Genomic and phenotypic variation in epidemic-spanning Salmonella enterica serovar Enteritidis isolates

PubMed Central

2009-01-01

Background Salmonella enterica serovar Enteritidis (S. Enteritidis) has caused major epidemics of gastrointestinal infection in many different countries. In this study we investigate genome divergence and pathogenic potential in S. Enteritidis isolated before, during and after an epidemic in Uruguay. Results 266 S. Enteritidis isolates were genotyped using RAPD-PCR and a selection were subjected to PFGE analysis. From these, 29 isolates spanning different periods, genetic profiles and sources of isolation were assayed for their ability to infect human epithelial cells and subjected to comparative genomic hybridization using a Salmonella pan-array and the sequenced strain S. Enteritidis PT4 P125109 as reference. Six other isolates from distant countries were included as external comparators. Two hundred and thirty three chromosomal genes as well as the virulence plasmid were found as variable among S. Enteritidis isolates. Ten out of the 16 chromosomal regions that varied between different isolates correspond to phage-like regions. The 2 oldest pre-epidemic isolates lack phage SE20 and harbour other phage encoded genes that are absent in the sequenced strain. Besides variation in prophage, we found variation in genes involved in metabolism and bacterial fitness. Five epidemic strains lack the complete Salmonella virulence plasmid. Significantly, strains with indistinguishable genetic patterns still showed major differences in their ability to infect epithelial cells, indicating that the approach used was insufficient to detect the genetic basis of this differential behaviour. Conclusion The recent epidemic of S. Enteritidis infection in Uruguay has been driven by the introduction of closely related strains of phage type 4 lineage. Our results confirm previous reports demonstrating a high degree of genetic homogeneity among S. Enteritidis isolates. However, 10 of the regions of variability described here are for the first time reported as being variable in S. Enteritidis. In particular, the oldest pre-epidemic isolates carry phage-associated genetic regions not previously reported in S. Enteritidis. Overall, our results support the view that phages play a crucial role in the generation of genetic diversity in S. Enteritidis and that phage SE20 may be a key marker for the emergence of particular isolates capable of causing epidemics. PMID:19922635

Investigations related to the epidemic strain involved in the French listeriosis outbreak in 1992.

PubMed Central

Jacquet, C; Catimel, B; Brosch, R; Buchrieser, C; Dehaumont, P; Goulet, V; Lepoutre, A; Veit, P; Rocourt, J

1995-01-01

Two hundred seventy-nine cases of human listeriosis (92 pregnancy-related cases and 187 non-pregnancy-related cases) caused by a serovar 4b and phagovar 2389:2425:3274:2671:47:108:340 strain were identified in France between March and December 1992. Epidemiological investigations included a case-control study (not described here) and microbiological analyses of foods. Results of the case-control study and characterization of food isolates identified pork tongue in jelly, a ready-to-eat meat product, as the major vehicle of this outbreak, and to a lesser extent, delicatessen products contaminated secondarily during handling in food stores. As far as serotyping, phage typing, DNA macrorestriction pattern analysis (obtained by pulsed-field gel electrophoresis [PFGE]), and ribotyping are concerned, this epidemic strain is phenotypically and genomically closely related to strains responsible for major outbreaks of listeriosis previously observed in Europe and North America. The epidemic strain sensu stricto as defined by PFGE (2/1/3) displayed the same serovar, phagovar, ribovar, and ApaI and NotI PFGE patterns as the epidemic strains from outbreaks in Switzerland, California, and Denmark, but it consistently showed differences in the SmaI PFGE profile. This information greatly contributed to the identification of the major food vehicle (pork tongue in jelly) and further allowed exclusion of other foods (cheese) as possible sources of this major listeriosis epidemic. PMID:7793944

Genome-wide molecular dissection of serotype M3 group A Streptococcus strains causing two epidemics of invasive infections.

PubMed

Beres, Stephen B; Sylva, Gail L; Sturdevant, Daniel E; Granville, Chanel N; Liu, Mengyao; Ricklefs, Stacy M; Whitney, Adeline R; Parkins, Larye D; Hoe, Nancy P; Adams, Gerald J; Low, Donald E; DeLeo, Frank R; McGeer, Allison; Musser, James M

2004-08-10

Molecular factors that contribute to the emergence of new virulent bacterial subclones and epidemics are poorly understood. We hypothesized that analysis of a population-based strain sample of serotype M3 group A Streptococcus (GAS) recovered from patients with invasive infection by using genome-wide investigative methods would provide new insight into this fundamental infectious disease problem. Serotype M3 GAS strains (n = 255) cultured from patients in Ontario, Canada, over 11 years and representing two distinct infection peaks were studied. Genetic diversity was indexed by pulsed-field gel electrophoresis, DNA-DNA microarray, whole-genome PCR scanning, prophage genotyping, targeted gene sequencing, and single-nucleotide polymorphism genotyping. All variation in gene content was attributable to acquisition or loss of prophages, a molecular process that generated unique combinations of proven or putative virulence genes. Distinct serotype M3 genotypes experienced rapid population expansion and caused infections that differed significantly in character and severity. Molecular genetic analysis, combined with immunologic studies, implicated a 4-aa duplication in the extreme N terminus of M protein as a factor contributing to an epidemic wave of serotype M3 invasive infections. This finding has implications for GAS vaccine research. Genome-wide analysis of population-based strain samples cultured from clinically well defined patients is crucial for understanding the molecular events underlying bacterial epidemics.

Genomic Dissection of an Icelandic Epidemic of Respiratory Disease in Horses and Associated Zoonotic Cases

PubMed Central

Björnsdóttir, Sigríður; Harris, Simon R.; Svansson, Vilhjálmur; Gunnarsson, Eggert; Sigurðardóttir, Ólöf G.; Gammeljord, Kristina; Steward, Karen F.; Newton, J. Richard; Robinson, Carl; Charbonneau, Amelia R. L.

2017-01-01

ABSTRACT Iceland is free of the major infectious diseases of horses. However, in 2010 an epidemic of respiratory disease of unknown cause spread through the country’s native horse population of 77,000. Microbiological investigations ruled out known viral agents but identified the opportunistic pathogen Streptococcus equi subsp. zooepidemicus (S. zooepidemicus) in diseased animals. We sequenced the genomes of 257 isolates of S. zooepidemicus to differentiate epidemic from endemic strains. We found that although multiple endemic clones of S. zooepidemicus were present, one particular clone, sequence type 209 (ST209), was likely to have been responsible for the epidemic. Concurrent with the epidemic, ST209 was also recovered from a human case of septicemia, highlighting the pathogenic potential of this strain. Epidemiological investigation revealed that the incursion of this strain into one training yard during February 2010 provided a nidus for the infection of multiple horses that then transmitted the strain to farms throughout Iceland. This study represents the first time that whole-genome sequencing has been used to investigate an epidemic on a national scale to identify the likely causative agent and the link to an associated zoonotic infection. Our data highlight the importance of national biosecurity to protect vulnerable populations of animals and also demonstrate the potential impact of S. zooepidemicus transmission to other animals, including humans. PMID:28765219

Epidemic typhoid in Chile: analysis by molecular and conventional methods of Salmonella typhi strain diversity in epidemic (1977 and 1981) and nonepidemic (1990) years.

PubMed

Fica, A E; Prat-Miranda, S; Fernandez-Ricci, A; D'Ottone, K; Cabello, F C

1996-07-01

From 1977 to 1986, Chile experienced an important typhoid fever epidemic, despite statistics that indicated apparently improving levels of sanitation of drinking water and sewage disposal. The lack of antibiotic resistance among the Salmonella typhi strains isolated during this period, the mild clinical presentation of the disease, and the initially low level of efficacy of the S. typhi Ty21a vaccine in the population exposed to the epidemic suggested that this epidemic might have resulted from the dissemination of S. typhi strains with unique characteristics. To investigate this hypothesis, we used conventional methods (bacteriophage typing and biotyping) and molecular methods (restriction fragment length polymorphism analysis, ribotyping, IS200 typing, and PCR amplification of the fliC-d gene) to study a population of 149 S. typhi isolates during 1977, 1981, and 1990, the years that included periods with low (when the disease was endemic) and high (when the disease was epidemic) morbidities. Our results indicate that these S. typhi isolates in Chile represent a number of highly diverse variants of the clone of S. typhi with a worldwide distribution described by Selander et al. (R. K. Selander, P. Beltran, N.H. Smith, R. Helmuth, F.A. Rubin, D.J. Kopecko, K. Ferris, B.D. Tall, A. Cravioto, and J.M. Musser, Infect. Immun. 58:2262-2275, 1990). For example, we detected 26 PstI and 10 ClaI ribotypes among 47 and 16 S. typhi strains belonging to this clone, respectively. These results suggest that the Chilean epidemic was probably produced by multiple sources of infection because of deficient sanitary conditions. These findings illustrate the usefulness of molecular methods for characterizing the potential causes of the typhoid epidemics and the possible routes of transmission of S. typhi strains in typhoid epidemics.

Epidemic typhoid in Chile: analysis by molecular and conventional methods of Salmonella typhi strain diversity in epidemic (1977 and 1981) and nonepidemic (1990) years.

PubMed Central

Fica, A E; Prat-Miranda, S; Fernandez-Ricci, A; D'Ottone, K; Cabello, F C

1996-01-01

From 1977 to 1986, Chile experienced an important typhoid fever epidemic, despite statistics that indicated apparently improving levels of sanitation of drinking water and sewage disposal. The lack of antibiotic resistance among the Salmonella typhi strains isolated during this period, the mild clinical presentation of the disease, and the initially low level of efficacy of the S. typhi Ty21a vaccine in the population exposed to the epidemic suggested that this epidemic might have resulted from the dissemination of S. typhi strains with unique characteristics. To investigate this hypothesis, we used conventional methods (bacteriophage typing and biotyping) and molecular methods (restriction fragment length polymorphism analysis, ribotyping, IS200 typing, and PCR amplification of the fliC-d gene) to study a population of 149 S. typhi isolates during 1977, 1981, and 1990, the years that included periods with low (when the disease was endemic) and high (when the disease was epidemic) morbidities. Our results indicate that these S. typhi isolates in Chile represent a number of highly diverse variants of the clone of S. typhi with a worldwide distribution described by Selander et al. (R. K. Selander, P. Beltran, N.H. Smith, R. Helmuth, F.A. Rubin, D.J. Kopecko, K. Ferris, B.D. Tall, A. Cravioto, and J.M. Musser, Infect. Immun. 58:2262-2275, 1990). For example, we detected 26 PstI and 10 ClaI ribotypes among 47 and 16 S. typhi strains belonging to this clone, respectively. These results suggest that the Chilean epidemic was probably produced by multiple sources of infection because of deficient sanitary conditions. These findings illustrate the usefulness of molecular methods for characterizing the potential causes of the typhoid epidemics and the possible routes of transmission of S. typhi strains in typhoid epidemics. PMID:8784573

Phenotypic Analysis Reveals that the 2010 Haiti Cholera Epidemic Is Linked to a Hypervirulent Strain

PubMed Central

Jones, Christopher J.; Wong, Jennifer; Queen, Jessica; Agarwal, Shivani; Yildiz, Fitnat H.

2016-01-01

Vibrio cholerae O1 El Tor strains have been responsible for pandemic cholera since 1961. These strains have evolved over time, spreading globally in three separate waves. Wave 3 is caused by altered El Tor (AET) variant strains, which include the strain with the signature ctxB7 allele that was introduced in 2010 into Haiti, where it caused a devastating epidemic. In this study, we used phenotypic analysis to compare an early isolate from the Haiti epidemic to wave 1 El Tor isolates commonly used for research. It is demonstrated that the Haiti isolate has increased production of cholera toxin (CT) and hemolysin, increased motility, and a reduced ability to form biofilms. This strain also outcompetes common wave 1 El Tor isolates for colonization of infant mice, indicating that it has increased virulence. Monitoring of CT production and motility in additional wave 3 isolates revealed that this phenotypic variation likely evolved over time rather than in a single genetic event. Analysis of available whole-genome sequences and phylogenetic analyses suggested that increased virulence arose from positive selection for mutations found in known and putative regulatory genes, including hns and vieA, diguanylate cyclase genes, and genes belonging to the lysR and gntR regulatory families. Overall, the studies presented here revealed that V. cholerae virulence potential can evolve and that the currently prevalent wave 3 AET strains are both phenotypically distinct from and more virulent than many El Tor isolates. PMID:27297393

Two viral strains and a possible novel recombinant are responsible for the explosive injecting drug use-associated HIV type 1 epidemic in Estonia.

PubMed

Zetterberg, Veera; Ustina, Valentina; Liitsola, Kirsi; Zilmer, Kai; Kalikova, Nelli; Sevastianova, Ksenia; Brummer-Korvenkontio, Henrikki; Leinikki, Pauli; Salminen, Mika O

2004-11-01

HIV-1 infection has been rare in Estonia. In 2000, an explosive epidemic among injecting drug users was detected in the Eastern border region, resulting in 3603 newly reported cases by the end of 2003. The molecular epidemiology of the outbreak was studied to establish whether the Estonian epidemic is linked to the epidemics in Eastern Europe. Over 200 newly infected individuals were prospectively sampled from June 2000 to March 2002 in a geographically representative way, with known dates of diagnosis and information of probable route of transmission. Viral regions coding for two viral gene regions were directly sequenced from plasma viral RNA and phylogenetically analyzed. In addition, a larger region coding for the entire env gene was sequenced from one sample and studied for indications of possible recombinant structure. The Estonian HIV outbreak was found to be caused by simultaneous introduction of two strains: a minor subtype A strain very similar to the Eastern European subtype A strain (approximately 8% of cases), and a second major strain (77%) found to be most closely related to the CRF06-cpx strain, previously described only from African countries. The variability in the two clusters was very low, suggesting point source introductions. Ten percent of cases seemed to be newly generated recombinants of the A and CRF06-cpx strains. Analysis of viral diversification over time revealed a rate of change within the V3 region of 0.83%/year for the CRF06-cpx strain, consistent with findings from other subtypes. Due to the relatively frequently found novel recombinant forms, the Estonian HIV-1 epidemic may allow studies of coinfection and intersubtype recombination in detail.

Slow Epidemic of Lymphogranuloma Venereum L2b Strain

PubMed Central

Spaargaren, Joke; Schachter, Julius; Moncada, Jeanne; de Vries, Henry J.C.; Fennema, Han S.A.; Peña, A. Salvador; Coutinho, Roel A.

2005-01-01

We traced the Chlamydia trachomatis L2b variant in Amsterdam and San Francisco. All recent lymphogranuloma venereum cases in Amsterdam were caused by the L2b variant. This variant was also present in the 1980s in San Francisco. Thus, the current "outbreak" is most likely a slowly evolving epidemic. PMID:16318741

Exacerbated type II interferon response drives hypervirulence and toxic shock by an emergent epidemic strain of Streptococcus suis.

PubMed

Lachance, Claude; Gottschalk, Marcelo; Gerber, Pehuén P; Lemire, Paul; Xu, Jianguo; Segura, Mariela

2013-06-01

Streptococcus suis, a major porcine pathogen, can be transmitted to humans and cause severe symptoms. A large human outbreak associated with an unusual streptococcal toxic shock-like syndrome (STSLS) was described in China. Albeit an early burst of proinflammatory cytokines following Chinese S. suis infection was suggested to be responsible for STSLS case severity, the mechanisms involved are still poorly understood. Using a mouse model, the host response to S. suis infection with a North American intermediately pathogenic strain, a European highly pathogenic strain, and the Chinese epidemic strain was investigated by a whole-genome microarray approach. Proinflammatory genes were expressed at higher levels in mice infected with the Chinese strain than those infected with the European strain. The Chinese strain induced a fast and strong gamma interferon (IFN-γ) response by natural killer (NK) cells. In fact, IFN-γ-knockout mice infected with the Chinese strain showed significantly better survival than wild-type mice. Conversely, infection with the less virulent North American strain resulted in an IFN-β-subjugated, low inflammatory response that might be beneficial for the host to clear the infection. Overall, our data suggest that a highly virulent epidemic strain has evolved to massively activate IFN-γ production, mainly by NK cells, leading to a rapid and lethal STSLS.

Widespread epidemic cholera caused by a restricted subset of Vibrio cholerae clones.

PubMed

Moore, S; Thomson, N; Mutreja, A; Piarroux, R

2014-05-01

Since 1817, seven cholera pandemics have plagued humankind. As the causative agent, Vibrio cholerae, is autochthonous in the aquatic ecosystem and some studies have revealed links between outbreaks and fluctuations in climatic and aquatic conditions, it has been widely assumed that cholera epidemics are triggered by environmental factors that promote the growth of local bacterial reservoirs. However, mounting epidemiological findings and genome sequence analysis of clinical isolates have indicated that epidemics are largely unassociated with most of the V. cholerae strains in aquatic ecosystems. Instead, only a specific subset of V. cholerae El Tor 'types' appears to be responsible for current epidemics. A recent report examining the evolution of a variety of V. cholerae strains indicates that the current pandemic is monophyletic and originated from a single ancestral clone that has spread globally in successive waves. In this review, we examine the clonal nature of the disease, with the example of the recent history of cholera in the Americas. Epidemiological data and genome sequence-based analysis of V. cholerae isolates demonstrate that the cholera epidemics of the 1990s in South America were triggered by the importation of a pathogenic V. cholerae strain that gradually spread throughout the region until local outbreaks ceased in 2001. Latin America remained almost unaffected by the disease until a new toxigenic V. cholerae clone was imported into Haiti in 2010. Overall, cholera appears to be largely caused by a subset of specific V. cholerae clones rather than by the vast diversity of V. cholerae strains in the environment. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

Epidemic Clostridium difficile Strains Demonstrate Increased Competitive Fitness Compared to Nonepidemic Isolates

PubMed Central

Robinson, Catherine D.; Auchtung, Jennifer M.; Collins, James

2014-01-01

Clostridium difficile infection is the most common cause of severe cases of antibiotic-associated diarrhea (AAD) and is a significant health burden. Recent increases in the rate of C. difficile infection have paralleled the emergence of a specific phylogenetic clade of C. difficile strains (ribotype 027; North American pulsed-field electrophoresis 1 [NAP1]; restriction endonuclease analysis [REA] group BI). Initial reports indicated that ribotype 027 strains were associated with increased morbidity and mortality and might be hypervirulent. Although subsequent work has raised some doubt as to whether ribotype 027 strains are hypervirulent, the strains are considered epidemic isolates that have caused severe outbreaks across the globe. We hypothesized that one factor that could lead to the increased prevalence of ribotype 027 strains would be if these strains had increased competitive fitness compared to strains of other ribotypes. We developed a moderate-throughput in vitro model of C. difficile infection and used it to test competition between four ribotype 027 clinical isolates and clinical isolates of four other ribotypes (001, 002, 014, and 053). We found that ribotype 027 strains outcompeted the strains of other ribotypes. A similar competitive advantage was observed when two ribotype pairs were competed in a mouse model of C. difficile infection. Based upon these results, we conclude that one possible mechanism through which ribotype 027 strains have caused outbreaks worldwide is their increased ability to compete in the presence of a complex microbiota. PMID:24733099

Laboratory preparedness for detection and monitoring of Shiga toxin 2-producing Escherichia coli O104:H4 in Europe and response to the 2011 outbreak.

PubMed

Rosin, P; Niskanen, T; Palm, D; Struelens, M; Takkinen, J

2013-06-20

A hybrid strain of enteroaggregative and Shiga toxin 2-producing Escherichia coli (EAEC-STEC) serotype O104:H4 strain caused a large outbreak of haemolytic uraemic syndrome and bloody diarrhoea in 2011 in Europe. Two surveys were performed in the European Union (EU) and European Economic Area (EEA) countries to assess their laboratory capabilities to detect and characterise this previously uncommon STEC strain. Prior to the outbreak, 11 of the 32 countries in this survey had capacity at national reference laboratory (NRL) level for epidemic case confirmation according to the EU definition. During the outbreak, at primary diagnostic level, nine countries reported that clinical microbiology laboratories routinely used Shiga toxin detection assays suitable for diagnosis of infections with EAEC-STEC O104:H4, while 14 countries had NRL capacity to confirm epidemic cases. Six months after the outbreak, 22 countries reported NRL capacity to confirm such cases following initiatives taken by NRLs and the European Centre for Disease Prevention and Control (ECDC) Food- and Waterborne Disease and Zoonoses laboratory network. These data highlight the challenge of detection and confirmation of epidemic infections caused by atypical STEC strains and the benefits of coordinated EU laboratory networks to strengthen capabilities in response to a major outbreak.

Genotype distribution of norovirus around the emergence of Sydney_2012 and the antigenic drift of contemporary GII.4 epidemic strains.

PubMed

Zhang, Jun; Shen, Zhen; Zhu, Zhaoqin; Zhang, Wanju; Chen, Huifen; Qian, Fangxing; Chen, Haili; Wang, Gang; Wang, Moying; Hu, Yunwen; Yuan, Zhenghong

2015-11-01

The pattern of epochal evolution of NoV is ongoing, while novel GII.4 variants emerge and cause new pandemics. Since, the emergence in March 2012, Sydney_2012 had replaced GII.4-2009 as the primary NoV strain in most countries in the northern hemisphere by November 2012. To determine the genotype distribution around the emergence of Sydney_2012 and to investigate the underlying evolution mechanisms of the contemporary GII.4 strains. From January 2012 to December 2013, molecular epidemiology of norovirus in 846 adults (≥16 years) in Shanghai were conducted. The VP1 proteins of the contemporary GII.4 strains (Den_Haag_2006b, New_Orleans_2009 and Sydney_2012) were expressed in vitro and purified. Receptor binding patterns of these three epidemic strains were determined through histo-blood group antigen (HBGA) binding assays. Convalescent serum from patients infected with GII.4 epidemic strains were employed to investigate the role of antigenic drift in the persistence of GII.4 epidemic strains through receptor-binding blockade assays. Epidemiological studies revealed that Sydeny_2012 has completely replaced Den_Haag_2006b and New_Orleans_2009 and has been the dominant circulating strain in Shanghai since its emergence in October 2012. Interestingly, Den_Haag_2006b and New_Orleans_2009 have been co-circulating in Shanghai before the emergence of Sydeny_2012. The contemporary GII.4 epidemic norovirus strains displayed commonly high tropism to the histo-blood group antigen receptors, whereas Sydeny_2012 was antigenically different from Den_Haag_2006b and New_Orleans_2009. Antigenic drift, rather than receptor switch, played a key role in the emergence and spreading of Sydney_2012. The contemporary GII.4 strains were evolving via epochal evolution without altered ligand binding profiles. Copyright © 2015 Elsevier B.V. All rights reserved.

Molecular epidemiology of serogroup a meningitis in Moscow, 1969 to 1997.

PubMed Central

Achtman, M.; van der Ende, A.; Zhu, P.; Koroleva, I. S.; Kusecek, B.; Morelli, G.; Schuurman, I. G.; Brieske, N.; Zurth, K.; Kostyukova, N. N.; Platonov, A. E.

2001-01-01

Molecular analysis of 103 serogroup A Neisseria meningitidis strains isolated in Moscow from 1969 to 1997 showed that four independent clonal groupings were responsible for successive waves of meningococcal disease. An epidemic from 1969 to the mid-1970s was caused by genocloud 2 of subgroup III, possibly imported from China. Subsequent endemic disease through the early 1990s was caused by subgroup X and then by subgroup VI, which has also caused endemic disease elsewhere in eastern Europe. A 1996 epidemic was part of the pandemic spread from Asia of genocloud 8 of subgroup III. Recent genocloud 8 epidemic disease in Moscow may represent an early warning for spread of these bacteria to other countries in Europe. PMID:11384519

Phylogenetic Analysis of Enterovirus 71 Strains Isolated during Linked Epidemics in Malaysia, Singapore, and Western Australia

PubMed Central

McMinn, Peter; Lindsay, Katie; Perera, David; Chan, Hung Ming; Chan, Kwai Peng; Cardosa, Mary Jane

2001-01-01

Enterovirus 71 (EV71) is a frequent cause of hand, foot, and mouth disease (HFMD) epidemics associated with severe neurological sequelae in a small proportion of cases. There has been a significant increase in EV71 epidemic activity throughout the Asia-Pacific region since 1997. Recent HFMD epidemics in this region have been associated with a severe form of brainstem encephalitis associated with pulmonary edema and high case fatality rates. In this study, we show that four genetic lineages of EV71 have been prevalent in the Asia-Pacific region since 1997, including two previously undescribed genogroups (B3 and B4). Furthermore, we show that viruses belonging to genogroups B3 and B4 have circulated endemically in Southeast Asia during this period and have been the primary cause of several large HFMD or encephalitis epidemics in Malaysia, Singapore, and Western Australia. PMID:11462047

Novel Human Adenovirus Causing Nosocomial Epidemic Keratoconjunctivitis▿

PubMed Central

Ishiko, Hiroaki; Shimada, Yasushi; Konno, Tsunetada; Hayashi, Akio; Ohguchi, Takeshi; Tagawa, Yoshitsugu; Aoki, Koki; Ohno, Shigeaki; Yamazaki, Shudo

2008-01-01

In 2000, we encountered cases of nosocomial infections with epidemic keratoconjunctivitis (EKC) at a university hospital in Kobe, in the western part of Japan. Two human adenovirus (HAdV) strains, Kobe-H and Kobe-S, were isolated from patients with nosocomial EKC infection. They were untypeable by existing neutralizing antisera; however, the isolate was neutralized with homologous antisera. We then encountered several cases of EKC due to nosocomial infections in eye clinics in different parts of Japan. A total of 80 HAdVs were isolated from patients with EKC at eight different hospitals. The partial hexon gene sequences of the isolates were determined and compared to those of the prototype strains of 51 serotypes. All isolates had identical partial hexon nucleotide sequences. Phylogenetic analysis classified these isolates into species of HAdV-D. The isolates showed 93.9 to 96.7% nucleotide identity with HAdV-D prototype strains, while all 32 HAdV-D prototype strains ranged from 93.2 to 99.2% identity. The sequences of the loop 2 and fiber knob regions from the representative strain, Kobe-H, were dissimilar in all prototype strains of 51 serotypes. We believe that this virus is a novel serotype of HAdV that causes EKC. PMID:18385435

Haemagglutinin mutations and glycosylation changes shaped the 2012/13 influenza A(H3N2) epidemic, Houston, Texas

PubMed Central

Stucker, K M; Schobel, S A; Olsen, R J; Hodges, H L; Lin, X; Halpin, R A; Fedorova, N; Stockwell, T B; Tovchigrechko, A; Das, S R; Wentworth, D E; Musser, J M

2017-01-01

While the early start and higher intensity of the 2012/13 influenza A virus (IAV) epidemic was not unprecedented, it was the first IAV epidemic season since the 2009 H1N1 influenza pandemic where the H3N2 subtype predominated. We directly sequenced the genomes of 154 H3N2 clinical specimens collected throughout the epidemic to better understand the evolution of H3N2 strains and to inform the H3N2 vaccine selection process. Phylogenetic analyses indicated that multiple co-circulating clades and continual antigenic drift in the haemagglutinin (HA) of clades 5, 3A, and 3C, with the evolution of a new 3C subgroup (3C-2012/13), were the driving causes of the epidemic. Drift variants contained HA substitutions and alterations in the potential N-linked glycosylation sites of HA. Antigenic analysis demonstrated that viruses in the emerging subclade 3C.3 and subgroup 3C-2012/13 were not well inhibited by antisera generated against the 3C.1 vaccine strains used for the 2012/13 (A/Victoria/361/2011) or 2013/14 (A/Texas/50/2012) seasons. Our data support updating the H3N2 vaccine strain to a clade 3C.2 or 3C.3-like strain or a subclade that has drifted further. They also underscore the challenges in vaccine strain selection, particularly regarding HA and neuraminidase substitutions derived during laboratory passage that may alter antigenic testing accuracy. PMID:25990233

Forecasting Influenza Epidemics in Hong Kong.

PubMed

Yang, Wan; Cowling, Benjamin J; Lau, Eric H Y; Shaman, Jeffrey

2015-07-01

Recent advances in mathematical modeling and inference methodologies have enabled development of systems capable of forecasting seasonal influenza epidemics in temperate regions in real-time. However, in subtropical and tropical regions, influenza epidemics can occur throughout the year, making routine forecast of influenza more challenging. Here we develop and report forecast systems that are able to predict irregular non-seasonal influenza epidemics, using either the ensemble adjustment Kalman filter or a modified particle filter in conjunction with a susceptible-infected-recovered (SIR) model. We applied these model-filter systems to retrospectively forecast influenza epidemics in Hong Kong from January 1998 to December 2013, including the 2009 pandemic. The forecast systems were able to forecast both the peak timing and peak magnitude for 44 epidemics in 16 years caused by individual influenza strains (i.e., seasonal influenza A(H1N1), pandemic A(H1N1), A(H3N2), and B), as well as 19 aggregate epidemics caused by one or more of these influenza strains. Average forecast accuracies were 37% (for both peak timing and magnitude) at 1-3 week leads, and 51% (peak timing) and 50% (peak magnitude) at 0 lead. Forecast accuracy increased as the spread of a given forecast ensemble decreased; the forecast accuracy for peak timing (peak magnitude) increased up to 43% (45%) for H1N1, 93% (89%) for H3N2, and 53% (68%) for influenza B at 1-3 week leads. These findings suggest that accurate forecasts can be made at least 3 weeks in advance for subtropical and tropical regions.

Forecasting Influenza Epidemics in Hong Kong

PubMed Central

Yang, Wan; Cowling, Benjamin J.; Lau, Eric H. Y.; Shaman, Jeffrey

2015-01-01

Recent advances in mathematical modeling and inference methodologies have enabled development of systems capable of forecasting seasonal influenza epidemics in temperate regions in real-time. However, in subtropical and tropical regions, influenza epidemics can occur throughout the year, making routine forecast of influenza more challenging. Here we develop and report forecast systems that are able to predict irregular non-seasonal influenza epidemics, using either the ensemble adjustment Kalman filter or a modified particle filter in conjunction with a susceptible-infected-recovered (SIR) model. We applied these model-filter systems to retrospectively forecast influenza epidemics in Hong Kong from January 1998 to December 2013, including the 2009 pandemic. The forecast systems were able to forecast both the peak timing and peak magnitude for 44 epidemics in 16 years caused by individual influenza strains (i.e., seasonal influenza A(H1N1), pandemic A(H1N1), A(H3N2), and B), as well as 19 aggregate epidemics caused by one or more of these influenza strains. Average forecast accuracies were 37% (for both peak timing and magnitude) at 1-3 week leads, and 51% (peak timing) and 50% (peak magnitude) at 0 lead. Forecast accuracy increased as the spread of a given forecast ensemble decreased; the forecast accuracy for peak timing (peak magnitude) increased up to 43% (45%) for H1N1, 93% (89%) for H3N2, and 53% (68%) for influenza B at 1-3 week leads. These findings suggest that accurate forecasts can be made at least 3 weeks in advance for subtropical and tropical regions. PMID:26226185

Antigenic and molecular characterization of wild type 1 poliovirus causing outbreaks of poliomyelitis in Albania and neighboring countries in 1996.

PubMed

Fiore, L; Genovese, D; Diamanti, E; Catone, S; Ridolfi, B; Ibrahimi, B; Konomi, R; van der Avoort, H G; Hovi, T; Crainic, R; Simeoni, P; Amato, C

1998-07-01

Mass vaccination has led poliomyelitis to become a rare disease in a large part of the world, including Western Europe. However, in the past 20 years wild polioviruses imported from countries where polio is endemic have been responsible for outbreaks in otherwise polio-free European countries. We report on the characterization of poliovirus isolates from a large outbreak of poliomyelitis that occurred in Albania in 1996 and that also spread to the neighboring countries of Yugoslavia and Greece. The epidemics involved 145 subjects, mostly young adults, and caused persisting paralysis in 87 individuals and 16 deaths. The agent responsible for the outbreak was isolated from 74 patients and was identified as wild type 1 poliovirus by both immunological and molecular methods. Sequence analysis of the genome demonstrated the involvement of a single virus strain throughout the epidemics, and genotyping analysis showed 95% homology of the strain with a wild type 1 poliovirus strain isolated in Pakistan in 1995. Neutralization assays with both human sera and monoclonal antibodies were performed to analyze the antigenic structure of the epidemic strain, suggesting its peculiar antigenic characteristics. The presented data underline the current risks of outbreaks due to imported wild poliovirus and emphasize the need to improve vaccination efforts and also the need to implement surveillance in countries free of indigenous wild poliovirus.

Antigenic and Molecular Characterization of Wild Type 1 Poliovirus Causing Outbreaks of Poliomyelitis in Albania and Neighboring Countries in 1996

PubMed Central

Fiore, L.; Genovese, D.; Diamanti, E.; Catone, S.; Ridolfi, B.; Ibrahimi, B.; konomi, R.; van der Avoort, H. G. A. M.; Hovi, T.; Crainic, R.; Simeoni, P.; Amato, C.

1998-01-01

Mass vaccination has led poliomyelitis to become a rare disease in a large part of the world, including Western Europe. However, in the past 20 years wild polioviruses imported from countries where polio is endemic have been responsible for outbreaks in otherwise polio-free European countries. We report on the characterization of poliovirus isolates from a large outbreak of poliomyelitis that occurred in Albania in 1996 and that also spread to the neighboring countries of Yugoslavia and Greece. The epidemics involved 145 subjects, mostly young adults, and caused persisting paralysis in 87 individuals and 16 deaths. The agent responsible for the outbreak was isolated from 74 patients and was identified as wild type 1 poliovirus by both immunological and molecular methods. Sequence analysis of the genome demonstrated the involvement of a single virus strain throughout the epidemics, and genotyping analysis showed 95% homology of the strain with a wild type 1 poliovirus strain isolated in Pakistan in 1995. Neutralization assays with both human sera and monoclonal antibodies were performed to analyze the antigenic structure of the epidemic strain, suggesting its peculiar antigenic characteristics. The presented data underline the current risks of outbreaks due to imported wild poliovirus and emphasize the need to improve vaccination efforts and also the need to implement surveillance in countries free of indigenous wild poliovirus. PMID:9650935

Genome Structural Diversity among 31 Bordetella pertussis Isolates from Two Recent U.S. Whooping Cough Statewide Epidemics.

PubMed

Bowden, Katherine E; Weigand, Michael R; Peng, Yanhui; Cassiday, Pamela K; Sammons, Scott; Knipe, Kristen; Rowe, Lori A; Loparev, Vladimir; Sheth, Mili; Weening, Keeley; Tondella, M Lucia; Williams, Margaret M

2016-01-01

During 2010 and 2012, California and Vermont, respectively, experienced statewide epidemics of pertussis with differences seen in the demographic affected, case clinical presentation, and molecular epidemiology of the circulating strains. To overcome limitations of the current molecular typing methods for pertussis, we utilized whole-genome sequencing to gain a broader understanding of how current circulating strains are causing large epidemics. Through the use of combined next-generation sequencing technologies, this study compared de novo, single-contig genome assemblies from 31 out of 33 Bordetella pertussis isolates collected during two separate pertussis statewide epidemics and 2 resequenced vaccine strains. Final genome architecture assemblies were verified with whole-genome optical mapping. Sixteen distinct genome rearrangement profiles were observed in epidemic isolate genomes, all of which were distinct from the genome structures of the two resequenced vaccine strains. These rearrangements appear to be mediated by repetitive sequence elements, such as high-copy-number mobile genetic elements and rRNA operons. Additionally, novel and previously identified single nucleotide polymorphisms were detected in 10 virulence-related genes in the epidemic isolates. Whole-genome variation analysis identified state-specific variants, and coding regions bearing nonsynonymous mutations were classified into functional annotated orthologous groups. Comprehensive studies on whole genomes are needed to understand the resurgence of pertussis and develop novel tools to better characterize the molecular epidemiology of evolving B. pertussis populations. IMPORTANCE Pertussis, or whooping cough, is the most poorly controlled vaccine-preventable bacterial disease in the United States, which has experienced a resurgence for more than a decade. Once viewed as a monomorphic pathogen, B. pertussis strains circulating during epidemics exhibit diversity visible on a genome structural level, previously undetectable by traditional sequence analysis using short-read technologies. For the first time, we combine short- and long-read sequencing platforms with restriction optical mapping for single-contig, de novo assembly of 31 isolates to investigate two geographically and temporally independent U.S. pertussis epidemics. These complete genomes reshape our understanding of B. pertussis evolution and strengthen molecular epidemiology toward one day understanding the resurgence of pertussis.

Characteristics of group A Streptococcus strains circulating during scarlet fever epidemic, Beijing, China, 2011.

PubMed

Yang, Peng; Peng, Xiaomin; Zhang, Daitao; Wu, Shuangsheng; Liu, Yimeng; Cui, Shujuan; Lu, Guilan; Duan, Wei; Shi, Weixian; Liu, Shuang; Li, Jing; Wang, Quanyi

2013-06-01

Scarlet fever is one of a variety of diseases caused by group A Streptococcus (GAS). During 2011, a scarlet fever epidemic characterized by peak monthly incidence rates 2.9-6.7 times higher than those in 2006-2010 occurred in Beijing, China. During the epidemic, hospital-based enhanced surveillance for scarlet fever and pharyngitis was conducted to determine characteristics of circulating GAS strains. The surveillance identified 3,359 clinical cases of scarlet fever or pharyngitis. GAS was isolated from 647 of the patients; 76.4% of the strains were type emm12, and 17.1% were emm1. Almost all isolates harbored superantigens speC and ssa. All isolates were susceptible to penicillin, and resistance rates were 96.1% to erythromycin, 93.7% to tetracycline, and 79.4% to clindamycin. Because emm12 type GAS is not the predominant type in other countries, wider surveillance for the possible spread of emm12 type GAS from China to other countries is warranted.

Characteristics of Group A Streptococcus Strains Circulating during Scarlet Fever Epidemic, Beijing, China, 2011

PubMed Central

Yang, Peng; Peng, Xiaomin; Zhang, Daitao; Wu, Shuangsheng; Liu, Yimeng; Cui, Shujuan; Lu, Guilan; Duan, Wei; Shi, Weixian; Liu, Shuang; Li, Jing

2013-01-01

Scarlet fever is one of a variety of diseases caused by group A Streptococcus (GAS). During 2011, a scarlet fever epidemic characterized by peak monthly incidence rates 2.9–6.7 times higher than those in 2006–2010 occurred in Beijing, China. During the epidemic, hospital-based enhanced surveillance for scarlet fever and pharyngitis was conducted to determine characteristics of circulating GAS strains. The surveillance identified 3,359 clinical cases of scarlet fever or pharyngitis. GAS was isolated from 647 of the patients; 76.4% of the strains were type emm12, and 17.1% were emm1. Almost all isolates harbored superantigens speC and ssa. All isolates were susceptible to penicillin, and resistance rates were 96.1% to erythromycin, 93.7% to tetracycline, and 79.4% to clindamycin. Because emm12 type GAS is not the predominant type in other countries, wider surveillance for the possible spread of emm12 type GAS from China to other countries is warranted. PMID:23735582

Paradox of vaccination: is vaccination really effective against avian flu epidemics?

PubMed

Iwami, Shingo; Suzuki, Takafumi; Takeuchi, Yasuhiro

2009-01-01

Although vaccination can be a useful tool for control of avian influenza epidemics, it might engender emergence of a vaccine-resistant strain. Field and experimental studies show that some avian influenza strains acquire resistance ability against vaccination. We investigated, in the context of the emergence of a vaccine-resistant strain, whether a vaccination program can prevent the spread of infectious disease. We also investigated how losses from immunization by vaccination imposed by the resistant strain affect the spread of the disease. We designed and analyzed a deterministic compartment model illustrating transmission of vaccine-sensitive and vaccine-resistant strains during a vaccination program. We investigated how the loss of protection effectiveness impacts the program. Results show that a vaccination to prevent the spread of disease can instead spread the disease when the resistant strain is less virulent than the sensitive strain. If the loss is high, the program does not prevent the spread of the resistant strain despite a large prevalence rate of the program. The epidemic's final size can be larger than that before the vaccination program. We propose how to use poor vaccines, which have a large loss, to maximize program effects and describe various program risks, which can be estimated using available epidemiological data. We presented clear and simple concepts to elucidate vaccination program guidelines to avoid negative program effects. Using our theory, monitoring the virulence of the resistant strain and investigating the loss caused by the resistant strain better development of vaccination strategies is possible.

Evolutionary genomics of Staphylococcus aureus: insights into the origin of methicillin-resistant strains and the toxic shock syndrome epidemic.

PubMed

Fitzgerald, J R; Sturdevant, D E; Mackie, S M; Gill, S R; Musser, J M

2001-07-17

An emerging theme in medical microbiology is that extensive variation exists in gene content among strains of many pathogenic bacterial species. However, this topic has not been investigated on a genome scale with strains recovered from patients with well-defined clinical conditions. Staphylococcus aureus is a major human pathogen and also causes economically important infections in cows and sheep. A DNA microarray representing >90% of the S. aureus genome was used to characterize genomic diversity, evolutionary relationships, and virulence gene distribution among 36 strains of divergent clonal lineages, including methicillin-resistant strains and organisms causing toxic shock syndrome. Genetic variation in S. aureus is very extensive, with approximately 22% of the genome comprised of dispensable genetic material. Eighteen large regions of difference were identified, and 10 of these regions have genes that encode putative virulence factors or proteins mediating antibiotic resistance. We find that lateral gene transfer has played a fundamental role in the evolution of S. aureus. The mec gene has been horizontally transferred into distinct S. aureus chromosomal backgrounds at least five times, demonstrating that methicillin-resistant strains have evolved multiple independent times, rather than from a single ancestral strain. This finding resolves a long-standing controversy in S. aureus research. The epidemic of toxic shock syndrome that occurred in the 1970s was caused by a change in the host environment, rather than rapid geographic dissemination of a new hypervirulent strain. DNA microarray analysis of large samples of clinically characterized strains provides broad insights into evolution, pathogenesis, and disease emergence.

Genomic Epidemiology of Hypervirulent Serogroup W, ST-11 Neisseria meningitidis

PubMed Central

Mustapha, Mustapha M.; Marsh, Jane W.; Krauland, Mary G.; Fernandez, Jorge O.; de Lemos, Ana Paula S.; Dunning Hotopp, Julie C.; Wang, Xin; Mayer, Leonard W.; Lawrence, Jeffrey G.; Hiller, N. Luisa; Harrison, Lee H.

2015-01-01

Neisseria meningitidis is a leading bacterial cause of sepsis and meningitis globally with dynamic strain distribution over time. Beginning with an epidemic among Hajj pilgrims in 2000, serogroup W (W) sequence type (ST) 11 emerged as a leading cause of epidemic meningitis in the African ‘meningitis belt’ and endemic cases in South America, Europe, Middle East and China. Previous genotyping studies were unable to reliably discriminate sporadic W ST-11 strains in circulation since 1970 from the Hajj outbreak strain (Hajj clone). It is also unclear what proportion of more recent W ST-11 disease clusters are caused by direct descendants of the Hajj clone. Whole genome sequences of 270 meningococcal strains isolated from patients with invasive meningococcal disease globally from 1970 to 2013 were compared using whole genome phylogenetic and major antigen-encoding gene sequence analyses. We found that all W ST-11 strains were descendants of an ancestral strain that had undergone unique capsular switching events. The Hajj clone and its descendants were distinct from other W ST-11 strains in that they shared a common antigen gene profile and had undergone recombination involving virulence genes encoding factor H binding protein, nitric oxide reductase, and nitrite reductase. These data demonstrate that recent acquisition of a distinct antigen-encoding gene profile and variations in meningococcal virulence genes was associated with the emergence of the Hajj clone. Importantly, W ST-11 strains unrelated to the Hajj outbreak contribute a significant proportion of W ST-11 cases globally. This study helps illuminate genomic factors associated with meningococcal strain emergence and evolution. PMID:26629539

KINETIC PROFILE OF INFLUENZA VIRUS INFECTION IN THREE RAT STRAINS

EPA Science Inventory

Abstract

Influenza infection is a respiratory disease of viral origin that can cause major epidemics in man. The influenza virus infects and damages epithelial cells of the respiratory tract and causes pneumonia. Lung lesions of mice infected with influenza virus resembl...

Updates on chikungunya epidemiology, clinical disease, and diagnostics.

PubMed

Sam, I-Ching; Kümmerer, Beate M; Chan, Yoke-Fun; Roques, Pierre; Drosten, Christian; AbuBakar, Sazaly

2015-04-01

Chikungunya virus (CHIKV) is an Aedes-borne alphavirus, historically found in Africa and Asia, where it caused sporadic outbreaks. In 2004, CHIKV reemerged in East Africa and spread globally to cause epidemics, including, for the first time, autochthonous transmission in Europe, the Middle East, and Oceania. The epidemic strains were of the East/Central/South African genotype. Strains of the Asian genotype of CHIKV continued to cause outbreaks in Asia and spread to Oceania and, in 2013, to the Americas. Acute disease, mainly comprising fever, rash, and arthralgia, was previously regarded as self-limiting; however, there is growing evidence of severe but rare manifestations, such as neurological disease. Furthermore, CHIKV appears to cause a significant burden of long-term morbidity due to persistent arthralgia. Diagnostic assays have advanced greatly in recent years, although there remains a need for simple, accurate, and affordable tests for the developing countries where CHIKV is most prevalent. This review focuses on recent important work on the epidemiology, clinical disease and diagnostics of CHIKV.

