events which manifests as loss of structure and function in the heart, however several recent studies draw attention to aging being primarily a stem cell problem. This review summarizes findings in support of the “stem cell hypothesis of aging” and discusses the impact of age on cardiac stem cells and the niche. PMID:25886698

  20. Effects of Asiasari radix on the morphology and viability of mesenchymal stem cells derived from the gingiva.

    PubMed

    Jeong, Su-Hyeon; Lee, Ji-Eun; Jin, Seong-Ho; Ko, Youngkyung; Park, Jun-Beom

    2014-12-01

    Medicinal herbs used in traditional Oriental medicine, which have been in use clinically for thousands of years, are attractive sources of novel therapeutics or preventatives. Asiasari radix (A. radix) has been suggested for use in the treatment of dental diseases, including toothache and aphthous stomatitis. The aim of this study was to evaluate the effects of A. radix extracts on the morphology and viability of human stem cells derived from the gingiva. An Asiasarum heterotropoides extract was centrifuged and freeze-dried in a lyophilizer. Stem cells derived from the gingiva were grown in the presence of A. radix at concentrations ranging between 0.1 µg/ml and 1 mg/ml (0, 0.1, 1, 10, 100 and 1,000 µg/ml). Cell morphology was evaluated with an optical microscope and the viability of the cells was quantitatively analyzed with a cell counting kit-8 (CCK-8) assay for up to seven days. The untreated control group exhibited normal fibroblast morphology. The shapes of the cells following 0.1, 1, 10 and 100 µg/ml A. radix treatments were similar to those of the control group. However, a significant change was noted in the 1,000 µg/ml group on day 1, when compared with the untreated group. Furthermore, on day 7, the shapes of the cells following 100 and 1,000 µg/ml A. radix treatments were rounder and fewer cells were present, when compared with those of the control group. The cultures that grew in the presence of A. radix did not exhibit any changes in the CCK‑8 assay on day 2; however, significant reductions in cell viability were noticed following 100 and 1,000 µg/ml A. radix treatment on days 5 and 7. Within the limits of this study, A. radix influenced the viability of the stem cells derived from the gingiva. Thus, the direct application of A. radix to oral tissues may produce adverse effects at high doses. Therefore, the concentration and application time of A. radix requires meticulous control to obtain optimal results. These effects require consideration

  1. Mesenchymal stem cells derived from adipose tissue are not affected by renal disease.

    PubMed

    Roemeling-van Rhijn, Marieke; Reinders, Marlies E J; de Klein, Annelies; Douben, Hannie; Korevaar, Sander S; Mensah, Fane K F; Dor, Frank J M F; IJzermans, Jan N M; Betjes, Michiel G H; Baan, Carla C; Weimar, Willem; Hoogduijn, Martin J

    2012-10-01

    Mesenchymal stem cells are a potential therapeutic agent in renal disease and kidney transplantation. Autologous cell use in kidney transplantation is preferred to avoid anti-HLA reactivity; however, the influence of renal disease on mesenchymal stem cells is unknown. To investigate the feasibility of autologous cell therapy in patients with renal disease, we isolated these cells from subcutaneous adipose tissue of healthy controls and patients with renal disease and compared them phenotypically and functionally. The mesenchymal stem cells from both groups showed similar morphology and differentiation capacity, and were both over 90% positive for CD73, CD105, and CD166, and negative for CD31 and CD45. They demonstrated comparable population doubling times, rates of apoptosis, and were both capable of inhibiting allo-antigen- and anti-CD3/CD28-activated peripheral blood mononuclear cell proliferation. In response to immune activation they both increased the expression of pro-inflammatory and anti-inflammatory factors. These mesenchymal stem cells were genetically stable after extensive expansion and, importantly, were not affected by uremic serum. Thus, mesenchymal stem cells of patients with renal disease have similar characteristics and functionality as those from healthy controls. Hence, our results indicate the feasibility of their use in autologous cell therapy in patients with renal disease.

  2. Pluripotent stem cells derived from mouse primordial germ cells by small molecule compounds.

    PubMed

    Kimura, Tohru; Kaga, Yoshiaki; Sekita, Yoichi; Fujikawa, Keita; Nakatani, Tsunetoshi; Odamoto, Mika; Funaki, Soichiro; Ikawa, Masahito; Abe, Kuniya; Nakano, Toru

    2015-01-01

    Primordial germ cells (PGCs) can give rise to pluripotent stem cells known as embryonic germ cells (EGCs) when cultured with basic fibroblast growth factor (bFGF), stem cell factor (SCF), and leukemia inhibitory factor. Somatic cells can give rise to induced pluripotent stem cells (iPSCs) by introduction of the reprogramming transcription factors Oct4, Sox2, and Klf4. The effects of Sox2 and Klf4 on somatic cell reprogramming can be reproduced using the small molecule compounds, transforming growth factor-β receptor (TGFβR) inhibitor and Kempaullone, respectively. Here we examined the effects of TGFβR inhibitor and Kempaullone on EGC derivation from PGCs. Treatment of PGCs with TGFβR inhibitor and/or Kempaullone generated pluripotent stem cells under standard embryonic stem cell (ESC) culture conditions without bFGF and SCF, which we termed induced EGCs (iEGCs). The derivation efficiency of iEGCs was dependent on the differentiation stage and sex. DNA methylation levels of imprinted genes in iEGCs were reduced, with the exception of the H19 gene. The promoters of genes involved in germline development were generally hypomethylated in PGCs, but three germline genes showed comparable DNA methylation levels among iEGs, ESCs, and iPSCs. These results show that PGCs can be reprogrammed into pluripotent state using small molecule compounds, and that DNA methylation of these germline genes is not maintained in iEGCs.

  3. Adipose stem cell-derived nanovesicles inhibit emphysema primarily via an FGF2-dependent pathway

    PubMed Central

    Kim, You-Sun; Kim, Ji-Young; Cho, RyeonJin; Shin, Dong-Myung; Lee, Sei Won; Oh, Yeon-Mok

    2017-01-01

    Cell therapy using stem cells has produced therapeutic benefits in animal models of COPD. Secretory mediators are proposed as one mechanism for stem cell effects because very few stem cells engraft after injection into recipient animals. Recently, nanovesicles that overcome the disadvantages of natural exosomes have been generated artificially from cells. We generated artificial nanovesicles from adipose-derived stem cells (ASCs) using sequential penetration through polycarbonate membranes. ASC-derived artificial nanovesicles displayed a 100 nm-sized spherical shape similar to ASC-derived natural exosomes and expressed both exosomal and stem cell markers. The proliferation rate of lung epithelial cells was increased in cells treated with ASC-derived artificial nanovesicles compared with cells treated with ASC-derived natural exosomes. The lower dose of ASC-derived artificial nanovesicles had similar regenerative capacity compared with a higher dose of ASCs and ASC-derived natural exosomes. In addition, FGF2 levels in the lungs of mice treated with ASC-derived artificial nanovesicles were increased. The uptake of ASC-derived artificial nanovesicles was inhibited by heparin, which is a competitive inhibitor of heparan sulfate proteoglycan that is associated with FGF2 signaling. Taken together, the data indicate that lower doses of ASC-derived artificial nanovesicles may have beneficial effects similar to higher doses of ASCs or ASC-derived natural exosomes in an animal model with emphysema, suggesting that artificial nanovesicles may have economic advantages that warrant future clinical studies. PMID:28082743

  4. Adipose stem cell-derived nanovesicles inhibit emphysema primarily via an FGF2-dependent pathway.

    PubMed

    Kim, You-Sun; Kim, Ji-Young; Cho, RyeonJin; Shin, Dong-Myung; Lee, Sei Won; Oh, Yeon-Mok

    2017-01-13

    Cell therapy using stem cells has produced therapeutic benefits in animal models of COPD. Secretory mediators are proposed as one mechanism for stem cell effects because very few stem cells engraft after injection into recipient animals. Recently, nanovesicles that overcome the disadvantages of natural exosomes have been generated artificially from cells. We generated artificial nanovesicles from adipose-derived stem cells (ASCs) using sequential penetration through polycarbonate membranes. ASC-derived artificial nanovesicles displayed a 100 nm-sized spherical shape similar to ASC-derived natural exosomes and expressed both exosomal and stem cell markers. The proliferation rate of lung epithelial cells was increased in cells treated with ASC-derived artificial nanovesicles compared with cells treated with ASC-derived natural exosomes. The lower dose of ASC-derived artificial nanovesicles had similar regenerative capacity compared with a higher dose of ASCs and ASC-derived natural exosomes. In addition, FGF2 levels in the lungs of mice treated with ASC-derived artificial nanovesicles were increased. The uptake of ASC-derived artificial nanovesicles was inhibited by heparin, which is a competitive inhibitor of heparan sulfate proteoglycan that is associated with FGF2 signaling. Taken together, the data indicate that lower doses of ASC-derived artificial nanovesicles may have beneficial effects similar to higher doses of ASCs or ASC-derived natural exosomes in an animal model with emphysema, suggesting that artificial nanovesicles may have economic advantages that warrant future clinical studies.

  5. Gene transfer properties and structural modeling of human stem cell-derived AAV.

    PubMed

    Smith, Laura J; Ul-Hasan, Taihra; Carvaines, Sarah K; Van Vliet, Kim; Yang, Ethel; Wong, Kamehameha K; Agbandje-McKenna, Mavis; Chatterjee, Saswati

    2014-09-01

    Adeno-associated virus (AAV) vectors are proving to be remarkably successful for in vivo gene delivery. Based upon reports of abundant AAV in the human marrow, we tested CD34(+) hematopoietic stem cells for the presence of natural AAV. Here, we report for the first time, the presence of novel AAV variants in healthy CD34(+) human peripheral blood stem cells. The majority of healthy peripheral blood stem cell donors were found to harbor AAV in their CD34(+) cells. Every AAV isolated from CD34(+) cells mapped to AAV Clade F. Gene transfer vectors derived from these novel AAVs efficiently underwent entry and postentry processing in human cord blood stem cells and supported stable gene transfer into long-term, in vivo engrafting human HSCs significantly better than other serotypes. AAVHSC-transduced human CD34(+) cells engrafted in vivo and gave rise to differentiated transgene-expressing progeny. Importantly, gene-marked CD34(+) stem cells persisted long term in xenograft recipients, indicating transduction of primitive progenitors. Notably, correlation of structure with function permitted identification of potential capsid components important for HSC transduction. Thus, AAVHSCs represent a new class of genetic vectors for the manipulation of HSC genomes.

  6. Naive Pluripotent Stem Cells Derived Directly from Isolated Cells of the Human Inner Cell Mass

    PubMed Central

    Guo, Ge; von Meyenn, Ferdinand; Santos, Fatima; Chen, Yaoyao; Reik, Wolf; Bertone, Paul; Smith, Austin; Nichols, Jennifer

    2016-01-01

    Summary Conventional generation of stem cells from human blastocysts produces a developmentally advanced, or primed, stage of pluripotency. In vitro resetting to a more naive phenotype has been reported. However, whether the reset culture conditions of selective kinase inhibition can enable capture of naive epiblast cells directly from the embryo has not been determined. Here, we show that in these specific conditions individual inner cell mass cells grow into colonies that may then be expanded over multiple passages while retaining a diploid karyotype and naive properties. The cells express hallmark naive pluripotency factors and additionally display features of mitochondrial respiration, global gene expression, and genome-wide hypomethylation distinct from primed cells. They transition through primed pluripotency into somatic lineage differentiation. Collectively these attributes suggest classification as human naive embryonic stem cells. Human counterparts of canonical mouse embryonic stem cells would argue for conservation in the phased progression of pluripotency in mammals. PMID:26947977

  7. Human Pluripotent Stem Cell-Derived Cardiomyocytes as Research and Therapeutic Tools

    PubMed Central

    Pesl, Martin; Lacampagne, Alain; Dvorak, Petr; Rotrekl, Vladimir; Meli, Albano C.

    2014-01-01

    Human pluripotent stem cells (hPSCs), namely, embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), with their ability of indefinite self-renewal and capability to differentiate into cell types derivatives of all three germ layers, represent a powerful research tool in developmental biology, for drug screening, disease modelling, and potentially cell replacement therapy. Efficient differentiation protocols that would result in the cell type of our interest are needed for maximal exploitation of these cells. In the present work, we aim at focusing on the protocols for differentiation of hPSCs into functional cardiomyocytes in vitro as well as achievements in the heart disease modelling and drug testing on the patient-specific iPSC-derived cardiomyocytes (iPSC-CMs). PMID:24800237

  8. Neuronal Differentiation of Embryonic Stem Cell Derived Neuronal Progenitors Can Be Regulated by Stretchable Conducting Polymers

    PubMed Central

    Srivastava, Nishit; Venugopalan, Vijay; Divya, M.S.; Rasheed, V.A.

    2013-01-01

    Electrically conducting polymers are prospective candidates as active substrates for the development of neuroprosthetic devices. The utility of these substrates for promoting differentiation of embryonic stem cells paves viable routes for regenerative medicine. Here, we have tuned the electrical and mechanical cues provided to the embryonic stem cells during differentiation by precisely straining the conducting polymer (CP) coated, elastomeric-substrate. Upon straining the substrates, the neural differentiation pattern occurs in form of aggregates, accompanied by a gradient where substrate interface reveals a higher degree of differentiation. The CP domains align under linear stress along with the formation of local defect patterns leading to disruption of actin cytoskeleton of cells, and can provide a mechano-transductive basis for the observed changes in the differentiation. Our results demonstrate that along with biochemical and mechanical cues, conductivity of the polymer plays a major role in cellular differentiation thereby providing another control feature to modulate the differentiation and proliferation of stem cells. PMID:23544950

  9. A Micropatterned Human Pluripotent Stem Cell-Based Ventricular Cardiac Anisotropic Sheet for Visualizing Drug-Induced Arrhythmogenicity.

    PubMed

    Shum, Angie M Y; Che, Hui; Wong, Andy On-Tik; Zhang, Chenzi; Wu, Hongkai; Chan, Camie W Y; Costa, Kevin; Khine, Michelle; Kong, Chi-Wing; Li, Ronald A

    2017-01-01

    A novel cardiomimetic biohybrid material, termed as the human ventricular cardiac anisotropic sheet (hvCAS) is reported. Well-characterized human pluripotent stem-cell-derived ventricular cardiomyocytes are strategically aligned to reproduce key electrophysiological features of native human ventricle, which, along with specific selection criteria, allows for a direct visualization of arrhythmic spiral re-entry and represents a revolutionary tool to assess preclinical drug-induced arrhythmogenicity.

  10. New Insights into Early Human Development: Lessons for Stem Cell Derivation and Differentiation.

    PubMed

    Rossant, Janet; Tam, Patrick P L

    2017-01-05

    Pathways underlying mouse embryonic development have always informed efforts to derive, maintain, and drive differentiation of human pluripotent stem cells. However, direct application of mouse embryology to the human system has not always been successful because of fundamental developmental differences between species. The naive pluripotent state of mouse embryonic stem cells (ESCs), in particular, has been difficult to capture in human ESCs, and appears to be transitory in the human embryo itself. Further studies of human and non-human primate embryo development are needed to untangle the complexities of pluripotency networks across mammalian species.

  11. Embryonic Stem Cell-Derived Microvesicles: Could They be Used for Retinal Regeneration?

    PubMed

    Farber, Debora B; Katsman, Diana

    2016-01-01

    Mouse embryonic stem cells (mESCs) release into the medium in which they are cultured heterogeneous populations of microvesicles (mESMVs), important components of cell-cell communication, that transfer their contents not only to other stem cells but also to cells of other origins. The purpose of these studies was to demonstrate that ESMVs could be the signals that lead the retinal progenitor Müller cells to de-differentiate and re-entry the cell cycle, followed by differentiation along retinal lineages. Indeed, we found that ESMVs induce these processes and change Müller cells' microenvironment towards a more permissive state for tissue regeneration.

  12. N-butylidenephthalide attenuates Alzheimer's disease-like cytopathy in Down syndrome induced pluripotent stem cell-derived neurons.

    PubMed

    Chang, Chia-Yu; Chen, Sheng-Mei; Lu, Huai-En; Lai, Syu-Ming; Lai, Ping-Shan; Shen, Po-Wen; Chen, Pei-Ying; Shen, Ching-I; Harn, Horng-Jyh; Lin, Shinn-Zong; Hwang, Shiaw-Min; Su, Hong-Lin

    2015-03-04

    Down syndrome (DS) patients with early-onset dementia share similar neurodegenerative features with Alzheimer's disease (AD). To recapitulate the AD cell model, DS induced pluripotent stem cells (DS-iPSCs), reprogrammed from mesenchymal stem cells in amniotic fluid, were directed toward a neuronal lineage. Neuroepithelial precursor cells with high purity and forebrain characteristics were robustly generated on day 10 (D10) of differentiation. Accumulated amyloid deposits, Tau protein hyperphosphorylation and Tau intracellular redistribution emerged rapidly in DS neurons within 45 days but not in normal embryonic stem cell-derived neurons. N-butylidenephthalide (Bdph), a major phthalide ingredient of Angelica sinensis, was emulsified by pluronic F127 to reduce its cellular toxicity and promote canonical Wnt signaling. Interestingly, we found that F127-Bdph showed significant therapeutic effects in reducing secreted Aβ40 deposits, the total Tau level and the hyperphosphorylated status of Tau in DS neurons. Taken together, DS-iPSC derived neural cells can serve as an ideal cellular model of DS and AD and have potential for high-throughput screening of candidate drugs. We also suggest that Bdph may benefit DS or AD treatment by scavenging Aβ aggregates and neurofibrillary tangles.

  13. Preclinical Studies of Induced Pluripotent Stem Cell-Derived Astrocyte Transplantation in ALS

    DTIC Science & Technology

    2013-10-01

    profiling 3 Abstract ( words) The generation of human induced pluripotent stem cells (hiPSCs) represents an exciting advancement with...Sensys KAF-1400 CCD camera (Roper Scientific) or on a Zeiss laser confocal microscope. Transplanted cells were localized by staining for human...GGAAAAATTGTCAGTAGTGCAATGGAACCAGATCGGGAATACCATTTTGGACAAGCA GTACGGTTTGTATGTAACTCAGGCTACAAGATTGAAGGAGATG 36 NES NM_006617.1 2345- 2445

  14. Concise Review: Embryonic Stem Cells Derived by Somatic Cell Nuclear Transfer: A Horse in the Race?

    PubMed

    Wolf, Don P; Morey, Robert; Kang, Eunju; Ma, Hong; Hayama, Tomonari; Laurent, Louise C; Mitalipov, Shoukhrat

    2017-01-01

    Embryonic stem cells (ESC) hold promise for the treatment of human medical conditions but are allogeneic. Here, we consider the differences between autologous pluripotent stem cells produced by nuclear transfer (NT-ESCs) and transcription factor-mediated, induced pluripotent stem cells (iPSCs) that impact the desirability of each of these cell types for clinical use. The derivation of NT-ESCs is more cumbersome and requires donor oocytes; however, the use of oocyte cytoplasm as the source of reprogramming factors is linked to a key advantage of NT-ESCs-the ability to replace mutant mitochondrial DNA in a patient cell (due to either age or inherited disease) with healthy donor mitochondria from an oocyte. Moreover, in epigenomic and transcriptomic comparisons between isogenic iPSCs and NT-ESCs, the latter produced cells that more closely resemble bona fide ESCs derived from fertilized embryos. Thus, although NT-ESCs are more difficult to generate than iPSCs, the ability of somatic cell nuclear transfer to replace aged or diseased mitochondria and the closer epigenomic and transcriptomic similarity between NT-ESCs and bona fide ESCs may make NT-ESCs superior for future applications in regenerative medicine. Stem Cells 2017;35:26-34.

  15. Pluripotent stem cells derived from mouse and human white mature adipocytes.

    PubMed

    Jumabay, Medet; Abdmaulen, Raushan; Ly, Albert; Cubberly, Mark R; Shahmirian, Laurine J; Heydarkhan-Hagvall, Sepideh; Dumesic, Daniel A; Yao, Yucheng; Boström, Kristina I

    2014-02-01

    White mature adipocytes give rise to so-called dedifferentiated fat (DFAT) cells that spontaneously undergo multilineage differentiation. In this study, we defined stem cell characteristics of DFAT cells as they are generated from adipocytes and the relationship between these characteristics and lineage differentiation. Both mouse and human DFAT cells, prepared from adipose tissue and lipoaspirate, respectively, showed evidence of pluripotency, with a maximum 5-7 days after adipocyte isolation. The DFAT cells spontaneously formed clusters in culture, which transiently expressed multiple stem cell markers, including stage-specific embryonic antigens, and Sca-1 (mouse) and CD105 (human), as determined by real-time polymerase chain reaction, fluorescence-activated cell sorting, and immunostaining. As the stem cell markers decreased, markers characteristic of the three germ layers and specific lineage differentiation, such as α-fetoprotein (endoderm, hepatic), Neurofilament-66 (ectoderm, neurogenic), and Troponin I (mesoderm, cardiomyogenic), increased. However, no teratoma formation was detected after injection in immunodeficient mice. A novel modification of the adipocyte isolation aimed at ensuring the initial purity of the adipocytes and avoiding ceiling culture allowed isolation of DFAT cells with pluripotent characteristics. Thus, the adipocyte-derived DFAT cells represent a plastic stem cell population that is highly responsive to changes in culture conditions and may benefit cell-based therapies.

  16. Pluripotent Stem Cells Derived From Mouse and Human White Mature Adipocytes

    PubMed Central

    Abdmaulen, Raushan; Ly, Albert; Cubberly, Mark R.; Shahmirian, Laurine J.; Heydarkhan-Hagvall, Sepideh; Dumesic, Daniel A.; Yao, Yucheng

    2014-01-01

    White mature adipocytes give rise to so-called dedifferentiated fat (DFAT) cells that spontaneously undergo multilineage differentiation. In this study, we defined stem cell characteristics of DFAT cells as they are generated from adipocytes and the relationship between these characteristics and lineage differentiation. Both mouse and human DFAT cells, prepared from adipose tissue and lipoaspirate, respectively, showed evidence of pluripotency, with a maximum 5–7 days after adipocyte isolation. The DFAT cells spontaneously formed clusters in culture, which transiently expressed multiple stem cell markers, including stage-specific embryonic antigens, and Sca-1 (mouse) and CD105 (human), as determined by real-time polymerase chain reaction, fluorescence-activated cell sorting, and immunostaining. As the stem cell markers decreased, markers characteristic of the three germ layers and specific lineage differentiation, such as α-fetoprotein (endoderm, hepatic), Neurofilament-66 (ectoderm, neurogenic), and Troponin I (mesoderm, cardiomyogenic), increased. However, no teratoma formation was detected after injection in immunodeficient mice. A novel modification of the adipocyte isolation aimed at ensuring the initial purity of the adipocytes and avoiding ceiling culture allowed isolation of DFAT cells with pluripotent characteristics. Thus, the adipocyte-derived DFAT cells represent a plastic stem cell population that is highly responsive to changes in culture conditions and may benefit cell-based therapies. PMID:24396033

  17. Pluripotency of adult stem cells derived from human and rat pancreas

    NASA Astrophysics Data System (ADS)

    Kruse, C.; Birth, M.; Rohwedel, J.; Assmuth, K.; Goepel, A.; Wedel, T.

    Adult stem cells are undifferentiated cells found within fully developed tissues or organs of an adult individuum. Until recently, these cells have been considered to bear less self-renewal ability and differentiation potency compared to embryonic stem cells. In recent studies an undifferentiated cell type was found in primary cultures of isolated acini from exocrine pancreas termed pancreatic stellate cells. Here we show that pancreatic stellate-like cells have the capacity of extended self-renewal and are able to differentiate spontaneously into cell types of all three germ layers expressing markers for smooth muscle cells, neurons, glial cells, epithelial cells, chondrocytes and secretory cells (insulin, amylase). Differentiation and subsequent formation of three-dimensional cellular aggregates (organoid bodies) were induced by merely culturing pancreatic stellate-like cells in hanging drops. These cells were developed into stable, long-term, in vitro cultures of both primary undifferentiated cell lines as well as organoid cultures. Thus, evidence is given that cell lineages of endodermal, mesodermal, and ectodermal origin arise spontaneously from a single adult undifferentiated cell type. Based on the present findings it is assumed that pancreatic stellate-like cells are a new class of lineage uncommitted pluripotent adult stem cells with a remarkable self-renewal ability and differentiation potency. The data emphasize the versatility of adult stem cells and may lead to a reappraisal of their use for the treatment of inherited disorders or acquired degenerative diseases.

  18. Bilayer hydrogel with autologous stem cells derived from debrided human burn skin for improved skin regeneration.

    PubMed

    Natesan, Shanmugasundaram; Zamora, David O; Wrice, Nicole L; Baer, David G; Christy, Robert J

    2013-01-01

    The objective of this study was to demonstrate that stem cells isolated from discarded skin obtained after debridement can be used with collagen and fibrin-based scaffolds to develop a tissue-engineered vascularized dermal equivalent. Discarded tissue samples were collected from severely burned patients undergoing wound debridement. Stem cells were isolated from the adipose tissue layer and their growth and immunophenotype characterized. To develop a skin equivalent, debrided skin adipose stem cells (dsASCs) were added to a collagen-polyethylene glycol (PEG) fibrin-based bilayer hydrogel and analyzed in vitro. The effect of the bilayered hydrogels on wound healing was demonstrated using an excision wound model in athymic rats. The dsASCs isolated from all samples were CD90, CD105, and stromal cell surface protein-1 positive, similar to adipose stem cells isolated from normal human lipoaspirates. Within the bilayer hydrogels, dsASCs proliferated and differentiated, maintained a spindle-shaped morphology in collagen, and developed a tubular microvascular network in the PEGylated fibrin. Rat excision wounds treated with bilayer hydrogels showed less wound contraction and exhibited better dermal matrix deposition and epithelial margin progression than controls. Stem cells can be isolated from the adipose layer of burned skin obtained during debridement. When dsASCs are incorporated within collagen-PEGylated fibrin bilayer hydrogels, they develop stromal and vascular phenotypes through matrix-directed differentiation without use of growth factors. Preliminary in vivo studies indicate that dsASC-bilayer hydrogels contribute significantly to wound healing and provide support for their use as a vascularized dermal substitute for skin regeneration to treat large surface area burns.

  19. Role of CD146 Enrichment in Purification of Stem Cells Derived from Dental Pulp Polyp

    PubMed Central

    Tavangar, Maryam Sadat; Hosseini, Seyed-Mojtaba; Dehghani-Nazhvani, Ali; Monabati, Ahmad

    2017-01-01

    Introduction: Hyperplastic pulpitis (pulp polyp) tissues contains cells with stem cell properties similar to that of the dental pulp stem cells (DPSCs). It has also been shown that CD146 enrichment can homogenize the cultures of DPSCs and enhance the colony forming potentials of their cultures. This study determines whether CD146 enrichment can help purifying the stem cells from heterogeneous cultures of the pulp polyp derived stem cells (PPSCs). Methods and Materials: Healthy dental pulps and pulp polyp tissues were enzymatically digested and the harvested single cells were sorted according to the presence of CD146 marker. The sorted cells were seeded directly for colony forming unit (CFU) assays of the negative and positive portions. Flowcytometric antigen panel and differentiation assays were used to see if these cells conform with mesenchymal stems cells (MSCs) definition. Differences between the between groups was assessed using independent t-test. The level of significance was set at 0.05. Results: Normal pulp tissue derived cells formed higher colonies (42.5±16.8 per 104 cells) than the pulp polyp (17.75±8.9 per 104 cells) (P=0.015). The CD146 positive portion of the polyp derived cells formed an average of 91.5±29.7 per 104 cells per CFU. On the other hand, CD146 negative portion did not show any colonies (P<0.001). Both resources showed cells with flowcytometric antigen panel and differentiation potentials conforming to MSC definition. Conclusion: The entire CFU of PPSCs were formed within CD146 enriched portion. It seems that CD146 enrichment may reduce the number of possible fibroblasts of the pulp polyps and may further homogenize the culture of the PPSCs. PMID:28179933

  20. Postnatal stem/progenitor cells derived from the dental pulp of adult chimpanzee

    PubMed Central

    Cheng, Pei-Hsun; Snyder, Brooke; Fillos, Dimitri; Ibegbu, Chris C; Huang, Anderson Hsien-Cheng; Chan, Anthony WS

    2008-01-01

    Background Chimpanzee dental pulp stem/stromal cells (ChDPSCs) are very similar to human bone marrow derived mesenchymal stem/stromal cells (hBMSCs) as demonstrated by the expression pattern of cell surface markers and their multipotent differentiation capability. Results ChDPSCs were isolated from an incisor and a canine of a forty-seven year old female chimpanzee. A homogenous population of ChDPSCs was established in early culture at a high proliferation rate and verified by the expression pattern of thirteen cell surface markers. The ChDPSCs are multipotent and were capable of differentiating into osteogenic, adipogenic and chondrogenic lineages under appropriate in vitro culture conditions. ChDPSCs also express stem cell (Sox-2, Nanog, Rex-1, Oct-4) and osteogenic (Osteonectin, osteocalcin, osteopontin) markers, which is comparable to reported results of rhesus monkey BMSCs (rBMSCs), hBMSCs and hDPSCs. Although ChDPSCs vigorously proliferated during the initial phase and gradually decreased in subsequent passages, the telomere length indicated that telomerase activity was not significantly reduced. Conclusion These results demonstrate that ChDPSCs can be efficiently isolated from post-mortem teeth of adult chimpanzees and are multipotent. Due to the almost identical genome composition of humans and chimpanzees, there is an emergent need for defining the new role of chimpanzee modeling in comparative medicine. Teeth are easy to recover at necropsy and easy to preserve prior to the retrieval of dental pulp for stem/stromal cells isolation. Therefore, the establishment of ChDPSCs would preserve and maximize the applications of such a unique and invaluable animal model, and could advance the understanding of cellular functions and differentiation control of adult stem cells in higher primates. PMID:18430234

  1. Human Embryonic Stem Cell-Derived Oligodendrocyte Progenitors Aid in Functional Recovery of Sensory Pathways following Contusive Spinal Cord Injury

    PubMed Central

    All, Angelo H.; Bazley, Faith A.; Gupta, Siddharth; Pashai, Nikta; Hu, Charles; Pourmorteza, Amir; Kerr, Candace

    2012-01-01

    Background Transplantations of human stem cell derivatives have been widely investigated in rodent models for the potential restoration of function of neural pathways after spinal cord injury (SCI). Studies have already demonstrated cells survival following transplantation in SCI. We sought to evaluate survival and potential therapeutic effects of transplanted human embryonic stem (hES) cell-derived oligodendrocyte progenitor cells (OPCs) in a contusive injury in rats. Bioluminescence imaging was utilized to verify survivability of cells up to 4 weeks, and somatosensory evoked potential (SSEPs) were recorded at the cortex to monitor function of sensory pathways throughout the 6-week recovery period. Principal Findings hES cells were transduced with the firefly luciferase gene and differentiated into OPCs. OPCs were transplanted into the lesion epicenter of rat spinal cords 2 hours after inducing a moderate contusive SCI. The hES-treatment group showed improved SSEPs, including increased amplitude and decreased latencies, compared to the control group. The bioluminescence of transplanted OPCs decreased by 97% in the injured spinal cord compared to only 80% when injected into an uninjured spinal cord. Bioluminescence increased in both experimental groups such that by week 3, no statistical difference was detected, signifying that the cells survived and proliferated independent of injury. Post-mortem histology of the spinal cords showed integration of human cells expressing mature oligodendrocyte markers and myelin basic protein without the expression of markers for astrocytes (GFAP) or pluripotent cells (OCT4). Conclusions hES-derived OPCs transplanted 2 hours after contusive SCI survive and differentiate into OLs that produce MBP. Treated rats demonstrated functional improvements in SSEP amplitudes and latencies compared to controls as early as 1 week post-injury. Finally, the hostile injury microenvironment at 2 hours post-injury initially caused increased cell

  2. Early maturation and distinct tau pathology in induced pluripotent stem cell-derived neurons from patients with MAPT mutations.

    PubMed

    Iovino, Mariangela; Agathou, Sylvia; González-Rueda, Ana; Del Castillo Velasco-Herrera, Martin; Borroni, Barbara; Alberici, Antonella; Lynch, Timothy; O'Dowd, Sean; Geti, Imbisaat; Gaffney, Daniel; Vallier, Ludovic; Paulsen, Ole; Káradóttir, Ragnhildur Thóra; Spillantini, Maria Grazia

    2015-11-01

    Tauopathies, such as Alzheimer's disease, some cases of frontotemporal dementia, corticobasal degeneration and progressive supranuclear palsy, are characterized by aggregates of the microtubule-associated protein tau, which are linked to neuronal death and disease development and can be caused by mutations in the MAPT gene. Six tau isoforms are present in the adult human brain and they differ by the presence of 3(3R) or 4(4R) C-terminal repeats. Only the shortest 3R isoform is present in foetal brain. MAPT mutations found in human disease affect tau binding to microtubules or the 3R:4R isoform ratio by altering exon 10 splicing. We have differentiated neurons from induced pluripotent stem cells derived from fibroblasts of controls and patients with N279K and P301L MAPT mutations. Induced pluripotent stem cell-derived neurons recapitulate developmental tau expression, showing the adult brain tau isoforms after several months in culture. Both N279K and P301L neurons exhibit earlier electrophysiological maturation and altered mitochondrial transport compared to controls. Specifically, the N279K neurons show abnormally premature developmental 4R tau expression, including changes in the 3R:4R isoform ratio and AT100-hyperphosphorylated tau aggregates, while P301L neurons are characterized by contorted processes with varicosity-like structures, some containing both alpha-synuclein and 4R tau. The previously unreported faster maturation of MAPT mutant human neurons, the developmental expression of 4R tau and the morphological alterations may contribute to disease development.

  3. Unique proliferation response in odontoblastic cells derived from human skeletal muscle stem cells by cytokine-induced matrix metalloproteinase-3

    SciTech Connect

    Ozeki, Nobuaki; Hase, Naoko; Kawai, Rie; Yamaguchi, Hideyuki; Hiyama, Taiki; Kondo, Ayami; Nakata, Kazuhiko; Mogi, Makio

    2015-02-01

    A pro-inflammatory cytokine mixture (CM: interleukin (IL)-1β, tumor necrosis factor-α and interferon-γ) and IL-1β-induced matrix metalloproteinase (MMP)-3 activity have been shown to increase the proliferation of rat dental pulp cells and murine stem cell-derived odontoblast-like cells. This suggests that MMP-3 may regulate wound healing and regeneration in the odontoblast-rich dental pulp. Here, we determined whether these results can be extrapolated to human dental pulp by investigating the effects of CM-induced MMP-3 up-regulation on the proliferation and apoptosis of purified odontoblast-like cells derived from human skeletal muscle stem cells. We used siRNA to specifically reduce MMP-3 expression. We found that CM treatment increased MMP-3 mRNA and protein levels as well as MMP-3 activity. Cell proliferation was also markedly increased, with no changes in apoptosis, upon treatment with CM and following the application of exogenous MMP-3. Endogenous tissue inhibitors of metalloproteinases were constitutively expressed during all experiments and unaffected by MMP-3. Although treatment with MMP-3 siRNA suppressed cell proliferation, it also unexpectedly increased apoptosis. This siRNA-mediated increase in apoptosis could be reversed by exogenous MMP-3. These results demonstrate that cytokine-induced MMP-3 activity regulates cell proliferation and suppresses apoptosis in human odontoblast-like cells. - Highlights: • Pro-inflammatory cytokines induce MMP-3 activity in human odontoblast-like cells. • Increased MMP-3 activity can promote cell proliferation in odontoblasts. • Specific loss of MMP-3 increases apoptosis in odontoblasts. • MMP-3 has potential as a promising new target for pupal repair and regeneration.

  4. Engineered Human Embryonic Stem Cell-Derived Lymphocytes to Study In Vivo Trafficking and Immunotherapy

    PubMed Central

    Knorr, David A.; Bock, Allison; Brentjens, Renier J.

    2013-01-01

    Human embryonic stem cell (hESC)-derived natural killer (NK) cells are a promising source of antitumor lymphocytes for immunotherapeutics. They also provide a genetically tractable platform well suited for the study of antitumor immunotherapies in preclinical models. We have previously demonstrated the potency of hESC-derived NK cells in vivo. Here we use both bioluminescent and fluorescent imaging to demonstrate trafficking of hESC-derived NK cells to tumors in vivo. Our dual-imaging approach allowed us to more specifically define the kinetics of NK cell trafficking to tumor sites. NK cell persistence and trafficking were further evaluated by flow cytometry and immunohistochemistry. This integrated approach provides a unique system to apply the use of human pluripotent stem cells to study the kinetics and biodistribution of adoptively transferred lymphocytes, advances broadly applicable to the field of immunotherapy. PMID:23421330

  5. Disease Modeling in Stem Cell-Derived 3D Organoid Systems.

    PubMed

    Dutta, Devanjali; Heo, Inha; Clevers, Hans

    2017-03-21

    Organoids are 3D in vitro culture systems derived from self-organizing stem cells. They can recapitulate the in vivo architecture, functionality, and genetic signature of original tissues. Thus, organoid technology has been rapidly applied to understanding stem cell biology, organogenesis, and various human pathologies. The recent development of human patient-derived organoids has enabled disease modeling with precision, highlighting their great potential in biomedical applications, translational medicine, and personalized therapy. In light of recent breakthroughs using organoids, it is only apt that we appreciate the advantages and shortcomings of this technology to exploit its full potential. We discuss recent advances in the application of organoids in studying cancer and hereditary diseases, as well as in the examination of host cell-microorganism interactions.

  6. Clinical translation of bioartificial liver support systems with human pluripotent stem cell-derived hepatic cells

    PubMed Central

    Sakiyama, Ryoichi; Blau, Brandon J; Miki, Toshio

    2017-01-01

    There is currently a pressing need for alternative therapies to liver transplantation. The number of patients waiting for a liver transplant is substantially higher than the number of transplantable donor livers, resulting in a long waiting time and a high waiting list mortality. An extracorporeal liver support system is one possible approach to overcome this problem. However, the ideal cell source for developing bioartificial liver (BAL) support systems has yet to be determined. Recent advancements in stem cell technology allow researchers to generate highly functional hepatocyte-like cells from human pluripotent stem cells (hPSCs). In this mini-review, we summarize previous clinical trials with different BAL systems, and discuss advantages of and potential obstacles to utilizing hPSC-derived hepatic cells in clinical-scale BAL systems. PMID:28373763

  7. Mesenchymal Stem Cell-Derived Extracellular Vesicles Promote Angiogenesis: Potencial Clinical Application

    PubMed Central

    Merino-González, Consuelo; Zuñiga, Felipe A.; Escudero, Carlos; Ormazabal, Valeska; Reyes, Camila; Nova-Lamperti, Estefanía; Salomón, Carlos; Aguayo, Claudio

    2016-01-01

    Mesenchymal stem cells (MSCs) are adult multipotent stem cells that are able to differentiate into multiple specialized cell types including osteocytes, adipocytes, and chondrocytes. MSCs exert different functions in the body and have recently been predicted to have a major clinical/therapeutic potential. However, the mechanisms of self-renewal and tissue regeneration are not completely understood. It has been shown that the biological effect depends mainly on its paracrine action. Furthermore, it has been reported that the secretion of soluble factors and the release of extracellular vesicles, such as exosomes, could mediate the cellular communication to induce cell-differentiation/self-renewal. This review provides an overview of MSC-derived exosomes in promoting angiogenicity and of the clinical relevance in a therapeutic approach. PMID:26903875

  8. Stem cell-derived neurons in the development of targeted treatment for schizophrenia and bipolar disorder.

    PubMed

    Watmuff, Bradley; Liu, Bangyan; Karmacharya, Rakesh

    2017-03-27

    The recent advent of induced pluripotent stem cells has enabled the study of patient-specific and disease-related neurons in vitro and has facilitated new directions of inquiry into disease mechanisms. With these approaches, we now have the possibility of correlating ex vivo cellular phenotypes with individual patient response to treatment and/or side effects, which makes targeted treatments for schizophrenia and bipolar disorder a distinct prospect in the coming years. Here, we briefly review the current state of stem cell-based models and explore studies that are providing new insights into the disease biology of schizophrenia and bipolar disorder, which are laying the foundations for the development of novel targeted therapies.

  9. Mitochondria modify exercise-induced development of stem cell-derived neurons in the adult brain.

    PubMed

    Steib, Kathrin; Schäffner, Iris; Jagasia, Ravi; Ebert, Birgit; Lie, D Chichung

    2014-05-07

    Neural stem cells in the adult mammalian hippocampus continuously generate new functional neurons, which modify the hippocampal network and significantly contribute to cognitive processes and mood regulation. Here, we show that the development of new neurons from stem cells in adult mice is paralleled by extensive changes to mitochondrial mass, distribution, and shape. Moreover, exercise-a strong modifier of adult hippocampal neurogenesis-accelerates neuronal maturation and induces a profound increase in mitochondrial content and the presence of mitochondria in dendritic segments. Genetic inhibition of the activity of the mitochondrial fission factor dynamin-related protein 1 (Drp1) inhibits neurogenesis under basal and exercise conditions. Conversely, enhanced Drp1 activity furthers exercise-induced acceleration of neuronal maturation. Collectively, these results indicate that adult hippocampal neurogenesis requires adaptation of the mitochondrial compartment and suggest that mitochondria are targets for enhancing neurogenesis-dependent hippocampal plasticity.