Typing methods for the plague pathogen, Yersinia pestis.

PubMed

Lindler, Luther E

2009-01-01

Phenotypic and genotypic methodologies have been used to differentiate the etiological agent of plague, Yersinia pestis. Historically, phenotypic methods were used to place isolates into one of three biovars based on nitrate reduction and glycerol fermentation. Classification of Y. pestis into genetic subtypes is problematic due to the relative monomorphic nature of the pathogen. Resolution into groups is dependent on the number and types of loci used in the analysis. The last 5-10 years of research and analysis in the field of Y. pestis genotyping have resulted in a recognition by Western scientists that two basic types of Y. pestis exist. One type, considered to be classic strains that are able to cause human plague transmitted by the normal flea vector, is termed epidemic strains. The other type does not typically cause human infections by normal routes of infection, but is virulent for rodents and is termed endemic strains. Previous classification schemes used outside the Western hemisphere referred to these latter strains as Pestoides varieties of Y. pestis. Recent molecular analysis has definitely shown that both endemic and epidemic strains arose independently from a common Yersinia pseudotuberculosis ancestor. Currently, 11 major groups of Y. pestis are defined globally.

Whole-Genome Characterization of Epidemic Neisseria meningitidis Serogroup C and Resurgence of Serogroup W, Niger, 2015.

PubMed

Kretz, Cecilia B; Retchless, Adam C; Sidikou, Fati; Issaka, Bassira; Ousmane, Sani; Schwartz, Stephanie; Tate, Ashley H; Pana, Assimawè; Njanpop-Lafourcade, Berthe-Marie; Nzeyimana, Innocent; Nse, Ricardo Obama; Deghmane, Ala-Eddine; Hong, Eva; Brynildsrud, Ola Brønstad; Novak, Ryan T; Meyer, Sarah A; Oukem-Boyer, Odile Ouwe Missi; Ronveaux, Olivier; Caugant, Dominique A; Taha, Muhamed-Kheir; Wang, Xin

2016-10-01

In 2015, Niger reported the largest epidemic of Neisseria meningitidis serogroup C (NmC) meningitis in sub-Saharan Africa. The NmC epidemic coincided with serogroup W (NmW) cases during the epidemic season, resulting in a total of 9,367 meningococcal cases through June 2015. To clarify the phylogenetic association, genetic evolution, and antibiotic determinants of the meningococcal strains in Niger, we sequenced the genomes of 102 isolates from this epidemic, comprising 81 NmC and 21 NmW isolates. The genomes of 82 isolates were completed, and all 102 were included in the analysis. All NmC isolates had sequence type 10217, which caused the outbreaks in Nigeria during 2013-2014 and for which a clonal complex has not yet been defined. The NmC isolates from Niger were substantially different from other NmC isolates collected globally. All NmW isolates belonged to clonal complex 11 and were closely related to the isolates causing recent outbreaks in Africa.

Periodic re-emergence of endemic strains with strong epidemic potential-a proposed explanation for the 2004 Indonesian dengue epidemic.

PubMed

Ong, Swee Hoe; Yip, Jin Teen; Chen, Yen Liang; Liu, Wei; Harun, Syahrial; Lystiyaningsih, Erlin; Heriyanto, Bambang; Beckett, Charmagne G; Mitchell, Wayne P; Hibberd, Martin L; Suwandono, Agus; Vasudevan, Subhash G; Schreiber, Mark J

2008-03-01

Indonesia experienced a severe dengue epidemic in the first quarter of 2004 with 58,301 cases and 658 deaths reported to the WHO. All four dengue virus (DENV) serotypes were detected, with DENV-3 the predominant strain. To ascertain the molecular epidemiology of the DENV associated with the epidemic, complete genomes of 15 isolates were sequenced from patient serum collected in Jakarta during the epidemic, and two historical DENV-3 isolates from previous epidemics in 1988 and 1998 were selectively sequenced for comparative studies. Phylogenetic trees for all four serotypes indicate the viruses are endemic strains that have been circulating in Indonesia for a few decades. Whole-genome phylogeny showed the 2004 DENV-3 isolates share high similarity with those isolated in 1998 during a major epidemic in Sumatra. Together these subtype I DENV-3 strains form a Sumatran-Javan clade with demonstrated epidemic potential. No newly-acquired amino acid mutations were found while comparing genomes from the two epidemics. This suggests re-emergence of little-changed endemic strains as causative agents of the epidemic in 2004. Notably, the molecular evidence rules out change in the viral genomes as the trigger of the epidemic.

Population and genetic study of Vibrio cholerae from the amazon environment confirms that the WASA-1 prophage is the main marker of the epidemic strain that circulated in the region.

PubMed

Morais, Lena Líllian Canto de Sá; Garza, Daniel Rios; Loureiro, Edvaldo Carlos Brito; Vale, Elivam Rodrigues; Santos, Denise Suéllem Amorim de Sousa; Corrêa, Vanessa Cavaleiro; Sousa, Nayara Rufino; Gurjão, Tereza Cristina Monteiro; Santos, Elisabeth Conceição de Oliveira; Vieira, Verônica Viana; da Fonseca, Erica Lourenço; Vicente, Ana Carolina Paulo

2013-01-01

Vibrio cholerae is a natural inhabitant of many aquatic environments in the world. Biotypes harboring similar virulence-related gene clusters are the causative agents of epidemic cholera, but the majority of strains are harmless to humans. Since 1971, environmental surveillance for potentially pathogenic V. cholerae has resulted in the isolation of many strains from the Brazilian Amazon aquatic ecosystem. Most of these strains are from the non-O1/non-O139 serogroups (NAGs), but toxigenic O1 strains were isolated during the Latin America cholera epidemic in the region (1991-1996). A collection of environmental V. cholerae strains from the Brazilian Amazon belonging to pre-epidemic (1977-1990), epidemic (1991-1996), and post-epidemic (1996-2007) periods in the region, was analyzed. The presence of genes related to virulence within the species and the genetic relationship among the strains were studied. These variables and the information available concerning the strains were used to build a Bayesian multivariate dependency model to distinguish the importance of each variable in determining the others. Some genes related to the epidemic strains were found in environmental NAGs during and after the epidemic. Significant diversity among the virulence-related gene content was observed among O1 strains isolated from the environment during the epidemic period, but not from clinical isolates, which were analyzed as controls. Despite this diversity, these strains exhibited similar PFGE profiles. PFGE profiles were significant while separating potentially epidemic clones from indigenous strains. No significant correlation with isolation source, place or period was observed. The presence of the WASA-1 prophage significantly correlated with serogroups, PFGE profiles, and the presence of virulence-related genes. This study provides a broad characterization of the environmental V. cholerae population from the Amazon, and also highlights the importance of identifying precisely defined genetic markers such as the WASA-1 prophage for the surveillance of cholera.

Population and Genetic Study of Vibrio cholerae from the Amazon Environment Confirms that the WASA-1 Prophage Is the Main Marker of the Epidemic Strain that Circulated in the Region

PubMed Central

Morais, Lena Líllian Canto de Sá; Garza, Daniel Rios; Loureiro, Edvaldo Carlos Brito; Vale, Elivam Rodrigues; Santos, Denise Suéllem Amorim de Sousa; Corrêa, Vanessa Cavaleiro; Sousa, Nayara Rufino; Gurjão, Tereza Cristina Monteiro; Santos, Elisabeth Conceição de Oliveira; Vieira, Verônica Viana; da Fonseca, Erica Lourenço; Vicente, Ana Carolina Paulo

2013-01-01

Vibrio cholerae is a natural inhabitant of many aquatic environments in the world. Biotypes harboring similar virulence-related gene clusters are the causative agents of epidemic cholera, but the majority of strains are harmless to humans. Since 1971, environmental surveillance for potentially pathogenic V. cholerae has resulted in the isolation of many strains from the Brazilian Amazon aquatic ecosystem. Most of these strains are from the non-O1/non-O139 serogroups (NAGs), but toxigenic O1 strains were isolated during the Latin America cholera epidemic in the region (1991-1996). A collection of environmental V. cholerae strains from the Brazilian Amazon belonging to pre-epidemic (1977-1990), epidemic (1991-1996), and post-epidemic (1996-2007) periods in the region, was analyzed. The presence of genes related to virulence within the species and the genetic relationship among the strains were studied. These variables and the information available concerning the strains were used to build a Bayesian multivariate dependency model to distinguish the importance of each variable in determining the others. Some genes related to the epidemic strains were found in environmental NAGs during and after the epidemic. Significant diversity among the virulence-related gene content was observed among O1 strains isolated from the environment during the epidemic period, but not from clinical isolates, which were analyzed as controls. Despite this diversity, these strains exhibited similar PFGE profiles. PFGE profiles were significant while separating potentially epidemic clones from indigenous strains. No significant correlation with isolation source, place or period was observed. The presence of the WASA-1 prophage significantly correlated with serogroups, PFGE profiles, and the presence of virulence-related genes. This study provides a broad characterization of the environmental V. cholerae population from the Amazon, and also highlights the importance of identifying precisely defined genetic markers such as the WASA-1 prophage for the surveillance of cholera. PMID:24303045

Deletion and Complementation of the Mating Type (MAT) Locus of the Wheat Head Blight Pathogen Gibberella zeae

PubMed Central

Desjardins, A. E.; Brown, D. W.; Yun, S.-H.; Proctor, R. H.; Lee, T.; Plattner, R. D.; Lu, S.-W.; Turgeon, B. G.

2004-01-01

Gibberella zeae, a self-fertile, haploid filamentous ascomycete, causes serious epidemics of wheat (Triticum aestivum) head blight worldwide and contaminates grain with trichothecene mycotoxins. Anecdotal evidence dating back to the late 19th century indicates that G. zeae ascospores (sexual spores) are a more important inoculum source than are macroconidia (asexual spores), although the fungus can produce both during wheat head blight epidemics. To develop fungal strains to test this hypothesis, the entire mating type (MAT1) locus was deleted from a self-fertile (MAT1-1/MAT1-2), virulent, trichothecene-producing wild-type strain of G. zeae. The resulting MAT deletion (mat1-1/mat1-2) strains were unable to produce perithecia or ascospores and appeared to be unable to mate with the fertile strain from which they were derived. Complementation of a MAT deletion strain by transformation with a copy of the entire MAT locus resulted in recovery of production of perithecia and ascospores. MAT deletion strains and MAT-complemented strains retained the ability to produce macroconidia that could cause head blight, as assessed by direct injection into wheat heads in greenhouse tests. Availability of MAT-null and MAT-complemented strains provides a means to determine the importance of ascospores in the biology of G. zeae and perhaps to identify novel approaches to control wheat head blight. PMID:15066842

[The characteristics of epidemic influenza A and B virus strains circulating in Russia during the 2007-2008 season].

PubMed

Ivanova, V T; Trushakova, S V; Oskerko, T A; Shevchenko, E S; Kolobukhina, L V; Vartanian, R V; Beliakova, N V; Iatsyshina, S B; Feodoritova, E L; Zueva, N D; Burtseva, E I

2009-01-01

In 2007-2008 in Russia, the epidemic upsurge of influenza morbidity was caused by the active circulation of influenza A(H1N1, A(H3N2), and B viruses. The center for Ecology and Epidemiology of Influenza studied 334 epidemic strains. The results of a comparative study of the svirus specificity of commercial test systems (AmpliSens Influenza virus A/B and AmpliSens Influenza virus A/H5N1) for the polymerase chain reaction diagnosis and virological assays, including virus isolation, revealed their high correlation, which confirms that they may be expensively used to monitor the circulation of influenza viruses in the Russian Federation. All the strains were isolated in the MDCK cell culture. Influenza A(H1N1) viruses (n = 127) were antigenic variants of the reference strains A/Solomon Islands/3/06 and A/Brisbane/59107. Influenza A(H3N2) viruses (n = 49) were antigenic variants of the reference strains A/Wisconsin/67/05 and A/Brisbane/10/08. One hundred and fifty seven Influenza B strains were drift variants of the reference strains B/Florida/4/06 and B/Shanghai/361/02 of lineage B/Yamagata/16/88 and one strain, a variant of Malaysia/2506/04 related to lineage B/victoria/2/87. The isolates interacted actively with human 0(I) blood group erythrocytes and much more weakly with chicken ones. All study influenza A(H1N1) viruses (n = 74) preserved their sensitivity to rimantadine while 24 (77%) of the 31 study influenza A(H3N2) virus strains were resistant. A study of the time course of changes in the generation of antibodies in the donor sera obtained in Moscow and the Moscow Region in different periods of the epidemic process revealed an increase in antibodies to the reference influenza A and B virus strains circulating in this period.

Deciphering the Origin of the 2012 Cholera Epidemic in Guinea by Integrating Epidemiological and Molecular Analyses

PubMed Central

Rebaudet, Stanislas; Mengel, Martin A.; Koivogui, Lamine; Moore, Sandra; Mutreja, Ankur; Kande, Yacouba; Yattara, Ousmane; Sarr Keita, Véronique; Njanpop-Lafourcade, Berthe-Marie; Fournier, Pierre-Edouard; Garnotel, Eric; Keita, Sakoba; Piarroux, Renaud

2014-01-01

Cholera is typically considered endemic in West Africa, especially in the Republic of Guinea. However, a three-year lull period was observed from 2009 to 2011, before a new epidemic struck the country in 2012, which was officially responsible for 7,350 suspected cases and 133 deaths. To determine whether cholera re-emerged from the aquatic environment or was rather imported due to human migration, a comprehensive epidemiological and molecular survey was conducted. A spatiotemporal analysis of the national case databases established Kaback Island, located off the southern coast of Guinea, as the initial focus of the epidemic in early February. According to the field investigations, the index case was found to be a fisherman who had recently arrived from a coastal district of neighboring Sierra Leone, where a cholera outbreak had recently occurred. MLVA-based genotype mapping of 38 clinical Vibrio cholerae O1 El Tor isolates sampled throughout the epidemic demonstrated a progressive genetic diversification of the strains from a single genotype isolated on Kaback Island in February, which correlated with spatial epidemic spread. Whole-genome sequencing characterized this strain as an “atypical” El Tor variant. Furthermore, genome-wide SNP-based phylogeny analysis grouped the Guinean strain into a new clade of the third wave of the seventh pandemic, distinct from previously analyzed African strains and directly related to a Bangladeshi isolate. Overall, these results highly suggest that the Guinean 2012 epidemic was caused by a V. cholerae clone that was likely imported from Sierra Leone by an infected individual. These results indicate the importance of promoting the cross-border identification and surveillance of mobile and vulnerable populations, including fishermen, to prevent, detect and control future epidemics in the region. Comprehensive epidemiological investigations should be expanded to better understand cholera dynamics and improve disease control strategies throughout the African continent. PMID:24901522

Inactivation of SAM-Methyltransferase is the Mechanism of Attenuation of a Historic Louse Borne Typhus Vaccine Strain

PubMed Central

Liu, Yan; Wu, Bin; Weinstock, George; Walker, David H.; Yu, Xue-jie

2014-01-01

Louse borne typhus (also called epidemic typhus) was one of man's major scourges, and epidemics of the disease can be reignited when social, economic, or political systems are disrupted. The fear of a bioterrorist attack using the etiologic agent of typhus, Rickettsia prowazekii, was a reality. An attenuated typhus vaccine, R. prowazekii Madrid E strain, was observed to revert to virulence as demonstrated by isolation of the virulent revertant Evir strain from animals which were inoculated with Madrid E strain. The mechanism of the mutation in R. prowazekii that affects the virulence of the vaccine was not known. We sequenced the genome of the virulent revertant Evir strain and compared its genome sequence with the genome sequences of its parental strain, Madrid E. We found that only a single nucleotide in the entire genome was different between the vaccine strain Madrid E and its virulent revertant strain Evir. The mutation is a single nucleotide insertion in the methyltransferase gene (also known as PR028) in the vaccine strain that inactivated the gene. We also confirmed that the vaccine strain E did not cause fever in guinea pigs and the virulent revertant strain Evir caused fever in guinea pigs. We concluded that a single nucleotide insertion in the methyltransferase gene of R. prowazekii attenuated the R. prowazekii vaccine strain E. This suggested that an irreversible insertion or deletion mutation in the methyl transferase gene of R. prowazekii is required for Madrid E to be considered a safe vaccine. PMID:25412248

Inactivation of SAM-methyltransferase is the mechanism of attenuation of a historic louse borne typhus vaccine strain.

PubMed

Liu, Yan; Wu, Bin; Weinstock, George; Walker, David H; Yu, Xue-Jie

2014-01-01

Louse borne typhus (also called epidemic typhus) was one of man's major scourges, and epidemics of the disease can be reignited when social, economic, or political systems are disrupted. The fear of a bioterrorist attack using the etiologic agent of typhus, Rickettsia prowazekii, was a reality. An attenuated typhus vaccine, R. prowazekii Madrid E strain, was observed to revert to virulence as demonstrated by isolation of the virulent revertant Evir strain from animals which were inoculated with Madrid E strain. The mechanism of the mutation in R. prowazekii that affects the virulence of the vaccine was not known. We sequenced the genome of the virulent revertant Evir strain and compared its genome sequence with the genome sequences of its parental strain, Madrid E. We found that only a single nucleotide in the entire genome was different between the vaccine strain Madrid E and its virulent revertant strain Evir. The mutation is a single nucleotide insertion in the methyltransferase gene (also known as PR028) in the vaccine strain that inactivated the gene. We also confirmed that the vaccine strain E did not cause fever in guinea pigs and the virulent revertant strain Evir caused fever in guinea pigs. We concluded that a single nucleotide insertion in the methyltransferase gene of R. prowazekii attenuated the R. prowazekii vaccine strain E. This suggested that an irreversible insertion or deletion mutation in the methyl transferase gene of R. prowazekii is required for Madrid E to be considered a safe vaccine.

Dynamics of a stochastic multi-strain SIS epidemic model driven by Lévy noise

NASA Astrophysics Data System (ADS)

Chen, Can; Kang, Yanmei

2017-01-01

A stochastic multi-strain SIS epidemic model is formulated by introducing Lévy noise into the disease transmission rate of each strain. First, we prove that the stochastic model admits a unique global positive solution, and, by the comparison theorem, we show that the solution remains within a positively invariant set almost surely. Next we investigate stochastic stability of the disease-free equilibrium, including stability in probability and pth moment asymptotic stability. Then sufficient conditions for persistence in the mean of the disease are established. Finally, based on an Euler scheme for Lévy-driven stochastic differential equations, numerical simulations for a stochastic two-strain model are carried out to verify the theoretical results. Moreover, numerical comparison results of the stochastic two-strain model and the deterministic version are also given. Lévy noise can cause the two strains to become extinct almost surely, even though there is a dominant strain that persists in the deterministic model. It can be concluded that the introduction of Lévy noise reduces the disease extinction threshold, which indicates that Lévy noise may suppress the disease outbreak.

Listeriolysin S: A bacteriocin from epidemic Listeria monocytogenes strains that targets the gut microbiota.

PubMed

Quereda, Juan J; Meza-Torres, Jazmín; Cossart, Pascale; Pizarro-Cerdá, Javier

2017-07-04

Listeria monocytogenes is a Gram-positive food-borne pathogen that in humans may traverse the intestinal, placental and blood/brain barriers, causing gastroenteritis, abortions and meningitis. Crossing of these barriers is dependent on the bacterial ability to enter host cells, and several L. monocytogenes surface and secreted virulence factors are known to facilitate entry and the intracellular lifecycle. The study of L. monocytogenes strains associated to human listeriosis epidemics has revealed the presence of novel virulence factors. One such factor is Listeriolysin S, a thiazole/oxazole modified microcin that displays bactericidal activity and modifies the host microbiota during infection. Our recent results therefore highlight the interaction of L. monocytogenes with gut microbes as a crucial step in epidemic listeriosis. In this article, we will discuss novel implications for this family of toxins in the pathogenesis of diverse medically relevant microorganisms.

Human respiratory syncytial virus genomic and antigenic variants isolated in two hospitals during one epidemic, in Santiago, Chile.

PubMed

Luchsinger, Vivian; Noy, Andrea Elgueta; Avendaño, Luis F

2008-07-01

Human respiratory syncytial virus (HRSV) is a major cause of severe lower respiratory tract infection (LRI) in children. Distinct variants of the viruses have been described. The objective was to compare the antigenic and genetic variability of HRSV strains recovered from infants admitted to two hospitals during one epidemic in a big city. We analyzed nasopharyngeal aspirates from 201 infants admitted for LRI to two hospitals during 2002 in Santiago, Chile. The analyses were carried out using a panel of monoclonal antibodies against G glycoprotein epitopes (EIA) and RFLP for N and G genes. No differences in HRSV groups A/B and in N patterns distribution were observed among both hospitals. On the contrary, antigenic and genetic G patterns displayed a wide diversity of strains circulating during one epidemic, in one big city. RSV variability assessment depended rather on the tool used for analysis than on the geographical location.

Listeriolysin S: A bacteriocin from epidemic Listeria monocytogenes strains that targets the gut microbiota

PubMed Central

Quereda, Juan J.; Meza-Torres, Jazmín; Cossart, Pascale; Pizarro-Cerdá, Javier

2017-01-01

ABSTRACT Listeria monocytogenes is a Gram-positive food-borne pathogen that in humans may traverse the intestinal, placental and blood/brain barriers, causing gastroenteritis, abortions and meningitis. Crossing of these barriers is dependent on the bacterial ability to enter host cells, and several L. monocytogenes surface and secreted virulence factors are known to facilitate entry and the intracellular lifecycle. The study of L. monocytogenes strains associated to human listeriosis epidemics has revealed the presence of novel virulence factors. One such factor is Listeriolysin S, a thiazole/oxazole modified microcin that displays bactericidal activity and modifies the host microbiota during infection. Our recent results therefore highlight the interaction of L. monocytogenes with gut microbes as a crucial step in epidemic listeriosis. In this article, we will discuss novel implications for this family of toxins in the pathogenesis of diverse medically relevant microorganisms. PMID:28156183

[No connection between scarlet fever and gouty fever. Historical analysis from Ytre Nordhordland during 1862-1884].

PubMed

Sandvik, H

1992-12-10

In 1987 there was an unexplained increase in severe streptococcal diseases in Norway and other western countries. In Norway this increase was not accompanied by a corresponding increase in acute rheumatic fever. This study investigated the occurrence of scarlet fever and acute rheumatic fever in a rural district (approximately 15,000 inhabitants) of western Norway during the years 1862-1884. Four epidemics of severe scarlet fever occurred during this period. The local doctor treated 1,155 patients (96% children), of whom 154 (13.3%) died. Acute glomerulonephritis with subsequent kidney failure seems to have been a major cause of death. During the same period 76 patients (96% adults) were treated for acute rheumatic fever. These cases were not related to the severe epidemics of scarlet fever. It is probable that different, co-circulating strains of streptococci caused the infections, which were followed by glomerulonephritis and rheumatic fever. It is possible that rheumatic fever was caused by the strain that induced the more benign "Angina tonsillaris".

Importance of exfoliatin toxin A production by Staphylococcus aureus strains isolated from clustered epidemics of neonatal pustulosis.

PubMed Central

Kaplan, M H; Chmel, H; Hsieh, H C; Stephens, A; Brinsko, V

1986-01-01

Clustered epidemics of pustulosis due to Staphylococcus aureus occurred in two geographically distant newborn nurseries. In nurseries A and B an attack rate of pustulosis of 0.8 and 2.0 cases per 100 live births occurred, respectively. Experimental phage type 1046/1116 belonging to phage group II dominated clustered epidemics in nursery A, while group II phage type 3A/3C/55/71 and 3A/3C/55 occurred in nursery B. Other group II strains also occasionally produced clustered epidemics. These epidemic strains were found to be making heat-stable dermal exfoliatin toxin A (ETA) which had a pI of 6.8 and a molecular weight of 32,000 and 33,000. ETA-bearing strains did not make bacteriocin. Children infected with ETA-producing strains developed extensive bullous pustulosis. Surveillance cultures of personnel revealed an ETA-bearing strain in only one person. This strain was not the same phage type as the epidemic cluster. In contrast, ETA-bearing epidemic strains were found in the inanimate environment of both nurseries. ETA protein acts as an important virulence factor in the production of neonatal pustulosis infection and appears to be linked with the ability of S. aureus organisms to stick to the inanimate environment. Images PMID:3700612

Genome characterization of a novel binary toxin-positive strain of Clostridium difficile and comparison with the epidemic 027 and 078 strains.

PubMed

Peng, Zhong; Liu, Sidi; Meng, Xiujuan; Liang, Wan; Xu, Zhuofei; Tang, Biao; Wang, Yuanguo; Duan, Juping; Fu, Chenchao; Wu, Bin; Wu, Anhua; Li, Chunhui

2017-01-01

Clostridium difficile is an anaerobic Gram-positive spore-forming gut pathogen that causes antibiotic-associated diarrhea worldwide. A small number of C. difficile strains express the binary toxin (CDT), which is generally found in C. difficile 027 (ST1) and/or 078 (ST11) in clinic. However, we isolated a binary toxin-positive non-027, non-078 C. difficile LC693 that is associated with severe diarrhea in China. The genotype of this strain was determined as ST201. To understand the pathogenesis-basis of C. difficile ST201, the strain LC693 was chosen for whole genome sequencing, and its genome sequence was analyzed together with the other two ST201 strains VL-0104 and VL-0391 and compared to the epidemic 027/ST1 and 078/ST11 strains. The project finally generated an estimated genome size of approximately 4.07 Mbp for strain LC693. Genome size of the three ST201 strains ranged from 4.07 to 4.16 Mb, with an average GC content between 28.5 and 28.9%. Phylogenetic analysis demonstrated that the ST201 strains belonged to clade 3. The ST201 genomes contained more than 40 antibiotic resistance genes and 15 of them were predicted to be associated with vancomycin-resistance. The ST201 strains contained a larger PaLoc with a Tn6218 element inserted than the 027/ST1 and 078/ST11 strains, and encoded a truncated TcdC. In addition, the ST201 strains contained intact binary toxin coding and regulation genes which are highly homologous to the 027/ST1 strain. Genome comparison of the ST201 strains with the epidemic 027 and 078 strain identified 641 genes specific for C. difficile ST201, and a number of them were predicted as fitness and virulence associated genes. The presence of those genes also contributes to the pathogenesis of the ST201 strains. In this study, the genomic characterization of three binary toxin-positive C. difficile ST201 strains in clade 3 was discussed and compared to the genomes of the epidemic 027 and the 078 strains. Our analysis identified a number fitness and virulence associated genes/loci in the ST201 genomes that contribute to the pathogenesis of C. difficile ST201.

Identification of an atypical strain of Toxoplasma gondii as the cause of a waterborne outbreak of toxoplasmosis in Santa IsabeldoIvai, Brazil

USDA-ARS?s Scientific Manuscript database

We have identified an atypical strain of Toxoplasmagondii as the causative agent of the 2001 outbreak of toxoplasmosis in Santa Isabel do Ivai, Brazil, which resulted in approximately 426 human infections. The epidemic clone was isolated from multiple water filters collected from a cistern linked ep...

Ecology of West Nile Fever across four European countries: Review of weather profiles, vector population dynamics and vector control response

USDA-ARS?s Scientific Manuscript database

West Nile virus (WNV) represents a serious burden to human and animal health because of its capacity to cause large unforeseen epidemics. Until 2004, only lineage 1 and 3 WNV strains had been found in Europe. Lineage 2 strains were initially isolated in 2004 (Hungary), again in 2008 (Austria), and f...

Epidemic Population Structure of Pseudomonas aeruginosa: Evidence for a Clone That Is Pathogenic to the Eye and That Has a Distinct Combination of Virulence Factors

PubMed Central

Lomholt, Jeanet A.; Poulsen, Knud; Kilian, Mogens

2001-01-01

The genetic structure of a population of Pseudomonas aeruginosa, isolated from patients with keratitis, endophthalmitis, and contact lens-associated red eye, contact lens storage cases, urine, ear, blood, lungs, wounds, feces, and the environment was determined by multilocus enzyme electrophoresis. The presence and characteristics of virulence factors were determined by restriction fragment length polymorphism analysis with DNA probes for lasA, lasB, aprA, exoS, exoT, exoU, and ctx and by zymography of staphylolysin, elastase, and alkaline protease. These analyses revealed an epidemic population structure of P. aeruginosa, characterized by frequent recombination in which a particular successful clone may increase, predominate for a time, and then disasappear as a result of recombination. Epidemic clones were found among isolates from patients with keratitis. They were characterized by high activity of a hitherto-unrecognized size variant of elastase, high alkaline protease activity, and possession of the exoU gene encoding the cytotoxic exoenzyme U. These virulence determinants are not exclusive traits in strains causing keratitis, as strains with other properties may cause keratitis in the presence of predisposing conditions. There were no uniform patterns of characteristics of isolates from other types of infection; however, all strains from urinary tract infections possessed the exoS gene, all strains from environment and feces and the major part of keratitis and wound isolates exhibited high elastase and alkaline protease activity, and all strains from feces showed high staphylolysin activity, indicating that these virulence factors may be important in the pathogenesis of these infectious diseases. PMID:11553572

Evolutionary pathway to increased virulence and epidemic group A Streptococcus disease derived from 3,615 genome sequences.

PubMed

Nasser, Waleed; Beres, Stephen B; Olsen, Randall J; Dean, Melissa A; Rice, Kelsey A; Long, S Wesley; Kristinsson, Karl G; Gottfredsson, Magnus; Vuopio, Jaana; Raisanen, Kati; Caugant, Dominique A; Steinbakk, Martin; Low, Donald E; McGeer, Allison; Darenberg, Jessica; Henriques-Normark, Birgitta; Van Beneden, Chris A; Hoffmann, Steen; Musser, James M

2014-04-29

We sequenced the genomes of 3,615 strains of serotype Emm protein 1 (M1) group A Streptococcus to unravel the nature and timing of molecular events contributing to the emergence, dissemination, and genetic diversification of an unusually virulent clone that now causes epidemic human infections worldwide. We discovered that the contemporary epidemic clone emerged in stepwise fashion from a precursor cell that first contained the phage encoding an extracellular DNase virulence factor (streptococcal DNase D2, SdaD2) and subsequently acquired the phage encoding the SpeA1 variant of the streptococcal pyrogenic exotoxin A superantigen. The SpeA2 toxin variant evolved from SpeA1 by a single-nucleotide change in the M1 progenitor strain before acquisition by horizontal gene transfer of a large chromosomal region encoding secreted toxins NAD(+)-glycohydrolase and streptolysin O. Acquisition of this 36-kb region in the early 1980s into just one cell containing the phage-encoded sdaD2 and speA2 genes was the final major molecular event preceding the emergence and rapid intercontinental spread of the contemporary epidemic clone. Thus, we resolve a decades-old controversy about the type and sequence of genomic alterations that produced this explosive epidemic. Analysis of comprehensive, population-based contemporary invasive strains from seven countries identified strong patterns of temporal population structure. Compared with a preepidemic reference strain, the contemporary clone is significantly more virulent in nonhuman primate models of pharyngitis and necrotizing fasciitis. A key finding is that the molecular evolutionary events transpiring in just one bacterial cell ultimately have produced millions of human infections worldwide.

Evolutionary pathway to increased virulence and epidemic group A Streptococcus disease derived from 3,615 genome sequences

PubMed Central

Nasser, Waleed; Beres, Stephen B.; Olsen, Randall J.; Dean, Melissa A.; Rice, Kelsey A.; Long, S. Wesley; Kristinsson, Karl G.; Gottfredsson, Magnus; Vuopio, Jaana; Raisanen, Kati; Caugant, Dominique A.; Steinbakk, Martin; Low, Donald E.; McGeer, Allison; Darenberg, Jessica; Henriques-Normark, Birgitta; Van Beneden, Chris A.; Hoffmann, Steen; Musser, James M.

2014-01-01

We sequenced the genomes of 3,615 strains of serotype Emm protein 1 (M1) group A Streptococcus to unravel the nature and timing of molecular events contributing to the emergence, dissemination, and genetic diversification of an unusually virulent clone that now causes epidemic human infections worldwide. We discovered that the contemporary epidemic clone emerged in stepwise fashion from a precursor cell that first contained the phage encoding an extracellular DNase virulence factor (streptococcal DNase D2, SdaD2) and subsequently acquired the phage encoding the SpeA1 variant of the streptococcal pyrogenic exotoxin A superantigen. The SpeA2 toxin variant evolved from SpeA1 by a single-nucleotide change in the M1 progenitor strain before acquisition by horizontal gene transfer of a large chromosomal region encoding secreted toxins NAD+-glycohydrolase and streptolysin O. Acquisition of this 36-kb region in the early 1980s into just one cell containing the phage-encoded sdaD2 and speA2 genes was the final major molecular event preceding the emergence and rapid intercontinental spread of the contemporary epidemic clone. Thus, we resolve a decades-old controversy about the type and sequence of genomic alterations that produced this explosive epidemic. Analysis of comprehensive, population-based contemporary invasive strains from seven countries identified strong patterns of temporal population structure. Compared with a preepidemic reference strain, the contemporary clone is significantly more virulent in nonhuman primate models of pharyngitis and necrotizing fasciitis. A key finding is that the molecular evolutionary events transpiring in just one bacterial cell ultimately have produced millions of human infections worldwide. PMID:24733896

Molecular genetic anatomy of inter- and intraserotype variation in the human bacterial pathogen group A Streptococcus.

PubMed

Beres, Stephen B; Richter, Ellen W; Nagiec, Michal J; Sumby, Paul; Porcella, Stephen F; DeLeo, Frank R; Musser, James M

2006-05-02

In recent years we have studied the relationship between strain genotypes and patient phenotypes in group A Streptococcus (GAS), a model human bacterial pathogen that causes extensive morbidity and mortality worldwide. We have concentrated our efforts on serotype M3 organisms because these strains are common causes of pharyngeal and invasive infections, produce unusually severe invasive infections, and can exhibit epidemic behavior. Our studies have been hindered by the lack of genome-scale phylogenies of multiple GAS strains and whole-genome sequences of multiple serotype M3 strains recovered from individuals with defined clinical phenotypes. To remove some of these impediments, we sequenced to closure the genome of four additional GAS strains and conducted comparative genomic resequencing of 12 contemporary serotype M3 strains representing distinct genotypes and phenotypes. Serotype M3 strains are a single phylogenetic lineage. Strains from asymptomatic throat carriers were significantly less virulent for mice than sterile-site isolates and evolved to a less virulent phenotype by multiple genetic pathways. Strain persistence or extinction between epidemics was strongly associated with presence or absence, respectively, of the prophage encoding streptococcal pyrogenic exotoxin A. A serotype M3 clone significantly underrepresented among necrotizing fasciitis cases has a unique frameshift mutation that truncates MtsR, a transcriptional regulator controlling expression of genes encoding iron-acquisition proteins. Expression microarray analysis of this clone confirmed significant alteration in expression of genes encoding iron metabolism proteins. Our analysis provided unprecedented detail about the molecular anatomy of bacterial strain genotype-patient phenotype relationships.

Molecular complexity of successive bacterial epidemics deconvoluted by comparative pathogenomics.

PubMed

Beres, Stephen B; Carroll, Ronan K; Shea, Patrick R; Sitkiewicz, Izabela; Martinez-Gutierrez, Juan Carlos; Low, Donald E; McGeer, Allison; Willey, Barbara M; Green, Karen; Tyrrell, Gregory J; Goldman, Thomas D; Feldgarden, Michael; Birren, Bruce W; Fofanov, Yuriy; Boos, John; Wheaton, William D; Honisch, Christiane; Musser, James M

2010-03-02

Understanding the fine-structure molecular architecture of bacterial epidemics has been a long-sought goal of infectious disease research. We used short-read-length DNA sequencing coupled with mass spectroscopy analysis of SNPs to study the molecular pathogenomics of three successive epidemics of invasive infections involving 344 serotype M3 group A Streptococcus in Ontario, Canada. Sequencing the genome of 95 strains from the three epidemics, coupled with analysis of 280 biallelic SNPs in all 344 strains, revealed an unexpectedly complex population structure composed of a dynamic mixture of distinct clonally related complexes. We discovered that each epidemic is dominated by micro- and macrobursts of multiple emergent clones, some with distinct strain genotype-patient phenotype relationships. On average, strains were differentiated from one another by only 49 SNPs and 11 insertion-deletion events (indels) in the core genome. Ten percent of SNPs are strain specific; that is, each strain has a unique genome sequence. We identified nonrandom temporal-spatial patterns of strain distribution within and between the epidemic peaks. The extensive full-genome data permitted us to identify genes with significantly increased rates of nonsynonymous (amino acid-altering) nucleotide polymorphisms, thereby providing clues about selective forces operative in the host. Comparative expression microarray analysis revealed that closely related strains differentiated by seemingly modest genetic changes can have significantly divergent transcriptomes. We conclude that enhanced understanding of bacterial epidemics requires a deep-sequencing, geographically centric, comparative pathogenomics strategy.

Phylogenetic Analysis of the Spike (S) Gene of the New Variants of Porcine Epidemic Diarrhoea Virus in Taiwan.

PubMed

Chiou, H-Y; Huang, Y-L; Deng, M-C; Chang, C-Y; Jeng, C-R; Tsai, P-S; Yang, C; Pang, V F; Chang, H-W

2017-02-01

New variants of porcine epidemic diarrhoea virus (PEDV), which emerged in Taiwan in late 2013, have caused a high morbidity and mortality in neonatal piglets. To investigate the molecular characteristics of the spike (S) gene of the emerging Taiwan PEDV strains for a better understanding of the genetic diversity and relationship among the Taiwan new variants and the global PEDVs, full-length S genes of PEDVs from nine 1-7 day-old piglets from three pig farms in the central and southern Taiwan were sequenced and analysed. The result of phylogenetic analysis of the S gene showed that all the Taiwan PEDV strains were closely related to the non-S INDEL strains from US, Canada and China, suggesting a common ancestor for these strains. As compared with the historic PEDVs and CV777-based vaccine strains, the nine Taiwan PEDV variants shared almost the same genetic signatures as the global non-S INDEL strains, including a series of insertions, deletions and mutations in the amino terminal as well as identical mutations in the neutralizing epitopes of the S gene. The high similarity of the S protein among the Taiwan and the globally emerged non-S INDEL PEDV strains suggests that the Taiwan new variants may share similar pathogenesis and immunogenicity as the global outbreak variants. The development of a novel vaccine based on the Taiwan or the global non-S INDEL strains may be contributive to the control of the current global porcine epidemic diarrhoea outbreaks. © 2015 Blackwell Verlag GmbH.

Presence of the epidemic North American Pulsed Field type 1 Clostridium difficile strain in hospitalized children.

PubMed

Toltzis, Philip; Kim, Jason; Dul, Michael; Zoltanski, Joan; Smathers, Sarah; Zaoutis, Theoklis

2009-04-01

A hypervirulent strain of Clostridium difficile-labeled North American Pulsed Field type 1 causes severe disease in adults. To determine the prevalence of NAP1 C. difficile in children, organisms from consecutive C. difficile toxin-positive stool samples at 2 children's hospitals microbiology laboratories were characterized. We found that 19.4% of these samples were NAP1.

Bottled beverages and typhoid fever: the Mexican epidemic of 1972-73.

PubMed Central

Gonzalez-Cortes, A; Gangarosa, E J; Parrilla, C; Martin, W T; Espinosa-Ayala, A M; Ruiz, L; Bessudo, D; Hernandez-Arreortua, H

1982-01-01

A chloramphenicol resistant strain of S. typhi which caused a very large epidemic of typhoid fever in Mexico in 1972-73 survived in opened bottles of one carbonated drink with a pH of 4.6 for two weeks and in another such drink with a pH of 5.1 for six months. Bottled beverages are potential sources of large outbreaks of enteric disease, and deserve the same type of standards sand monitoring as comparable fluids such as milk. PMID:7091481

[Study on the neutralization capacity of different types of human measles virus vaccine and the epidemic strains].

PubMed

Feng, Yan; Lu, Yi-yu; Yan, Ju-ying; Jiang, Xiao-hui; Shi, Wen; Xu, Chang-ping; Li, Zhen

2007-11-01

To explore the neutralization capacities of different types of human serum to measles virus epidemic strains and vaccine strain. Neutralization antibody (NT) to Shanghai 191 and measles virus isolates in 2005 were tested using acute and convalescent serum samples from diagnosed measles patients, children serum samples collected before and after vaccination and serum samples of migrant residents, from 3 different regions. Additionally, animal immune serum referring to vaccine strain and 3 epidemic strains were prepared and used to undergo crossing neutralization test with corresponding strains mentioned-above. Antigenic ratios were calculated. GMT value of NT of after-immune serum to vaccine strains was 50.82,1.86 times higher than that to MVi/ZJ/05/7 (GMT was 27.35), whereas GMT value of convalescent serum to MVi/ZJ/05/7 (GMT was 386.95) was obviously higher than that to vaccine strain (GMT was 1:151.83),and GMT value of migrant residents' serum in 3 regions to MVi/ZJ/05/7 were 2.22-4.17 times lower than that to vaccine strain. Meanwhile,the antigenic ratios between MVi/ZJ/ 99/1, MVi/ZJ/04/1, MVi/ZJ/05/7 and vaccine strain were found to be 4.28,5.24 and 5.66 respectively. Additionally,low NT titers to vaccine strain were found in patients' acute sera and GMT value was over 1:4. There were obvious differences on neutralization antibody of different types of serum to measles vaccine strain and epidemic strains which indicating the antigenic diversity of epidemic strains had influenced the protective effectiveness of vaccine antibody to epidemic strains. It was of significance to carry on research projects on the antigenic diversity and effectiveness of measles vaccine.

Comparative analysis of protein evolution in the genome of pre-epidemic and epidemic Zika virus.

PubMed

Ramaiah, Arunachalam; Dai, Lei; Contreras, Deisy; Sinha, Sanjeev; Sun, Ren; Arumugaswami, Vaithilingaraja

2017-07-01

Zika virus (ZIKV) causes microcephaly in congenital infection, neurological disorders, and poor pregnancy outcome and no vaccine is available for use in humans or approved. Although ZIKV was first discovered in 1947, the exact mechanism of virus replication and pathogenesis remains unknown. Recent outbreaks of Zika virus in the Americas clearly suggest a human-mosquito cycle or urban cycle of transmission. Understanding the conserved and adaptive features in the evolution of ZIKV genome will provide a hint on the mechanism of ZIKV adaptation to a new cycle of transmission. Here, we show comprehensive analysis of protein evolution of ZIKV strains including the current 2015-16 outbreak. To identify the constraints on ZIKV evolution, selection pressure at individual codons, immune epitopes and co-evolving sites were analyzed. Phylogenetic trees show that the ZIKV strains of the Asian genotype form distinct cluster and share a common ancestor with African genotype. The TMRCA (Time to the Most Recent Common Ancestor) for the Asian lineage and the subsequently evolved Asian human strains was calculated at 88 and 34years ago, respectively. The proteome of current 2015/16 epidemic ZIKV strains of Asian genotype was found to be genetically conserved due to genome-wide negative selection, with limited positive selection. We identified a total of 16 amino acid substitutions in the epidemic and pre-epidemic strains from human, mosquito, and monkey hosts. Negatively selected amino acid sites of Envelope protein (E-protein) (positions 69, 166, and 174) and NS5 (292, 345, and 587) were located in central dimerization domains and C-terminal RNA-directed RNA polymerase regions, respectively. The predicted 137 (92 CD4 TCEs; 45 CD8 TCEs) immunogenic peptide chains comprising negatively selected amino acid sites can be considered as suitable target for sub-unit vaccine development, as these sites are less likely to generate immune-escape variants due to strong functional constrains operating on them. The targeted changes at the amino acid level may contribute to better adaptation of ZIKV strains to human-mosquito cycle or urban cycle of transmission. Copyright © 2017. Published by Elsevier B.V.

Genetic diversity of the haemagglutinin (HA) of human influenza a (H1N1) virus in montenegro: Focus on its origin and evolution.