  10. Matrix Gla protein regulates differentiation of endothelial cells derived from mouse embryonic stem cells.

    PubMed

    Yao, Jiayi; Guihard, Pierre J; Blazquez-Medela, Ana M; Guo, Yina; Liu, Ting; Boström, Kristina I; Yao, Yucheng

    2016-01-01

    Matrix Gla protein (MGP) is an antagonist of bone morphogenetic proteins and expressed in vascular endothelial cells. Lack of MGP causes vascular abnormalities in multiple organs in mice. The objective of this study is to define the role of MGP in early endothelial differentiation. We find that expression of endothelial markers is highly induced in Mgp null organs, which, in wild type, contain high MGP expression. Furthermore, Mgp null embryonic stem cells express higher levels of endothelial markers than wild-type controls and an abnormal temporal pattern of expression. We also find that the Mgp-deficient endothelial cells adopt characteristics of mesenchymal stem cells. We conclude that loss of MGP causes dysregulation of early endothelial differentiation.

  11. Engineered human embryonic stem cell-derived lymphocytes to study in vivo trafficking and immunotherapy.

    PubMed

    Knorr, David A; Bock, Allison; Brentjens, Renier J; Kaufman, Dan S

    2013-07-01

    Human embryonic stem cell (hESC)-derived natural killer (NK) cells are a promising source of antitumor lymphocytes for immunotherapeutics. They also provide a genetically tractable platform well suited for the study of antitumor immunotherapies in preclinical models. We have previously demonstrated the potency of hESC-derived NK cells in vivo. Here we use both bioluminescent and fluorescent imaging to demonstrate trafficking of hESC-derived NK cells to tumors in vivo. Our dual-imaging approach allowed us to more specifically define the kinetics of NK cell trafficking to tumor sites. NK cell persistence and trafficking were further evaluated by flow cytometry and immunohistochemistry. This integrated approach provides a unique system to apply the use of human pluripotent stem cells to study the kinetics and biodistribution of adoptively transferred lymphocytes, advances broadly applicable to the field of immunotherapy.

  12. Developmental origin and lineage plasticity of endogenous cardiac stem cells.

    PubMed

    Santini, Maria Paola; Forte, Elvira; Harvey, Richard P; Kovacic, Jason C

    2016-04-15

    Over the past two decades, several populations of cardiac stem cells have been described in the adult mammalian heart. For the most part, however, their lineage origins and in vivo functions remain largely unexplored. This Review summarizes what is known about different populations of embryonic and adult cardiac stem cells, including KIT(+), PDGFRα(+), ISL1(+)and SCA1(+)cells, side population cells, cardiospheres and epicardial cells. We discuss their developmental origins and defining characteristics, and consider their possible contribution to heart organogenesis and regeneration. We also summarize the origin and plasticity of cardiac fibroblasts and circulating endothelial progenitor cells, and consider what role these cells have in contributing to cardiac repair.

  13. In Vitro Osteogenic Potential of Green Fluorescent Protein Labelled Human Embryonic Stem Cell-Derived Osteoprogenitors

    PubMed Central

    Sriram, Gopu; Li, Mingming; Zou, Yu; Li, Lulu; Handral, Harish K.; Rosa, Vinicus; Cao, Tong

    2016-01-01

    Cellular therapy using stem cells in bone regeneration has gained increasing interest. Various studies suggest the clinical utility of osteoprogenitors-like mesenchymal stem cells in bone regeneration. However, limited availability of mesenchymal stem cells and conflicting evidence on their therapeutic efficacy limit their clinical application. Human embryonic stem cells (hESCs) are potentially an unlimited source of healthy and functional osteoprogenitors (OPs) that could be utilized for bone regenerative applications. However, limited ability to track hESC-derived progenies in vivo greatly hinders translational studies. Hence, in this study, we aimed to establish hESC-derived OPs (hESC-OPs) expressing green fluorescent protein (GFP) and to investigate their osteogenic differentiation potential in vitro. We fluorescently labelled H9-hESCs using a plasmid vector encoding GFP. The GFP-expressing hESCs were differentiated into hESC-OPs. The hESC-OPsGFP+ stably expressed high levels of GFP, CD73, CD90, and CD105. They possessed osteogenic differentiation potential in vitro as demonstrated by increased expression of COL1A1, RUNX2, OSTERIX, and OPG transcripts and mineralized nodules positive for Alizarin Red and immunocytochemical expression of osteocalcin, alkaline phosphatase, and collagen-I. In conclusion, we have demonstrated that fluorescently labelled hESC-OPs can maintain their GFP expression for the long term and their potential for osteogenic differentiation in vitro. In future, these fluorescently labelled hESC-OPs could be used for noninvasive assessment of bone regeneration, safety, and therapeutic efficacy. PMID:28003831

  14. Importance of Being Nernst: Synaptic Activity and Functional Relevance in Stem Cell-derived Neurons

    DTIC Science & Technology

    2015-07-26

    dissociated primary neurons, immortalized cell lines derived from neuronal and non-neuronal tissues and, most recently, stem cells. The predictive value of...repair of damaged neural tissues [8,9]. However, SCN models must be shown to be competent to form context-appropriate, functioning neurons before...of neuronal maturation have been well-described in dissociated cultures of primary neurons, it is important to recognize that the source tissues

  15. Advances in pluripotent stem cell-derived endothelial cells: from biomaterials to organ regeneration.

    PubMed

    Lui, Kathy O

    2014-01-01

    Human embryonic stem cells (ESCs), by virtue of their capability to self-renew and differentiate into a variety of cell types, represent the first type of pluripotent stem cells (PSCs) to be used in clinical transplantation during recent phase-I trials; however, it is still unclear whether hESC-derived tissues can self-organize and form part of the vascularized, functional organ following transplantation. Recently, endothelial cells (ECs) or angiogenic factors such as VEGFA have been demonstrated to support development and regeneration of multiple organ systems, including the heart, pancreas, liver, lung and bone marrow. Therefore, co-transplantation of ECs derived from the same parental PSCs that differentiate into cell types of interest; or overexpression of the inductive angiogenic factors responsible for organ regeneration might be beneficial to support function of hPSC-derived tissues. In this special issue, we discuss how protein kinases (Ng and colleagues); DNA methylation and histone modification (Tsui and colleagues) regulate cellular pluripotency and cell-fate specification of PSCs. In addition, we discuss how ECs and angiogenic factors could contribute to repair and regeneration of organs such as the heart (Yuan and colleagues), the cardiovascular system (Tse and colleagues) and the pancreas (Lui). We also discuss the role of mesenchymal stem cells or paracrine factors secreted by them in tissue repair (Li and colleagues). Lastly, we discuss how to generate self-organized and vascularized tissues derived from PSCs in a 2- or 3-dimensional format by fusing tissue bioengineering approaches with stem cell technology (Chen).

  16. Immunomodulation by Transplanted Human Embryonic Stem Cell-Derived Oligodendroglial Progenitors in Experimental Autoimmune Encephalomyelitis

    PubMed Central

    Kim, Heechul; Walczak, Piotr; Kerr, Candace; Galpoththawela, Chulani; Gilad, Assaf A.; Muja, Naser; Bulte, Jeff W.M.

    2013-01-01

    Transplantation of embryonic stem cells and their neural derivatives can lead to amelioration of the disease symptoms of experimental autoimmune encephalomyelitis (EAE), an animal model for multiple sclerosis (MS). Oligodendroglial progenitors (OPs), derived from human embryonic stem cells (hESC, HES-1), were labeled with superparamagnetic iron oxide and transduced with luciferase. At 7 days following induction of EAE in C57/BL6 mice, 1 × 106 cells were transplanted in the ventricles of C57/BL6 mice and noninvasively monitored by magnetic resonance and bioluminescence imaging. Cells were found to remain within the cerebroventricular system and did not survive for more than 10 days. However, EAE mice that received hESC-OPs showed a significant improvement in neurological disability scores (0.9 ± 0.2; n = 12) compared to that of control animals (3.3 ± 0.4; n = 12) at day 15 post-transplantation. Histopathologically, transplanted hESC-OPs generated TREM2-positive CD45 cells, increased TIMP-1 expression, confined inflammatory cells within the subarachnoid space, and gave rise to higher numbers of Foxp3-positive regulatory T cells in the spinal cord and spleen. Our results suggest that transplantation of hESC-OPs can alter the pathogenesis of EAE through immunomodulation, potentially providing new avenues for stem cell-based treatment of MS. PMID:22949039

  17. [Application Prospect of Stem Cell-derived Microvesicles in Regeneration of Injured Tissues].

    PubMed

    Yin, Huiqun; Jiang, Hong

    2015-06-01

    More and more evidence indicates that microvesicles (MVs) play a key role in cell-to-cell communication. The MVs are circular fragments of membrane released from the endosomal compartment as exosomes or shed from the cell surface membranes of most types. Components of donor cells are incorporated into MVs that contain bioactive lipids, proteins, genetic cargoes. MVs derived from stem cells may reprogram cells that survived in injury tissue and favor tissue regeneration by delivering their bioactive cargoes to influence the behaviors of recipient cells. Compared with mesenchymal stem cells (MSCs), MVs derived from MSCs were found to mimic the beneficial effects of these cells. These proregenerative effects mediated by MVs can be explained by the fact that MVs are enriched in bioactive lipids, anti-apoptotic and pro-stimulatory growth factors or cytokines, and deliver mRNAs, regulatory miRNAs and proteins that improve overall cell function. Therefore, it opens novel perspectives in exploiting these MVs in tissue regeneration and repair. In addition, the use of MVs instead of stem cells could represent a safe and potentially more advantageous alternative to cell-therapy approaches.

  18. Gene profiling of human induced pluripotent stem cell-derived astrocyte progenitors following spinal cord engraftment.

    PubMed

    Haidet-Phillips, Amanda M; Roybon, Laurent; Gross, Sarah K; Tuteja, Alisha; Donnelly, Christopher J; Richard, Jean-Philippe; Ko, Myungsung; Sherman, Alex; Eggan, Kevin; Henderson, Christopher E; Maragakis, Nicholas J

    2014-05-01

    The generation of human induced pluripotent stem cells (hiPSCs) represents an exciting advancement with promise for stem cell transplantation therapies as well as for neurological disease modeling. Based on the emerging roles for astrocytes in neurological disorders, we investigated whether hiPSC-derived astrocyte progenitors could be engrafted to the rodent spinal cord and how the characteristics of these cells changed between in vitro culture and after transplantation to the in vivo spinal cord environment. Our results show that human embryonic stem cell- and hiPSC-derived astrocyte progenitors survive long-term after spinal cord engraftment and differentiate to astrocytes in vivo with few cells from other lineages present. Gene profiling of the transplanted cells demonstrates the astrocyte progenitors continue to mature in vivo and upregulate a variety of astrocyte-specific genes. Given this mature astrocyte gene profile, this work highlights hiPSCs as a tool to investigate disease-related astrocyte biology using in vivo disease modeling with significant implications for human neurological diseases currently lacking animal models.

  19. Isolation and characterization of equine dental pulp stem cells derived from Thoroughbred wolf teeth

    PubMed Central

    ISHIKAWA, Shingo; HORINOUCHI, Chie; MURATA, Daiki; MATSUZAKI, Shota; MISUMI, Kazuhiro; IWAMOTO, Yohei; KOROSUE, Kenji; HOBO, Seiji

    2016-01-01

    Mesenchymal stem cells (MSCs) are adult multipotent stem cells that are capable of self-renewal and differentiation into multiple cell lineages. Methods for cell therapy using MSCs have been developed in equine medicine. Recently, human dental pulp stem cells (DPSCs) have drawn much attention owing to their trophic factor producing ability and minimally invasive collection methods. However, there have been no reports on equine dental pulp-derived cells (eDPCs). Therefore, the aim of this study was to isolate and characterize the eDPCs from discarded wolf teeth. Plastic-adherent spindle-shaped cells were isolated from wolf teeth. The doubling time of the isolated eDPCs was approximately 1 day. Differentiation assays using induction medium eDPCs differentiated into osteogenic, chondrogenic and adipogenic lineages. The eDPCs expressed mesenchymal makers (CD11a/18, CD44, CD90 CD105 and MHC class I and II), but did not express hematopoietic markers (CD34 and CD45). Taken together, the results show that eDPCs can be isolated from discarded wolf teeth, and they satisfy the minimal criteria for MSCs. Thus, these eDPCs can be referred to as equine DPSCs (eDPSCs). These eDPSCs may become a new source for cell therapy. PMID:27818457

  20. Ensuring the Quality of Stem Cell-Derived In Vitro Models for Toxicity Testing.

    PubMed

    Stacey, Glyn N; Coecke, Sandra; Price, Anna-Bal; Healy, Lyn; Jennings, Paul; Wilmes, Anja; Pinset, Christian; Ingelman-Sundberg, Magnus; Louisse, Jochem; Haupt, Simone; Kidd, Darren; Robitski, Andrea; Jahnke, Heinz-Georg; Lemaitre, Gilles; Myatt, Glenn

    Quality control of cell cultures used in new in vitro toxicology assays is crucial to the provision of reliable, reproducible and accurate toxicity data on new drugs or constituents of new consumer products. This chapter explores the key scientific and ethical criteria that must be addressed at the earliest stages of developing toxicology assays based on human pluripotent stem cell (hPSC) lines. It also identifies key considerations for such assays to be acceptable for regulatory, laboratory safety and commercial purposes. Also addressed is the development of hPSC-based assays for the tissue and cell types of greatest interest in drug toxicology. The chapter draws on a range of expert opinion within the European Commission/Cosmetics Europe-funded alternative testing cluster SEURAT-1 and consensus from international groups delivering this guidance such as the International Stem Cell Banking Initiative. Accordingly, the chapter summarizes the most up-date best practices in the use and quality control of human Pluripotent Stem Cell lines in the development of in vitro toxicity assays from leading experts in the field.

  1. Isolation and characterisation of mesenchymal stem cells derived from human placenta tissue

    PubMed Central

    Vellasamy, Shalini; Sandrasaigaran, Pratheep; Vidyadaran, Sharmili; George, Elizabeth; Ramasamy, Rajesh

    2012-01-01

    AIM: To explore the feasibility of placenta tissue as a reliable and efficient source for generating mesenchymal stem cells (MSC). METHODS: MSC were generated from human placenta tissue by enzymatic digestion and mechanical dissociation. The placenta MSC (PLC-MSC) were characterized for expression of cell surface markers, embryonic stem cell (ECS) gene expression and their differentiation ability into adipocytes and osteocytes. The immunosuppressive properties of PLC-MSC on resting and phytohemagglutinin (PHA) stimulated allogenic T cells were assessed by means of cell proliferation via incorporation of tritium thymidine (3H-TdR). RESULTS: The generated PLC-MSC appeared as spindle-shaped cells, expressed common MSC surface markers and ESC transcriptional factors. They also differentiated into adipogenic and osteogenic lineages when induced. However, continuous cultivation up to passage 15 caused changes in morphological appearance and cellular senescence, although the stem cell nature of their protein expression was unchanged. In terms of their immunosuppressive properties, PLC-MSC were unable to stimulate resting T cell proliferation; they inhibited the PHA stimulated T cells in a dose dependent manner through cell to cell contact. In our study, MSC generated from human placenta exhibited similar mesenchymal cell surface markers; MSC-like gene expression pattern and MSC-like differentiation potential were comparable to other sources of MSC. CONCLUSION: We suggest that placenta tissues can serve as an alternative source of MSC for future experimental and clinical studies. PMID:22993662

  2. Immunological barriers to stem-cell based cardiac repair.

    PubMed

    Karabekian, Zaruhi; Posnack, Nikki Gillum; Sarvazyan, Narine

    2011-06-01

    Repair of damaged myocardium with pluripotent stem cell derived cardiomyocytes is becoming increasingly more feasible. Developments in stem cell research emphasize the need to address the foreseeable problem of immune rejection following transplantation. Pluripotent stem cell (PSC) derived cardiomyocytes have unique immune characteristics, some of which are not advantageous for transplantation. Here we review the possible mechanisms of PSC-derived cardiomyocytes rejection, summarize the current knowledge pertaining to immunogenicity of such cells and describe the existing controversies. Myocardial graft rejection can be reduced by modifying PSCs prior to their differentiation into cardiomyocytes. Overall, this approach facilitates the development of universal donor stem cells suitable for the regeneration of many different tissue types.

  3. Concave Pit-Containing Scaffold Surfaces Improve Stem Cell-Derived Osteoblast Performance and Lead to Significant Bone Tissue Formation

    PubMed Central

    Cusella-De Angelis, Maria Gabriella; Laino, Gregorio; Piattelli, Adriano; Pacifici, Maurizio; De Rosa, Alfredo; Papaccio, Gianpaolo

    2007-01-01

    Background Scaffold surface features are thought to be important regulators of stem cell performance and endurance in tissue engineering applications, but details about these fundamental aspects of stem cell biology remain largely unclear. Methodology and Findings In the present study, smooth clinical-grade lactide-coglyolic acid 85:15 (PLGA) scaffolds were carved as membranes and treated with NMP (N-metil-pyrrolidone) to create controlled subtractive pits or microcavities. Scanning electron and confocal microscopy revealed that the NMP-treated membranes contained: (i) large microcavities of 80–120 µm in diameter and 40–100 µm in depth, which we termed primary; and (ii) smaller microcavities of 10–20 µm in diameter and 3–10 µm in depth located within the primary cavities, which we termed secondary. We asked whether a microcavity-rich scaffold had distinct bone-forming capabilities compared to a smooth one. To do so, mesenchymal stem cells derived from human dental pulp were seeded onto the two types of scaffold and monitored over time for cytoarchitectural characteristics, differentiation status and production of important factors, including bone morphogenetic protein-2 (BMP-2) and vascular endothelial growth factor (VEGF). We found that the microcavity-rich scaffold enhanced cell adhesion: the cells created intimate contact with secondary microcavities and were polarized. These cytological responses were not seen with the smooth-surface scaffold. Moreover, cells on the microcavity-rich scaffold released larger amounts of BMP-2 and VEGF into the culture medium and expressed higher alkaline phosphatase activity. When this type of scaffold was transplanted into rats, superior bone formation was elicited compared to cells seeded on the smooth scaffold. Conclusion In conclusion, surface microcavities appear to support a more vigorous osteogenic response of stem cells and should be used in the design of therapeutic substrates to improve bone repair and

  4. Porcine Pluripotent Stem Cells Derived from IVF Embryos Contribute to Chimeric Development In Vivo.

    PubMed

    Xue, Binghua; Li, Yan; He, Yilong; Wei, Renyue; Sun, Ruizhen; Yin, Zhi; Bou, Gerelchimeg; Liu, Zhonghua

    2016-01-01

    Although the pig is considered an important model of human disease and an ideal animal for the preclinical testing of cell transplantation, the utility of this model has been hampered by a lack of genuine porcine embryonic stem cells. Here, we derived a porcine pluripotent stem cell (pPSC) line from day 5.5 blastocysts in a newly developed culture system based on MXV medium and a 5% oxygen atmosphere. The pPSCs had been passaged more than 75 times over two years, and the morphology of the colony was similar to that of human embryonic stem cells. Characterization and assessment showed that the pPSCs were alkaline phosphatase (AKP) positive, possessed normal karyotypes and expressed classic pluripotent markers, including OCT4, SOX2 and NANOG. In vitro differentiation through embryonic body formation and in vivo differentiation via teratoma formation in nude mice demonstrated that the pPSCs could differentiate into cells of the three germ layers. The pPSCs transfected with fuw-DsRed (pPSC-FDs) could be passaged with a stable expression of both DsRed and pluripotent markers. Notably, when pPSC-FDs were used as donor cells for somatic nuclear transfer, 11.52% of the reconstructed embryos developed into blastocysts, which was not significantly different from that of the reconstructed embryos derived from porcine embryonic fibroblasts. When pPSC-FDs were injected into day 4.5 blastocysts, they became involved in the in vitro embryonic development and contributed to the viscera of foetuses at day 50 of pregnancy as well as the developed placenta after the chimeric blastocysts were transferred into recipients. These findings indicated that the pPSCs were porcine pluripotent cells; that this would be a useful cell line for porcine genetic engineering and a valuable cell line for clarifying the molecular mechanism of pluripotency regulation in pigs.

  5. Idiopathic Autism: Cellular and Molecular Phenotypes in Pluripotent Stem Cell-Derived Neurons.

    PubMed

    Liu, Xiaozhuo; Campanac, Emilie; Cheung, Hoi-Hung; Ziats, Mark N; Canterel-Thouennon, Lucile; Raygada, Margarita; Baxendale, Vanessa; Pang, Alan Lap-Yin; Yang, Lu; Swedo, Susan; Thurm, Audrey; Lee, Tin-Lap; Fung, Kwok-Pui; Chan, Wai-Yee; Hoffman, Dax A; Rennert, Owen M

    2016-06-29

    Autism spectrum disorder is a complex neurodevelopmental disorder whose pathophysiology remains elusive as a consequence of the unavailability for study of patient brain neurons; this deficit may potentially be circumvented by neural differentiation of induced pluripotent stem cells. Rare syndromes with single gene mutations and autistic symptoms have significantly advanced the molecular and cellular understanding of autism spectrum disorders; however, in aggregate, they only represent a fraction of all cases of autism. In an effort to define the cellular and molecular phenotypes in human neurons of non-syndromic autism, we generated induced pluripotent stem cells (iPSCs) from three male autism spectrum disorder patients who had no identifiable clinical syndromes, and their unaffected male siblings and subsequently differentiated these patient-specific stem cells into electrophysiologically active neurons. iPSC-derived neurons from these autistic patients displayed decreases in the frequency and kinetics of spontaneous excitatory postsynaptic currents relative to controls, as well as significant decreases in Na(+) and inactivating K(+) voltage-gated currents. Moreover, whole-genome microarray analysis of gene expression identified 161 unique genes that were significantly differentially expressed in autistic patient iPSC-derived neurons (>twofold, FDR < 0.05). These genes were significantly enriched for processes related to synaptic transmission, such as neuroactive ligand-receptor signaling and extracellular matrix interactions, and were enriched for genes previously associated with autism spectrum disorder. Our data demonstrate aberrant voltage-gated currents and underlying molecular changes related to synaptic function in iPSC-derived neurons from individuals with idiopathic autism as compared to unaffected siblings controls.

  6. Human embryonic stem cell-derived mesoderm-like epithelium transitions to mesenchymal progenitor cells.

    PubMed

    Boyd, Nolan L; Robbins, Kelly R; Dhara, Sujoy K; West, Franklin D; Stice, Steven L

    2009-08-01

    Human embryonic stem cells (hESC) have the potential to produce all of the cells in the body. They are able to self-renew indefinitely, potentially making them a source for large-scale production of therapeutic cell lines. Here, we developed a monolayer differentiation culture that induces hESC (WA09 and BG01) to form epithelial sheets with mesodermal gene expression patterns (BMP4, RUNX1, and GATA4). These E-cadherin+ CD90low cells then undergo apparent epithelial-mesenchymal transition for the derivation of mesenchymal progenitor cells (hESC-derived mesenchymal cells [hES-MC]) that by flow cytometry are negative for hematopoietic (CD34, CD45, and CD133) and endothelial (CD31 and CD146) markers, but positive for markers associated with mesenchymal stem cells (CD73, CD90, CD105, and CD166). To determine their functionality, we tested their capacity to produce the three lineages associated with mesenchymal stem cells and found they could form osteogenic and chondrogenic, but not adipogenic lineages. The derived hES-MC were able to remodel and contract collagen I lattice constructs to an equivalent degree as keloid fibroblasts and were induced to express alpha-smooth muscle actin when exposed to transforming growth factor (TGF)-beta1, but not platelet derived growth factor-B (PDGF-B). These data suggest that the derived hES-MC are multipotent cells with potential uses in tissue engineering and regenerative medicine and for providing a highly reproducible cell source for adult-like progenitor cells.

  7. Biocompatibility of Accelerated Mineral Trioxide Aggregate on Stem Cells Derived from Human Dental Pulp.

    PubMed

    Kulan, Pinar; Karabiyik, Ozge; Kose, Gamze T; Kargul, Betul

    2016-02-01

    The aim of this study was to evaluate the effects of several additives on the setting time and cytotoxicity of accelerated-set mineral trioxide aggregate (MTA) on stem cells of human dental pulp. ProRoot white MTA (WMTA) (Dentsply Tulsa Dental, Johnson City, TN) was mixed with various additives including distilled water, 2.5% disodium hydrogen phosphate (Na2HPO4) (Merck, Darmstadt, Germany), K-Y Jelly (Johnson & Johnson, Markham, ON, Canada), and 5% and 10% calcium chloride (CaCl2) (Merck). The setting times were evaluated using a Vicat apparatus (Alsa Lab, Istanbul, Turkey). Human dental pulp stem cells were isolated and seeded into 48-well plates at 2 × 10(3) cells per well and incubated with MTA samples for 24 hours, 3 days, and 7 days. Cell viability was evaluated using the 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium assay. MTA mixed with 10% CaCl2 showed the lowest setting time (P < .05). According to the 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium results on the 1st, 3rd, and 7th days, a statistically significant difference was found (P < .05) between MTA groups and the control group. MTA mixed with K-Y Jelly in all groups showed the lowest cell viability at all time points (P < .05). The cell viability of MTA mixed with distilled water, 5% CaCl2, 10% CaCl2, and Na2HPO4 increased significantly through time (P < .05). This in vitro study found MTA mixed with 5% and 10% CaCl2 and Na2HPO4 is biocompatible with dental pulp stem cells in terms of cell viability. Further in vitro and in vivo investigations are required to prove the clinical applications of MTA mixed with various additives.

  8. Methods for derivation of multipotent neural crest cells derived from human pluripotent stem cells

    PubMed Central

    Avery, John; Dalton, Stephen

    2016-01-01

    Summary Multipotent, neural crest cells (NCCs) produce a wide-range of cell types during embryonic development. This includes melanocytes, peripheral neurons, smooth muscle cells, osteocytes, chondrocytes and adipocytes. The protocol described here allows for highly-efficient differentiation of human pluripotent stem cells to a neural crest fate within 15 days. This is accomplished under feeder-free conditions, using chemically defined medium supplemented with two small molecule inhibitors that block glycogen synthase kinase 3 (GSK3) and bone morphogenic protein (BMP) signaling. This technology is well-suited as a platform to understand in greater detail the pathogenesis of human disease associated with impaired neural crest development/migration. PMID:25986498

  9. Patient-specific embryonic stem cells derived from human SCNT blastocysts.

    PubMed

    Hwang, Woo Suk; Roh, Sung Il; Lee, Byeong Chun; Kang, Sung Keun; Kwon, Dae Kee; Kim, Sue; Kim, Sun Jong; Park, Sun Woo; Kwon, Hee Sun; Lee, Chang Kyu; Lee, Jung Bok; Kim, Jin Mee; Ahn, Curie; Paek, Sun Ha; Chang, Sang Sik; Koo, Jung Jin; Yoon, Hyun Soo; Hwang, Jung Hye; Hwang, Youn Young; Park, Ye Soo; Oh, Sun Kyung; Kim, Hee Sun; Park, Jong Hyuk; Moon, Shin Yong; Schatten, Gerald

    2005-06-17

    Patient-specific, immune-matched human embryonic stem cells (hESCs) are anticipated to be of great biomedical importance for studies of disease and development and to advance clinical deliberations regarding stem cell transplantation. Eleven hESC lines were established by somatic cell nuclear transfer (SCNT) of skin cells from patients with disease or injury into donated oocytes. These lines, nuclear transfer (NT)-hESCs, grown on human feeders from the same NT donor or from genetically unrelated individuals, were established at high rates, regardless of NT donor sex or age. NT-hESCs were pluripotent, chromosomally normal, and matched the NT patient's DNA. The major histocompatibility complex identity of each NT-hESC when compared to the patient's own showed immunological compatibility, which is important for eventual transplantation. With the generation of these NT-hESCs, evaluations of genetic and epigenetic stability can be made. Additional work remains to be done regarding the development of reliable directed differentiation and the elimination of remaining animal components. Before clinical use of these cells can occur, preclinical evidence is required to prove that transplantation of differentiated NT-hESCs can be safe, effective, and tolerated.

  10. Systematic Identification of Single Amino Acid Variants in Glioma Stem-Cell-Derived Chromosome 19 Proteins

    PubMed Central

    2015-01-01

    Novel proteoforms with single amino acid variations represent proteins that often have altered biological functions but are less explored in the human proteome. We have developed an approach, searching high quality shotgun proteomic data against an extended protein database, to identify expressed mutant proteoforms in glioma stem cell (GSC) lines. The systematic search of MS/MS spectra using PEAKS 7.0 as the search engine has recognized 17 chromosome 19 proteins in GSCs with altered amino acid sequences. The results were further verified by manual spectral examination, validating 19 proteoforms. One of the novel findings, a mutant form of branched-chain aminotransferase 2 (p.Thr186Arg), was verified at the transcript level and by targeted proteomics in several glioma stem cell lines. The structure of this proteoform was examined by molecular modeling in order to estimate conformational changes due to mutation that might lead to functional modifications potentially linked to glioma. Based on our initial findings, we believe that our approach presented could contribute to construct a more complete map of the human functional proteome. PMID:25399873

  11. Generation of human pluripotent stem cell-derived hepatocyte-like cells for drug toxicity screening.

    PubMed

    Takayama, Kazuo; Mizuguchi, Hiroyuki

    2017-02-01

    Because drug-induced liver injury is one of the main reasons for drug development failures, it is important to perform drug toxicity screening in the early phase of pharmaceutical development. Currently, primary human hepatocytes are most widely used for the prediction of drug-induced liver injury. However, the sources of primary human hepatocytes are limited, making it difficult to supply the abundant quantities required for large-scale drug toxicity screening. Therefore, there is an urgent need for a novel unlimited, efficient, inexpensive, and predictive model which can be applied for large-scale drug toxicity screening. Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells are able to replicate indefinitely and differentiate into most of the body's cell types, including hepatocytes. It is expected that hepatocyte-like cells generated from human ES/iPS cells (human ES/iPS-HLCs) will be a useful tool for drug toxicity screening. To apply human ES/iPS-HLCs to various applications including drug toxicity screening, homogenous and functional HLCs must be differentiated from human ES/iPS cells. In this review, we will introduce the current status of hepatocyte differentiation technology from human ES/iPS cells and a novel method to predict drug-induced liver injury using human ES/iPS-HLCs.

  12. Spectroscopic signature of mouse embryonic stem cell-derived hepatocytes using synchrotron Fourier transform infrared microspectroscopy

    NASA Astrophysics Data System (ADS)

    Thumanu, Kanjana; Tanthanuch, Waraporn; Ye, Danna; Sangmalee, Anawat; Lorthongpanich, Chanchao; Parnpai, Rangsun; Heraud, Philip

    2011-05-01

    Stem cell-based therapy for liver regeneration has been proposed to overcome the persistent shortage in the supply of suitable donor organs. A requirement for this to succeed is to find a rapid method to detect functional hepatocytes, differentiated from embryonic stem cells. We propose Fourier transform infrared (FTIR) microspectroscopy as a versatile method to identify the early and last stages of the differentiation process leading to the formation of hepatocytes. Using synchrotron-FTIR microspectroscopy, the means of identifying hepatocytes at the single-cell level is possible and explored. Principal component analysis and subsequent partial least-squares (PLS) discriminant analysis is applied to distinguish endoderm induction from hepatic progenitor cells and matured hepatocyte-like cells. The data are well modeled by PLS with endoderm induction, hepatic progenitor cells, and mature hepatocyte-like cells able to be discriminated with very high sensitivity and specificity. This method provides a practical tool to monitor endoderm induction and has the potential to be applied for quality control of cell differentiation leading to hepatocyte formation.

  13. Brief Report: Immune Microenvironment Determines the Immunogenicity of Induced Pluripotent Stem Cell Derivatives.

    PubMed

    Todorova, Dilyana; Kim, Jinchul; Hamzeinejad, Sara; He, Jingjin; Xu, Yang

    2016-02-01

    The breakthrough of induced pluripotent stem cells (iPSCs) has raised the possibility that patient-specific iPSCs can provide autologous cells for cell therapy without the concern for immune rejection. However, the immunogenicity of iPSC-derived cells remains controversial. Using syngeneic C57BL/6 (B6) mouse transplantation model, several studies indicate that B6 iPSC-derived cells exhibit some levels of immunogenicity when transplanted into B6 mice subcutaneously. In contrast, one recent study has concluded that various lineages of B6 iPSC-derived cells exhibit no immunogenicity when transplanted under the kidney capsule of B6 mice. To resolve the controversy concerning this critical issue of iPSC biology, we used the same B6 transplantation model to demonstrate that the immune response toward antigens is dependent on the immune environment of the transplantation site. Immunogenic antigen-expressing B6 embryonic stem cells (ESCs) as well as B6 iPSCs and their terminally differentiated cells survived under the kidney capsule but are immune rejected when transplanted subcutaneously or intramuscularly. The cotransplantation of mature B6 dendritic cells under the kidney capsule leads to immune rejection of B6 iPSC-derived grafts but not B6 ESC-derived grafts, indicating that the lack of detectable immune response to iPSC-derived grafts under the kidney capsule is due to the lack of functional antigen presenting cells.

  14. Novel application of stem cell-derived factors for periodontal regeneration

    SciTech Connect

    Inukai, Takeharu; Katagiri, Wataru; Yoshimi, Ryoko; Osugi, Masashi; Kawai, Takamasa; Hibi, Hideharu; Ueda, Minoru

    2013-01-11

    Highlights: Black-Right-Pointing-Pointer Mesenchymal stem cells (MSCs) secrete a variety of cytokines. Black-Right-Pointing-Pointer Cytokines were detected in conditioned medium from cultured MSCs (MSC-CM). Black-Right-Pointing-Pointer MSC-CM enhanced activation of dog MSCs and periodontal ligament cells. Black-Right-Pointing-Pointer MSC-CM significantly promoted alveolar bone and cementum regeneration. Black-Right-Pointing-Pointer Multiple cytokines contained in MSC-CM promote periodontal regeneration. -- Abstract: The effect of conditioned medium from cultured mesenchymal stem cells (MSC-CM) on periodontal regeneration was evaluated. In vitro, MSC-CM stimulated migration and proliferation of dog MSCs (dMSCs) and dog periodontal ligament cells (dPDLCs). Cytokines such as insulin-like growth factor, vascular endothelial growth factor, transforming growth factor-{beta}1, and hepatocyte growth factor were detected in MSC-CM. In vivo, one-wall critical-size, intrabony periodontal defects were surgically created in the mandible of dogs. Dogs with these defects were divided into three groups that received MSC-CM, PBS, or no implants. Absorbable atelo-collagen sponges (TERUPLUG Registered-Sign ) were used as a scaffold material. Based on radiographic and histological observation 4 weeks after transplantation, the defect sites in the MSC-CM group displayed significantly greater alveolar bone and cementum regeneration than the other groups. These findings suggest that MSC-CM enhanced periodontal regeneration due to multiple cytokines contained in MSC-CM.

  15. Generation of retinal pigment epithelial cells from human embryonic stem cell-derived spherical neural masses.

    PubMed

    Cho, Myung Soo; Kim, Sang Jin; Ku, Seung-Yup; Park, Jung Hyun; Lee, Haksup; Yoo, Dae Hoon; Park, Un Chul; Song, Seul Ae; Choi, Young Min; Yu, Hyeong Gon

    2012-09-01

    Dysfunction and loss of retinal pigment epithelium (RPE) are major pathologic changes observed in various retinal degenerative diseases such as aged-related macular degeneration. RPE generated from human pluripotent stem cells can be a good candidate for RPE replacement therapy. Here, we show the differentiation of human embryonic stem cells (hESCs) toward RPE with the generation of spherical neural masses (SNMs), which are pure masses of hESCs-derived neural precursors. During the early passaging of SNMs, cystic structures arising from opened neural tube-like structures showed pigmented epithelial morphology. These pigmented cells were differentiated into functional RPE by neuroectodermal induction and mechanical purification. Most of the differentiated cells showed typical RPE morphologies, such as a polygonal-shaped epithelial monolayer, and transmission electron microscopy revealed apical microvilli, pigment granules, and tight junctions. These cells also expressed molecular markers of RPE, including Mitf, ZO-1, RPE65, CRALBP, and bestrophin. The generated RPE also showed phagocytosis of isolated bovine photoreceptor outer segment and secreting pigment epithelium-derived factor and vascular endothelial growth factor. Functional RPE could be generated from SNM in our method. Because SNMs have several advantages, including the capability of expansion for long periods without loss of differentiation capability, easy storage and thawing, and no need for feeder cells, our method for RPE differentiation may be used as an efficient strategy for generating functional RPE cells for retinal regeneration therapy.

  16. Stem cell-derived kidney cells and organoids: Recent breakthroughs and emerging applications.

    PubMed

    Chuah, Jacqueline Kai Chin; Zink, Daniele

    The global rise in the numbers of kidney patients and the shortage in transplantable organs have led to an increasing interest in kidney-specific regenerative therapies, renal disease modelling and bioartificial kidneys. Sources for large quantities of high-quality renal cells and tissues would be required, also for applications in in vitro platforms for compound safety and efficacy screening. Stem cell-based approaches for the generation of renal-like cells and tissues would be most attractive, but such methods were not available until recently. This situation has drastically changed since 2013, and various protocols for the generation of renal-like cells and precursors from pluripotent stem cells (PSC) have been established. The most recent breakthroughs were related to the establishment of various protocols for the generation of PSC-derived kidney organoids. In combination with recent advances in genome editing, bioprinting and the establishment of predictive renal screening platforms this results in exciting new possibilities. This review will give a comprehensive overview over current PSC-based protocols for the generation of renal-like cells, precursors and organoids, and their current and potential applications in regenerative medicine, compound screening, disease modelling and bioartificial organs.

  17. Functional Maturation of Human Stem Cell-Derived Neurons in Long-Term Cultures

    PubMed Central

    Töpfer, Felix M.; Wood, Phillip G.; Busskamp, Volker; Bamberg, Ernst

    2017-01-01

    Differentiated neurons can be rapidly acquired, within days, by inducing stem cells to express neurogenic transcription factors. We developed a protocol to maintain long-term cultures of human neurons, called iNGNs, which are obtained by inducing Neurogenin-1 and Neurogenin-2 expression in induced pluripotent stem cells. We followed the functional development of iNGNs over months and they showed many hallmark properties for neuronal maturation, including robust electrical and synaptic activity. Using iNGNs expressing a variant of channelrhodopsin-2, called CatCh, we could control iNGN activity with blue light stimulation. In combination with optogenetic tools, iNGNs offer opportunities for studies that require precise spatial and temporal resolution. iNGNs developed spontaneous network activity, and these networks had excitatory glutamatergic synapses, which we characterized with single-cell synaptic recordings. AMPA glutamatergic receptor activity was especially dominant in postsynaptic recordings, whereas NMDA glutamatergic receptor activity was absent from postsynaptic recordings but present in extrasynaptic recordings. Our results on long-term cultures of iNGNs could help in future studies elucidating mechanisms of human synaptogenesis and neurotransmission, along with the ability to scale-up the size of the cultures. PMID:28052116

  18. Function of human pluripotent stem cell-derived photoreceptor progenitors in blind mice

    PubMed Central

    Barnea-Cramer, Alona O.; Wang, Wei; Lu, Shi-Jiang; Singh, Mandeep S.; Luo, Chenmei; Huo, Hongguang; McClements, Michelle E.; Barnard, Alun R.; MacLaren, Robert E.; Lanza, Robert

    2016-01-01

    Photoreceptor degeneration due to retinitis pigmentosa (RP) is a primary cause of inherited retinal blindness. Photoreceptor cell-replacement may hold the potential for repair in a completely degenerate retina by reinstating light sensitive cells to form connections that relay information to downstream retinal layers. This study assessed the therapeutic potential of photoreceptor progenitors derived from human embryonic and induced pluripotent stem cells (ESCs and iPSCs) using a protocol that is suitable for future clinical trials. ESCs and iPSCs were cultured in four specific stages under defined conditions, resulting in generation of a near-homogeneous population of photoreceptor-like progenitors. Following transplantation into mice with end-stage retinal degeneration, these cells differentiated into photoreceptors and formed a cell layer connected with host retinal neurons. Visual function was partially restored in treated animals, as evidenced by two visual behavioral tests. Furthermore, the magnitude of functional improvement was positively correlated with the number of engrafted cells. Similar efficacy was observed using either ESCs or iPSCs as source material. These data validate the potential of human pluripotent stem cells for photoreceptor replacement therapies aimed at photoreceptor regeneration in retinal disease. PMID:27405580

  19. Mesenchymal Stem Cell-Derived Extracellular Vesicles: Roles in Tumor Growth, Progression, and Drug Resistance

    PubMed Central

    Tu, Huaijun; Yang, Yazhi; Wu, Qiong

    2017-01-01

    Mesenchymal stem cells (MSCs) are ubiquitously present in many tissues. Due to their unique advantages, MSCs have been widely employed in clinical studies. Emerging evidences indicate that MSCs can also migrate to the tumor surrounding stroma and exert complex effects on tumor growth and progression. However, the effect of MSCs on tumor growth is still a matter of debate. Several studies have shown that MSCs could favor tumor growth. On the contrary, other groups have demonstrated that MSCs suppressed tumor progression. Extracellular vesicles have emerged as a new mechanism of cell-to-cell communication in the development of tumor diseases. MSCs-derived extracellular vesicles (MSC-EVs) could mimic the effects of the mesenchymal stem cells from which they originate. Different studies have reported that MSC-EVs may exert various effects on the growth, metastasis, and drug response of different tumor cells by transferring proteins, messenger RNA, and microRNA to recipient cells. In the present review, we summarize the components of MSC-EVs and discuss the roles of MSC-EVs in different malignant diseases, including the related mechanisms that may account for their therapeutic potential. MSC-EVs open up a promising opportunity in the treatment of cancer with increased efficacy. PMID:28377788

  20. Concise Review: Measuring Physiological Responses of Human Pluripotent Stem Cell Derived Cardiomyocytes to Drugs and Disease

    PubMed Central

    van Meer, Berend J.; Tertoolen, Leon G.J.; Mummery, Christine L.

    2016-01-01

    Abstract Cardiomyocytes from human pluripotent stem cells (hPSC) are of growing interest as models to understand mechanisms underlying genetic disease, identify potential drug targets and for safety pharmacology as they may predict human relevant effects more accurately and inexpensively than animals or other cell models. Crucial to their optimal use are accurate methods to quantify cardiomyocyte phenotypes accurately and reproducibly. Here, we review current methods for determining biophysical parameters of hPSC‐derived cardiomyocytes (hPSC‐CMs) that recapitulate disease and drug responses. Even though hPSC‐CMs as currently available are immature, various biophysical methods are nevertheless already providing useful insights into the biology of the human heart and its maladies. Advantages and limitations of assays currently available looking toward applications of hPSC‐CMs are described with examples of how they have been used to date. This will help guide the choice of biophysical method to characterize healthy cardiomyocytes and their pathologies in vitro. Stem Cells 2016;34:2008–2015 PMID:27250776

  1. Innate immune response of human pluripotent stem cell-derived airway epithelium.

    PubMed

    McIntyre, Brendan A S; Kushwah, Rahul; Mechael, Rami; Shapovalova, Zoya; Alev, Cantas; Bhatia, Mickie

    2015-07-01

    The acquisition of innate immune response is requisite to having bona fide differentiation of airway epithelium. Procedures developed to differentiate lung airway from human pluripotent stem cells (hPSCs) have demonstrated anecdotal evidence for innate immune response, but an in-depth exploration of response levels is lacking. Herein, using an established method of airway epithelial generation from hPSCs, we show that hPSC-derived epithelial cells are able to up-regulate expression of TNFα, IL8 and IL1β in response to challenge with bacterial endotoxin LPS, but lack response from genes associated with innate immune response in other cell types. Further, stimulation of cells with TNF-α resulted in auto-induction of TNFα transcript, as well as cytokine responses of IL8 and IL1β. The demonstration of innate immune induction in hPSC-derived airway epithelia gives further strength to the functionality of in vitro protocols aimed at generating differentiated airway cells that can potentially be used in a translational setting. Finally, we propose that innate immune challenge of airway epithelium from human pluripotent stem cell sources be used as a robust validation of functional in vitro differentiation.

  2. Economic 3D-printing approach for transplantation of human stem cell-derived β-like cells.

    PubMed

    Song, Jiwon; Millman, Jeffrey R

    2016-12-01

    Transplantation of human pluripotent stem cells (hPSC) differentiated into insulin-producing β cells is a regenerative medicine approach being investigated for diabetes cell replacement therapy. This report presents a multifaceted transplantation strategy that combines differentiation into stem cell-derived β (SC-β) cells with 3D printing. By modulating the parameters of a low-cost 3D printer, we created a macroporous device composed of polylactic acid (PLA) that houses SC-β cell clusters within a degradable fibrin gel. Using finite element modeling of cellular oxygen diffusion-consumption and an in vitro culture system that allows for culture of devices at physiological oxygen levels, we identified cluster sizes that avoid severe hypoxia within 3D-printed devices and developed a microwell-based technique for resizing clusters within this range. Upon transplantation into mice, SC-β cell-embedded 3D-printed devices function for 12 weeks, are retrievable, and maintain structural integrity. Here, we demonstrate a novel 3D-printing approach that advances the use of differentiated hPSC for regenerative medicine applications and serves as a platform for future transplantation strategies.

  3. BMS-708163 and Nilotinib restore synaptic dysfunction in human embryonic stem cell-derived Alzheimer’s disease models

    PubMed Central

    Nishioka, Hisae; Tooi, Norie; Isobe, Takehisa; Nakatsuji, Norio; Aiba, Kazuhiro

    2016-01-01

    Alzheimer’s disease (AD) is the most common form of dementia. Cellular AD models derived from human pluripotent stem cells are promising tools in AD research. We recently developed human embryonic stem cell-derived AD models which overexpress mutant Presenilin1 genes, and which exhibit AD phenotypes, including synaptic dysfunction. In this study, we found that our AD models showed reduced levels of RAB3A and SV2B proteins in the pre-synapses, which is a possible cause of electrophysiological abnormalities. Through the screening of chemical compounds using our AD models, we have identified Aβ peptide inhibitors which decrease the concentration of Aβ in culture supernatant. Among these, BMS-708163 and Nilotinib were found to improve the expression levels of RAB3A and SV2B proteins and to recover the electrophysiological function in our AD models. These results suggest that the AD models we developed are promising materials for the discovery of AD drugs that target the expression of pre-synaptic proteins and synaptic function. PMID:27641902

  4. Three-Dimensional Culture of Human Embryonic Stem Cell Derived Hepatic Endoderm and Its Role in Bioartificial Liver Construction

    PubMed Central

    Sharma, Ruchi; Greenhough, Sebastian; Medine, Claire N.; Hay, David C.

    2010-01-01

    The liver carries out a range of functions essential for bodily homeostasis. The impairment of liver functions has serious implications and is responsible for high rates of patient morbidity and mortality. Presently, liver transplantation remains the only effective treatment, but donor availability is a major limitation. Therefore, artificial and bioartificial liver devices have been developed to bridge patients to liver transplantation. Existing support devices improve hepatic encephalopathy to a certain extent; however their usage is associated with side effects. The major hindrance in the development of bioartificial liver devices and cellular therapies is the limited availability of human hepatocytes. Moreover, primary hepatocytes are difficult to maintain and lose hepatic identity and function over time even with sophisticated tissue culture media. To overcome this limitation, renewable cell sources are being explored. Human embryonic stem cells are one such cellular resource and have been shown to generate a reliable and reproducible supply of human hepatic endoderm. Therefore, the use of human embryonic stem cell-derived hepatic endoderm in combination with tissue engineering has the potential to pave the way for the development of novel bioartificial liver devices and predictive drug toxicity assays. PMID:20169088

  5. Hallmarks of Alzheimer's Disease in Stem-Cell-Derived Human Neurons Transplanted into Mouse Brain.

    PubMed

    Espuny-Camacho, Ira; Arranz, Amaia M; Fiers, Mark; Snellinx, An; Ando, Kunie; Munck, Sebastian; Bonnefont, Jerome; Lambot, Laurie; Corthout, Nikky; Omodho, Lorna; Vanden Eynden, Elke; Radaelli, Enrico; Tesseur, Ina; Wray, Selina; Ebneth, Andreas; Hardy, John; Leroy, Karelle; Brion, Jean-Pierre; Vanderhaeghen, Pierre; De Strooper, Bart

    2017-03-08

    Human pluripotent stem cells (PSCs) provide a unique entry to study species-specific aspects of human disorders such as Alzheimer's disease (AD). However, in vitro culture of neurons deprives them of their natural environment. Here we transplanted human PSC-derived cortical neuronal precursors into the brain of a murine AD model. Human neurons differentiate and integrate into the brain, express 3R/4R Tau splice forms, show abnormal phosphorylation and conformational Tau changes, and undergo neurodegeneration. Remarkably, cell death was dissociated from tangle formation in this natural 3D model of AD. Using genome-wide expression analysis, we observed upregulation of genes involved in myelination and downregulation of genes related to memory and cognition, synaptic transmission, and neuron projection. This novel chimeric model for AD displays human-specific pathological features and allows the analysis of different genetic backgrounds and mutations during the course of the disease.

  6. A simple method to generate adipose stem cell-derived neurons for screening purposes.

    PubMed

    Bossio, Caterina; Mastrangelo, Rosa; Morini, Raffaella; Tonna, Noemi; Coco, Silvia; Verderio, Claudia; Matteoli, Michela; Bianco, Fabio

    2013-10-01

    Strategies involved in mesenchymal stem cell (MSC) differentiation toward neuronal cells for screening purposes are characterized by quality and quantity issues. Differentiated cells are often scarce with respect to starting undifferentiated population, and the differentiation process is usually quite long, with high risk of contamination and low yield efficiency. Here, we describe a novel simple method to induce direct differentiation of MSCs into neuronal cells, without neurosphere formation. Differentiated cells are characterized by clear morphological changes, expression of neuronal specific markers, showing functional response to depolarizing stimuli and electrophysiological properties similar to those of developing neurons. The method described here represents a valuable tool for future strategies aimed at personalized screening of therapeutic agents in vitro.

  7. Transcriptome analysis of common gene expression in human mesenchymal stem cells derived from four different origins.

    PubMed

    Wang, Tzu-Hao; Lee, Yun-Shien; Hwang, Shiaw-Min

    2011-01-01

    We have used Affymetrix oligonucleotide microarrays to analyze common transcriptomes and thereby learn about the core gene expression profile in human mesenchymal stem cells (MSC) from different tissues, including fetal amniotic fluid-derived MSC, term pregnancy amniotic membrane-derived MSC, term pregnancy umbilical cord blood-derived MSC, and adult bone marrow-derived MSC. The beauty of microarray analysis of gene expression (MAGE) is that it can be used to discover associating genes that were previously thought to be unrelated to a physiological or pathological event. However, interpreting complex biological processes from gene expression profiles often requires extensive knowledge mining in biomedical literature. In this chapter, we describe, step-by-step, how to use a commercially available biological database and software program, MetaCore (GeneGo Inc.), for functional network analysis.

  8. Stem and progenitor cell-derived astroglia therapies for neurological diseases

    PubMed Central

    Chen, Chen; Chan, Albert; Wen, Han; Chung, Seung-Hyuk; Deng, Wenbin; Jiang, Peng

    2015-01-01

    Astroglia are a major cellular constituent of the central nervous system (CNS) and play crucial roles in brain development, function and integrity. Increasing evidence demonstrates that astroglia dysfunction occurs in a variety of neurological disorders ranging from CNS injuries to genetic diseases and chronic degenerative conditions. These new insights herald the concept that transplantation of astroglia could be of therapeutic value in treating the injured or diseased CNS. Recent technological advances in the generation of human astroglia from stem and progenitor cells have been prominent. We propose that a better understanding of the suitability of astroglial cells in transplantation, as well as of their therapeutic effects in animal models may lead to the establishment of astroglia-based therapies to treat neurological diseases. PMID:26443123

  9. Autologous Induced Stem-Cell-Derived Retinal Cells for Macular Degeneration.

    PubMed

    Mandai, Michiko; Watanabe, Akira; Kurimoto, Yasuo; Hirami, Yasuhiko; Morinaga, Chikako; Daimon, Takashi; Fujihara, Masashi; Akimaru, Hiroshi; Sakai, Noriko; Shibata, Yumiko; Terada, Motoki; Nomiya, Yui; Tanishima, Shigeki; Nakamura, Masahiro; Kamao, Hiroyuki; Sugita, Sunao; Onishi, Akishi; Ito, Tomoko; Fujita, Kanako; Kawamata, Shin; Go, Masahiro J; Shinohara, Chikara; Hata, Ken-Ichiro; Sawada, Masanori; Yamamoto, Midori; Ohta, Sachiko; Ohara, Yasuo; Yoshida, Kenichi; Kuwahara, Junko; Kitano, Yuko; Amano, Naoki; Umekage, Masafumi; Kitaoka, Fumiyo; Tanaka, Azusa; Okada, Chihiro; Takasu, Naoko; Ogawa, Seishi; Yamanaka, Shinya; Takahashi, Masayo

    2017-03-16

    We assessed the feasibility of transplanting a sheet of retinal pigment epithelial (RPE) cells differentiated from induced pluripotent stem cells (iPSCs) in a patient with neovascular age-related macular degeneration. The iPSCs were generated from skin fibroblasts obtained from two patients with advanced neovascular age-related macular degeneration and were differentiated into RPE cells. The RPE cells and the iPSCs from which they were derived were subject to extensive testing. A surgery that included the removal of the neovascular membrane and transplantation of the autologous iPSC-derived RPE cell sheet under the retina was performed in one of the patients. At 1 year after surgery, the transplanted sheet remained intact, best corrected visual acuity had not improved or worsened, and cystoid macular edema was present. (Funded by Highway Program for Realization of Regenerative Medicine and others; University Hospital Medical Information Network Clinical Trials Registry [UMIN-CTR] number, UMIN000011929 .).

  10. Complete Meiosis from Embryonic Stem Cell-Derived Germ Cells In Vitro.

    PubMed

    Zhou, Quan; Wang, Mei; Yuan, Yan; Wang, Xuepeng; Fu, Rui; Wan, Haifeng; Xie, Mingming; Liu, Mingxi; Guo, Xuejiang; Zheng, Ying; Feng, Guihai; Shi, Qinghua; Zhao, Xiao-Yang; Sha, Jiahao; Zhou, Qi

    2016-03-03

    In vitro generation of functional gametes is a promising approach for treating infertility, although faithful replication of meiosis has proven to be a substantial obstacle to deriving haploid gamete cells in culture. Here we report complete in vitro meiosis from embryonic stem cell (ESC)-derived primordial germ cells (PGCLCs). Co-culture of PGCLCs with neonatal testicular somatic cells and sequential exposure to morphogens and sex hormones reproduced key hallmarks of meiosis, including erasure of genetic imprinting, chromosomal synapsis and recombination, and correct nuclear DNA and chromosomal content in the resulting haploid cells. Intracytoplasmic injection of the resulting spermatid-like cells into oocytes produced viable and fertile offspring, showing that this robust stepwise approach can functionally recapitulate male gametogenesis in vitro. These findings provide a platform for investigating meiotic mechanisms and the potential generation of human haploid spermatids in vitro.

  11. Extracellular Recordings of Patterned Human Pluripotent Stem Cell-Derived Cardiomyocytes on Aligned Fibers

    PubMed Central

    Minami, Itsunari; Yu, Leqian; Nakajima, Minako; Qiao, Jing; Shimono, Ken; Nakatsuji, Norio; Kotera, Hitetoshi; Chen, Yong

    2016-01-01

    Human induced pluripotent stem cell (hiPSC) derived cardiomyocytes (CMs) hold high potential for use in drug assessment and myocardial regeneration. To create tissue-like constructs of CMs for extracellular monitoring, we placed aligned fibers (AFs) on the surface of a microelectrode array and then seeded hiPSC-CMs for subsequent monitoring for 14 days. As expected, the CMs organized into anisotropic and matured tissue and the extracellular recordings showed reduced premature beating higher signal amplitude and a higher probability of T-wave detection as compared to the culture without fibers. The CMs on the aligned fibers samples also exhibited anisotropic propagation of the field potential. These results therefore suggest that the hiPSC-CMs cultured on AFs can be used more reliably for cell based assays. PMID:27446217

  12. Single cell-derived clones from human adipose stem cells present different immunomodulatory properties.

    PubMed

    Sempere, J M; Martinez-Peinado, P; Arribas, M I; Reig, J A; De La Sen, M L; Zubcoff, J J; Fraga, M F; Fernández, A F; Santana, A; Roche, E

    2014-05-01

    Human adipose mesenchymal stem cells are a heterogeneous population, where cell cultures derived from single-cell-expanded clones present varying degrees of differential plasticity. This work focuses on the immunomodulatory/anti-inflammatory properties of these cells. To this end, five single-cell clones were isolated (generally called 1.X and 3.X) from two volunteers. Regarding the expression level of the lineage-characteristic surface antigens, clones 1·10 and 1·22 expressed the lowest amounts, while clones 3·10 and 3·5 expressed more CD105 than the rest and clone 1·7 expressed higher amounts of CD73 and CD44. Regarding cytokine secretion, all clones were capable of spontaneously releasing high levels of interleukin (IL)-6 and low to moderate levels of IL-8. These differences can be explained in part by the distinct methylation profile exhibited by the clones. Furthermore, and after lipopolysaccharide stimulation, clone 3.X produced the highest amounts of proinflammatory cytokines such as IL-1β, while clones 1·10 and 1·22 highly expressed IL-4 and IL-5. In co-culture experiments, clones 1.X are, together, more potent inhibitors than clones 3.X for proliferation of total, CD3(+) T, CD4(+) T and CD8(+) T lymphocytes and natural killer (NK) cells. The results of this work indicate that the adipose stem cell population is heterogeneous in cytokine production profile, and that isolation, characterization and selection of the appropriate cell clone is a more exact method for the possible treatment of different patients or pathologies.

  13. Reconstruction of phrenic neuron identity in embryonic stem cell-derived motor neurons

    PubMed Central

    Machado, Carolina Barcellos; Kanning, Kevin C.; Kreis, Patricia; Stevenson, Danielle; Crossley, Martin; Nowak, Magdalena; Iacovino, Michelina; Kyba, Michael; Chambers, David; Blanc, Eric; Lieberam, Ivo

    2014-01-01

    Air breathing is an essential motor function for vertebrates living on land. The rhythm that drives breathing is generated within the central nervous system and relayed via specialised subsets of spinal motor neurons to muscles that regulate lung volume. In mammals, a key respiratory muscle is the diaphragm, which is innervated by motor neurons in the phrenic nucleus. Remarkably, relatively little is known about how this crucial subtype of motor neuron is generated during embryogenesis. Here, we used direct differentiation of motor neurons from mouse embryonic stem cells as a tool to identify genes that direct phrenic neuron identity. We find that three determinants, Pou3f1, Hoxa5 and Notch, act in combination to promote a phrenic neuron molecular identity. We show that Notch signalling induces Pou3f1 in developing motor neurons in vitro and in vivo. This suggests that the phrenic neuron lineage is established through a local source of Notch ligand at mid-cervical levels. Furthermore, we find that the cadherins Pcdh10, which is regulated by Pou3f1 and Hoxa5, and Cdh10, which is controlled by Pou3f1, are both mediators of like-like clustering of motor neuron cell bodies. This specific Pcdh10/Cdh10 activity might provide the means by which phrenic neurons are assembled into a distinct nucleus. Our study provides a framework for understanding how phrenic neuron identity is conferred and will help to generate this rare and inaccessible yet vital neuronal subtype directly from pluripotent stem cells, thus facilitating subsequent functional investigations. PMID:24496616

  14. Single cell-derived clones from human adipose stem cells present different immunomodulatory properties

    PubMed Central

    Sempere, J M; Martinez-Peinado, P; Arribas, M I; Reig, J A; De La Sen, M L; Zubcoff, J J; Fraga, M F; Fernández, A F; Santana, A; Roche, E

    2014-01-01

    Human adipose mesenchymal stem cells are a heterogeneous population, where cell cultures derived from single-cell-expanded clones present varying degrees of differential plasticity. This work focuses on the immunomodulatory/anti-inflammatory properties of these cells. To this end, five single-cell clones were isolated (generally called 1.X and 3.X) from two volunteers. Regarding the expression level of the lineage-characteristic surface antigens, clones 1·10 and 1·22 expressed the lowest amounts, while clones 3·10 and 3·5 expressed more CD105 than the rest and clone 1·7 expressed higher amounts of CD73 and CD44. Regarding cytokine secretion, all clones were capable of spontaneously releasing high levels of interleukin (IL)-6 and low to moderate levels of IL-8. These differences can be explained in part by the distinct methylation profile exhibited by the clones. Furthermore, and after lipopolysaccharide stimulation, clone 3.X produced the highest amounts of proinflammatory cytokines such as IL-1β, while clones 1·10 and 1·22 highly expressed IL-4 and IL-5. In co-culture experiments, clones 1.X are, together, more potent inhibitors than clones 3.X for proliferation of total, CD3+T, CD4+T and CD8+T lymphocytes and natural killer (NK) cells. The results of this work indicate that the adipose stem cell population is heterogeneous in cytokine production profile, and that isolation, characterization and selection of the appropriate cell clone is a more exact method for the possible treatment of different patients or pathologies. PMID:24666184

  15. Mesenchymal stem cell-derived exosomes from different sources selectively promote neuritic outgrowth.

    PubMed

    Lopez-Verrilli, M A; Caviedes, A; Cabrera, A; Sandoval, S; Wyneken, U; Khoury, M

    2016-04-21

    Mesenchymal stem cells (MSCs) obtained from bone marrow (BM) have been shown to promote neuronal growth and survival. However, the comparative effects of MSCs of different sources, including menstrual MSCs (MenSCs), BM, umbilical cord and chorion stem cells on neurite outgrowth have not yet been explored. Moreover, the modulatory effects of MSCs may be mediated by paracrine mechanisms, i.e. by molecules contained in the MSC secretome that includes soluble factors and extracellular vesicles such as microvesicles and/or exosomes. The biogenesis of microvesicles, characterized by a vesicle diameter of 50 to 1000 nm, involves membrane shedding while exosomes, of 30 to 100 nm in diameter, originate in the multivesicular bodies within cells. Both vesicle types, which can be harvested from the conditioned media of cell cultures by differential centrifugation steps, regulate the function of target cells due to their molecular content of microRNA, mRNA, proteins and lipids. Here, we compared the effect of human menstrual MSCs (MenSCs) mediated by cell-cell contact, by their total secretome or by secretome-derived extracellular vesicles on neuritic outgrowth in primary neuronal cultures. The contact of MenSCs with cortical neurons inhibited neurite outgrowth while their total secretome enhanced it. The extracellular vesicle fractions showed a distinctive effect: while the exosome-enriched fraction enhanced neurite outgrowth, the microvesicle-enriched fraction displayed an inhibitory effect. When we compared exosome fractions of different human MSC sources, MenSC exosomes showed superior effects on the growth of the longest neurite in cortical neurons and had a comparable effect to BM-SC exosomes on neurite outgrowth in dorsal root ganglia neurons. Thus, the growth-stimulating effects of exosomes derived from MenSCs as well as the opposing effects of both extracellular vesicle fractions provide important information regarding the potential use of MenSCs as therapeutic

  16. Reconstruction of phrenic neuron identity in embryonic stem cell-derived motor neurons.

    PubMed

    Machado, Carolina Barcellos; Kanning, Kevin C; Kreis, Patricia; Stevenson, Danielle; Crossley, Martin; Nowak, Magdalena; Iacovino, Michelina; Kyba, Michael; Chambers, David; Blanc, Eric; Lieberam, Ivo

    2014-02-01

    Air breathing is an essential motor function for vertebrates living on land. The rhythm that drives breathing is generated within the central nervous system and relayed via specialised subsets of spinal motor neurons to muscles that regulate lung volume. In mammals, a key respiratory muscle is the diaphragm, which is innervated by motor neurons in the phrenic nucleus. Remarkably, relatively little is known about how this crucial subtype of motor neuron is generated during embryogenesis. Here, we used direct differentiation of motor neurons from mouse embryonic stem cells as a tool to identify genes that direct phrenic neuron identity. We find that three determinants, Pou3f1, Hoxa5 and Notch, act in combination to promote a phrenic neuron molecular identity. We show that Notch signalling induces Pou3f1 in developing motor neurons in vitro and in vivo. This suggests that the phrenic neuron lineage is established through a local source of Notch ligand at mid-cervical levels. Furthermore, we find that the cadherins Pcdh10, which is regulated by Pou3f1 and Hoxa5, and Cdh10, which is controlled by Pou3f1, are both mediators of like-like clustering of motor neuron cell bodies. This specific Pcdh10/Cdh10 activity might provide the means by which phrenic neurons are assembled into a distinct nucleus. Our study provides a framework for understanding how phrenic neuron identity is conferred and will help to generate this rare and inaccessible yet vital neuronal subtype directly from pluripotent stem cells, thus facilitating subsequent functional investigations.

  17. Generation of tissue-engineered small intestine using embryonic stem cell-derived human intestinal organoids

    PubMed Central

    Finkbeiner, Stacy R.; Freeman, Jennifer J.; Wieck, Minna M.; El-Nachef, Wael; Altheim, Christopher H.; Tsai, Yu-Hwai; Huang, Sha; Dyal, Rachel; White, Eric S.; Grikscheit, Tracy C.; Teitelbaum, Daniel H.; Spence, Jason R.

    2015-01-01

    ABSTRACT Short bowel syndrome (SBS) is characterized by poor nutrient absorption due to a deficit of healthy intestine. Current treatment practices rely on providing supportive medical therapy with parenteral nutrition; while life saving, such interventions are not curative and are still associated with significant co-morbidities. As approaches to lengthen remaining intestinal tissue have been met with only limited success and intestinal transplants have poor survival outcomes, new approaches to treating SBS are necessary. Human intestine derived from embryonic stem cells (hESCs) or induced pluripotent stem cells (iPSCs), called human intestinal organoids (HIOs), have the potential to offer a personalized and scalable source of intestine for regenerative therapies. However, given that HIOs are small three-dimensional structures grown in vitro, methods to generate usable HIO-derived constructs are needed. We investigated the ability of hESCs or HIOs to populate acellular porcine intestinal matrices and artificial polyglycolic/poly L lactic acid (PGA/PLLA) scaffolds, and examined the ability of matrix/scaffolds to thrive when transplanted in vivo. Our results demonstrate that the acellular matrix alone is not sufficient to instruct hESC differentiation towards an endodermal or intestinal fate. We observed that while HIOs reseed acellular porcine matrices in vitro, the HIO-reseeded matrices do not thrive when transplanted in vivo. In contrast, HIO-seeded PGA/PLLA scaffolds thrive in vivo and develop into tissue that looks nearly identical to adult human intestinal tissue. Our results suggest that HIO-seeded PGA/PLLA scaffolds are a promising avenue for developing the mucosal component of tissue engineered human small intestine, which need to be explored further to develop them into fully functional tissue. PMID:26459240

  18. Generation of tissue-engineered small intestine using embryonic stem cell-derived human intestinal organoids.

    PubMed

    Finkbeiner, Stacy R; Freeman, Jennifer J; Wieck, Minna M; El-Nachef, Wael; Altheim, Christopher H; Tsai, Yu-Hwai; Huang, Sha; Dyal, Rachel; White, Eric S; Grikscheit, Tracy C; Teitelbaum, Daniel H; Spence, Jason R

    2015-10-12

    Short bowel syndrome (SBS) is characterized by poor nutrient absorption due to a deficit of healthy intestine. Current treatment practices rely on providing supportive medical therapy with parenteral nutrition; while life saving, such interventions are not curative and are still associated with significant co-morbidities. As approaches to lengthen remaining intestinal tissue have been met with only limited success and intestinal transplants have poor survival outcomes, new approaches to treating SBS are necessary. Human intestine derived from embryonic stem cells (hESCs) or induced pluripotent stem cells (iPSCs), called human intestinal organoids (HIOs), have the potential to offer a personalized and scalable source of intestine for regenerative therapies. However, given that HIOs are small three-dimensional structures grown in vitro, methods to generate usable HIO-derived constructs are needed. We investigated the ability of hESCs or HIOs to populate acellular porcine intestinal matrices and artificial polyglycolic/poly L lactic acid (PGA/PLLA) scaffolds, and examined the ability of matrix/scaffolds to thrive when transplanted in vivo. Our results demonstrate that the acellular matrix alone is not sufficient to instruct hESC differentiation towards an endodermal or intestinal fate. We observed that while HIOs reseed acellular porcine matrices in vitro, the HIO-reseeded matrices do not thrive when transplanted in vivo. In contrast, HIO-seeded PGA/PLLA scaffolds thrive in vivo and develop into tissue that looks nearly identical to adult human intestinal tissue. Our results suggest that HIO-seeded PGA/PLLA scaffolds are a promising avenue for developing the mucosal component of tissue engineered human small intestine, which need to be explored further to develop them into fully functional tissue.

  19. Influence of activin A supplementation during human embryonic stem cell derivation on germ cell differentiation potential.

    PubMed

    Duggal, Galbha; Heindryckx, Björn; Warrier, Sharat; O'Leary, Thomas; Van der Jeught, Margot; Lierman, Sylvie; Vossaert, Liesbeth; Deroo, Tom; Deforce, Dieter; Chuva de Sousa Lopes, Susana M; De Sutter, Petra

    2013-12-01

    Human embryonic stem cells (hESCs) are more similar to "primed" mouse epiblast stem cells (mEpiSCs). mEpiSCs, which are derived in Activin A, show an increased propensity to form primordial germ cell (PGC)-like cells in response to bone morphogenic protein 4 (BMP4). Hence, we hypothesized that hESCs derived in the presence of Activin A may be more competent in differentiating towards PGC-like cells after supplementation with BMP4 compared to standard hESC lines. We were able to successfully derive two hESC lines in the presence of Activin A, which were pluripotent and showed higher base levels of STELLA and cKIT compared to standard hESC lines derived without Activin A addition. Furthermore, upon differentiation as embryoid bodies in the presence of BMP4, we observed upregulation of VASA at day 7, both at the transcript and protein level compared to standard hESC lines, which appeared to take longer time for PGC specification. Unlike other hESC lines, nuclear pSMAD2/3 presence confirmed that Activin signalling was switched on in Activin A-derived hESC lines. They were also responsive to BMP4 based on nuclear detection of pSMAD1/5/8 and showed endodermal differentiation as a result of GATA-6 expression. Hence, our results provide novel insights into the impact of hESC derivation in the presence of Activin A and its subsequent influence on germ cell differentiation potential in vitro.

  20. Generation of Neural Crest-Like Cells From Human Periodontal Ligament Cell-Derived Induced Pluripotent Stem Cells.

    PubMed

    Tomokiyo, Atsushi; Hynes, Kim; Ng, Jia; Menicanin, Danijela; Camp, Esther; Arthur, Agnes; Gronthos, Stan; Mark Bartold, Peter

    2017-02-01

    Neural crest cells (NCC) hold great promise for tissue engineering, however the inability to easily obtain large numbers of NCC is a major factor limiting their use in studies of regenerative medicine. Induced pluripotent stem cells (iPSC) are emerging as a novel candidate that could provide an unlimited source of NCC. In the present study, we examined the potential of neural crest tissue-derived periodontal ligament (PDL) iPSC to differentiate into neural crest-like cells (NCLC) relative to iPSC generated from a non-neural crest derived tissue, foreskin fibroblasts (FF). We detected high HNK1 expression during the differentiation of PDL and FF iPSC into NCLC as a marker for enriching for a population of cells with NCC characteristics. We isolated PDL iPSC- and FF iPSC-derived NCLC, which highly expressed HNK1. A high proportion of the HNK1-positive cell populations generated, expressed the MSC markers, whilst very few cells expressed the pluripotency markers or the hematopoietic markers. The PDL and FF HNK1-positive populations gave rise to smooth muscle, neural, glial, osteoblastic and adipocytic like cells and exhibited higher expression of smooth muscle, neural, and glial cell-associated markers than the PDL and FF HNK1-negative populations. Interestingly, the HNK1-positive cells derived from the PDL-iPSC exhibited a greater ability to differentiate into smooth muscle, neural, glial cells and adipocytes, than the HNK1-positive cells derived from the FF-iPSC. Our work suggests that HNK1-enriched NCLC from neural crest tissue-derived iPSC more closely resemble the phenotypic and functional hallmarks of NCC compared to the HNK1-low population and non-neural crest iPSC-derived NCLC. J. Cell. Physiol. 232: 402-416, 2017. © 2016 Wiley Periodicals, Inc.

  1. Polyphosphate induces matrix metalloproteinase-3-mediated proliferation of odontoblast-like cells derived from induced pluripotent stem cells

    SciTech Connect

    Ozeki, Nobuaki; Hase, Naoko; Yamaguchi, Hideyuki; Hiyama, Taiki; Kawai, Rie; Kondo, Ayami; Nakata, Kazuhiko; Mogi, Makio

    2015-05-01

    Inorganic polyphosphate [Poly(P)] may represent a physiological source of phosphate and has the ability to induce bone differentiation in osteoblasts. We previously reported that cytokine-induced matrix metalloproteinase (MMP)-3 accelerates the proliferation of purified odontoblast-like cells. In this study, MMP-3 small interfering RNA (siRNA) was transfected into odontoblast-like cells derived from induced pluripotent stem cells to investigate whether MMP-3 activity is induced by Poly(P) and/or is associated with cell proliferation and differentiation into odontoblast-like cells. Treatment with Poly(P) led to an increase in both cell proliferation and additional odontoblastic differentiation. Poly(P)-treated cells showed a small but significant increase in dentin sialophosphoprotein (DSPP) and dentin matrix protein-1 (DMP-1) mRNA expression, which are markers of mature odontoblasts. The cells also acquired additional odontoblast-specific properties including adoption of an odontoblastic phenotype typified by high alkaline phosphatase (ALP) activity and a calcification capacity. In addition, Poly(P) induced expression of MMP-3 mRNA and protein, and increased MMP-3 activity. MMP-3 siRNA-mediated disruption of the expression of these effectors potently suppressed the expression of odontoblastic biomarkers ALP, DSPP, and DMP-1, and blocked calcification. Interestingly, upon siRNA-mediated silencing of MMP-3, we noted a potent and significant decrease in cell proliferation. Using specific siRNAs, we revealed that a unique signaling cascade, Poly(P)→MMP-3→DSPP and/or DMP-1, was intimately involved in the proliferation of odontoblast-like cells. - Highlights: • Polyphosphate increases proliferation of iPS cell-derived odontoblast-like cells. • Polyphosphate-induced MMP-3 results in an increase of cell proliferation. • Induced cell proliferation involves MMP-3, DSPP, and/or DMP-1 sequentially. • Induced MMP-3 also results in an increase of odontoblastic

  2. Introducing a single-cell-derived human mesenchymal stem cell line expressing hTERT after lentiviral gene transfer.

    PubMed

    Böcker, Wolfgang; Yin, Zhanhai; Drosse, Inga; Haasters, Florian; Rossmann, Oliver; Wierer, Matthias; Popov, Cvetan; Locher, Melanie; Mutschler, Wolf; Docheva, Denitsa; Schieker, Matthias

    2008-08-01

    Human mesenchymal stem cells (hMSCs) can be readily isolated from bone marrow and differentiate into multiple tissues, making them a promising target for future cell and gene therapy applications. The low frequency of hMSCs in bone marrow necessitates their isolation and expansion in vitro prior to clinical use, but due to senescence-associated growth arrest during culture, limited cell numbers can be generated. The lifespan of hMSCs has been extended by ectopic expression of human telomerase reverse transcriptase (hTERT) using retroviral vectors. Since malignant transformation was observed in hMSCs and retroviral vectors cause insertional mutagenesis, we ectopically expressed hTERT using lentiviral gene transfer. Single-cell-derived hMSC clones expressing hTERT did not show malignant transformation in vitro and in vivo after extended culture periods. There were no changes observed in the expression of tumour suppressor genes and karyotype. Cultured hMSCs lack telomerase activity, but it was significantly increased by ectopic expression of hTERT. HTERT expression prevented hMSC senescence and the cells showed significantly higher and unlimited proliferation capacity. Even after an extended culture period, hMSCs expressing hTERT preserved their stem cells character as shown by osteogenic, adipogenic and chondrogenic differentiation. In summary, extending the lifespan of human mesenchymal stem cells by ectopic expression of hTERT using lentiviral gene transfer may be an attractive and safe way to generate appropriate cell numbers for cell and gene therapy applications.

  3. Functional and phenotypic differences of pure populations of stem cell-derived astrocytes and neuronal precursor cells.

    PubMed

    Kleiderman, Susanne; Sá, João V; Teixeira, Ana P; Brito, Catarina; Gutbier, Simon; Evje, Lars G; Hadera, Mussie G; Glaab, Enrico; Henry, Margit; Sachinidis, Agapios; Alves, Paula M; Sonnewald, Ursula; Leist, Marcel

    2016-05-01

    Availability of homogeneous astrocyte populations would facilitate research concerning cell plasticity (metabolic and transcriptional adaptations; innate immune responses) and cell cycle reactivation. Current protocols to prepare astrocyte cultures differ in their final content of immature precursor cells, preactivated cells or entirely different cell types. A new method taking care of all these issues would improve research on astrocyte functions. We found here that the exposure of a defined population of pluripotent stem cell-derived neural stem cells (NSC) to BMP4 results in pure, nonproliferating astrocyte cultures within 24-48 h. These murine astrocytes generated from embryonic stem cells (mAGES) expressed the positive markers GFAP, aquaporin 4 and GLT-1, supported neuronal function, and acquired innate immune functions such as the response to tumor necrosis factor and interleukin 1. The protocol was applicable to several normal or disease-prone pluripotent cell lines, and the corresponding mAGES all exited the cell cycle and lost most of their nestin expression, in contrast to astrocytes generated by serum-addition or obtained as primary cultures. Comparative gene expression analysis of mAGES and NSC allowed quantification of differences between the two cell types and a definition of an improved marker set to define astrocytes. Inclusion of several published data sets in this transcriptome comparison revealed the similarity of mAGES with cortical astrocytes in vivo. Metabolic analysis of homogeneous NSC and astrocyte populations revealed distinct neurochemical features: both cell types synthesized glutamine and citrate, but only mature astrocytes released these metabolites. Thus, the homogeneous cultures allowed an improved definition of NSC and astrocyte features.

  4. Stromal cell-derived factor-1 promotes human adipose tissue-derived stem cell survival and chronic wound healing

    PubMed Central

    LI, QIANG; GUO, YANPING; CHEN, FEIFEI; LIU, JING; JIN, PEISHENG

    2016-01-01

    Adipose tissue-derived stem cells (ADSCs) hold great potential for the stem cell-based therapy of cutaneous wound healing. Stromal cell-derived factor-1 (SDF-1) activates CXC chemokine receptor (CXCR)4+ and CXCR7+ cells and plays an important role in wound healing. Increasing evidence suggests a critical role for SDF-1 in cell apoptosis and the survival of mesenchymal stem cells. However, the function of SDF-1 in the apoptosis and wound healing ability of ADSCs is not well understood. The aim of this study was to analyze the effect of SDF-1 on the apoptosis and therapeutic effect of ADSCs in cutaneous chronic wounds in vitro and in vivos. By flow cytometric analysis, it was found that hypoxia and serum free promoted the apoptosis of ADSCs. When pretreated with SDF-1, the apoptosis of ADSCs induced by hypoxia and serum depletion was partly recovered. Furthermore, in vivo experiments established that the post-implantation cell survival and chronic wound healing ability of ADSCs were increased following pretreatment with SDF-1 in a diabetic mouse model of chronic wound healing. To explore the potential mechanism underlying the effect of SDF-1 on ADSC apoptosis, western blot analysis was employed and the results indicate that SDF-1 may protect against cell apoptosis in hypoxic and serum-free conditions through activation of the caspase signaling pathway in ADSCs. This study provides evidence that SDF-1 pretreatment can increase the therapeutic effect of ADSCs in cutaneous chronic wounds in vitro and in vivo. PMID:27347016

  5. Building A New Treatment For Heart Failure-Transplantation of Induced Pluripotent Stem Cell-derived Cells into the Heart

    PubMed Central

    Miyagawa, Shigeru; Fukushima, Satsuki; Imanishi, Yukiko; Kawamura, Takuji; Mochizuki-Oda, Noriko; Masuda, Shigeo; Sawa, Yoshiki

    2016-01-01

    Advanced cardiac failure is a progressive intractable disease and is the main cause of mortality and morbidity worldwide. Since this pathology is represented by a definite decrease in cardiomyocyte number, supplementation of functional cardiomyocytes into the heart would hypothetically be an ideal therapeutic option. Recently, unlimited in vitro production of human functional cardiomyocytes was established by using induced pluripotent stem cell (iPSC) technology, which avoids the use of human embryos. A number of basic studies including ours have shown that transplantation of iPSC-derived cardiomyocytes (iPSC-CMs) into the damaged heart leads to recovery of cardiac function, thereby establishing “proof-of-concept” of this iPSC-transplantation therapy. However, considering clinical application of this therapy, its feasibility, safety, and therapeutic efficacy need to be further investigated in the pre-clinical stage. This review summarizes up-to-date important topics related to safety and efficacy of iPSC-CMs transplantation therapy for cardiac disease and discusses the prospects for this treatment in clinical studies.

  6. Stem Cell Derived Extracellular Matrix Enables Survival and Multi Lineage Differentiation within Superporous Hydrogels

    PubMed Central

    Köllmer, Melanie; Keskar, Vandana; Hauk, Thomas G.; Collins, John M.; Russell, Brenda; Gemeinhart, Richard A.