PubMed

Mugosa, Boban; Vujosevic, Danijela; Ciccozzi, Massimo; Valli, Maria Beatrice; Capobianchi, Maria Rosaria; Lo Presti, Alessandra; Cella, Eleonora; Giovanetti, Marta; Lai, Alessia; Angeletti, Silvia; Scarpa, Fabio; Terzić, Dragica; Vratnica, Zoran

2016-11-01

In 2009 an influenza A epidemic caused by a swine origin H1N1strain, unusual in human hosts, has been described. The present research is aimed to perform the first phylogenetic investigation on the influenza virus A (H1N1) strains circulating in Montenegro, from December 1, 2009, when the first case of death due to H1N1 was confirmed, and the epidemic began causing a total of four fatalities. The phylogenetic analysis of the strains circulating showed the absence of a pure Montenegrin cluster, suggesting the occurrence of multiple re-introductions in that population from different areas till as far as the early 2010. The time to most recent common ancestor (TMRCA) for the complete dataset has been dated in early 2008, pre-dating the first Montenegrin identification of H1N1 infection. These data suggest that virus was spreading undetected, may be as a consequence of unidentified infections in returning travelers. Anyhow, the estimated TMRCA of Montenegrin strains is fully consistent to that found in different areas. Compatibly with the time coverage of the study period here analyzed, molecular dynamic of Montenegrin strains follows similar trend as in other countries. J. Med. Virol. 88:1905-1913, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Strain-specific estimation of epidemic success provides insights into the transmission dynamics of tuberculosis

PubMed Central

Rasigade, Jean-Philippe; Barbier, Maxime; Dumitrescu, Oana; Pichat, Catherine; Carret, Gérard; Ronnaux-Baron, Anne-Sophie; Blasquez, Ghislaine; Godin-Benhaim, Christine; Boisset, Sandrine; Carricajo, Anne; Jacomo, Véronique; Fredenucci, Isabelle; Pérouse de Montclos, Michèle; Flandrois, Jean-Pierre; Ader, Florence; Supply, Philip; Lina, Gérard; Wirth, Thierry

2017-01-01

The transmission dynamics of tuberculosis involves complex interactions of socio-economic and, possibly, microbiological factors. We describe an analytical framework to infer factors of epidemic success based on the joint analysis of epidemiological, clinical and pathogen genetic data. We derive isolate-specific, genetic distance-based estimates of epidemic success, and we represent success-related time-dependent concepts, namely epidemicity and endemicity, by restricting analysis to specific time scales. The method is applied to analyze a surveillance-based cohort of 1,641 tuberculosis patients with minisatellite-based isolate genotypes. Known predictors of isolate endemicity (older age, native status) and epidemicity (younger age, sputum smear positivity) were identified with high confidence (P < 0.001). Long-term epidemic success also correlated with the ability of Euro-American and Beijing MTBC lineages to cause active pulmonary infection, independent of patient age and country of origin. Our results demonstrate how important insights into the transmission dynamics of tuberculosis can be gained from active surveillance data. PMID:28349973

[Comparative analysis on the complete genome sequence of mumps epidemic strain and mumps vaccine strain S79 isolated in Zhejiang province, China between year 2005 and 2010].

PubMed

Zhang, Dong-Yan; Feng, Yan; Zhong, Shu-Ling; Lu, Yi-Yu; Zhuang, Fang-Cheng; Xu, Chang-Ping

2012-03-01

To compare the differences in the complete genome sequence between mumps epidemic strain and mumps vaccine strain S79 isolated in Zhejiang province. A total of 4 mumps epidemic strains, which were separated from Zhejiang province during 2005 to 2010, named as ZJ05-1, ZJ06-3, ZJ08-1 and ZJ10-1 were selected in the study. The complete genome sequences were amplified using RT-PCR. The genetic differences between vaccine strain S79 and other genotype strains were compared; while the genetic-distance was calculated and the evolution was analyzed. The biggest difference between the 4 epidemic strains and the vaccine strain S79 was found on the membrane associated protein gene; whose average nucleotide differential number was 42.5 +/- 3.0 and the average variant ratio was 13.6%; while the mean amino acid differential number was 12.8 +/- 1.5 and the average variant ratio was 22.4%. The smallest difference among the 4 epidemic strains and the vaccine strain was found in stromatin genes, whose average nucleotide differential number was 73.8 +/- 2.5 and the average variant ratio was 5.9%; while the mean amino acid differential number was 3.0 +/- 0.8 and the average variant ratio was 0.8%. The dn/ds value of the stromatin genes of the 4 epidemic strains reached the highest, as 0.6526; but without any positive pressure (dn/ds < 1, chi2 = 0.87, P > 0.05). There were mutations happened on the known antigen epitope, as 8th amino acid of membrane associated protein genes and on the 336th and 356th amino acid of hemagglutinin/neuraminidase proteins. Compared with the vaccine strain, the glycosylation sites of ZJ05-1, ZJ06-3, ZJ08-1 and ZJ10-1 increased 1, 1, 2 and 2 respectively. The complete amino acid sequence of all strains showed that there were 17 characteristic sites found on the genotype-F mumps strain. Within the complete genome, the genetic-distance between epidemic strains and vaccine strains in Zhejiang province (0.071) was significantly larger than the genetic-distance between strains in Yunnan province (0.013); the difference showing statistical significance (t = 4.14, P < 0.05). Except nucleocapsid protein genes, all the genes shared similar evolution tree. There were significant differences found in the genes between mumps epidemic strain and mumps vaccine in Zhejiang province.

Ecology of West Nile virus across four European countries: review of weather profiles, vector population dynamics and vector control response.

PubMed

Chaskopoulou, Alexandra; L'Ambert, Gregory; Petric, Dusan; Bellini, Romeo; Zgomba, Marija; Groen, Thomas A; Marrama, Laurence; Bicout, Dominique J

2016-09-02

West Nile virus (WNV) represents a serious burden to human and animal health because of its capacity to cause unforeseen and large epidemics. Until 2004, only lineage 1 and 3 WNV strains had been found in Europe. Lineage 2 strains were initially isolated in 2004 (Hungary) and in 2008 (Austria) and for the first time caused a major WNV epidemic in 2010 in Greece with 262 clinical human cases and 35 fatalities. Since then, WNV lineage 2 outbreaks have been reported in several European countries including Italy, Serbia and Greece. Understanding the interaction of ecological factors that affect WNV transmission is crucial for preventing or decreasing the impact of future epidemics. The synchronous co-occurrence of competent mosquito vectors, virus, bird reservoir hosts, and susceptible humans is necessary for the initiation and propagation of an epidemic. Weather is the key abiotic factor influencing the life-cycles of the mosquito vector, the virus, the reservoir hosts and the interactions between them. The purpose of this paper is to review and compare mosquito population dynamics, and weather conditions, in three ecologically different contexts (urban/semi-urban, rural/agricultural, natural) across four European countries (Italy, France, Serbia, Greece) with a history of WNV outbreaks. Local control strategies will be described as well. Improving our understanding of WNV ecology is a prerequisite step for appraising and optimizing vector control strategies in Europe with the ultimate goal to minimize the probability of WNV infection.

Infection of hamsters with historical and epidemic BI types of Clostridium difficile.

PubMed

Razaq, Nadia; Sambol, Susan; Nagaro, Kristin; Zukowski, Walter; Cheknis, Adam; Johnson, Stuart; Gerding, Dale N

2007-12-15

North American and European hospitals have reported outbreaks of Clostridium difficile-associated disease with unexpectedly high mortality caused by a newly recognized group of C. difficile strains, group BI. Our objective was to compare, in hamsters, the virulence of a historical nonepidemic BI type, BI1, with that of 2 recent epidemic BI types, BI6 and BI17, and with that of 2 standard toxigenic strains, K14 and 630. For each strain, 10 hamsters were given 1 dose of clindamycin, followed 5 days later with 100 C. difficile spores administered by gastric inoculation. Outcomes were recorded. The hamster model demonstrated variations in mean times from inoculation to death (for BI6, 40 h; for BI1, 48 h; for K14, 49 h; for BI17, 69 h; for 630, 102 h; for BI6, BI1, and K14 vs. 630, P< .01; for BI17 vs. 630, P< .05) and from colonization to death (for BI1, 7 h; for BI17, 13 h; for BI6, 16 h; for K14, 17 h; for 630, 52 h; for BI1, BI17, BI6, and K14 vs. 630, P< .01). Group BI strains were not more rapidly fatal than the standard toxinotype 0 strain K14 but were more rapidly fatal than the standard toxinotype 0 strain 630. BI6, the most common BI type in our collection, was particularly virulent in hamsters, consistently causing death within 48 h of inoculation.

Multiple-Locus Variable-Number Tandem Repeat Analysis of Dutch Bordetella pertussis Strains Reveals Rapid Genetic Changes with Clonal Expansion during the Late 1990s

PubMed Central

Schouls, Leo M.; van der Heide, Han G. J.; Vauterin, Luc; Vauterin, Paul; Mooi, Frits R.

2004-01-01

Bordetella pertussis, the causative agent of whooping cough, has remained endemic in The Netherlands despite extensive nationwide vaccination since 1953. In the 1990s, several epidemic periods have resulted in many cases of pertussis. We have proposed that strain variation has played a major role in the upsurges of this disease in The Netherlands. Therefore, molecular characterization of strains is important in identifying the causes of pertussis epidemiology. For this reason, we have developed a multiple-locus variable-number tandem repeat analysis (MLVA) typing system for B. pertussis. By combining the MLVA profile with the allelic profile based on multiple-antigen sequence typing, we were able to further differentiate strains. The relationships between the various genotypes were visualized by constructing a minimum spanning tree. MLVA of Dutch strains of B. pertussis revealed that the genotypes of the strains isolated in the prevaccination period were diverse and clearly distinct from the strains isolated in the 1990s. Furthermore, there was a decrease in diversity in the strains from the late 1990s, with a remarkable clonal expansion that coincided with the epidemic periods. Using this genotyping, we have been able to show that B. pertussis is much more dynamic than expected. PMID:15292152

Clostridium difficile infection in the twenty-first century

PubMed Central

Ghose, Chandrabali

2013-01-01

Clostridium difficile is a spore-forming gram-positive bacillus, and the leading cause of antibiotic-associated nosocomial diarrhea and colitis in the industrialized world. With the emergence of a hypervirulent strain of C. difficile (BI/NAP1/027), the epidemiology of C. difficile infection has rapidly changed in the last decade. C. difficile infection, once thought to be an easy to treat bacterial infection, has evolved into an epidemic that is associated with a high rate of mortality, causing disease in patients thought to be low-risk. In this review, we discuss the changing face of C .difficile infection and the novel treatment and prevention strategies needed to halt this ever growing epidemic. PMID:26038491

Understanding bat SARS-like coronaviruses for the preparation of future coronavirus outbreaks - Implications for coronavirus vaccine development.

PubMed

Ng, Oi-Wing; Tan, Yee-Joo

2017-01-02

The severe acute respiratory syndrome coronavirus (SARS-CoV) first emerged in 2003, causing the SARS epidemic which resulted in a 10% fatality rate. The advancements in metagenomic techniques have allowed the identification of SARS-like coronaviruses (SL-CoVs) sequences that share high homology to the human SARS-CoV epidemic strains from wildlife bats, presenting concrete evidence that bats are the origin and natural reservoir of SARS-CoV. The application of reverse genetics further enabled that characterization of these bat CoVs and the prediction of their potential to cause disease in humans. The knowledge gained from such studies is valuable in the surveillance and preparation of a possible future outbreak caused by a spill-over of these bat SL-CoVs.

Characterization of epidemic Neisseria meningitidis serogroup C strains in several Brazilian states.

PubMed Central

Sacchi, C T; Tondella, M L; de Lemos, A P; Gorla, M C; Berto, D B; Kumiochi, N H; Melles, C E

1994-01-01

Epidemic strains of the Neisseria meningitidis C:2b:P1.3 electrophoretic type 11 complex were responsible for an outbreak in Curitiba, Parana State, Brazil, from 1990 to 1991. Strains of this complex were also isolated in other Brazilian states and were responsible for a meningococcal disease epidemic in São Paulo State in 1990. Serotyping both with monoclonal antibodies and by multilocus enzyme electrophoresis was useful for typing these epidemic strains related to the increased incidence of meningococcal disease. The genetic similarity of members of the electrophoretic type 11 complex was confirmed by the ribotyping method by using EcoRI or ClaI endonuclease restriction enzymes. Images PMID:7929775

[The genetical evolution of the full length genes of 5 EV 71 strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV71 infection].

PubMed

Liu, Wei-long; Yang, Gui-lin; Wei, Qing; Zhang, Ming-xia; Chen, Xin-chun; Liu, Ying-xia; Gao, Yang; Zhou, Bo-ping

2011-02-01

To investigate the characteristics of molecular epidemiology and molecular evolution of 5 EV 71 (enterovirus 71, EV71) strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV 71 infection. 5 EV 71 strains were isolated, and sequenced to analyzed the full length gene sequences in order to compare nucleotide and amino acid homology with other EV71 strains from other regions and countries as well as previous strains across the world through bioinformatics software. 5 strains of EV 71 belonged to sub-genotype C4 by analysis of nucleotide sequences of VP1 and VP4 of EV 71. The differences of nucleotide and amino acid sequences were much small with nucleotide homology of 93% and amino acid homology of 98% among these 5 strains. A phylogenetic tree analysis indicated that 2008 Shenzhen epidemic strains were the most close to 2004 Shenzhen circulating strains, and also much close to 1998 Shenzhen epidemic strains and 2008 Fuyang Anhui strains. The dead strain was very close to 2008 Fuyang Anhui epidemic strains. It can be speculated that this epidemic strains of EV 71 probably originate from the same ancient strain in the history, may from 1998 Shenzhen strain.

First dengue haemorrhagic fever epidemic in the Americas, 1981: insights into the causative agent.

PubMed

Rodriguez-Roche, Rosmari; Hinojosa, Yoandri; Guzman, Maria G

2014-12-01

Historical records describe a disease in North America that clinically resembled dengue haemorrhagic fever during the latter part of the slave-trading period. However, the dengue epidemic that occurred in Cuba in 1981 was the first laboratory-confirmed and clinically diagnosed outbreak of dengue haemorrhagic fever in the Americas. At that time, the presumed source of the dengue type 2 strain isolated during this epidemic was considered controversial, partly because of the limited sequence data and partly because the origin of the virus appeared to be southern Asia. Here, we present a molecular characterisation at the whole-genome level of the original strains isolated at different time points during the epidemic. Phylogenetic trees constructed using Bayesian methods indicated that 1981 Cuban strains group within the Asian 2 genotype. In addition, the study revealed that viral evolution occurred during the epidemic - a fact that could be related to the increasing severity from month to month. Moreover, the Cuban strains exhibited particular amino acid substitutions that differentiate them from the New Guinea C prototype strain as well as from dengue type 2 strains isolated globally.

Pseudomonas syringae pv. actinidiae Draft Genomes Comparison Reveal Strain-Specific Features Involved in Adaptation and Virulence to Actinidia Species

PubMed Central

Marcelletti, Simone; Ferrante, Patrizia; Petriccione, Milena; Firrao, Giuseppe; Scortichini, Marco

2011-01-01

A recent re-emerging bacterial canker disease incited by Pseudomonas syringae pv. actinidiae (Psa) is causing severe economic losses to Actinidia chinensis and A. deliciosa cultivations in southern Europe, New Zealand, Chile and South Korea. Little is known about the genetic features of this pathovar. We generated genome-wide Illumina sequence data from two Psa strains causing outbreaks of bacterial canker on the A. deliciosa cv. Hayward in Japan (J-Psa, type-strain of the pathovar) and in Italy (I-Psa) in 1984 and 1992, respectively as well as from a Psa strain (I2-Psa) isolated at the beginning of the recent epidemic on A. chinensis cv. Hort16A in Italy. All strains were isolated from typical leaf spot symptoms. The phylogenetic relationships revealed that Psa is more closely related to P. s. pv. theae than to P. avellanae within genomospecies 8. Comparative genomic analyses revealed both relevant intrapathovar variations and putative pathovar-specific genomic regions in Psa. The genomic sequences of J-Psa and I-Psa were very similar. Conversely, the I2-Psa genome encodes four additional effector protein genes, lacks a 50 kb plasmid and the phaseolotoxin gene cluster, argK-tox but has acquired a 160 kb plasmid and putative prophage sequences. Several lines of evidence from the analysis of the genome sequences support the hypothesis that this strain did not evolve from the Psa population that caused the epidemics in 1984–1992 in Japan and Italy but rather is the product of a recent independent evolution of the pathovar actinidiae for infecting Actinidia spp. All Psa strains share the genetic potential for copper resistance, antibiotic detoxification, high affinity iron acquisition and detoxification of nitric oxide of plant origin. Similar to other sequenced phytopathogenic pseudomonads associated with woody plant species, the Psa strains isolated from leaves also display a set of genes involved in the catabolism of plant-derived aromatic compounds. PMID:22132095

Survival of Serratia marcescens in benzalkonium chloride and in multiple-dose medication vials: relationship to epidemic septic arthritis.

PubMed Central

Nakashima, A K; Highsmith, A K; Martone, W J

1987-01-01

In an epidemic of septic arthritis due to Serratia marcescens, the intra-articular injection of contaminated methylprednisolone may have played a key role. The epidemic strain was found in used multiple-dose vials of methylprednisolone and in a canister of cotton balls soaked in benzalkonium chloride. The cotton balls had been used for antisepsis and disinfection. Growth characteristics of the epidemic strain of S. marcescens were compared with those of control strains of S. marcescens which had been obtained from unrelated nosocomial outbreaks. The epidemic strain was able to survive in 1:100 dilutions of benzalkonium chloride and was able to grow to greater than 10(5) CFU/ml in multiple-dose vials of methylprednisoline; control strains could not be recovered after 24 h in the same solutions. The preservative in methylprednisolone is gamma-myristyl picolinium chloride, a compound chemically related to benzalkonium chloride. We speculate that the epidemic strain of S. marcescens, which was resistant to benzalkonium chloride, had cross-resistance to gamma-myristyl picolinium chloride. If the cotton balls were used to disinfect the tops of the multiple-dose vials of methylprednisolone, small numbers of organisms subsequently introduced into the solution could have grown to high concentrations. PMID:3298309

HIV competition dynamics over sexual networks: first comer advantage conserves founder effects.

PubMed

Ferdinandy, Bence; Mones, Enys; Vicsek, Tamás; Müller, Viktor

2015-02-01

Outside Africa, the global phylogeography of HIV is characterized by compartmentalized local epidemics that are typically dominated by a single subtype, which indicates strong founder effects. We hypothesized that the competition of viral strains at the epidemic level may involve an advantage of the resident strain that was the first to colonize a population. Such an effect would slow down the invasion of new strains, and thus also the diversification of the epidemic. We developed a stochastic modelling framework to simulate HIV epidemics over dynamic contact networks. We simulated epidemics in which the second strain was introduced into a population where the first strain had established a steady-state epidemic, and assessed whether, and on what time scale, the second strain was able to spread in the population. Simulations were parameterized based on empirical data; we tested scenarios with varying levels of overall prevalence. The spread of the second strain occurred on a much slower time scale compared with the initial expansion of the first strain. With strains of equal transmission efficiency, the second strain was unable to invade on a time scale relevant for the history of the HIV pandemic. To become dominant over a time scale of decades, the second strain needed considerable (>25%) advantage in transmission efficiency over the resident strain. The inhibition effect was weaker if the second strain was introduced while the first strain was still in its growth phase. We also tested how possible mechanisms of interference (inhibition of superinfection, depletion of highly connected hubs in the network, one-time acute peak of infectiousness) contribute to the inhibition effect. Our simulations confirmed a strong first comer advantage in the competition dynamics of HIV at the population level, which may explain the global phylogeography of the virus and may influence the future evolution of the pandemic.

A new concept of the epidemic process of influenza A virus.

PubMed Central

Hope-Simpson, R. E.; Golubev, D. B.

1987-01-01

Influenza A virus was discovered in 1933, and since then four major variants have caused all the epidemics of human influenza A. Each had an era of solo world prevalence until 1977 as follows: H0N1 (old style) strains until 1946, H1N1 (old style) strains until 1957, H2N2 strains until 1968, then H3N2 strains, which were joined in 1977 by a renewed prevalence of H1N1 (old style) strains. Serological studies show that H2N2 strains probably had had a previous era of world prevalence during the last quarter of the nineteenth century, and had then been replaced by H3N2 strains from about 1900 to 1918. From about 1907 the H3N2 strains had been joined, as now, by H1N1 (old style) strains until both had been replaced in 1918 by a fifth major variant closely related to swine influenza virus A/Hswine1N1 (old style), which had then had an era of solo world prevalence in mankind until about 1929, when it had been replaced by the H0N1 strains that were first isolated in 1933. Eras of prevalence of a major variant have usually been initiated by a severe pandemic followed at intervals of a year or two by successive epidemics in each of which the nature of the virus is usually a little changed (antigenic drift), but not enough to permit frequent recurrent infections during the same era. Changes of major variant (antigenic shift) are large enough to permit reinfection. At both major and minor changes the strains of the previous variant tend to disappear and to be replaced within a single season, worldwide in the case of a major variant, or in the area of prevalence of a previous minor variant. Pandemics, epidemics and antigenic variations all occur seasonally, and influenza and its viruses virtually disappear from the population of any locality between epidemics, an interval of many consecutive months. A global view, however, shows influenza continually present in the world population, progressing each year south and then north, thus crossing the equator twice yearly around the equinoxes, the tropical monsoon periods. Influenza arrives in the temperate latitudes in the colder months, about 6 months separating its arrival in the two hemispheres. None of this behaviour is explained by the current concept that the virus is surviving like measles virus by direct spread from the sick providing endless chains of human influenza A.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:3301379

Evolutionary characterization of the emerging porcine epidemic diarrhea virus worldwide and 2014 epidemic in Taiwan.

PubMed

Sung, Ming-Hua; Deng, Ming-Chung; Chung, Yi-Hsuan; Huang, Yu-Liang; Chang, Chia-Yi; Lan, Yu-Ching; Chou, Hsin-Lin; Chao, Day-Yu

2015-12-01

Since 2010, a new variant of PEDV belonging to Genogroup 2 has been transmitting in China and further spreading to the Unites States and other Asian countries including Taiwan. In order to characterize in detail the temporal and geographic relationships among PEDV strains, the present study systematically evaluated the evolutionary patterns and phylogenetic resolution in each gene of the whole PEDV genome in order to determine which regions provided the maximal interpretative power. The result was further applied to identify the origin of PEDV that caused the 2014 epidemic in Taiwan. Thirty-four full genome sequences were downloaded from GenBank and divided into three non-mutually exclusive groups, namely, worldwide, Genogroup 2 and China, to cover different ranges of secular and spatial trends. Each dataset was then divided into different alignments by different genes for likelihood mapping and phylogenetic analysis. Our study suggested that both nsp3 and S genes contained the highest phylogenetic signal with substitution rate and phylogenetic topology similar to those obtained from the complete genome. Furthermore, the proportion of nodes with high posterior support (posterior probability >0.8) was similar between nsp3 and S genes. The nsp3 gene sequences from three clinical samples of swine with PEDV infections were aligned with other strains available from GenBank and the results suggested that the virus responsible for the 2014 PEDV outbreak in Taiwan clustered together with Clade I from the US within Genogroup 2. In conclusion, the current study identified the nsp3 gene as an alternative marker for a rapid and unequivocal classification of the circulating PEDV strains which provides complementary information to the S gene in identifying the emergence of epidemic strain resulting from recombination. Copyright © 2015 Elsevier B.V. All rights reserved.

Establishment of a nanoparticle-assisted RT-PCR assay to distinguish field strains and attenuated strains of porcine epidemic diarrhea virus.

PubMed

Zhu, Yu; Wang, Gui-Hua; Cui, Yu-Dong; Cui, Shang-Jin

2016-09-01

Porcine epidemic diarrhea virus (PEDV) can cause serious disease and even death in neonatal piglets, resulting in serious damage to the swine industry worldwide. Open reading frame 3 (ORF3) is the only accessory gene in the PEDV genome. Previous studies have indicated that PEDV vaccine strains have a partial deletion in ORF3. In this study, a nanoparticle-assisted polymerase chain reaction (nanoparticle-assisted RT-PCR) assay targeting the ORF3 of PEDV was developed to distinguish PEDV field strains from attenuated strains by using a specific pair of primers. The PCR products of field strains and attenuated strains were 264 bp and 215 bp in length, respectively. The sensitivity and specificity of this assay were also assessed. The nanoparticle-assisted RT-PCR assay was 10-100 times more sensitive than the conventional RT-PCR assay, with no cross-reactions when amplifying porcine pseudorabies virus (PRV), porcine circovirus type 2 (PCV2), classical swine fever virus (CSFV), porcine parvovirus (PPV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine rotavirus (RV), and porcine transmissible gastroenteritis virus (TGEV). The nanoparticle-assisted RT-PCR assay we describe here can be used to distinguish field strains from vaccine strains of PEDV, and it shows promise for reducing economic loss due to PEDV infection.

Outbreak of Bacillus cereus infections in a neonatal intensive care unit traced to balloons used in manual ventilation.

PubMed

Van Der Zwet, W C; Parlevliet, G A; Savelkoul, P H; Stoof, J; Kaiser, A M; Van Furth, A M; Vandenbroucke-Grauls, C M

2000-11-01

In 1998, an outbreak of systemic infections caused by Bacillus cereus occurred in the Neonatal Intensive Care Unit of the University Hospital Vrije Universiteit, Amsterdam, The Netherlands. Three neonates developed sepsis with positive blood cultures. One neonate died, and the other two neonates recovered. An environmental survey, a prospective surveillance study of neonates, and a case control study were performed, in combination with molecular typing, in order to identify potential sources and transmission routes of infection. Genotypic fingerprinting by amplified-fragment length polymorphism (AFLP) showed that the three infections were caused by a single clonal type of B. cereus. The same strain was found in trachea aspirate specimens of 35 other neonates. The case control study showed mechanical ventilation with a Sensormedics ventilation machine to be a risk factor for colonization and/or infection (odds ratio, 9.8; 95% confidence interval, 1.1 to 88.2). Prospective surveillance showed that colonization with B. cereus occurred exclusively in the respiratory tract of mechanically ventilated neonates. The epidemic strain of B. cereus was found on the hands of nursing staff and in balloons used for manual ventilation. Sterilization of these balloons ended the outbreak. We conclude that B. cereus can cause outbreaks of severe opportunistic infection in neonates. Typing by AFLP proved very useful in the identification of the outbreak and in the analysis of strains recovered from the environment to trace the cause of the epidemic.

Outbreak of Bacillus cereus Infections in a Neonatal Intensive Care Unit Traced to Balloons Used in Manual Ventilation

PubMed Central

Van Der Zwet, Wil C.; Parlevliet, Gerard A.; Savelkoul, Paul H.; Stoof, Jeroen; Kaiser, Annie M.; Van Furth, A. Marceline; Vandenbroucke-Grauls, Christina M.

2000-01-01

In 1998, an outbreak of systemic infections caused by Bacillus cereus occurred in the Neonatal Intensive Care Unit of the University Hospital Vrije Universiteit, Amsterdam, The Netherlands. Three neonates developed sepsis with positive blood cultures. One neonate died, and the other two neonates recovered. An environmental survey, a prospective surveillance study of neonates, and a case control study were performed, in combination with molecular typing, in order to identify potential sources and transmission routes of infection. Genotypic fingerprinting by amplified-fragment length polymorphism (AFLP) showed that the three infections were caused by a single clonal type of B. cereus. The same strain was found in trachea aspirate specimens of 35 other neonates. The case control study showed mechanical ventilation with a Sensormedics ventilation machine to be a risk factor for colonization and/or infection (odds ratio, 9.8; 95% confidence interval, 1.1 to 88.2). Prospective surveillance showed that colonization with B. cereus occurred exclusively in the respiratory tract of mechanically ventilated neonates. The epidemic strain of B. cereus was found on the hands of nursing staff and in balloons used for manual ventilation. Sterilization of these balloons ended the outbreak. We conclude that B. cereus can cause outbreaks of severe opportunistic infection in neonates. Typing by AFLP proved very useful in the identification of the outbreak and in the analysis of strains recovered from the environment to trace the cause of the epidemic. PMID:11060080

Lethal distemper in badgers (Meles meles) following epidemic in dogs and wolves.

PubMed

Di Sabatino, Daria; Di Francesco, Gabriella; Zaccaria, Guendalina; Malatesta, Daniela; Brugnola, Luca; Marcacci, Maurilia; Portanti, Ottavio; De Massis, Fabrizio; Savini, Giovanni; Teodori, Liana; Ruggieri, Enzo; Mangone, Iolanda; Badagliacca, Pietro; Lorusso, Alessio

2016-12-01

Canine distemper virus (CDV) represents an important conservation threat to many wild carnivores. A large distemper epidemic sustained by an Arctic-lineage strain occurred in Italy in 2013, mainly in the Abruzzi region, causing overt disease in domestic and shepherd dogs, Apennine wolves (Canis lupus) and other wild carnivores. Two badgers were collected by the end of September 2015 in a rural area of the Abruzzi region and were demonstrated to be CDV-positive by real time RT-PCR and IHC in several tissues. The genome of CDV isolates from badgers showed Y549H substitution in the mature H protein. By employing all publicly available Arctic-lineage H protein encoding gene sequences, six amino acid changes in recent Italian strains with respect to Italian strains of dogs from 2000 to 2008, were observed. A CDV strain belonging to the European-wildlife lineage was also identified in a fox found dead in the same region in 2016, proving co-circulation of an additional CDV lineage. Copyright © 2016 Elsevier B.V. All rights reserved.

EMERGING PATHOGENS OF ANIMAL ORIGIN: UNIQUE CHALLENGES FOR QUANTITATIVE MICROBIAL RISK ASSESSMENT

EPA Science Inventory

Recently severe human epidemics caused by waterborne Cryptosporidium parvum and Escherichia coli Strain (157:H7 of animal origin have attracted much attention in the national news media. Among the 130 diseases that can be transmitted to man from domestic and wild animals, a signi...

Origin of the Outbreak in France of Pseudomonas syringae pv. actinidiae Biovar 3, the Causal Agent of Bacterial Canker of Kiwifruit, Revealed by a Multilocus Variable-Number Tandem-Repeat Analysis

PubMed Central

Cunty, A.; Cesbron, S.; Poliakoff, F.; Jacques, M.-A.

2015-01-01

The first outbreaks of bacterial canker of kiwifruit caused by Pseudomonas syringae pv. actinidiae biovar 3 were detected in France in 2010. P. syringae pv. actinidiae causes leaf spots, dieback, and canker that sometimes lead to the death of the vine. P. syringae pv. actinidifoliorum, which is pathogenic on kiwi as well, causes only leaf spots. In order to conduct an epidemiological study to track the spread of the epidemics of these two pathogens in France, we developed a multilocus variable-number tandem-repeat (VNTR) analysis (MLVA). MLVA was conducted on 340 strains of P. syringae pv. actinidiae biovar 3 isolated in Chile, China, France, Italy, and New Zealand and on 39 strains of P. syringae pv. actinidifoliorum isolated in Australia, France, and New Zealand. Eleven polymorphic VNTR loci were identified in the genomes of P. syringae pv. actinidiae biovar 3 ICMP 18744 and of P. syringae pv. actinidifoliorum ICMP 18807. MLVA enabled the structuring of P. syringae pv. actinidiae biovar 3 and P. syringae pv. actinidifoliorum strains in 55 and 16 haplotypes, respectively. MLVA and discriminant analysis of principal components revealed that strains isolated in Chile, China, and New Zealand are genetically distinct from P. syringae pv. actinidiae strains isolated in France and in Italy, which appear to be closely related at the genetic level. In contrast, no structuring was observed for P. syringae pv. actinidifoliorum. We developed an MLVA scheme to explore the diversity within P. syringae pv. actinidiae biovar 3 and to trace the dispersal routes of epidemic P. syringae pv. actinidiae biovar 3 in Europe. We suggest using this MLVA scheme to trace the dispersal routes of P. syringae pv. actinidiae at a global level. PMID:26209667

Improved understanding of factors driving methicillin-resistant Staphylococcus aureus epidemic waves

PubMed Central

Chatterjee, Som S; Otto, Michael

2013-01-01

Methicillin-resistant Staphylococcus aureus (MRSA) remains one of the most important causes of nosocomial infections worldwide. Since the global spread of MRSA in the 1960s, MRSA strains have evolved with increased pathogenic potential. Notably, some strains are now capable of causing persistent infections not only in hospitalized patients but also in healthy individuals in the community. Furthermore, MRSA is increasingly associated with infections among livestock-associated workers, primarily because of transmission from animals to humans. Moreover, many MRSA strains have gained resistance to most available antibiotics. In this review, we will present current knowledge on MRSA epidemiology and discuss new endeavors being undertaken to understand better the molecular and epidemiological underpinnings of MRSA outbreaks. PMID:23861600

Persistence and Epidemic Propagation of a Pseudomonas aeruginosa Sequence Type 235 Clone Harboring an IS26 Composite Transposon Carrying the blaIMP-1 Integron in Hiroshima, Japan, 2005 to 2012

PubMed Central

Shimizu, Wataru; Kayama, Shizuo; Kouda, Shuntaro; Ogura, Yoshitoshi; Kobayashi, Kanao; Shigemoto, Norifumi; Shimada, Norimitsu; Yano, Raita; Hisatsune, Junzo; Kato, Fuminori; Hayashi, Tetsuya; Sueda, Taijiro; Ohge, Hiroki

2015-01-01

A 9-year surveillance for multidrug-resistant (MDR) Pseudomonas aeruginosa in the Hiroshima region showed that the number of isolates harboring the metallo-β-lactamase gene blaIMP-1 abruptly increased after 2004, recorded the highest peak in 2006, and showed a tendency to decline afterwards, indicating a history of an epidemic. PCR mapping of the variable regions of the integrons showed that this epidemic was caused by the clonal persistence and propagation of an MDR P. aeruginosa strain harboring the blaIMP-1 gene and an aminoglycoside 6′-N-acetyltransferase gene, aac(6′)-Iae in a class I integron (In113), whose integrase gene intl1 was disrupted by an IS26 insertion. Sequence analysis of the representative strain PA058447 resistance element containing the In113-derived gene cassette array showed that the element forms an IS26 transposon embedded in the chromosome. It has a Tn21 backbone and is composed of two segments sandwiched by three IS26s. In Japan, clonal nationwide expansion of an MDR P. aeruginosa NCGM2.S1 harboring chromosomally encoded In113 with intact intl1 is reported. Multilocus sequence typing and genomic comparison strongly suggest that PA058447 and NCGM2.S1 belong to the same clonal lineage. Moreover, the structures of the resistance element in the two strains are very similar, but the sites of insertion into the chromosome are different. Based on tagging information of the IS26 present in both resistance elements, we suggest that the MDR P. aeruginosa clone causing the epidemic in Hiroshima for the past 9 years originated from a common ancestor genome of PA058447 and NCGM2.S1 through an IS26 insertion into intl1 of In113 and through IS26-mediated genomic rearrangements. PMID:25712351

Burkholderia cepacia complex in cystic fibrosis in the post-epidemic period: multilocus sequence typing-based approach.

PubMed

Fila, Libor; Dřevínek, Pavel

2017-11-01

Cystic fibrosis (CF) patients in the Czech Republic suffered in the late 1990s from an epidemic with ST32 strain of Burkholderia cepacia complex (Bcc). Cohort segregation of Bcc and of ST32 positive patients was introduced in 1999 and 2002, respectively. We performed a study to evaluate the molecular epidemiology of Bcc infection after implementation of these infection control measures. Patients attending the Prague CF adult Centre from 2000 to 2015 were included in the present study. Demographic data and microbial statuses were collected from patient records. All Bcc isolates were analyzed using multilocus sequence typing (MLST). The prevalences of epidemic strain ST32 and of other Bcc strains were calculated. Ninety out of 227 CF patients were infected with Bcc during the study period. The prevalence of ST32 cases significantly decreased from 46.5% in 2000-2001 to 10.4% in 2014-2015 (P < 0.001) due to occurrence of only one new case in 2003, as well as to the death of 72% of ST32-infected patients. Conversely, there was a significant increase in prevalence of other Bcc strains, which rose from 0 to 14.9% (P = 0.015) and of transient infections. A micro-epidemic of infection with ST630 strain was observed in 2014 in lung transplant patients hospitalized in intensive care unit. The prevalence of epidemic strain ST32 decreased, whereas that of non-clonal strains of Bcc increased. Routine use of MLST allowed early detection of new and potentially epidemic strains.

Intercontinental spread of a genetically distinctive complex of clones of Neisseria meningitidis causing epidemic disease.

PubMed

Caugant, D A; Frøholm, L O; Bøvre, K; Holten, E; Frasch, C E; Mocca, L F; Zollinger, W D; Selander, R K

1986-07-01

Strains of Neisseria meningitidis responsible for an epidemic of meningococcal disease occurring in Norway since the mid-1970s and for recent increases in the incidence of disease in several other parts of Europe have been identified by multilocus enzyme electrophoresis as members of a distinctive group of 22 closely related clones (the ET-5 complex). Clones of this complex have also colonized South Africa, Chile, Cuba, and Florida, where they have been identified as the causative agents of recent outbreaks of meningococcal disease. There is strong circumstantial evidence that outbreaks of disease occurring in Miami in 1981 and 1982 were caused in large part by bacteria that reached Florida via human immigrants from Cuba.

R Factors in Strains of Salmonella typhi and Shigella dysenteriae 1 Isolated During Epidemics in Mexico: Classification by Compatibility

PubMed Central

Datta, Naomi; Olarte, J.

1974-01-01

All 17 Salmonella typhi strains tested from the epidemic in Mexico carried R factors of compatibility group H, conferring resistance to chloramphenicol, streptomycin, tetracycline, and sulfonamides. Some S. typhi strains carried, in addition, non-conjugative, ampicillin resistance plasmids and R factors of the I or A–C complex. All 20 Shigella dysenteriae 1 strains tested of epidemic origin carried O-group R factors. Ampicillin resistance in S. dysenteriae 1 was not proved to be plasmid borne. R factors of group H were not identified in any of the tested Mexican isolates other than S. typhi, but R factors of group O were identified in Escherichia coli, Shigella flexneri, and one strain of S. typhi, as well as in the epidemic S. dysenteriae. An R factor was identified which seemed to have two compatibility specificities, groups Iω and O. PMID:4599123

Effect of tcdR Mutation on Sporulation in the Epidemic Clostridium difficile Strain R20291.

PubMed

Girinathan, Brintha P; Monot, Marc; Boyle, Daniel; McAllister, Kathleen N; Sorg, Joseph A; Dupuy, Bruno; Govind, Revathi

2017-01-01

Clostridium difficile is an important nosocomial pathogen and the leading cause of hospital-acquired diarrhea. Antibiotic use is the primary risk factor for the development of C. difficile -associated disease because it disrupts normally protective gut flora and enables C. difficile to colonize the colon. C. difficile damages host tissue by secreting toxins and disseminates by forming spores. The toxin-encoding genes, tcdA and tcdB , are part of a pathogenicity locus, which also includes the tcdR gene that codes for TcdR, an alternate sigma factor that initiates transcription of tcdA and tcdB genes. We created a tcdR mutant in epidemic-type C. difficile strain R20291 in an attempt to identify the global role of tcdR . A site-directed mutation in tcdR affected both toxin production and sporulation in C. difficile R20291. Spores of the tcdR mutant were more heat sensitive than the wild type (WT). Nearly 3-fold more taurocholate was needed to germinate spores from the tcdR mutant than to germinate the spores prepared from the WT strain. Transmission electron microscopic analysis of the spores also revealed a weakly assembled exosporium on the tcdR mutant spores. Accordingly, comparative transcriptome analysis showed many differentially expressed sporulation genes in the tcdR mutant compared to the WT strain. These data suggest that regulatory networks of toxin production and sporulation in C. difficile strain R20291 a re linked with each other. IMPORTANCE C. difficile infects thousands of hospitalized patients every year, causing significant morbidity and mortality. C. difficile spores play a pivotal role in the transmission of the pathogen in the hospital environment. During infection, the spores germinate, and the vegetative bacterial cells produce toxins that damage host tissue. Thus, sporulation and toxin production are two important traits of C. difficile . In this study, we showed that a mutation in tcdR , the toxin gene regulator, affects both toxin production and sporulation in epidemic-type C. difficile strain R20291.

Effect of tcdR Mutation on Sporulation in the Epidemic Clostridium difficile Strain R20291

PubMed Central

Girinathan, Brintha P.; Monot, Marc; Boyle, Daniel; McAllister, Kathleen N.; Dupuy, Bruno

2017-01-01

ABSTRACT Clostridium difficile is an important nosocomial pathogen and the leading cause of hospital-acquired diarrhea. Antibiotic use is the primary risk factor for the development of C. difficile-associated disease because it disrupts normally protective gut flora and enables C. difficile to colonize the colon. C. difficile damages host tissue by secreting toxins and disseminates by forming spores. The toxin-encoding genes, tcdA and tcdB, are part of a pathogenicity locus, which also includes the tcdR gene that codes for TcdR, an alternate sigma factor that initiates transcription of tcdA and tcdB genes. We created a tcdR mutant in epidemic-type C. difficile strain R20291 in an attempt to identify the global role of tcdR. A site-directed mutation in tcdR affected both toxin production and sporulation in C. difficile R20291. Spores of the tcdR mutant were more heat sensitive than the wild type (WT). Nearly 3-fold more taurocholate was needed to germinate spores from the tcdR mutant than to germinate the spores prepared from the WT strain. Transmission electron microscopic analysis of the spores also revealed a weakly assembled exosporium on the tcdR mutant spores. Accordingly, comparative transcriptome analysis showed many differentially expressed sporulation genes in the tcdR mutant compared to the WT strain. These data suggest that regulatory networks of toxin production and sporulation in C. difficile strain R20291 are linked with each other. IMPORTANCE C. difficile infects thousands of hospitalized patients every year, causing significant morbidity and mortality. C. difficile spores play a pivotal role in the transmission of the pathogen in the hospital environment. During infection, the spores germinate, and the vegetative bacterial cells produce toxins that damage host tissue. Thus, sporulation and toxin production are two important traits of C. difficile. In this study, we showed that a mutation in tcdR, the toxin gene regulator, affects both toxin production and sporulation in epidemic-type C. difficile strain R20291. PMID:28217744

Multigenome analysis identifies a worldwide distributed epidemic Legionella pneumophila clone that emerged within a highly diverse species

PubMed Central

Cazalet, Christel; Jarraud, Sophie; Ghavi-Helm, Yad; Kunst, Frank; Glaser, Philippe; Etienne; Buchrieser, Carmen

2008-01-01

Genomics can provide the basis for understanding the evolution of emerging, lethal human pathogens such as Legionella pneumophila, the causative agent of Legionnaires’ disease. This bacterium replicates within amoebae and persists in the environment as a free-living microbe. Among the many Legionella species described, L. pneumophila is associated with 90% of human disease and within the 15 serogroups (Sg), L. pneumophila Sg1 causes over 84% of Legionnaires’ disease worldwide. Why L. pneumophila Sg1 is so predominant is unknown. Here, we report the first comprehensive screen of the gene content of 217 L. pneumophila and 32 non-L. pneumophila strains isolated from humans and the environment using a Legionella DNA-array. Strikingly, we uncovered a high conservation of virulence- and eukaryotic-like genes, indicating strong environmental selection pressures for their preservation. No specific hybridization profile differentiated clinical and environmental strains or strains of different serogroups. Surprisingly, the gene cluster coding the determinants of the core and the O side-chain synthesis of the lipopolysaccaride (LPS cluster) determining Sg1 was present in diverse genomic backgrounds, strongly implicating the LPS of Sg1 itself as a principal cause of the high prevalence of Sg1 strains in human disease and suggesting that the LPS cluster can be transferred horizontally. Genomic analysis also revealed that L. pneumophila is a genetically diverse species, in part due to horizontal gene transfer of mobile genetic elements among L. pneumophila strains, but also between different Legionella species. However, the genomic background also plays a role in disease causation as demonstrated by the identification of a globally distributed epidemic strain exhibiting the genotype of the sequenced L. pneumophila strain Paris. PMID:18256241

Analysis of HIV Type 1 BF Recombinant Sequences from South America Dates the Origin of CRF12_BF to a Recombination Event in the 1970s

PubMed Central

Dilernia, Dario A.; Jones, Leandro R.; Pando, Maria A.; Rabinovich, Roberto D.; Damilano, Gabriel D.; Turk, Gabriela; Rubio, Andrea E.; Pampuro, Sandra; Gomez-Carrillo, Manuel

2011-01-01

Abstract HIV-1 epidemics in South America are believed to have originated in part from the subtype B epidemic initiated in the Caribbean/North America region. However, circulation of BF recombinants in similar proportions was extensively reported. Information currently shows that many BF recombinants share a recombination structure similar to that found in the CRF12_BF. In the present study, analyzing a set of 405 HIV sequences, we identified the most likely origin of the BF epidemic in an early event of recombination. We found that the subtype B epidemics in South America analyzed in the present study were initiated by a founder event that occurred in the early 1970s, a few years after the introduction of these strains in the Americas. Regarding the F/BF recombinant epidemics, by analyzing a subtype F genomic segment within the viral gene gag present in the majority of the BF recombinants, we found evidence of a geographic divergence very soon after the introduction of subtype F strains in South America. Moreover, through analysis of a subtype B segment present in all the CRF12_BF-like recombination structure, we estimated the circulation of the subtype B strain that gave rise to that recombinant structure around the same time period estimated for the introduction of subtype F strains. The HIV epidemics in South America were initiated in part through a founder event driven by subtype B strains coming from the previously established epidemic in the north of the continent. A second introduction driven by subtype F strains is likely to have encountered the incipient subtype B epidemic that soon after their arrival recombined with them, originating the BF epidemic in the region. These results may explain why in South America the majority of F sequences are found as BF recombinants. PMID:20919926

Global stability analysis of two-strain epidemic model with bilinear and non-monotone incidence rates

NASA Astrophysics Data System (ADS)

Baba, Isa Abdullahi; Hincal, Evren

2017-05-01

In this article we studied an epidemic model consisting of two strains with different types of incidence rates; bilinear and non-monotone. The model consists of four equilibrium points: disease-free equilibrium, endemic with respect to strain 1, endemic with respect to strain 2, and endemic with respect to both strains. The global stability analysis of the equilibrium points was carried out through the use of Lyapunov functions. Two basic reproduction ratios R 1 0 and R 2 0 are found, and we have shown that if both are less than one, the disease dies out, and if both are greater than one epidemic occurs. Furthermore, epidemics occur with respect to any strain with a basic reproduction ratio greater than one and disease dies out with respect to any strain with a basic reproduction ratio less than one. It was also shown that any strain with highest basic reproduction ratio will automatically outperform the other strain, thereby eliminating it. Numerical simulations were carried out to support the analytic result and to show the effect of the parameter k in the non-monotone incidence rate, which describes the psychological effect of general public towards infection.

[Enteroviruses in the XX and XXI centuries].

PubMed

Seĭbil', V B; Malyshkina, L P

2005-01-01

The modern view of the role of enteroviruses in the eradication of poliomyelitis is presented. Enteroviruses were discovered in the XX century. In the 1950s they caused great epidemics of poliomyelitis and serous meningitis in many countries of the world. The introduction of oral poliomyelitis vaccine (OPV) into medical practice made it possible to eliminate the epidemics of poliomyelitis in a short time. Poliomyelitis morbidity was reduced to sporadic cases and in a number of regions disappeared. OPV produced non-specific influence also on the epidemics of serous meningitis, as well as on a case incidence. The eradication of poliomyelitis viruses and the cessation of immunization with OPV will not result in eradication of paralytic diseases. Paralytogenic viruses of 20 serotypes circulate in nature, and some of these viruses are capable of causing the outbreaks of severe paralytic diseases. The authors propose either to retain immunization with OVP as tour immunizations with monovaccine of type 2, or to create new live enterovirus vaccines on the basis of avirulent enterovirus strains.

Detection of Measles Virus Genotypes B3, D4, D5, D8, and H1 in the Surveillance System in Hokkaido, Japan, 2006-2015, the Last Decade toward the Elimination.

PubMed

Miyoshi, Masahiro; Komagome, Rika; Yamaguchi, Hiroki; Ohnishi, Asami; Kikuchi, Masayuki; Ishida, Setsuko; Nagano, Hideki; Okano, Motohiko

2017-05-24

Measles is an acute and highly contagious disease caused by measles virus (MeV). The government of Japan, following the last epidemic in 2007 and 2008, which was caused by genotype D5 strains, introduced a catch-up-vaccination program for teenagers during Japan fiscal years 2008-2012 and a mandatory case-based reporting system for the nationwide elimination. Furthermore, laboratory confirmation of measles cases by genotyping of isolates has been performed to clarify the source of infection and support the interruption of measles cases. Owing to these preventive measures, the number of measles cases has been steadily decreasing after the last epidemic. In March 2015, Japan was internationally verified as having achieved measles elimination by the World Health Organization Regional Office for the Western Pacific. The continuous elimination of measles and high levels of vaccination coverage for MeV have been maintained nationally. However, imported or import-associated cases of measles have sporadically occurred during this time. After the last nationwide epidemic, 17 imported or import-associated measles cases (MeV strains identified as genotypes H1, D4, D8, and B3) were reported in Hokkaido, the northern islands of Japan. In this study, we present the occurrence of measles and surveillance activities in Hokkaido during 2006-2015.

Transcriptome Remodeling Contributes to Epidemic Disease Caused by the Human Pathogen Streptococcus pyogenes.

PubMed

Beres, Stephen B; Kachroo, Priyanka; Nasser, Waleed; Olsen, Randall J; Zhu, Luchang; Flores, Anthony R; de la Riva, Ivan; Paez-Mayorga, Jesus; Jimenez, Francisco E; Cantu, Concepcion; Vuopio, Jaana; Jalava, Jari; Kristinsson, Karl G; Gottfredsson, Magnus; Corander, Jukka; Fittipaldi, Nahuel; Di Luca, Maria Chiara; Petrelli, Dezemona; Vitali, Luca A; Raiford, Annessa; Jenkins, Leslie; Musser, James M

2016-05-31

For over a century, a fundamental objective in infection biology research has been to understand the molecular processes contributing to the origin and perpetuation of epidemics. Divergent hypotheses have emerged concerning the extent to which environmental events or pathogen evolution dominates in these processes. Remarkably few studies bear on this important issue. Based on population pathogenomic analysis of 1,200 Streptococcus pyogenes type emm89 infection isolates, we report that a series of horizontal gene transfer events produced a new pathogenic genotype with increased ability to cause infection, leading to an epidemic wave of disease on at least two continents. In the aggregate, these and other genetic changes substantially remodeled the transcriptomes of the evolved progeny, causing extensive differential expression of virulence genes and altered pathogen-host interaction, including enhanced immune evasion. Our findings delineate the precise molecular genetic changes that occurred and enhance our understanding of the evolutionary processes that contribute to the emergence and persistence of epidemically successful pathogen clones. The data have significant implications for understanding bacterial epidemics and for translational research efforts to blunt their detrimental effects. The confluence of studies of molecular events underlying pathogen strain emergence, evolutionary genetic processes mediating altered virulence, and epidemics is in its infancy. Although understanding these events is necessary to develop new or improved strategies to protect health, surprisingly few studies have addressed this issue, in particular, at the comprehensive population genomic level. Herein we establish that substantial remodeling of the transcriptome of the human-specific pathogen Streptococcus pyogenes by horizontal gene flow and other evolutionary genetic changes is a central factor in precipitating and perpetuating epidemic disease. The data unambiguously show that the key outcome of these molecular events is evolution of a new, more virulent pathogenic genotype. Our findings provide new understanding of epidemic disease. Copyright © 2016 Beres et al.

Epidemic Typhoid in Vietnam: Molecular Typing of Multiple-Antibiotic-Resistant Salmonella enterica Serotype Typhi from Four Outbreaks

PubMed Central

Connerton, Phillippa; Wain, John; Hien, Tran T.; Ali, Tahir; Parry, Christopher; Chinh, Nguyen T.; Vinh, Ha; Ho, Vo A.; Diep, To S.; Day, Nicholas P. J.; White, Nicholas J.; Dougan, Gordon; Farrar, Jeremy J.

2000-01-01

Multidrug-resistant Salmonella enterica serotype Typhi isolates from four outbreaks of typhoid fever in southern Vietnam between 1993 and 1997 were compared. Pulsed-field gel electrophoresis, bacteriophage and plasmid typing, and antibiotic susceptibilities showed that independent outbreaks of multidrug-resistant typhoid fever in southern Vietnam are caused by single bacterial strains. However, different outbreaks do not derive from the clonal expansion of a single multidrug-resistant serotype Typhi strain. PMID:10655411

Mediterranean Fin Whales (Balaenoptera physalus) Threatened by Dolphin MorbilliVirus.

PubMed

Mazzariol, Sandro; Centelleghe, Cinzia; Beffagna, Giorgia; Povinelli, Michele; Terracciano, Giuliana; Cocumelli, Cristiano; Pintore, Antonio; Denurra, Daniele; Casalone, Cristina; Pautasso, Alessandra; Di Francesco, Cristina Esmeralda; Di Guardo, Giovanni

2016-02-01

During 2011-2013, dolphin morbillivirus was molecularly identified in 4 stranded fin whales from the Mediterranean Sea. Nucleoprotein, phosphoprotein, and hemagglutinin gene sequences of the identified strain were highly homologous with those of a morbillivirus that caused a 2006-2007 epidemic in the Mediterranean. Dolphin morbillivirus represents a serious threat for fin whales.

Analysis of the VP2 protein gene of canine parvovirus strains from affected dogs in Japan.

PubMed

Soma, Takehisa; Taharaguchi, Satoshi; Ohinata, Tsuyoshi; Ishii, Hiroshi; Hara, Motonobu

2013-04-01

To clarify the evolution of canine parvovirus 2 (CPV-2) that has recently been epidemic in Japan, VP2 gene sequences at positions 3556-4166 were analyzed in 107 CPV-2 strains obtained from rectal swabs of diarrheic dogs from 2009 to 2011. CPV-2b (95 strains) was more frequently detected than CPV-2a (nine strains), while CPV-2c was not detected. Remaining three strains were identified as the original type CPV-2, which should be derived from vaccines. These findings are similar to the previous results involving Japanese strains, suggesting there has been no great change in the recent CPV-2 epidemic in Japan. This epidemic is the same as that in Taiwan. Furthermore, a 324-lle mutant, which has been reported in Korean and Chinese strains, was detected in 66.7% of CPV-2a strains. Copyright © 2012 Elsevier Ltd. All rights reserved.

The structural proteins of epidemic and historical strains of Zika virus differ in their ability to initiate viral infection in human host cells.

PubMed

Bos, Sandra; Viranaicken, Wildriss; Turpin, Jonathan; El-Kalamouni, Chaker; Roche, Marjolaine; Krejbich-Trotot, Pascale; Desprès, Philippe; Gadea, Gilles

2018-03-01

Mosquito-borne Zika virus (ZIKV) recently emerged in South Pacific islands and Americas where large epidemics were documented. In the present study, we investigated the contribution of the structural proteins C, prM and E in the permissiveness of human host cells to epidemic strains of ZIKV. To this end, we evaluated the capacity of the epidemic strain BeH819015 to infect epithelial A549 and neuronal SH-SY5Y cells in comparison to the African historical MR766 strain. For that purpose, we generated a molecular clone of BeH819015 and a chimeric clone of MR766 which contains the BeH819015 structural protein region. We showed that ZIKV containing BeH819015 structural proteins was much less efficient in cell-attachment leading to a reduced susceptibility of A549 and SH-SY5Y cells to viral infection. Our data illustrate a previously underrated role for C, prM, and E in ZIKV epidemic strain ability to initiate viral infection in human host cells. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Evidence for transmission of Pseudomonas cepacia by social contact in cystic fibrosis.

PubMed

Govan, J R; Brown, P H; Maddison, J; Doherty, C J; Nelson, J W; Dodd, M; Greening, A P; Webb, A K

1993-07-03

Pulmonary colonisation with Pseudomonas cepacia in patients with cystic fibrosis can be associated with increased morbidity and mortality. The modes of transmission of P cepacia are, however, unclear. We used selective media and phenotypic and genomic typing systems to investigate the acquisition of P cepacia by adults with cystic fibrosis. An analysis of isolates from 210 patients attending regional clinics in Edinburgh and Manchester between 1986 and 1992 showed that the main cause of increased isolations of P cepacia from 1989 was the emergence of an epidemic strain that had spread between patients in both clinics. Epidemiological evidence indicated that social contact was important in spread of the epidemic strain within and between clinics. We suggest that guidelines to limit the acquisition of P cepacia should not be restricted to patients in hospital, and that intimate or frequent social contact is associated with a high risk of cross-infection.

History and origin of the HIV-1 subtype C epidemic in South Africa and the greater southern African region

PubMed Central

Wilkinson, Eduan; Engelbrecht, Susan; de Oliveira, Tulio

2015-01-01

HIV has spread at an alarming rate in South Africa, making it the country with the highest number of HIV infections. Several studies have investigated the histories of HIV-1 subtype C epidemics but none have done so in the context of social and political transformation in southern Africa. There is a need to understand how these processes affects epidemics, as socio-political transformation is a common and on-going process in Africa. Here, we genotyped strains from the start of the epidemic and applied phylodynamic techniques to determine the history of the southern Africa and South African epidemic from longitudinal sampled data. The southern African epidemic’s estimated dates of origin was placed around 1960 (95% HPD 1956–64), while dynamic reconstruction revealed strong growth during the 1970s and 80s. The South African epidemic has a similar origin, caused by multiple introductions from neighbouring countries, and grew exponentially during the 1980s and 90s, coinciding with socio-political changes in South Africa. These findings provide an indication as to when the epidemic started and how it has grown, while the inclusion of sequence data from the start of the epidemic provided better estimates. The epidemic have stabilized in recent years with the expansion of antiretroviral therapy. PMID:26574165

Humoral immunity to influenza in an at-risk population and severe influenza cases in Russia in 2016-2017.

PubMed

Ilyicheva, Tatyana N; Durymanov, Alexander G; Svyatchenko, Svetlana V; Marchenko, Vasily Yu; Sobolev, Ivan A; Bakulina, Anastasiya Yu; Goncharova, Natalia I; Kolosova, Natalia P; Susloparov, Ivan M; Pyankova, Olga G; Ryzhikov, Alexander B; Maksyutov, Rinat A

2018-06-05

This work aimed to analyze the herd immunity to influenza among a Russian population living in regions with an increased risk of emergence of viruses with pandemic potential, and to isolate and investigate virus strains from severe influenza cases, including fatal cases, during the 2016-2017 epidemic season. In November 2016 - March 2017 highly pathogenic influenza outbreaks were registered in Russia among wild birds and poultry. No cases of human infection were registered. Analysis of 760 sera from people who had contact with infected or perished birds revealed the presence of antibodies to A(H5N1) virus of clade 2.3.2.1c and A(H5N8) virus of clade 2.3.4.4. The 2016-2017 influenza epidemic season in Russia began in weeks 46-47 of 2016 with predominant circulation of influenza A(H3N2) viruses. Strains isolated from severe influenza cases mainly belonged to 3C.2a.2 and 3C.2a.3 genetic groups. Up to the 8th week of 2017 severe influenza cases were often caused by influenza B viruses which belonged to 1A genetic group with antigenic properties similar to B/Brisbane/60/2008. All influenza A and B virus strains isolated in the 2016-2017 epidemic season were sensitive to oseltamivir and zanamivir.

Worldwide Occurrence of Integrative Conjugative Element Encoding Multidrug Resistance Determinants in Epidemic Vibrio cholerae O1

PubMed Central

Marin, Michel A.; Fonseca, Erica L.; Andrade, Bruno N.; Cabral, Adriana C.; Vicente, Ana Carolina P.

2014-01-01

In the last decades, there has been an increase of cholera epidemics caused by multidrug resistant strains. Particularly, the integrative and conjugative element (ICE) seems to play a major role in the emergence of multidrug resistant Vibrio cholerae. This study fully characterized, by whole genome sequencing, new ICEs carried by multidrug resistant V. cholerae O1 strains from Nigeria (2010) (ICEVchNig1) and Nepal (1994) (ICEVchNep1). The gene content and gene order of these two ICEs are the same, and identical to ICEVchInd5, ICEVchBan5 and ICEVchHai1 previously identified in multidrug resistant V. cholerae O1. This ICE is characterized by dfrA1, sul2, strAB and floR antimicrobial resistance genes, and by unique gene content in HS4 and HS5 ICE regions. Screening for ICEs, in publicly available V. cholerae genomes, revealed the occurrence and widespread distribution of this ICE among V. cholerae O1. Metagenomic analysis found segments of this ICE in marine environments far from the direct influence of the cholera epidemic. Therefore, this study revealed the epidemiology of a spatio-temporal prevalent ICE in V. cholerae O1. Its occurrence and dispersion in V. cholerae O1 strains from different continents throughout more than two decades can be indicative of its role in the fitness of the current pandemic lineage. PMID:25265418

Mediterranean Fin Whales (Balaenoptera physalus) Threatened by Dolphin MorbilliVirus

PubMed Central

Centelleghe, Cinzia; Beffagna, Giorgia; Povinelli, Michele; Terracciano, Giuliana; Cocumelli, Cristiano; Pintore, Antonio; Denurra, Daniele; Casalone, Cristina; Pautasso, Alessandra; Di Francesco, Cristina Esmeralda; Di Guardo, Giovanni

2016-01-01

During 2011–2013, dolphin morbillivirus was molecularly identified in 4 stranded fin whales from the Mediterranean Sea. Nucleoprotein, phosphoprotein, and hemagglutinin gene sequences of the identified strain were highly homologous with those of a morbillivirus that caused a 2006–2007 epidemic in the Mediterranean. Dolphin morbillivirus represents a serious threat for fin whales. PMID:26812485

Isolation of epidemic poliovirus from sewage during the 1992-3 type 3 outbreak in The Netherlands.

PubMed Central

van der Avoort, H. G.; Reimerink, J. H.; Ras, A.; Mulders, M. N.; van Loon, A. M.

1995-01-01

To examine the extent of wild poliovirus circulation during the 1992-3 epidemic in the Netherlands caused by poliovirus type 3, 269 samples from sewage pipelines at 120 locations were examined for the presence of poliovirus. The epidemic virus strain was found in 23 samples, all from locations inside the risk area which contained communities that refuse vaccination for religious reasons. By sewage investigation, the wildtype virus was shown to be present in the early phase of the epidemic at two locations, one week before patients were reported from that area. The wild type 3 poliovirus was also detected retrospectively in a river water sample collected for other reasons three weeks before notification of the first poliomyelitis case, at a site a few kilometres upstream the home village of this patient. Oral poliovirus vaccine (OPV) virus was found at 28 locations inside or at the border of the risk area. Trivalent OPV was offered to unvaccinated or incompletely-vaccinated persons living in this region as part of the measures to control the epidemic. PMID:7781736

Coxsackievirus A6: a new emerging pathogen causing hand, foot and mouth disease outbreaks worldwide.

PubMed

Bian, Lianlian; Wang, Yiping; Yao, Xin; Mao, Qunying; Xu, Miao; Liang, Zhenglun

2015-01-01

Enterovirus 71 (EV71) and coxsackievirus A16 (CA16) are the predominant pathogens causing outbreaks of hand, foot and mouth disease (HFMD) worldwide. Other human enterovirus A (HEV-A) serotypes tend to cause only sporadic HFMD cases. However, since a HFMD caused by coxsackievirus A6 broke out in Finland in 2008, CA6 has been identified as the responsible pathogen for a series of HFMD outbreaks in Europe, North America and Asia. Because of the severity of the clinical manifestations and the underestimated public health burden, the epidemic of CA6-associated HFMD presents a new challenge to the control of HFMD. This article reviewed the epidemic characteristics, molecular epidemiology, clinical features and laboratory diagnosis of CA6 infection. The genetic evolution of CA6 strains associated with HFMD was also analyzed. It indicated that the development of a multivalent vaccine combining EV71, CA16 and CA6 is an urgent necessity to control HFMD.

Molecular identification of the first local dengue fever outbreak in Shenzhen city, China: a potential imported vertical transmission from Southeast Asia?

PubMed

Yang, F; Guo, G Z; Chen, J Q; Ma, H W; Liu, T; Huang, D N; Yao, C H; Zhang, R L; Xue, C F; Zhang, L

2014-02-01

A suspected dengue fever outbreak occurred in 2010 at a solitary construction site in Shenzhen city, China. To investigate this epidemic, we used serological, molecular biological, and bioinformatics techniques. Of nine serum samples from suspected patients, we detected seven positive for dengue virus (DENV) antibodies, eight for DENV-1 RNA, and three containing live viruses. The isolated virus, SZ1029 strain, was sequenced and confirmed as DENV-1, showing the highest E-gene homology to D1/Malaysia/36000/05 and SG(EHI)DED142808 strains recently reported in Southeast Asia. Further phylogenetic tree analysis confirmed their close relationship. At the epidemic site, we also detected 14 asymptomatic co-workers (out of 291) positive for DENV antibody, and DENV-1-positive mosquitoes. Thus, we concluded that DENV-1 caused the first local dengue fever outbreak in Shenzhen. Because no imported case was identified, the molecular fingerprints of the SZ1029 strain suggest this outbreak may be due to vertical transmission imported from Southeast Asia.

[Epidemic of gastroenteritis in Noumea (New Caledonia) caused by an enterotoxinogenic strain of Escherichia coli (0l26:B16) believed to be enteropathogenic].

PubMed

Germani, Y; Amat, F; Brethes, B; Begaud, E; Plassart, H

1985-01-01

A strain of enteropathogenic Escherichia coli 0126:B16 has been isolated in fifteen children and one adult during a severe outbreak. One infant is dead. The strain produced heat-stable enterotoxin, attach to rabbit enterocytes but did not have colonization factor antigen CFA/I or CFA/II. Its hemagglutination type was the same that the E. coli H10407, CFA/I+. It presented a resistance at eight antibiotics and, with the loss of enterotoxigenicity, there was a loss of resistance at ampicillin and of the capacity to attach to enterocytes.

Preventing clostridium difficile infection in the intensive care unit.

PubMed

Zilberberg, Marya D; Shorr, Andrew F

2013-01-01

Clostridium difficile is a formidable problem in the twenty-first century. Because of injudicious use of antibiotics, the emergence of the hypervirulent epidemic strain of this organism has been difficult to contain. The NAP1/BI/027 strain causes more-severe disease than other widely prevalent strains and affects patients who were not traditionally thought to be at risk for Clostridium difficile infection. Critically ill patients remain at high risk for this pathogen, and preventive measures, such as meticulous contact precautions, hand hygiene, environmental disinfection, and, most importantly, antibiotic stewardship, are the cornerstones of mitigation in the intensive care unit. Copyright © 2013 Elsevier Inc. All rights reserved.

First report of multiple lineages of dengue viruses type 1 in Rio de Janeiro, Brazil.

PubMed

dos Santos, Flavia B; Nogueira, Fernanda B; Castro, Márcia G; Nunes, Priscila Cg; de Filippis, Ana Maria B; Faria, Nieli Rc; Simões, Jaqueline Bs; Sampaio, Simone A; Santos, Clarice R; Nogueira, Rita Maria R

2011-08-03

In Brazil dengue has been a major public health problem since DENV-1 introduction and spread in 1986. After a low or silent co-circulation, DENV-1 re-emerged in 2009 causing a major epidemic in the country in 2010 and 2011. In this study, the phylogeny of DENV-1 strains isolated in RJ after its first introduction in 1986 and after its emergence in 2009 and 2010 was performed in order to document possible evolutionary patterns or introductions in a re-emergent virus. The analysis of the E gene sequences demonstrated that DENV-1 isolated during 2009/2010 still belong to genotype V (Americas/Africa) but grouping in a distinct clade (lineage II) of that represented by earlier DENV-1 (lineage I). However, strains isolated in 2011 grouped together forming another distinct clade (lineage III). The monitoring of DENV is important to observe the spread of potentially virulent strains as well to evaluate its impact over the population during an outbreak. Whether explosive epidemics reported in Brazil caused mainly by DENV-1 was due to lineage replacement, or due the population susceptibility to this serotype which has not circulated for almost a decade or even due to the occurrence of secondary infections in a hyperendemic country, is not clear. This is the first report of multiple lineages of DENV-1 detected in Brazil.

Development of a Novel Vaccine Containing Binary Toxin for the Prevention of Clostridium difficile Disease with Enhanced Efficacy against NAP1 Strains.

PubMed

Secore, Susan; Wang, Su; Doughtry, Julie; Xie, Jinfu; Miezeiewski, Matt; Rustandi, Richard R; Horton, Melanie; Xoconostle, Rachel; Wang, Bei; Lancaster, Catherine; Kristopeit, Adam; Wang, Sheng-Ching; Christanti, Sianny; Vitelli, Salvatore; Gentile, Marie-Pierre; Goerke, Aaron; Skinner, Julie; Strable, Erica; Thiriot, David S; Bodmer, Jean-Luc; Heinrichs, Jon H

2017-01-01

Clostridium difficile infections (CDI) are a leading cause of nosocomial diarrhea in the developed world. The main virulence factors of the bacterium are the large clostridial toxins (LCTs), TcdA and TcdB, which are largely responsible for the symptoms of the disease. Recent outbreaks of CDI have been associated with the emergence of hypervirulent strains, such as NAP1/BI/027, many strains of which also produce a third toxin, binary toxin (CDTa and CDTb). These hypervirulent strains have been associated with increased morbidity and higher mortality. Here we present pre-clinical data describing a novel tetravalent vaccine composed of attenuated forms of TcdA, TcdB and binary toxin components CDTa and CDTb. We demonstrate, using the Syrian golden hamster model of CDI, that the inclusion of binary toxin components CDTa and CDTb significantly improves the efficacy of the vaccine against challenge with NAP1 strains in comparison to vaccines containing only TcdA and TcdB antigens, while providing comparable efficacy against challenge with the prototypic, non-epidemic strain VPI10463. This combination vaccine elicits high neutralizing antibody titers against TcdA, TcdB and binary toxin in both hamsters and rhesus macaques. Finally we present data that binary toxin alone can act as a virulence factor in animal models. Taken together, these data strongly support the inclusion of binary toxin in a vaccine against CDI to provide enhanced protection from epidemic strains of C. difficile.

Development of a Novel Vaccine Containing Binary Toxin for the Prevention of Clostridium difficile Disease with Enhanced Efficacy against NAP1 Strains

PubMed Central

Wang, Su; Doughtry, Julie; Xie, Jinfu; Miezeiewski, Matt; Rustandi, Richard R.; Horton, Melanie; Xoconostle, Rachel; Wang, Bei; Lancaster, Catherine; Kristopeit, Adam; Wang, Sheng-Ching; Christanti, Sianny; Vitelli, Salvatore; Gentile, Marie-Pierre; Goerke, Aaron; Skinner, Julie; Strable, Erica; Thiriot, David S.; Bodmer, Jean-Luc; Heinrichs, Jon H.

2017-01-01

Clostridium difficile infections (CDI) are a leading cause of nosocomial diarrhea in the developed world. The main virulence factors of the bacterium are the large clostridial toxins (LCTs), TcdA and TcdB, which are largely responsible for the symptoms of the disease. Recent outbreaks of CDI have been associated with the emergence of hypervirulent strains, such as NAP1/BI/027, many strains of which also produce a third toxin, binary toxin (CDTa and CDTb). These hypervirulent strains have been associated with increased morbidity and higher mortality. Here we present pre-clinical data describing a novel tetravalent vaccine composed of attenuated forms of TcdA, TcdB and binary toxin components CDTa and CDTb. We demonstrate, using the Syrian golden hamster model of CDI, that the inclusion of binary toxin components CDTa and CDTb significantly improves the efficacy of the vaccine against challenge with NAP1 strains in comparison to vaccines containing only TcdA and TcdB antigens, while providing comparable efficacy against challenge with the prototypic, non-epidemic strain VPI10463. This combination vaccine elicits high neutralizing antibody titers against TcdA, TcdB and binary toxin in both hamsters and rhesus macaques. Finally we present data that binary toxin alone can act as a virulence factor in animal models. Taken together, these data strongly support the inclusion of binary toxin in a vaccine against CDI to provide enhanced protection from epidemic strains of C. difficile. PMID:28125650

Self-mating in the definitive host potentiates clonal outbreaks of the apicomplexan parasites Sarcocystis neurona and Toxoplasma gondii.

PubMed

Wendte, Jered M; Miller, Melissa A; Lambourn, Dyanna M; Magargal, Spencer L; Jessup, David A; Grigg, Michael E

2010-12-23

Tissue-encysting coccidia, including Toxoplasma gondii and Sarcocystis neurona, are heterogamous parasites with sexual and asexual life stages in definitive and intermediate hosts, respectively. During its sexual life stage, T. gondii reproduces either by genetic out-crossing or via clonal amplification of a single strain through self-mating. Out-crossing has been experimentally verified as a potent mechanism capable of producing offspring possessing a range of adaptive and virulence potentials. In contrast, selfing and other life history traits, such as asexual expansion of tissue-cysts by oral transmission among intermediate hosts, have been proposed to explain the genetic basis for the clonal population structure of T. gondii. In this study, we investigated the contributing roles self-mating and sexual recombination play in nature to maintain clonal population structures and produce or expand parasite clones capable of causing disease epidemics for two tissue encysting parasites. We applied high-resolution genotyping against strains isolated from a T. gondii waterborne outbreak that caused symptomatic disease in 155 immune-competent people in Brazil and a S. neurona outbreak that resulted in a mass mortality event in Southern sea otters. In both cases, a single, genetically distinct clone was found infecting outbreak-exposed individuals. Furthermore, the T. gondii outbreak clone was one of several apparently recombinant progeny recovered from the local environment. Since oocysts or sporocysts were the infectious form implicated in each outbreak, the expansion of the epidemic clone can be explained by self-mating. The results also show that out-crossing preceded selfing to produce the virulent T. gondii clone. For the tissue encysting coccidia, self-mating exists as a key adaptation potentiating the epidemic expansion and transmission of newly emerged parasite clones that can profoundly shape parasite population genetic structures or cause devastating disease outbreaks.

Hepatitis A

PubMed Central

Maynard, James E.

1976-01-01

Hepatitis A is a disease of worldwide distribution which occurs in endemic and epidemic form and is transmitted primarily by person-to-person contact through the fecal-oral route. Common source epidemics due to contamination of food are relatively common, and water-borne epidemics have been described less frequently. The presumed etiologic agent of hepatitis A has now been visualized by immune electron microscopic (IEM) techniques in early acute-illness-phase stools of humans with hepatitis A as well as in chimpanzees experimentally infected with material known to contain hepatitis A virus. In addition, several new serologic tests for the detection of antibody against hepatitis A virus have been described. These include complement fixation and immune adherence techniques. Current data suggest that hepatitis A is caused by a single viral agent lacking the morphologic heterogeneity of hepatitis B viral components and that there may be relative antigenic homogeneity between strains of virus recovered from various parts of the world. Serologic studies to date also indicate that hepatitis A virus is not a major contributing cause in post-transfusion hepatitis. ImagesFIG. 2 PMID:183390

Origin of the Outbreak in France of Pseudomonas syringae pv. actinidiae Biovar 3, the Causal Agent of Bacterial Canker of Kiwifruit, Revealed by a Multilocus Variable-Number Tandem-Repeat Analysis.

PubMed

Cunty, A; Cesbron, S; Poliakoff, F; Jacques, M-A; Manceau, C

2015-10-01

The first outbreaks of bacterial canker of kiwifruit caused by Pseudomonas syringae pv. actinidiae biovar 3 were detected in France in 2010. P. syringae pv. actinidiae causes leaf spots, dieback, and canker that sometimes lead to the death of the vine. P. syringae pv. actinidifoliorum, which is pathogenic on kiwi as well, causes only leaf spots. In order to conduct an epidemiological study to track the spread of the epidemics of these two pathogens in France, we developed a multilocus variable-number tandem-repeat (VNTR) analysis (MLVA). MLVA was conducted on 340 strains of P. syringae pv. actinidiae biovar 3 isolated in Chile, China, France, Italy, and New Zealand and on 39 strains of P. syringae pv. actinidifoliorum isolated in Australia, France, and New Zealand. Eleven polymorphic VNTR loci were identified in the genomes of P. syringae pv. actinidiae biovar 3 ICMP 18744 and of P. syringae pv. actinidifoliorum ICMP 18807. MLVA enabled the structuring of P. syringae pv. actinidiae biovar 3 and P. syringae pv. actinidifoliorum strains in 55 and 16 haplotypes, respectively. MLVA and discriminant analysis of principal components revealed that strains isolated in Chile, China, and New Zealand are genetically distinct from P. syringae pv. actinidiae strains isolated in France and in Italy, which appear to be closely related at the genetic level. In contrast, no structuring was observed for P. syringae pv. actinidifoliorum. We developed an MLVA scheme to explore the diversity within P. syringae pv. actinidiae biovar 3 and to trace the dispersal routes of epidemic P. syringae pv. actinidiae biovar 3 in Europe. We suggest using this MLVA scheme to trace the dispersal routes of P. syringae pv. actinidiae at a global level. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Evolutionary Relationships of Endemic/Epidemic and Sylvatic Dengue Viruses

PubMed Central

Wang, Eryu; Ni, Haolin; Xu, Renling; Barrett, Alan D. T.; Watowich, Stanley J.; Gubler, Duane J.; Weaver, Scott C.

2000-01-01

Endemic/epidemic dengue viruses (DEN) that are transmitted among humans by the mosquito vectors Aedes aegypti and Aedes albopictus are hypothesized to have evolved from sylvatic DEN strains that are transmitted among nonhuman primates in West Africa and Malaysia by other Aedes mosquitoes. We tested this hypothesis with phylogenetic studies using envelope protein gene sequences of both endemic/epidemic and sylvatic strains. The basal position of sylvatic lineages of DEN-1, -2, and -4 suggested that the endemic/epidemic lineages of these three DEN serotypes evolved independently from sylvatic progenitors. Time estimates for evolution of the endemic/epidemic forms ranged from 100 to 1,500 years ago, and the evolution of endemic/epidemic forms represents relatively recent events in the history of DEN evolution. Analysis of envelope protein amino acid changes predicted to have accompanied endemic/epidemic emergence suggested a role for domain III in adaptation to new mosquito and/or human hosts. PMID:10708439

Aggressiveness Changes in Populations of Didymella pinodes over Winter and Spring Pea Cropping Seasons

PubMed Central

Laloi, G.; Montarry, J.; Guibert, M.; Andrivon, D.; Michot, D.

2016-01-01

ABSTRACT Ascochyta blight, caused by the necrotrophic ascomycete Didymella pinodes, is responsible for severe losses in winter and spring pea crops. Despite different climatic conditions, epidemics on winter and spring crops are due to a single population of D. pinodes, suggesting gene flow either between the two crops or from reservoir sources during the cropping season. This should lead to similar pathogenicity characteristics in isolates sampled from the two crops. However, these hypotheses have never been formally tested. We therefore sampled a total of 520 D. pinodes strains throughout a growing season from winter and spring pea plots (WP and SP, respectively) and from winter and spring trap plants (TWP and TSP). Amplified fragment length polymorphism (AFLP) markers revealed high genetic diversity within subpopulations, whereas pathogenicity tests showed that mean aggressiveness increases over the course of an epidemic. These results support the idea that alloinoculum contributes to the carryover of epidemics between winter and spring crops and that the most aggressive isolates are selected as an epidemic progresses. IMPORTANCE Ascochyta blight, caused by Didymella pinodes, is responsible for severe losses in pea crops. While previous studies have shown that ascochyta blight epidemics on winter and spring crops are due to a single population of D. pinodes, suggesting that isolates from the two crops present similar pathogenicity characteristics, that hypothesis have never been tested. Genetic analysis of subpopulations sampled throughout a growing season from winter and spring pea plots revealed high genetic diversity within subpopulations, whereas pathogenicity tests showed that mean aggressiveness increases over the course of an epidemic. PMID:27208102

Bacteriocin from epidemic Listeria strains alters the host intestinal microbiota to favor infection

PubMed Central

Quereda, Juan J.; Dussurget, Olivier; Nahori, Marie-Anne; Ghozlane, Amine; Volant, Stevenn; Dillies, Marie-Agnès; Regnault, Béatrice; Kennedy, Sean; Mondot, Stanislas; Villoing, Barbara; Cossart, Pascale; Pizarro-Cerda, Javier

2016-01-01

Listeria monocytogenes is responsible for gastroenteritis in healthy individuals and for a severe invasive disease in immunocompromised patients. Among the three identified L. monocytogenes evolutionary lineages, lineage I strains are overrepresented in epidemic listeriosis outbreaks, but the mechanisms underlying the higher virulence potential of strains of this lineage remain elusive. Here, we demonstrate that Listeriolysin S (LLS), a virulence factor only present in a subset of lineage I strains, is a bacteriocin highly expressed in the intestine of orally infected mice that alters the host intestinal microbiota and promotes intestinal colonization by L. monocytogenes, as well as deeper organ infection. To our knowledge, these results therefore identify LLS as the first bacteriocin described in L. monocytogenes and associate modulation of host microbiota by L. monocytogenes epidemic strains to increased virulence. PMID:27140611

Laboratory-Based Surveillance and Molecular Characterization of Dengue Viruses in Taiwan, 2014.

PubMed

Chang, Shu-Fen; Yang, Cheng-Fen; Hsu, Tung-Chieh; Su, Chien-Ling; Lin, Chien-Chou; Shu, Pei-Yun

2016-04-01

We present the results of a laboratory-based surveillance of dengue in Taiwan in 2014. A total of 240 imported dengue cases were identified. The patients had arrived from 16 countries, and Malaysia, Indonesia, the Philippines, and China were the most frequent importing countries. Phylogenetic analyses showed that genotype I of dengue virus type 1 (DENV-1) and the cosmopolitan genotype of DENV-2 were the predominant DENV strains circulating in southeast Asia. The 2014 dengue epidemic was the largest ever to occur in Taiwan since World War II, and there were 15,492 laboratory-confirmed indigenous dengue cases. Phylogenetic analysis showed that the explosive dengue epidemic in southern Taiwan was caused by a DENV-1 strain of genotype I imported from Indonesia. There were several possible causes of this outbreak, including delayed notification of the outbreak, limited staff and resources for control measures, abnormal weather conditions, and a serious gas pipeline explosion in the dengue hot spot areas in Kaohsiung City. However, the results of this surveillance indicated that both active and passive surveillance systems should be strengthened so appropriate public health measures can be taken promptly to prevent large-scale dengue outbreaks. © The American Society of Tropical Medicine and Hygiene.

Laboratory-Based Surveillance and Molecular Characterization of Dengue Viruses in Taiwan, 2014

PubMed Central

Chang, Shu-Fen; Yang, Cheng-Fen; Hsu, Tung-Chieh; Su, Chien-Ling; Lin, Chien-Chou; Shu, Pei-Yun

2016-01-01

We present the results of a laboratory-based surveillance of dengue in Taiwan in 2014. A total of 240 imported dengue cases were identified. The patients had arrived from 16 countries, and Malaysia, Indonesia, the Philippines, and China were the most frequent importing countries. Phylogenetic analyses showed that genotype I of dengue virus type 1 (DENV-1) and the cosmopolitan genotype of DENV-2 were the predominant DENV strains circulating in southeast Asia. The 2014 dengue epidemic was the largest ever to occur in Taiwan since World War II, and there were 15,492 laboratory-confirmed indigenous dengue cases. Phylogenetic analysis showed that the explosive dengue epidemic in southern Taiwan was caused by a DENV-1 strain of genotype I imported from Indonesia. There were several possible causes of this outbreak, including delayed notification of the outbreak, limited staff and resources for control measures, abnormal weather conditions, and a serious gas pipeline explosion in the dengue hot spot areas in Kaohsiung City. However, the results of this surveillance indicated that both active and passive surveillance systems should be strengthened so appropriate public health measures can be taken promptly to prevent large-scale dengue outbreaks. PMID:26880779

Molecular characterization of a wild poliovirus type 3 epidemic in The Netherlands (1992 and 1993).

PubMed Central

Mulders, M N; van Loon, A M; van der Avoort, H G; Reimerink, J H; Ras, A; Bestebroer, T M; Drebot, M A; Kew, O M; Koopmans, M P

1995-01-01

An outbreak of poliomyelitis due to wild poliovirus type 3 (PV3) occurred in an unvaccinated community in The Netherlands between September 1992 and February 1993. The outbreak involved 71 patients. The aim of this study was to characterize the virus at the molecular level and to analyze the molecular evolution of the epidemic virus. Molecular analysis was carried out by sequencing the VP1/2A junction region (150 nucleotides) of 50 PV3 strains isolated in association with this outbreak and the entire VP1 gene of 14 strains. In addition, the sequence of the VP1/2A junction region of strains from geographical regions endemic for PV3 (Egypt, India, and Central Asia) was analyzed and compared with the nucleotide sequence of the epidemic strain from The Netherlands. The earliest isolate was obtained from river water sampled 3 weeks before diagnosis of the first poliomyelitis patient and was found by VP1/2A sequence analysis to be genetically identical to the strain isolated from the first patient. Sequence divergence among the strains from the epidemic in The Netherlands was less than 2%. The closest genetic similarity (97.3%) was found with an Indian isolate (New Delhi, December 1991), indicating the likely source of the virus. A more than 99% sequence similarity was found in the VP1/2A region. Finally, the sequence information was used to design primers for the specific and highly sensitive molecular detection of PV3 strains during the epidemic. PMID:8586711

Molecular epidemiology of enterovirus 71 infection in the central region of Taiwan from 2002 to 2012.

PubMed

Wu, Wen-Hao; Kuo, Ta-Cheng; Lin, Yu-Ting; Huang, Szu-Wei; Liu, Hsin-Fu; Wang, John; Chen, Yi-Ming Arthur

2013-01-01

Enterovirus 71 (EV71), a causative agent of hand, foot, and mouth disease can be classified into three genotypes and many subtypes. The objectives of this study were to conduct a molecular epidemiological study of EV71 in the central region of Taiwan from 2002-2012 and to test the hypothesis that whether the alternative appearance of different EV71 subtypes in Taiwan is due to transmission from neighboring countries or from re-emergence of pre-existing local strains. We selected 174 EV71 isolates and used reverse transcription-polymerase chain reaction to amplify their VP1 region for DNA sequencing. Phylogenetic analyses were conducted using Neighbor-Joining, Maximum Likelihood and Bayesian methods. We found that the major subtypes of EV71 in Taiwan were B4 for 2002 epidemic, C4 for 2004-2005 epidemic, B5 for 2008-2009 epidemic, C4 for 2010 epidemic and B5 for 2011-2012 epidemic. Phylogenetic analysis demonstrated that the 2002 and 2008 epidemics were associated with EV71 from Malaysia and Singapore; while both 2010 and 2011-2012 epidemics originated from different regions of mainland China including Shanghai, Henan, Xiamen and Gong-Dong. Furthermore, minor strains have been identified in each epidemic and some of them were correlated with the subsequent outbreaks. Therefore, the EV71 infection in Taiwan may originate from pre-existing minor strains or from other regions in Asia including mainland China. In addition, 101 EV71 isolates were selected for the detection of new recombinant strains using the nucleotide sequences spanning the VP1-2A-2B region. No new recombinant strain was found. Analysis of clinical manifestations showed that patients infected with C4 had significantly higher rates of pharyngeal vesicles or ulcers than patients infected with B5. This is the first study demonstrating that different EV 71 genotypes may have different clinical manifestations and the association of EV71 infections between Taiwan and mainland China.

Survivability and molecular variation in Vibrio cholerae from epidemic sites in China.

PubMed

Li, X Q; Wang, M; Deng, Z A; Shen, J C; Zhang, X Q; Liu, Y F; Cai, Y S; Wu, X W; DI, B

2015-01-01

The survival behaviour of Vibrio cholerae in cholera epidemics, together with its attributes of virulence-associated genes and molecular fingerprints, are significant for managing cholera epidemics. Here, we selected five strains representative of V. cholerae O1 and O139 involved in cholera events, examined their survival capacity in large volumes of water sampled from epidemic sites of a 2005 cholera outbreak, and determined virulence-associated genes and molecular subtype changes of the surviving isolates recovered. The five strains exhibited different survival capacities varying from 17 to 38 days. The virulence-associated genes of the surviving isolates remained unchanged, while their pulsotypes underwent slight variation. In particular, one waterway-isolated strain maintained virulence-associated genes and evolved to share the same pulsotype as patient strains, highlighting its role in the cholera outbreak. The strong survival capacity and molecular attributes of V. cholerae might account for its persistence in environmental waters and the long duration of the cholera outbreak, allowing effective control measures.

Vaccine Efficacy and Affinity Maturation

NASA Astrophysics Data System (ADS)

Lee, Hayoun; Deem, Michael W.

2002-03-01

We propose macroscopic equations to describe variable vaccine efficacy between repeated vaccinee and first time vaccinee. The main ingredients are antigenic distance between epidemic strain and vaccne strain, and affinity maturation dynamics which differs in primary and second response. Increase of affinity by repeated vaccine leads to localization in immune space. This localization decreases the ability of the immune system to response to distant, but related epidemic strains.

Rapid genotyping of Legionella pneumophila serogroup 1 strains by a novel DNA microarray-based assay during the outbreak investigation in Warstein, Germany 2013.

PubMed

Petzold, Markus; Ehricht, Ralf; Slickers, Peter; Pleischl, Stefan; Brockmann, Ansgar; Exner, Martin; Monecke, Stefan; Lück, Christian

2017-06-01

Between 1 August and 6 September 2013, an outbreak of Legionnaires' disease (LD) with 78 cases confirmed by positive urinary antigen tests occurred in Warstein, North Rhine-Westphalia, Germany. Legionella (L.) pneumophila, serogroup (Sg) 1, monoclonal antibody (mAb) subgroup Knoxville, sequence type (ST) 345, was identified as the epidemic strain. This strain was isolated from seven patients. To detect the source of the infection, epidemiological typing of clinical and environmental strains was performed in two consecutive steps. First, strains were typed by monoclonal antibodies. Indistinguishable strains were further subtyped by sequence-based typing (SBT) which is the internationally recognized standard method for epidemiological genotyping of L. pneumophila. In an early stage of the outbreak investigation, many environmental isolates were found to belong to the mAb subgroup Knoxville, but to two different STs, namely to ST 345, the epidemic strain, and to ST 600. A majority of environmental isolates belonged to ST 600 whereas the epidemic ST 345 strain was less common in environmental samples. To rapidly distinguish both Knoxville strains, we applied a novel typing method based on DNA-hybridization on glass chips. The new assay can easily and rapidly discriminate L. pneumophila Sg 1 strains. Thus, we were able to quickly identify the sources harboring the epidemic strain, i.e., two cooling towers of different companies, the waste water treatment plants (WWTP) of the city and one company as well as water samples of the river Wester and its branches. Copyright © 2016 Elsevier GmbH. All rights reserved.

Ten-Year Surveillance of Measles Virus from 2007-2016 in Osaka City, Japan.