    2012-01-01

    Hydrophilic poly(ethylene glycol) diacrylate (PEGDA) hydrogel surfaces resist protein adsorption and are generally thought to be unsuitable for anchorage dependent cells to adhere. Intriguingly, our previous findings revealed that PEGDA superporous hydrogel scaffolds (SPHs) allow anchorage of bone marrow derived human mesenchymal stem cells (hMSCs) and support their long term survival. Therefore, we hypothesized that the physicochemical characteristics of the scaffold impart properties that could foster cellular responses. We examined if hMSCs alter their microenvironment to allow cell attachment by synthesizing their own extracellular matrix (ECM) proteins. Immunofluorescence staining revealed extensive expression of collagen type I, collagen type IV, laminin and fibronectin within hMSC-seeded SPHs by the end of the third week. Whether cultured in serum-free or serum-supplemented medium, hMSC ECM protein gene expression patterns exhibited no substantial changes. The presence of serum proteins is required for initial anchorage of hMSCs within the SPHs but not for the hMSC survival after 24 hours. In contrast to 2D expansion on tissue culture plastic (TCP), hMSCs cultured within SPHs proliferate similarly in the presence or absence of serum. To test whether hMSCs retain their undifferentiated state within the SPHs, cell-seeded constructs were cultured for 3 weeks in stem cell maintenance medium and the expression of hMSC-specific cell surface markers were evaluated by flow cytometry. CD105, CD90, CD73 and CD44 were present to a similar extent in the SPH and in 2D monolayer culture. We further demonstrated multi lineage potential of hMSCs grown in the PEGDA SPHs whereby differentiation into osteoblasts, chondrocytes and adipocytes could be induced. The present study demonstrates the potential of hMSCs to alter the “blank” PEGDA environment to a milieu conducive to cell growth and multi-lineage differentiation by secreting adhesive ECM proteins within the porous

  7. Isolation and characterization of ovine mesenchymal stem cells derived from peripheral blood

    PubMed Central

    2012-01-01

    Background Mesenchymal stem cells (MSCs) are multipotent stem cells with capacity to differentiate into several mesenchymal lineages. This quality makes MSCs good candidates for use in cell therapy. MSCs can be isolated from a variety of tissues including bone marrow and adipose tissue, which are the most common sources of these cells. However, MSCs can also be isolated from peripheral blood. Sheep has been proposed as an ideal model for biomedical studies including those of orthopaedics and transmissible spongiform encephalopathies (TSEs). The aim of this work was to advance these studies by investigating the possibility of MSC isolation from ovine peripheral blood (oPB-MSCs) and by subsequently characterizing there in vitro properties. Results Plastic-adherent fibroblast-like cells were obtained from the mononuclear fraction of blood samples. These cells were analysed for their proliferative and differentiation potential into adipocytes, osteoblasts and chondrocytes, as well as for the gene expression of cell surface markers. The isolated cells expressed transcripts for markers CD29, CD73 and CD90, but failed to express the haematopoietic marker CD45 and expressed only low levels of CD105. The expression of CD34 was variable. The differentiation potential of this cell population was evaluated using specific differentiation media. Although the ability of the cultures derived from different animals to differentiate into adipocytes, osteoblasts and chondrocytes was heterogeneous, we confirmed this feature using specific staining and analysing the gene expression of differentiation markers. Finally, we tested the ability of oPB-MSCs to transdifferentiate into neuronal-like cells. Morphological changes were observed after 24-hour culture in neurogenic media, and the transcript levels of the neurogenic markers increased during the prolonged induction period. Moreover, oPB-MSCs expressed the cellular prion protein gene (PRNP), which was up-regulated during neurogenesis

  8. Tumour resistance in induced pluripotent stem cells derived from naked mole-rats.

    PubMed

    Miyawaki, Shingo; Kawamura, Yoshimi; Oiwa, Yuki; Shimizu, Atsushi; Hachiya, Tsuyoshi; Bono, Hidemasa; Koya, Ikuko; Okada, Yohei; Kimura, Tokuhiro; Tsuchiya, Yoshihiro; Suzuki, Sadafumi; Onishi, Nobuyuki; Kuzumaki, Naoko; Matsuzaki, Yumi; Narita, Minoru; Ikeda, Eiji; Okanoya, Kazuo; Seino, Ken-Ichiro; Saya, Hideyuki; Okano, Hideyuki; Miura, Kyoko

    2016-05-10

    The naked mole-rat (NMR, Heterocephalus glaber), which is the longest-lived rodent species, exhibits extraordinary resistance to cancer. Here we report that NMR somatic cells exhibit a unique tumour-suppressor response to reprogramming induction. In this study, we generate NMR-induced pluripotent stem cells (NMR-iPSCs) and find that NMR-iPSCs do not exhibit teratoma-forming tumorigenicity due to the species-specific activation of tumour-suppressor alternative reading frame (ARF) and a disruption mutation of the oncogene ES cell-expressed Ras (ERAS). The forced expression of Arf in mouse iPSCs markedly reduces tumorigenicity. Furthermore, we identify an NMR-specific tumour-suppression phenotype-ARF suppression-induced senescence (ASIS)-that may protect iPSCs and somatic cells from ARF suppression and, as a consequence, tumorigenicity. Thus, NMR-specific ARF regulation and the disruption of ERAS regulate tumour resistance in NMR-iPSCs. Our findings obtained from studies of NMR-iPSCs provide new insight into the mechanisms of tumorigenicity in iPSCs and cancer resistance in the NMR.

  9. Lysosomal cross-correction by hematopoietic stem cell-derived macrophages via tunneling nanotubes

    PubMed Central

    Naphade, Swati; Sharma, Jay; Chevronnay, Héloïse P. Gaide; Shook, Michael A.; Yeagy, Brian A.; Rocca, Celine J.; Ur, Sarah N.; Lau, Athena J.; Courtoy, Pierre J.; Cherqui, Stephanie

    2014-01-01

    Despite controversies on the potential of hematopoietic stem cells (HSCs) to promote tissue repair, we previously showed that HSC transplantation could correct cystinosis, a multi-systemic lysosomal storage disease, caused by a defective lysosomal membrane cystine transporter, cystinosin (CTNS). Addressing the cellular mechanisms, we here report vesicular cross-correction after HSC differentiation into macrophages. Upon co-culture with cystinotic fibroblasts, macrophages produced tunneling nanotubes (TNTs) allowing transfer of cystinosin-bearing lysosomes into Ctns-deficient cells, which exploited the same route to retrogradely transfer cystine-loaded lysosomes to macrophages, providing a bidirectional correction mechanism. TNT formation was enhanced by contact with diseased cells. In vivo, HSCs grafted to cystinotic kidneys also generated nanotubular extensions resembling invadopodia that crossed the dense basement membranes and delivered cystinosin into diseased proximal tubular cells. This is the first report of correction of a genetic lysosomal defect by bidirectional vesicular exchange via TNTs and suggests broader potential for HSC transplantation for other disorders due to defective vesicular proteins. PMID:25186209

  10. Mesenchymal Stem Cell-Derived Exosomes: New Opportunity in Cell-Free Therapy

    PubMed Central

    Pashoutan Sarvar, Davod; Shamsasenjan, Karim; Akbarzadehlaleh, Parvin

    2016-01-01

    Mesenchymal stromal/stem cells (MSCs) are involved in tissue homeostasis through direct cell-to-cell interaction, as well as secretion of soluble factors. Exosomes are the sort of soluble biological mediators that obtained from MSCs cultured media in vitro. MSC-derived exosomes (MSC-DEs) which produced under physiological or pathological conditions are central mediators of intercellular communications by conveying proteins, lipids, mRNAs, siRNA, ribosomal RNAs and miRNAs to the neighbor or distant cells. MSC-DEs have been tested in various disease models, and the results have revealed that their functions are similar to those of MSCs. They have the supportive functions in organisms such as repairing tissue damages, suppressing inflammatory responses, and modulating the immune system. MSC-DEs are of great interest in the scope of regenerative medicine because of their unique capacity to the regeneration of the damaged tissues, and the present paper aims to introduce MSC-DEs as a novel hope in cell-free therapy. PMID:27766213

  11. Innervation of Cochlear Hair Cells by Human Induced Pluripotent Stem Cell-Derived Neurons In Vitro.

    PubMed

    Gunewardene, Niliksha; Crombie, Duncan; Dottori, Mirella; Nayagam, Bryony A

    2016-01-01

    Induced pluripotent stem cells (iPSCs) may serve as an autologous source of replacement neurons in the injured cochlea, if they can be successfully differentiated and reconnected with residual elements in the damaged auditory system. Here, we explored the potential of hiPSC-derived neurons to innervate early postnatal hair cells, using established in vitro assays. We compared two hiPSC lines against a well-characterized hESC line. After ten days' coculture in vitro, hiPSC-derived neural processes contacted inner and outer hair cells in whole cochlear explant cultures. Neural processes from hiPSC-derived neurons also made contact with hair cells in denervated sensory epithelia explants and expressed synapsin at these points of contact. Interestingly, hiPSC-derived neurons cocultured with hair cells at an early stage of differentiation formed synapses with a higher number of hair cells, compared to hiPSC-derived neurons cocultured at a later stage of differentiation. Notable differences in the innervation potentials of the hiPSC-derived neurons were also observed and variations existed between the hiPSC lines in their innervation efficiencies. Collectively, these data illustrate the promise of hiPSCs for auditory neuron replacement and highlight the need to develop methods to mitigate variabilities observed amongst hiPSC lines, in order to achieve reliable clinical improvements for patients.

  12. Innervation of Cochlear Hair Cells by Human Induced Pluripotent Stem Cell-Derived Neurons In Vitro

    PubMed Central

    Gunewardene, Niliksha; Crombie, Duncan; Dottori, Mirella; Nayagam, Bryony A.

    2016-01-01

    Induced pluripotent stem cells (iPSCs) may serve as an autologous source of replacement neurons in the injured cochlea, if they can be successfully differentiated and reconnected with residual elements in the damaged auditory system. Here, we explored the potential of hiPSC-derived neurons to innervate early postnatal hair cells, using established in vitro assays. We compared two hiPSC lines against a well-characterized hESC line. After ten days' coculture in vitro, hiPSC-derived neural processes contacted inner and outer hair cells in whole cochlear explant cultures. Neural processes from hiPSC-derived neurons also made contact with hair cells in denervated sensory epithelia explants and expressed synapsin at these points of contact. Interestingly, hiPSC-derived neurons cocultured with hair cells at an early stage of differentiation formed synapses with a higher number of hair cells, compared to hiPSC-derived neurons cocultured at a later stage of differentiation. Notable differences in the innervation potentials of the hiPSC-derived neurons were also observed and variations existed between the hiPSC lines in their innervation efficiencies. Collectively, these data illustrate the promise of hiPSCs for auditory neuron replacement and highlight the need to develop methods to mitigate variabilities observed amongst hiPSC lines, in order to achieve reliable clinical improvements for patients. PMID:26966437

  13. High Content Analysis of Human Pluripotent Stem Cell Derived Hepatocytes Reveals Drug Induced Steatosis and Phospholipidosis

    PubMed Central

    Pradip, Arvind; Steel, Daniella; Jacobsson, Susanna; Holmgren, Gustav; Ingelman-Sundberg, Magnus; Sartipy, Peter; Björquist, Petter; Johansson, Inger; Edsbagge, Josefina

    2016-01-01

    Hepatotoxicity is one of the most cited reasons for withdrawal of approved drugs from the market. The use of nonclinically relevant in vitro and in vivo testing systems contributes to the high attrition rates. Recent advances in differentiating human induced pluripotent stem cells (hiPSCs) into pure cultures of hepatocyte-like cells expressing functional drug metabolizing enzymes open up possibilities for novel, more relevant human cell based toxicity models. The present study aimed to investigate the use of hiPSC derived hepatocytes for conducting mechanistic toxicity testing by image based high content analysis (HCA). The hiPSC derived hepatocytes were exposed to drugs known to cause hepatotoxicity through steatosis and phospholipidosis, measuring several endpoints representing different mechanisms involved in drug induced hepatotoxicity. The hiPSC derived hepatocytes were benchmarked to the HepG2 cell line and generated robust HCA data with low imprecision between plates and batches. The different parameters measured were detected at subcytotoxic concentrations and the order of which the compounds were categorized (as severe, moderate, mild, or nontoxic) based on the degree of injury at isomolar concentration corresponded to previously published data. Taken together, the present study shows how hiPSC derived hepatocytes can be used as a platform for screening drug induced hepatotoxicity by HCA. PMID:26880940

  14. Mesenchymal Stem Cell-Derived Exosomes: Immunomodulatory Evaluation in an Antigen-Induced Synovitis Porcine Model

    PubMed Central

    Casado, Javier G.; Blázquez, Rebeca; Vela, Francisco Javier; Álvarez, Verónica; Tarazona, Raquel; Sánchez-Margallo, Francisco Miguel

    2017-01-01

    Synovitis is an inflammatory process associated with pain, disability, and discomfort, which is usually treated with anti-inflammatory drugs or biological agents. Mesenchymal stem cells (MSCs) have been also successfully used in the treatment of inflammatory-related diseases such as synovitis or arthritis. In the last years, the exosomes derived from MSCs have become a promising tool for the treatment of inflammatory-related diseases and their therapeutic effect is thought to be mediated (at least in part) by their immunomodulatory potential. In this work, we aimed to evaluate the anti-inflammatory effect of these exosomes in an antigen-induced synovitis animal model. To our knowledge, this is the first report where exosomes derived from MSCs have been evaluated in an animal model of synovitis. Our results demonstrated a decrease of synovial lymphocytes together with a downregulation of TNF-α transcripts in those exosome-treated joints. These results support the immunomodulatory effect of these exosomes and point out that they may represent a promising therapeutic option for the treatment of synovitis. PMID:28377922

  15. Susceptibility of Human Embryonic Stem Cell-Derived Neural Cells to Japanese Encephalitis Virus Infection

    PubMed Central

    Shen, Shih-Cheng; Shen, Ching-I; Lin, Ho; Chen, Chun-Jung; Chang, Chia-Yu; Chen, Sheng-Mei; Lee, Hsiu-Chin; Lai, Ping-Shan; Su, Hong-Lin

    2014-01-01

    Pluripotent human embryonic stem cells (hESCs) can be efficiently directed to become immature neuroepithelial precursor cells (NPCs) and functional mature neural cells, including neurotransmitter-secreting neurons and glial cells. Investigating the susceptibility of these hESCs-derived neural cells to neurotrophic viruses, such as Japanese encephalitis virus (JEV), provides insight into the viral cell tropism in the infected human brain. We demonstrate that hESC-derived NPCs are highly vulnerable to JEV infection at a low multiplicity of infection (MOI). In addition, glial fibrillary acid protein (GFAP)-expressing glial cells are also susceptible to JEV infection. In contrast, only a few mature neurons were infected at MOI 10 or higher on the third day post-infection. In addition, functional neurotransmitter-secreting neurons are also resistant to JEV infection at high MOI. Moreover, we discover that vimentin intermediate filament, reported as a putative neurovirulent JEV receptor, is highly expressed in NPCs and glial cells, but not mature neurons. These results indicate that the expression of vimentin in neural cells correlates to the cell tropism of JEV. Finally, we further demonstrate that membranous vimentin is necessary for the susceptibility of hESC-derived NPCs to JEV infection. PMID:25517725

  16. Concise Review: Tissue-Specific Microvascular Endothelial Cells Derived from Human Pluripotent Stem Cells

    PubMed Central

    Wilson, Hannah K.; Canfield, Scott G.; Shusta, Eric V.; Palecek, Sean P.

    2014-01-01

    Accumulating evidence suggests that endothelial cells (ECs) display significant heterogeneity across tissue types, playing an important role in tissue regeneration and homeostasis. Recent work demonstrating the derivation of tissue-specific microvascular endothelial cells (TS-MVECs) from human pluripotent stem cells (hPSCs) has ignited the potential to generate tissue-specific models which may be applied to regenerative medicine and in vitro modeling applications. Here we review techniques by which hPSC-derived TS-MVECs have been made to date and discuss how current hPSC-EC differentiation protocols may be directed towards tissue-specific fates. We begin by discussing the nature of EC tissue specificity in vivo and review general hPSC-EC differentiation protocols generated over the last decade. Finally, we describe how specificity can be integrated into hPSC-EC protocols to generate hPSC-derived TS-MVECs in vitro, including EC and parenchymal cell co-culture, directed differentiation, and direct reprogramming strategies. PMID:25070152

  17. Human Blood-Brain Barrier Endothelial Cells Derived from Pluripotent Stem Cells

    PubMed Central

    Lippmann, Ethan S.; Azarin, Samira M.; Kay, Jennifer E.; Nessler, Randy A.; Wilson, Hannah K.; Al-Ahmad, Abraham; Palecek, Sean P.; Shusta, Eric V.

    2012-01-01

    The blood-brain barrier (BBB) plays an important role in brain health and is often compromised in disease. Moreover, as a result of its significant barrier properties, this endothelial interface restricts neurotherapeutic uptake. Thus, a renewable source of human BBB endothelium could prove enabling for brain research and pharmaceutical development. Herein, we demonstrate that endothelial cells generated from human pluripotent stem cells (hPSCs) can be specified to possess many BBB attributes, including well-organized tight junctions, expression of nutrient transporters, and polarized efflux transporter activity. Importantly, hPSC-derived BBB endothelial cells respond to astrocytic cues yielding impressive barrier properties as measured by transendothelial electrical resistance (1450±140 Ωxcm2) and molecular permeability that correlates well with in vivo brain uptake. In addition, specification of hPSC-derived BBB endothelial cells occurs in concert with neural cell co-differentiation via Wnt/β-catenin signaling, consistent with previous transgenic studies. This study represents the first example of organ-specific endothelial differentiation from hPSCs. PMID:22729031

  18. Brief reports: Lysosomal cross-correction by hematopoietic stem cell-derived macrophages via tunneling nanotubes.

    PubMed

    Naphade, Swati; Sharma, Jay; Gaide Chevronnay, Héloïse P; Shook, Michael A; Yeagy, Brian A; Rocca, Celine J; Ur, Sarah N; Lau, Athena J; Courtoy, Pierre J; Cherqui, Stephanie

    2015-01-01

    Despite controversies on the potential of hematopoietic stem cells (HSCs) to promote tissue repair, we previously showed that HSC transplantation could correct cystinosis, a multisystemic lysosomal storage disease, caused by a defective lysosomal membrane cystine transporter, cystinosin (CTNS gene). Addressing the cellular mechanisms, we here report vesicular cross-correction after HSC differentiation into macrophages. Upon coculture with cystinotic fibroblasts, macrophages produced tunneling nanotubes (TNTs) allowing transfer of cystinosin-bearing lysosomes into Ctns-deficient cells, which exploited the same route to retrogradely transfer cystine-loaded lysosomes to macrophages, providing a bidirectional correction mechanism. TNT formation was enhanced by contact with diseased cells. In vivo, HSCs grafted to cystinotic kidneys also generated nanotubular extensions resembling invadopodia that crossed the dense basement membranes and delivered cystinosin into diseased proximal tubular cells. This is the first report of correction of a genetic lysosomal defect by bidirectional vesicular exchange via TNTs and suggests broader potential for HSC transplantation for other disorders due to defective vesicular proteins.

  19. A Computational Model for Investigating Tumor Apoptosis Induced by Mesenchymal Stem Cell-Derived Secretome

    PubMed Central

    Sudiono, Janti

    2016-01-01

    Apoptosis is a programmed cell death that occurs naturally in physiological and pathological conditions. Defective apoptosis can trigger the development and progression of cancer. Experiments suggest the ability of secretome derived from mesenchymal stem cells (MSC) to induce apoptosis in cancer cells. We develop a hybrid discrete-continuous multiscale model to further investigate the effect of MSC-derived secretome in tumor growth. The model encompasses three biological scales. At the molecular scale, a system of ordinary differential equations regulate the expression of proteins involved in apoptosis signaling pathways. At the cellular scale, discrete equations control cellular migration, phenotypic switching, and proliferation. At the extracellular scale, a system of partial differential equations are employed to describe the dynamics of microenvironmental chemicals concentrations. The simulation is able to produce both avascular tumor growth rate and phenotypic patterns as observed in the experiments. In addition, we obtain good quantitative agreements with the experimental data on the apoptosis of HeLa cancer cells treated with MSC-derived secretome. We use this model to predict the growth of avascular tumor under various secretome concentrations over time. PMID:27956936

  20. Pig Induced Pluripotent Stem Cell-Derived Neural Rosettes Parallel Human Differentiation Into Sensory Neural Subtypes.

    PubMed

    Webb, Robin L; Gallegos-Cárdenas, Amalia; Miller, Colette N; Solomotis, Nicholas J; Liu, Hong-Xiang; West, Franklin D; Stice, Steven L

    2017-04-01

    The pig is the large animal model of choice for study of nerve regeneration and wound repair. Availability of porcine sensory neural cells would conceptually allow for analogous cell-based peripheral nerve regeneration in porcine injuries of similar severity and size to those found in humans. After recently reporting that porcine (or pig) induced pluripotent stem cells (piPSCs) differentiate into neural rosette (NR) structures similar to human NRs, here we demonstrate that pig NR cells could differentiate into neural crest cells and other peripheral nervous system-relevant cell types. Treatment with either bone morphogenetic protein 4 or fetal bovine serum led to differentiation into BRN3A-positive sensory cells and increased expression of sensory neuron TRK receptor gene family: TRKA, TRKB, and TRKC. Porcine sensory neural cells would allow determination of parallels between human and porcine cells in response to noxious stimuli, analgesics, and reparative mechanisms. In vitro differentiation of pig sensory neurons provides a novel model system for neural cell subtype specification and would provide a novel platform for the study of regenerative therapeutics by elucidating the requirements for innervation following injury and axonal survival.

  1. Harnessing the Angiogenic Potential of Stem Cell-Derived Exosomes for Vascular Regeneration

    PubMed Central

    Alcayaga-Miranda, F.; Varas-Godoy, M.; Khoury, M.

    2016-01-01

    Mesenchymal stem cells (MSCs) are known to display important regenerative properties through the secretion of proangiogenic factors. Recent evidence pointed at the key role played by exosomes released from MSCs in this paracrine mechanism. Exosomes are key mediators of intercellular communication and contain a cargo that includes a modifiable content of microRNA (miRNA), mRNA, and proteins. Since the biogenesis of the MSCs-derived exosomes is regulated by the cross talk between MSCs and their niche, the content of the exosomes and consequently their biological function are dependent on the cell of origin and the physiologic or pathologic status of their microenvironment. Recent preclinical studies revealed that MSCs-derived exosomes have a critical implication in the angiogenic process since the use of exosomes-depleted conditioned medium impaired the MSCs angiogenesis response. In this review, we discuss the current knowledge related to the angiogenic potential of MSCs-exosomes and methods to enhance their biological activities for improved vascular regeneration. The current gain of insight in exosomes studies highlights the power of combining cell based therapies and their secreted products in therapeutic angiogenesis. PMID:27127516

  2. Consensus comparative analysis of human embryonic stem cell-derived cardiomyocytes.

    PubMed

    Zhang, Shaohong; Poon, Ellen; Xie, Dongqing; Boheler, Kenneth R; Li, Ronald A; Wong, Hau-San

    2015-01-01

    Global transcriptional analyses have been performed with human embryonic stem cells (hESC) derived cardiomyocytes (CMs) to identify molecules and pathways important for human CM differentiation, but variations in culture and profiling conditions have led to greatly divergent results among different studies. Consensus investigation to identify genes and gene sets enriched in multiple studies is important for revealing differential gene expression intrinsic to human CM differentiation independent of the above variables, but reliable methods of conducting such comparison are lacking. We examined differential gene expression between hESC and hESC-CMs from multiple microarray studies. For single gene analysis, we identified genes that were expressed at increased levels in hESC-CMs in seven datasets and which have not been previously highlighted. For gene set analysis, we developed a new algorithm, consensus comparative analysis (CSSCMP), capable of evaluating enrichment of gene sets from heterogeneous data sources. Based on both theoretical analysis and experimental validation, CSSCMP is more efficient and less susceptible to experimental variations than traditional methods. We applied CSSCMP to hESC-CM microarray data and revealed novel gene set enrichment (e.g., glucocorticoid stimulus), and also identified genes that might mediate this response. Our results provide important molecular information intrinsic to hESC-CM differentiation. Data and Matlab codes can be downloaded from S1 Data.

  3. Characterization and comparison of embryonic stem cell-derived KDR+ cells with endothelial cells.

    PubMed

    Sun, Xuan; Cheng, Lamei; Duan, Huaxin; Lin, Ge; Lu, Guangxiu

    2012-09-01

    Growing interest in utilizing endothelial cells (ECs) for therapeutic purposes has led to the exploration of human embryonic stem cells (hESCs) as a potential source for endothelial progenitors. In this study, ECs were induced from hESC lines and their biological characteristics were analyzed and compared with both cord blood endothelial progenitor cells (CBEPCs) and human umbilical vein endothelial cells (HUVECs) in vitro. The results showed that isolated embryonic KDR+ cells (EC-KDR+) display characteristics that were similar to CBEPCs and HUVECs. EC-KDR+, CBEPCs and HUVECs all expressed CD31 and CD144, incorporated DiI-Ac-LDL, bound UEA1 lectin, and were able to form tube-like structures on Matrigel. Compared with CBEPCs and HUVECs, the expression level of endothelial progenitor cell markers such as CD133 and KDR in EC-KDR+ was significantly higher, while the mature endothelial marker vWF was lowly expressed in EC-KDR+. In summary, the study showed that EC-KDR+ are primitive endothelial-like progenitors and might be a potential source for therapeutic vascular regeneration and tissue engineering.

  4. In Vitro Imaging of Angiogenesis Using Embryonic Stem Cell-Derived Endothelial Cells

    PubMed Central

    Stuhlmann, Heidi

    2012-01-01

    Angiogenesis is an important event during developmental processes, and it plays a key role in neovascularization. The development of an in vitro model that can be used for live imaging of vessel growth will facilitate the study of molecular and cellular mechanisms for the growth of blood vessels. Embryonic stem cells (ESCs) are considered to be a novel renewable source for the derivation of genetically manipulable endothelial cells (ECs). To derive green fluorescence protein (GFP)-expressing ECs, we used a transgenic ESC line in which a GFP reporter was driven by the endothelial-specific promoter fetal liver kinase 1. ESC-ECs were isolated from 11-day embryoid bodies by fluorescence-activated cell sorting. Embedding the aggregated ESC-ECs in a 3-dimensional collagen gel matrix resulted in ESC-EC migration out of the aggregates and coalescence into a capillary network. Time-lapse microscopy revealed EC migration, proliferation, lumen formation, and anastomosis to other capillary vessels during this process, which were reminiscent of angiogenic processes. Vascular endothelial growth factor plays major roles in the induction of ESC-EC angiogenesis in vitro. Blockage of the β1 integrin subunit severely impaired ESC-EC survival and migration. We demonstrate that our in vitro ESC-EC angiogenesis model represents a high-resolution dynamic video-image system for observing the cellular events underlying angiogenic cascades. We also consider this model as an image screening tool for the identification of pro-angiogenic and anti-angiogenic molecules. PMID:21385073

  5. Comparison of the Biological Characteristics of Mesenchymal Stem Cells Derived from Bone Marrow and Skin

    PubMed Central

    Liu, Ruifeng; Chang, Wenjuan; Wei, Hong; Zhang, Kaiming

    2016-01-01

    Mesenchymal stem cells (MSCs) exhibit high proliferation and self-renewal capabilities and are critical for tissue repair and regeneration during ontogenesis. They also play a role in immunomodulation. MSCs can be isolated from a variety of tissues and have many potential applications in the clinical setting. However, MSCs of different origins may possess different biological characteristics. In this study, we performed a comprehensive comparison of MSCs isolated from bone marrow and skin (BMMSCs and SMSCs, resp.), including analysis of the skin sampling area, separation method, culture conditions, primary and passage culture times, cell surface markers, multipotency, cytokine secretion, gene expression, and fibroblast-like features. The results showed that the MSCs from both sources had similar cell morphologies, surface markers, and differentiation capacities. However, the two cell types exhibited major differences in growth characteristics; the primary culture time of BMMSCs was significantly shorter than that of SMSCs, whereas the growth rate of BMMSCs was lower than that of SMSCs after passaging. Moreover, differences in gene expression and cytokine secretion profiles were observed. For example, secretion of proliferative cytokines was significantly higher for SMSCs than for BMMSCs. Our findings provide insights into the different biological functions of both cell types. PMID:27239202

  6. Stem cell-derived tissue-associated regulatory T cells ameliorate the development of autoimmunity

    PubMed Central

    Haque, Mohammad; Song, Jianyong; Fino, Kristin; Sandhu, Praneet; Song, Xinmeng; Lei, Fengyang; Zheng, Songguo; Ni, Bing; Fang, Deyu; Song, Jianxun

    2016-01-01

    Pluripotent stem cells (PSCs) have the potential to produce almost all of the cells in the body, including regulatory T cells (Tregs). However, the exact conditions required for the development of antigen (Ag)-specific Tregs from PSCs (i.e., PSC-Tregs) are not well delineated. Ag-specific PSC-Tregs can be tissue/organ-associated and migrate to local inflamed tissues/organs to suppress the autoimmune response after adoptive transfer, thereby avoiding potential overall immunosuppression from non-specific Tregs. In this study, we developed a new approach to generate functional Ag-specific Tregs from induced PSCs (iPSCs), i.e., iPSC-Tregs, which had the ability to generate an Ag-specific immunosuppressive response in a murine model of arthritis. We retrovirally transduced murine iPSCs with a construct containing genes of Ag-specific T cell receptor (TCR) and the transcriptional factor FoxP3. We differentiated the iPSCs into Ag-specific iPSC-Tregs using in vitro or in vivo Notch signaling, and demonstrated that adoptive transfer of such Tregs dramatically suppressed autoimmunity in a well-established Ag-induced arthritis model, including the inflammation, joint destruction, cartilage prostaglandin depletion, osteoclast activity, and Th17 production. Our results indicate that PSCs can be used to develop Ag-specific Tregs, which have a therapeutic potential for Treg-based therapies of autoimmune disorders. PMID:26846186

  7. Pre-transplantation specification of stem cells to cardiac lineage for regeneration of cardiac tissue.

    PubMed

    Mayorga, Maritza; Finan, Amanda; Penn, Marc

    2009-03-01

    Myocardial infarction (MI) is a lead cause of mortality in the Western world. Treatment of acute MI is focused on restoration of antegrade flow which inhibits further tissue loss, but does not restore function to damaged tissue. Chronic therapy for injured myocardial tissue involves medical therapy that attempts to minimize pathologic remodeling of the heart. End stage therapy for chronic heart failure (CHF) involves inotropic therapy to increase surviving cardiac myocyte function or mechanical augmentation of cardiac performance. Not until the point of heart transplantation, a limited resource at best, does therapy focus on the fundamental problem of needing to replace injured tissue with new contractile tissue. In this setting, the potential for stem cell therapy has garnered significant interest for its potential to regenerate or create new contractile cardiac tissue. While to date adult stem cell therapy in clinical trials has suggested potential benefit, there is waning belief that the approaches used to date lead to regeneration of cardiac tissue. As the literature has better defined the pathways involved in cardiac differentiation, preclinical studies have suggested that stem cell pretreatment to direct stem cell differentiation prior to stem cell transplantation may be a more efficacious strategy for inducing cardiac regeneration. Here we review the available literature on pre-transplantation conditioning of stem cells in an attempt to better understand stem cell behavior and their readiness in cell-based therapy for myocardial regeneration.

  8. A cGMP-applicable expansion method for aggregates of human neural stem and progenitor cells derived from pluripotent stem cells or fetal brain tissue.

    PubMed

    Shelley, Brandon C; Gowing, Geneviève; Svendsen, Clive N

    2014-06-15

    A cell expansion technique to amass large numbers of cells from a single specimen for research experiments and clinical trials would greatly benefit the stem cell community. Many current expansion methods are laborious and costly, and those involving complete dissociation may cause several stem and progenitor cell types to undergo differentiation or early senescence. To overcome these problems, we have developed an automated mechanical passaging method referred to as "chopping" that is simple and inexpensive. This technique avoids chemical or enzymatic dissociation into single cells and instead allows for the large-scale expansion of suspended, spheroid cultures that maintain constant cell/cell contact. The chopping method has primarily been used for fetal brain-derived neural progenitor cells or neurospheres, and has recently been published for use with neural stem cells derived from embryonic and induced pluripotent stem cells. The procedure involves seeding neurospheres onto a tissue culture Petri dish and subsequently passing a sharp, sterile blade through the cells effectively automating the tedious process of manually mechanically dissociating each sphere. Suspending cells in culture provides a favorable surface area-to-volume ratio; as over 500,000 cells can be grown within a single neurosphere of less than 0.5 mm in diameter. In one T175 flask, over 50 million cells can grow in suspension cultures compared to only 15 million in adherent cultures. Importantly, the chopping procedure has been used under current good manufacturing practice (cGMP), permitting mass quantity production of clinical-grade cell products.

  9. Modeling human development and disease in pluripotent stem cell-derived gastric organoids

    PubMed Central

    McCracken, Kyle W.; Catá, Emily M.; Crawford, Calyn M.; Sinagoga, Katie L.; Schumacher, Michael; Rockich, Briana E.; Tsai, Yu-Hwai; Mayhew, Christopher N.; Spence, Jason R.; Zavros, Yana; Wells, James M.

    2014-01-01

    Gastric diseases, including peptic ulcer disease and gastric cancer, affect 10% of the world’s population and are largely due to chronic H. pylori infection1–3. Species differences in embryonic development and architecture of the adult stomach make animal models suboptimal for studying human stomach organogenesis and pathogenesis4, and there is no experimental model of normal human gastric mucosa. Here we report the de novo generation of three-dimensional human gastric tissue in vitro through the directed differentiation of human pluripotent stem cells (hPSCs). We identified that temporal manipulation of the FGF, WNT, BMP, retinoic acid and EGF signaling pathways and three-dimensional growth are sufficient to generate human gastric organoids (hGOs). Developing hGOs progressed through molecular and morphogenetic stages that were nearly identical to the developing antrum of the mouse stomach. Organoids formed primitive gastric gland- and pit-like domains, proliferative zones containing LGR5-expressing cells, surface and antral mucous cells, and a diversity of gastric endocrine cells. We used hGO cultures to identify novel signaling mechanisms that regulate early endoderm patterning and gastric endocrine cell differentiation upstream of the transcription factor NEUROG3. Using hGOs to model pathogenesis of human disease, we found that H. pylori infection resulted in rapid association of the virulence factor CagA with the c-Met receptor, activation of signaling and induction of epithelial proliferation. Together, these studies describe a novel and robust in vitro system for elucidating the mechanisms underlying human stomach development and disease. PMID:25363776

  10. Exogenous Nitric Oxide Protects Human Embryonic Stem Cell-Derived Cardiomyocytes against Ischemia/Reperfusion Injury

    PubMed Central

    Pálóczi, János; Varga, Zoltán V.; Szebényi, Kornélia; Sarkadi, Balázs; Madonna, Rosalinda; De Caterina, Raffaele; Csont, Tamás; Eschenhagen, Thomas; Ferdinandy, Péter; Görbe, Anikó

    2016-01-01

    Background and Aims. Human embryonic stem cell- (hESC-) derived cardiomyocytes are one of the useful screening platforms of potential cardiocytoprotective molecules. However, little is known about the behavior of these cardiomyocytes in simulated ischemia/reperfusion conditions. In this study, we have tested the cytoprotective effect of an NO donor and the brain type natriuretic peptide (BNP) in a screening platform based first on differentiated embryonic bodies (EBs, 6 + 4 days) and then on more differentiated cardiomyocytes (6 + 24 days), both derived from hESCs. Methods. Both types of hESC-derived cells were exposed to 150 min simulated ischemia, followed by 120 min reperfusion. Cell viability was assessed by propidium iodide staining. The following treatments were applied during simulated ischemia in differentiated EBs: the NO-donor S-nitroso-N-acetylpenicillamine (SNAP) (10−7, 10−6, and 10−5 M), BNP (10−9, 10−8, and 10−7 M), and the nonspecific NO synthase inhibitor Nω-nitro-L-arginine (L-NNA, 10−5 M). Results. SNAP (10−6, 10−5 M) significantly attenuated cell death in differentiated EBs. However, simulated ischemia/reperfusion-induced cell death was not affected by BNP or by L-NNA. In separate experiments, SNAP (10−6 M) also protected hESC-derived cardiomyocytes. Conclusions. We conclude that SNAP, but not BNP, protects differentiated EBs or cardiomyocytes derived from hESCs against simulated ischemia/reperfusion injury. The present screening platform is a useful tool for discovery of cardiocytoprotective molecules and their cellular mechanisms. PMID:27403231

  11. Proliferation in culture of primordial germ cells derived from embryonic stem cell: induction by retinoic acid

    PubMed Central

    Makoolati, Zohreh; Movahedin, Mansoureh; Forouzandeh-Moghadam, Mehdi

    2016-01-01

    An in vitro system that supports primordial germ cells (PGCs) survival and proliferation is useful for enhancement of these cells and efficient transplantation in infertility disorders. One approach is cultivation of PGCs under proper conditions that allow self-renewal and proliferation of PGCs. For this purpose, we compared the effects of different concentrations of retinoic acid (RA), and the effect of PGCs co-culture (Co-C) with SIM mouse embryo-derived thioguanine- and ouabain-resistant (STO) cells on the proliferation of embryonic stem cells (ESCs)-derived PGCs. One-day-old embryoid body (EB) was cultured for 4 days in simple culture system in the presence of 5 ng/ml bone morphogenetic protein-4 (BMP4) (SCB group) for PGC induction. For PGC enrichment, ESCs-derived germ cells were cultured for 7 days in the presence of different doses (0–5  μM) of RA, both in the simple and STO Co-C systems. At the end of the culture period, viability and proliferation rates were assessed and expression of mouse vasa homologue (Mvh),  α6 integrin,  β1 integrin, stimulated by retinoic acid 8 (Stra8) and piwi (Drosophila)-like 2 (Piwil2) was evaluated using quantitative PCR. Also, the inductive effects were investigated immunocytochemically with Mvh and cadherin1 (CDH1) on the selected groups. Immunocytochemistry/PCR results showed higher expression of Mvh, the PGC-specific marker, in 3  μM RA concentrations on the top of the STO feeder layer. Meanwhile, assessment of the Stra8 mRNA and CDH1 protein, the specific makers for spermatogonia, showed no significant differences between groups. Based on the results, it seems that in the presence of 3 μM RA on top of the STO feeder layer cells, the majority of the cells transdifferentiated into germ cells were PGCs. PMID:27834666

  12. Effects of mesenchymal stem cell-derived cytokines on the functional properties of endothelial progenitor cells.

    PubMed

    Kamprom, Witchayaporn; Kheolamai, Pakpoom; U-Pratya, Yaowalak; Supokawej, Aungkura; Wattanapanitch, Methichit; Laowtammathron, Chuti; Issaragrisil, Surapol

    2016-01-01

    Human mesenchymal stem cell (hMSC) is a potential source for cell therapy due to its property to promote tissue repair. Although, it has been known that hMSCs promote tissue repair via angiogenic cytokines, the interaction between hMSC-derived cytokines and the endothelial progenitor cells (EPCs), which play an important role in tissue neovascularization, is poorly characterized. We investigate the effect of cytokine released from different sources of hMSCs including bone marrow and gestational tissues on the EPC functions in vitro. The migration, extracellular matrix invasion and vessel formation of EPCs were studied in the presence or absence of cytokines released from various sources of hMSCs using transwell culture system. The migration of EPCs was highest when co-culture with secretory factors from placenta-derived hMSCs (PL-hMSCs) compared to those co-culture with other sources of hMSCs. For invasion and vessel formation, secretory factors from bone marrow-derived hMSCs (BM-hMSCs) could produce the maximal enhancement compared to other sources. We further identified the secreted cytokines and found that the migratory-enhancing cytokine from PL-hMSCs was PDGF-BB while the enhancing cytokine from BM-hMSCs on invasion was IGF-1. For vessel formation, the cytokines released from BM-hMSCs were IGF1 and SDF-1. In conclusion, hMSCs can release angiogenic cytokines which increase the migration, invasion and vessel forming capacity of EPCs. We can then use hMSCs as a source of angiogenic cytokines to induce neovascularization in injured/ischemic tissues.

  13. Multilineage potential and proteomic profiling of human dental stem cells derived from a single donor

    SciTech Connect

    Patil, Rajreddy; Kumar, B. Mohana; Lee, Won-Jae; Jeon, Ryoung-Hoon; Jang, Si-Jung; Lee, Yeon-Mi; Park, Bong-Wook; Byun, June-Ho; Ahn, Chun-Seob; Kim, Jae-Won; Rho, Gyu-Jin

    2014-01-01

    Dental tissues provide an alternative autologous source of mesenchymal stem cells (MSCs) for regenerative medicine. In this study, we isolated human dental MSCs of follicle, pulp and papilla tissue from a single donor tooth after impacted third molar extraction by excluding the individual differences. We then compared the morphology, proliferation rate, expression of MSC-specific and pluripotency markers, and in vitro differentiation ability into osteoblasts, adipocytes, chondrocytes and functional hepatocyte-like cells (HLCs). Finally, we analyzed the protein expression profiles of undifferentiated dental MSCs using 2DE coupled with MALDI-TOF-MS. Three types of dental MSCs largely shared similar morphology, proliferation potential, expression of surface markers and pluripotent transcription factors, and differentiation ability into osteoblasts, adipocytes, and chondrocytes. Upon hepatogenic induction, all MSCs were transdifferentiated into functional HLCs, and acquired hepatocyte functions by showing their ability for glycogen storage and urea production. Based on the proteome profiling results, we identified nineteen proteins either found commonly or differentially expressed among the three types of dental MSCs. In conclusion, three kinds of dental MSCs from a single donor tooth possessed largely similar cellular properties and multilineage potential. Further, these dental MSCs had similar proteomic profiles, suggesting their interchangeable applications for basic research and call therapy. - Highlights: • Isolated and characterized three types of human dental MSCs from a single donor. • MSCs of dental follicle, pulp and papilla had largely similar biological properties. • All MSCs were capable of transdifferentiating into functional hepatocyte-like cells. • 2DE proteomics with MALDI-TOF/MS identified 19 proteins in three types of MSCs. • Similar proteomic profiles suggest interchangeable applications of dental MSCs.

  14. Functional characteristics of mesenchymal stem cells derived from the adipose tissue of a patient with achondroplasia.

    PubMed

    Park, Jeong-Ran; Lee, Hanbyeol; Kim, Chung-Hyo; Hong, Seok-Ho; Ha, Kwon-Soo; Yang, Se-Ran

    2016-05-01

    Mesenchymal stem cells (MSCs) can be isolated from various tissues including bone marrow, adipose tissue, skin dermis, and umbilical Wharton's jelly as well as injured tissues. MSCs possess the capacity for self-renewal and the potential for differentiation into adipogenic, osteogenic, and chondrogenic lineages. However, the characteristics of MSCs in injured tissues, such as achondroplasia (ACH), are not well known. In this study, we isolated MSCs from human subcutaneous adipose (ACH-SAMSCs) tissue and circumjacent human adipose tissue of the cartilage (ACH-CAMSCs) from a patient with ACH. We then analyzed the characterization of ACH-SAMSCs and ACH-CAMSCs, compared with normal human dermis-derived MSCs (hDMSCs). In flow cytometry analysis, the isolated ACH-MSCs expressed low levels of CD73, CD90, and CD105, compared with hDMSCs. Moreover, both ACH- SAMSCs and ACH-CAMSCs had constitutionally overactive fibroblast growth factor receptor 3 (FGFR3) and exhibited significantly reduced osteogenic differentiation, compared to enhanced adipogenic differentiation. The activity of extracellular signal-regulated kinases 1/2 (ERK1/2) and p38 mitogen-activated protein kinases (p38 MAPK) was increased in ACH-MSCs. In addition, the efficacy of osteogenic differentiation was slightly restored in osteogenic differentiation medium with MAPKs inhibitors. These results suggest that they play essential roles in MSC differentiation toward adipogenesis in ACH pathology. In conclusion, the identification of the characteristics of ACH-MSCs and the favoring of adipogenic differentiation via the FGFR3/MAPK axis might help to elucidate the pathogenic mechanisms relevant to other skeletal diseases and could provide targets for therapeutic interventions.