PubMed

Kaida, Atsushi; Iritani, Nobuhiro; Kanbayashi, Daiki; Yamamoto, Seiji P; Hirai, Yuki; Hakui, Noritaka; Fujimori, Ryoko; Mori, Hiromi; Hirokawa, Hidetetsu; Ogasawara, Jun; Kubo, Hideyuki

2018-03-22

Measles is a highly contagious infection caused by the measles virus (MV). This study performed long-term surveillance in order to survey the prevalence of MV. A total of 417 patients diagnosed with or suspected of having measles were tested for MV between January 2007 and December 2016 in Osaka City, Japan. Reverse transcription-polymerase chain reaction-based testing of clinical specimens showed that 54 patients (12.9%) were MV-positive. An MV epidemic occurred in 2007, in which all detected MV strains were genotype D5, an epidemic strain in Japan at that time. The detected wild-type MV strains in sporadic or outbreak-associated cases since 2011 included genotypes D4, D8, B3, and H1. Three vaccine strains (all genotype A) were also detected. Children ＜10 years of age accounted for 90.0% of the MV-positive patients in 2007. In contrast, adults (≥ 20 years of age) accounted for the majority of MV-positive cases since 2011, as follows: 100%, 50%, 71.4%, 100%, and 87.5% of cases in 2011, 2013, 2014, 2015, and 2016, respectively. The recent high rate of two-dose MV vaccination coverage among children in Japan may have contributed to the reduced risk of MV infection and onset of measles in young persons.

H3N2 Mismatch of 2014–15 Northern Hemisphere Influenza Vaccines and Head-to-head Comparison between Human and Ferret Antisera derived Antigenic Maps

PubMed Central

Xie, Hang; Wan, Xiu-Feng; Ye, Zhiping; Plant, Ewan P.; Zhao, Yangqing; Xu, Yifei; Li, Xing; Finch, Courtney; Zhao, Nan; Kawano, Toshiaki; Zoueva, Olga; Chiang, Meng-Jung; Jing, Xianghong; Lin, Zhengshi; Zhang, Anding; Zhu, Yanhong

2015-01-01

The poor performance of 2014–15 Northern Hemisphere (NH) influenza vaccines was attributed to mismatched H3N2 component with circulating epidemic strains. Using human serum samples collected from 2009–10, 2010–11 and 2014–15 NH influenza vaccine trials, we assessed their cross-reactive hemagglutination inhibition (HAI) antibody responses against recent H3 epidemic isolates. All three populations (children, adults, and older adults) vaccinated with the 2014–15 NH egg- or cell-based vaccine, showed >50% reduction in HAI post-vaccination geometric mean titers against epidemic H3 isolates from those against egg-grown H3 vaccine strain A/Texas/50/2012 (TX/12e). The 2014–15 NH vaccines, regardless of production type, failed to further extend HAI cross-reactivity against H3 epidemic strains from previous seasonal vaccines. Head-to-head comparison between ferret and human antisera derived antigenic maps revealed different antigenic patterns among representative egg- and cell-grown H3 viruses characterized. Molecular modeling indicated that the mutations of epidemic H3 strains were mainly located in antibody-binding sites A and B as compared with TX/12e. To improve vaccine strain selection, human serologic testing on vaccination-induced cross-reactivity need be emphasized along with virus antigenic characterization by ferret model. PMID:26472175

H3N2 Mismatch of 2014-15 Northern Hemisphere Influenza Vaccines and Head-to-head Comparison between Human and Ferret Antisera derived Antigenic Maps

NASA Astrophysics Data System (ADS)

Xie, Hang; Wan, Xiu-Feng; Ye, Zhiping; Plant, Ewan P.; Zhao, Yangqing; Xu, Yifei; Li, Xing; Finch, Courtney; Zhao, Nan; Kawano, Toshiaki; Zoueva, Olga; Chiang, Meng-Jung; Jing, Xianghong; Lin, Zhengshi; Zhang, Anding; Zhu, Yanhong

2015-10-01

The poor performance of 2014-15 Northern Hemisphere (NH) influenza vaccines was attributed to mismatched H3N2 component with circulating epidemic strains. Using human serum samples collected from 2009-10, 2010-11 and 2014-15 NH influenza vaccine trials, we assessed their cross-reactive hemagglutination inhibition (HAI) antibody responses against recent H3 epidemic isolates. All three populations (children, adults, and older adults) vaccinated with the 2014-15 NH egg- or cell-based vaccine, showed >50% reduction in HAI post-vaccination geometric mean titers against epidemic H3 isolates from those against egg-grown H3 vaccine strain A/Texas/50/2012 (TX/12e). The 2014-15 NH vaccines, regardless of production type, failed to further extend HAI cross-reactivity against H3 epidemic strains from previous seasonal vaccines. Head-to-head comparison between ferret and human antisera derived antigenic maps revealed different antigenic patterns among representative egg- and cell-grown H3 viruses characterized. Molecular modeling indicated that the mutations of epidemic H3 strains were mainly located in antibody-binding sites A and B as compared with TX/12e. To improve vaccine strain selection, human serologic testing on vaccination-induced cross-reactivity need be emphasized along with virus antigenic characterization by ferret model.

Detection of cholera (ctx) and zonula occludens (zot) toxin genes in Vibrio cholerae O1, O139 and non-O1 strains.

PubMed

Rivera, I G; Chowdhury, M A; Sanchez, P S; Sato, M I; Huq, A; Colwell, R R; Martins, M T

1995-09-01

Vibrio cholerae O1 and V. cholerae non-O1 strains isolated from environmental samples collected in São Paulo, Brazil, during cholera epidemics and pre-epidemic periods were examined for the presence of toxin genes. V. cholerae O1 strains isolated from clinical samples in Peru and Mexico, and V. cholerae O139 strains from India were also examined for the presence of ctx (cholera toxin gene) and zot (zonula occludens toxin gene) by polymerase chain reaction (PCR). A modified DNA-extraction method applied in this study yielded satisfactory recovery of genomic DNA from vibrios. Results showed that strains of V. cholerae O1 isolated during the preepidemic period were ctx (-)/zot (-) whereas strains isolated during the epidemic were ctx (+)/zot (+). All V. cholerae non-O1 strains tested in the study were ctx (-)/zot (-), whereas all V. cholerae O139 strains were ctx (+)/zot (+). Rapid detection of the virulence genes (ctx and zot) can be achieved by PCR and this can serve as an important tool in the epidemiology and surveillance of V. cholerae.

Distribution of Genes Encoding Putative Transmissibility Factors among Epidemic and Nonepidemic Strains of Burkholderia cepacia from Cystic Fibrosis Patients in the United Kingdom

PubMed Central

Clode, Fiona E.; Kaufmann, Mary E.; Malnick, Henry; Pitt, Tyrone L.

2000-01-01

In the last 15 years, Burkholderia cepacia has emerged as a significant pathogen in cystic fibrosis (CF) patients, mainly due to the severity of infection observed in a subset of patients and the fear of transmission of the organism to noncolonized patients. Although patients who deteriorate rapidly cannot be predicted by microbiological characteristics, three genetic markers have been described for strains that spread between patients. These are the cblA gene, encoding giant cable pili; a hybrid of two insertion sequences, IS1356 and IS402; and a 1.4-kb open reading frame known as the B. cepacia epidemic strain marker (BCESM). The latter two are of unknown function. An epidemic strain lineage was previously identified among CF patients in the United Kingdom that apparently had spread from North America and that was characterized by a specific random amplified polymorphic DNA (RAPD) pattern. We searched for the described genetic markers using specific PCR assays with 117 patient isolates of B. cepacia from 40 United Kingdom hospitals. Isolates were grouped according to genomovar and epidemic strain lineage RAPD pattern with a 10-base primer, P272. A total of 41 isolates from patients in 12 hospitals were classified as the epidemic strain, and 40 of these were distributed in genomovars IIIa (11 isolates), IIIb (1 isolate), and IIIc (28 isolates). All isolates of the epidemic strain were positive for the cblA gene and BCESM, but two lacked the insertion sequence hybrid. None of the 76 sporadic isolates contained cblA or the insertion sequence hybrid, but 11 of them were positive for BCESM. Nonepidemic isolates were distributed among genomovars I or IV (9), II (49), IIIa (11), IIIb (3), and IIIc (4). There were three clusters of cross-infection (one involving two patients and two involving three patients) with isolates of genomovar II. We conclude that in the United Kingdom, a single clonal lineage has spread between and within some hospitals providing care for CF patients. The presence of the cblA gene is the most specific marker for the epidemic strain. We recommend that all isolates of B. cepacia from CF patients should be screened by PCR to influence segregation and infection control strategies. PMID:10790095

Resurgence of Mumps in Korea

PubMed Central

2015-01-01

Routine vaccination against mumps has markedly reduced its incidence. However, the incidence of mumps continuously has increased since 2007. In 2013, a large mumps epidemic occurred in Korea, and this epidemic is still an ongoing problem. This epidemic occurred primarily in school settings and affected vaccinated adolescents, predominantly male students. The recent resurgence of mumps is caused by multiple factors: suboptimal effectiveness of the current mumps vaccines, use of the Rubini strain vaccine, waning immunity in the absence of natural boosting due to the marked reduction in the mumps incidence, genotype mismatch between the vaccine and circulating mumps virus strains, and environmental conditions that foster intense exposures. Containment of mumps outbreaks is challenging because the sensitivity of diagnostic tests is low among vaccinees and control measures are less efficient because of the inherent nature of the mumps virus. Despite the suboptimal vaccine effectiveness in outbreak settings, maintaining the high vaccine coverage is an important strategy to prevent mumps outbreaks, given that the routine use of mumps vaccines has substantially reduced the incidence of mumps and its complications as compared with that in the pre-vaccine era. In order to control the current mumps epidemic and prevent further outbreaks, we need to better understand the dynamics of mumps among vaccinated populations and the changing epidemiology in Korea. Concerted efforts should be made to systematically monitor the immunization status of the Korean population and to improve diagnosis efficiency. Furthermore, more effective mumps vaccines need to be developed in the future. PMID:25844258

Genetic relatedness of ciprofloxacin-resistant Shigella dysenteriae type 1 strains isolated in south Asia.

PubMed

Talukder, Kaisar A; Khajanchi, Bijay K; Islam, M Aminul; Dutta, Dilip K; Islam, Zhahirul; Safa, Ashrafus; Khan, G Y; Alam, Khorshed; Hossain, M A; Malla, Sarala; Niyogi, S K; Rahman, Mustafizur; Watanabe, Haruo; Nair, G Balakrish; Sack, David A

2004-10-01

The aim of the present study was to determine the clonal relationships of ciprofloxacin-resistant Shigella dysenteriae type 1 strains isolated from south Asia, and S. dysenteriae 1 strains associated with epidemics in 1978, 1984 and 1994. The antimicrobial susceptibilities were examined by NCCLS methods. Molecular epidemiological characterization was performed by plasmid profiling, pulsed-field gel electrophoresis (PFGE) and mutation analysis of the quinolone resistance-determining region (QRDR) of gyrA by sequencing. Plasmid patterns of the current ciprofloxacin-resistant strains from India, Nepal and Bangladesh were very similar to those of the 1978, 1984 and 1994 epidemic isolates of S. dysenteriae 1, except for the presence of a new plasmid of approximately 2.6 MDa, which was found in one recent ciprofloxacin-resistant strain isolated in Bangladesh. PFGE analysis showed that the ciprofloxacin-resistant strains isolated in Bangladesh, India and Nepal belonged to a PFGE type (type A), which was possibly related to that of the 1984 and 1994 clone of S. dysenteriae 1, but different from 1978 epidemic strains. The current ciprofloxacin-resistant strains belong to five subtypes (A3-A7), all of which were found in India, but in Bangladesh and Nepal, only A3 existed. Mutation analysis of the QRDR of gyrA revealed that amino acid substitutions at positions 83 and 87 of ciprofloxacin-resistant strains isolated in Bangladesh were similar to those of the strains isolated in Nepal, but different (at position 87) from ciprofloxacin-resistant strains isolated in India. PFGE and mutation analysis of gyrA showed differences between the current ciprofloxacin-resistant S. dysenteriae 1 strains isolated in south Asia and those associated with epidemics in 1978, 1984 and 1994.

A Field Guide to Pandemic, Epidemic and Sporadic Clones of Methicillin-Resistant Staphylococcus aureus

PubMed Central

Monecke, Stefan; Coombs, Geoffrey; Shore, Anna C.; Coleman, David C.; Akpaka, Patrick; Borg, Michael; Chow, Henry; Ip, Margaret; Jatzwauk, Lutz; Jonas, Daniel; Kadlec, Kristina; Kearns, Angela; Laurent, Frederic; O'Brien, Frances G.; Pearson, Julie; Ruppelt, Antje; Schwarz, Stefan; Scicluna, Elizabeth; Slickers, Peter; Tan, Hui-Leen; Weber, Stefan; Ehricht, Ralf

2011-01-01

In recent years, methicillin-resistant Staphylococcus aureus (MRSA) have become a truly global challenge. In addition to the long-known healthcare-associated clones, novel strains have also emerged outside of the hospital settings, in the community as well as in livestock. The emergence and spread of virulent clones expressing Panton-Valentine leukocidin (PVL) is an additional cause for concern. In order to provide an overview of pandemic, epidemic and sporadic strains, more than 3,000 clinical and veterinary isolates of MRSA mainly from Germany, the United Kingdom, Ireland, France, Malta, Abu Dhabi, Hong Kong, Australia, Trinidad & Tobago as well as some reference strains from the United States have been genotyped by DNA microarray analysis. This technique allowed the assignment of the MRSA isolates to 34 distinct lineages which can be clearly defined based on non-mobile genes. The results were in accordance with data from multilocus sequence typing. More than 100 different strains were distinguished based on affiliation to these lineages, SCCmec type and the presence or absence of PVL. These strains are described here mainly with regard to clinically relevant antimicrobial resistance- and virulence-associated markers, but also in relation to epidemiology and geographic distribution. The findings of the study show a high level of biodiversity among MRSA, especially among strains harbouring SCCmec IV and V elements. The data also indicate a high rate of genetic recombination in MRSA involving SCC elements, bacteriophages or other mobile genetic elements and large-scale chromosomal replacements. PMID:21494333

Phylodynamics of the HIV-1 epidemic in Cuba.

PubMed

Delatorre, Edson; Bello, Gonzalo

2013-01-01

Previous studies have shown that the HIV-1 epidemic in Cuba displayed a complex molecular epidemiologic profile with circulation of several subtypes and circulating recombinant forms (CRF); but the evolutionary and population history of those viral variants remains unknown. HIV-1 pol sequences of the most prevalent Cuban lineages (subtypes B, C and G, CRF18_cpx, CRF19_cpx, and CRFs20/23/24_BG) isolated between 1999 and 2011 were analyzed. Maximum-likelihood analyses revealed multiple introductions of subtype B (n≥66), subtype C (n≥10), subtype G (n≥8) and CRF18_cpx (n≥2) viruses in Cuba. The bulk of HIV-1 infections in this country, however, was caused by dissemination of a few founder strains probably introduced from North America/Europe (clades B(CU-I) and B(CU-II)), east Africa (clade C(CU-I)) and central Africa (clades G(CU), CRF18(CU) and CRF19(CU)), or locally generated (clades CRFs20/23/24_BG). Bayesian-coalescent analyses show that the major HIV-1 founder strains were introduced into Cuba during 1985-1995; whereas the CRFs_BG strains emerged in the second half of the 1990s. Most HIV-1 Cuban clades appear to have experienced an initial period of fast exponential spread during the 1990s and early 2000s, followed by a more recent decline in growth rate. The median initial growth rate of HIV-1 Cuban clades ranged from 0.4 year⁻¹ to 1.6 year⁻¹. Thus, the HIV-1 epidemic in Cuba has been a result of the successful introduction of a few viral strains that began to circulate at a rather late time of the AIDS pandemic, but then were rapidly disseminated through local transmission networks.

Molecular characterization of wild-type polioviruses isolated in Greece during the 1996 outbreak in Albania.

PubMed

Kyriakopoulou, Zaharoula; Kottaridi, Christine; Dedepsidis, Evaggelos; Bolanaki, Eugenia; Levidiotou-Stefanou, Stamatina; Markoulatos, Panayotis

2006-03-01

During the present study three type 1 poliovirus strains isolated in Greece during the 1996 poliomyelitis outbreak in Albania were retrospectively investigated and determination of their relationship with other epidemic strains isolated in Albania or elsewhere during previous epidemics was attempted. SimPlot analysis revealed that the three Greek strains are the result of a recombination event in the VP2 coding region.

Genetic Surveillance Detects Both Clonal and Epidemic Transmission of Malaria following Enhanced Intervention in Senegal

PubMed Central

Séne, Papa Diogoye; Park, Danny C.; Neafsey, Daniel E.; Schaffner, Stephen F.; Hamilton, Elizabeth J.; Lukens, Amanda K.; Van Tyne, Daria; Mboup, Souleymane; Sabeti, Pardis C.; Ndiaye, Daouda; Wirth, Dyann F.

2013-01-01

Using parasite genotyping tools, we screened patients with mild uncomplicated malaria seeking treatment at a clinic in Thiès, Senegal, from 2006 to 2011. We identified a growing frequency of infections caused by genetically identical parasite strains, coincident with increased deployment of malaria control interventions and decreased malaria deaths. Parasite genotypes in some cases persisted clonally across dry seasons. The increase in frequency of genetically identical parasite strains corresponded with decrease in the probability of multiple infections. Further, these observations support evidence of both clonal and epidemic population structures. These data provide the first evidence of a temporal correlation between the appearance of identical parasite types and increased malaria control efforts in Africa, which here included distribution of insecticide treated nets (ITNs), use of rapid diagnostic tests (RDTs) for malaria detection, and deployment of artemisinin combination therapy (ACT). Our results imply that genetic surveillance can be used to evaluate the effectiveness of disease control strategies and assist a rational global malaria eradication campaign. PMID:23593309

Deciphering the Origins and Tracking the Evolution of Cholera Epidemics with Whole-Genome-Based Molecular Epidemiology

PubMed Central

Grad, Yonatan H.; Waldor, Matthew K.

2013-01-01

ABSTRACT The devastating Haitian cholera outbreak that began in October 2010 is the first known cholera epidemic in this island nation. Epidemiological and genomic data have provided strong evidence that United Nations security forces from Nepal introduced toxigenic Vibrio cholerae O1, the cause of epidemic cholera, to Haiti shortly before the outbreak arose. However, some have contended that indigenous V. cholerae contributed to the outbreak. In a recent paper (mBio 4:e00398-13, 2013), L. S. Katz et al. explored the nature and rate of changes in this ancient pathogen’s genome during an outbreak, based on whole-genome sequencing of 23 Haitian V. cholerae clinical isolates obtained over a 20-month period. Notably, they detected point mutations, deletions, and inversions but found no insertion of horizontally transmitted DNA, arguing strongly against the idea that autochthonous V. cholerae donated DNA to the outbreak strain. Furthermore, they found that Haitian epidemic V. cholerae isolates were virtually untransformable. Comparative genomic analyses revealed that the Haitian isolates were nearly identical to isolates from Nepal and that the Nepalese-Haitian isolates were distinguishable from isolates circulating elsewhere in the world. Reconstruction of the phylogeny of the Haitian isolates was consistent with a single introduction of V. cholerae to Haiti sometime between late July and late October 2010, dates remarkably concordant with epidemiological observations. In aggregate, this paper provides additional compelling evidence that the V. cholerae strain responsible for the Haitian cholera epidemic came from Nepal and illustrates the power of whole-genome-based analyses for epidemiology, pathogen evolution, and forensics. PMID:24023387

Emergence of wheat blast in Bangladesh was caused by a South American lineage of Magnaporthe oryzae.

PubMed

Islam, M Tofazzal; Croll, Daniel; Gladieux, Pierre; Soanes, Darren M; Persoons, Antoine; Bhattacharjee, Pallab; Hossain, Md Shaid; Gupta, Dipali Rani; Rahman, Md Mahbubur; Mahboob, M Golam; Cook, Nicola; Salam, Moin U; Surovy, Musrat Zahan; Sancho, Vanessa Bueno; Maciel, João Leodato Nunes; NhaniJúnior, Antonio; Castroagudín, Vanina Lilián; Reges, Juliana T de Assis; Ceresini, Paulo Cezar; Ravel, Sebastien; Kellner, Ronny; Fournier, Elisabeth; Tharreau, Didier; Lebrun, Marc-Henri; McDonald, Bruce A; Stitt, Timothy; Swan, Daniel; Talbot, Nicholas J; Saunders, Diane G O; Win, Joe; Kamoun, Sophien

2016-10-03

In February 2016, a new fungal disease was spotted in wheat fields across eight districts in Bangladesh. The epidemic spread to an estimated 15,000 hectares, about 16 % of the cultivated wheat area in Bangladesh, with yield losses reaching up to 100 %. Within weeks of the onset of the epidemic, we performed transcriptome sequencing of symptomatic leaf samples collected directly from Bangladeshi fields. Reinoculation of seedlings with strains isolated from infected wheat grains showed wheat blast symptoms on leaves of wheat but not rice. Our phylogenomic and population genomic analyses revealed that the wheat blast outbreak in Bangladesh was most likely caused by a wheat-infecting South American lineage of the blast fungus Magnaporthe oryzae. Our findings suggest that genomic surveillance can be rapidly applied to monitor plant disease outbreaks and provide valuable information regarding the identity and origin of the infectious agent.

Molecular Studies of Alphavirus Immunogenicity

DTIC Science & Technology

1992-12-03

RNAs. These include Ockelbo virus, a virus causing epidemic polyarthritis .n northern Europe , strains of Sindbis virus from Africa, India, Australia...TD TL A VA VAT R YE VDNI T 3421 GGUGUGGUGGIJGGCAUUGAGAACUUUUGCGGAGAGCAAAJAGAGCAUUUGAAGCGAUCAGA 3480 P VL LA L RT F A QS KRA F QA I R 3481...alphaviruses. The Sindbis-like viruses, which are found throughout the Old World from Northern Europe to Africa, India, the Philippines and the Australasian

Phylogenomics of Brazilian epidemic isolates of Mycobacterium abscessus subsp. bolletii reveals relationships of global outbreak strains

PubMed Central

Davidson, Rebecca M.; Hasan, Nabeeh A.; de Moura, Vinicius Calado Nogueira; Duarte, Rafael Silva; Jackson, Mary; Strong, Michael

2013-01-01

Rapidly growing, non-tuberculous mycobacteria (NTM) in the Mycobacterium abscessus (MAB) species are emerging pathogens that cause various diseases including skin and respiratory infections. The species has undergone recent taxonomic nomenclature refinement, and is currently recognized as two subspecies, M. abscessus subsp. abscessus (MAB-A) and M. abscessus subsp. bolletii (MAB-B). The recently reported outbreaks of MAB-B in surgical patients in Brazil from 2004 to 2009 and in cystic fibrosis patients in the United Kingdom (UK) in 2006 to 2012 underscore the need to investigate the genetic diversity of clinical MAB strains. To this end, we sequenced the genomes of two Brazilian MAB-B epidemic isolates (CRM-0019 and CRM-0020) derived from an outbreak of skin infections in Rio de Janeiro, two unrelated MAB strains from patients with pulmonary infections in the United States (US) (NJH8 and NJH11) and one type MAB-B strain (CCUG 48898) and compared them to 25 publically available genomes of globally diverse MAB strains. Genome-wide analyses of 27,598 core genome single nucleotide polymorphisms (SNPs) revealed that the two Brazilian derived CRM strains are nearly indistinguishable from one another and are more closely related to UK outbreak isolates infecting CF patients than to strains from the US, Malaysia or France. Comparative genomic analyses of six closely related outbreak strains revealed geographic-specific large-scale insertion/deletion variation that corresponds to bacteriophage insertions and recombination hotspots. Our study integrates new genome sequence data with existing genomic information to explore the global diversity of infectious M. abscessus isolates and to compare clinically relevant outbreak strains from different continents. PMID:24055961

Invasion and Maintenance of Dengue Virus Type 2 and Type 4 in the Americas†

PubMed Central

Carrington, Christine V. F.; Foster, Jerome E.; Pybus, Oliver G.; Bennett, Shannon N.; Holmes, Edward C.

2005-01-01

Dengue virus type 4 (DENV-4) was first reported in the Americas in 1981, where it caused epidemics of dengue fever throughout the region. In the same year, the region's first epidemic of dengue hemorrhagic fever was reported, caused by an Asian strain of dengue virus type 2 (DENV-2) that was distinct from the American subtype circulating previously. Despite the importance of these epidemics, little is known about the rates or determinants of viral spread among island and mainland populations or their directions of movement. We employed a Bayesian coalescent approach to investigate the transmission histories of DENV-2 and DENV-4 since their introduction in 1981 and a parsimony method to assess patterns of strain migration. For both viruses there was an initial invasion phase characterized by an exponential increase in the number of DENV lineages, after which levels of genetic diversity remained constant despite reported fluctuations in DENV-2 and DENV-4 activity. Strikingly, viral lineage numbers increased far more rapidly for DENV-4 than DENV-2, indicative of a more rapid rate of exponential population growth in DENV-4 or a higher rate of geographic dispersal, allowing this virus to move more effectively among localities. We propose that these contrasting dynamics may reflect underlying differences in patterns of host immunity. Despite continued gene flow along particular transmission routes, the overall extent of viral traffic was less than expected under panmixis. Hence, DENV in the Americas has a clear geographic structure that maintains viral diversity between outbreaks. PMID:16282468

National Epidemiologic Surveys of Enterobacter aerogenes in Belgian Hospitals from 1996 to 1998

PubMed Central

De Gheldre, Y.; Struelens, M. J.; Glupczynski, Y.; De Mol, P.; Maes, N.; Nonhoff, C.; Chetoui, H.; Sion, C.; Ronveaux, O.; Vaneechoutte, M.

2001-01-01

Two national surveys were conducted to describe the incidence and prevalence of Enterobacter aerogenes in 21 Belgian hospitals in 1996 and 1997 and to characterize the genotypic diversity and the antimicrobial resistance profiles of clinical strains of E. aerogenes isolated from hospitalized patients in Belgium in 1997 and 1998. Twenty-nine hospitals collected 10 isolates of E. aerogenes, which were typed by arbitrarily primed PCR (AP-PCR) using two primers and pulsed-field gel electrophoresis. MICs of 10 antimicrobial agents were determined by the agar dilution method. Beta-lactamases were detected by the double-disk diffusion test and characterized by isoelectric point. The median incidence of E. aerogenes colonization or infection increased from 3.3 per 1,000 admissions in 1996 to 4.2 per 1000 admissions in the first half of 1997 (P < 0.01). E. aerogenes strains (n = 260) clustered in 25 AP-PCR types. Two major types, BE1 and BE2, included 36 and 38% of strains and were found in 21 and 25 hospitals, respectively. The BE1 type was indistinguishable from a previously described epidemic strain in France. Half of the strains produced an extended-spectrum beta-lactamase, either TEM-24 (in 86% of the strains) or TEM-3 (in 14% of the strains). Over 75% of the isolates were resistant to ceftazidime, piperacillin-tazobactam, and ciprofloxacin. Over 90% of the strains were susceptible to cefepime, carbapenems, and aminoglycosides. In conclusion, these data suggest a nationwide dissemination of two epidemic multiresistant E. aerogenes strains in Belgian hospitals. TEM-24 beta-lactamase was frequently harbored by one of these epidemic strains, which appeared to be genotypically related to a TEM-24-producing epidemic strain from France, suggesting international dissemination. PMID:11230400

Pathogenesis comparison between the United States porcine epidemic diarrhoea virus prototype and S-INDEL-variant strains in conventional neonatal piglets.

PubMed

Chen, Qi; Gauger, Phillip C; Stafne, Molly R; Thomas, Joseph T; Madson, Darin M; Huang, Haiyan; Zheng, Ying; Li, Ganwu; Zhang, Jianqiang

2016-05-01

At least two genetically different porcine epidemic diarrhoea virus (PEDV) strains have been identified in the USA: US PEDV prototype and S-INDEL-variant strains. The objective of this study was to compare the pathogenicity differences of the US PEDV prototype and S-INDEL-variant strains in conventional neonatal piglets under experimental infections. Fifty PEDV-negative 5-day-old pigs were divided into five groups of ten pigs each and were inoculated orogastrically with three US PEDV prototype isolates (IN19338/2013, NC35140/2013 and NC49469/2013), an S-INDEL-variant isolate (IL20697/2014), and virus-negative culture medium, respectively, with virus titres of 104 TCID50 ml- 1, 10 ml per pig. All three PEDV prototype isolates tested in this study, regardless of their phylogenetic clades, had similar pathogenicity and caused severe enteric disease in 5-day-old pigs as evidenced by clinical signs, faecal virus shedding, and gross and histopathological lesions. Compared with pigs inoculated with the three US PEDV prototype isolates, pigs inoculated with the S-INDEL-variant isolate had significantly diminished clinical signs, virus shedding in faeces, gross lesions in small intestines, caeca and colons, histopathological lesions in small intestines, and immunohistochemistry staining in ileum. However, the US PEDV prototype and the S-INDEL-variant strains induced similar viraemia levels in inoculated pigs. Whole genome sequences of the PEDV prototype and S-INDEL-variant strains were determined, but the molecular basis of virulence differences between these PEDV strains remains to be elucidated using a reverse genetics approach.

Aggressiveness Changes in Populations of Didymella pinodes over Winter and Spring Pea Cropping Seasons.

PubMed

Laloi, G; Montarry, J; Guibert, M; Andrivon, D; Michot, D; Le May, C

2016-07-15

Ascochyta blight, caused by the necrotrophic ascomycete Didymella pinodes, is responsible for severe losses in winter and spring pea crops. Despite different climatic conditions, epidemics on winter and spring crops are due to a single population of D. pinodes, suggesting gene flow either between the two crops or from reservoir sources during the cropping season. This should lead to similar pathogenicity characteristics in isolates sampled from the two crops. However, these hypotheses have never been formally tested. We therefore sampled a total of 520 D. pinodes strains throughout a growing season from winter and spring pea plots (WP and SP, respectively) and from winter and spring trap plants (TWP and TSP). Amplified fragment length polymorphism (AFLP) markers revealed high genetic diversity within subpopulations, whereas pathogenicity tests showed that mean aggressiveness increases over the course of an epidemic. These results support the idea that alloinoculum contributes to the carryover of epidemics between winter and spring crops and that the most aggressive isolates are selected as an epidemic progresses. Ascochyta blight, caused by Didymella pinodes, is responsible for severe losses in pea crops. While previous studies have shown that ascochyta blight epidemics on winter and spring crops are due to a single population of D. pinodes, suggesting that isolates from the two crops present similar pathogenicity characteristics, that hypothesis have never been tested. Genetic analysis of subpopulations sampled throughout a growing season from winter and spring pea plots revealed high genetic diversity within subpopulations, whereas pathogenicity tests showed that mean aggressiveness increases over the course of an epidemic. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Ecologic studies of Venezuelan encephalitis virus in Peru during 1970-1971.

PubMed

Scherer, W F; Madalengoitia, J; Flores, W; Acosta, M

1975-04-01

Venezuelan encephalitis (VE) virus has intermittently produced epidemics and equine epizootics on the dry Pacific coastal plain of Peru since at least the 1930's. However, evidence that the virus exists in the Amazon region of Peru to the east of the Andes mountains was not obtained until antibodies were found in human sera collected in 1965, and 10 strains of the virus were isolated in a forest near the city of Iquitos, Peru during February and March 1971. Eight strains came from mosquitoes and two from dead sentinel hamsters. Three hamsters exposed in forests near Iquitos developed VE virus antibodies suggesting that hamster-benign strains also exist there. Antibody tests of equine sera revealed no evidence that VE virus was actively cycling during the late 1950's or 1960's in southern coastal Peru, where equine epizootics had occurred in the 1930's and 1940's. In northern coastal Peru bordering Ecuador, antibodies were present in equine sera, presumably residual from the 1969 outbreak caused by subtype I virus, since neutralizing antibody titers were higher to subtype I virus than to subtypes III or IV. No VE virus was detected in this northern region during the dry season of 1970 by use of sentinel hamsters. The possibility is considered that VE epidemics and equine epizootics on the Pacific coast of Peru are caused by movements of virus in infected vertebrates traversing Andean passes or in infected vertebrates or mosquitoes carried in airplanes from the Amazon region.

In vitro transfer of multiple resistance observed in vivo during a Salmonella london epidemic.

PubMed

Lantos, J; Marjai, E

1980-01-01

Between 1976 and 1978, waves of Salmonella london infections conveyed by raw meat and meat products were observed. The strains isolated during the epidemic were first susceptible then developed multiple antibiotic resistance. The identical antibiotic resistance patterns of the strain and their more frequent occurrence in hospital environments indicated plasmid-mediated resistance. R-plasmid transfer, minimum inhibition concentration and resistance elimination were studied in representative strains. The resistant S. london strain and transconjugants of Escherichia coli rendered resistant were compared. The results proved that multiple resistance was plasmid-mediated.

Genome-Wide Study of the Defective Sucrose Fermenter Strain of Vibrio cholerae from the Latin American Cholera Epidemic

PubMed Central

Garza, Daniel Rios; Thompson, Cristiane C.; Loureiro, Edvaldo Carlos Brito; Dutilh, Bas E.; Inada, Davi Toshio; Junior, Edivaldo Costa Sousa; Cardoso, Jedson Ferreira; Nunes, Márcio Roberto T.; de Lima, Clayton Pereira Silva; Silvestre, Rodrigo Vellasco Duarte; Nunes, Keley Nascimento Barbosa; Santos, Elisabeth C. O.; Edwards, Robert A.; Vicente, Ana Carolina P.; de Sá Morais, Lena Lillian Canto

2012-01-01

The 7th cholera pandemic reached Latin America in 1991, spreading from Peru to virtually all Latin American countries. During the late epidemic period, a strain that failed to ferment sucrose dominated cholera outbreaks in the Northern Brazilian Amazon region. In order to understand the genomic characteristics and the determinants of this altered sucrose fermenting phenotype, the genome of the strain IEC224 was sequenced. This paper reports a broad genomic study of this strain, showing its correlation with the major epidemic lineage. The potentially mobile genomic regions are shown to possess GC content deviation, and harbor the main V. cholera virulence genes. A novel bioinformatic approach was applied in order to identify the putative functions of hypothetical proteins, and was compared with the automatic annotation by RAST. The genome of a large bacteriophage was found to be integrated to the IEC224's alanine aminopeptidase gene. The presence of this phage is shown to be a common characteristic of the El Tor strains from the Latin American epidemic, as well as its putative ancestor from Angola. The defective sucrose fermenting phenotype is shown to be due to a single nucleotide insertion in the V. cholerae sucrose-specific transportation gene. This frame-shift mutation truncated a membrane protein, altering its structural pore-like conformation. Further, the identification of a common bacteriophage reinforces both the monophyletic and African-Origin hypotheses for the main causative agent of the 1991 Latin America cholera epidemics. PMID:22662140

[Genetic characterization analysis on epidemic rubella virus strains isolated in Liaoning from 2007 to 2012].

PubMed

Wang, Yan; Ma, Yan; Xu, Xiao-Ting; Fan, Xue-Song; Lin, Qian; Sui, Dan; Yin, Ye; Wu, Feng-Tong; Pan, Bai-Ling; Liu, Guang-Yuan; Wang, Ji-Jian; Han, Yue; Guo, Jun-Qiao; Zhao, Zhuo

2013-11-01

To analyze the genetic characterization of epidemic rubella virus strains isolated in Liaoning from 2007-2012, a total of 145 rubella virus strains were isolated using Vero/Slam cell line from the patients' throat swabs during rubella outbreaks and sporadics cases in Liaoning Province from 2007 to 2012. Fragments of 945 nucleotides containing 1E gene from 145 rubella virus isolates were amplified by RT-PCR, the PCR products were sequenced and analyzed. Based on the 739 nucleotides of 1E gene, the phylogenetic trees were constructed with 32 WHO rubella reference strains of 13 genotypes downloaded from GenBank and 145 rubella virus strains. The results showed that the 145 rubella virus strains in 2007 -2012 belonged to genotype 1E, nucleotide acids and amino acids similarities were 97.2%-100.0% and 97.6%-100.0%, respectively. Compared to the 1E reference strains(Rvi/ Dezhou.CHN/02, RVi/MYS/01), the nucleotide acids and amino acids similarities were 96.6%-99.2% and 98.2%-100.0%, respectively except for one amino acid change (Val246-Ala246) of RVi/Shenyang. Liaoning. CHN/13.11/13, and Asp262-Asn262 of RVi/Shenyang. Liaoning. CHN/13.11/4 and RVi/Liaoyang. Liaoning. CHN/26. 11/2. there had no change found in the important antigenic epitope sites, the hemagglutination inhibition and neutralization epitopes of the other rubella viruses. All the 145 strains isolated had the same amino acid change (Leu338--Phe338) in E1 protein. These findings suggested that genotype 1E of rubella virus was the predominant genotype in Liaoning province. the rubella prevailed in recent six years was mainly caused by rubella viruses genotype 1E with multi-transmission routes.

Emergence and genomic diversification of a virulent serogroup W:ST-2881(CC175) Neisseria meningitidis clone in the African meningitis belt.

PubMed

Lamelas, Araceli; Hauser, Julia; Dangy, Jean-Pierre; Hamid, Abdul-Wahab M; Röltgen, Katharina; Abdul Sater, Mohamad R; Hodgson, Abraham; Sie, Ali; Junghanss, Thomas; Harris, Simon R; Parkhill, Julian; Bentley, Stephen D; Pluschke, Gerd

2017-08-01

Countries of the African 'meningitis belt' are susceptible to meningococcal meningitis outbreaks. While in the past major epidemics have been primarily caused by serogroup A meningococci, W strains are currently responsible for most of the cases. After an epidemic in Mecca in 2000, W:ST-11 strains have caused many outbreaks worldwide. An unrelated W:ST-2881 clone was described for the first time in 2002, with the first meningitis cases caused by these bacteria reported in 2003. Here we describe results of a comparative whole-genome analysis of 74 W:ST-2881 strains isolated within the framework of two longitudinal colonization and disease studies conducted in Ghana and Burkina Faso. Genomic data indicate that the W:ST-2881 clone has emerged from Y:ST-175(CC175) bacteria by capsule switching. The circulating W:ST-2881 populations were composed of a variety of closely related but distinct genomic variants with no systematic differences between colonization and disease isolates. Two distinct and geographically clustered phylogenetic clonal variants were identified in Burkina Faso and a third in Ghana. On the basis of the presence or absence of 17 recombination fragments, the Ghanaian variant could be differentiated into five clusters. All 25 Ghanaian disease isolates clustered together with 23 out of 40 Ghanaian isolates associated with carriage within one cluster, indicating that W:ST-2881 clusters differ in virulence. More than half of the genes affected by horizontal gene transfer encoded proteins of the 'cell envelope' and the 'transport/binding protein' categories, which indicates that exchange of non-capsular antigens plays an important role in immune evasion.

Deep comparative genomics among Chlamydia trachomatis lymphogranuloma venereum isolates highlights genes potentially involved in pathoadaptation.

PubMed

Borges, Vítor; Gomes, João Paulo

2015-06-01

Lymphogranuloma venereum (LGV) is a human sexually transmitted disease caused by the obligate intracellular bacterium Chlamydia trachomatis (serovars L1-L3). LGV clinical manifestations range from severe ulcerative proctitis (anorectal syndrome), primarily caused by the epidemic L2b strains, to painful inguinal lymphadenopathy (the typical LGV bubonic form). Besides potential host-related factors, the differential disease severity and tissue tropism among LGV strains is likely a function of the genetic backbone of the strains. We aimed to characterize the genetic variability among LGV strains as strain- or serovar-specific mutations may underlie phenotypic signatures, and to investigate the mutational events that occurred throughout the pathoadaptation of the epidemic L2b lineage. By analyzing 20 previously published genomes from L1, L2, L2b and L3 strains and two new genomes from L2b strains, we detected 1497 variant sites and about 100 indels, affecting 453 genes and 144 intergenic regions, with 34 genes displaying a clear overrepresentation of nonsynonymous mutations. Effectors and/or type III secretion substrates (almost all of those described in the literature) and inclusion membrane proteins showed amino acid changes that were about fivefold more frequent than silent changes. More than 120 variant sites occurred in plasmid-regulated virulence genes, and 66% yielded amino acid changes. The identified serovar-specific variant sites revealed that the L2b-specific mutations are likely associated with higher fitness and pointed out potential targets for future highly discriminatory diagnostic/typing tests. By evaluating the evolutionary pathway beyond the L2b clonal radiation, we observed that 90.2% of the intra-L2b variant sites occurring in coding regions involve nonsynonymous mutations, where CT456/tarp has been the main target. Considering the progress on C. trachomatis genetic manipulation, this study may constitute an important contribution for prioritizing study targets for functional genomics aiming to dissect the impact of the identified intra-LGV polymorphisms on virulence or tropism dissimilarities among LGV strains. Copyright © 2015 Elsevier B.V. All rights reserved.

Complete Genome Sequences of Porcine Epidemic Diarrhea Virus Strains JSLS-1/2015 and JS-2/2015 Isolated from China.

PubMed

Tao, Jie; Li, Benqiang; Zhang, Chunling; Liu, Huili

2016-11-10

Two porcine epidemic diarrhea virus (PEDV) strains, JSLS-1/2015 and JS-2/2015, were isolated from piglets with watery diarrhea in South China. Two genomic sequences were highly homologous to the attenuated DR13 strain. Furthermore, JSLS-1/2015 contains a 24-amino-acid deletion in open reading frame 1b, which was first reported in PEDV isolates. Copyright © 2016 Tao et al.

Molecular Characterization of Invasive Meningococcal Isolates from Countries in the African Meningitis Belt before Introduction of a Serogroup A Conjugate Vaccine

PubMed Central

Caugant, Dominique A.; Kristiansen, Paul A.; Wang, Xin; Mayer, Leonard W.; Taha, Muhamed-Kheir; Ouédraogo, Rasmata; Kandolo, Denis; Bougoudogo, Flabou; Sow, Samba; Bonte, Laurence

2012-01-01

Background The serogroup A conjugate meningococcal vaccine, MenAfriVac, was introduced in mass vaccination campaigns in December 2010 in Burkina Faso, Mali and Niger. In the coming years, vaccination will be extended to other African countries at risk of epidemics. To document the molecular characteristics of disease-causing meningococcal strains circulating in the meningitis belt of Africa before vaccine introduction, the World Health Organization Collaborating Centers on Meningococci in Europe and United States established a common strain collection of 773 isolates from cases of invasive meningococcal disease collected between 2004 and 2010 from 13 sub-Saharan countries. Methodology All isolates were characterized by multilocus sequence typing, and 487 (62%) were also analyzed for genetic variation in the surface antigens PorA and FetA. Antibiotic susceptibility was tested for part of the collection. Principal Findings Only 19 sequence types (STs) belonging to 6 clonal complexes were revealed. ST-5 clonal complex dominated with 578 (74.8%) isolates. All ST-5 complex isolates were remarkably homogeneous in their PorA (P1.20,9) and FetA (F3-1) and characterized the serogroup A strains which have been responsible for most epidemics during this time period. Sixty-eight (8.8%) of the 773 isolates belonged to the ST-11 clonal complex which was mainly represented by serogroup W135, while an additional 38 (4.9%) W135 isolates belonged to the ST-175 complex. Forty-eight (6.2%) serogroup X isolates from West Africa belonged to the ST-181 complex, while serogroup X cases in Kenya and Uganda were caused by an unrelated clone, ST-5403. Serogroup X, ST-181, emerged in Burkina Faso before vaccine introduction. Conclusions In the seven years preceding introduction of a new serogroup A conjugate vaccine, serogroup A of the ST-5 clonal complex was identified as the predominant disease-causing strain. PMID:23029368

[Influenza and influenza-like acute respiratory diseases in Slovakia in the 1999-2000 season].

PubMed

Kristufkova, Z; Blaskovicova, H

2000-01-01

Acute respiratory infections (ARI) represent the most frequent cause of morbidity. Their epidemic outbreaks become a severe problem not only in healthcare, but also in economical and social spheres. Presentation of epidemiological and virologic characteristics of the 1999-2000 influenza season in Slovakia; their comparison with the same Influenza season in other European countries, as well as with the situation during the preceding season in Slovakia. The epidemiological analysis of Influenza and influenza-like diseases is based on the duty of attending physicians to report the number of new cases, complications, cases of working inability due to disease, and death cases. The reports are required on a compulsory weekly basis, and the reported cases are structured into 4 age groups. The laboratory diagnosis is based on virus isolation, rapid detection of antigen and serological tests. The outbreak of Influenza spread through Slovakia during the period between the 4th and 8th calendar weeks with its peak appearing during the 6th calendar week, when its incidence reached 2821 cases/100,000. The age group mostly afflicted by morbidity during the entire investigated season were children at the age of 0-5, while during the outbreak, the highest morbidity was reported among school children at the age of 6-14. The epidemic broke out on the entire territory of the Slovak Republic at the same time. 5 death cases were reported. Complicated cases were reported in 6.1% of the diseased. 34.1% of the group at the age from 15 to 59 were reported to be unable to work due to disease. 25 isolates of influenza virus were obtained from 505 nasopharyngeal swabs. 2 strains were found to be atigenetically similar to the vaccine strain A(H3N2)/Sydney 5/97 and A(H3N2)/Moscow 10/99. Regarding ARI aetiology, influenza viruses were serologically confirmed in 1356 samples; out of which type A(H3N2) was confirmed in 930 cases, A(H1N1) in 143 cases, type B in 283 cases; adenoviruses were detected in 467 samples; RS viruses in 779 samples; and Mycoplasma pneumoniae in 859 samples. Mixed infection caused by two viruses was diagnosed in 27 cases. The outbreak which hit Slovakia in the 1999/2000 season was a part of the European epidemic wave. As to its extent, it was a mild epidemic outbreak. It was significantly low as to its incidence among children. During autumn months, ARI aetiology was dominated by M. pneumoniae, viruses of type A(H3N2) prevailed. The identification of strains isolated during the investigated season confirmed that strains of influenza virus similar to strain A(H3N2)/Sydney 5/97 which is contained within the vaccine which has been assessed for this season, circulated in Slovakia during the past two subsequent seasons. Similar experience was reported from the majority of European countries involved in the international WHO programme of influenza Surveillance. These facts explain the mild extent of the investigated epidemic outbreak. (Tab. 5, Fig. 7, Ref. 8.)