  15. Neuroprotective Effect of Human Adipose Stem Cell-Derived Extract in Amyotrophic Lateral Sclerosis.

    PubMed

    Jeon, Gye Sun; Im, Wooseok; Shim, Yu-Mi; Lee, Mijung; Kim, Myung-Jin; Hong, Yoon-Ho; Seong, Seung-Yong; Kim, Manho; Sung, Jung-Joon

    2016-04-01

    Amyotrophic lateral sclerosis (ALS) is a devastating human neurodegenerative disease. The precise pathogenic mechanisms of the disease remain uncertain, and as of yet, there is no effective cure. Human adipose stem cells (hASC) can be easily obtained during operative procedures. hASC have a clinically feasible potential to treat neurodegenerative disorders, since cytosolic extract of hASC contain a number of essential neurotrophic factors. In this study, we investigated effects of hASC extract on the SOD1 G93A mouse model of ALS and in vitro test. Administration of hASC extract improved motor function and prolonged the time until symptom onset, rotarod failure, and death in ALS mice. In the hASC extracts group, choline acetyltransferase immunostaining in the ventral horn of the lumbar spinal cord showed a large number of motor neurons, suggesting normal morphology. The neuroprotective effect of hASC extract in ALS mice was also suggested by western blot analysis of spinal cord extract from ALS mice and in vitro test. hASC extract treatment significantly increased expression of p-Akt, p-CREB, and PGC-1α in SOD1 G93A mouse model and in vitro test. Our results indicated that hASC extract reduced apoptotic cell death and recovered mutant SOD1-induced mitochondrial dysfunction. Moreover, hASC extract reduced mitochondrial membrane potential. In conclusion, we have demonstrated, for the first time, that hASC extract exert a potential therapeutic action in the SOD1 G93A mouse model of ALS and in vitro test. These findings suggest that hASC hold promise as a novel therapeutic strategy for treating ALS.

  16. Alcohol-Induced Molecular Dysregulation in Human Embryonic Stem Cell-Derived Neural Precursor Cells.

    PubMed

    Kim, Yi Young; Roubal, Ivan; Lee, Youn Soo; Kim, Jin Seok; Hoang, Michael; Mathiyakom, Nathan; Kim, Yong

    Adverse effect of alcohol on neural function has been well documented. Especially, the teratogenic effect of alcohol on neurodevelopment during embryogenesis has been demonstrated in various models, which could be a pathologic basis for fetal alcohol spectrum disorders (FASDs). While the developmental defects from alcohol abuse during gestation have been described, the specific mechanisms by which alcohol mediates these injuries have yet to be determined. Recent studies have shown that alcohol has significant effect on molecular and cellular regulatory mechanisms in embryonic stem cell (ESC) differentiation including genes involved in neural development. To test our hypothesis that alcohol induces molecular alterations during neural differentiation we have derived neural precursor cells from pluripotent human ESCs in the presence or absence of ethanol treatment. Genome-wide transcriptomic profiling identified molecular alterations induced by ethanol exposure during neural differentiation of hESCs into neural rosettes and neural precursor cell populations. The Database for Annotation, Visualization and Integrated Discovery (DAVID) functional analysis on significantly altered genes showed potential ethanol's effect on JAK-STAT signaling pathway, neuroactive ligand-receptor interaction, Toll-like receptor (TLR) signaling pathway, cytokine-cytokine receptor interaction and regulation of autophagy. We have further quantitatively verified ethanol-induced alterations of selected candidate genes. Among verified genes we further examined the expression of P2RX3, which is associated with nociception, a peripheral pain response. We found ethanol significantly reduced the level of P2RX3 in undifferentiated hESCs, but induced the level of P2RX3 mRNA and protein in hESC-derived NPCs. Our result suggests ethanol-induced dysregulation of P2RX3 along with alterations in molecules involved in neural activity such as neuroactive ligand-receptor interaction may be a molecular event

  17. Inflammatory Cytokines Induce a Unique Mineralizing Phenotype in Mesenchymal Stem Cells Derived from Human Bone Marrow*

    PubMed Central

    Ferreira, Elisabeth; Porter, Ryan M.; Wehling, Nathalie; O'Sullivan, Regina P.; Liu, Fangjun; Boskey, Adele; Estok, Daniel M.; Harris, Mitchell B.; Vrahas, Mark S.; Evans, Christopher H.; Wells, James W.

    2013-01-01

    Bone marrow contains mesenchymal stem cells (MSCs) that can differentiate along multiple mesenchymal lineages. In this capacity they are thought to be important in the intrinsic turnover and repair of connective tissues while also serving as a basis for tissue engineering and regenerative medicine. However, little is known of the biological responses of human MSCs to inflammatory conditions. When cultured with IL-1β, marrow-derived MSCs from 8 of 10 human subjects deposited copious hydroxyapatite, in which authenticity was confirmed by Fourier transform infrared spectroscopy. Transmission electron microscopy revealed the production of fine needles of hydroxyapatite in conjunction with matrix vesicles. Alkaline phosphatase activity did not increase in response to inflammatory mediators, but PPi production fell, reflecting lower ectonucleotide pyrophosphatase activity in cells and matrix vesicles. Because PPi is the major physiological inhibitor of mineralization, its decline generated permissive conditions for hydroxyapatite formation. This is in contrast to MSCs treated with dexamethasone, where PPi levels did not fall and mineralization was fuelled by a large and rapid increase in alkaline phosphatase activity. Bone sialoprotein was the only osteoblast marker strongly induced by IL-1β; thus these cells do not become osteoblasts despite depositing abundant mineral. RT-PCR did not detect transcripts indicative of alternative mesenchymal lineages, including chondrocytes, myoblasts, adipocytes, ligament, tendon, or vascular smooth muscle cells. IL-1β phosphorylated multiple MAPKs and activated nuclear factor-κB (NF-κB). Certain inhibitors of MAPK and PI3K, but not NF-κB, prevented mineralization. The findings are of importance to soft tissue mineralization, tissue engineering, and regenerative medicine. PMID:23970554

  18. Alcohol-Induced Molecular Dysregulation in Human Embryonic Stem Cell-Derived Neural Precursor Cells

    PubMed Central

    Kim, Yi Young; Roubal, Ivan; Lee, Youn Soo; Kim, Jin Seok; Hoang, Michael; Mathiyakom, Nathan; Kim, Yong

    2016-01-01

    Adverse effect of alcohol on neural function has been well documented. Especially, the teratogenic effect of alcohol on neurodevelopment during embryogenesis has been demonstrated in various models, which could be a pathologic basis for fetal alcohol spectrum disorders (FASDs). While the developmental defects from alcohol abuse during gestation have been described, the specific mechanisms by which alcohol mediates these injuries have yet to be determined. Recent studies have shown that alcohol has significant effect on molecular and cellular regulatory mechanisms in embryonic stem cell (ESC) differentiation including genes involved in neural development. To test our hypothesis that alcohol induces molecular alterations during neural differentiation we have derived neural precursor cells from pluripotent human ESCs in the presence or absence of ethanol treatment. Genome-wide transcriptomic profiling identified molecular alterations induced by ethanol exposure during neural differentiation of hESCs into neural rosettes and neural precursor cell populations. The Database for Annotation, Visualization and Integrated Discovery (DAVID) functional analysis on significantly altered genes showed potential ethanol’s effect on JAK-STAT signaling pathway, neuroactive ligand-receptor interaction, Toll-like receptor (TLR) signaling pathway, cytokine-cytokine receptor interaction and regulation of autophagy. We have further quantitatively verified ethanol-induced alterations of selected candidate genes. Among verified genes we further examined the expression of P2RX3, which is associated with nociception, a peripheral pain response. We found ethanol significantly reduced the level of P2RX3 in undifferentiated hESCs, but induced the level of P2RX3 mRNA and protein in hESC-derived NPCs. Our result suggests ethanol-induced dysregulation of P2RX3 along with alterations in molecules involved in neural activity such as neuroactive ligand-receptor interaction may be a molecular event

  19. Human Embryonic Stem Cell Derived Vascular Progenitor Cells Capable of Endothelial and Smooth Muscle Cell Function

    PubMed Central

    Hill, Katherine L; Obrtlikova, Petra; Alvarez, Diego F; King, Judy A; Keirstead, Susan A; Allred, Jeremy R; Kaufman, Dan S

    2010-01-01

    OBJECTIVE Previous studies have demonstrated development of endothelial cells (ECs) and smooth muscle cells (SMCs) as separate cell lineages derived from human embryonic stem cells (hESCs). We demonstrate CD34+ cells isolated from differentiated hESCs function as vascular progenitor cells capable of producing both ECs and SMCs. These studies better define the developmental origin and reveal the relationship between these two cell types, as well as provide a more complete biological characterization. MATERIALS AND METHODS hESCs are co-cultured on M2-10B4 stromal cells or Wnt1 expressing M2-10B4 for 13–15 days to generate a CD34+ cell population. These cells are isolated using a magnetic antibody separation kit and cultured on fibronectin coated dishes in EC medium. To induce SMC differentiation, culture medium is changed and a morphological and phenotypic change occurs within 24–48 hours. RESULTS CD34+ vascular progenitor cells give rise to ECs and SMCs. The two populations express respective cell specific transcripts and proteins, exhibit intracellular calcium in response to various agonists, and form robust tube-like structures when co-cultured in Matrigel. Human umbilical vein endothelial cells (HUVEC) cultured under SMC conditions do not exhibit a change in phenotype or genotype. Wnt1 overexpressing stromal cells produced an increased number of progenitor cells. CONCLUSIONS The ability to generate large numbers of ECs and SMCs from a single vascular progenitor cell population is promising for therapeutic use to treat a variety of diseased and ischemic conditions. The step-wise differentiation outlined here is an efficient, reproducible method with potential for large scale cultures suitable for clinical applications. PMID:20067819

  20. Limited Immunogenicity of Human Induced Pluripotent Stem Cell-Derived Cartilages

    PubMed Central

    Kimura, Takeshi; Yamashita, Akihiro; Ozono, Keiichi

    2016-01-01

    Articular cartilage damage does not spontaneously heal and could ultimately result in a loss of joint function. Damaged cartilage can be repaired with cell/tissue sources that are transplanted, however, autologous chondrocytes are limited in number as a cell source. Induced pluripotent stem cells (iPSCs) are a relatively new and abundant cell source and can be made from the patient, but at a considerable cost. Because cartilage is immunoprivileged tissue, allogeneic cartilages have been transplanted effectively without matching for human leukocyte antigen (HLA), but are difficult to acquire due to scarcity of donors. In this study, we examined the immunogenicity of human iPSC-derived cartilages (hiPS-Carts) in vitro to evaluate whether allogeneic hiPS-Carts can be a new cell/tissue source. The cells in hiPS-Carts expressed limited amounts of major histocompatibility complex (MHC) class I (HLA-ABC) and MHC class II (HLA-DRDQDP). Treatment with interferon γ (IFNγ) induced the expression of MHC class I, but not MHC class II in hiPS-Carts. A mixed lymphocyte reaction assay showed that hiPS-Carts stimulated the proliferation of neither T cells nor the activation of NK cells. Furthermore, hiPS-Carts suppressed the proliferation of T cells stimulated with interleukin 2 and phytohemagglutinin (PHA). Together with previously reported findings, these results suggest that hiPS-Carts are no more antigenic than human cartilage. Additionally, in combination with the fact that iPSCs are unlimitedly expandable and thus can supply unlimited amounts of iPS-Carts from even one iPSC line, they suggest that allogeneic hiPS-Carts are a candidate source for transplantation to treat articular cartilage damage. PMID:27762664

  1. In Vitro Uptake of Silver Nanoparticles and Their Toxicity in Human Mesenchymal Stem Cells Derived from Bone Marrow.

    PubMed

    He, Wei; Liu, Xujie; Kienzle, Arne; Müller, Werner E G; Feng, Qingling

    2016-01-01

    During the last decade, the usage of silver nanoparticles in biomedical fields has increased rapidly, mainly due to their excellent antibacterial effects. They are used in many medical products such as wound dressings, catheters, bone cement and artificial cardiac valves. In tissue engineering, silver nanoparticles are often loaded as a filler for fabrication of nanocomposite scaffolds which subsequently are seeded with human mesenchymal stem cells. Thus, possible adverse effects of silver nanoparticles on human stem cells should be investigated carefully to ensure a safe usage. In this study, silver nanoparticles with a mean diameter of ~30 nm were prepared and their toxicity in human mesenchymal stem cells was investigated. Transmission electron microscopic images reveal the uptake and localization of the silver nanoparticles in the cytoplasm. Upon internalization of Ag NPs inside the cells, an increase in the release of lactate dehydrogenase and the production of reactive oxygen species was quantified. Furthermore, they caused a reduction in both cell viability and mitochondrial membrane potential in a dose-dependent manner. Annexin V-FITC/PI staining implied that silver nanoparticles did not only induce apoptosis but also cause necrosis. Based on cell cycle analysis, G2/M arrest was detected in cells treated with silver nanoparticles, implicating DNA damage. The high level of reactive oxygen species induced by nanoparticles is considered to be the main cause of their toxicity.

  2. [Study on pluripotency and cultivation of ES-like cells derived from male germ stem cells of bovine fetuses].

    PubMed

    Dong, Wu-Zi; Shen, Wen-Zheng; Hua, Jin-Lian; Dou, Zhong-Ying

    2007-07-01

    Male germ stem cells (mGSCs), which is in testis after sex differentiation, derive from primordial germ cells. In this study, bovine mGSCs were isolated from testis of 20 weeks fetuses. Number of CD9 positive cells of the cells through two-steps adhering plates velocity different was 95.8% by flow cytometer. The carina-type cells clones and the plane-type cells clones appeared in co-cultured system. One cells lines had been successively maintained for 4 passages, and the cells clusters showed AKP positive staining. The cells clusters showed nest-shape in third passage showed SSEA1 and Oct-4 positive staining. These cells can also spontaneously differentiate into c-kit positive staining germ cells, and the cells were directional induced to formaactin positive staining cardiac-like cells cluster and NF positive staining neuron-like cells. The conclusion showed that male germ stem cells from 20 weeks bovine fetuses could be in vitro formed like embryonic stem cells.

  3. Stem cell-derived erythrocytes as upcoming players in blood transfusion

    PubMed Central

    Migliaccio, A. R.

    2015-01-01

    Background Blood transfusion is current standard-of-care for genetic forms of anemia that would be otherwise lethal and allows implementation of aggressive cytotoxic/surgical therapies developed for numerous types of cancer. In developed countries the blood supply is adequate and sporadically even in excess. However, difficulties exist in finding blood with rare phenotypes to treat alloimmunized patients and the progressive ageing of the human population predicts that blood will become scarce by 2050. These considerations establish the need for the development of techniques to generate cultured red blood cell (cRBCs) as transfusion products. Materials and Methods Recent progress in cell culture techniques is revolutionizing organ replacement therapies. Two new disciplines, cell therapy and tissue engineering, have been developed to generate in vitro therapeutic products for a variety of applications ranging from skin grafts to organ-function repairs. It is currently believed that these advances will eventually allow ex-vivo production of various cell types in numbers so great that, in the case of red cells, would be clinically adequate for transfusion. Results Proof-of-principle in animal models indicate that cRBCs generated from murine embryonic stem cells protect mice from lethal anemia. Conditions to generate small amounts of clinical grade cRBCs have been established and the first-in-man administration of autologous cRBCs perfomed. The results of this trial indicate that cRBCs survive in vivo at least as long as their natural counterpart. Discussion These ground-breaking reports have raised great excitement for clinical evaluation of cRBCs for transfusion. However, skepticism still persist that production of cRBCs in numbers sufficient for transfusion will ever be possible. This paper will discuss diagnostic and clinical goals pursuable with numbers of cRBCs that may be generated with current technology. Conclusion We are confident that development of relevant

  4. Genome modification leads to phenotype reversal in human myotonic dystrophy type 1 induced pluripotent stem cell-derived neural stem cells.

    PubMed

    Xia, Guangbin; Gao, Yuanzheng; Jin, Shouguang; Subramony, S H; Terada, Naohiro; Ranum, Laura P W; Swanson, Maurice S; Ashizawa, Tetsuo

    2015-06-01

    Myotonic dystrophy type 1 (DM1) is caused by expanded CTG repeats in the 3'-untranslated region (3' UTR) of the DMPK gene. Correcting the mutation in DM1 stem cells would be an important step toward autologous stem cell therapy. The objective of this study is to demonstrate in vitro genome editing to prevent production of toxic mutant transcripts and reverse phenotypes in DM1 stem cells. Genome editing was performed in DM1 neural stem cells (NSCs) derived from human DM1 induced pluripotent stem (iPS) cells. An editing cassette containing SV40/bGH polyA signals was integrated upstream of the CTG repeats by TALEN-mediated homologous recombination (HR). The expression of mutant CUG repeats transcript was monitored by nuclear RNA foci, the molecular hallmarks of DM1, using RNA fluorescence in situ hybridization. Alternative splicing of microtubule-associated protein tau (MAPT) and muscleblind-like (MBNL) proteins were analyzed to further monitor the phenotype reversal after genome modification. The cassette was successfully inserted into DMPK intron 9 and this genomic modification led to complete disappearance of nuclear RNA foci. MAPT and MBNL 1, 2 aberrant splicing in DM1 NSCs were reversed to normal pattern in genome-modified NSCs. Genome modification by integration of exogenous polyA signals upstream of the DMPK CTG repeat expansion prevents the production of toxic RNA and leads to phenotype reversal in human DM1 iPS-cells derived stem cells. Our data provide proof-of-principle evidence that genome modification may be used to generate genetically modified progenitor cells as a first step toward autologous cell transfer therapy for DM1.

  5. Innate Immune Response of Human Embryonic Stem Cell-Derived Fibroblasts and Mesenchymal Stem Cells to Periodontopathogens

    PubMed Central

    Seneviratne, Chaminda Jayampath

    2016-01-01

    Periodontitis involves complex interplay of bacteria and host immune response resulting in destruction of supporting tissues of the tooth. Toll-like receptors (TLRs) play a role in recognizing microbial pathogens and eliciting an innate immune response. Recently, the potential application of multipotent stem cells and pluripotent stem cells including human embryonic stem cells (hESCs) in periodontal regenerative therapy has been proposed. However, little is known about the impact of periodontopathogens on hESC-derived progenies. This study investigates the effects of heat-killed periodontopathogens, namely, Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans, on TLR and cytokine expression profile of hESC-derived progenies, namely, fibroblasts (hESC-Fib) and mesenchymal stem cells (hESC-MSCs). Additionally, the serotype-dependent effect of A. actinomycetemcomitans on hESC-derived progenies was explored. Both hESC-Fib and hESC-MSCs constitutively expressed TLR-2 and TLR-4. hESC-Fib upon exposure to periodontopathogens displayed upregulation of TLRs and release of cytokines (IL-1β, IL-6, and IL-8). In contrast, hESC-MSCs were largely nonresponsive to bacterial challenge, especially in terms of cytokine production. Further, exposure of hESC-Fib to A. actinomycetemcomitans serotype c was associated with higher IL-8 production than serotype b. In contrast, the hESC-MSCs displayed no serotype-dependent response. Differential response of the two hESC progenies implies a phenotype-dependent response to periodontopathogens and supports the concept of immunomodulatory properties of MSCs. PMID:27642305

  6. The effects of human platelet lysate on dental pulp stem cells derived from impacted human third molars.

    PubMed

    Chen, Bo; Sun, Hai-Hua; Wang, Han-Guo; Kong, Hui; Chen, Fa-Ming; Yu, Qing

    2012-07-01

    Human platelet lysate (PL) has been suggested as a substitute for fetal bovine serum (FBS) in the large-scale expansion of dental pulp stem cells (DPSCs). However, the biological effects and the optimal concentrations of PL for the proliferation and differentiation of human DPSCs remain unexplored. We isolated and expanded stem cells from the dental pulp of extracted third molars and evaluated the effects of PL on the cells' proliferative capacity and differentiation potential in vitro and in vivo. Before testing, immunocytochemical staining and flow cytometry-based cell sorting showed that the cells derived from human dental pulp contained mesenchymal stem cell populations. Cells were grown on tissue culture plastic or on hydroxyapatite-tricalcium phosphate (HA/TCP) biomaterials and were incubated with either normal or odontogenic/osteogenic media in the presence or absence of various concentrations of human PL for further investigation. The proliferation of DPSCs was significantly increased when the cells were cultured in 5% PL under all testing conditions (P < 0.05). However, this enhancement was inconsistent when the cells were cultured in 1% PL or in 10% PL; 10% PL significantly inhibited cell proliferation and was therefore excluded from further differentiation testing. Culture medium containing 5% PL also significantly promoted the mineralized differentiation of DPSCs, as indicated by the measurement of alkaline phosphatase activity and calcium deposition under mineral-conditioned media (P < 0.05). Scanning electron microscopy and modified Ponceau trichrome staining showed that the cells treated with 5% PL and mineralizing media were highly capable of integrating with the HA/TCP biomaterials and had fully covered the surface of the scaffold with an extensive sheet-like structure 14 d after seeding. In addition, 5% PL showed significantly positive effects on tissue regeneration in two in vivo transplantation models. We conclude that the appropriate

  7. Dental stem cells as an alternative source for cardiac regeneration.

    PubMed

    Xin, Loo Zhang; Govindasamy, Vijayendran; Musa, Sabri; Abu Kasim, Noor Hayaty

    2013-10-01

    Dental tissues contains stem cells or progenitors that have high proliferative capacity, are clonogenic in vitro and demonstrate the ability to differentiate to multiple type cells involving neurons, bone, cartilage, fat and smooth muscle. Numerous experiments have demonstrated that the multipotent stem cells are not rejected by immune system and therefore it may be possible to use these cells in allogeneic settings. In addition, these remarkable cells are easily abundantly available couple with less invasive procedure in isolating comparing to bone marrow aspiration. Here we proposed dental stem cells as candidate for cardiac regeneration based on its immature characteristic and propensity towards cardiac lineage via PI3-Kinase/Aktsignalling pathway.

  8. Embryonic Stem Cell-Derived Microvesicles Induce Gene Expression Changes in Müller Cells of the Retina

    PubMed Central

    Katsman, Diana; Stackpole, Emma J.; Domin, Daniel R.; Farber, Debora B.

    2012-01-01

    Cell-derived microvesicles (MVs), recognized as important components of cell-cell communication, contain mRNAs, miRNAs, proteins and lipids and transfer their bioactive contents from parent cells to cells of other origins. We have studied the effect that MVs released from embryonic stem cells (ESMVs) have on retinal progenitor Müller cells. Cultured human Müller cells were exposed to mouse ESMVs every 48 hours for a total of 9 treatments. Morphological changes were observed by light microscopy in the treated cells, which grew as individual heterogeneous cells, compared to the uniform, spindle-like adherent cellular sheets of untreated cells. ESMVs transferred to Müller cells embryonic stem cell (ESC) mRNAs involved in the maintenance of pluripotency, including Oct4 and Sox2, and the miRNAs of the 290 cluster, important regulators of the ESC-specific cell cycle. Moreover, ESMV exposure induced up-regulation of the basal levels of endogenous human Oct4 mRNA in Müller cells. mRNA and miRNA microarrays of ESMV-treated vs. untreated Müller cells revealed the up-regulation of genes and miRNAs involved in the induction of pluripotency, cellular proliferation, early ocular genes and genes important for retinal protection and remodeling, as well as the down-regulation of inhibitory and scar-related genes and miRNAs involved in differentiation and cell cycle arrest. To further characterize the heterogeneous cell population of ESMV-treated Müller cells, their expression of retinal cell markers was compared to that in untreated control cells by immunocytochemistry. Markers for amacrine, ganglion and rod photoreceptors were present in treated but not in control Müller cells. Together, our findings indicate that ESMs induce de-differentiation and pluripotency in their target Müller cells, which may turn on an early retinogenic program of differentiation. PMID:23226281

  9. In vitro differentiation of neural stem cells derived from human olfactory bulb into dopaminergic-like neurons.

    PubMed

    Alizadeh, Rafieh; Hassanzadeh, Gholamreza; Joghataei, Mohammad Taghi; Soleimani, Mansoureh; Moradi, Fatemeh; Mohammadpour, Shahram; Ghorbani, Jahangir; Safavi, Ali; Sarbishegi, Maryam; Pirhajati Mahabadi, Vahid; Alizadeh, Leila; Hadjighassem, Mahmoudreza

    2017-03-01

    This study describes a new accessible source of neuronal stem cells that can be used in Parkinson's disease cell transplant. The human olfactory bulb contains neural stem cells (NSCs) that are responsible for neurogenesis in the brain and the replacement of damaged cellular components throughout life. NSCs are capable of differentiating into neuronal and glial cells. We isolated NSCs from the olfactory bulb of brain-death donors and differentiated them into dopaminergic neurons. The olfactory bulb tissues obtained were cultured in Dulbecco's modified Eagle's medium/nutrient mixture F12, B27 supplemented with basic fibroblast growth factor, epidermal growth factor and leukemia inhibitory factor. The NSCs and proliferation markers were assessed. The multipotentiality of olfactory bulb NSCs was demonstrated by their capacity to differentiate into neurons, oligodendrocytes and astrocytes. To generate dopaminergic neurons, olfactory bulb NSCs were differentiated in neurobasal medium, supplemented with B27, and treated with sonic hedgehog, fibroblast growth factor 8 and glial cell-derived neurotrophic factor from the 7th to the 21st day, followed by detection of dopaminergic neuronal markers including tyrosine hydroxylase and aromatic l-amino acid decarboxylase. The cells were expanded, established in continuous cell lines and differentiated into the two classical neuronal phenotypes. The percentage of co-positive cells (microtubule-associated protein 2 and tyrosine hydroxylase; aromatic l-amino acid decarboxylase and tyrosine hydroxylase) in the treated cells was significantly higher than in the untreated cells. These results illustrate the existence of multipotent NSCs in the adult human olfactory bulb that are capable of differentiating toward putative dopaminergic neurons in the presence of trophic factors. Taken together, our data encourage further investigations of the possible use of olfactory bulb NSCs as a promising cell-based therapeutic strategy for Parkinson

  10. An Abbreviated Protocol for In Vitro Generation of Functional Human Embryonic Stem Cell-Derived Beta-Like Cells

    PubMed Central

    Massumi, Mohammad; Pourasgari, Farzaneh; Nalla, Amarnadh; Batchuluun, Battsetseg; Nagy, Kristina; Neely, Eric; Gull, Rida; Nagy, Andras; Wheeler, Michael B.

    2016-01-01

    The ability to yield glucose-responsive pancreatic beta-cells from human pluripotent stem cells in vitro will facilitate the development of the cell replacement therapies for the treatment of Type 1 Diabetes. Here, through the sequential in vitro targeting of selected signaling pathways, we have developed an abbreviated five-stage protocol (25–30 days) to generate human Embryonic Stem Cell-Derived Beta-like Cells (ES-DBCs). We showed that Geltrex, as an extracellular matrix, could support the generation of ES-DBCs more efficiently than that of the previously described culture systems. The activation of FGF and Retinoic Acid along with the inhibition of BMP, SHH and TGF-beta led to the generation of 75% NKX6.1+/NGN3+ Endocrine Progenitors. The inhibition of Notch and tyrosine kinase receptor AXL, and the treatment with Exendin-4 and T3 in the final stage resulted in 35% mono-hormonal insulin positive cells, 1% insulin and glucagon positive cells and 30% insulin and NKX6.1 co-expressing cells. Functionally, ES-DBCs were responsive to high glucose in static incubation and perifusion studies, and could secrete insulin in response to successive glucose stimulations. Mitochondrial metabolic flux analyses using Seahorse demonstrated that the ES-DBCs could efficiently metabolize glucose and generate intracellular signals to trigger insulin secretion. In conclusion, targeting selected signaling pathways for 25–30 days was sufficient to generate ES-DBCs in vitro. The ability of ES-DBCs to secrete insulin in response to glucose renders them a promising model for the in vitro screening of drugs, small molecules or genes that may have potential to influence beta-cell function. PMID:27755557

  11. Embryonic stem cell-derived microvesicles induce gene expression changes in Müller cells of the retina.

    PubMed

    Katsman, Diana; Stackpole, Emma J; Domin, Daniel R; Farber, Debora B

    2012-01-01

    Cell-derived microvesicles (MVs), recognized as important components of cell-cell communication, contain mRNAs, miRNAs, proteins and lipids and transfer their bioactive contents from parent cells to cells of other origins. We have studied the effect that MVs released from embryonic stem cells (ESMVs) have on retinal progenitor Müller cells. Cultured human Müller cells were exposed to mouse ESMVs every 48 hours for a total of 9 treatments. Morphological changes were observed by light microscopy in the treated cells, which grew as individual heterogeneous cells, compared to the uniform, spindle-like adherent cellular sheets of untreated cells. ESMVs transferred to Müller cells embryonic stem cell (ESC) mRNAs involved in the maintenance of pluripotency, including Oct4 and Sox2, and the miRNAs of the 290 cluster, important regulators of the ESC-specific cell cycle. Moreover, ESMV exposure induced up-regulation of the basal levels of endogenous human Oct4 mRNA in Müller cells. mRNA and miRNA microarrays of ESMV-treated vs. untreated Müller cells revealed the up-regulation of genes and miRNAs involved in the induction of pluripotency, cellular proliferation, early ocular genes and genes important for retinal protection and remodeling, as well as the down-regulation of inhibitory and scar-related genes and miRNAs involved in differentiation and cell cycle arrest. To further characterize the heterogeneous cell population of ESMV-treated Müller cells, their expression of retinal cell markers was compared to that in untreated control cells by immunocytochemistry. Markers for amacrine, ganglion and rod photoreceptors were present in treated but not in control Müller cells. Together, our findings indicate that ESMs induce de-differentiation and pluripotency in their target Müller cells, which may turn on an early retinogenic program of differentiation.

  12. In vitro generation of three-dimensional substrate-adherent embryonic stem cell-derived neural aggregates for application in animal models of neurological disorders.

    PubMed

    Hargus, Gunnar; Cui, Yi-Fang; Dihné, Marcel; Bernreuther, Christian; Schachner, Melitta

    2012-05-01

    In vitro-differentiated embryonic stem (ES) cells comprise a useful source for cell replacement therapy, but the efficiency and safety of a translational approach are highly dependent on optimized protocols for directed differentiation of ES cells into the desired cell types in vitro. Furthermore, the transplantation of three-dimensional ES cell-derived structures instead of a single-cell suspension may improve graft survival and function by providing a beneficial microenvironment for implanted cells. To this end, we have developed a new method to efficiently differentiate mouse ES cells into neural aggregates that consist predominantly (>90%) of postmitotic neurons, neural progenitor cells, and radial glia-like cells. When transplanted into the excitotoxically lesioned striatum of adult mice, these substrate-adherent embryonic stem cell-derived neural aggregates (SENAs) showed significant advantages over transplanted single-cell suspensions of ES cell-derived neural cells, including improved survival of GABAergic neurons, increased cell migration, and significantly decreased risk of teratoma formation. Furthermore, SENAs mediated functional improvement after transplantation into animal models of Parkinson's disease and spinal cord injury. This unit describes in detail how SENAs are efficiently derived from mouse ES cells in vitro and how SENAs are isolated for transplantation. Furthermore, methods are presented for successful implantation of SENAs into animal models of Huntington's disease, Parkinson's disease, and spinal cord injury to study the effects of stem cell-derived neural aggregates in a disease context in vivo.

  13. CARDIAC-LIKE OSCILLATION IN LIVER STEM CELLS INDUCE THEIR ACQUISITION OF CARDIAC PHENOTYPE

    EPA Science Inventory

    We examined in a cardiac microenvironment the plasticity of a liver stem cell line (WB F344) generated from a cloned, single, non-parenchymal epithelial cell from a normal adult male rat. Our previous studies suggested that WB F344 cells acquire a cardiac phenotype in the absenc...

  14. Patient-specific cardiovascular progenitor cells derived from integration-free induced pluripotent stem cells for vascular tissue regeneration

    PubMed Central

    Hu, Jiang; Wang, Yongyu; Jiao, Jiao; Liu, Zhongning; Zhao, Chao; Zhou, Zhou; Zhang, Zhanpeng; Forde, Kaitlynn; Wang, Lunchang; Wang, Jiangang; Baylink, David J.; Zhang, Xiao-Bing; Gao, Shaorong; Yang, Bo; Chen, Y. Eugene; Ma, Peter X.

    2015-01-01

    Tissue-engineered blood vessels (TEBVs) are promising in regenerating a live vascular replacement. However, the vascular cell source is limited, and it is crucial to develop a scaffold that accommodates new type of vascular progenitor cells and facilitates in vivo lineage specification of the cells into functional vascular smooth muscle cells (VSMCs) to regenerate vascular tissue. In the present study, integration-free human induced pluripotent stem cells (hiPSCs) were established from patient peripheral blood mononuclear cells through episomal vector nucleofection of reprogramming factors. The established hiPSCs were then induced into mesoderm-originated cardiovascular progenitor cells (CVPCs) with a highly efficient directed lineage specification method. The derived CVPCs were demonstrated to be able to differentiate into functional VSMCs. Subcutaneous implantation of CVPCs seeded on macroporous nanofibrous poly(l-lactide) scaffolds led to in vivo VSMC lineage specification and matrix deposition inside the scaffolds. In summary, we established integration-free patient-specific hiPSCs from peripheral blood mononuclear cells, derived CVPCs through directed lineage specification, and developed an advanced scaffold for these progenitor cells to further differentiate in vivo into VSMCs and regenerate vascular tissue in a subcutaneous implantation model. This study has established an efficient patient-specific approach towards in vivo regeneration of vascular tissue. PMID:26398309

  15. The effect of magnetic nanoparticles on neuronal differentiation of induced pluripotent stem cell-derived neural precursors

    PubMed Central

    Jiráková, Klára; Šeneklová, Monika; Jirák, Daniel; Turnovcová, Karolína; Vosmanská, Magda; Babič, Michal; Horák, Daniel; Veverka, Pavel; Jendelová, Pavla

    2016-01-01

    Introduction Magnetic resonance (MR) imaging is suitable for noninvasive long-term tracking. We labeled human induced pluripotent stem cell-derived neural precursors (iPSC-NPs) with two types of iron-based nanoparticles, silica-coated cobalt zinc ferrite nanoparticles (CZF) and poly-l-lysine-coated iron oxide superparamagnetic nanoparticles (PLL-coated γ-Fe2O3) and studied their effect on proliferation and neuronal differentiation. Materials and methods We investigated the effect of these two contrast agents on neural precursor cell proliferation and differentiation capability. We further defined the intracellular localization and labeling efficiency and analyzed labeled cells by MR. Results Cell proliferation was not affected by PLL-coated γ-Fe2O3 but was slowed down in cells labeled with CZF. Labeling efficiency, iron content and relaxation rates measured by MR were lower in cells labeled with CZF when compared to PLL-coated γ-Fe2O3. Cytoplasmic localization of both types of nanoparticles was confirmed by transmission electron microscopy. Flow cytometry and immunocytochemical analysis of specific markers expressed during neuronal differentiation did not show any significant differences between unlabeled cells or cells labeled with both magnetic nanoparticles. Conclusion Our results show that cells labeled with PLL-coated γ-Fe2O3 are suitable for MR detection, did not affect the differentiation potential of iPSC-NPs and are suitable for in vivo cell therapies in experimental models of central nervous system disorders. PMID:27920532

  16. Recommended Ethical Safeguards on Fertilization of Human Germ Cells Derived from Pluripotent Stem Cells Solely for Research Purposes.

    PubMed

    Mizuno, Hiroshi

    2016-08-01

    Production of human fertilized embryos by using germ cells derived from pluripotent stem cells (PSCs) entails ethical issues that differ fundamentally depending on the aim. If the aim is solely to conduct research, then embryo generation, utilization and destruction must respect for the human embryo as having the innate potential to develop into a human being. If the aim is human reproduction, this technology must never be used to manipulate human life, confuse social order, or negatively affect future generations. Researchers should distinguish the aims and then accordingly establish a consensus on the safeguards needed to proceed with scientifically significant and socially accepted research, or otherwise set a moratorium. Currently, in Japan, germ cell production from human PSCs is permitted, whereas fertilization of these germ cells is not. The Japanese Expert Panel on Bioethics in the Cabinet Office has proposed that all of the following conditions must be met to approve fertilization for research purposes: (1) the research is significant for the life sciences and medicine; (2) the benefits or anticipated benefits are socially accepted; (3) human safety is assured; and (4) safeguards are put in place. If fertilization is ethically approved, I recommend the following safeguards: limitation of the purpose to improving conventional ART as an initial step; permitted culture of human embryos until the appearance of the primitive streak; restriction of the number of embryos produced to the minimum necessary; prohibition of transplantation into a human or animal uterus; and provision of human-derived ova that are not required for ART treatment.

  17. Conditional-ready mouse embryonic stem cell derived macrophages enable the study of essential genes in macrophage function

    PubMed Central

    Yeung, A. T. Y.; Hale, C.; Xia, J.; Tate, P. H.; Goulding, D.; Keane, J. A.; Mukhopadhyay, S.; Forrester, L.; Billker, O.; Skarnes, W. C.; Hancock, R. E. W.; Dougan, G.

    2015-01-01

    The ability to differentiate genetically modified mouse embryonic stem (ES) cells into functional macrophages provides a potentially attractive resource to study host-pathogen interactions without the need for animal experimentation. This is particularly useful in instances where the gene of interest is essential and a knockout mouse is not available. Here we differentiated mouse ES cells into macrophages in vitro and showed, through a combination of flow cytometry, microscopic imaging, and RNA-Seq, that ES cell-derived macrophages responded to S. Typhimurium, in a comparable manner to mouse bone marrow derived macrophages. We constructed a homozygous mutant mouse ES cell line in the Traf2 gene that is known to play a role in tumour necrosis factor-α signalling but has not been studied for its role in infections or response to Toll-like receptor agonists. Interestingly, traf2-deficient macrophages produced reduced levels of inflammatory cytokines in response to lipopolysaccharide (LPS) or flagellin stimulation and exhibited increased susceptibility to S. Typhimurium infection. PMID:25752829

  18. Monocytic cells derived from human embryonic stem cells and fetal liver share common differentiation pathways and homeostatic functions.

    PubMed

    Klimchenko, Olena; Di Stefano, Antonio; Geoerger, Birgit; Hamidi, Sofiane; Opolon, Paule; Robert, Thomas; Routhier, Mélanie; El-Benna, Jamel; Delezoide, Anne-Lise; Boukour, Siham; Lescure, Bernadette; Solary, Eric; Vainchenker, William; Norol, Françoise

    2011-03-17

    The early emergence of macrophages and their large pattern of tissue distribution during development suggest that they may play a critical role in the initial steps of embryogenesis. In the present study, we show that monocytic cells derived from human embryonic stem cells (hESCs) and from fetal liver follow a differentiation pathway different to that of adult cells, leading to specific functions. Embryonic and fetal monocytic cells differentiated from a CD14(low)CD16(-) precursor to form CD14(high)CD16(+) cells without producing the CD14(high)CD16(-) cell population that predominates in adult peripheral blood. Both demonstrated an enhanced expression of genes encoding tissue-degrading enzymes, chemokines, and scavenger receptors, as was previously reported for M2 macrophages. Compared with adult blood monocytes, embryonic and fetal monocytic cells secreted high amounts of proteins acting on tissue remodeling and angiogenesis, and most of them expressed the Tie2 receptor. Furthermore, they promoted vascular remodeling in xenotransplanted human tumors. These findings suggest that the regulation of human fetal and embryonic monocytic cell differentiation leads to the generation of cells endowed mainly with anti-inflammatory and remodeling functions. Trophic and immunosuppressive functions of M2-polarized macrophages link fetus and tumor development, and hESCs offer a valuable experimental model for in vitro studies of mechanisms sustaining these processes.

  19. Poly(trimethylene carbonate) as an elastic biodegradable film for human embryonic stem cell-derived retinal pigment epithelial cells.

    PubMed

    Sorkio, Anni; Haimi, Suvi; Verdoold, Vincent; Juuti-Uusitalo, Kati; Grijpma, Dirk; Skottman, Heli

    2017-01-04

    Human embryonic stem cell-derived retinal pigment epithelial (hESC-RPE) cell therapies show tremendous potential for the treatment of retinal degenerative diseases. A tissue engineering approach, where cells are delivered to the subretinal space on a biodegradable carrier as a sheet, shows great promise for these RPE cell therapies. The aim of the present study was to assess whether a flexible, elastic and biodegradable poly(trimethylene carbonate) (PTMC) film promotes the formation of functional hESC-RPE and performs better than often used biodegradable poly(d,l-lactide) (PDLLA) film. Human ESC-RPE maturation and functionality on PTMC films was assessed by cell proliferation assays, RPE-specific gene and protein expression, phagocytic activity and growth factor secretion. It is demonstrated that the mechanical properties of PTMC films have close resemblance to those of the native Bruch's membrane and support the formation hESC-RPE monolayer in serum-free culture conditions with high degree of functionality. In contrast, use of PDLLA films did not lead to the formation of confluent monolayers of hESC-RPE cells and had unsuitable mechanical properties for retinal application. In conclusion, the present study indicates that flexible and elastic biodegradable PTMC films show potential for retinal tissue engineering applications. Copyright © 2017 John Wiley & Sons, Ltd.