Isolation and characterization of a Korean porcine epidemic diarrhea virus strain KNU-141112.

PubMed

Lee, Sunhee; Kim, Youngnam; Lee, Changhee

2015-10-02

Severe outbreaks of porcine epidemic diarrhea virus (PEDV) have re-emerged in Korea and rapidly swept across the country, causing tremendous economic losses to producers and customers. Despite the availability of PEDV vaccines in the domestic market, the disease continues to plague the Korean pork industry, raising issues regarding their protective efficacy and new vaccine development. Therefore, PEDV isolation in cell culture is urgently needed to develop efficacious vaccines and diagnostic assays and to conduct further studies on the virus biology. In the present study, one Korean PEDV strain, KOR/KNU-141112/2014, was successfully isolated and serially propagated in Vero cells for over 30 passages. The in vitro and in vivo characteristics of the Korean PEDV isolate were investigated. Virus production in cell culture was confirmed by cytopathology, immunofluorescence, and real-time RT-PCR. The infectious virus titers of the viruses during the first 30 passages ranged from 10(5.1) to 10(8.2) TCID50 per ml. The inactivated KNU-141112 virus was found to mediate potent neutralizing antibody responses in immunized guinea pigs. Animal studies showed that KNU-141112 virus causes severe diarrhea and vomiting, fecal shedding, and acute atrophic enteritis, indicating that strain KNU-141112 is highly enteropathogenic in the natural host. In addition, the entire genomes or complete S genes of KNU-141112 viruses at selected cell culture passages were sequenced to assess the genetic stability and relatedness. Our genomic analyses indicated that the Korean isolate KNU-141112 is genetically stable during the first 30 passages in cell culture and is grouped within subgroup G2b together with the recent re-emergent Korean strains. Copyright © 2015 Elsevier B.V. All rights reserved.

Isolation, molecular characterization and an artificial infection model for a variant porcine epidemic diarrhea virus strain from Jiangsu Province, China.

PubMed

Zhang, Hewei; Xia, Mingqi; Ju, Decai; Wu, Bai; Ning, Chen; Song, Ni; Feng, Teng; Chen, Feng; Wang, Xin; Wu, Ying; Wang, Wei; Cheng, Shipeng; Jin, Wenjie; Zhang, Shucheng; Zhang, Chunjie; Cheng, Xiangchao; Ding, Ke; Wu, Hua

2017-12-01

Porcine epidemic diarrhea virus (PEDV) is a causative agent of porcine intestinal disease, which causes vomiting, diarrhea, and dehydration in piglets. PEDV is associated with the most severe pathogenesis in one-week-old piglets, with mortality rates reaching 100%. A PEDV strain was isolated from the intestinal tract of diarrheic piglets from a pig farm in Jiangsu Province in March 2016, termed the JS201603 isolate. The isolated virus was confirmed to be PEDV via RT-PCR, electron microscopy, a cytopathic effect assay and sequence analysis. The S and ORF3 genes of the JS201603 isolate were sequenced, revealing that the S gene was associated with a 15-base insertion at 167 nt, 176 - 186 nt, and 427 - 429 nt, as well as a six-base deletion in 487 - 492 nt, indicating that it was a current epidemic variant compared with the classical strain, CV777. No deletion occurred between 245 - 293 nt of the ORF3 gene in the JS201603 isolate compared with the vaccine isolates YY2013 and SQ2014. An experimental infection model indicated that the piglets in the challenge group successively developed diarrhea, exhibiting yellow-colored loose stools with a foul odor. The piglets in the JS201603 isolate challenge group displayed reduced food consumption, lost weight, and in severe cases even died. No abnormalities were observed in the control group. The JS201603 variant isolated in this study contributes to the evolutionary analysis of diarrhea virus. The experimental infection model has established a foundation for further studies on vaccine development.

Multispacer Typing of Rickettsia prowazekii Enabling Epidemiological Studies of Epidemic Typhus†

PubMed Central

Zhu, Yong; Fournier, Pierre-Edouard; Ogata, Hiroyuki; Raoult, Didier

2005-01-01

Currently, there is no tool for typing Rickettsia prowazekii, the causative agent of epidemic typhus, currently considered a potential bioterrorism agent, at the strain level. To test if the multispacer typing (MST) method could differentiate strains of R. prowazekii, we amplified and sequenced the 25 most variable intergenic spacers between the R. prowazekii and R. conorii genomes in five strains and 10 body louse amplicons of R. prowazekii from various geographic origins. Two intergenic spacers, i.e., rpmE/tRNAfMet and serS/virB4, were variable among tested R. prowazekii isolates and allowed identification of three and two genotypes, respectively. When the genotypes obtained from the two spacers were combined, we identified four different genotypes. MST demonstrated that several R. prowazekii strains circulated in human body lice during an outbreak of epidemic typhus in Burundi. This may help to discriminate between natural and intentional outbreaks. Our study supports the usefulness of MST as a versatile method for rickettsial strain genotyping. PMID:16145131

Multispacer typing of Rickettsia prowazekii enabling epidemiological studies of epidemic typhus.

PubMed

Zhu, Yong; Fournier, Pierre-Edouard; Ogata, Hiroyuki; Raoult, Didier

2005-09-01

Currently, there is no tool for typing Rickettsia prowazekii, the causative agent of epidemic typhus, currently considered a potential bioterrorism agent, at the strain level. To test if the multispacer typing (MST) method could differentiate strains of R. prowazekii, we amplified and sequenced the 25 most variable intergenic spacers between the R. prowazekii and R. conorii genomes in five strains and 10 body louse amplicons of R. prowazekii from various geographic origins. Two intergenic spacers, i.e., rpmE/tRNA(fMet) and serS/virB4, were variable among tested R. prowazekii isolates and allowed identification of three and two genotypes, respectively. When the genotypes obtained from the two spacers were combined, we identified four different genotypes. MST demonstrated that several R. prowazekii strains circulated in human body lice during an outbreak of epidemic typhus in Burundi. This may help to discriminate between natural and intentional outbreaks. Our study supports the usefulness of MST as a versatile method for rickettsial strain genotyping.

Identification and development of a promising novel mumps vaccine candidate strain.

PubMed

Liang, Yan; Ma, Shaohui; Liu, Longding; Zhao, Hongling; Wang, Lichun; Jiang, Li; Xie, Zhongping; Dong, Chenghong; Li, Qihan

2010-12-01

Mumps epidemics are usually caused by airborne transmission of mumps virus (MuV) and have high morbidity in non-immunized children. Epidemiological studies in many regions of China show that the genotype F viral strain is the most prevalent. However, the genotype A strain is currently used to prepare vaccines. Regional epidemiological MuV data suggest a significant application for the development of live attenuated mumps vaccines targeting specific genotypes. This article reports the isolation and culture of a genotype F MuV candidate strain that could be used to prepare a live attenuated mumps vaccine. This strain is shown to have good immunological efficacy and stability in neurovirulence evaluations. This work should facilitate the implementation of mumps vaccination in mainland China by targeting the most prevalent MuV genotype, genotype F. Copyright © 2010 Institut Pasteur. Published by Elsevier SAS. All rights reserved.

Phylogenetic Analyses Suggest that Factors Other Than the Capsid Protein Play a Role in the Epidemic Potential of GII.2 Norovirus.

PubMed

Tohma, Kentaro; Lepore, Cara J; Ford-Siltz, Lauren A; Parra, Gabriel I

2017-01-01

Norovirus is the leading cause of acute gastroenteritis worldwide. For over two decades, a single genotype (GII.4) has been responsible for most norovirus-associated cases. However, during the winter of 2014 to 2015, the GII.4 strains were displaced by a rarely detected genotype (GII.17) in several countries of the Asian continent. Moreover, during the winter of 2016 to 2017, the GII.2 strain reemerged as predominant in different countries worldwide. This reemerging GII.2 strain is a recombinant virus that presents a GII.P16 polymerase genotype. In this study, we investigated the evolutionary dynamics of GII.2 to determine the mechanism of this sudden emergence in the human population. The phylogenetic analyses indicated strong linear evolution of the VP1-encoding sequence, albeit with minor changes in the amino acid sequence over time. Without major genetic differences among the strains, a clustering based on the polymerase genotype was observed in the tree. This association did not affect the substitution rate of the VP1. Phylogenetic analyses of the polymerase region showed that reemerging GII.P16-GII.2 strains diverged into a new cluster, with a small number of amino acid substitutions detected on the surface of the associated polymerase. Thus, besides recombination or antigenic shift, point mutations in nonstructural proteins could also lead to novel properties with epidemic potential in different norovirus genotypes. IMPORTANCE Noroviruses are a major cause of gastroenteritis worldwide. Currently, there is no vaccine or specific antiviral available to treat norovirus disease. Multiple norovirus strains infect humans, but a single genotype (GII.4) has been regarded as the most important cause of viral gastroenteritis outbreaks worldwide. Its persistence and predominance have been explained by the continuous replacement of variants that present new antigenic properties on their capsid protein, thus evading the herd immunity acquired to the previous variants. Over the last three seasons, minor genotypes have displaced the GII.4 viruses as the predominant strains. One of these genotypes, GII.2, reemerged as predominant during 2016 to 2017. Here we show that factors such as minor changes in the polymerase may have driven the reemergence of GII.2 during the last season. A better understanding of norovirus diversity is important for the development of effective treatments against noroviruses.

A molecular trigger for intercontinental epidemics of group A Streptococcus

PubMed Central

Zhu, Luchang; Olsen, Randall J.; Nasser, Waleed; Beres, Stephen B.; Vuopio, Jaana; Kristinsson, Karl G.; Gottfredsson, Magnus; Porter, Adeline R.; DeLeo, Frank R.; Musser, James M.

2015-01-01

The identification of the molecular events responsible for strain emergence, enhanced virulence, and epidemicity has been a long-pursued goal in infectious diseases research. A recent analysis of 3,615 genomes of serotype M1 group A Streptococcus strains (the so-called “flesh-eating” bacterium) identified a recombination event that coincides with the global M1 pandemic beginning in the early 1980s. Here, we have shown that the allelic variation that results from this recombination event, which replaces the chromosomal region encoding secreted NADase and streptolysin O, is the key driver of increased toxin production and enhanced infection severity of the M1 pandemic strains. Using isoallelic mutant strains, we found that 3 polymorphisms in this toxin gene region increase resistance to killing by human polymorphonuclear leukocytes, increase bacterial proliferation, and increase virulence in animal models of pharyngitis and necrotizing fasciitis. Genome sequencing of an additional 1,125 streptococcal strains and virulence studies revealed that a highly similar recombinational replacement event underlies an ongoing intercontinental epidemic of serotype M89 group A Streptococcus infections. By identifying the molecular changes that enhance upper respiratory tract fitness, increased resistance to innate immunity, and increased tissue destruction, we describe a mechanism that underpins epidemic streptococcal infections, which have affected many millions of people. PMID:26258415

Typing of Canine Parvovirus Strains Circulating in North-East China.

PubMed

Zhao, H; Wang, J; Jiang, Y; Cheng, Y; Lin, P; Zhu, H; Han, G; Yi, L; Zhang, S; Guo, L; Cheng, S

2017-04-01

Canine parvovirus (CPV) is highly contagious and is a major cause of haemorrhagic enteritis and myocarditis in dogs. We investigated the genetic variation of emerging CPV strains by sequencing 64 CPV VP2 genes from 216 clinical samples of dogs from Heilongjiang, Jilin, Liaoning, Shandong and Hebei in 2014. Genetic analysis revealed that CPV-2b was predominant in Hebei and CPV-2a was predominant in the other four provinces. In addition, a CPV-2c strain has emerged in Shandong province. All samples had a Ser-Ala substitution at residue 297 and an Ile-Arg substitution at residue 324. Interestingly, in five separate canine samples, we found a mutation of Gln370 to Arg, until now detected only in isolates from pandas. The phylogenetic analysis showed clear distinctions between epidemic isolates and vaccine strains and between Chinese CPV-2c strains and CPV-2c strains found in other countries. Monitoring recent incidence of CPV strains enables evaluation and implementation of disease control strategies. © 2015 Blackwell Verlag GmbH.

Global epidemiology of capsular group W meningococcal disease (1970-2015): Multifocal emergence and persistence of hypervirulent sequence type (ST)-11 clonal complex.

PubMed

Mustapha, Mustapha M; Marsh, Jane W; Harrison, Lee H

2016-03-18

Following an outbreak in Mecca Saudi Arabia in 2000, meningococcal strains expressing capsular group W (W) emerged as a major cause of invasive meningococcal disease (IMD) worldwide. The Saudi Arabian outbreak strain (Hajj clone) belonging to the ST-11 clonal complex (cc11) is similar to W cc11 causing occasional sporadic disease before 2000. Since 2000, W cc11 has caused large meningococcal disease epidemics in the African meningitis belt and endemic disease in South America, Europe and China. Traditional molecular epidemiologic typing suggested that a majority of current W cc11 burden represented global spread of the Hajj clone. However, recent whole genome sequencing (WGS) analyses revealed significant genetic heterogeneity among global W cc11 strains. While continued spread of the Hajj clone occurs in the Middle East, the meningitis belt and South Africa have co-circulation of the Hajj clone and other unrelated W cc11 strains. Notably, South America, the UK, and France share a genetically distinct W cc11 strain. Other W lineages persist in low numbers in Europe, North America and the meningitis belt. In summary, WGS is helping to unravel the complex genomic epidemiology of group W meningococcal strains. Wider application of WGS and strengthening of global IMD surveillance is necessary to monitor the continued evolution of group W lineages. Copyright © 2016 Elsevier Ltd. All rights reserved.

Detection and phylogenetic analyses of spike genes in porcine epidemic diarrhea virus strains circulating in China in 2016-2017.

PubMed

Zhang, Qiaoling; Liu, Xinsheng; Fang, Yuzhen; Zhou, Peng; Wang, Yonglu; Zhang, Yongguang

2017-10-10

Large-scale outbreaks of porcine epidemic diarrhea (PED) have re-emerged in China in recent years. However, little is known about the genetic diversity and molecular epidemiology of field strains of PED virus (PEDV) in China in 2016-2017. To address this issue, in this study, 116 diarrhea samples were collected from pig farms in 6 Chinese provinces in 2016-2017 and were detected using PCR for main porcine enteric pathogens, including PEDV, porcine deltacoronavirus (PDCoV), porcine transmissible gastroenteritis virus (TGEV) and porcine kobuvirus (PKV). In addition, the complete S genes from 11 representative PEDV strains were sequenced and analyzed. PCR detection showed that 52.6% (61/116) of these samples were positive for PEDV. Furthermore, sequencing results for the spike (S) genes from 11 of the epidemic PEDV strains showed 93-94% nucleotide identity and 92-93% amino acid identity with the classical CV777 strain. Compared with the CV777 vaccine strain, these strains had an insertion (A 133 ), a deletion (G 155 ), and a continuous 4-amino-acid insertion ( 56 NNTN 59 ) in the S1 region. Phylogenetic analysis based on the S gene indicated that the 11 assessed PEDV strains were genetically diverse and clustered into the G2 group. These results demonstrate that the epidemic strains of PEDV in China in 2016-2017 are mainly virulent strains that belong to the G2 group and genetically differ from the vaccine strain. Importantly, this is the first report that the samples collected in Hainan Province were positive for PEDV (59.2%, 25/42). To our knowledge, this article presents the first report of a virulent PEDV strain isolated from Hainan Island, China. The results of this study will contribute to the understanding of the epidemiology and genetic characteristics of PEDV in China.

The prospects and challenges of universal vaccines for influenza

PubMed Central

Subbarao, Kanta; Matsuoka, Yumiko

2013-01-01

Vaccination is the most effective way to reduce the impact of epidemic as well as pandemic influenza. However, the licensed inactivated influenza vaccine induces strain-specific immunity and must be updated annually. When novel viruses appear, matched vaccines are not likely to be available in time for the first wave of a pandemic. Yet, the enormous diversity of influenza A viruses in nature makes it impossible to predict which subtype or strain will cause the next pandemic. Several recent scientific advances have generated renewed enthusiasm and hope for universal vaccines that will induce broad protection from a range of influenza viruses. PMID:23685068

Characterization of Klebsiella pneumoniae isolates from New Zealand sea lion (Phocarctos hookeri) pups during and after the epidemics on Enderby Island, Auckland Islands.

PubMed

Castinel, Aurélie; Grinberg, Alex; Pattison, Rebecca; Duignan, Pádraig; Pomroy, Bill; Rogers, Lynn; Wilkinson, Ian

2007-05-16

The 2001/2002 and 2002/2003 breeding seasons of New Zealand sea lions (NZSLs) on the Auckland Islands were marked by a high pup mortality caused by acute bacterial infections. As part of a health survey from 1998/1999 to 2004/2005, tissues and swabs of lesions had been collected at necropsy to identify the bacteria associated with pup mortality. Klebsiella pneumoniae was grown in pure culture from 83% of various organs and lesions in 2001/2002 and 76% in 2002/2003, and less frequently in the following seasons (56% in 2003/2004 and 49% in 2004/2005). Pup isolates of K. pneumoniae showed identical minimal inhibitory concentrations (MIC) of cefuroxime, neomycin, cephalotin, cephalexin and dihydrostreptomycin, suggesting clonal aetiology of the pathogen. Isolates also tested negative for production of extended-spectrum beta-lactamases (ESBLs), which was not in favour of an anthropogenetic origin of the epidemic strain. Pulsed-field gel electrophoresis (PFGE) of XbaI DNA macrorestriction fragments was performed on isolates of K. pneumoniae and Klebsiella oxytoca from 35 pups, thee NZSL adult females, and from three human patients for comparison. PFGE showed that pup isolates of K. pneumoniae were genetically indistinguishable but were neither related to K. pneumoniae from humans and from NZSL adults, nor to K. oxytoca from NZSLs. It is concluded that the 2001/2002 and 2002/2003 epidemics at Sandy Bay rookery were caused by a single K. pneumoniae clonal lineage, genetically different from the strain carried by adult NZSLs. An anthropogenic origin of the K. pneumoniae clone could not be confirmed, but further investigations are required to rule-out such occurrence.

Self-Mating in the Definitive Host Potentiates Clonal Outbreaks of the Apicomplexan Parasites Sarcocystis neurona and Toxoplasma gondii

PubMed Central

Wendte, Jered M.; Miller, Melissa A.; Lambourn, Dyanna M.; Magargal, Spencer L.; Jessup, David A.; Grigg, Michael E.

2010-01-01

Tissue-encysting coccidia, including Toxoplasma gondii and Sarcocystis neurona, are heterogamous parasites with sexual and asexual life stages in definitive and intermediate hosts, respectively. During its sexual life stage, T. gondii reproduces either by genetic out-crossing or via clonal amplification of a single strain through self-mating. Out-crossing has been experimentally verified as a potent mechanism capable of producing offspring possessing a range of adaptive and virulence potentials. In contrast, selfing and other life history traits, such as asexual expansion of tissue-cysts by oral transmission among intermediate hosts, have been proposed to explain the genetic basis for the clonal population structure of T. gondii. In this study, we investigated the contributing roles self-mating and sexual recombination play in nature to maintain clonal population structures and produce or expand parasite clones capable of causing disease epidemics for two tissue encysting parasites. We applied high-resolution genotyping against strains isolated from a T. gondii waterborne outbreak that caused symptomatic disease in 155 immune-competent people in Brazil and a S. neurona outbreak that resulted in a mass mortality event in Southern sea otters. In both cases, a single, genetically distinct clone was found infecting outbreak-exposed individuals. Furthermore, the T. gondii outbreak clone was one of several apparently recombinant progeny recovered from the local environment. Since oocysts or sporocysts were the infectious form implicated in each outbreak, the expansion of the epidemic clone can be explained by self-mating. The results also show that out-crossing preceded selfing to produce the virulent T. gondii clone. For the tissue encysting coccidia, self-mating exists as a key adaptation potentiating the epidemic expansion and transmission of newly emerged parasite clones that can profoundly shape parasite population genetic structures or cause devastating disease outbreaks. PMID:21203443

An outbreak of food-borne group A Streptococcus (GAS) tonsillopharyngitis among residents of a dormitory.

PubMed

Sarvghad, M R; Naderi, H R; Naderi-Nassab, M; Majdzadeh, R; Javanian, M; Faramarzi, H; Fatehmanesh, P

2005-01-01

Epidemics of food-borne pharyngitis due to group A Streptococcus are rarely reported. Here we present an outbreak of food-borne tonsillopharyngitis in female dormitories in the Islamic Republic of Iran. Throat swabs and cultures were performed on a number of patients, and of specimens from the nasopharynx and hands of staff who were involved in food processing. We planned a case-control study for assessing the source of epidemics. 11 out of 17 throat swabs of students were positive for Streptococcus group A and also 2 throat samples from asymptomatic cooks were positive. A DNA fingerprinting study showed that Streptococcus group A strains of 11 students and 1 cook had the same T agglutination pattern and M protein factor (M3/T13). It is suggested that group A streptococci as well as group C and G streptococci can cause epidemic food-borne pharyngitis. Regular health surveillance of food handlers and food preparation processes are important for prevention of such outbreaks.

Phylogenetic comparison of the VP7, VP4, VP6, and NSP4 genes of rotaviruses isolated from children in Nizhny Novgorod, Russia, 2015-2016, with cogent genes of the Rotarix and RotaTeq vaccine strains.

PubMed

Morozova, O V; Sashina, T A; Epifanova, N V; Zverev, V V; Kashnikov, A U; Novikova, N A

2018-04-01

Group A rotaviruses (RVA) are one of the leading causes of gastroenteritis in young children worldwide. The introduction of universal mass vaccination around the world has contributed to a reduction in hospitalizations and outpatient visits associated with rotavirus infection. Continued surveillance of RVA strains is needed to determine long-term effects of vaccine introduction. In the present work, we carried out the analysis of the genotypic diversity of RVA strains isolated in Nizhny Novgorod (Russia) during the 2015-2016 epidemic season. Also we conducted a comparative analysis of the amino acid sequences of T-cell epitopes of wild-type and vaccine (RotaTeq and Rotarix) strains. In total, 1461 samples were examined. RVAs were detected in 30.4% of cases. Rotaviruses with genotype G9P[8] (40.5%) dominated in the 2015-16 epidemic season. Additionally, RVAs with the following genotypes were detected: G4P[8] (25.4%), G1P[8] (13%), G2P[4] (3.2%). Rotaviruses with genotypes G3P[9], G6P[9], and G1P[9] totaled 3%. The number of partially typed and untyped RVA samples was 66 (14.9%). The findings of a RVA of G6P[9] genotype in Russia were an original observation. Our analysis of VP6 and NSP4 T-cell epitopes showed highly conserved amino acid sequences. The found differences seem not to be caused by the immune pressure but were rather related to the genotypic affiliations of the proteins. Vaccination against rotavirus infection is not included in the national vaccination schedule in Russia. Monitoring of the genotypic and antigenic diversity of contemporary RVA will allow providing a comparative analysis of wild-type strains in areas with and without vaccine campaign.

Molecular Analyses of Vibrio cholerae O1 Clinical Strains, Including New Nontoxigenic Variants Isolated in Mexico during the Cholera Epidemic Years between 1991 and 2000▿

PubMed Central

Lizárraga-Partida, Marcial Leonardo; Quilici, Marie-Laure

2009-01-01

We studied the evolution of Vibrio cholerae O1 during the 1991 to 2000 cholera epidemic in Mexico by biochemical, serological, and molecular characterization of strains collected during this period. Strains were divided into toxigenic and nontoxigenic groups according to the presence or absence of genes encoding cholera toxin. As previously reported, we characterized two populations among toxigenic strains, which were present from the first year of the epidemic. BglI rRNA analysis revealed that these strains had ribotype profiles, denoted M5 and M6 in our study, that were identical to those previously designated Koblavi B5 or Popovic 5 and Popovic 6a or Tamayo B21a, respectively. Ribotype M5 was isolated between 1991 and 1993. This ribotype had a low level of genetic variation as detected by pulsed-field gel electrophoresis (PFGE). Ribotype M6 persisted from 1991 to 2000. However, PFGE profiles suggested that two epidemiologically unrelated strains coexisted within this single ribotype from 1995 until the end of the epidemic. We identified three new BglI ribotypes, Mx1, Mx2, and Mx3, from nontoxigenic V. cholerae O1 strains isolated between 1998 and 2000; one of them grouped strains positive for the toxin-coregulated pilus island. They differed from nontoxigenic clones isolated in Latin America and on the U.S. Gulf Coast and are probably autochthonous Mexican V. cholerae O1 variants. Most of these new variants were isolated from states surrounding the Gulf of Mexico, where the highest incidence of cholera in the country was recorded. Thus, the Mexican Gulf Coast, like the U.S. Gulf Coast, may act as an environmental reservoir of V. cholerae O1. PMID:19213700

Molecular analyses of Vibrio cholerae O1 clinical strains, including new nontoxigenic variants isolated in Mexico during the Cholera epidemic years between 1991 and 2000.

PubMed

Lizárraga-Partida, Marcial Leonardo; Quilici, Marie-Laure

2009-05-01

We studied the evolution of Vibrio cholerae O1 during the 1991 to 2000 cholera epidemic in Mexico by biochemical, serological, and molecular characterization of strains collected during this period. Strains were divided into toxigenic and nontoxigenic groups according to the presence or absence of genes encoding cholera toxin. As previously reported, we characterized two populations among toxigenic strains, which were present from the first year of the epidemic. BglI rRNA analysis revealed that these strains had ribotype profiles, denoted M5 and M6 in our study, that were identical to those previously designated Koblavi B5 or Popovic 5 and Popovic 6a or Tamayo B21a, respectively. Ribotype M5 was isolated between 1991 and 1993. This ribotype had a low level of genetic variation as detected by pulsed-field gel electrophoresis (PFGE). Ribotype M6 persisted from 1991 to 2000. However, PFGE profiles suggested that two epidemiologically unrelated strains coexisted within this single ribotype from 1995 until the end of the epidemic. We identified three new BglI ribotypes, Mx1, Mx2, and Mx3, from nontoxigenic V. cholerae O1 strains isolated between 1998 and 2000; one of them grouped strains positive for the toxin-coregulated pilus island. They differed from nontoxigenic clones isolated in Latin America and on the U.S. Gulf Coast and are probably autochthonous Mexican V. cholerae O1 variants. Most of these new variants were isolated from states surrounding the Gulf of Mexico, where the highest incidence of cholera in the country was recorded. Thus, the Mexican Gulf Coast, like the U.S. Gulf Coast, may act as an environmental reservoir of V. cholerae O1.

The Canadian influenza decision, 1976.

PubMed Central

Morrison, A. B.; Liston, A. J.; Abbott, J. D.

1976-01-01

This paper explains the Canadian decision process following the isolation and identification of A/New Jersey/8/76 at Fort Dix, New Jersey in February 1976. The cause for concern was the emergence of a swine-like strain related to that which caused the 1918-19 pandemic, together with proved man-to-man transmission. This concern was reinforced since all new influenza A strains known to have infected the number of persons involved at Fort Dix have become strains of epidemic importance. The Fort Dix outbreak gave sufficient warning to allow implementation of a national vaccination program, to prevent and protect against influenza. In the past such an opportunity had not occurred, and vaccine use had, at best, constituted an intervention in the course of an outbreak. The National Advisory Committee on Immunizing Agents had all available information when it reached its decision to recommend vaccination with bivalent (A/Victoria and A/New Jersey) or with monovalent (A/New Jersey) vaccine for selective, high-risk groups. This was an independent, scientifically based decision. PMID:991022

High Genetic Diversity of Measles Virus, World Health Organization European Region, 2005–2006

PubMed Central

Brown, Kevin E.; Jin, Li; Santibanez, Sabine; Shulga, Sergey V.; Aboudy, Yair; Demchyshyna, Irina V.; Djemileva, Sultana; Echevarria, Juan E.; Featherstone, David F.; Hukic, Mirsada; Johansen, Kari; Litwinska, Bogumila; Lopareva, Elena; Lupulescu, Emilia; Mentis, Andreas; Mihneva, Zefira; Mosquera, Maria M.; Muscat, Mark; Naumova, M.A.; Nedeljkovic, Jasminka; Nekrasova, Ljubov S.; Magurano, Fabio; Fortuna, Claudia; Rebelo de Andrade, Helena; Richard, Jean-Luc; Robo, Alma; Rota, Paul A.; Samoilovich, Elena O.; Sarv, Inna; Semeiko, Galina V.; Shugayev, Nazim; Utegenova, Elmira S.; van Binnendijk, Rob; Vinner, Lasse; Waku-Kouomou, Diane; Wild, T. Fabian; Brown, David W.G.; Mankertz, Annette; Muller, Claude P.; Mulders, Mick N.

2008-01-01

During 2005–2006, nine measles virus (MV) genotypes were identified throughout the World Health Organization European Region. All major epidemics were associated with genotypes D4, D6, and B3. Other genotypes (B2, D5, D8, D9, G2, and H1) were only found in limited numbers of cases after importation from other continents. The genetic diversity of endemic D6 strains was low; genotypes C2 and D7, circulating in Europe until recent years, were no longer identified. The transmission chains of several indigenous MV strains may thus have been interrupted by enhanced vaccination. However, multiple importations from Africa and Asia and virus introduction into highly mobile and unvaccinated communities caused a massive spread of D4 and B3 strains throughout much of the region. Thus, despite the reduction of endemic MV circulation, importation of MV from other continents caused prolonged circulation and large outbreaks after their introduction into unvaccinated and highly mobile communities. PMID:18258089

Complete Genomic Characterization of Three Tick-Borne Encephalitis Viruses Detected Along the China-North Korea Border, 2011.

PubMed

He, Xiaoxia; Zhao, Junwei; Fu, Shihong; Yao, Lisi; Gao, Xiaoyan; Liu, Yan; He, Ying; Liang, Guodong; Wang, Huanyu

2018-05-09

Tick-borne encephalitis virus (TBEV) causes neurological infections with serious sequelae in Europe and Northeast Asia. In China, the major epidemic areas are along the borders with Russia and North Korea. Although several TBEV isolates have been reported, the biological characteristics of the Chinese strains, especially those along the China-North Korea border, are unclear. In this study, we detected seven TBEV fragment sequences in 602 adult Dermacentor silvarum collected in the Changbai Mountain area of Jilin Province on the China-North Korea border and characterized the genome of three TBEV strains (JLCB11-08, JLCB11-35, and JLCB11-40). These three TBEV strains belong to the TBEV-Far Eastern (TBEV-FE) genotype and clustered most closely with the Svetlogorie and Kavalerovo strains from Russia. In addition, the TBEV strains from Northeast China clustered geographically within the TBEV-FE subtype branch. These findings will facilitate further research on the distinct genetic groupings of TBEV strains in China.

Cell Vacuolation Caused by Vibrio cholerae Hemolysin

PubMed Central

Figueroa-Arredondo, Paula; Heuser, John E.; Akopyants, Natalia S.; Morisaki, J. Hiroshi; Giono-Cerezo, Silvia; Enríquez-Rincón, Fernando; Berg, Douglas E.

2001-01-01

Non-O1 strains of Vibrio cholerae implicated in gastroenteritis and diarrhea generally lack virulence determinants such as cholera toxin that are characteristic of epidemic strains; the factors that contribute to their virulence are not understood. Here we report that at least one-third of diarrhea-associated nonepidemic V. cholerae strains from Mexico cause vacuolation of cultured Vero cells. Detailed analyses indicated that this vacuolation was related to that caused by aerolysin, a pore-forming toxin of Aeromonas; it involved primarily the endoplasmic reticulum at early times (∼1 to 4 h after exposure), and resulted in formation of large, acidic, endosome-like multivesicular vacuoles (probably autophagosomes) only at late times (∼16 h). In contrast to vacuolation caused by Helicobacter pylori VacA protein, that induced by V. cholerae was exacerbated by agents that block vacuolar proton pumping but not by endosome-targeted weak bases. It caused centripetal redistribution of endosomes, reflecting cytoplasmic alkalinization. The gene for V. cholerae vacuolating activity was cloned and was found to correspond to hlyA, the structural gene for hemolysin. HlyA protein is a pore-forming toxin that causes ion leakage and, ultimately, eukaryotic cell lysis. Thus, a distinct form of cell vacuolation precedes cytolysis at low doses of hemolysin. We propose that this vacuolation, in itself, contributes to the virulence of V. cholerae strains, perhaps by perturbing intracellular membrane trafficking or ion exchange in target cells and thereby affecting local intestinal inflammatory or other defense responses. PMID:11179335

Cell vacuolation caused by Vibrio cholerae hemolysin.

PubMed

Figueroa-Arredondo, P; Heuser, J E; Akopyants, N S; Morisaki, J H; Giono-Cerezo, S; Enríquez-Rincón, F; Berg, D E

2001-03-01

Non-O1 strains of Vibrio cholerae implicated in gastroenteritis and diarrhea generally lack virulence determinants such as cholera toxin that are characteristic of epidemic strains; the factors that contribute to their virulence are not understood. Here we report that at least one-third of diarrhea-associated nonepidemic V. cholerae strains from Mexico cause vacuolation of cultured Vero cells. Detailed analyses indicated that this vacuolation was related to that caused by aerolysin, a pore-forming toxin of Aeromonas; it involved primarily the endoplasmic reticulum at early times (approximately 1 to 4 h after exposure), and resulted in formation of large, acidic, endosome-like multivesicular vacuoles (probably autophagosomes) only at late times (approximately 16 h). In contrast to vacuolation caused by Helicobacter pylori VacA protein, that induced by V. cholerae was exacerbated by agents that block vacuolar proton pumping but not by endosome-targeted weak bases. It caused centripetal redistribution of endosomes, reflecting cytoplasmic alkalinization. The gene for V. cholerae vacuolating activity was cloned and was found to correspond to hlyA, the structural gene for hemolysin. HlyA protein is a pore-forming toxin that causes ion leakage and, ultimately, eukaryotic cell lysis. Thus, a distinct form of cell vacuolation precedes cytolysis at low doses of hemolysin. We propose that this vacuolation, in itself, contributes to the virulence of V. cholerae strains, perhaps by perturbing intracellular membrane trafficking or ion exchange in target cells and thereby affecting local intestinal inflammatory or other defense responses.

Immunogenicity of 2 serogroup B outer-membrane protein meningococcal vaccines: a randomized controlled trial in Chile.

PubMed

Tappero, J W; Lagos, R; Ballesteros, A M; Plikaytis, B; Williams, D; Dykes, J; Gheesling, L L; Carlone, G M; Høiby, E A; Holst, J; Nøkleby, H; Rosenqvist, E; Sierra, G; Campa, C; Sotolongo, F; Vega, J; Garcia, J; Herrera, P; Poolman, J T; Perkins, B A

1999-04-28

Meningococcal disease occurs worldwide, and serogroup B disease accounts for a large proportion of cases. Although persons younger than 4 years are at greatest risk for serogroup B meningococcal disease, vaccine efficacy has not been demonstrated in this age group. To evaluate serum bactericidal activity (SBA) against homologous vaccine type strains and a heterologous Chilean epidemic strain of Neisseria meningitidis as a potential correlate for vaccine efficacy. Double-blind, randomized controlled trial conducted between March 14 and July 20, 1994. All blood samples were taken by December 1994. Santiago, Chile, where a clonal serogroup B meningococcal disease epidemic began in 1993. Infants younger than 1 year (n = 187), children aged 2 to 4 years (n = 183), and adults aged 17 to 30 years (n = 173). Participants received 3 doses of outer-membrane protein (OMP) meningococcal vaccine developed in either Cuba or Norway or a control vaccine, with each dose given 2 months apart. Blood samples were obtained at baseline, prior to dose 3, and at 4 to 6 weeks after dose 3. Immune response, defined as a 4-fold or greater rise in SBA titer 4 to 6 weeks after dose 3 compared with prevaccination titer. Children and adult recipients of either meningococcal vaccine were more likely than controls to develop an immune response to the heterologous epidemic strain. After 3 doses of vaccine, 31% to 35% of children responded to the vaccine vs 5% to placebo; 37% to 60% of adults responded to vaccine vs 4% to placebo (P<.05 vs control for all). Infants, however, did not respond. In contrast, against homologous vaccine type strains, the response rate was 67% or higher among children and adults and 90% or higher among infants (P<.001 vs control for all). Subsequent SBA against 7 isogenic homologous target strains identified class 1 OMP as the immunodominant antigen. These data suggest that neither serogroup B OMP meningococcal vaccine would confer protection during a heterologous epidemic. However, epidemic strain-specific vaccines homologous for class 1 OMP are promising candidates for the control of epidemic serogroup B meningococcal disease.

Two Isoforms of Yersinia pestis Plasminogen Activator Pla: Intraspecies Distribution, Intrinsic Disorder Propensity, and Contribution to Virulence.

PubMed

Dentovskaya, Svetlana V; Platonov, Mikhail E; Svetoch, Tat'yana E; Kopylov, Pavel Kh; Kombarova, Tat'yana I; Ivanov, Sergey A; Shaikhutdinova, Rima Z; Kolombet, Lyubov' V; Chauhan, Sadhana; Ablamunits, Vitaly G; Motin, Vladimir L; Uversky, Vladimir N; Anisimov, Andrey P

2016-01-01

It has been shown previously that several endemic Y. pestis isolates with limited virulence contained the I259 isoform of the outer membrane protease Pla, while the epidemic highly virulent strains possessed only the T259 Pla isoform. Our sequence analysis of the pla gene from 118 Y. pestis subsp. microtus strains revealed that the I259 isoform was present exclusively in the endemic strains providing a convictive evidence of more ancestral origin of this isoform. Analysis of the effects of the I259T polymorphism on the intrinsic disorder propensity of Pla revealed that the I259T mutation slightly increases the intrinsic disorder propensity of the C-terminal tail of Pla and makes this protein slightly more prone for disorder-based protein-protein interactions, suggesting that the T259 Pla could be functionally more active than the I259 Pla. This assumption was proven experimentally by assessing the coagulase and fibrinolytic activities of the two Pla isoforms in human plasma, as well as in a direct fluorometric assay with the Pla peptide substrate. The virulence testing of Pla-negative or expressing the I259 and T259 Pla isoforms Y. pestis subsp. microtus and subsp. pestis strains did not reveal any significant difference in LD50 values and dose-dependent survival assays between them by using a subcutaneous route of challenge of mice and guinea pigs or intradermal challenge of mice. However, a significant decrease in time-to-death was observed in animals infected with the epidemic T259 Pla-producing strains as compared to the parent Pla-negative variants. Survival curves of the endemic I259 Pla+ strains fit between them, but significant difference in mean time to death post infection between the Pla-strains and their I259 Pla+ variants could be seen only in the isogenic set of subsp. pestis strains. These findings suggest an essential role for the outer membrane protease Pla evolution in Y. pestis bubonic infection exacerbation that is necessary for intensification of epidemic process from endemic natural focality with sporadic cases in men to rapidly expanding epizootics followed by human epidemic outbreaks, local epidemics or even pandemics.

Two Isoforms of Yersinia pestis Plasminogen Activator Pla: Intraspecies Distribution, Intrinsic Disorder Propensity, and Contribution to Virulence

PubMed Central

Dentovskaya, Svetlana V.; Platonov, Mikhail E.; Svetoch, Tat’yana E.; Kopylov, Pavel Kh.; Kombarova, Tat’yana I.; Ivanov, Sergey A.; Shaikhutdinova, Rima Z.; Kolombet, Lyubov’ V.; Chauhan, Sadhana; Ablamunits, Vitaly G.; Motin, Vladimir L.; Uversky, Vladimir N.

2016-01-01

It has been shown previously that several endemic Y. pestis isolates with limited virulence contained the I259 isoform of the outer membrane protease Pla, while the epidemic highly virulent strains possessed only the T259 Pla isoform. Our sequence analysis of the pla gene from 118 Y. pestis subsp. microtus strains revealed that the I259 isoform was present exclusively in the endemic strains providing a convictive evidence of more ancestral origin of this isoform. Analysis of the effects of the I259T polymorphism on the intrinsic disorder propensity of Pla revealed that the I259T mutation slightly increases the intrinsic disorder propensity of the C-terminal tail of Pla and makes this protein slightly more prone for disorder-based protein-protein interactions, suggesting that the T259 Pla could be functionally more active than the I259 Pla. This assumption was proven experimentally by assessing the coagulase and fibrinolytic activities of the two Pla isoforms in human plasma, as well as in a direct fluorometric assay with the Pla peptide substrate. The virulence testing of Pla-negative or expressing the I259 and T259 Pla isoforms Y. pestis subsp. microtus and subsp. pestis strains did not reveal any significant difference in LD50 values and dose-dependent survival assays between them by using a subcutaneous route of challenge of mice and guinea pigs or intradermal challenge of mice. However, a significant decrease in time-to-death was observed in animals infected with the epidemic T259 Pla-producing strains as compared to the parent Pla-negative variants. Survival curves of the endemic I259 Pla+ strains fit between them, but significant difference in mean time to death post infection between the Pla−strains and their I259 Pla+ variants could be seen only in the isogenic set of subsp. pestis strains. These findings suggest an essential role for the outer membrane protease Pla evolution in Y. pestis bubonic infection exacerbation that is necessary for intensification of epidemic process from endemic natural focality with sporadic cases in men to rapidly expanding epizootics followed by human epidemic outbreaks, local epidemics or even pandemics. PMID:27936190

STUDIES ON THE BIOLOGY OF STREPTOCOCCUS

PubMed Central

Stevens, Franklin A.; Dochez, A. R.

1924-01-01

1. Strains of hemolytic streptococci from cases of scarlet fever occurring in New York, San Francisco, Chicago, Baltimore, and Copenhagen, Denmark, all interagglutinate with immune sera prepared with these strains. 2. Sera prepared with these strains do not agglutinate pyogenic streptococci or strains isolated from cases of septic sore throat. 3. The strains obtained from the throats of patients from an epidemic of scarlet fever and the strain from the milk responsible for this epidemic fall into the scarlatinal group according to these agglutination tests. 4. Absorption tests can be carried out with these strains and sera under proper conditions. 5. A group of hemolytic streptococci biologically distinct from streptococci from other sources than scarlet fever is constantly associated with scarlatina. They constitute a group of closely related streptococci which may be identified by agglutination tests. PMID:19868913

Clostridium difficile chimeric toxin receptor binding domain vaccine induced protection against different strains in active and passive challenge models.

PubMed

Tian, Jing-Hui; Glenn, Gregory; Flyer, David; Zhou, Bin; Liu, Ye; Sullivan, Eddie; Wu, Hua; Cummings, James F; Elllingsworth, Larry; Smith, Gale

2017-07-24

Clostridium difficile is the number one cause of nosocomial antibiotic-associated diarrhea in developed countries. Historically, pathogenesis was attributed two homologous glucosylating toxins, toxin-A (TcdA) and toxin-B (TcdB). Over the past decade, however, highly virulent epidemic strains of C. difficile (B1/NAP1/027) have emerged and are linked to an increase in morbidity and mortality. Increased virulence is attributed to multiple factors including: increased production of A- and B-toxins; production of binary toxin (CDT); and the emergence of more toxic TcdB variants (TcdB (027) ). TcdB (027) is more cytotoxicity to cells; causes greater tissue damage and toxicity in animals; and is antigenically distinct from historical TcdB (TcdB (003) ). Broadly protective vaccines and therapeutic antibody strategies, therefore, may target TcdA, TcdB variants and CDT. To facilitate the generation of multivalent toxin-based C. difficile vaccines and therapeutic antibodies, we have generated fusion proteins constructed from the receptor binding domains (RBD) of TcdA, TcdB (003) , TcdB (027) and CDT. Herein, we describe the development of a trivalent toxin (T-toxin) vaccine (CDTb/TcdB (003) /TcdA) and quadravalent toxin (Q-toxin) vaccine (CDTb/TcB (003) /TcdA/TcdB (027) ) fusion proteins that retain the protective toxin neutralizing epitopes. Active immunization of mice or hamsters with T-toxin or Q-toxin fusion protein vaccines elicited the generation of toxin neutralizing antibodies to each of the toxins. Hamsters immunized with the Q-toxin vaccine were broadly protected against spore challenge with historical C. difficile 630 (toxinotype 0/ribotype 003) and epidemic NAP1 (toxinotype III/ribotype 027) strains. Fully human polyclonal antitoxin IgG was produced by immunization of transgenic bovine with these fusion proteins. In passive transfer studies, mice were protected against lethal toxin challenge. Hamsters treated with human antitoxin IgG were completely protected when challenged with historical or epidemic strains of C. difficile. The use of chimeric fusion proteins is an attractive approach to producing multivalent antitoxin vaccines and therapeutic polyclonal antibodies for prevention and treatment of C. difficile infections (CDI). Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Explaining rapid reinfections in multiple-wave influenza outbreaks: Tristan da Cunha 1971 epidemic as a case study

PubMed Central

Camacho, Anton; Ballesteros, Sébastien; Graham, Andrea L.; Carrat, Fabrice; Ratmann, Oliver; Cazelles, Bernard

2011-01-01

Influenza usually spreads through the human population in multiple-wave outbreaks. Successive reinfection of individuals over a short time interval has been explicitly reported during past pandemics. However, the causes of rapid reinfection and the role of reinfection in driving multiple-wave outbreaks remain poorly understood. To investigate these issues, we focus on a two-wave influenza A/H3N2 epidemic that occurred on the remote island of Tristan da Cunha in 1971. Over 59 days, 273 (96%) of 284 islanders experienced at least one attack and 92 (32%) experienced two attacks. We formulate six mathematical models invoking a variety of antigenic and immunological reinfection mechanisms. Using a maximum-likelihood analysis to confront model predictions with the reported incidence time series, we demonstrate that only two mechanisms can be retained: some hosts with either a delayed or deficient humoral immune response to the primary influenza infection were reinfected by the same strain, thus initiating the second epidemic wave. Both mechanisms are supported by previous empirical studies and may arise from a combination of genetic and ecological causes. We advocate that a better understanding and account of heterogeneity in the human immune response are essential to analysis of multiple-wave influenza outbreaks and pandemic planning. PMID:21525058

Viral haemorrhagic fevers imported into non-endemic countries: risk assessment and management.