  20. A new system for profiling drug-induced calcium signal perturbation in human embryonic stem cell-derived cardiomyocytes.

    PubMed

    Lewis, Kimberley J; Silvester, Nicole C; Barberini-Jammaers, Steven; Mason, Sammy A; Marsh, Sarah A; Lipka, Magdalena; George, Christopher H

    2015-03-01

    The emergence of human stem cell-derived cardiomyocyte (hSCCM)-based assays in the cardiovascular (CV) drug discovery sphere requires the development of improved systems for interrogating the rich information that these cell models have the potential to yield. We developed a new analytical framework termed SALVO (synchronization, amplitude, length, and variability of oscillation) to profile the amplitude and temporal patterning of intra- and intercellular calcium signals in hSCCM. SALVO quantified drug-induced perturbations in the calcium signaling "fingerprint" in spontaneously contractile hSCCM. Multiparametric SALVO outputs were integrated into a single index of in vitro cytotoxicity that confirmed the rank order of perturbation as astemizole > thioridazine > cisapride > flecainide > valdecoxib > sotalol > nadolol ≈ control. This rank order of drug-induced Ca(2+) signal disruption is in close agreement with the known arrhythmogenic liabilities of these compounds in humans. Validation of the system using a second set of compounds and hierarchical cluster analysis demonstrated the utility of SALVO to discriminate drugs based on their mechanisms of action. We discuss the utility of this new mechanistically agnostic system for the evaluation of in vitro drug cytotoxicity in hSCCM syncytia and the potential placement of SALVO in the early stage drug screening framework.

  1. Tolerance induction and reversal of diabetes in mice transplanted with human embryonic stem cell-derived pancreatic endoderm.

    PubMed

    Szot, Gregory L; Yadav, Mahesh; Lang, Jiena; Kroon, Evert; Kerr, Justin; Kadoya, Kuniko; Brandon, Eugene P; Baetge, Emmanuel E; Bour-Jordan, Hélène; Bluestone, Jeffrey A

    2015-02-05

    Type 1 diabetes (T1D) is an autoimmune disease caused by T cell-mediated destruction of insulin-producing β cells in the islets of Langerhans. In most cases, reversal of disease would require strategies combining islet cell replacement with immunotherapy that are currently available only for the most severely affected patients. Here, we demonstrate that immunotherapies that target T cell costimulatory pathways block the rejection of xenogeneic human embryonic-stem-cell-derived pancreatic endoderm (hESC-PE) in mice. The therapy allowed for long-term development of hESC-PE into islet-like structures capable of producing human insulin and maintaining normoglycemia. Moreover, short-term costimulation blockade led to robust immune tolerance that could be transferred independently of regulatory T cells. Importantly, costimulation blockade prevented the rejection of allogeneic hESC-PE by human PBMCs in a humanized model in vivo. These results support the clinical development of hESC-derived therapy, combined with tolerogenic treatments, as a sustainable alternative strategy for patients with T1D.

  2. Conditional-ready mouse embryonic stem cell derived macrophages enable the study of essential genes in macrophage function.

    PubMed

    Yeung, A T Y; Hale, C; Xia, J; Tate, P H; Goulding, D; Keane, J A; Mukhopadhyay, S; Forrester, L; Billker, O; Skarnes, W C; Hancock, R E W; Dougan, G

    2015-03-10

    The ability to differentiate genetically modified mouse embryonic stem (ES) cells into functional macrophages provides a potentially attractive resource to study host-pathogen interactions without the need for animal experimentation. This is particularly useful in instances where the gene of interest is essential and a knockout mouse is not available. Here we differentiated mouse ES cells into macrophages in vitro and showed, through a combination of flow cytometry, microscopic imaging, and RNA-Seq, that ES cell-derived macrophages responded to S. Typhimurium, in a comparable manner to mouse bone marrow derived macrophages. We constructed a homozygous mutant mouse ES cell line in the Traf2 gene that is known to play a role in tumour necrosis factor-α signalling but has not been studied for its role in infections or response to Toll-like receptor agonists. Interestingly, traf2-deficient macrophages produced reduced levels of inflammatory cytokines in response to lipopolysaccharide (LPS) or flagellin stimulation and exhibited increased susceptibility to S. Typhimurium infection.

  3. Magnetically Responsive Bone Marrow Mesenchymal Stem Cell-Derived Smooth Muscle Cells Maintain Their Benefits to Augmenting Elastic Matrix Neoassembly.

    PubMed

    Swaminathan, Ganesh; Sivaraman, Balakrishnan; Moore, Lee; Zborowski, Maciej; Ramamurthi, Anand

    2016-04-01

    Abdominal aortic aneurysms (AAA) represent abnormal aortal expansions that result from chronic proteolytic breakdown of elastin and collagen fibers by matrix metalloproteases. Poor elastogenesis by adult vascular smooth muscle cells (SMCs) limits regenerative repair of elastic fibers, critical for AAA growth arrest. Toward overcoming these limitations, we recently demonstrated significant elastogenesis by bone marrow mesenchymal stem cell-derived SMCs (BM-SMCs) and their proelastogenesis and antiproteolytic effects on rat aneurysmal SMCs (EaRASMCs). We currently investigate the effects of super paramagnetic iron oxide nanoparticle (SPION) labeling of BM-SMCs, necessary to magnetically guide them to the AAA wall, on their functional benefits. Our results indicate that SPION-labeling is noncytotoxic and does not adversely impact the phenotype and elastogenesis by BM-SMCs. In addition, SPION-BM-SMCs showed no changes in the ability of the BM-SMCs to stimulate elastin regeneration and attenuate proteolytic activity by EaRASMCs. Together, our results are promising toward the utility of SPIONs for magnetic targeting of BM-SMCs for in situ AAA regenerative repair.

  4. Modeling Viral Infectious Diseases and Development of Antiviral Therapies Using Human Induced Pluripotent Stem Cell-Derived Systems

    PubMed Central

    Trevisan, Marta; Sinigaglia, Alessandro; Desole, Giovanna; Berto, Alessandro; Pacenti, Monia; Palù, Giorgio; Barzon, Luisa

    2015-01-01

    The recent biotechnology breakthrough of cell reprogramming and generation of induced pluripotent stem cells (iPSCs), which has revolutionized the approaches to study the mechanisms of human diseases and to test new drugs, can be exploited to generate patient-specific models for the investigation of host–pathogen interactions and to develop new antimicrobial and antiviral therapies. Applications of iPSC technology to the study of viral infections in humans have included in vitro modeling of viral infections of neural, liver, and cardiac cells; modeling of human genetic susceptibility to severe viral infectious diseases, such as encephalitis and severe influenza; genetic engineering and genome editing of patient-specific iPSC-derived cells to confer antiviral resistance. PMID:26184286

  5. Contractile properties of early human embryonic stem cell-derived cardiomyocytes: beta-adrenergic stimulation induces positive chronotropy and lusitropy but not inotropy.

    PubMed

    Pillekamp, Frank; Haustein, Moritz; Khalil, Markus; Emmelheinz, Markus; Nazzal, Rewa; Adelmann, Roland; Nguemo, Filomain; Rubenchyk, Olga; Pfannkuche, Kurt; Matzkies, Matthias; Reppel, Michael; Bloch, Wilhelm; Brockmeier, Konrad; Hescheler, Juergen

    2012-08-10

    Human embryonic stem cell-derived cardiomyocytes (hESC-CMs) provide the unique opportunity to study the very early development of the human heart. The aim of this study was to investigate the effect of calcium and beta-adrenergic stimulation on the contractile properties of early hESC-CMs. Beating clusters containing hESC-CMs were co-cultured in vitro with noncontractile slices of neonatal murine ventricles. After 5-7 days, when beating clusters had integrated morphologically into the damaged tissue, isometric force measurements were performed during spontaneous beating as well as during electrical field stimulation. Spontaneous beating stopped when extracellular calcium ([Ca²⁺](ec)) was removed or after administration of the Ca²⁺ channel blocker nifedipine. During field stimulation at a constant rate, the developed force increased with incremental concentrations of [Ca²⁺](ec). During spontaneous beating, rising [Ca²⁺](ec) increased beating rate and developed force up to a [Ca²⁺](ec) of 2.5 mM. When [Ca²⁺](ec) was increased further, spontaneous beating rate decreased, whereas the developed force continued to increase. The beta-adrenergic agonist isoproterenol induced a dose-dependent increase of the frequency of spontaneous beating; however, it did not significantly change the developed force during spontaneous contractions or during electrical stimulation at a constant rate. Force developed by early hESC-CMs depends on [Ca²⁺](ec) and on the L-type Ca²⁺ channel. The lack of an inotropic reaction despite a pronounced chronotropic response after beta-adrenergic stimulation most likely indicates immaturity of the sarcoplasmic reticulum. For cell-replacement strategies, further maturation of cardiac cells has to be achieved either in vitro before or in vivo after transplantation.

  6. Functional properties of human embryonic stem cell-derived cardiomyocytes: intracellular Ca2+ handling and the role of sarcoplasmic reticulum in the contraction.

    PubMed

    Dolnikov, Katya; Shilkrut, Mark; Zeevi-Levin, Naama; Gerecht-Nir, Sharon; Amit, Michal; Danon, Asaf; Itskovitz-Eldor, Joseph; Binah, Ofer

    2006-02-01

    Since cardiac transplantation is limited by the small availability of donor organs, regeneration of the diseased myocardium by cell transplantation is an attractive therapeutic modality. To determine the compatibility of human embryonic stem cell-derived cardiomyocytes (hESC-CMs) (7 to 55 days old) with the myocardium, we investigated their functional properties regarding intracellular Ca2+ handling and the role of the sarcoplasmic reticulum in the contraction. The functional properties of hESC-CMs were investigated by recording simultaneously [Ca2+]i transients and contractions. Additionally, we performed Western blot analysis of the Ca2+-handling proteins SERCA2, calsequestrin, phospholamban, and Na+/Ca2+ exchanger (NCX). Our major findings are, first, that hESC-CMs displayed temporally related [Ca2+]i transients and contractions, negative force-frequency relations, and lack of post-rest potentiation. Second, ryanodine, thapsigargin, and caffeine did not affect the [Ca2+]i transient and contraction, indicating that at this developmental stage, contraction depends on transsarcolemmal Ca2+ influx rather than on sarcoplasmic reticulum Ca2+ release. Third, in agreement with the notion that a voltage-dependent Ca2+ current is present in hESC-CMs and contributes to the mechanical function, verapamil completely blocked contraction. Fourth, whereas hESC-CMs expressed SERCA2 and NCX at levels comparable to those of the adult porcine myocardium, calsequestrin and phospholamban were not expressed. Our study shows for the first time that functional properties related to intracellular Ca2+ handling of hESC-CMs differ markedly from the adult myocardium, probably due to immature sarcoplasmic reticulum capacity.

  7. Immune modulatory mesenchymal stem cells derived from human embryonic stem cells through a trophoblast-like stage.

    PubMed

    Wang, Xiaofang; Lazorchak, Adam S; Song, Li; Li, Enqin; Zhang, Zhenwu; Jiang, Bin; Xu, Ren-He

    2016-02-01

    Mesenchymal stem/stromal cells (MSCs) have great clinical potential in modulating inflammation and promoting tissue repair. Human embryonic stem cells (hESCs) have recently emerged as a potentially superior cell source for MSCs. However, the generation methods reported so far vary greatly in quality and efficiency. Here, we describe a novel method to rapidly and efficiently produce MSCs from hESCs via a trophoblast-like intermediate stage in approximately 11-16 days. We term these cells "T-MSCs" and show that T-MSCs express a phenotype and differentiation potential minimally required to define MSCs. T-MSCs exhibit potent immunomodulatory activity in vitro as they can remarkably inhibit proliferation of cocultured T and B lymphocytes. Unlike bone marrow MSCs, T-MSCs do not have increased expression of inflammatory mediators in response to IFNγ. Moreover, T-MSCs constitutively express a high level of the immune inhibitory ligand PD-L1 and elicit strong and durable efficacy in two distinct animal models of autoimmune disease, dextran sulfate sodium induced colitis, and experimental autoimmune encephalomyelitis, at doses near those approved for clinical trials. Together, we present a simple and fast derivation method to generate MSCs from hESCs, which possess potent immunomodulatory properties in vitro and in vivo and may serve as a novel and ideal candidate for MSC-based therapies.

  8. Induced pluripotent stem cell-derived gamete-associated proteins incite rejection of induced pluripotent stem cells in syngeneic mice.

    PubMed

    Kim, Eun-Mi; Manzar, Gohar; Zavazava, Nicholas

    2017-02-10

    The safety of induced pluripotent stem cells (iPSCs) in autologous recipients has been questioned after iPSCs, but not embryonic stem cells (ESCs), were reported to be rejected in syngeneic mice. This important topic has remained controversial because there has not been a mechanistic explanation for this phenomenon. Here, we hypothesize that iPSCs, but not ESCs, readily differentiate into gamete-forming cells that express meiotic antigens normally found in immune-privileged gonads. Because peripheral blood T cells are not tolerized to these antigens in the thymus, gamete-associated-proteins (GAPs) sensitize T cells leading to rejection. Here, we provide evidence that GAPs expressed in iPSC teratomas, but not in ESC teratomas, are responsible for the immunological rejection of iPSCs. Furthermore, silencing the expression of Stra8, 'the master regulator of meiosis', in iPSCs, using short hairpin RNA led to significant abrogation of the rejection of iPSCs, supporting our central hypothesis that GAPs expressed after initiation of meiosis in iPSCs were responsible for rejection. In contrast to iPSCs, iPSC-derivatives, such as haematopoietic progenitor cells, are able to engraft long-term into syngeneic recipients because they no longer express GAPs. Our findings, for the first time, provide a unifying explanation of why iPSCs, but not ESCs, are rejected in syngeneic recipients, ending the current controversy on the safety of iPSCs and their derivatives.

  9. Mathematically-Engineered Stromal Cell-Derived Factor 1alpha Stem Cell Cytokine Analogue Enhances Mechanical Properties of Infarcted Myocardium

    PubMed Central

    Jr, John W. MacArthur; Trubelja, Alen; Shudo, Yasuhiro; Hsiao, Philip; Fairman, Alex; Yang, Elaine; Hiesinger, William; Atluri, Pavan; Woo, Y Joseph

    2014-01-01

    Background The biomechanical response to a myocardial infarction consists of ventricular remodeling that leads to dilation, loss of contractile function, abnormal stress patterns and ultimately heart failure. We hypothesized that intramyocardial injection of our previously designed pro-angiogenic chemokine, an engineered stromal cell derived factor 1alpha analogue(ESA), improves mechanical properties of the heart post-infarction. Methods Male rats (n=54) underwent either sham surgery (n=17) with no coronary artery ligation or ligation of the LAD (n=37). Rats in the MI group were then randomized to receive either saline (0.1cc, n=18) or ESA (6μg/kg, n=19) injected into the myocardium at 4 predetermined spots around the borderzone. Echocardiograms were performed preoperatively and before the terminal surgery. After 4 weeks the hearts were explanted and longitudinally sectioned. Uniaxial tensile testing was completed using an Instron 5543 Microtester. Optical strain was evaluated utilizing custom image acquisition software, Digi-Velpo, and analyzed in MATLAB. Results Compared to the saline control group at 4 weeks, the ESA injected hearts had higher ejection fractions (71.8% ± 9.0 vs. 55.3% ± 12.6, p= 0.0004) smaller end-diastolic left ventricular internal dimensions (0.686cm ± 0.110 vs. 0.763cm ± 0.160, p= 0.04), higher cardiac output (36ml/min ± 11.6 vs. 26.9ml/min ± 7.3, p= 0.05) and the tensile modulus was lower(251kPa ± 56 vs. 301kPa ± 81, p= 0.04). The tensile modulus for the sham group was 195kPa ± 56, indicating ESA injection results in a less stiff ventricle. Conclusions Direct injection of ESA alters the biomechanical response to MI, improving the mechanical properties in the post-infarct heart. PMID:23244259

  10. Transplantation of stem cell-derived astrocytes for the treatment of amyotrophic lateral sclerosis and spinal cord injury

    PubMed Central

    Nicaise, Charles; Mitrecic, Dinko; Falnikar, Aditi; Lepore, Angelo C

    2015-01-01

    Neglected for years, astrocytes are now recognized to fulfill and support many, if not all, homeostatic functions of the healthy central nervous system (CNS). During neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS) and spinal cord injury (SCI), astrocytes in the vicinity of degenerating areas undergo both morphological and functional changes that might compromise their intrinsic properties. Evidence from human and animal studies show that deficient astrocyte functions or loss-of-astrocytes largely contribute to increased susceptibility to cell death for neurons, oligodendrocytes and axons during ALS and SCI disease progression. Despite exciting advances in experimental CNS repair, most of current approaches that are translated into clinical trials focus on the replacement or support of spinal neurons through stem cell transplantation, while none focus on the specific replacement of astroglial populations. Knowing the important functions carried out by astrocytes in the CNS, astrocyte replacement-based therapies might be a promising approach to alleviate overall astrocyte dysfunction, deliver neurotrophic support to degenerating spinal tissue and stimulate endogenous CNS repair abilities. Enclosed in this review, we gathered experimental evidence that argue in favor of astrocyte transplantation during ALS and SCI. Based on their intrinsic properties and according to the cell type transplanted, astrocyte precursors or stem cell-derived astrocytes promote axonal growth, support mechanisms and cells involved in myelination, are able to modulate the host immune response, deliver neurotrophic factors and provide protective molecules against oxidative or excitotoxic insults, amongst many possible benefits. Embryonic or adult stem cells can even be genetically engineered in order to deliver missing gene products and therefore maximize the chance of neuroprotection and functional recovery. However, before broad clinical translation, further preclinical

  11. Reprogramming of mesenchymal stem cells derived from iPSCs seeded on biofunctionalized calcium phosphate scaffold for bone engineering

    PubMed Central

    Liu, Jun; Chen, Wenchuan; Zhao, Zhihe; Xu, Hockin H. K.

    2013-01-01

    Human induced pluripotent stem cell-derived mesenchymal stem cells (iPSC-MSCs) are a promising choice of patient-specific stem cells with superior capability of cell expansion. There has been no report on bone morphogenic protein 2 (BMP2) gene modification of iPSC-MSCs for bone tissue engineering. The objectives of this study were to: (1) genetically modify iPSC-MSCs for BMP2 delivery; and (2) to seed BMP2 gene-modified iPSC-MSCs on calcium phosphate cement (CPC) immobilized with RGD for bone tissue engineering. iPSC-MSCs were infected with green fluorescence protein (GFP-iPSC-MSCs), or BMP2 lentivirus (BMP2-iPSC-MSCs). High levels of GFP expression were detected and more than 68% of GFP-iPSC-MSCs were GFP positive. BMP2-iPSC-MSCs expressed higher BMP2 levels than iPSC-MSCs in quantitative RT-PCR and ELISA assays (p < 0.05). BMP2-iPSC-MSCs did not compromise growth kinetics and cell cycle stages compared to iPSC-MSCs. After 14 d in osteogenic medium, ALP activity of BMP2-iPSC-MSCs was 1.8 times that of iPSC-MSCs (p < 0.05), indicating that BMP2 gene transduction of iPSC-MSCs enhanced osteogenic differentiation. BMP2-iPSC-MSCs were seeded on CPC scaffold biofunctionalized with RGD (RGD-CPC). BMP2-iPSC-MSCs attached well on RGD-CPC. At 14 d, COL1A1 expression of BMP2-iPSC-MSCs was 1.9 times that of iPSC-MSCs. OC expression of BMP2-iPSC-MSCs was 2.3 times that of iPSC-MSCs. Bone matrix mineralization by BMP2-iPSC-MSCs was was 1.8 times that of iPSC-MSCs at 21 d. In conclusion, iPSC-MSCs seeded on CPC were suitable for bone tissue engineering. BMP2 gene-modified iPSC-MSCs on RGD-CPC underwent osteogenic differentiation, and the overexpression of BMP2 in iPSC-MSCs enhanced differentiation and bone mineral production on RGD-CPC. BMP2-iPSC-MSC seeding on RGD-CPC scaffold is promising to enhance bone regeneration efficacy. PMID:23891395

  12. Bystander Effect Fuels Human Induced Pluripotent Stem Cell-Derived Neural Stem Cells to Quickly Attenuate Early Stage Neurological Deficits After Stroke

    PubMed Central

    Eckert, Auston; Huang, Lei; Gonzalez, Rodolfo; Kim, Hye-Sun; Hamblin, Milton H.

    2015-01-01

    Present therapies for stroke rest with tissue plasminogen activator (tPA), the sole licensed antithrombotic on the market; however, tPA’s effectiveness is limited in that the drug not only must be administered less than 3–5 hours after stroke but often exacerbates blood-brain barrier (BBB) leakage and increases hemorrhagic incidence. A potentially promising therapy for stroke is transplantation of human induced pluripotent stem cell-derived neural stem cells (hiPSC-NSCs). To date, the effects of iPSCs on injuries that take place during early stage ischemic stroke have not been well studied. Consequently, we engrafted iPSC-NSCs into the ipsilesional hippocampus, a natural niche of NSCs, at 24 hours after stroke (prior to secondary BBB opening and when inflammatory signature is abundant). At 48 hours after stroke (24 hours after transplant), hiPSC-NSCs had migrated to the stroke lesion and quickly improved neurological function. Transplanted mice showed reduced expression of proinflammatory factors (tumor necrosis factor-α, interleukin 6 [IL-6], IL-1β, monocyte chemotactic protein 1, macrophage inflammatory protein 1α), microglial activation, and adhesion molecules (intercellular adhesion molecule 1, vascular cell adhesion molecule 1) and attenuated BBB damage. We are the first to report that engrafted hiPSC-NSCs rapidly improved neurological function (less than 24 hours after transplant). Rapid hiPSC-NSC therapeutic activity is mainly due to a bystander effect that elicits reduced inflammation and BBB damage. Significance Clinically, cerebral vessel occlusion is rarely permanent because of spontaneous or thrombolytic therapy-mediated reperfusion. These results have clinical implications indicating a much extended therapeutic window for transplantation of human induced pluripotent stem cell-derived neural stem cells (hiPSC-NSCs; 24 hours after stroke as opposed to the 5-hour window with tissue plasminogen activator [tPA]). In addition, there is potential for a

  13. Chemical genetics and its potential in cardiac stem cell therapy.

    PubMed

    Vieira, Joaquim M; Riley, Paul R

    2013-05-01

    Over the last decade or so, intensive research in cardiac stem cell biology has led to significant discoveries towards a potential therapy for cardiovascular disease; the main cause of morbidity and mortality in humans. The major goal within the field of cardiovascular regenerative medicine is to replace lost or damaged cardiac muscle and coronaries following ischaemic disease. At present, de novo cardiomyocytes can be generated either in vitro, for cell transplantation or disease modelling using directed differentiation of embryonic stem cells or induced pluripotent stem cells, or in vivo via direct reprogramming of resident adult cardiac fibroblast or ectopic stimulation of resident cardiac stem or progenitor cells. A major bottleneck with all of these approaches is the low efficiency of cardiomyocyte differentiation alongside their relative functional immaturity. Chemical genetics, and the application of phenotypic screening with small molecule libraries, represent a means to enhance understanding of the molecular pathways controlling cardiovascular cell differentiation and, moreover, offer the potential for discovery of new drugs to invoke heart repair and regeneration. Here, we review the potential of chemical genetics in cardiac stem cell therapy, highlighting not only the major contributions to the field so far, but also the future challenges.

  14. Isolation and Characterization of Exosome from Human Embryonic Stem Cell-Derived C-Myc-Immortalized Mesenchymal Stem Cells.

    PubMed

    Lai, Ruenn Chai; Yeo, Ronne Wee Yeh; Padmanabhan, Jayanthi; Choo, Andre; de Kleijn, Dominique P V; Lim, Sai Kiang

    2016-01-01

    Mesenchymal stem cells (MSC) are currently the cell type of choice in many cell therapy trials. The number of therapeutic applications for MSCs registered as product IND submissions with the FDA and initiation of registered clinical trials has increased substantially in recent years, in particular between 2006 and 2012. However, defined mechanisms of action underpinning the therapeutic efficacy of MSCs are lacking, but they are increasingly attributed to MSC trophic secretion rather than their differentiation potential. A promising secreted therapeutic candidate is an extracellular vesicle (EV) known as the exosome. The use of exosomes instead of cells as a therapeutic agent provides several advantages. A critical advantage is the prospect of a conventional pharmaceutical manufacturing process that is highly scalable and amenable to the stringent manufacturing process. For example, MSCs used as producers of therapeutics, and not as therapeutics per se, could be immortalized to generate infinitely expansible clonal lines to enhance the reproducible production of therapeutic exosomes. In this chapter, we will describe the immortalization of MSCs, and the production, isolation, and characterization of exosomes from immortalized MSC.

  15. Predictors for severe cardiac complications after hematopoietic stem cell transplantation.

    PubMed

    Sakata-Yanagimoto, M; Kanda, Y; Nakagawa, M; Asano-Mori, Y; Kandabashi, K; Izutsu, K; Imai, Y; Hangaishi, A; Kurokawa, M; Tsujino, S; Ogawa, S; Chiba, S; Motokura, T; Hirai, H

    2004-05-01

    The value of pre-transplant factors for predicting the development of cardiac complications after transplantation has been inconsistent among studies. We analyzed the impact of pre-transplant factors on the incidence of severe cardiac complications in 164 hematopoietic stem cell transplant recipients. We identified eight patients (4.8%) who experienced grade III or IV cardiac complications according to the Bearman criteria. Seven died of cardiac causes a median of 3 days after the onset of cardiac complications. On univariate analysis, both the cumulative dose of anthracyclines and the use of anthracyclines within 60 days before transplantation affected the incidence of severe cardiac complications (P=0.0091 and 0.011). The dissociation of heart rate and body temperature, which reflects "relative tachycardia", was also associated with a higher incidence of cardiac complications (P=0.024). None of the variables obtained by electrocardiography or echocardiography were useful for predicting cardiac complications after transplantation, although the statistical power might not be sufficient to detect the usefulness of ejection fraction. On a multivariate analysis, the cumulative dose of anthracyclines was the only independent significant risk factor for severe cardiac complications. We conclude that the cumulative dose of anthracyclines is the most potent predictor of cardiac complications and the administration of anthracyclines should be avoided within two months before transplantation.

  16. Hyperthermia Influences the Effects of Sodium Channel Blocking Drugs in Human-Induced Pluripotent Stem Cell-Derived Cardiomyocytes

    PubMed Central

    El-Battrawy, Ibrahim; Lang, Siegfried; Zhao, Zhihan; Akin, Ibrahim; Yücel, Gökhan; Meister, Sophie; Patocskai, Bence; Behnes, Michael; Rudic, Boris; Tülümen, Erol; Liebe, Volker; Tiburcy, Malte; Dworacek, Jennifer; Zimmermann, Wolfram-Hubertus; Utikal, Jochen; Wieland, Thomas; Borggrefe, Martin; Zhou, Xiao-Bo

    2016-01-01

    Introduction Fever can increase the susceptibility to supraventricular and ventricular arrhythmias, in which sodium channel dysfunction has been implicated. Whether fever influences the efficacy of sodium channel blocking drugs is unknown. The current study was designed to investigate the temperature dependent effects of distinct sodium channel blocking drugs on the sodium currents in human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs). Methods and Results hiPSC-CMs were generated from human skin fibroblasts of a healthy donor. The peak and late sodium currents (INa), steady-state activation, inactivation and recovery from inactivation of INa in hiPSC-CMs were analyzed using the whole-cell patch clamp technique. The effects of different concentrations of the antiarrhythmic drugs flecainide, lidocaine, ajmaline and the antianginal drug ranolazine on INa were tested at 36°C and 40°C. Increasing the temperature of the bath solution from 36°C to 40°C enhanced the inhibition of peak INa but reduced the inhibition of late INa by flecainide and lidocaine. By contrast, increasing the temperature reduced the effect of ajmaline and ranolazine on the peak INa but not late INa. None of the tested drugs showed temperature-dependent effects on the steady-state activation and inactivation as well as on the recovery from inactivation of INa in hiPSC-CMs. Conclusions Temperature variation from the physiological to the febrile range apparently influences the effects of sodium channel blockers on the sodium currents. This may influence their antiarrhythmic efficacy in patients suffering from fever. PMID:27829006

  17. Accelerated intoxication of GABAergic synapses by botulinum neurotoxin A disinhibits stem cell-derived neuron networks prior to network silencing

    PubMed Central

    Beske, Phillip H.; Scheeler, Stephen M.; Adler, Michael; McNutt, Patrick M.

    2015-01-01

    Botulinum neurotoxins (BoNTs) are extremely potent toxins that specifically cleave SNARE proteins in peripheral synapses, preventing neurotransmitter release. Neuronal responses to BoNT intoxication are traditionally studied by quantifying SNARE protein cleavage in vitro or monitoring physiological paralysis in vivo. Consequently, the dynamic effects of intoxication on synaptic behaviors are not well-understood. We have reported that mouse embryonic stem cell-derived neurons (ESNs) are highly sensitive to BoNT based on molecular readouts of intoxication. Here we study the time-dependent changes in synapse- and network-level behaviors following addition of BoNT/A to spontaneously active networks of glutamatergic and GABAergic ESNs. Whole-cell patch-clamp recordings indicated that BoNT/A rapidly blocked synaptic neurotransmission, confirming that ESNs replicate the functional pathophysiology responsible for clinical botulism. Quantitation of spontaneous neurotransmission in pharmacologically isolated synapses revealed accelerated silencing of GABAergic synapses compared to glutamatergic synapses, which was consistent with the selective accumulation of cleaved SNAP-25 at GAD1+ pre-synaptic terminals at early timepoints. Different latencies of intoxication resulted in complex network responses to BoNT/A addition, involving rapid disinhibition of stochastic firing followed by network silencing. Synaptic activity was found to be highly sensitive to SNAP-25 cleavage, reflecting the functional consequences of the localized cleavage of the small subpopulation of SNAP-25 that is engaged in neurotransmitter release in the nerve terminal. Collectively these findings illustrate that use of synaptic function assays in networked neurons cultures offers a novel and highly sensitive approach for mechanistic studies of toxin:neuron interactions and synaptic responses to BoNT. PMID:25954159

  18. Alpha-Latrotoxin Rescues SNAP-25 from BoNT/A-Mediated Proteolysis in Embryonic Stem Cell-Derived Neurons

    PubMed Central

    Mesngon, Mariano; McNutt, Patrick

    2011-01-01

    The botulinum neurotoxins (BoNTs) exhibit zinc-dependent proteolytic activity against members of the core synaptic membrane fusion complex, preventing neurotransmitter release and resulting in neuromuscular paralysis. No pharmacologic therapies have been identified that clinically relieve botulinum poisoning. The black widow spider venom α-latrotoxin (LTX) has the potential to attenuate the severity or duration of BoNT-induced paralysis in neurons via the induction of synaptic degeneration and remodeling. The potential for LTX to antagonize botulinum poisoning was evaluated in embryonic stem cell-derived neurons (ESNs), using a novel screening assay designed around the kinetics of BoNT/A activation. Exposure of ESNs to 400 pM LTX for 6.5 or 13 min resulted in the nearly complete restoration of uncleaved SNAP-25 within 48 h, whereas treatment with 60 mM K+ had no effect. Time-lapse imaging demonstrated that LTX treatment caused a profound increase in Ca2+ influx and evidence of excitotoxicity, though ESNs remained viable 48 h after LTX treatment. This is the first instance of a cell-based treatment that has shown the ability to eliminate BoNT activity. These data suggest that LTX treatment may provide the basis for a new class of therapeutic approach to BoNT intoxication and may contribute to an improved understanding of long-term mechanisms of BoNT intoxication and recovery. They further demonstrate that ESNs are a novel, responsive and biologically relevant model for LTX research and BoNT therapeutic drug discovery. PMID:22069721

  19. [Cancer vaccine therapy using genetically modified induced pluripotent stem cell-derived dendritic cells expressing the TAA gene].

    PubMed

    Iwamoto, Hiromitsu; Ojima, Toshiyasu; Nakamori, Mikihito; Nakamura, Masaki; Hayata, Keiji; Katsuda, Masahiro; Iida, Takeshi; Miyazawa, Motoki; Iwahashi, Makoto; Yamaue, Hiroki

    2013-11-01

    It is generally accepted that the difficulty in obtaining a sufficient number of functional dendritic cells (DCs) poses a serious problem in DC-based immunotherapy. Therefore, we used induced pluripotent stem (iPS) cell-derived DCs (iPSDCs) instead. If the therapeutic efficacy of iPSDCs was equivalent to that of bone marrow-derived DCs( BMDCs), then the above-mentioned problems may be solved. In this study, we generated iPSDCs from iPS cells and compared their capacity to mature and migrate to the regional lymph nodes with that of BMDCs. We adenovirally transduced the hgp100 gene, which codes for a natural tumor antigen, into the DCs and immunized the mice with these genetically modified DCs. The cytotoxic activity of CD8( +) cytotoxic T lymphocytes( CTLs) was assayed using a 51Cr-release assay. The therapeutic efficacy of the vaccination was examined in a subcutaneous tumor model. Our results demonstrated that iPSDCs equaled BMDCs in terms of their maturation and migration capacity. Furthermore, hgp100-specific CTLs were generated in mice that were immunized with the genetically modified iPSDCs. These CTLs exhibited a high level of cytotoxicity against B16 cells, which is similar to that exhibited by CTLs generated in BMDCs immunized mice. Moreover, vaccination with genetically modified iPSDCs elicited a high level of therapeutic efficacy equaling that of vaccination with BMDCs. This study clarified experimentally that genetically modified iPSDCs are equivalent to BMDCs in terms of tumor-associated antigen-specific therapeutic antitumor immunity. This vaccination strategy may therefore be useful for future clinical application as a cancer vaccine.

  20. Surface Modified Biodegradable Electrospun Membranes as a Carrier for Human Embryonic Stem Cell-Derived Retinal Pigment Epithelial Cells.

    PubMed

    Sorkio, Anni; Porter, Patrick J; Juuti-Uusitalo, Kati; Meenan, Brian J; Skottman, Heli; Burke, George A

    2015-09-01

    Human embryonic stem cell-derived retinal pigment epithelial (hESC-RPE) cells are currently undergoing clinical trials to treat retinal degenerative diseases. Transplantation of hESC-RPE cells in conjuction with a supportive biomaterial carrier holds great potential as a future treatment for retinal degeneration. However, there has been no such biodegradable material that could support the growth and maturation of hESC-RPE cells so far. The primary aim of this work was to create a thin porous poly (L-lactide-co-caprolactone) (PLCL) membrane that could promote attachment, proliferation, and maturation of the hESC-RPE cells in serum-free culture conditions. The PLCL membranes were modified by atmospheric pressure plasma processing and coated with collagen IV to enhance cell growth and maturation. Permeability of the membranes was analyzed with an Ussing chamber system. Analysis with scanning electron microscopy, contact angle measurement, atomic force microscopy, and X-ray photoelectron spectroscopy demonstrated that plasma surface treatment augments the surface properties of the membrane, which enhances the binding and conformation of the protein. Cell proliferation assays, reverse transcription-polymerase chain reaction, indirect immunofluoresence staining, trans-epithelial electrical resistance measurements, and in vitro phagocytosis assay clearly demonstrated that the plasma treated PLCL membranes supported the adherence, proliferation, maturation and functionality of hESC-RPE cells in serum-free culture conditions. Here, we report for the first time, how PLCL membranes can be modified with atmospheric pressure plasma processing to enable the formation of a functional hESC-RPE monolayer on a porous biodegradable substrate, which have a potential as a tissue-engineered construct for regenerative retinal repair applications.

  1. Nanofiber Matrices Promote the Neuronal Differentiation of Human Embryonic Stem Cell-Derived Neural Precursors In Vitro

    PubMed Central

    Lim, Shawn H.; Christopherson, Gregory T.; Xu, Leyan; Nasonkin, Igor; Yu, Christopher; Mao, Hai-Quan; Koliatsos, Vassilis E.

    2011-01-01

    The potential of human embryonic stem (ES) cells as experimental therapies for neuronal replacement has recently received considerable attention. In view of the organization of the mature nervous system into distinct neural circuits, key challenges of such therapies are the directed differentiation of human ES cell-derived neural precursors (NPs) into specific neuronal types and the directional growth of axons along specified trajectories. In the present study, we cultured human NPs derived from the NIH-approved ES line BGO1 on polycaprolactone fiber matrices of different diameter (i.e., nanofibers and microfibers) and orientation (i.e., aligned and random); fibers were coated with poly-L-ornithine/laminin to mimic the extracellular matrix and support the adhesion, viability, and differentiation of NPs. On aligned fibrous meshes, human NPs adopt polarized cell morphology with processes extending along the axis of the fiber, whereas NPs on plain tissue culture surfaces or random fiber substrates form nonpolarized neurite networks. Under differentiation conditions, human NPs cultured on aligned fibrous substrates show a higher rate of neuronal differentiation than other matrices; 62% and 86% of NPs become TUJ1 (+) early neurons on aligned micro- and nanofibers, respectively, whereas only 32% and 27% of NPs acquire the same fate on random micro- and nanofibers. Metabolic cell activity/viability studies reveal that fiber alignment and diameter also have an effect on NP viability, but only in the presence of mitogens. Our findings demonstrate that fibrous substrates serve as an artificial extracellular matrix and provide a microenviroment that influences key aspects of the neuronal differentiation of ES-derived NPs. PMID:20973749

  2. Availability of human induced pluripotent stem cell-derived cardiomyocytes in assessment of drug potential for QT prolongation

    SciTech Connect

    Nozaki, Yumiko; Honda, Yayoi; Tsujimoto, Shinji; Watanabe, Hitoshi; Kunimatsu, Takeshi; Funabashi, Hitoshi

    2014-07-01

    Field potential duration (FPD) in human-induced pluripotent stem cell-derived cardiomyocytes (hiPS-CMs), which can express QT interval in an electrocardiogram, is reported to be a useful tool to predict K{sup +} channel and Ca{sup 2+} channel blocker effects on QT interval. However, there is no report showing that this technique can be used to predict multichannel blocker potential for QT prolongation. The aim of this study is to show that FPD from MEA (Multielectrode array) of hiPS-CMs can detect QT prolongation induced by multichannel blockers. hiPS-CMs were seeded onto MEA and FPD was measured for 2 min every 10 min for 30 min after drug exposure for the vehicle and each drug concentration. I{sub Kr} and I{sub Ks} blockers concentration-dependently prolonged corrected FPD (FPDc), whereas Ca{sup 2+} channel blockers concentration-dependently shortened FPDc. Also, the multichannel blockers Amiodarone, Paroxetine, Terfenadine and Citalopram prolonged FPDc in a concentration dependent manner. Finally, the I{sub Kr} blockers, Terfenadine and Citalopram, which are reported to cause Torsade de Pointes (TdP) in clinical practice, produced early afterdepolarization (EAD). hiPS-CMs using MEA system and FPDc can predict the effects of drug candidates on QT interval. This study also shows that this assay can help detect EAD for drugs with TdP potential. - Highlights: • We focused on hiPS-CMs to replace in vitro assays in preclinical screening studies. • hiPS-CMs FPD is useful as an indicator to predict drug potential for QT prolongation. • MEA assay can help detect EAD for drugs with TdP potentials. • MEA assay in hiPS-CMs is useful for accurately predicting drug TdP risk in humans.

  3. Embryonic stem cell-derived granulosa cells participate in ovarian follicle formation in vitro and in vivo.

    PubMed

    Woods, Dori C; White, Yvonne A R; Niikura, Yuichi; Kiatpongsan, Sorapop; Lee, Ho-Joon; Tilly, Jonathan L

    2013-05-01

    Differentiating embryonic stem cells (ESCs) can form ovarian follicle-like structures in vitro, consisting of an oocyte-like cell surrounded by somatic cells capable of steroidogenesis. Using a dual-fluorescence reporter system in which mouse ESCs express green fluorescent protein (GFP) under the control of a germ cell-specific Pou5f1 gene promoter and red fluorescent protein (Discosoma sp red [DsRed]) driven by the granulosa cell-specific Forkhead box L2 (Foxl2) gene promoter, we first confirmed in vitro formation of follicle-like structures containing GFP-positive cells surrounded by DsRed-positive cells. Isolated DsRed-positive cells specified from ECSs exhibited a gene expression profile consistent with granulosa cells, as revealed by the detection of messenger RNAs (mRNAs) for Foxl2, follistatin (Fst), anti-Müllerian hormone (Amh), and follicle-stimulating hormone receptor (Fshr) as well as by production of both progesterone and estradiol. In addition, treatment of isolated DsRed-expressing cells with follicle-stimulating hormone (FSH) significantly increased estradiol production over basal levels, confirming the presence of functional FSH receptors in these cells. Last, ESC-derived DsRed-positive cells injected into neonatal mouse ovaries became incorporated within the granulosa cell layer of immature follicles. These studies demonstrate that Foxl2-expressing ovarian somatic cells derived in vitro from differentiating ESCs express granulosa cell markers, actively associate with germ cells in vitro, synthesize steroids, respond to FSH, and participate in folliculogenesis in vivo.

  4. In Vivo Efficacy of Umbilical Cord Blood Stem Cell-Derived NK Cells in the Treatment of Metastatic Colorectal Cancer

    PubMed Central

    Veluchamy, John P.; Lopez-Lastra, Silvia; Spanholtz, Jan; Bohme, Fenna; Kok, Nina; Heideman, Daniëlle A. M.; Verheul, Henk M. W.; Di Santo, James P.; de Gruijl, Tanja D.; van der Vliet, Hans J.

    2017-01-01

    Therapeutic monoclonal antibodies against the epidermal growth factor receptor (EGFR) act by inhibiting EGFR downstream signaling and by eliciting a natural killer (NK) cell-mediated antitumor response. The IgG1 mAb cetuximab has been used for treatment of RASwt metastatic colorectal cancer (mCRC) patients, showing limited efficacy. In the present study, we address the potential of adoptive NK cell therapy to overcome these limitations investigating two allogeneic NK cell products, i.e., allogeneic activated peripheral blood NK cells (A-PBNK) and umbilical cord blood stem cell-derived NK cells (UCB-NK). While cetuximab monotherapy was not effective against EGFR− RASwt, EGFR+ RASmut, and EGFR+ BRAFmut cells, A-PBNK were able to initiate lysis of EGFR+ colon cancer cells irrespective of RAS or BRAF status. Cytotoxic effects of A-PBNK (but not UCB-NK) were further potentiated significantly by coating EGFR+ colon cancer cells with cetuximab. Of note, a significantly higher cytotoxicity was induced by UCB-NK in EGFR−RASwt (42 ± 8 versus 67 ± 7%), EGFR+ RASmut (20 ± 2 versus 37 ± 6%), and EGFR+ BRAFmut (23 ± 3 versus 43 ± 7%) colon cancer cells compared to A-PBNK and equaled the cytotoxic efficacy of the combination of A-PBNK and cetuximab. The antitumor efficacy of UCB-NK cells against cetuximab-resistant human EGFR+ RASmut colon cancer cells was further confirmed in an in vivo preclinical mouse model where UCB-NK showed enhanced antitumor cytotoxicity against colon cancer independent of EGFR and RAS status. As UCB-NK have been proven safe in a recently conducted phase I clinical trial in acute myeloid leukemia, a fast translation into clinical proof of concept for mCRC could be considered. PMID:28220124

  5. Isolation and Transplantation of Corneal Endothelial Cell–Like Cells Derived from In-Vitro-Differentiated Human Embryonic Stem Cells

    PubMed Central

    Zhang, Kai; Pang, Kunpeng

    2014-01-01

    The maintenance of corneal dehydration and transparency depends on barrier and pump functions of corneal endothelial cells (CECs). The human CECs have no proliferation capacity in vivo and the ability to divide in vitro under culture conditions is dramatically limited. Thus, the acquisition of massive cells analogous to normal human CECs is extremely necessary whether from the perspective of cellular basic research or from clinical applications. Here we report the derivation of CEC-like cells from human embryonic stem cells (hESCs) through the periocular mesenchymal precursor (POMP) phase. Using the transwell coculture system of hESCs with differentiated human corneal stromal cells, we induced hESCs to differentiate into POMPs. Then, CEC-like cells were derived from POMPs with lens epithelial cell–conditioned medium. Within 1 week, CEC-like cells that expressed the corneal endothelium (CE) differentiation marker N-cadherin and transcription factors FoxC1 and Pitx2 were detectable. Fluorescence-activated cell sorting (FACS)–based isolation of the N-cadherin/vimentin dual-positive population enriches for CEC-like cells. The isolated CEC-like cells were labeled with carboxyfluorescein diacetate, succinimidyl ester (CFDA SE) and seeded onto posterior acellular porcine corneal matrix lamellae to construct the CEC-like cell sheets. Pump function parameters of the CEC-like cell sheets approximated those of human donor corneas. Importantly, when the CEC-like cell sheets were transplanted into the eyes of rabbit CE dysfunction models, the corneal transparency was restored gradually. In conclusion, CEC-like cells derived from hESCs displayed characteristics of native human CECs. This renewable source of human CECs offers massive cells for further studies of human CEC biological characteristics and potential applications of replacement therapies as substitution for donor CECs in the future. PMID:24499373

  6. A Systemized Approach to Investigate Ca2+ Synchronization in Clusters of Human Induced Pluripotent Stem-Cell Derived Cardiomyocytes

    PubMed Central

    Jones, Aled R.; Edwards, David H.; Cummins, Michael J.; Williams, Alan J.; George, Christopher H.

    2016-01-01

    Induced pluripotent stem cell-derived cardiomyocytes (IPS-CM) are considered by many to be the cornerstone of future approaches to repair the diseased heart. However, current methods for producing IPS-CM typically yield highly variable populations with low batch-to-batch reproducibility. The underlying reasons for this are not fully understood. Here we report on a systematized approach to investigate the effect of maturation in embryoid bodies (EB) vs. “on plate” culture on spontaneous activity and regional Ca2+ synchronization in IPS-CM clusters. A detailed analysis of the temporal and spatial organization of Ca2+ spikes in IPS-CM clusters revealed that the disaggregation of EBs between 0.5 and 2 weeks produced IPS-CM characterized by spontaneous beating and high levels of regional Ca2+ synchronization. These phenomena were typically absent in IPS-CM obtained from older EBs (>2 weeks). The maintenance of all spontaneously active IPS-CM clusters under “on plate” culture conditions promoted the progressive reduction in regional Ca2+ synchronization and the loss of spontaneous Ca2+ spiking. Raising the extracellular [Ca2+] surrounding these quiescent IPS-CM clusters from ~0.4 to 1.8 mM unmasked discrete behaviors typified by either (a) long-lasting Ca2+ elevation that returned to baseline or (b) persistent, large-amplitude Ca2+ oscillations around an increased cytoplasmic [Ca2+]. The different responses of IPS-CM to elevated extracellular [Ca2+] could be traced back to their routes of derivation. The data point to the possibility of predictably influencing IPS-CM phenotype and response to external activation via defined interventions at early stages in their maturation. PMID:26793710

  7. In vitro cardiotoxicity assessment of environmental chemicals using an organotypic human induced pluripotent stem cell-derived model.

    PubMed

    Sirenko, Oksana; Grimm, Fabian A; Ryan, Kristen R; Iwata, Yasuhiro; Chiu, Weihsueh A; Parham, Frederick; Wignall, Jessica A; Anson, Blake; Cromwell, Evan F; Behl, Mamta; Rusyn, Ivan; Tice, Raymond R

    2017-03-01

    An important target area for addressing data gaps through in vitro screening is the detection of potential cardiotoxicants. Despite the fact that current conservative estimates relate at least 23% of all cardiovascular disease cases to environmental exposures, the identities of the causative agents remain largely uncharacterized. Here, we evaluate the feasibility of a combinatorial in vitro/in silico screening approach for functional and mechanistic cardiotoxicity profiling of environmental hazards using a library of 69 representative environmental chemicals and drugs. Human induced pluripotent stem cell-derived cardiomyocytes were exposed in concentration-response for 30min or 24h and effects on cardiomyocyte beating and cellular and mitochondrial toxicity were assessed by kinetic measurements of intracellular Ca(2+) flux and high-content imaging using the nuclear dye Hoechst 33342, the cell viability marker Calcein AM, and the mitochondrial depolarization probe JC-10. More than half of the tested chemicals exhibited effects on cardiomyocyte beating after 30min of exposure. In contrast, after 24h, effects on cell beating without concomitant cytotoxicity were observed in about one third of the compounds. Concentration-response data for in vitro bioactivity phenotypes visualized using the Toxicological Prioritization Index (ToxPi) showed chemical class-specific clustering of environmental chemicals, including pesticides, flame retardants, and polycyclic aromatic hydrocarbons. For environmental chemicals with human exposure predictions, the activity-to-exposure ratios between modeled blood concentrations and in vitro bioactivity were between one and five orders of magnitude. These findings not only demonstrate that some ubiquitous environmental pollutants might have the potential at high exposure levels to alter cardiomyocyte function, but also indicate similarities in the mechanism of these effects both within and among chemicals and classes.

  8. Embryonic stem cells in cardiac repair and regeneration.

    PubMed

    Singla, Dinender K

    2009-08-01

    Cell transplantation is a subject of fast-growing research with a potential of a therapeutic approach for the treatment of heart diseases. Clinical applications require preparation of large number of donor cells. Stem cell studies published to date demonstrate that scientists have not reached the general consensus to use an optimal cell type for better cardiac repair and regeneration. We used embryonic stem (ES) cells and their released factors for cardiac repair and regeneration. The major concern of cardiac regeneration with stem cells includes engraftment, differentiation, and teratoma formation after ES cell transplantation. Our current knowledge of ES cell transplantation in the heart is very limited. This review discusses the use of various growth factors to enhance ES cells engraftment and differentiation, as well as the issue of teratoma formation.

  9. Texture Descriptors Ensembles Enable Image-Based Classification of Maturation of Human Stem Cell-Derived Retinal Pigmented Epithelium

    PubMed Central

    Caetano dos Santos, Florentino Luciano; Skottman, Heli; Juuti-Uusitalo, Kati; Hyttinen, Jari

    2016-01-01

    showed that the developed ensembles of texture descriptors are able to classify the RPE cell maturation stage. Moreover, we proved that preprocessing and region-based decomposition improves many descriptors’ accuracy in biological dataset classification. Finally, we built the first public dataset of stem cell-derived RPE cells, which is publicly available to the scientific community for classification studies. The proposed tool is available at https://www.dei.unipd.it/node/2357 and the RPE dataset at http://www.biomeditech.fi/data/RPE_dataset/. Both are available at https://figshare.com/s/d6fb591f1beb4f8efa6f. PMID:26895509

  10. CD13 and ROR2 Permit Isolation of Highly Enriched Cardiac Mesoderm from Differentiating Human Embryonic Stem Cells

    PubMed Central

    Skelton, Rhys J.P.; Brady, Bevin; Khoja, Suhail; Sahoo, Debashis; Engel, James; Arasaratnam, Deevina; Saleh, Kholoud K.; Abilez, Oscar J.; Zhao, Peng; Stanley, Edouard G.; Elefanty, Andrew G.; Kwon, Murray; Elliott, David A.; Ardehali, Reza

    2016-01-01

    Summary The generation of tissue-specific cell types from human embryonic stem cells (hESCs) is critical for the development of future stem cell-based regenerative therapies. Here, we identify CD13 and ROR2 as cell-surface markers capable of selecting early cardiac mesoderm emerging during hESC differentiation. We demonstrate that the CD13+/ROR2+ population encompasses pre-cardiac mesoderm, which efficiently differentiates to all major cardiovascular lineages. We determined the engraftment potential of CD13+/ROR2+ in small (murine) and large (porcine) animal models, and demonstrated that CD13+/ROR2+ progenitors have the capacity to differentiate toward cardiomyocytes, fibroblasts, smooth muscle, and endothelial cells in vivo. Collectively, our data show that CD13 and ROR2 identify a cardiac lineage precursor pool that is capable of successful engraftment into the porcine heart. These markers represent valuable tools for further dissection of early human cardiac differentiation, and will enable a detailed assessment of human pluripotent stem cell-derived cardiac lineage cells for potential clinical applications. PMID:26771355

  11. CD13 and ROR2 Permit Isolation of Highly Enriched Cardiac Mesoderm from Differentiating Human Embryonic Stem Cells.

    PubMed

    Skelton, Rhys J P; Brady, Bevin; Khoja, Suhail; Sahoo, Debashis; Engel, James; Arasaratnam, Deevina; Saleh, Kholoud K; Abilez, Oscar J; Zhao, Peng; Stanley, Edouard G; Elefanty, Andrew G; Kwon, Murray; Elliott, David A; Ardehali, Reza

    2016-01-12

    The generation of tissue-specific cell types from human embryonic stem cells (hESCs) is critical for the development of future stem cell-based regenerative therapies. Here, we identify CD13 and ROR2 as cell-surface markers capable of selecting early cardiac mesoderm emerging during hESC differentiation. We demonstrate that the CD13+/ROR2+ population encompasses pre-cardiac mesoderm, which efficiently differentiates to all major cardiovascular lineages. We determined the engraftment potential of CD13+/ROR2+ in small (murine) and large (porcine) animal models, and demonstrated that CD13+/ROR2+ progenitors have the capacity to differentiate toward cardiomyocytes, fibroblasts, smooth muscle, and endothelial cells in vivo. Collectively, our data show that CD13 and ROR2 identify a cardiac lineage precursor pool that is capable of successful engraftment into the porcine heart. These markers represent valuable tools for further dissection of early human cardiac differentiation, and will enable a detailed assessment of human pluripotent stem cell-derived cardiac lineage cells for potential clinical applications.

  12. Concise Review: Cardiac Disease Modeling Using Induced Pluripotent Stem Cells.

    PubMed

    Yang, Chunbo; Al-Aama, Jumana; Stojkovic, Miodrag; Keavney, Bernard; Trafford, Andrew; Lako, Majlinda; Armstrong, Lyle

    2015-09-01

    Genetic cardiac diseases are major causes of morbidity and mortality. Although animal models have been created to provide some useful insights into the pathogenesis of genetic cardiac diseases, the significant species differences and the lack of genetic information for complex genetic diseases markedly attenuate the application values of such data. Generation of induced pluripotent stem cells (iPSCs) from patient-specific specimens and subsequent derivation of cardiomyocytes offer novel avenues to study the mechanisms underlying cardiac diseases, to identify new causative genes, and to provide insights into the disease aetiology. In recent years, the list of human iPSC-based models for genetic cardiac diseases has been expanding rapidly, although there are still remaining concerns on the level of functionality of iPSC-derived cardiomyocytes and their ability to be used for modeling complex cardiac diseases in adults. This review focuses on the development of cardiomyocyte induction from pluripotent stem cells, the recent progress in heart disease modeling using iPSC-derived cardiomyocytes, and the challenges associated with understanding complex genetic diseases. To address these issues, we examine the similarity between iPSC-derived cardiomyocytes and their ex vivo counterparts and how this relates to the method used to differentiate the pluripotent stem cells into a cardiomyocyte phenotype. We progress to examine categories of congenital cardiac abnormalities that are suitable for iPSC-based disease modeling.

  13. Therapeutic application of cardiac stem cells and other cell types.

    PubMed

    Hayashi, Emiko; Hosoda, Toru

    2013-01-01

    Various researches on regenerative medicine were carried out experimentally, and selected modalities have been introduced to the clinical arena. Meanwhile, the presence of resident stem cells in the heart and their role in physiological cell turnover were demonstrated. So far skeletal myoblasts, bone marrow-derived cells, mesenchymal stromal cells, and resident cardiac cells have been applied for therapeutic myocardial regeneration. Among them, autologous transplantation of c-kit-positive cardiac stem cells in congestive heart failure patients resulted in an outstanding outcome, with long-lasting beneficial effects without major adverse events. By reviewing these clinical trials, an endeavor was made to seek for an ideal cellular therapy for cardiovascular diseases.

  14. Ca2+-Currents in Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes Effects of Two Different Culture Conditions

    PubMed Central

    Uzun, Ahmet U.; Mannhardt, Ingra; Breckwoldt, Kaja; Horváth, András; Johannsen, Silke S.; Hansen, Arne; Eschenhagen, Thomas; Christ, Torsten

    2016-01-01

    Human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CM) provide a unique opportunity to study human heart physiology and pharmacology and repair injured hearts. The suitability of hiPSC-CM critically depends on how closely they share physiological properties of human adult cardiomyocytes (CM). Here we investigated whether a 3D engineered heart tissue (EHT) culture format favors maturation and addressed the L-type Ca2+-current (ICa,L) as a readout. The results were compared with hiPSC-CM cultured in conventional monolayer (ML) and to our previous data from human adult atrial and ventricular CM obtained when identical patch-clamp protocols were used. HiPSC-CM were two- to three-fold smaller than adult CM, independently of culture format [capacitance ML 45 ± 1 pF (n = 289), EHT 45 ± 1 pF (n = 460), atrial CM 87 ± 3 pF (n = 196), ventricular CM 126 ± 8 pF (n = 50)]. Only 88% of ML cells showed ICa, but all EHT. Basal ICa density was 10 ± 1 pA/pF (n = 207) for ML and 12 ± 1 pA/pF (n = 361) for EHT and was larger than in adult CM [7 ± 1 pA/pF (p < 0.05, n = 196) for atrial CM and 6 ± 1 pA/pF (p < 0.05, n = 47) for ventricular CM]. However, ML and EHT showed robust T-type Ca2+-currents (ICa,T). While (−)-Bay K 8644, that activates ICa,L directly, increased ICa,Lto the same extent in ML and EHT, β1- and β2-adrenoceptor effects were marginal in ML, but of same size as (−)-Bay K 8644 in EHT. The opposite was true for serotonin receptors. Sensitivity to β1 and β2-adrenoceptor stimulation was the same in EHT as in adult CM (−logEC50: 5.9 and 6.1 for norepinephrine (NE) and epinephrine (Epi), respectively), but very low concentrations of Rp-8-Br-cAMPS were sufficient to suppress effects (−logEC50: 5.3 and 5.3 respectively for NE and Epi). Taken together, hiPSC-CM express ICa,L at the same density as human adult CM, but, in contrast, possess robust ICa,T. Increased effects of catecholamines in EHT suggest more efficient maturation. PMID:27672365

  15. In Vivo Efficacy of Umbilical Cord Blood Stem Cell-Derived NK Cells in the Treatment of Metastatic Colorectal Cancer.

    PubMed

    Veluchamy, John P; Lopez-Lastra, Silvia; Spanholtz, Jan; Bohme, Fenna; Kok, Nina; Heideman, Daniëlle A M; Verheul, Henk M W; Di Santo, James P; de Gruijl, Tanja D; van der Vliet, Hans J

    2017-01-01

    Therapeutic monoclonal antibodies against the epidermal growth factor receptor (EGFR) act by inhibiting EGFR downstream signaling and by eliciting a natural killer (NK) cell-mediated antitumor response. The IgG1 mAb cetuximab has been used for treatment of RAS(wt) metastatic colorectal cancer (mCRC) patients, showing limited efficacy. In the present study, we address the potential of adoptive NK cell therapy to overcome these limitations investigating two allogeneic NK cell products, i.e., allogeneic activated peripheral blood NK cells (A-PBNK) and umbilical cord blood stem cell-derived NK cells (UCB-NK). While cetuximab monotherapy was not effective against EGFR(-) RAS(wt), EGFR(+) RAS(mut), and EGFR(+) BRAF(mut) cells, A-PBNK were able to initiate lysis of EGFR(+) colon cancer cells irrespective of RAS or BRAF status. Cytotoxic effects of A-PBNK (but not UCB-NK) were further potentiated significantly by coating EGFR(+) colon cancer cells with cetuximab. Of note, a significantly higher cytotoxicity was induced by UCB-NK in EGFR(-)RAS(wt) (42 ± 8 versus 67 ± 7%), EGFR(+) RAS(mut) (20 ± 2 versus 37 ± 6%), and EGFR(+) BRAF(mut) (23 ± 3 versus 43 ± 7%) colon cancer cells compared to A-PBNK and equaled the cytotoxic efficacy of the combination of A-PBNK and cetuximab. The antitumor efficacy of UCB-NK cells against cetuximab-resistant human EGFR(+) RAS(mut) colon cancer cells was further confirmed in an in vivo preclinical mouse model where UCB-NK showed enhanced antitumor cytotoxicity against colon cancer independent of EGFR and RAS status. As UCB-NK have been proven safe in a recently conducted phase I clinical trial in acute myeloid leukemia, a fast translation into clinical proof of concept for mCRC could be considered.

  16. Regulation of alternative macrophage activation in the liver following acetaminophen intoxication by stem cell-derived tyrosine kinase

    SciTech Connect

    Gardner, Carol R.; Hankey, Pamela; Mishin, Vladimir; Francis, Mary; Yu, Shan; Laskin, Jeffrey D.; Laskin, Debra L.

    2012-07-15

    Stem cell-derived tyrosine kinase (STK) is a transmembrane receptor reported to play a role in macrophage switching from a classically activated/proinflammatory phenotype to an alternatively activated/wound repair phenotype. In the present studies, STK{sup −/−} mice were used to assess the role of STK in acetaminophen-induced hepatotoxicity as evidence suggests that the pathogenic process involves both of these macrophage subpopulations. In wild type mice, centrilobular hepatic necrosis and increases in serum transaminase levels were observed within 6 h of acetaminophen administration (300 mg/kg, i.p.). Loss of STK resulted in a significant increase in sensitivity of mice to the hepatotoxic effects of acetaminophen and increased mortality, effects independent of its metabolism. This was associated with reduced levels of hepatic glutathione, rapid upregulation of inducible nitric oxide synthase, and prolonged induction of heme oxygenase-1, suggesting excessive oxidative stress in STK{sup −/−} mice. F4/80, a marker of mature macrophages, was highly expressed on subpopulations of Kupffer cells in livers of wild type, but not STK{sup −/−} mice. Whereas F4/80{sup +} macrophages rapidly declined in the livers of wild type mice following acetaminophen intoxication, they increased in STK{sup −/−} mice. In wild type mice hepatic expression of tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-12, products of classically activated macrophages, increased after acetaminophen administration. Monocyte chemotactic protein-1 (MCP-1) and its receptor, CCR2, as well as IL-10, mediators involved in recruiting and activating anti-inflammatory/wound repair macrophages, also increased in wild type mice after acetaminophen. Loss of STK blunted the effects of acetaminophen on expression of TNFα, IL-1β, IL-12, MCP-1 and CCR2, while expression of IL-10 increased. Hepatic expression of CX3CL1, and its receptor, CX3CR1 also increased in STK{sup −/−} mice

  17. Ca(2+)-Currents in Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes Effects of Two Different Culture Conditions.

    PubMed

    Uzun, Ahmet U; Mannhardt, Ingra; Breckwoldt, Kaja; Horváth, András; Johannsen, Silke S; Hansen, Arne; Eschenhagen, Thomas; Christ, Torsten

    2016-01-01

    Human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CM) provide a unique opportunity to study human heart physiology and pharmacology and repair injured hearts. The suitability of hiPSC-CM critically depends on how closely they share physiological properties of human adult cardiomyocytes (CM). Here we investigated whether a 3D engineered heart tissue (EHT) culture format favors maturation and addressed the L-type Ca(2+)-current (ICa,L) as a readout. The results were compared with hiPSC-CM cultured in conventional monolayer (ML) and to our previous data from human adult atrial and ventricular CM obtained when identical patch-clamp protocols were used. HiPSC-CM were two- to three-fold smaller than adult CM, independently of culture format [capacitance ML 45 ± 1 pF (n = 289), EHT 45 ± 1 pF (n = 460), atrial CM 87 ± 3 pF (n = 196), ventricular CM 126 ± 8 pF (n = 50)]. Only 88% of ML cells showed ICa, but all EHT. Basal ICa density was 10 ± 1 pA/pF (n = 207) for ML and 12 ± 1 pA/pF (n = 361) for EHT and was larger than in adult CM [7 ± 1 pA/pF (p < 0.05, n = 196) for atrial CM and 6 ± 1 pA/pF (p < 0.05, n = 47) for ventricular CM]. However, ML and EHT showed robust T-type Ca(2+)-currents (ICa,T). While (-)-Bay K 8644, that activates ICa,L directly, increased ICa,Lto the same extent in ML and EHT, β1- and β2-adrenoceptor effects were marginal in ML, but of same size as (-)-Bay K 8644 in EHT. The opposite was true for serotonin receptors. Sensitivity to β1 and β2-adrenoceptor stimulation was the same in EHT as in adult CM (-logEC50: 5.9 and 6.1 for norepinephrine (NE) and epinephrine (Epi), respectively), but very low concentrations of Rp-8-Br-cAMPS were sufficient to suppress effects (-logEC50: 5.3 and 5.3 respectively for NE and Epi). Taken together, hiPSC-CM express ICa,L at the same density as human adult CM, but, in contrast, possess robust ICa,T. Increased effects of catecholamines in EHT suggest more efficient maturation.

  18. Mesenchymal Stem Cells and Inflammatory Cardiomyopathy: Cardiac Homing and Beyond

    PubMed Central

    Van Linthout, S.; Stamm, Ch.; Schultheiss, H.-P.; Tschöpe, C.

    2011-01-01

    Under conventional heart failure therapy, inflammatory cardiomyopathy usually has a progressive course, merging for alternative interventional strategies. There is accumulating support for the application of cellular transplantation as a strategy to improve myocardial function. Mesenchymal stem cells (MSCs) have the advantage over other stem cells that they possess immunomodulatory features, making them attractive candidates for the treatment of inflammatory cardiomyopathy. Studies in experimental models of inflammatory cardiomyopathy have consistently demonstrated the potential of MSCs to reduce cardiac injury and to improve cardiac function. This paper gives an overview about how inflammation triggers the functionality of MSCs and how it induces cardiac homing. Finally, the potential of intravenous application of MSCs by inflammatory cardiomyopathy is discussed. PMID:21403844

  19. Transplantation of Photoreceptor Precursors Isolated via a Cell Surface Biomarker Panel From Embryonic Stem Cell-Derived Self-Forming Retina.

    PubMed

    Lakowski, Jorn; Gonzalez-Cordero, Anai; West, Emma L; Han, Ya-Ting; Welby, Emily; Naeem, Arifa; Blackford, Samuel J I; Bainbridge, James W B; Pearson, Rachael A; Ali, Robin R; Sowden, Jane C

    2015-08-01

    Loss of photoreceptors due to retinal degeneration is a major cause of untreatable blindness. Cell replacement therapy, using pluripotent stem cell-derived photoreceptor cells, may be a feasible future treatment. Achieving safe and effective cell replacement is critically dependent on the stringent selection and purification of optimal cells for transplantation. Previously, we demonstrated effective transplantation of post-mitotic photoreceptor precursor cells labelled by fluorescent reporter genes. As genetically labelled cells are not desirable for therapy, here we developed a surface biomarker cell selection strategy for application to complex pluripotent stem cell differentiation cultures. We show that a five cell surface biomarker panel CD73(+)CD24(+)CD133(+)CD47(+)CD15(-) facilitates the isolation of photoreceptor precursors from three-dimensional self-forming retina differentiated from mouse embryonic stem cells. Importantly, stem cell-derived cells isolated using the biomarker panel successfully integrate and mature into new rod photoreceptors in the adult mouse retinae after subretinal transplantation. Conversely, unsorted or negatively selected cells do not give rise to newly integrated rods after transplantation. The biomarker panel also removes detrimental proliferating cells prior to transplantation. Notably, we demonstrate how expression of the biomarker panel is conserved in the human retina and propose that a similar selection strategy will facilitate isolation of human transplantation-competent cells for therapeutic application.

  20. Improving and accelerating the differentiation and functional maturation of human stem cell-derived neurons: role of extracellular calcium and GABA.

    PubMed

    Kemp, Paul J; Rushton, David J; Yarova, Polina L; Schnell, Christian; Geater, Charlene; Hancock, Jane M; Wieland, Annalena; Hughes, Alis; Badder, Luned; Cope, Emma; Riccardi, Daniela; Randall, Andrew D; Brown, Jonathan T; Allen, Nicholas D; Telezhkin, Vsevolod

    2016-11-15

    Neurons differentiated from pluripotent stem cells using established neural culture conditions often exhibit functional deficits. Recently, we have developed enhanced media which both synchronize the neurogenesis of pluripotent stem cell-derived neural progenitors and accelerate their functional maturation; together these media are termed SynaptoJuice. This pair of media are pro-synaptogenic and generate authentic, mature synaptic networks of connected forebrain neurons from a variety of induced pluripotent and embryonic stem cell lines. Such enhanced rate and extent of synchronized maturation of pluripotent stem cell-derived neural progenitor cells generates neurons which are characterized by a relatively hyperpolarized resting membrane potential, higher spontaneous and induced action potential activity, enhanced synaptic activity, more complete development of a mature inhibitory GABAA receptor phenotype and faster production of electrical network activity when compared to standard differentiation media. This entire process - from pre-patterned neural progenitor to active neuron - takes 3 weeks or less, making it an ideal platform for drug discovery and disease modelling in the fields of human neurodegenerative and neuropsychiatric disorders, such as Huntington's disease, Parkinson's disease, Alzheimer's disease and Schizophrenia.

  1. Cardiac stem cell research: an elephant in the room?

    PubMed

    Di Felice, Valentina; De Luca, Angela; Colorito, Maria Luisa; Montalbano, Antonella; Ardizzone, Nella Maria; Macaluso, Filippo; Gammazza, Antonella Marino; Cappello, Francesco; Zummo, Giovanni

    2009-03-01

    Heart disease is the leading cause of death in the industrialized world, and stem cell therapy seems to be a promising treatment for injured cardiac tissue. To reach this goal, the scientific community needs to find a good source of stem cells that can be used to obtain new myocardium in a very period range of time. Since there are many ethical and technical problems with using embryonic stem cells as a source of cells with cardiogenic potential, many laboratories have attempted to isolate potential cardiac stem cells from several tissues. The best candidates seem to be cardiac "progenitor" and/or "stem" cells, which can be isolated from subendocardial biopsies from the same patient or from embryonic and/or fetal myocardium. Regardless of the technique used to isolate and characterize these cells, it appears that the different cells isolated from adult myocardium to date are all phenotypic variations of a unique cell type that expresses several markers, such as c-Kit, CD34, MDR-1, Sca-1, CD45, nestin, or Isl-1, in various combinations.

  2. Efficient Generation of β-Globin-Expressing Erythroid Cells Using Stromal Cell-Derived Induced Pluripotent Stem Cells from Patients with Sickle Cell Disease.

    PubMed

    Uchida, Naoya; Haro-Mora, Juan J; Fujita, Atsushi; Lee, Duck-Yeon; Winkler, Thomas; Hsieh, Matthew M; Tisdale, John F

    2017-03-01

    Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells represent an ideal source for in vitro modeling of erythropoiesis and a potential alternative source for red blood cell transfusions. However, iPS cell-derived erythroid cells predominantly produce ε- and γ-globin without β-globin production. We recently demonstrated that ES cell-derived sacs (ES sacs), known to express hemangioblast markers, allow for efficient erythroid cell generation with β-globin production. In this study, we generated several iPS cell lines derived from bone marrow stromal cells (MSCs) and peripheral blood erythroid progenitors (EPs) from sickle cell disease patients, and evaluated hematopoietic stem/progenitor cell (HSPC) generation after iPS sac induction as well as subsequent erythroid differentiation. MSC-derived iPS sacs yielded greater amounts of immature hematopoietic progenitors (VEGFR2 + GPA-), definitive HSPCs (CD34 + CD45+), and megakaryoerythroid progenitors (GPA + CD41a+), as compared to EP-derived iPS sacs. Erythroid differentiation from MSC-derived iPS sacs resulted in greater amounts of erythroid cells (GPA+) and higher β-globin (and βS-globin) expression, comparable to ES sac-derived cells. These data demonstrate that human MSC-derived iPS sacs allow for more efficient erythroid cell generation with higher β-globin production, likely due to heightened emergence of immature progenitors. Our findings should be important for iPS cell-derived erythroid cell generation. Stem Cells 2017;35:586-596.

  3. Activin A Modulates CRIPTO-1/HNF4α+ Cells to Guide Cardiac Differentiation from Human Embryonic Stem Cells

    PubMed Central

    Duelen, Robin; Gilbert, Guillaume; Patel, Abdulsamie; de Schaetzen, Nathalie; De Waele, Liesbeth; Roderick, Llewelyn; Sipido, Karin R.; Verfaillie, Catherine M.; Buyse, Gunnar M.

    2017-01-01

    The use of human pluripotent stem cells in basic and translational cardiac research requires efficient differentiation protocols towards cardiomyocytes. In vitro differentiation yields heterogeneous populations of ventricular-, atrial-, and nodal-like cells hindering their potential applications in regenerative therapies. We described the effect of the growth factor Activin A during early human embryonic stem cell fate determination in cardiac differentiation. Addition of high levels of Activin A during embryoid body cardiac differentiation augmented the generation of endoderm derivatives, which in turn promoted cardiomyocyte differentiation. Moreover, a dose-dependent increase in the coreceptor expression of the TGF-β superfamily member CRIPTO-1 was observed in response to Activin A. We hypothesized that interactions between cells derived from meso- and endodermal lineages in embryoid bodies contributed to improved cell maturation in early stages of cardiac differentiation, improving the beating frequency and the percentage of contracting embryoid bodies. Activin A did not seem to affect the properties of cardiomyocytes at later stages of differentiation, measuring action potentials, and intracellular Ca2+ dynamics. These findings are relevant for improving our understanding on human heart development, and the proposed protocol could be further explored to obtain cardiomyocytes with functional phenotypes, similar to those observed in adult cardiac myocytes. PMID:28163723

  4. Amniotic fluid stem cells morph into a cardiovascular lineage: analysis of a chemically induced cardiac and vascular commitment.

    PubMed

    Maioli, Margherita; Contini, Giovanni; Santaniello, Sara; Bandiera, Pasquale; Pigliaru, Gianfranco; Sanna, Raimonda; Rinaldi, Salvatore; Delitala, Alessandro P; Montella, Andrea; Bagella, Luigi; Ventura, Carlo

    2013-01-01

    Mouse embryonic stem cells were previously observed along with mesenchymal stem cells from different sources, after being treated with a mixed ester of hyaluronan with butyric and retinoic acids, to show a significant increase in the yield of cardiogenic and vascular differentiated elements. The aim of the present study was to determine if stem cells derived from primitive fetal cells present in human amniotic fluid (hAFSCs) and cultured in the presence of a mixture of hyaluronic (HA), butyric (BU), and retinoic (RA) acids show a higher yield of differentiation toward the cardiovascular phenotype as compared with untreated cells. During the differentiation process elicited by exposure to HA + BU + RA, genes controlling pluripotency and plasticity of stem cells, such as Sox2, Nanog, and Oct4, were significantly downregulated at the transcriptional level. At this point, a significant increase in expression of genes controlling the appearance of cardiogenic and vascular lineages in HA + BU + RA-treated cells was observed. The protein expression levels typical of cardiac and vascular phenotypes, evaluated by Western blotting, immunofluorescence, and flow cytometry, were higher in hAFSCs cultured in the presence of HA + BU + RA, as compared with untreated control cells. Appearance of the cardiac phenotype was further inferred by ultrastructural analysis using transmission and scanning electron microscopy. These results demonstrate that a mixture of HA + BU + RA significantly increased the yield of elements committed toward cardiac and vascular phenotypes, confirming what we have previously observed in other cellular types.

  5. Neural stem cell-like cells derived from autologous bone mesenchymal stem cells for the treatment of patients with cerebral palsy

    PubMed Central

    2013-01-01

    Background Stem cell therapy is a promising treatment for cerebral palsy, which refers to a category of brain diseases that are associated with chronic motor disability in children. Autologous MSCs may be a better cell source and have been studied for the treatment of cerebral palsy because of their functions in tissue repair and the regulation of immunological processes. Methods To assess neural stem cell–like (NSC-like) cells derived from autologous marrow mesenchymal stem cells as a novel treatment for patients with moderate-to-severe cerebral palsy, a total of 60 cerebral palsy patients were enrolled in this open-label, non-randomised, observer-blinded controlled clinical study with a 6-months follow-up. For the transplantation group, a total of 30 cerebral palsy patients received an autologous NSC-like cells transplantation (1-2 × 107 cells into the subarachnoid cavity) and rehabilitation treatments whereas 30 patients in the control group only received rehabilitation treatment. Results We recorded the gross motor function measurement scores, language quotients, and adverse events up to 6 months post-treatment. The gross motor function measurement scores in the transplantation group were significantly higher at month 3 (the score increase was 42.6, 95% CI: 9.8–75.3, P=.011) and month 6 (the score increase was 58.6, 95% CI: 25.8–91.4, P=.001) post-treatment compared with the baseline scores. The increase in the Gross Motor Function Measurement scores in the control group was not significant. The increases in the language quotients at months 1, 3, and 6 post-treatment were not statistically significant when compared with the baseline quotients in both groups. All the 60 patients survived, and none of the patients experienced serious adverse events or complications. Conclusion Our results indicated that NSC-like cells are safe and effective for the treatment of motor deficits related to cerebral palsy. Further randomised clinical trials are necessary to

  6. Perspectives on stem cell therapy for cardiac regeneration. Advances and challenges.

    PubMed

    Choi, Sung Hyun; Jung, Seok Yun; Kwon, Sang-Mo; Baek, Sang Hong

    2012-01-01

    Ischemic heart disease (IHD) accelerates cardiomyocyte loss, but the developing stem cell research could be useful for regenerating a variety of tissue cells, including cardiomyocytes. Diverse sources of stem cells for IHD have been reported, including embryonic stem cells, induced pluripotent stem cells, skeletal myoblasts, bone marrow-derived stem cells, mesenchymal stem cells, and cardiac stem cells. However, stem cells have unique advantages and disadvantages for cardiac tissue regeneration, which are important considerations in determining the specific cells for improving cell survival and long-term engraftment after transplantation. Additionally, the dosage and administration method of stem cells need to be standardized to increase stability and efficacy for clinical applications. Accordingly, this review presents a summary of the stem cell therapies that have been studied for cardiac regeneration thus far, and discusses the direction of future cardiac regeneration research for stem cells.

  7. Kidney specific protein-positive cells derived from embryonic stem cells reproduce tubular structures in vitro and differentiate into renal tubular cells.

    PubMed

    Morizane, Ryuji; Monkawa, Toshiaki; Fujii, Shizuka; Yamaguchi, Shintaro; Homma, Koichiro; Matsuzaki, Yumi; Okano, Hideyuki; Itoh, Hiroshi

    2014-01-01

    Embryonic stem cells and induced pluripotent stem cells have the ability to differentiate into various organs and tissues, and are regarded as new tools for the elucidation of disease mechanisms as well as sources for regenerative therapies. However, a method of inducing organ-specific cells from pluripotent stem cells is urgently needed. Although many scientists have been developing methods to induce various organ-specific cells from pluripotent stem cells, renal lineage cells have yet to be induced in vitro because of the complexity of kidney structures and the diversity of kidney-component cells. Here, we describe a method of inducing renal tubular cells from mouse embryonic stem cells via the cell purification of kidney specific protein (KSP)-positive cells using an anti-KSP antibody. The global gene expression profiles of KSP-positive cells derived from ES cells exhibited characteristics similar to those of cells in the developing kidney, and KSP-positive cells had the capacity to form tubular structures resembling renal tubular cells when grown in a 3D culture in Matrigel. Moreover, our results indicated that KSP-positive cells acquired the characteristics of each segment of renal tubular cells through tubular formation when stimulated with Wnt4. This method is an important step toward kidney disease research using pluripotent stem cells, and the development of kidney regeneration therapies.

  8. Serum- and stromal cell-free hypoxic generation of embryonic stem cell-derived hematopoietic cells in vitro, capable of multilineage repopulation of immunocompetent mice.

    PubMed

    Lesinski, Dietrich Armin; Heinz, Niels; Pilat-Carotta, Sandra; Rudolph, Cornelia; Jacobs, Roland; Schlegelberger, Brigitte; Klump, Hannes; Schiedlmeier, Bernhard

    2012-08-01

    Induced pluripotent stem cells (iPSCs) may become a promising source for the generation of patient-specific hematopoietic stem cells (HSCs) in vitro. A crucial prerequisite will be the availability of reliable protocols for the directed and efficient differentiation toward HSCs. So far, the most robust strategy for generating HSCs from pluripotent cells in vitro has been established in the mouse model involving ectopic expression of the human transcription factor HOXB4. However, most differentiation protocols include coculture on a xenogenic stroma cell line and the use of animal serum. Involvement of any of both would pose a major barrier to the translation of those protocols to human autologous iPSCs intended for clinical use. Therefore, we asked whether long-term repopulating HSCs can, in principle, be generated from embryonic stem cells without stroma cells or serum. Here, we showed that long-term multilineage engraftment could be accomplished in immunocompetent mice when HSCs were generated in serum-free medium without stroma cell support and when hypoxic conditions were used. Under those conditions, HOXB4(+) embryonic stem cell-derived hematopoietic stem and progenitor cells were immunophenotypically similar to definitive bone marrow resident E-SLAM(+) (CD150(+)CD48(-)CD45(+)CD201(+)) HSCs. Thus, our findings may ease the development of definitive, adult-type HSCs from pluripotent stem cells, entirely in vitro.

  9. Harnessing the secretome of cardiac stem cells as therapy for ischemic heart disease.

    PubMed

    Khanabdali, Ramin; Rosdah, Ayeshah A; Dusting, Gregory J; Lim, Shiang Y

    2016-08-01

    Adult stem cells continue to promise opportunities to repair damaged cardiac tissue. However, precisely how adult stem cells accomplish cardiac repair, especially after ischemic damage, remains controversial. It has been postulated that the clinical benefit of adult stem cells for cardiovascular disease results from the release of cytokines and growth factors by the transplanted cells. Studies in animal models of myocardial infarction have reported that such paracrine factors released from transplanted adult stem cells contribute to improved cardiac function by several processes. These include promoting neovascularization of damaged tissue, reducing inflammation, reducing fibrosis and scar formation, as well as protecting cardiomyocytes from apoptosis. In addition, these factors might also stimulate endogenous repair by activating cardiac stem cells. Interestingly, stem cells discovered to be resident in the heart appear to be functionally superior to extra-cardiac adult stem cells when transplanted for cardiac repair and regeneration. In this review, we discuss the therapeutic potential of cardiac stem cells and how the proteins secreted from these cells might be harnessed to promote repair and regeneration of damaged cardiac tissue. We also highlight how recent controversies about the efficacy of adult stem cells in clinical trials of ischemic heart disease have not dampened enthusiasm for the application of cardiac stem cells and their paracrine factors for cardiac repair: the latter have proved superior to the mesenchymal stem cells used in most clinical trials in the past, some of which appear to have been conducted with sub-optimal rigor.