PubMed

Bannister, Barbara

2010-01-01

Viral haemorrhagic fevers (VHFs) are severe infections capable of causing haemorrhagic disease and fatal multi-organ failure. Crimean-Congo, Marburg, Ebola and Lassa viruses cause both sporadic cases and large epidemics over wide endemic areas. Original articles and reviews identified by PubMed search and personal reading; European and United States national guidance and legislation. World Health Organization information, documents and reports. VHFs cause significant morbidity and mortality in their endemic areas; they can cause healthcare-related infections, and their broad diversity and range are increasingly recognized. There is uncertainty about the risks presented by VHFs in non-endemic countries, particularly in healthcare environments. Consensus on the best modes of care and infection control are only slowly emerging. With increasing commerce in rural and low-income areas, VHF outbreaks increasingly expand, causing social and economic damage. New ecologies, viral strains and clinical syndromes are being discovered. There is a great need for rapid diagnostic tests and effective antiviral treatments. Vaccine development programmes are challenged by multiple viral strains and the need for trials in rural communities.

Comparative genomics of multidrug resistance in Acinetobacter baumannii.

PubMed

Fournier, Pierre-Edouard; Vallenet, David; Barbe, Valérie; Audic, Stéphane; Ogata, Hiroyuki; Poirel, Laurent; Richet, Hervé; Robert, Catherine; Mangenot, Sophie; Abergel, Chantal; Nordmann, Patrice; Weissenbach, Jean; Raoult, Didier; Claverie, Jean-Michel

2006-01-01

Acinetobacter baumannii is a species of nonfermentative gram-negative bacteria commonly found in water and soil. This organism was susceptible to most antibiotics in the 1970s. It has now become a major cause of hospital-acquired infections worldwide due to its remarkable propensity to rapidly acquire resistance determinants to a wide range of antibacterial agents. Here we use a comparative genomic approach to identify the complete repertoire of resistance genes exhibited by the multidrug-resistant A. baumannii strain AYE, which is epidemic in France, as well as to investigate the mechanisms of their acquisition by comparison with the fully susceptible A. baumannii strain SDF, which is associated with human body lice. The assembly of the whole shotgun genome sequences of the strains AYE and SDF gave an estimated size of 3.9 and 3.2 Mb, respectively. A. baumannii strain AYE exhibits an 86-kb genomic region termed a resistance island--the largest identified to date--in which 45 resistance genes are clustered. At the homologous location, the SDF strain exhibits a 20 kb-genomic island flanked by transposases but devoid of resistance markers. Such a switching genomic structure might be a hotspot that could explain the rapid acquisition of resistance markers under antimicrobial pressure. Sequence similarity and phylogenetic analyses confirm that most of the resistance genes found in the A. baumannii strain AYE have been recently acquired from bacteria of the genera Pseudomonas, Salmonella, or Escherichia. This study also resulted in the discovery of 19 new putative resistance genes. Whole-genome sequencing appears to be a fast and efficient approach to the exhaustive identification of resistance genes in epidemic infectious agents of clinical significance.

Did an epidemic of tularemia in Ancient Egypt affect the course of world history?

PubMed

Trevisanato, Siro I

2004-01-01

The dynamics of the spreading, and the identity of a virulent epidemic, similar to bubonic plague or typhus, which hit Ancient Egypt in the middle of the Bronze Age, are hereby presented. Documented in medical papyri as well as archaeological findings, and re-echoed in biblical texts, a plague entered Egypt's main harbor, Avaris, around 1715 BC. As a result, the country was severely weakened at a time when it was already facing serious sociopolitical issues: crumbling central government, immigration, foreign influence, and the rise in power of the army and of warlords. The Hebrews, one of the ethnic groups within the Avaris area, appeared immune amidst the devastation of the plague. This immunity was key to identify the etiological agent of the epidemic: Francisella tularensis, the Gram-negative bacterium passed by ticks, and that causes tularemia. The disease manifests itself as either an ulceroglandular or a typhoid syndrome, accounting for its similarity with bubonic plague and typhus. Cellular immunity provides the main defense against F. tularensis, and is achieved through continuous contact with avirulent strains of the bacterium. Urban dwellers of Avaris, who had a limited contact to animals, would have been defenseless against the virulent strains, unlike the Hebrews, who lived off sheep and other animals. Attempting to consolidate Egypt's central government in the aftermath of the tularemia epidemic, led among others to the internment of the Hebrews in labor camps. The repressive measures against the Hebrews left traces in the subsequent archaeological layer (stratum F) at Avaris. As a corollary, the enslavement would set the stage for the exodus of the Hebrew community from Egypt at a later time.

Molecular epidemiology of C. diphtheriae strains during different phases of the diphtheria epidemic in Belarus

PubMed Central

Kolodkina, Valentina; Titov, Leonid; Sharapa, Tatyana; Grimont, Francine; Grimont, Patrick AD; Efstratiou, Androulla

2006-01-01

Background The reemergence of epidemic diphtheria in Belarus in 1990s has provided us with important information on the biology of the disease and the diversity of the causative agent Corynebacterium diphtheriae. Molecular investigations were conducted with the aim to analyze the genetic variability of C diphtheriae during the post-epidemic period. Methods The biotype and toxigenicity status of 3513 C. diphtheriae strains isolated from all areas in Belarus during a declining period of diphtheria morbidity (1996–2005) was undertaken. Of these, 384 strains were isolated from diphtheria cases, 1968 from tonsillitis patients, 426 from contacts and 735 from healthy carriers. Four hundred and thirty two selected strains were ribotyped. Results The C diphtheriae gravis biotype, which was prevalent during 1996–2000, was "replaced" by the mitis biotype during 2001–2005. The distribution of toxigenic C. diphtheriae strains also decreased from 47.1% (1996) to 5.8% (2005). Changes in the distribution of the epidemic ribotypes Sankt-Peterburg and Rossija were also observed. During 2001–2005 the proportion of the Sankt-Peterburg ribotype decreased from 24.3% to 2.3%, in contrast to the Rossija ribotype, that increased from 25.1% to 49.1%. The circulation of other toxigenic ribotypes (Otchakov, Lyon, Bangladesh), which were prevalent during the period of high diphtheria incidence, also decreased. But at the same time, the proportion of non-toxigenic strains with the Cluj and Rossija ribotypes dramatically increased and accounted for 49.3% and 30.1%, respectively. Conclusion The decrease in morbidity correlated with the dramatic decrease in the isolation of the gravis biotype and Sankt Peterburg ribotype, and the prevalence of the Rossija ribotype along with other rare ribotypes associated with non-toxigenic strains (Cluj and Rossija, in particular). PMID:16911772

Evolution of pathogen virulence across space during an epidemic

USGS Publications Warehouse

Osnas, Erik; Hurtado, Paul J.; Dobson, Andrew P.

2015-01-01

We explore pathogen virulence evolution during the spatial expansion of an infectious disease epidemic in the presence of a novel host movement trade-off, using a simple, spatially explicit mathematical model. This work is motivated by empirical observations of the Mycoplasma gallisepticum invasion into North American house finch (Haemorhous mexicanus) populations; however, our results likely have important applications to other emerging infectious diseases in mobile hosts. We assume that infection reduces host movement and survival and that across pathogen strains the severity of these reductions increases with pathogen infectiousness. Assuming these trade-offs between pathogen virulence (host mortality), pathogen transmission, and host movement, we find that pathogen virulence levels near the epidemic front (that maximize wave speed) are lower than those that have a short-term growth rate advantage or that ultimately prevail (i.e., are evolutionarily stable) near the epicenter and where infection becomes endemic (i.e., that maximize the pathogen basic reproductive ratio). We predict that, under these trade-offs, less virulent pathogen strains will dominate the periphery of an epidemic and that more virulent strains will increase in frequency after invasion where disease is endemic. These results have important implications for observing and interpreting spatiotemporal epidemic data and may help explain transient virulence dynamics of emerging infectious diseases.

National Borders Effectively Halt the Spread of Rabies: The Current Rabies Epidemic in China Is Dislocated from Cases in Neighboring Countries

PubMed Central

Guo, Zhenyang; Tao, Xiaoyan; Yin, Cuiping; Han, Na; Yu, Jinning; Li, Hao; Liu, Haizhou; Fang, Wei; Adams, James; Wang, Jun; Liang, Guodong; Tang, Qing; Rayner, Simon

2013-01-01

China has seen a massive resurgence of rabies cases in the last 15 years with more than 25,000 human fatalities. Initial cases were reported in the southwest but are now reported in almost every province. There have been several phylogenetic investigations into the origin and spread of the virus within China but few reports investigating the impact of the epidemic on neighboring countries. We therefore collected nucleoprotein sequences from China and South East Asia and investigated their phylogenetic and phylogeographic relationship. Our results indicate that within South East Asia, isolates mainly cluster according to their geographic origin. We found evidence of sporadic exchange of strains between neighboring countries, but it appears that the major strain responsible for the current Chinese epidemic has not been exported. This suggests that national geographical boundaries and border controls are effective at halting the spread of rabies from China into adjacent regions. We further investigated the geographic structure of Chinese sequences and found that the current epidemic is dominated by variant strains that were likely present at low levels in previous domestic epidemics. We also identified epidemiological linkages between high incidence provinces consistent with observations based on surveillance data from human rabies cases. PMID:23383359

National borders effectively halt the spread of rabies: the current rabies epidemic in China is dislocated from cases in neighboring countries.

PubMed

Guo, Zhenyang; Tao, Xiaoyan; Yin, Cuiping; Han, Na; Yu, Jinning; Li, Hao; Liu, Haizhou; Fang, Wei; Adams, James; Wang, Jun; Liang, Guodong; Tang, Qing; Rayner, Simon

2013-01-01

China has seen a massive resurgence of rabies cases in the last 15 years with more than 25,000 human fatalities. Initial cases were reported in the southwest but are now reported in almost every province. There have been several phylogenetic investigations into the origin and spread of the virus within China but few reports investigating the impact of the epidemic on neighboring countries. We therefore collected nucleoprotein sequences from China and South East Asia and investigated their phylogenetic and phylogeographic relationship. Our results indicate that within South East Asia, isolates mainly cluster according to their geographic origin. We found evidence of sporadic exchange of strains between neighboring countries, but it appears that the major strain responsible for the current Chinese epidemic has not been exported. This suggests that national geographical boundaries and border controls are effective at halting the spread of rabies from China into adjacent regions. We further investigated the geographic structure of Chinese sequences and found that the current epidemic is dominated by variant strains that were likely present at low levels in previous domestic epidemics. We also identified epidemiological linkages between high incidence provinces consistent with observations based on surveillance data from human rabies cases.

Molecular epidemiology of HIV-1 infection in Europe: An overview.

PubMed

Beloukas, Apostolos; Psarris, Alexandros; Giannelou, Polina; Kostaki, Evangelia; Hatzakis, Angelos; Paraskevis, Dimitrios

2016-12-01

Human Immunodeficiency Virus type 1 (HIV-1) is characterised by vast genetic diversity. Globally circulating HIV-1 viruses are classified into distinct phylogenetic strains (subtypes, sub-subtypes) and several recombinant forms. Here we describe the characteristics and evolution of European HIV-1 epidemic over time through a review of published literature and updated queries of existing HIV-1 sequence databases. HIV-1 in Western and Central Europe was introduced in the early-1980s in the form of subtype B, which is still the predominant clade. However, in Eastern Europe (Former Soviet Union (FSU) countries and Russia) the predominant strain, introduced into Ukraine in the mid-1990s, is subtype A (A FSU ) with transmission mostly occurring in People Who Inject Drugs (PWID). In recent years, the epidemic is evolving towards a complex tapestry with an increase in the prevalence of non-B subtypes and recombinants in Western and Central Europe. Non-B epidemics are mainly associated with immigrants, heterosexuals and females but more recently, non-B clades have also spread amongst groups where non-B strains were previously absent - non-immigrant European populations and amongst men having sex with men (MSM). In some countries, non-B clades have spread amongst the native population, for example subtype G in Portugal and subtype A in Greece, Albania and Cyprus. Romania provides a unique case where sub-subtype F1 has predominated throughout the epidemic. In contrast, HIV-1 epidemic in FSU countries remains more homogeneous with A FSU clade predominating in all countries. The differences between the evolution of the Western epidemic and the Eastern epidemic may be attributable to differences in transmission risk behaviours, lifestyle and the patterns of human mobility. The study of HIV-1 epidemic diversity provides a useful tool by which we can understand the history of the pandemic in addition to allowing us to monitor the spread and growth of the epidemic over time. Copyright © 2016 Elsevier B.V. All rights reserved.

Lack of Involvement of Fenton Chemistry in Death of Methicillin-Resistant and Methicillin-Sensitive Strains of Staphylococcus aureus and Destruction of Their Genomes on Wet or Dry Copper Alloy Surfaces

PubMed Central

2016-01-01

The pandemic of hospital-acquired infections caused by methicillin-resistant Staphylococcus aureus (MRSA) has declined, but the evolution of strains with enhanced virulence and toxins and the increase of community-associated infections are still a threat. In previous studies, 107 MRSA bacteria applied as simulated droplet contamination were killed on copper and brass surfaces within 90 min. However, contamination of surfaces is often via finger tips and dries rapidly, and it may be overlooked by cleaning regimes (unlike visible droplets). In this new study, a 5-log reduction of a hardy epidemic strain of MRSA (epidemic methicillin-resistant S. aureus 16 [EMRSA-16]) was observed following 10 min of contact with copper, and a 4-log reduction was observed on copper nickel and cartridge brass alloys in 15 min. A methicillin-sensitive S. aureus (MSSA) strain from an osteomyelitis patient was killed on copper surfaces in 15 min, and 4-log and 3-log reductions occurred within 20 min of contact with copper nickel and cartridge brass, respectively. Bacterial respiration was compromised on copper surfaces, and superoxide was generated as part of the killing mechanism. In addition, destruction of genomic DNA occurs on copper and brass surfaces, allaying concerns about horizontal gene transfer and copper resistance. Incorporation of copper alloy biocidal surfaces may help to reduce the spread of this dangerous pathogen. PMID:26826226

A Reverse Genetics Platform That Spans the Zika Virus Family Tree

PubMed Central

Widman, Douglas G.; Young, Ellen; Yount, Boyd L.; Plante, Kenneth S.; Gallichotte, Emily N.; Carbaugh, Derek L.; Plante, Jessica; Swanstrom, Jesica; Heise, Mark T.; Lazear, Helen M.

2017-01-01

ABSTRACT Zika virus (ZIKV), a mosquito-borne flavivirus discovered in 1947, has only recently caused large outbreaks and emerged as a significant human pathogen. In 2015, ZIKV was detected in Brazil, and the resulting epidemic has spread throughout the Western Hemisphere. Severe complications from ZIKV infection include neurological disorders such as Guillain-Barré syndrome in adults and a variety of fetal abnormalities, including microcephaly, blindness, placental insufficiency, and fetal demise. There is an urgent need for tools and reagents to study the pathogenesis of epidemic ZIKV and for testing vaccines and antivirals. Using a reverse genetics platform, we generated six ZIKV infectious clones and derivative viruses representing diverse temporal and geographic origins. These include three versions of MR766, the prototype 1947 strain (with and without a glycosylation site in the envelope protein), and H/PF/2013, a 2013 human isolate from French Polynesia representative of the virus introduced to Brazil. In the course of synthesizing a clone of a circulating Brazilian strain, phylogenetic studies identified two distinct ZIKV clades in Brazil. We reconstructed viable clones of strains SPH2015 and BeH819015, representing ancestral members of each clade. We assessed recombinant virus replication, binding to monoclonal antibodies, and virulence in mice. This panel of molecular clones and recombinant virus isolates will enable targeted studies of viral determinants of pathogenesis, adaptation, and evolution, as well as the rational attenuation of contemporary outbreak strains to facilitate the design of vaccines and therapeutics. PMID:28270583

Chemical and Stress Resistances of Clostridium difficile Spores and Vegetative Cells

PubMed Central

Edwards, Adrianne N.; Karim, Samiha T.; Pascual, Ricardo A.; Jowhar, Lina M.; Anderson, Sarah E.; McBride, Shonna M.

2016-01-01

Clostridium difficile is a Gram-positive, sporogenic and anaerobic bacterium that causes a potentially fatal colitis. C. difficile enters the body as dormant spores that germinate in the colon to form vegetative cells that secrete toxins and cause the symptoms of infection. During transit through the intestine, some vegetative cells transform into spores, which are more resistant to killing by environmental insults than the vegetative cells. Understanding the inherent resistance properties of the vegetative and spore forms of C. difficile is imperative for the development of methods to target and destroy the bacterium. The objective of this study was to define the chemical and environmental resistance properties of C. difficile vegetative cells and spores. We examined vegetative cell and spore tolerances of three C. difficile strains, including 630Δerm, a 012 ribotype and a derivative of a past epidemic strain; R20291, a 027 ribotype and current epidemic strain; and 5325, a clinical isolate that is a 078 ribotype. All isolates were tested for tolerance to ethanol, oxygen, hydrogen peroxide, butanol, chloroform, heat and sodium hypochlorite (household bleach). Our results indicate that 630Δerm vegetative cells (630 spo0A) are more resistant to oxidative stress than those of R20291 (R20291 spo0A) and 5325 (5325 spo0A). In addition, 5325 spo0A vegetative cells exhibited greater resistance to organic solvents. In contrast, 630Δerm spores were more sensitive than R20291 or 5325 spores to butanol. Spores from all three strains exhibited high levels of resistance to ethanol, hydrogen peroxide, chloroform and heat, although R20291 spores were more resistant to temperatures in the range of 60–75°C. Finally, household bleach served as the only chemical reagent tested that consistently reduced C. difficile vegetative cells and spores of all tested strains. These findings establish conditions that result in vegetative cell and spore elimination and illustrate the resistance of C. difficile to common decontamination methods. These results further demonstrate that the vegetative cells and spores of various C. difficile strains have different resistance properties that may impact decontamination of surfaces and hands. PMID:27833595

PubMed Central

BARBERIS, I.; MYLES, P.; AULT, S.K.; MARTINI, M.

2016-01-01

Summary Influenza is a highly infectious airborne disease with an important epidemiological and societal burden; annual epidemics and pandemics have occurred since ancient times, causing tens of millions of deaths. A hundred years after this virus was first isolated, influenza vaccines are an important influenza prevention strategy and the preparations used display good safety and tolerability profiles. Innovative tools, such as recombinant technologies and intra-dermal devices, are currently being investigated in order to improve the immunological response. The recurring mutations of influenza strains has prompted the recent introduction of a quadrivalent inactivated vaccine. In the near future, scientific research will strive to produce a long-lasting universal vaccine containing an antigen that will offer protection against all influenza virus strains. PMID:27980374

Statins in influenza: time for a controlled clinical study.

PubMed

Carrillo-Esper, Raúl

2009-01-01

Mexico recently experienced the impact of an influenza epidemic. This outbreak, the H1N1 strain, affected a large number of citizens and caused panic, economic instability and increased health care costs to the federal government and public and private institutions. Influenza outbreaks are periodic. They may or may not be seasonal, and severity of the disease is linked to host immunity and to the virus strain. In the event of a pandemic as happened in 1918, it is estimated that approximately 175-350 million people may die, and health systems would face a catastrophic situation due to the insufficiency of antivirals and vaccines, as well as affecting hospital infrastructure.

Genomic Variation and Evolution of Vibrio parahaemolyticus ST36 over the Course of a Transcontinental Epidemic Expansion

PubMed Central

Abanto, Michel; Haendiges, Julie; Myers, Robert A.; Trinanes, Joaquin; Baker-Austin, Craig

2017-01-01

ABSTRACT Vibrio parahaemolyticus is the leading cause of seafood-related infections with illnesses undergoing a geographic expansion. In this process of expansion, the most fundamental change has been the transition from infections caused by local strains to the surge of pandemic clonal types. Pandemic clone sequence type 3 (ST3) was the only example of transcontinental spreading until 2012, when ST36 was detected outside the region where it is endemic in the U.S. Pacific Northwest causing infections along the U.S. northeast coast and Spain. Here, we used genome-wide analyses to reconstruct the evolutionary history of the V. parahaemolyticus ST36 clone over the course of its geographic expansion during the previous 25 years. The origin of this lineage was estimated to be in ~1985. By 1995, a new variant emerged in the region and quickly replaced the old clone, which has not been detected since 2000. The new Pacific Northwest (PNW) lineage was responsible for the first cases associated with this clone outside the Pacific Northwest region. After several introductions into the northeast coast, the new PNW clone differentiated into a highly dynamic group that continues to cause illness on the northeast coast of the United States. Surprisingly, the strains detected in Europe in 2012 diverged from this ancestral group around 2000 and have conserved genetic features present only in the old PNW lineage. Recombination was identified as the major driver of diversification, with some preliminary observations suggesting a trend toward a more specialized lifestyle, which may represent a critical element in the expansion of epidemics under scenarios of coastal warming. PMID:29138301

Genetic Analysis of Hepatitis A Virus Strains That Induced Epidemics in Korea during 2007–2009

PubMed Central

Lee, Hyeokjin; Jeong, Hyesook; Yun, Heasun; Kim, Kisang; Kim, Jong-Hyun; Yang, Jai Myung

2012-01-01

Hepatitis A virus is one of the most prominent causes of fecally transmitted acute hepatitis worldwide. In order to characterize the viral agents causing an outbreak in Korea (comprising North and South Korea) from June 2007 to May 2009, we collected specimens and performed genotyping of the VP1/P2A and VP3/VP1 regions of hepatitis A virus. We then used a multiple-alignment algorithm to compare the nucleotide sequences of the 2 regions with those of reference strains. Hepatitis A virus antibodies were detected in 64 patients from 5 reported outbreaks (North Korea, June 2007 [n = 11]; Jeonnam, April 2008 [n = 15]; Daegu, May 2008 [n = 13]; Seoul, May 2009 [n = 22]; and Incheon, May 2009 [n = 3]). We found 100% homology between strains isolated from the Kaesong Industrial Region and Jeonnam. While those strains were classified as genotype IA strains, strains from Seoul and Incheon were identified as genotype IIIA strains and showed 98.9 to 100% homology. Genotype IIIA was also dominant in Daegu, where strains were 95.7 to 100% homologous. All hepatitis A virus strains isolated from the Kaesong Industrial Region, Jeonnam, Seoul, and Incheon belonged to a single cluster. However, strains from Daegu could be classified into 2 clusters, suggesting that the outbreak had multiple sources. This study indicates that hepatitis A virus strains of 2 different genotypes are currently cocirculating in Korea. Moreover, it documents an increasing prevalence of genotype IIIA strains in the country. PMID:22238447

Isolation and sequence analysis of the complete NS1 and VP2 genes of canine parvovirus from domestic dogs in 2013 and 2014 in China.

PubMed

Wang, Hualei; Jin, Hongli; Li, Qian; Zhao, Guoxing; Cheng, Nan; Feng, Na; Zheng, Xuexing; Wang, Jianzhong; Zhao, Yongkun; Li, Ling; Cao, Zengguo; Yan, Feihu; Wang, Lina; Wang, Tiecheng; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu

2016-02-01

Canine parvovirus (CPV) can cause severe disease in animals and continuously generates new variant and recombinant strains in dogs that have a strong impact on sanitation. It is therefore necessary to investigate epidemic CPV strains to improve our understanding of CPV transmission and epidemic behavior. However, most studies have focused on the analysis of VP2, and therefore, information about recombination and relationships between strains is still lacking. Here, 14 strains of CPV were isolated from domestic dogs suspected of hosting CPV between 2013 and 2014 in China. The complete NS1 and VP2 genes were sequenced and analyzed. The results suggest that the new CPV-2a and new CPV-2b types are the prevalent strains in China. In addition to a few mutations (residues 19, 544, 545, 572 and 583 of NS1 and residues 267, 370, 377 and 440 of VP2) that were preserved during transmission, new mutations (residues 60, 630 of NS1, and residues 21, 310 of VP2) were found in the isolated strains. A phylogenetic tree based on VP2 sequences illustrated that the new CPV-2a and new CPV-2b strains from China form single clusters that are distinct from lineages from other countries. Moreover, recombination between the new CPV-2a and new CPV-2b types was also identified in the isolated strains. Due to differences in selection pressures or recombination, there were a small number of inconsistencies between the phylogenetic trees for VP2 and NS1, which indicated that phylogenetic relationships based on VP2 might not be representative of those based on NS1. The data indicated that mutations and recombination are constantly occurring along with the spread of CPV in China.

Dietary trehalose enhances virulence of epidemic Clostridium difficile.

PubMed

Collins, J; Robinson, C; Danhof, H; Knetsch, C W; van Leeuwen, H C; Lawley, T D; Auchtung, J M; Britton, R A

2018-01-18

Clostridium difficile disease has recently increased to become a dominant nosocomial pathogen in North America and Europe, although little is known about what has driven this emergence. Here we show that two epidemic ribotypes (RT027 and RT078) have acquired unique mechanisms to metabolize low concentrations of the disaccharide trehalose. RT027 strains contain a single point mutation in the trehalose repressor that increases the sensitivity of this ribotype to trehalose by more than 500-fold. Furthermore, dietary trehalose increases the virulence of a RT027 strain in a mouse model of infection. RT078 strains acquired a cluster of four genes involved in trehalose metabolism, including a PTS permease that is both necessary and sufficient for growth on low concentrations of trehalose. We propose that the implementation of trehalose as a food additive into the human diet, shortly before the emergence of these two epidemic lineages, helped select for their emergence and contributed to hypervirulence.

[Algorithm of toxigenic genetically altered Vibrio cholerae El Tor biovar strain identification].

PubMed

Smirnova, N I; Agafonov, D A; Zadnova, S P; Cherkasov, A V; Kutyrev, V V

2014-01-01

Development of an algorithm of genetically altered Vibrio cholerae biovar El Tor strai identification that ensures determination of serogroup, serovar and biovar of the studied isolate based on pheno- and genotypic properties, detection of genetically altered cholera El Tor causative agents, their differentiation by epidemic potential as well as evaluation of variability of key pathogenicity genes. Complex analysis of 28 natural V. cholerae strains was carried out by using traditional microbiological methods, PCR and fragmentary sequencing. An algorithm of toxigenic genetically altered V. cholerae biovar El Tor strain identification was developed that includes 4 stages: determination of serogroup, serovar and biovar based on phenotypic properties, confirmation of serogroup and biovar based on molecular-genetic properties determination of strains as genetically altered, differentiation of genetically altered strains by their epidemic potential and detection of ctxB and tcpA key pathogenicity gene polymorphism. The algorithm is based on the use of traditional microbiological methods, PCR and sequencing of gene fragments. The use of the developed algorithm will increase the effectiveness of detection of genetically altered variants of the cholera El Tor causative agent, their differentiation by epidemic potential and will ensure establishment of polymorphism of genes that code key pathogenicity factors for determination of origins of the strains and possible routes of introduction of the infection.

Chimera states in multi-strain epidemic models with temporary immunity

NASA Astrophysics Data System (ADS)

Bauer, Larissa; Bassett, Jason; Hövel, Philipp; Kyrychko, Yuliya N.; Blyuss, Konstantin B.

2017-11-01

We investigate a time-delayed epidemic model for multi-strain diseases with temporary immunity. In the absence of cross-immunity between strains, dynamics of each individual strain exhibit emergence and annihilation of limit cycles due to a Hopf bifurcation of the endemic equilibrium, and a saddle-node bifurcation of limit cycles depending on the time delay associated with duration of temporary immunity. Effects of all-to-all and non-local coupling topologies are systematically investigated by means of numerical simulations, and they suggest that cross-immunity is able to induce a diverse range of complex dynamical behaviors and synchronization patterns, including discrete traveling waves, solitary states, and amplitude chimeras. Interestingly, chimera states are observed for narrower cross-immunity kernels, which can have profound implications for understanding the dynamics of multi-strain diseases.

Changing prevalence of hepatitis B virus genotypes in Iceland.

PubMed

Björnsdottir, Thora B; Stanzeit, Barbara; Sällberg, Matti; Löve, Arthur; Hultgren, Catharina

2005-12-01

At present eight hepatitis B virus (HBV) genotypes have been characterized: A to H. The most common genotype in Northern Europe is genotype A. So far there is no record of the specific HBV genotype distribution in Iceland. Iceland has a small population whose homogeneity has changed due to increasing migration during the past decades. The distribution of HBV genotypes in Iceland was analyzed using sera from 170 Icelandic patients. The samples were obtained before 1989, during an HBV epidemic among intravenous drug users in 1989 to 1992 and after 1994. A fragment of the HBV S-gene was amplified, sequenced and subjected to phylogenetic analysis. Among samples derived before 1989 genotypes A, C, and D were found. Most of the samples diagnosed during the epidemic belonged to genotype D and a smaller portion to genotype A. This suggests that the epidemic was most likely caused either by an endogenous HBV strain or by a strain imported from Europe or the USA. Among samples obtained after 1994, genotypes A to E and G were found, but the majority were of genotypes A, C, and D. This is consistent with an increase in migration and immigration from regions in Asia and Africa during the past 10 years. Thus, the changing prevalence of HBV genotypes in a small isolated community such as Iceland reflects the influence of migration and increasing contacts with regions outside the Western World. Copyright (c) 2005 Wiley-Liss, inc.

Role of vaccination-induced immunity and antigenic distance in the transmission dynamics of highly pathogenic avian influenza H5N1

PubMed Central

Rousou, Xanthoula; Kalthoff, Donata; Beer, Martin

2016-01-01

Highly pathogenic avian influenza (HPAI) H5N1 epidemics in poultry cause huge economic losses as well as sporadic human morbidity and mortality. Vaccination in poultry has often been reported as being ineffective in preventing transmission and as a potential driving force in the selection of immune escape mutants. We conducted transmission experiments to evaluate the transmission dynamics of HPAI H5N1 strains in chickens vaccinated with high and low doses of immune escape mutants we have previously selected, and analysed the data using mathematical models. Remarkably, we demonstrate that the effect of antigenic distances between the vaccine and challenge strains used in this study is too small to influence the transmission dynamics of the strains used. This is because the effect of a sufficient vaccine dose on antibody levels against the challenge viruses is large enough to compensate for any decrease in antibody titres due to antigenic differences between vaccine and challenge strains. Our results show that at least under experimental conditions, vaccination will remain effective even after antigenic changes as may be caused by the initial selection in vaccinated birds. PMID:26763336

Genome-Based Infection Tracking Reveals Dynamics of Clostridium difficile Transmission and Disease Recurrence.

PubMed

Kumar, Nitin; Miyajima, Fabio; He, Miao; Roberts, Paul; Swale, Andrew; Ellison, Louise; Pickard, Derek; Smith, Godfrey; Molyneux, Rebecca; Dougan, Gordon; Parkhill, Julian; Wren, Brendan W; Parry, Christopher M; Pirmohamed, Munir; Lawley, Trevor D

2016-03-15

Accurate tracking of Clostridium difficile transmission within healthcare settings is key to its containment but is hindered by the lack of discriminatory power of standard genotyping methods. We describe a whole-genome phylogenetic-based method to track the transmission of individual clones in infected hospital patients from the epidemic C. difficile 027/ST1 lineage, and to distinguish between the 2 causes of recurrent disease, relapse (same strain), or reinfection (different strain). We monitored patients with C. difficile infection in a UK hospital over a 2-year period. We performed whole-genome sequencing and phylogenetic analysis of 108 strains isolated from symptomatic patients. High-resolution phylogeny was integrated with in-hospital transfers and contact data to create an infection network linking individual patients and specific hospital wards. Epidemic C. difficile 027/ST1 caused the majority of infections during our sampling period. Integration of whole-genome single nucleotide polymorphism (SNP) phylogenetic analysis, which accurately discriminated between 27 distinct SNP genotypes, with patient movement and contact data identified 32 plausible transmission events, including ward-based contamination (66%) or direct donor-recipient contact (34%). Highly contagious donors were identified who contributed to the persistence of clones within distinct hospital wards and the spread of clones between wards, especially in areas of intense turnover. Recurrent cases were identified between 4 and 26 weeks, highlighting the limitation of the standard <8-week cutoff used for patient diagnosis and management. Genome-based infection tracking to monitor the persistence and spread of C. difficile within healthcare facilities could inform infection control and patient management. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America.

Non-toxigenic environmental Vibrio cholerae O1 strain from Haiti provides evidence of pre-pandemic cholera in Hispaniola.

PubMed

Azarian, Taj; Ali, Afsar; Johnson, Judith A; Jubair, Mohammad; Cella, Eleonora; Ciccozzi, Massimo; Nolan, David J; Farmerie, William; Rashid, Mohammad H; Sinha-Ray, Shrestha; Alam, Meer T; Morris, J Glenn; Salemi, Marco

2016-10-27

Vibrio cholerae is ubiquitous in aquatic environments, with environmental toxigenic V. cholerae O1 strains serving as a source for recurrent cholera epidemics and pandemic disease. However, a number of questions remain about long-term survival and evolution of V. cholerae strains within these aquatic environmental reservoirs. Through monitoring of the Haitian aquatic environment following the 2010 cholera epidemic, we isolated two novel non-toxigenic (ctxA/B-negative) Vibrio cholerae O1. These two isolates underwent whole-genome sequencing and were investigated through comparative genomics and Bayesian coalescent analysis. These isolates cluster in the evolutionary tree with strains responsible for clinical cholera, possessing genomic components of 6 th and 7 th pandemic lineages, and diverge from "modern" cholera strains around 1548 C.E. [95% HPD: 1532-1555]. Vibrio Pathogenicity Island (VPI)-1 was present; however, SXT/R391-family ICE and VPI-2 were absent. Rugose phenotype conversion and vibriophage resistance evidenced adaption for persistence in aquatic environments. The identification of V. cholerae O1 strains in the Haitian environment, which predate the first reported cholera pandemic in 1817, broadens our understanding of the history of pandemics. It also raises the possibility that these and similar environmental strains could acquire virulence genes from the 2010 Haitian epidemic clone, including the cholera toxin producing CTXϕ.

The Epidemic History of HIV-1 CRF07_BC in Hetian Prefecture and the Role of It on HIV Spreading in China.

PubMed

Wu, Jianjun; Guo, Hongxiong; Zhang, Jing; Liu, Xiaoming; Ayoupu, Aideaierli; Shen, Yuelan; Miao, Lifeng; Tang, Jihai; Lei, Yanhua; Su, Bin

2017-04-01

CRF07_BC is one of the most prevalent HIV-1 strains in China, and Xinjiang Uygur Autonomous Region has ever been considered to be a second epidemic center after Yunnan Province in previous studies. Here we use HIV-1 pol gene sequences identified from Hetian Prefecture located in Xinjiang Autonomous Region to reconstruct the epidemic history of HIV CRF07_BC strain circulating in this region. We found that CRF07_BC is the predominant HIV-1 form in Hetian Prefecture, and the estimated tMRCA analysis shows that there is no enough evidence supporting Xinjiang Autonomous Region as a second epidemic center of spreading HIV-1. It may imply that every city may be only a point among the HIV spreading network because of the frequent migration of population in the whole country nowadays.

Plasmid and surface antigen markers of endemic and epidemic Legionella pneumophila strains.

PubMed Central

Brown, A; Vickers, R M; Elder, E M; Lema, M; Garrity, G M

1982-01-01

Environmental and clinical isolates of Legionella pneumophila obtained from the Pittsburgh Veterans Administration Medical Center were studied for the presence of plasmids and for unique surface antigens. The majority of environmental isolates contained a single 80-megadalton plasmid. After an epidemic of nosocomial Legionnaires disease subsided in the Spring of 1981, plasmid-bearing environmental isolates persisted in the environment. Whereas L. pneumophila could not be reisolated from most sites with plasmidless isolates. During this epidemic the attack rate was highest on wards with plasmidless isolates. All clinical isolates were plasmidless. Strains were serotyped by the indirect immunofluorescence method with serum from a single immunized rat which was used both without absorption and after absorption with various plasmid-bearing and plasmidless isolates. These studies suggested that a plasmid-associated surface antigen was present and that the most common plasmidless environmental serotype was similar to the epidemic clinical serotype. Images PMID:7119096

Epidemic Keratoconjunctivitis Due to the Novel Hexon-Chimeric-Intermediate 22,37/H8 Human Adenovirus ▿

PubMed Central

Aoki, Koki; Ishiko, Hiroaki; Konno, Tsunetada; Shimada, Yasushi; Hayashi, Akio; Kaneko, Hisatoshi; Ohguchi, Takeshi; Tagawa, Yoshitsugu; Ohno, Shigeaki; Yamazaki, Shudo

2008-01-01

In a 2-month period in 2003, we encountered an outbreak of epidemic keratoconjunctivitis (EKC) in Japan. We detected 67 human adenoviruses (HAdVs) by PCR from eye swabs of patients with EKC at five eye clinics in different parts of Japan. Forty-one of the 67 HAdV DNAs from the swabs were identified as HAdV-37 by phylogenetic analysis using a partial hexon gene sequence. When the restriction patterns of these viral genomes were compared with that of the HAdV-37 prototype strain, one isolate showed a never-before-seen restriction pattern. Within 1 year, we encountered three more EKC cases caused by a genetically identical virus: two nosocomial infections at two different university hospitals and a sporadic infection at an eye clinic. We determined the nucleotide sequences of the full-length hexon and fiber genes of these isolates and compared them to those of the 51 prototype strains. Surprisingly, the sequence of the hexon (ɛ determinant) loop-1 and -2 regions showed the highest nucleotide identity with HAdV-22, a rare EKC isolate. However, the nucleotide sequence of the fiber gene was identical to that of the HAdV-8 prototype strain. 22 We propose that this virus is a new hexon-chimeric intermediate HAdV-22,37/H8, and may be an etiological agent of EKC. PMID:18701656

Comparative genomics of Vibrio cholerae El Tor strains isolated at epidemic complications in Siberia and at the Far East.

PubMed

Mironova, Liliya V; Gladkikh, Anna S; Ponomareva, Anna S; Feranchuk, Sergey I; Bochalgin, Nikita О; Basov, Evgenii A; Yu Khunkheeva, Zhanna; Balakhonov, Sergey V

2018-06-01

The territory of Siberia and the Far East of Russia is classified as epidemically safe for cholera; however, in the 1970s and 1990s a number of infection importation cases and acute outbreaks associated with the cholera importation were reported. Here, we analyze genomes of four Vibrio cholerae El Tor strains isolated from humans during epidemic complications (imported cases, an outbreak) in the 1990s. The analyzed strains harbor the classical allele of the cholera toxin subunit B gene (ctxB1); thus, belong to genetically altered variants of the El Tor biotype. Analysis of the genomes revealed their high homology with the V. cholerae N16961 reference strain: 85-93 SNPs were identified in the core genome as compared to the reference. The determined features of SNPs in the CTX prophage made it possible to propose the presence of a new subtype - CTX-2a in two strains; the other two strains carried the prophage of CTX-3 type. Results of phylogenetic analysis based on SNP-typing demonstrated that two strains belonged to the second wave, and two - to the early third wave of cholera dissemination in the world. Phylogenetic reconstruction in combination with epidemiological data permitted to trace the origin of the strains and the way of their importation to the Russian Federation directly or through temporary cholera foci. Copyright © 2018 Elsevier B.V. All rights reserved.

Cross protective immune responses in nursing piglets infected with a US spike-insertion deletion porcine epidemic diarrhea virus strain and challenged with an original US PEDV strain.

PubMed

Annamalai, Thavamathi; Lin, Chun-Ming; Gao, Xiang; Liu, Xinsheng; Lu, Zhongyan; Saif, Linda J; Wang, Qiuhong

2017-10-06

We investigated cross-protective immunity of a US spike-insertion deletion porcine epidemic diarrhea virus (PEDV) Iowa106 (S-INDEL) strain against the original US PEDV (PC21A) strain in nursing piglets. Piglets were inoculated orally with S-INDEL, PC21A or mock. At 20-29 days post-inoculation (dpi), all pigs were challenged with the PC21A strain. The S-INDEL-inoculated pigs had lower ileal IgA antibody secreting cells, serum IgA and neutralizing antibody titers compared with PC21A-inoculated pigs. No pigs in the PC21A-group developed diarrhea, whereas 81 and 100% of pigs in the S-INDEL and mock-groups had diarrhea post challenge, respectively. S-INDEL induced partial protective immunity against the original US PEDV strain.

Sentinel Surveillance of Influenza-Like-Illness in Two Cities of the Tropical Country of Ecuador: 2006–2010

PubMed Central

Douce, Richard W.; Aleman, Washington; Chicaiza-Ayala, Wilson; Madrid, Cesar; Sovero, Merly; Delgado, Franklin; Rodas, Mireya; Ampuero, Julia; Chauca, Gloria; Perez, Juan; Garcia, Josefina; Kochel, Tadeusz; Halsey, Eric S.; Laguna-Torres, V. Alberto

2011-01-01

Background Tropical countries are thought to play an important role in the global behavior of respiratory infections such as influenza. The tropical country of Ecuador has almost no documentation of the causes of acute respiratory infections. The objectives of this study were to identify the viral agents associated with influenza like illness (ILI) in Ecuador, describe what strains of influenza were circulating in the region along with their epidemiologic characteristics, and perform molecular characterization of those strains. Methodology/Findings This is a prospective surveillance study of the causes of ILI based on viral culture of oropharyngeal specimens and case report forms obtained in hospitals from two cities of Ecuador over 4 years. Out of 1,702 cases of ILI, nine viral agents were detected in 597 patients. During the time of the study, seven genetic variants of influenza circulated in Ecuador, causing six periods of increased activity. There appeared to be more heterogeneity in the cause of ILI in the tropical city of Guayaquil when compared with the Andean city of Quito. Conclusions/Significance This was the most extensive documentation of the viral causes of ILI in Ecuador to date. Influenza was a common cause of ILI in Ecuador, causing more than one outbreak per year. There was no well defined influenza season although there were periods of time when no influenza was detected alternating with epidemics of different variant strains. PMID:21887216

Epidemic Spread of Symbiotic and Non-Symbiotic Bradyrhizobium Genotypes Across California.

PubMed

Hollowell, A C; Regus, J U; Gano, K A; Bantay, R; Centeno, D; Pham, J; Lyu, J Y; Moore, D; Bernardo, A; Lopez, G; Patil, A; Patel, S; Lii, Y; Sachs, J L

2016-04-01

The patterns and drivers of bacterial strain dominance remain poorly understood in natural populations. Here, we cultured 1292 Bradyrhizobium isolates from symbiotic root nodules and the soil root interface of the host plant Acmispon strigosus across a >840-km transect in California. To investigate epidemiology and the potential role of accessory loci as epidemic drivers, isolates were genotyped at two chromosomal loci and were assayed for presence or absence of accessory "symbiosis island" loci that encode capacity to form nodules on hosts. We found that Bradyrhizobium populations were very diverse but dominated by few haplotypes-with a single "epidemic" haplotype constituting nearly 30 % of collected isolates and spreading nearly statewide. In many Bradyrhizobium lineages, we inferred presence and absence of the symbiosis island suggesting recurrent evolutionary gain and or loss of symbiotic capacity. We did not find statistical phylogenetic evidence that the symbiosis island acquisition promotes strain dominance and both symbiotic and non-symbiotic strains exhibited population dominance and spatial spread. Our dataset reveals that a strikingly few Bradyrhizobium genotypes can rapidly spread to dominate a landscape and suggests that these epidemics are not driven by the acquisition of accessory loci as occurs in key human pathogens.

Molecular phylogenetic and evolutionary analyses of Muar strain of Japanese encephalitis virus reveal it is the missing fifth genotype.