  10. Quantitative analysis of serotonin secreted by human embryonic stem cells-derived serotonergic neurons via pH-mediated online stacking-CE-ESI-MRM.

    PubMed

    Zhong, Xuefei; Hao, Ling; Lu, Jianfeng; Ye, Hui; Zhang, Su-Chun; Li, Lingjun

    2016-04-01

    A CE-ESI-MRM-based assay was developed for targeted analysis of serotonin released by human embryonic stem cells-derived serotonergic neurons in a chemically defined environment. A discontinuous electrolyte system was optimized for pH-mediated online stacking of serotonin. Combining with a liquid-liquid extraction procedure, LOD of serotonin in the Krebs'-Ringer's solution by CE-ESI-MS/MS on a 3D ion trap MS was0.15 ng/mL. The quantitative results confirmed the serotonergic identity of the in vitro developed neurons and the capacity of these neurons to release serotonin in response to stimulus.

  11. Stem cells derived from human first-trimester umbilical cord have the potential to differentiate into oocyte-like cells in vitro.

    PubMed

    Hu, Xiang; Lu, Hua; Cao, Sheng; Deng, Yan-Li; Li, Qi-Jia; Wan, Qian; Yie, Shang-Mian

    2015-05-01

    Compared to stem cells derived from human term umbilical cord, stem cells derived from human first-trimester umbilical cord (hFTUC) exhibit a significantly greater proliferative potential, and more efficiency in terms of their in vitro differentiation. In the present study, we investigated whether hFTUC-derived stem cells are able to differentiate into germ cells. The hFTUC-derived stem cells were first isolated, expanded and then cultured in differentiation medium containing human follicular fluid, follicle-stimulating hormone (FSH)/luteinizing hormone (LH) and estradiol for 24 days. During the period of induction, a subpopulation of the cultured cells appeared that had a morphological resemblance to primordial germ cells (PGCs) and cumulus-oocyte complex (COC)-like cells, and oocyte-like cells (OLCs). The PGC-like cells expressed specific markers indicative of germ cell formation such as octamer-binding transcription factor 4 (OCT4), stage-specific embryonic antigen 1 (SSEA1), B lymphocyte-induced maturation protein-1 (Blimp1), PR domain containing 14 (Prdm14), transcription factor AP-2 gamma (Tfap2C), VASA, STELLA, deleted in azoospermia-like (DAZL) and interferon-induced transmembrane protein 3 (IFITM3). The OLCs, which contained a single germinal vesicle, expressed oocyte-specific markers, such as synaptonemal complex protein 3 (SCP3), growth/differentiation factor-9 (GDF9), GDF9B and zona pellucida (ZP)1, ZP2 and ZP3. The COC-like cells secreted estradiol, vascular endothelial growth factor and leukemia inhibitory factor. Thus, our findings suggest that hFTUC-derived stem cells have an intrinsic ability to differentiate into OLCs, which may provide an in vitro model for the identification of factors involved in germ cell formation and differentiation.

  12. Exosomes Secreted from Human-Induced Pluripotent Stem Cell-Derived Mesenchymal Stem Cells Prevent Osteonecrosis of the Femoral Head by Promoting Angiogenesis

    PubMed Central

    Liu, Xiaolin; Li, Qing; Niu, Xin; Hu, Bin; Chen, Shengbao; Song, Wenqi; Ding, Jian; Zhang, Changqing; Wang, Yang

    2017-01-01

    Background: Local ischemia is the main pathological performance in osteonecrosis of the femoral head (ONFH). There is currently no effective therapy to promote angiogenesis in the femoral head. Recent studies revealed that exosomes secreted by induced pluripotent stem cell-derived mesenchymal stem cells (iPS-MSC-Exos) have great therapeutic potential in ischemic tissues, but whether they could promote angiogenesis in ONFH has not been reported, and little is known regarding the underlying mechanism. Methods: iPS-MSC-Exos were intravenously injected to a steroid-induced rat osteonecrosis model. Samples of the femoral head were obtained 3 weeks after all the injections. The effects were assessed by measuring local angiogenesis and bone loss through histological and immunohistochemical (IHC) staining, micro-CT and three-dimensional microangiography. The effects of exosomes on endothelial cells were studied through evaluations of proliferation, migration and tube-forming analyses. The expression levels of angiogenic related PI3K/Akt signaling pathway of endothelial cells were evaluated following stimulation of iPS-MSC-Exos. The promoting effects of exosomes were re-evaluated following blockade of PI3K/Akt. Results: The in vivo study revealed that administration of iPS-MSC-Exos significantly prevented bone loss, and increased microvessel density in the femoral head compared with control group. We found that iPS-MSC-Exos significantly enhanced the proliferation, migration and tube-forming capacities of endothelial cells in vitro. iPS-MSC-Exos could activate PI3K/Akt signaling pathway in endothelial cells. Moreover, the promoting effects of iPS-MSC-Exos were abolished after blockade of PI3K/Akt on endothelial cells. Conclusions: Our findings suggest that transplantation of iPS-MSC-Exos exerts a preventative effect on ONFH by promoting local angiogenesis and preventing bone loss. The promoting effect might be attributed to activation of the PI3K/Akt signaling pathway on

  13. Improving Cell Engraftment in Cardiac Stem Cell Therapy

    PubMed Central

    Xie, Xiaoyun

    2016-01-01

    Myocardial infarction (MI) affects millions of people worldwide. MI causes massive cardiac cell death and heart function decrease. However, heart tissue cannot effectively regenerate by itself. While stem cell therapy has been considered an effective approach for regeneration, the efficacy of cardiac stem cell therapy remains low due to inferior cell engraftment in the infarcted region. This is mainly a result of low cell retention in the tissue and poor cell survival under ischemic, immune rejection and inflammatory conditions. Various approaches have been explored to improve cell engraftment: increase of cell retention using biomaterials as cell carriers; augmentation of cell survival under ischemic conditions by preconditioning cells, genetic modification of cells, and controlled release of growth factors and oxygen; and enhancement of cell survival by protecting cells from excessive inflammation and immune surveillance. In this paper, we review current progress, advantages, disadvantages, and potential solutions of these approaches. PMID:26783405

  14. Early cardiac development: a view from stem cells to embryos

    PubMed Central

    Van Vliet, Patrick; Wu, Sean M.; Zaffran, Stéphane; Pucéat, Michel

    2012-01-01

    From the 1920s, early cardiac development has been studied in chick and, later, in mouse embryos in order to understand the first cell fate decisions that drive specification and determination of the endocardium, myocardium, and epicardium. More recently, mouse and human embryonic stem cells (ESCs) have demonstrated faithful recapitulation of early cardiogenesis and have contributed significantly to this research over the past few decades. Derived almost 15 years ago, human ESCs have provided a unique developmental model for understanding the genetic and epigenetic regulation of early human cardiogenesis. Here, we review the biological concepts underlying cell fate decisions during early cardiogenesis in model organisms and ESCs. We draw upon both pioneering and recent studies and highlight the continued role for in vitro stem cells in cardiac developmental biology. PMID:22893679

  15. Therapeutic application of mesenchymal stem cell-derived exosomes: A promising cell-free therapeutic strategy in regenerative medicine.

    PubMed

    Motavaf, M; Pakravan, K; Babashah, S; Malekvandfard, F; Masoumi, M; Sadeghizadeh, M

    2016-06-30

    Mesenchymal stem cells have emerged as promising therapeutic candidates in regenerative medicine. The mechanisms underlying mesenchymal stem cells regenerative properties were initially attributed to their engraftment in injured tissues and their subsequent transdifferentiation to repair and replace damaged cells. However, studies in animal models and patients indicated that the low number of transplanted mesenchymal stem cells localize to the target tissue and transdifferentiate to appropriate cell lineage. Instead the regenerative potential of mesenchymal stem cells has been found - at least in part - to be mediated via their paracrine actions. Recently, a secreted group of vesicles, called "exosome" has been identified as major mediator of mesenchymal stem cells therapeutic efficacy. In this review, we will summarize the current literature on administration of exosomes released by mesenchymal stem cells in regenerative medicine and suggest how they could help to improve tissue regeneration following injury.

  16. The Role of MicroRNAs in Cardiac Stem Cells

    PubMed Central

    Purvis, Nima; Bahn, Andrew; Katare, Rajesh

    2015-01-01

    Stem cells are considered as the next generation drug treatment in patients with cardiovascular disease who are resistant to conventional treatment. Among several stem cells used in the clinical setting, cardiac stem cells (CSCs) which reside in the myocardium and epicardium of the heart have been shown to be an effective option for the source of stem cells. In normal circumstances, CSCs primarily function as a cell store to replace the physiologically depleted cardiovascular cells, while under the diseased condition they have been shown to experimentally regenerate the diseased myocardium. In spite of their major functional role, molecular mechanisms regulating the CSCs proliferation and differentiation are still unknown. MicroRNAs (miRs) are small, noncoding RNA molecules that regulate gene expression at the posttranscriptional level. Recent studies have demonstrated the important role of miRs in regulating stem cell proliferation and differentiation, as well as other physiological and pathological processes related to stem cell function. This review summarises the current understanding of the role of miRs in CSCs. A deeper understanding of the mechanisms by which miRs regulate CSCs may lead to advances in the mode of stem cell therapies for the treatment of cardiovascular diseases. PMID:25802528

  17. Spliced stromal cell-derived factor-1α analog stimulates endothelial progenitor cell migration and improves cardiac function in a dose-dependent manner after myocardial infarction

    PubMed Central

    Hiesinger, William; Frederick, John R.; Atluri, Pavan; McCormick, Ryan C.; Marotta, Nicole; Muenzer, Jeffrey R.; Woo, Y. Joseph

    2011-01-01

    Objectives Stromal cell-derived factor (SDF)-1α is a potent endogenous endothelial progenitor cell (EPC) chemokine and key angiogenic precursor. Recombinant SDF-1α has been demonstrated to improve neovasculogenesis and cardiac function after myocardial infarction (MI) but SDF-1α is a bulky protein with a short half-life. Small peptide analogs might provide translational advantages, including ease of synthesis, low manufacturing costs, and the potential to control delivery within tissues using engineered biomaterials. We hypothesized that a minimized peptide analog of SDF-1α, designed by splicing the N-terminus (activation and binding) and C-terminus (extracellular stabilization) with a truncated amino acid linker, would induce EPC migration and preserve ventricular function after MI. Methods EPC migration was first determined in vitro using a Boyden chamber assay. For in vivo analysis, male rats (n=48) underwent left anterior descending coronary artery ligation. At infarction, the rats were randomized into 4 groups and received peri-infarct intramyocardial injections of saline, 3 μg/kg of SDF-1α, 3 μg/kg of spliced SDF analog, or 6 μg/kg spliced SDF analog. After 4 weeks, the rats underwent closed chest pressure volume conductance catheter analysis. Results EPCs showed significantly increased migration when placed in both a recombinant SDF-1α and spliced SDF analog gradient. The rats treated with spliced SDF analog at MI demonstrated a significant dose-dependent improvement in end-diastolic pressure, stroke volume, ejection fraction, cardiac output, and stroke work compared with the control rats. Conclusions A spliced peptide analog of SDF-1α containing both the N- and C- termini of the native protein induced EPC migration, improved ventricular function after acute MI, and provided translational advantages compared with recombinant human SDF-1α. PMID:20951261

  18. Defining the optimal window for cranial transplantation of human induced pluripotent stem cell-derived cells to ameliorate radiation-induced cognitive impairment.

    PubMed

    Acharya, Munjal M; Martirosian, Vahan; Christie, Lori-Ann; Riparip, Lara; Strnadel, Jan; Parihar, Vipan K; Limoli, Charles L

    2015-01-01

    Past preclinical studies have demonstrated the capability of using human stem cell transplantation in the irradiated brain to ameliorate radiation-induced cognitive dysfunction. Intrahippocampal transplantation of human embryonic stem cells and human neural stem cells (hNSCs) was found to functionally restore cognition in rats 1 and 4 months after cranial irradiation. To optimize the potential therapeutic benefits of human stem cell transplantation, we have further defined optimal transplantation windows for maximizing cognitive benefits after irradiation and used induced pluripotent stem cell-derived hNSCs (iPSC-hNSCs) that may eventually help minimize graft rejection in the host brain. For these studies, animals given an acute head-only dose of 10 Gy were grafted with iPSC-hNSCs at 2 days, 2 weeks, or 4 weeks following irradiation. Animals receiving stem cell grafts showed improved hippocampal spatial memory and contextual fear-conditioning performance compared with irradiated sham-surgery controls when analyzed 1 month after transplantation surgery. Importantly, superior performance was evident when stem cell grafting was delayed by 4 weeks following irradiation compared with animals grafted at earlier times. Analysis of the 4-week cohort showed that the surviving grafted cells migrated throughout the CA1 and CA3 subfields of the host hippocampus and differentiated into neuronal (∼39%) and astroglial (∼14%) subtypes. Furthermore, radiation-induced inflammation was significantly attenuated across multiple hippocampal subfields in animals receiving iPSC-hNSCs at 4 weeks after irradiation. These studies expand our prior findings to demonstrate that protracted stem cell grafting provides improved cognitive benefits following irradiation that are associated with reduced neuroinflammation.

  19. Controlled Release of Collagen-Binding SDF-1α Improves Cardiac Function after Myocardial Infarction by Recruiting Endogenous Stem Cells

    PubMed Central

    Sun, Jie; Zhao, Yannan; Li, Qingguo; Chen, Bing; Hou, Xianglin; Xiao, Zhifeng; Dai, Jianwu

    2016-01-01

    Stromal cell-derived factor-1α (SDF-1α) is a well-characterized chemokine that mobilizes stem cells homing to the ischemic heart, which is beneficial for cardiac regeneration. However, clinically administered native SDF-1α diffuses quickly, thus decreasing its local concentration, and results in side effects. Thus, a controlled release system for SDF-1α is required to produce an effective local concentration in the ischemic heart. In this study, we developed a recombinant chemokine, consisting of SDF-1α and a collagen-binding domain, which retains both the SDF-1α and collagen-binding activity (CBD-SDF-1α). In an in vitro assay, CBD-SDF-1α could specifically bind to a collagen gel and achieve sustained release. An intramyocardial injection of CBD-SDF-1α after acute myocardial infarction demonstrated that the protein was largely tethered in the ischemic area and that controlled release had been achieved. Furthermore, CBD-SDF-1α enhanced the recruitment of c-kit positive (c-kit+) stem cells, increased capillary density and improved cardiac function, whereas NAT-SDF-1α had no such beneficial effects. Our findings demonstrate that CBD-SDF-1α can specifically bind to collagen and achieve controlled release both in vitro and in vivo. Local delivery of this protein could mobilize endogenous stem cells homing to the ischemic heart and improve cardiac function after myocardial infarction. PMID:27226084

  20. Controlled Release of Collagen-Binding SDF-1α Improves Cardiac Function after Myocardial Infarction by Recruiting Endogenous Stem Cells.

    PubMed

    Sun, Jie; Zhao, Yannan; Li, Qingguo; Chen, Bing; Hou, Xianglin; Xiao, Zhifeng; Dai, Jianwu

    2016-05-26

    Stromal cell-derived factor-1α (SDF-1α) is a well-characterized chemokine that mobilizes stem cells homing to the ischemic heart, which is beneficial for cardiac regeneration. However, clinically administered native SDF-1α diffuses quickly, thus decreasing its local concentration, and results in side effects. Thus, a controlled release system for SDF-1α is required to produce an effective local concentration in the ischemic heart. In this study, we developed a recombinant chemokine, consisting of SDF-1α and a collagen-binding domain, which retains both the SDF-1α and collagen-binding activity (CBD-SDF-1α). In an in vitro assay, CBD-SDF-1α could specifically bind to a collagen gel and achieve sustained release. An intramyocardial injection of CBD-SDF-1α after acute myocardial infarction demonstrated that the protein was largely tethered in the ischemic area and that controlled release had been achieved. Furthermore, CBD-SDF-1α enhanced the recruitment of c-kit positive (c-kit(+)) stem cells, increased capillary density and improved cardiac function, whereas NAT-SDF-1α had no such beneficial effects. Our findings demonstrate that CBD-SDF-1α can specifically bind to collagen and achieve controlled release both in vitro and in vivo. Local delivery of this protein could mobilize endogenous stem cells homing to the ischemic heart and improve cardiac function after myocardial infarction.

  1. A Multiplex High-Throughput Gene Expression Assay to Simultaneously Detect Disease and Functional Markers in Induced Pluripotent Stem Cell-Derived Retinal Pigment Epithelium

    PubMed Central

    Ferrer, Marc; Corneo, Barbara; Davis, Janine; Wan, Qin; Miyagishima, Kiyoharu Joshua; King, Rebecca; Maminishkis, Arvydas; Marugan, Juan; Sharma, Ruchi; Shure, Michael; Temple, Sally; Miller, Sheldon

    2014-01-01

    There is continuing interest in the development of lineage-specific cells from induced pluripotent stem (iPS) cells for use in cell therapies and drug discovery. Although in most cases differentiated cells show features of the desired lineage, they retain fetal gene expression and do not fully mature into “adult-like” cells. Such cells may not serve as an effective therapy because, once implanted, immature cells pose the risk of uncontrolled growth. Therefore, there is a need to optimize lineage-specific stem cell differentiation protocols to produce cells that no longer express fetal genes and have attained “adult-like” phenotypes. Toward that goal, it is critical to develop assays that simultaneously measure cell function and disease markers in high-throughput format. Here, we use a multiplex high-throughput gene expression assay that simultaneously detects endogenous expression of multiple developmental, functional, and disease markers in iPS cell-derived retinal pigment epithelium (RPE). We optimized protocols to differentiate iPS cell-derived RPE that was then grown in 96- and 384-well plates. As a proof of principle, we demonstrate differential expression of eight genes in iPS cells, iPS cell-derived RPE at two different differentiation stages, and primary human RPE using this multiplex assay. The data obtained from the multiplex gene expression assay are significantly correlated with standard quantitative reverse transcription-polymerase chain reaction-based measurements, confirming the ability of this high-throughput assay to measure relevant gene expression changes. This assay provides the basis to screen for compounds that improve RPE function and maturation and target disease pathways, thus providing the basis for effective treatments of several retinal degenerative diseases. PMID:24873859

  2. Mutant SOD1 microglia-generated nitroxidative stress promotes toxicity to human fetal neural stem cell-derived motor neurons through direct damage and noxious interactions with astrocytes

    PubMed Central

    Thonhoff, Jason R; Gao, Junling; Dunn, Tiffany J; Ojeda, Luis; Wu, Ping

    2012-01-01

    Amyotrophic lateral sclerosis (ALS) is a devastating motor neuron disease. Human neural stem cells (hNSCs) may have the potential to replace lost motor neurons. The therapeutic efficacy of stem cell therapy depends greatly on the survival of grafted stem cell-derived motor neurons in the microenvironment of the spinal cord in ALS. After transplantation of hNSCs into the spinal cords of transgenic ALS rats, morphological analysis reveals that grafted hNSCs differentiate into motor neurons. However, hNSCs degenerate and show signs of nitroxidative damage at the disease end-stage. Using an in vitro coculture system, we systematically assess interactions between microglia and astroglia derived from both nontransgenic rats and transgenic rats expressing human mutant SOD1G93A before and after symptomatic disease onset, and determine the effects of such microglia-astroglia interactions on the survival of hNSC-derived motor neurons. We found that ALS microglia, specifically isolated after symptomatic disease onset, are directly toxic to hNSC-derived motor neurons. Furthermore, nontransgenic astrocytes not only lose their protective role in hNSC-derived motor neuron survival in vitro, but also exhibit toxic features when cocultured with mutant SOD1G93A microglia. Using inhibitors of inducible nitric oxide synthase and NADPH oxidase, we show that microglia-generated nitric oxide and superoxide partially contribute to motor neuron loss and astrocyte dysfunction in this coculture paradigm. In summary, reactive oxygen/nitrogen species released from overactivated microglia in ALS directly eliminate human neural stem cell-derived motor neurons and reduce the neuroprotective capacities of astrocytes PMID:23671793

  3. Fabrication and evaluation of electrohydrodynamic jet 3D printed polycaprolactone/chitosan cell carriers using human embryonic stem cell-derived fibroblasts.

    PubMed

    Wu, Yang; Sriram, Gopu; Fawzy, Amr S; Fuh, Jerry Yh; Rosa, Vinicius; Cao, Tong; Wong, Yoke San

    2016-08-01

    Biological function of adherent cells depends on the cell-cell and cell-matrix interactions in three-dimensional space. To understand the behavior of cells in 3D environment and their interactions with neighboring cells and matrix requires 3D culture systems. Here, we present a novel 3D cell carrier scaffold that provides an environment for routine 3D cell growth in vitro We have developed thin, mechanically stable electrohydrodynamic jet (E-jet) 3D printed polycaprolactone and polycaprolactone/Chitosan macroporous scaffolds with precise fiber orientation for basic 3D cell culture application. We have evaluated the application of this technology by growing human embryonic stem cell-derived fibroblasts within these 3D scaffolds. Assessment of cell viability and proliferation of cells seeded on polycaprolactone and polycaprolactone/Chitosan 3D-scaffolds show that the human embryonic stem cell-derived fibroblasts could adhere and proliferate on the scaffolds over time. Further, using confocal microscopy we demonstrate the ability to use fluorescence-labelled cells that could be microscopically monitored in real-time. Hence, these 3D printed polycaprolactone and polycaprolactone/Chitosan scaffolds could be used as a cell carrier for in vitro 3D cell culture-, bioreactor- and tissue engineering-related applications in the future.

  4. Isolation of Multipotent Nestin-Expressing Stem Cells Derived from the Epidermis of Elderly Humans and TAT-VHL Peptide-Mediated Neuronal Differentiation of These Cells

    PubMed Central

    Kanno, Hiroshi; Kubo, Atsuhiko; Yoshizumi, Tetsuya; Mikami, Taro; Maegawa, Jiro

    2013-01-01

    A specialized population of cells residing in the hair follicle is quiescent but shows pluripotency for differentiating into epithelial-mesenchymal lineage cells. Therefore, such cells are hoped to be useful as implantable donor cells for regenerative therapy. Recently, it was reported that intracellular delivery of TAT-VHL peptide induces neuronal differentiation of skin-derived precursors. In the present study, we successfully isolated multipotent stem cells derived from the epidermis of elderly humans, characterized these cells as being capable of sphere formation and strong expression of nestin, fibronectin, and CD34 but not of keratin 15, and identified the niche of these cells as being the outer root sheath of the hair follicles. In addition, we showed that TAT-VHL peptide induced their neuronal differentiation in vitro, and confirmed by fluorescence immunohistochemistry the neuronal differentiation of such peptide-treated cells implanted into rodent brains. These multipotent nestin-expressing stem cells derived from human epidermis are easily accessible and should be useful as donor cells for neuronal regenerative cell therapy. PMID:23644888

  5. In vitro model of cerebral ischemia by using brain microvascular endothelial cells derived from human induced pluripotent stem cells.

    PubMed

    Kokubu, Yasuhiro; Yamaguchi, Tomoko; Kawabata, Kenji

    2017-04-29

    Brain-derived microvascular endothelial cells (BMECs), which play a central role in blood brain barrier (BBB), can be used for the evaluation of drug transport into the brain. Although human BMEC cell lines have already been reported, they lack original properties such as barrier integrity. Pluripotent stem cells (PSCs) can be used for various applications such as regenerative therapy, drug screening, and pathological study. In the recent study, an induction method of BMECs from PSCs has been established, making it possible to more precisely study the in vitro human BBB function. Here, using induced pluripotent stem (iPS) cell-derived BMECs, we examined the effects of oxygen-glucose deprivation (OGD) and OGD/reoxygenation (OGD/R) on BBB permeability. OGD disrupted the barrier function, and the dysfunction was rapidly restored by re-supply of the oxygen and glucose. Interestingly, TNF-α, which is known to be secreted from astrocytes and microglia in the cerebral ischemia, prevented the restoration of OGD-induced barrier dysfunction in an apoptosis-independent manner. Thus, we could establish the in vitro BBB disease model that mimics the cerebral ischemia by using iPS cell-derived BMECs.

  6. The developing role of Neuregulin1 in cardiac regenerative stem cell therapy.

    PubMed

    P Blomberg, Christopher; Lee, Juyong; P Morgan, James

    2014-01-01

    Myocardial infarction, heart failure, and chronic ischemic heart disease account for the majority of the cardiovascular burden. The current treatment strategies focus on limiting the progression of disease and preserving cardiac myocardium. The goal of stem cell therapy, on the other hand, is to reverse or replace damaged cardiac tissue. Over the past two decades many studies have been conducted to understand stem cell performance, survival, and the potential for cardiac repair. Neuregulin1, an epidermal growth factor family member, promotes embryonic stem cell differentiation into the cardiac lineage and improves survival in bone marrow-derived mesenchymal stem cell and embryonic endothelial progenitor cells. Current clinical trials are actively pursuing Neuregulin1's therapeutic potential in the areas of heart failure and cardiac ischemia. It is the intent of this paper to review the current knowledge of Neuregulin1 in stem cell biology and discuss the potential of using Neuregulin1 to improve stem cell therapy for cardiac repair.

  7. Trichostatin A enhances differentiation of human induced pluripotent stem cells to cardiogenic cells for cardiac tissue engineering.

    PubMed

    Lim, Shiang Y; Sivakumaran, Priyadharshini; Crombie, Duncan E; Dusting, Gregory J; Pébay, Alice; Dilley, Rodney J

    2013-09-01

    Human induced pluripotent stem (iPS) cells are a promising source of autologous cardiomyocytes to repair and regenerate myocardium for treatment of heart disease. In this study, we have identified a novel strategy to enhance cardiac differentiation of human iPS cells by treating embryoid bodies (EBs) with a histone deacetylase inhibitor, trichostatin A (TSA), together with activin A and bone morphogenetic protein 4 (BMP4). Over a narrow window of concentrations, TSA (1 ng/ml) directed the differentiation of human iPS cells into a cardiomyocyte lineage. TSA also exerted an additive effect with activin A (100 ng/ml) and BMP4 (20 ng/ml). The resulting cardiomyocytes expressed several cardiac-specific transcription factors and contractile proteins at both gene and protein levels. Functionally, the contractile EBs displayed calcium cycling and were responsive to the chronotropic agents isoprenaline (0.1 μM) and carbachol (1 μM). Implanting microdissected beating areas of iPS cells into tissue engineering chambers in immunocompromised rats produced engineered constructs that supported their survival, and they maintained spontaneous contraction. Human cardiomyocytes were identified as compact patches of muscle tissue incorporated within a host fibrocellular stroma and were vascularized by host neovessels. In conclusion, human iPS cell-derived cardiomyocytes can be used to engineer functional cardiac muscle tissue for studying the pathophysiology of cardiac disease, for drug discovery test beds, and potentially for generation of cardiac grafts to surgically replace damaged myocardium.

  8. Extracellular O-Linked N-Acetylglucosamine Is Enriched in Stem Cells Derived from Human Umbilical Cord Blood

    PubMed Central

    Hirvonen, Tia; Ritamo, Ilja; Natunen, Suvi; Tuimala, Jarno; Laitinen, Saara; Anderson, Heidi; Nystedt, Johanna; Räbinä, Jarkko; Valmu, Leena

    2014-01-01

    Abstract Stem cells have a unique ability to self-renew and differentiate into diverse cell types. Currently, stem cells from various sources are being explored as a promising new treatment for a variety of human diseases. A diverse set of functional and phenotypical markers are used in the characterization of specific therapeutic stem cell populations. The glycans on the stem cell surface respond rapidly to alterations in cellular state and signaling and are therefore ideal for identifying even minor changes in cell populations. Many stem cell markers are based on cell surface glycan epitopes including the widely used markers SSEA-3, SSEA-4, Tra 1-60, and Tra 1-81. We have now discovered by mRNA analysis that a novel glycosyltranferase, epidermal growth factor (EGF) domain-specific O-linked GlcNAc transferase (EOGT), is highly expressed in stem cells. EOGT is responsible for adding O-linked N-acetylglucosamine (O-GlcNAc) to folded EGF domains on extracellular proteins, such as those on the Notch receptors. We were able to show by immunological assays that human umbilical cord blood–derived mesenchymal stromal cells display O-GlcNAc, the product of EOGT, and that O-GlcNAc is further elongated with galactose to form O-linked N-acetyllactosamine. We suggest that these novel glycans are involved in the fine tuning of Notch receptor signaling pathways in stem cells. PMID:24804163

  9. Identification of Regulatory Factors for Mesenchymal Stem Cell-Derived Salivary Epithelial Cells in a Co-Culture System

    PubMed Central

    Park, Yun-Jong; Koh, Jin; Gauna, Adrienne E.; Chen, Sixue; Cha, Seunghee

    2014-01-01

    Patients with Sjögren’s syndrome or head and neck cancer patients who have undergone radiation therapy suffer from severe dry mouth (xerostomia) due to salivary exocrine cell death. Regeneration of the salivary glands requires a better understanding of regulatory mechanisms by which stem cells differentiate into exocrine cells. In our study, bone marrow-derived mesenchymal stem cells were co-cultured with primary salivary epithelial cells from C57BL/6 mice. Co-cultured bone marrow-derived mesenchymal stem cells clearly resembled salivary epithelial cells, as confirmed by strong expression of salivary gland epithelial cell-specific markers, such as alpha-amylase, muscarinic type 3 receptor, aquaporin-5, and cytokeratin 19. To identify regulatory factors involved in this differentiation, transdifferentiated mesenchymal stem cells were analyzed temporarily by two-dimensional-gel-electrophoresis, which detected 58 protein spots (>1.5 fold change, p<0.05) that were further categorized into 12 temporal expression patterns. Of those proteins only induced in differentiated mesenchymal stem cells, ankryin-repeat-domain-containing-protein 56, high-mobility-group-protein 20B, and transcription factor E2a were selected as putative regulatory factors for mesenchymal stem cell transdifferentiation based on putative roles in salivary gland development. Induction of these molecules was confirmed by RT-PCR and western blotting on separate sets of co-cultured mesenchymal stem cells. In conclusion, our study is the first to identify differentially expressed proteins that are implicated in mesenchymal stem cell differentiation into salivary gland epithelial cells. Further investigation to elucidate regulatory roles of these three transcription factors in mesenchymal stem cell reprogramming will provide a critical foundation for a novel cell-based regenerative therapy for patients with xerostomia. PMID:25402494

  10. Human Pluripotent Stem Cell-derived Cortical Neurons for High Throughput Medication Screening in Autism: A Proof of Concept Study in SHANK3 Haploinsufficiency Syndrome.

    PubMed

    Darville, Hélène; Poulet, Aurélie; Rodet-Amsellem, Frédérique; Chatrousse, Laure; Pernelle, Julie; Boissart, Claire; Héron, Delphine; Nava, Caroline; Perrier, Anselme; Jarrige, Margot; Cogé, Francis; Millan, Mark J; Bourgeron, Thomas; Peschanski, Marc; Delorme, Richard; Benchoua, Alexandra

    2016-07-01

    Autism spectrum disorders affect millions of individuals worldwide, but their heterogeneity complicates therapeutic intervention that is essentially symptomatic. A versatile yet relevant model to rationally screen among hundreds of therapeutic options would help improving clinical practice. Here we investigated whether neurons differentiated from pluripotent stem cells can provide such a tool using SHANK3 haploinsufficiency as a proof of principle. A library of compounds was screened for potential to increase SHANK3 mRNA content in neurons differentiated from control human embryonic stem cells. Using induced pluripotent stem cell technology, active compounds were then evaluated for efficacy in correcting dysfunctional networks of neurons differentiated from individuals with deleterious point mutations of SHANK3. Among 202 compounds tested, lithium and valproic acid showed the best efficacy at corrected SHANK3 haploinsufficiency associated phenotypes in cellulo. Lithium pharmacotherapy was subsequently provided to one patient and, after one year, an encouraging decrease in autism severity was observed. This demonstrated that pluripotent stem cell-derived neurons provide a novel cellular paradigm exploitable in the search for specific disease-modifying treatments.

  11. Transplantation of Donor-Origin Mouse Embryonic Stem Cell-Derived Thymic Epithelial Progenitors Prevents the Development of Chronic Graft-versus-Host Disease in Mice.

    PubMed

    Hu, Rong; Liu, Yalan; Su, Min; Song, Yinhong; Rood, Debra; Lai, Laijun

    2017-01-01

    Allogeneic hematopoietic stem cell transplantation (HSCT) is a potentially curative therapy for many malignant and nonmalignant diseases. However, chronic graft-versus-host disease (cGVHD) remains a significant cause of late morbidity and mortality after allogeneic HSCT. cGVHD often manifests as autoimmune syndrome. Thymic epithelial cells (TECs) play a critical role in supporting negative selection and regulatory T-cell (Treg) generation. Studies have shown that damage in TECs is sufficient to induce cGVHD. We have previously reported that mouse embryonic stem cells (mESCs) can be selectively induced to generate thymic epithelial progenitors (TEPs) in vitro. When transplanted in vivo, mESC-TEPs further develop into TECs that support T-cell development. We show here that transplantation of donor-origin mESC-TEPs into cGVHD recipients induces immune tolerance to both donor and host antigens and prevents the development of cGVHD. This is associated with more TECs and Tregs. Our results suggest that embryonic stem cell-derived TEPs may offer a new tool to control cGVHD. Stem Cells Translational Medicine 2017;6:121-130.

  12. Role of Cardiac Stem Cells in Cardiac Pathophysiology: A Paradigm Shift in Human Myocardial Biology

    PubMed Central

    Leri, Annarosa; Kajstura, Jan; Anversa, Piero

    2012-01-01

    For nearly a century, the human heart has been viewed as a terminally differentiated post-mitotic organ in which the number of cardiomyocytes is established at birth and these cells persist throughout the lifespan of the organ and organism. However, the discovery that cardiac stem cells (CSCs) live in the heart and differentiate into the various cardiac cell lineages has changed profoundly our understanding of myocardial biology. CSCs regulate myocyte turnover and condition myocardial recovery following injury. This novel information imposes a reconsideration of the mechanisms involved in myocardial aging and the progression of cardiac hypertrophy to heart failure. Similarly, the processes implicated in the adaptation of the infarcted heart have to be dissected in terms of the critical role that CSCs and myocyte regeneration play in the restoration of myocardial mass and ventricular function. Several categories of cardiac progenitors have been described but, thus far, the c-kit-positive cell is the only class of resident cells with the biological and functional properties of tissue specific adult stem cells. PMID:21960726

  13. The myocardial regenerative potential of three-dimensional engineered cardiac tissues composed of multiple human iPS cell-derived cardiovascular cell lineages

    PubMed Central

    Masumoto, Hidetoshi; Nakane, Takeichiro; Tinney, Joseph P.; Yuan, Fangping; Ye, Fei; Kowalski, William J.; Minakata, Kenji; Sakata, Ryuzo; Yamashita, Jun K.; Keller, Bradley B.

    2016-01-01

    Human induced pluripotent stem cells (hiPSCs) are a robust source for cardiac regenerative therapy due to their potential to support autologous and allogeneic transplant paradigms. The in vitro generation of three-dimensional myocardial tissue constructs using biomaterials as an implantable hiPSC-derived myocardium provides a path to realize sustainable myocardial regeneration. We generated engineered cardiac tissues (ECTs) from three cellular compositions of cardiomyocytes (CMs), endothelial cells (ECs), and vascular mural cells (MCs) differentiated from hiPSCs. We then determined the impact of cell composition on ECT structural and functional properties. In vitro force measurement showed that CM+EC+MC ECTs possessed preferential electromechanical properties versus ECTs without vascular cells indicating that incorporation of vascular cells augmented tissue maturation and function. The inclusion of MCs facilitated more mature CM sarcomeric structure, preferential alignment, and activated multiple tissue maturation pathways. The CM+EC+MC ECTs implanted onto infarcted, immune tolerant rat hearts engrafted, displayed both host and graft-derived vasculature, and ameliorated myocardial dysfunction. Thus, a composition of CMs and multiple vascular lineages derived from hiPSCs and incorporated into ECTs promotes functional maturation and demonstrates myocardial replacement and perfusion relevant for clinical translation. PMID:27435115

  14. Which has more stem-cell characteristics: Müller cells or Müller cells derived from in vivo culture in neurospheres?

    PubMed Central

    Ji, Hong-Pei; Xiong, Yu; Zhang, En-Dong; Song, Wei-Tao; Gao, Zhao-Lin; Yao, Fei; Sun, Hong; Zhou, Rong-Rong; Xia, Xiao-Bo

    2017-01-01

    Objective: Müller cells can be acquired from in vitro culture or a neurosphere culture system. Both culture methods yield cells with progenitor-cell characteristics that can differentiate into mature nervous cells. We compared the progenitor-cell traits of Müller cells acquired from each method. Methods: Primary murine Müller cells were isolated in serum culture media and used to generate Müller cells derived from neurospheres in serum-free culture conditions. Gene expression of neural progenitor cell markers was examined by Q-PCR in the two groups. Expression of rhodopsin and the cone-rod homeobox protein CRX were assessed after induction with 1 μM all-trans retinoic acid (RA) for 7 days. Results: After more than four passages, many cells were large, flattened, and difficult to passage. A spontaneously immortalized Müller cell line was not established. Three-passage neurospheres yielded few new spheres. Genes coding for Nestin, Sox2, Chx10, and Vimentin were downregulated in cells derived from neurospheres compared to the cells from standard culture, while Pax6 was upregulated. Müller cells from both culture methods were induced into rod photoreceptors, but expression of rhodopsin and CRX was greater in the Müller cells from the standard culture. Conclusion: Both culture methods yielded cells with stem-cell characteristics that can be induced into rod photoreceptor neurons by RA. Serum had no influence on the “stemness” of the cells. Cells from standard culture had greater “stemness” than cells derived from neurospheres. The standard Müller cells would seem to be the best choice for transplantation in cell replacement therapy for photoreceptor degeneration. PMID:28337288

  15. Bone marrow stromal/stem cell-derived extracellular vesicles regulate osteoblast activity and differentiation in vitro and promote bone regeneration in vivo.

    PubMed

    Qin, Yunhao; Wang, Lian; Gao, Zhengliang; Chen, Genyin; Zhang, Changqing

    2016-02-25

    Emerging evidence suggests that extracellular vesicles (EVs) are secreted by diverse tissues and play important roles in cell-cell communication, organ interactions and tissue homeostasis. Studies have reported the use of EVs to stimulate tissue regeneration, such as hepatic cell regeneration, and to treat diseases, such as pulmonary hypertension. However, little is known about the osteogenic effect of EVs. In this study, we explore the role of bone marrow stromal cell-derived EVs in the regulation of osteoblast activity and bone regeneration. We isolated bone marrow stromal/stem cell (BMSC)-derived EVs through gradient ultracentrifugation and ultrafiltration, and tested the influence of the EVs on osteogenesis both in vivo and in vitro. The results indicated that EVs positively regulated osteogenic genes and osteoblastic differentiation but did not inhibit proliferation in vitro. Furthermore, we constructed an EVs delivery system to stimulate bone formation in Sprague Dawley (SD) rats with calvarial defects. We found that BMSC-derived EVs led to more bone formation in the critical-size calvarial bone defects. Moreover, we found that miR-196a plays an essential role in the regulation of osteoblastic differentiation and the expression of osteogenic genes. We anticipate that our assay using bone marrow stromal cell-derived EVs will become a valuable tool for promoting bone regeneration.

  16. The RUNX1 +24 enhancer and P1 promoter identify a unique subpopulation of hematopoietic progenitor cells derived from human pluripotent stem cells.

    PubMed

    Ferrell, Patrick I; Xi, Jiafei; Ma, Chao; Adlakha, Mitali; Kaufman, Dan S

    2015-04-01

    Derivation of hematopoietic stem cells (HSCs) from human pluripotent stem cells remains a key goal for the fields of developmental biology and regenerative medicine. Here, we use a novel genetic reporter system to prospectively identify and isolate early hematopoietic cells derived from human embryonic stem cells (hESCs) and human induced pluripotent cells (iPSCs). Cloning the human RUNX1c P1 promoter and +24 enhancer to drive expression of tdTomato (tdTom) in hESCs and iPSCs, we demonstrate that tdTom expression faithfully enriches for RUNX1c-expressing hematopoietic progenitor cells. Time-lapse microscopy demonstrated the tdTom(+) hematopoietic cells to emerge from adherent cells. Furthermore, inhibition of primitive hematopoiesis by blocking Activin/Nodal signaling promoted the expansion and/or survival of the tdTom(+) population. Notably, RUNX1c/tdTom(+) cells represent only a limited subpopulation of the CD34(+) CD45(+) and CD34(+) CD43(+) cells with a unique genetic signature. Using gene array analysis, we find significantly lower expression of Let-7 and mir181a microRNAs in the RUNX1c/tdTom(+) cell population. These phenotypic and genetic analyses comparing the RUNX1c/tdTom(+) population to CD34(+) CD45(+) umbilical cord blood and fetal liver demonstrate several key differences that likely impact the development of HSCs capable of long-term multilineage engraftment from hESCs and iPSCs.

  17. Novel, high-yield red blood cell production methods from CD34-positive cells derived from human embryonic stem, yolk sac, fetal liver, cord blood, and peripheral blood.

    PubMed

    Olivier, Emmanuel; Qiu, Caihong; Bouhassira, Eric E

    2012-08-01

    The current supply of red blood cells expressing rare blood groups is not sufficient to cover all the existing transfusion needs for chronically transfused patients, such as sickle cell disease homozygous carriers, because of alloimmunization. In vitro production of cultured red blood cells is slowly emerging as a possible complement to the existing collection-based red blood cell procurement system. The yield of cultured red blood cells can theoretically be maximized by amplifying the stem, progenitor, or precursor compartment. Here, we combined methods designed to expand these three compartments to optimize the yield of cultured red blood cells and found that exposing CD34(+) cells t