PubMed

Mohammed, Manal A F; Galbraith, Sareen E; Radford, Alan D; Dove, Winifred; Takasaki, Tomohiko; Kurane, Ichiro; Solomon, Tom

2011-07-01

Japanese encephalitis virus (JEV) is the most important cause of epidemic encephalitis worldwide but its origin is unknown. Epidemics of encephalitis suggestive of Japanese encephalitis (JE) were described in Japan from the 1870s onwards. Four genotypes of JEV have been characterised and representatives of each genotype have been fully sequenced. Based on limited information, a single isolate from Malaysia is thought to represent a putative fifth genotype. We have determined the complete nucleotide and amino acid sequence of Muar strain and compared it with other fully sequenced JEV genomes. Muar was the least similar, with nucleotide divergence ranging from 20.2 to 21.2% and amino acid divergence ranging from 8.5 to 9.9%. Phylogenetic analysis of Muar strain revealed that it does represent a distinct fifth genotype of JEV. We elucidated Muar signature amino acids in the envelope (E) protein, including E327 Glu on the exposed lateral surface of the putative receptor binding domain which distinguishes Muar strain from the other four genotypes. Evolutionary analysis of full-length JEV genomes revealed that the mean evolutionary rate is 4.35 × 10(-4) (3.4906 × 10(-4) to 5.303 × 10(-4)) nucleotides substitutions per site per year and suggests JEV originated from its ancestral virus in the mid 1500s in the Indonesia-Malaysia region and evolved there into different genotypes, which then spread across Asia. No strong evidence for positive selection was found between JEV strains of the five genotypes and the E gene has generally been subjected to strong purifying selection. Copyright © 2011 Elsevier B.V. All rights reserved.

Homogentisate 1-2-Dioxygenase Downregulation in the Chronic Persistence of Pseudomonas aeruginosa Australian Epidemic Strain-1 in the CF Lung

PubMed Central

Harmer, Christopher J.; Wynn, Matthew; Pinto, Rachel; Cordwell, Stuart; Rose, Barbara R.; Harbour, Colin; Triccas, James A.; Manos, Jim

2015-01-01

Some Pseudomonas aeruginosa strains including Australian Epidemic Strain-1 (AES-1 or AUS-01) cause persistent chronic infection in cystic fibrosis (CF) patients, with greater morbidity and mortality. Factors conferring persistence are largely unknown. Previously we analysed the transcriptomes of AES-1 grown in Luria broth, nematode growth medium for Caenorhabditis elegans assay (both aerobic) and artificial sputum medium (mainly hypoxic). Transcriptional comparisons included chronic AES-1 strains against PAO1 and acute AES-1 (AES-1R) against its chronic isogen (AES-1M), isolated 10.5 years apart from a CF patient and not eradicated in the meantime. Prominent amongst genes downregulated in AES-1M in all comparisons was homogentisate-1-2-dioxygenase (hmgA); an oxygen-dependent gene known to be mutationally deactivated in many chronic infection strains of P. aeruginosa. To investigate if hmgA downregulation and deactivation gave similar virulence persistence profiles, a hmgA mutant made in UCBPP-PA14 utilising RedS-recombinase and AES-1M were assessed in the C. elegans virulence assay, and the C57BL/6 mouse for pulmonary colonisation and TNF-α response. In C. elegans, hmgA deactivation resulted in significantly increased PA14 virulence while hmgA downregulation reduced AES-1M virulence. AES-1M was significantly more persistent in mouse lung and showed a significant increase in TNF-α (p<0.0001), sustained even with no detectable bacteria. PA14ΔhmgA did not show increased TNF-α. This study suggests that hmgA may have a role in P. aeruginosa persistence in chronic infection and the results provide a starting point for clarifying the role of hmgA in chronic AES-1. PMID:26252386

National Influenza Surveillance in the Philippines from 2006 to 2012: seasonality and circulating strains.

PubMed

Lucero, Marilla G; Inobaya, Marianette T; Nillos, Leilani T; Tan, Alvin G; Arguelles, Vina Lea F; Dureza, Christine Joy C; Mercado, Edelwisa S; Bautista, Analisa N; Tallo, Veronica L; Barrientos, Agnes V; Rodriguez, Tomas; Olveda, Remigio M

2016-12-19

The results of routine influenza surveillance in 13 regions in the Philippines from 2006 to 2012 are presented, describing the annual seasonal epidemics of confirmed influenza virus infection, seasonal and alert thresholds, epidemic curve, and circulating influenza strains. Retrospective analysis of Philippine influenza surveillance data from 2006 to 2012 was conducted to determine seasonality with the use of weekly influenza positivity rates and calculating epidemic curves and seasonal and alert thresholds using the World Health Organization (WHO) global epidemiological surveillance standards for influenza. Increased weekly influenza positive rates were observed from June to November, coinciding with the rainy season and school opening. Two or more peaks of influenza activity were observed with different dominant influenza types associated with each peak. A-H1N1, A-H3N2, and two types of B viruses circulated during the influenza season in varying proportions every year. Increased influenza activity for 2012 occurred 8 weeks late in week 29, rather than the expected week of rise of cases in week 21 as depicted in the established average epidemic curve and seasonal threshold. The intensity was severe going above the alert threshold but of short duration. Southern Hemisphere vaccine strains matched circulating influenza virus for more surveillance years than Northern Hemisphere vaccine strains. Influenza seasonality in the Philippines is from June to November. The ideal time to administer Southern Hemisphere influenza vaccine should be from April to May. With two lineages of influenza B circulating annually, quadrivalent vaccine might have more impact on influenza control than trivalent vaccine. Establishment of thresholds and average epidemic curve provide a tool for policy-makers to assess the intensity or severity of the current influenza epidemic even early in its course, to help plan more precisely resources necessary to control the outbreak. Influenza surveillance activities should be continued in the Philippines and funding for such activities should already be incorporated into the Philippine health budget.

Genotypic and phenotypic characterization of Chikungunya virus of different genotypes from Malaysia.

PubMed

Sam, I-Ching; Loong, Shih-Keng; Michael, Jasmine Chandramathi; Chua, Chong-Long; Wan Sulaiman, Wan Yusoff; Vythilingam, Indra; Chan, Shie-Yien; Chiam, Chun-Wei; Yeong, Yze-Shiuan; AbuBakar, Sazaly; Chan, Yoke-Fun

2012-01-01

Mosquito-borne Chikungunya virus (CHIKV) has recently re-emerged globally. The epidemic East/Central/South African (ECSA) strains have spread for the first time to Asia, which previously only had endemic Asian strains. In Malaysia, the ECSA strain caused an extensive nationwide outbreak in 2008, while the Asian strains only caused limited outbreaks prior to this. To gain insight into these observed epidemiological differences, we compared genotypic and phenotypic characteristics of CHIKV of Asian and ECSA genotypes isolated in Malaysia. CHIKV of Asian and ECSA genotypes were isolated from patients during outbreaks in Bagan Panchor in 2006, and Johor in 2008. Sequencing of the CHIKV strains revealed 96.8% amino acid similarity, including an unusual 7 residue deletion in the nsP3 protein of the Asian strain. CHIKV replication in cells and Aedes mosquitoes was measured by virus titration. There were no differences in mammalian cell lines. The ECSA strain reached significantly higher titres in Ae. albopictus cells (C6/36). Both CHIKV strains infected Ae. albopictus mosquitoes at a higher rate than Ae. aegypti, but when compared to each other, the ECSA strain had much higher midgut infection and replication, and salivary gland dissemination, while the Asian strain infected Ae. aegypti at higher rates. The greater ability of the ECSA strain to replicate in Ae. albopictus may explain why it spread far more quickly and extensively in humans in Malaysia than the Asian strain ever did, particularly in rural areas where Ae. albopictus predominates. Intergenotypic genetic differences were found at E1, E2, and nsP3 sites previously reported to be determinants of host adaptability in alphaviruses. Transmission of CHIKV in humans is influenced by virus strain and vector species, which has implications for regions with more than one circulating CHIKV genotype and Aedes species.

A diagnostic PCR assay for the detection of an Australian epidemic strain of Pseudomonas aeruginosa

PubMed Central

2010-01-01

Background Chronic lung infection with the bacterium Pseudomonas aeruginosa is one of the hallmarks of cystic fibrosis (CF) and is associated with worsening lung function, increased hospitalisation and reduced life expectancy. A virulent clonal strain of P. aeruginosa (Australian epidemic strain I; AES-I) has been found to be widespread in CF patients in eastern Australia. Methods Suppression subtractive hybridization (SSH) was employed to identify genetic sequences that are present in the AES-I strain but absent from the sequenced reference strain PAO1. We used PCR to evaluate the distribution of several of the AES-I loci amongst a collection of 188 P. aeruginosa isolates which was comprised of 35 AES-I isolates (as determined by PFGE), 78 non-AES-I CF isolates including other epidemic CF strains as well as 69 P. aeruginosa isolates from other clinical and environmental sources. Results We have identified a unique AES-I genetic locus that is present in all 35 AES-I isolates tested and not present in any of the other 153 P. aeruginosa strains examined. We have used this unique AES-I locus to develop a diagnostic PCR and a real-time PCR assay to detect the presence of P. aeruginosa and AES-I in patient sputum samples. Conclusions We have developed diagnostic PCR assays that are 100% sensitive and 100% specific for the P. aeruginosa strain AES-I. We have also shown that Whatman FTA® Elute cards may be used with PCR-based assays to rapidly detect the presence of P. aeruginosa strains in CF sputum. PMID:20637114

Phylogenetic analysis of dengue virus types 1 and 4 circulating in Puerto Rico and Key West, Florida, during 2010 epidemics.

PubMed

Añez, Germán; Heisey, Daniel A R; Espina, Luz M; Stramer, Susan L; Rios, Maria

2012-09-01

We describe sequences of six strains of dengue virus (DENV): three DENV-1 isolates and two DENV-4 isolates from Puerto Rico, and a DENV-1 strain from Key West, Florida, obtained from blood donors during 2010 epidemics. Phylogenetic analysis revealed that the Puerto Rico DENV-1 strains constitute a new lineage within genotype V different from those that circulated in Puerto Rico during the past two decades. The newer Puerto Rico DENV-1 strains associated with strains from the Caribbean and South America. The DENV-1 strain from Key West, Florida clustered with a strain isolated from mosquito pools collected in that area and with a number of strains from Nicaragua and Mexico circulating during 2006-2009. The Puerto Rico DENV-4 isolates of genotype II associated with strains that have circulated on the island throughout the 1980s and 1990s and with strains from the Caribbean region and Central America. Introduction and circulation of novel DENV lineages in dengue-endemic regions have the potential to increase the severity of dengue cases.

The HIV Epidemic: High-Income Countries

PubMed Central

Vermund, Sten H.; Leigh-Brown, Andrew J.

2012-01-01

The HIV epidemic in higher-income nations is driven by receptive anal intercourse, injection drug use through needle/syringe sharing, and, less efficiently, vaginal intercourse. Alcohol and noninjecting drug use increase sexual HIV vulnerability. Appropriate diagnostic screening has nearly eliminated blood/blood product-related transmissions and, with antiretroviral therapy, has reduced mother-to-child transmission radically. Affected subgroups have changed over time (e.g., increasing numbers of Black and minority ethnic men who have sex with men). Molecular phylogenetic approaches have established historical links between HIV strains from central Africa to those in the United States and thence to Europe. However, Europe did not just receive virus from the United States, as it was also imported from Africa directly. Initial introductions led to epidemics in different risk groups in Western Europe distinguished by viral clades/sequences, and likewise, more recent explosive epidemics linked to injection drug use in Eastern Europe are associated with specific strains. Recent developments in phylodynamic approaches have made it possible to obtain estimates of sequence evolution rates and network parameters for epidemics. PMID:22553497

Bordetella pertussis isolates in Finland: Serotype and fimbrial expression

PubMed Central

Heikkinen, Eriikka; Xing, Dorothy K; Ölander, Rose-Marie; Hytönen, Jukka; Viljanen, Matti K; Mertsola, Jussi; He, Qiushui

2008-01-01

Background Bordetella pertussis causes whooping cough or pertussis in humans. It produces several virulence factors, of which the fimbriae are considered adhesins and elicit immune responses in the host. B. pertussis has three distinct serotypes Fim2, Fim3 or Fim2,3. Generally, B. pertussis Fim2 strains predominate in unvaccinated populations, whereas Fim3 strains are often isolated in vaccinated populations. In Finland, pertussis vaccination was introduced in 1952. The whole-cell vaccine contained two strains, 18530 (Fim3) since 1962 and strain 1772 (Fim2,3) added in 1976. After that the vaccine has remained the same until 2005 when the whole-cell vaccine was replaced by the acellular vaccine containing pertussis toxin and filamentous hemagglutinin. Our aims were to study serotypes of Finnish B. pertussis isolates from 1974 to 2006 in a population with > 90% vaccination coverage and fimbrial expression of the isolates during infection. Serotyping was done by agglutination and serotype-specific antibody responses were determined by blocking ELISA. Results Altogether, 1,109 isolates were serotyped. Before 1976, serotype distributions of Fim2, Fim3 and Fim2,3 were 67%, 19% and 10%, respectively. From 1976 to 1998, 94% of the isolates were Fim2 serotype. Since 1999, the frequency of Fim3 strains started to increase and reached 83% during a nationwide epidemic in 2003. A significant increase in level of serum IgG antibodies against purified fimbriae was observed between paired sera of 37 patients. The patients infected by Fim3 strains had antibodies which blocked the binding of monoclonal antibodies to Fim3 but not to Fim2. Moreover, about one third of the Fim2 strain infected patients developed antibodies capable of blocking of binding of both anti-Fim2 and Fim3 monoclonal antibodies. Conclusion Despite extensive vaccinations in Finland, B. pertussis Fim2 strains were the most common serotype. Emergence of Fim3 strains started in 1999 and coincided with nationwide epidemics. Results of serotype-specific antibody responses suggest that Fim2 strains could express Fim3 during infection, showing a difference in fimbrial expression between in vivo and in vitro. PMID:18816412

Transmission of Hepatitis E Virus in Developing Countries

PubMed Central

Khuroo, Mohammad S.; Khuroo, Mehnaaz S.; Khuroo, Naira S.

2016-01-01

Hepatitis E virus (HEV), an RNA virus of the Hepeviridae family, has marked heterogeneity. While all five HEV genotypes can cause human infections, genotypes HEV-1 and -2 infect humans alone, genotypes HEV-3 and -4 primarily infect pigs, boars and deer, and genotype HEV-7 primarily infects dromedaries. The global distribution of HEV has distinct epidemiological patterns based on ecology and socioeconomic factors. In resource-poor countries, disease presents as large-scale waterborne epidemics, and few epidemics have spread through person-to-person contact; however, endemic diseases within these countries can potentially spread through person-to-person contact or fecally contaminated water and foods. Vertical transmission of HEV from infected mother to fetus causes high fetal and perinatal mortality. Other means of transmission, such as zoonotic transmission, can fluctuate depending upon the region and strain of the virus. For instance, zoonotic transmission can sometimes play an insignificant role in human infections, such as in India, where human and pig HEV infections are unrelated. However, recently China and Southeast Asia have experienced a zoonotic spread of HEV-4 from pigs to humans and this has become the dominant mode of transmission of hepatitis E in eastern China. Zoonotic HEV infections in humans occur by eating undercooked pig flesh, raw liver, and sausages; through vocational contact; or via pig slurry, which leads to environmental contamination of agricultural products and seafood. Lastly, blood transfusion-associated HEV infections occur in many countries and screening of donors for HEV RNA is currently under serious consideration. To summarize, HEV genotypes 1 and 2 cause epidemic and endemic diseases in resource poor countries, primarily spreading through contaminated drinking water. HEV genotypes 3 and 4 on the other hand, cause autochthonous infections in developed, and many developing countries, by means of a unique zoonotic food-borne transmission. PMID:27657112

Epidemiological characterizations, pathogen spectrum and molecular characteristics of Coxsackievirus A16 from patients with HFMD in Yantai, Shandong, China between 2011 and 2015

PubMed Central

Sun, Zhenlu; Zhang, Guifang; Guo, Peijun; Liu, Juan; Gao, Qiao; Xu, Xiaowen; Gong, Lianfeng

2017-01-01

ABSTRACT This study aimed to investigate the epidemiological characterizations and pathogen spectrum of hand, foot, and mouth disease (HFMD) in Yantai City, Shandong Province, China, during 2011–2015, and to study the nucleotide evolution and amino acid variation of coxsackievirus A16 (CV-A16) epidemic strains that caused HFMD. The HFMD epidemic began to rise in March, and became prevalent from May to August, reached its peak in June, and then declined in September every year, children aged one to 5 years-old had the highest incidence rate whereas the incidence in children under 6 months was very low, and there were more males than females. Enterovirus nucleic acid detection using real-time reverse transcription polymerase chain reaction was performed on 2130 clinical specimens collected from patients with HFMD between 2011 and 2015, and 2012 enterovirus positive samples were detected, including 678 CV-A16, 639 EV-A71, and 695 other enteroviruses. In total, 60 CV-A16 isolates were randomly selected each year for virus isolation, of which 33 CV-A16 strains were randomly selected for further characterization because CV-A16 is the predominant serotype that caused HFMD in Yantai City, and a phylogenetic tree based on the VP1 region was constructed. All 33 CV-A16 strains belonged to the Bla and B1b genotypes, with a nucleotide similarity of 87.9–100% and deduced amino acid similarity of 98.6–100%. Compared with the reference strain Tainan/5079/98 (AF177911), amino acid mutations were identified at positions 11, 23, 25, 31, 99, 145, and 289, where differences were observed among 33 strains, indicating a unique mutation map of CV-A16 in Yantai City. Our findings demonstrate the etiologic characteristics of HFMD, provide supporting evidence for the prevention and control of HFMD, and open a promising avenue for vaccine development against HFMD, by targeting CV-A16. PMID:28537484

Population-genomic insights into emergence, crop adaptation and dissemination of Pseudomonas syringae pathogens

PubMed Central

Monteil, Caroline L.; Yahara, Koji; Studholme, David J.; Mageiros, Leonardos; Méric, Guillaume; Swingle, Bryan; Morris, Cindy E.

2016-01-01

Many bacterial pathogens are well characterized but, in some cases, little is known about the populations from which they emerged. This limits understanding of the molecular mechanisms underlying disease. The crop pathogen Pseudomonas syringae sensu lato has been widely isolated from the environment, including wild plants and components of the water cycle, and causes disease in several economically important crops. Here, we compared genome sequences of 45 P. syringae crop pathogen outbreak strains with 69 closely related environmental isolates. Phylogenetic reconstruction revealed that crop pathogens emerged many times independently from environmental populations. Unexpectedly, differences in gene content between environmental populations and outbreak strains were minimal with most virulence genes present in both. However, a genome-wide association study identified a small number of genes, including the type III effector genes hopQ1 and hopD1, to be associated with crop pathogens, but not with environmental populations, suggesting that this small group of genes may play an important role in crop disease emergence. Intriguingly, genome-wide analysis of homologous recombination revealed that the locus Psyr 0346, predicted to encode a protein that confers antibiotic resistance, has been frequently exchanged among lineages and thus may contribute to pathogen fitness. Finally, we found that isolates from diseased crops and from components of the water cycle, collected during the same crop disease epidemic, form a single population. This provides the strongest evidence yet that precipitation and irrigation water are an overlooked inoculum source for disease epidemics caused by P. syringae. PMID:28348830

Population-genomic insights into emergence, crop adaptation and dissemination of Pseudomonas syringae pathogens.

PubMed

Monteil, Caroline L; Yahara, Koji; Studholme, David J; Mageiros, Leonardos; Méric, Guillaume; Swingle, Bryan; Morris, Cindy E; Vinatzer, Boris A; Sheppard, Samuel K

2016-10-01

Many bacterial pathogens are well characterized but, in some cases, little is known about the populations from which they emerged. This limits understanding of the molecular mechanisms underlying disease. The crop pathogen Pseudomonas syringae sensu lato has been widely isolated from the environment, including wild plants and components of the water cycle, and causes disease in several economically important crops. Here, we compared genome sequences of 45 P. syringae crop pathogen outbreak strains with 69 closely related environmental isolates. Phylogenetic reconstruction revealed that crop pathogens emerged many times independently from environmental populations. Unexpectedly, differences in gene content between environmental populations and outbreak strains were minimal with most virulence genes present in both. However, a genome-wide association study identified a small number of genes, including the type III effector genes hopQ1 and hopD1 , to be associated with crop pathogens, but not with environmental populations, suggesting that this small group of genes may play an important role in crop disease emergence. Intriguingly, genome-wide analysis of homologous recombination revealed that the locus Psyr 0346, predicted to encode a protein that confers antibiotic resistance, has been frequently exchanged among lineages and thus may contribute to pathogen fitness. Finally, we found that isolates from diseased crops and from components of the water cycle, collected during the same crop disease epidemic, form a single population. This provides the strongest evidence yet that precipitation and irrigation water are an overlooked inoculum source for disease epidemics caused by P. syringae .

SNR analysis: molecular investigation of an anthrax epidemic

PubMed Central

2010-01-01

Background In Italy, anthrax is endemic but occurs sporadically. During the summer of 2004, in the Pollino National Park, Basilicata, Southern Italy, an anthrax epidemic consisting of 41 outbreaks occurred; it claimed the lives of 124 animals belonging to different mammal species. This study is a retrospective molecular epidemiological investigation carried out on 53 isolates collected during the epidemic. A 25-loci Multiple Locus VNTR Analysis (MLVA) MLVA was initially performed to define genetic relationships, followed by an investigation of genetic diversity between epidemic strains through Single Nucleotide Repeat (SNR) analysis. Results 53 Bacillus anthracis strains were isolated. The 25-loci MLVA analysis identified all of them as belonging to a single genotype, while the SNR analysis was able to detect the existence of five subgenotypes (SGTs), allowing a detailed epidemic investigation. SGT-1 was the most frequent (46/53); SGTs 2 (4/53), 3 (1/53) 4 (1/53) and 5 (1/53) were detected in the remaining seven isolates. Conclusions The analysis revealed the prevalent spread, during this epidemic, of a single anthrax clone. SGT-1 - widely distributed across the epidemic area and present throughout the period in question - may, thus, be the ancestral form. SGTs 2, 3 and 4 differed from SGT-1 at only one locus, suggesting that they could have evolved directly from the latter during the course of this epidemic. SGT-5 differed from the other SGTs at 2-3 loci. This isolate, thus, appears to be more distantly related to SGT-1 and may not be a direct descendant of the lineage responsible for the majority of cases in this epidemic. These data confirm the importance of molecular typing and subtyping methods for in-depth epidemiological analyses of anthrax epidemics. PMID:20187980

Emergence and control of epidemic meningococcal meningitis in sub-Saharan Africa.

PubMed

Mohammed, Idris; Iliyasu, Garba; Habib, Abdulrazaq Garba

2017-02-01

For more than a century, meningitis epidemics have regularly recurred across sub-Saharan Africa, involving 19 contiguous countries that constitute a 'meningitis belt' where historically the causative agent has been serogroup A meningococcus. Attempts to control epidemic meningococcal meningitis in Africa by vaccination with meningococcal polysaccharide (PS) vaccines have not been successful. This is largely because PS vaccines are poorly immunogenic in young children, do not induce immunological memory, and have little or no effect on the pharyngeal carriage. Meningococcal PS-protein conjugate vaccines overcome these deficiencies. Conjugate meningococcal vaccine against serotype A (MenAfriVac) was developed between 2001 and 2009 and deployed in 2010. So far, 262 million individuals have been immunized across the meningitis belt. The public health benefits of MenAfriVac have already been demonstrated by a sharp decline in reported cases of meningococcal disease in the countries where it has been introduced. However, serogroup replacement following mass meningitis vaccination has been noted, and in 2015 an epidemic with a novel strain of serogroup C was recorded in Niger and Nigeria for the first time since 1975. This has posed a serious challenge toward elimination of meningococcal meningitis epidemics in the African. For an effective control of meningococcal meningitis in the African meningitis belt, there is a need for an effective surveillance system, provision of rapid antigen detection kits as well as affordable vaccine that provides protection against the main serogroups causing meningitis in the sub-region.

Herald waves of cholera in nineteenth century London.

PubMed

Tien, Joseph H; Poinar, Hendrik N; Fisman, David N; Earn, David J D

2011-05-06

Deaths from cholera in London, UK, were recorded weekly from 1824 to 1901. Three features of the time series stand out: (i) cholera deaths were strongly seasonal, with peak mortality almost always in the summer, (ii) the only non-summer outbreaks occurred in the spring of 1832, the autumn of 1848 and the winter of 1853, and (iii) extraordinarily severe summer outbreaks occurred in 1832, 1849, 1854 and 1866 (the four 'great' cholera years). The non-summer outbreaks of 1832, 1848 and 1853 appear to have been herald waves of newly invading cholera strains. In addition, a simple mathematical model confirms that a non-summer introduction of a new cholera strain can result in an initial herald wave, followed by a severe outbreak the following summer. Through the analysis of the genomes of nineteenth-century specimens, it may be possible to identify the strains that caused these herald waves and the well-known cholera epidemics that followed.

Identification of Novel Genomic Islands in Liverpool Epidemic Strain of Pseudomonas aeruginosa Using Segmentation and Clustering

PubMed Central

Jani, Mehul; Mathee, Kalai; Azad, Rajeev K.

2016-01-01

Pseudomonas aeruginosa is an opportunistic pathogen implicated in a myriad of infections and a leading pathogen responsible for mortality in patients with cystic fibrosis (CF). Horizontal transfers of genes among the microorganisms living within CF patients have led to highly virulent and multi-drug resistant strains such as the Liverpool epidemic strain of P. aeruginosa, namely the LESB58 strain that has the propensity to acquire virulence and antibiotic resistance genes. Often these genes are acquired in large clusters, referred to as “genomic islands (GIs).” To decipher GIs and understand their contributions to the evolution of virulence and antibiotic resistance in P. aeruginosa LESB58, we utilized a recursive segmentation and clustering procedure, presented here as a genome-mining tool, “GEMINI.” GEMINI was validated on experimentally verified islands in the LESB58 strain before examining its potential to decipher novel islands. Of the 6062 genes in P. aeruginosa LESB58, 596 genes were identified to be resident on 20 GIs of which 12 have not been previously reported. Comparative genomics provided evidence in support of our novel predictions. Furthermore, GEMINI unraveled the mosaic structure of islands that are composed of segments of likely different evolutionary origins, and demonstrated its ability to identify potential strain biomarkers. These newly found islands likely have contributed to the hyper-virulence and multidrug resistance of the Liverpool epidemic strain of P. aeruginosa. PMID:27536294

Distinct Host Tropism Protein Signatures to Identify Possible Zoonotic Influenza A Viruses.

PubMed

Eng, Christine L P; Tong, Joo Chuan; Tan, Tin Wee

2016-01-01

Zoonotic influenza A viruses constantly pose a health threat to humans as novel strains occasionally emerge from the avian population to cause human infections. Many past epidemic as well as pandemic strains have originated from avian species. While most viruses are restricted to their primary hosts, zoonotic strains can sometimes arise from mutations or reassortment, leading them to acquire the capability to escape host species barrier and successfully infect a new host. Phylogenetic analyses and genetic markers are useful in tracing the origins of zoonotic infections, but there are still no effective means to identify high risk strains prior to an outbreak. Here we show that distinct host tropism protein signatures can be used to identify possible zoonotic strains in avian species which have the potential to cause human infections. We have discovered that influenza A viruses can now be classified into avian, human, or zoonotic strains based on their host tropism protein signatures. Analysis of all influenza A viruses with complete proteome using the host tropism prediction system, based on machine learning classifications of avian and human viral proteins has uncovered distinct signatures of zoonotic strains as mosaics of avian and human viral proteins. This is in contrast with typical avian or human strains where they show mostly avian or human viral proteins in their signatures respectively. Moreover, we have found that zoonotic strains from the same influenza outbreaks carry similar host tropism protein signatures characteristic of a common ancestry. Our results demonstrate that the distinct host tropism protein signature in zoonotic strains may prove useful in influenza surveillance to rapidly identify potential high risk strains circulating in avian species, which may grant us the foresight in anticipating an impending influenza outbreak.

Methicillin-resistant Staphylococcus aureus, Western Australia

PubMed Central

Dailey, Lynne; Coombs, Geoffrey W.; O'Brien, Frances G.; Pearman, John W.; Christiansen, Keryn; Grubb, Warren B.

2005-01-01

Methicillin-resistant Staphylococcus aureus (MRSA) continues to be a notable cause of hospital-acquired infections. A statewide screening and control policy was implemented in Western Australia (WA) after an outbreak of epidemic MRSA in a Perth hospital in 1982. We report on statutory notifications from1998 to 2002 and review the 20-year period from 1983 to 2002. The rate of reporting of community-associated Western Australia MRSA (WAMRSA) escalated from 1998 to 2002 but may have peaked in 2001. Several outbreaks were halted, but they resulted in an increase in reports as a result of screening. A notable increase in ciprofloxacin resistance during the study period was observed as a result of more United Kingdom epidemic MRSA (EMRSA) -15 and -16. WA has seen a persistently low incidence of multidrug-resistant MRSA because of the screening and decolonization program. Non–multidrug-resistant, community-associated WAMRSA strains have not established in WA hospitals. PMID:16318700

Emergence of recombinant forms in geographic regions with co-circulating HIV subtypes in the dynamic HIV-1 epidemic

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Ming; Letiner, Thomas K; Korber, Bette T

2009-01-01

We have reexamined the subtype designations of {approx}10,000 subtype A, B, C, G, and AG, BC, BF recombinant sequences, and compared the results of the new analysis with their published designations. Intersubtype recombinants dominate HIV epidemics in three different geographical regions. The circulating recombinant from (CRF) CRF02-AG, common in West Central Africa, appears to result from a recombination event that occurred early in the divergence between subtypes A and G, although additional more recent recombination events may have contributed to the breakpoint pattern in this recombinant lineage as well. The Chinese recombinant epidemic strains CRF07 and CRF08, in contrast, resultmore » from recent recombinations between more contemporary strains. Nevertheless, CRF07 and CRF08 contributed to many subsequent recombination events. The BF recombinant epidemics in two HIV-1 epicenters in South America are not independent and BF epidemics in South America have an unusually high fraction of unique recombinant forms (URFs) that have each been found only once and carry distinctive breakpoints. Taken together, these analyses reveal a complex and dynamic picture of the current HIV-1 epidemic, and suggest a means of grouping and tracking relationships between viruses through preservation of shared breakpints.« less

Epidemic waves of cholera in the last two decades in Mozambique.

PubMed

Langa, José Paulo; Sema, Cynthia; De Deus, Nilsa; Colombo, Mauro Maria; Taviani, Elisa

2015-07-04

Africa is increasingly affected by cholera. In Mozambique, cholera appeared in the early 1970s when the seventh pandemic entered Africa from the Indian subcontinent. In the following decades, several epidemics were registered in the country, the 1997-1999 epidemic being the most extended. Since then, Mozambique has been considered an endemic area for cholera, characterized by yearly outbreaks occurring with a seasonal pattern. At least three pandemic variants are thought to have originated in the Indian subcontinent and spread worldwide at different times. To understand the epidemiology of cholera in Mozambique, whether the disease re-emerges periodically or is imported by different routes of transmission, we investigated clinical V. cholerae O1 isolated during 1997-1999 and 2012-2014 epidemics. By detecting and characterizing seven genetic elements, the mobilome profile of each isolate was obtained. By comparing it to known seventh pandemic reference strains, it was possible to discern among different V. cholerae O1 variants active in the country. During 1997-1999, epidemic strains showed two different genetic profiles, both related to a pandemic clone that originated from India and was reported in other African countries in the 1990s. Isolates from 2012-2014 outbreaks showed a genetic background related to the pandemic strains currently active as the prevalent causative agent of cholera worldwide. Despite cholera being endemic in Mozambique, the epidemiology of the disease in the past 20 years has been strongly influenced by the cholera seventh pandemic waves that originated in the Indian subcontinent.

A Reverse Genetics Platform That Spans the Zika Virus Family Tree.

PubMed

Widman, Douglas G; Young, Ellen; Yount, Boyd L; Plante, Kenneth S; Gallichotte, Emily N; Carbaugh, Derek L; Peck, Kayla M; Plante, Jessica; Swanstrom, Jesica; Heise, Mark T; Lazear, Helen M; Baric, Ralph S

2017-03-07

Zika virus (ZIKV), a mosquito-borne flavivirus discovered in 1947, has only recently caused large outbreaks and emerged as a significant human pathogen. In 2015, ZIKV was detected in Brazil, and the resulting epidemic has spread throughout the Western Hemisphere. Severe complications from ZIKV infection include neurological disorders such as Guillain-Barré syndrome in adults and a variety of fetal abnormalities, including microcephaly, blindness, placental insufficiency, and fetal demise. There is an urgent need for tools and reagents to study the pathogenesis of epidemic ZIKV and for testing vaccines and antivirals. Using a reverse genetics platform, we generated six ZIKV infectious clones and derivative viruses representing diverse temporal and geographic origins. These include three versions of MR766, the prototype 1947 strain (with and without a glycosylation site in the envelope protein), and H/PF/2013, a 2013 human isolate from French Polynesia representative of the virus introduced to Brazil. In the course of synthesizing a clone of a circulating Brazilian strain, phylogenetic studies identified two distinct ZIKV clades in Brazil. We reconstructed viable clones of strains SPH2015 and BeH819015, representing ancestral members of each clade. We assessed recombinant virus replication, binding to monoclonal antibodies, and virulence in mice. This panel of molecular clones and recombinant virus isolates will enable targeted studies of viral determinants of pathogenesis, adaptation, and evolution, as well as the rational attenuation of contemporary outbreak strains to facilitate the design of vaccines and therapeutics. IMPORTANCE Viral emergence is a poorly understood process as evidenced by the sudden emergence of Zika virus in Latin America and the Caribbean. Malleable reagents that both predate and span an expanding epidemic are key to understanding the virologic determinants that regulate pathogenesis and transmission. We have generated representative cDNA molecular clones and recombinant viruses that span the known ZIKV family tree, including early Brazilian isolates. Recombinant viruses replicated efficiently in cell culture and were pathogenic in immunodeficient mice, providing a genetic platform for rational vaccine and therapeutic design. Copyright © 2017 Widman et al.

MRSA virulence and spread

PubMed Central

Otto, Michael

2012-01-01

Summary Methicillin-resistant Staphylococcus aureus (MRSA) is one of the most frequent causes of hospital- and community-associated infections. Resistance to the entire class of β-lactam antibiotics, such as methicillin and penicillin, makes MRSA infections difficult to treat. Hospital-associated MRSA strains are often multi-drug resistant, leaving only lower efficiency drugs such as vancomycin as treatments options. Like many other S. aureus strains, MRSA strains produce a series of virulence factors, such as toxins and adhesion proteins. Recent findings have shed some new light on the molecular events that underlie MRSA epidemic waves. Newly emerging MRSA clones appear to have acquired phenotypic traits that render them more virulent or able to colonize better, either via mobile genetic elements or adaptation of gene expression. Acquisition of Panton-Valentine leukocidin genes and increased expression of core genome-encoded toxins are being discussed as potentially contributing to the success of the recently emerged community-associated MRSA strains. However, the molecular factors underlying the spread of hospital- and community-associated MRSA strains are still far from being completely understood, a situation calling for enhanced research efforts in that area. PMID:22747834

[The epidemiology and etiology research of Tibetan sheep plague in Qinghai plateau].

PubMed

Wei, Baiqing; Xiong, Haoming; Yang, Xiaoyan; Yang, Yonghai; Qi, Meiying; Jin, Juan; Xin, Youquan; Li, Xiang; Yang, Hanqing; Han, Xiumin; Dai, Ruixia

2015-03-01

To identify the epidemiology and etiology characteristics of Tibetan sheep plague in Qinghai plateau. The background materials of Qinghai Tibetan sheep plague found during 1975 to 2009 were summarized, the regional, time and interpersonal distribution, infection routes, ecological factors for the spread were used to analyze; followed by choosing 14 Yersinia pestis strains isolated from such sheep for biochemical test, toxicity test, virulence factors identification, plasmid analysis, and DFR genotype. From 1975 to 2009, 14 Yersinia pestis strains were isolated from Tibetan sheep in Qinghai province. Tibetan sheep, as the infection source, had caused 10 cases of human plague, 25 plague patients, and 13 cases of death. All of the initial cases were infected due to eating Tibetan sheep died of plague; followed by cases due to contact of plague patients, while all the initial cases were bubonic plague. Cases of bubonic plague developed into secondary pneumonic plague and septicemia plague were most popular and with high mortality. Most of the Tibetan sheep plague and human plague occurred in Gannan ecological zone in southern Gansu province, which was closely related to its unique ecological and geographical landscape. Tibetan sheep plague coincided with human plague caused by Tibetan sheep, especially noteworthy was that November (a time for marmots to start their dormancy) witnesses the number of Yersinia pestis strains isolated from Tibetan sheep and human plague cases caused by Tibetan sheep. This constituted the underlying cause that the epidemic time of Tibetan sheep plague lags obviously behind that of the Marmot plague. It was confirmed in the study that all the 14 strains were of Qinghai-Tibet Plateau ecotype, with virulence factors evaluation and toxicity test demonstrating strains as velogenic. As found in the (Different Region) DFR genotyping, the strains isolated from Yushu county and Zhiduo county were genomovar 5, the two strain isolated from Nangqian county were genomovar 5 and genomovar 7, while those isolated Delingha region were genomovar 8. Tibetan sheep were vulnerable to plague infection, hence causing human plague as the infectious source. The Yersinia pestis strains isolated from Tibetan sheep plague carried pathogen characteristics of Qinghai-Tibet plateau plague, developing many new characteristics of such plague.

High Incidence of Invasive Group A Streptococcus Disease Caused by Strains of Uncommon emm Types in Thunder Bay, Ontario, Canada

PubMed Central

Athey, Taryn B. T.; Teatero, Sarah; Sieswerda, Lee E.; Gubbay, Jonathan B.; Marchand-Austin, Alex; Li, Aimin; Wasserscheid, Jessica; Dewar, Ken; McGeer, Allison; Williams, David

2015-01-01

An outbreak of type emm59 invasive group A Streptococcus (iGAS) disease was declared in 2008 in Thunder Bay District, Northwestern Ontario, 2 years after a countrywide emm59 epidemic was recognized in Canada. Despite a declining number of emm59 infections since 2010, numerous cases of iGAS disease continue to be reported in the area. We collected clinical information on all iGAS cases recorded in Thunder Bay District from 2008 to 2013. We also emm typed and sequenced the genomes of all available strains isolated from 2011 to 2013 from iGAS infections and from severe cases of soft tissue infections. We used whole-genome sequencing data to investigate the population structure of GAS strains of the most frequently isolated emm types. We report an increased incidence of iGAS in Thunder Bay compared to the metropolitan area of Toronto/Peel and the province of Ontario. Illicit drug use, alcohol abuse, homelessness, and hepatitis C infection were underlying diseases or conditions that might have predisposed patients to iGAS disease. Most cases were caused by clonal strains of skin or generalist emm types (i.e., emm82, emm87, emm101, emm4, emm83, and emm114) uncommonly seen in other areas of the province. We observed rapid waxing and waning of emm types causing disease and their replacement by other emm types associated with the same tissue tropisms. Thus, iGAS disease in Thunder Bay District predominantly affects a select population of disadvantaged persons and is caused by clonally related strains of a few skin and generalist emm types less commonly associated with iGAS in other areas of Ontario. PMID:26491184

High Incidence of Invasive Group A Streptococcus Disease Caused by Strains of Uncommon emm Types in Thunder Bay, Ontario, Canada.

PubMed

Athey, Taryn B T; Teatero, Sarah; Sieswerda, Lee E; Gubbay, Jonathan B; Marchand-Austin, Alex; Li, Aimin; Wasserscheid, Jessica; Dewar, Ken; McGeer, Allison; Williams, David; Fittipaldi, Nahuel

2016-01-01

An outbreak of type emm59 invasive group A Streptococcus (iGAS) disease was declared in 2008 in Thunder Bay District, Northwestern Ontario, 2 years after a countrywide emm59 epidemic was recognized in Canada. Despite a declining number of emm59 infections since 2010, numerous cases of iGAS disease continue to be reported in the area. We collected clinical information on all iGAS cases recorded in Thunder Bay District from 2008 to 2013. We also emm typed and sequenced the genomes of all available strains isolated from 2011 to 2013 from iGAS infections and from severe cases of soft tissue infections. We used whole-genome sequencing data to investigate the population structure of GAS strains of the most frequently isolated emm types. We report an increased incidence of iGAS in Thunder Bay compared to the metropolitan area of Toronto/Peel and the province of Ontario. Illicit drug use, alcohol abuse, homelessness, and hepatitis C infection were underlying diseases or conditions that might have predisposed patients to iGAS disease. Most cases were caused by clonal strains of skin or generalist emm types (i.e., emm82, emm87, emm101, emm4, emm83, and emm114) uncommonly seen in other areas of the province. We observed rapid waxing and waning of emm types causing disease and their replacement by other emm types associated with the same tissue tropisms. Thus, iGAS disease in Thunder Bay District predominantly affects a select population of disadvantaged persons and is caused by clonally related strains of a few skin and generalist emm types less commonly associated with iGAS in other areas of Ontario. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Novel epidemic clones of Listeria monocytogenes, United States, 2011

USDA-ARS?s Scientific Manuscript database

This study determined whether four clinical and five food/environmental isolates associated with the 2011 U.S. cantaloupe listeriosis outbreak were previously identified outbreak strains, if they belonged to previously observed clonal complexes (CCs), to one of the five known epidemic clones (ECs) o...

Simple model of epidemics with pathogen mutation.

PubMed

Girvan, Michelle; Callaway, Duncan S; Newman, M E J; Strogatz, Steven H

2002-03-01

We study how the interplay between the memory immune response and pathogen mutation affects epidemic dynamics in two related models. The first explicitly models pathogen mutation and individual memory immune responses, with contacted individuals becoming infected only if they are exposed to strains that are significantly different from other strains in their memory repertoire. The second model is a reduction of the first to a system of difference equations. In this case, individuals spend a fixed amount of time in a generalized immune class. In both models, we observe four fundamentally different types of behavior, depending on parameters: (1) pathogen extinction due to lack of contact between individuals; (2) endemic infection; (3) periodic epidemic outbreaks; and (4) one or more outbreaks followed by extinction of the epidemic due to extremely low minima in the oscillations. We analyze both models to determine the location of each transition. Our main result is that pathogens in highly connected populations must mutate rapidly in order to remain viable.

[Circulating vaccine-derived poliovirus type 2 outbreak in Democratic Republic of Congo 2011-2012].

PubMed

Bazira, L; Coulibaly, T; Mayenga, M; Ncharre, C; Yogolelo, R; Mbule, A; Moudzeo, H; Lwamba, P; Mulumba, A W; Cabore, J

2015-10-01

According to the WHO records of 2013, the incidence of poliomyelitis was reduced by more than 99%, the number of endemic countries decreased from 125 in 1988 to 3 in 2013 and over 10 million cases were prevented from poliomyelitis thanks to the intensive use of Oral polio vaccine (OPV). However, the emergence of circulating vaccine-derived poliovirus strains (cVDPV), causing serious epidemics like the wild poliovirus, is a major challenge on the final straight towards the goal of eradication and OPV cessation. This paper describes the cVDPVoutbreak that occurred in the Democratic Republic of Congo (DRC) from November 2011 to April 2012. All children under 15 years of age with acute flaccid paralysis (AFP) and confirmed presence of cVDPV in the stool samples were included. Thirty (30) children, all from the administrative territories of Bukama and Malemba Nkulu in the Katanga Province (south-east DRC), were reported. The virus responsible was the cVDPV type 2 (0.7% -3.5% divergent from the reference Sabin 2 strain) in 29 children (97%) and the ambiguous vaccine-derived poliovirus strain (0.7% divergent) was confirmed in one case (3%), a boy seventeen months old and already vaccinated four times with OPV. Twentyfive children (83%) were protected by any of the routine EPI vaccines and 3 children (10%) had never received any dose of OPV. In reaction, DRC has conducted five local campaigns over a period of 10 months (from January to October 2012) and the epidemic was stopped after the second round performed in March 2012. As elsewhere in similar conditions, low immunization coverage, poor sanitation conditions and the stop of the use of OPV2 have favoured the emergence of the third cVDPV epidemic in DRC. The implementation of the Strategic Plan for Polio eradication and endgame strategic plan 2013-2018 will prevent the emergence of cVDPV and set up the conditions for a coordinated OPV phase out.

Genome sequence and comparative microarray analysis of serotype M18 group A Streptococcus strains associated with acute rheumatic fever outbreaks.

PubMed

Smoot, James C; Barbian, Kent D; Van Gompel, Jamie J; Smoot, Laura M; Chaussee, Michael S; Sylva, Gail L; Sturdevant, Daniel E; Ricklefs, Stacy M; Porcella, Stephen F; Parkins, Larye D; Beres, Stephen B; Campbell, David S; Smith, Todd M; Zhang, Qing; Kapur, Vivek; Daly, Judy A; Veasy, L George; Musser, James M

2002-04-02

Acute rheumatic fever (ARF), a sequelae of group A Streptococcus (GAS) infection, is the most common cause of preventable childhood heart disease worldwide. The molecular basis of ARF and the subsequent rheumatic heart disease are poorly understood. Serotype M18 GAS strains have been associated for decades with ARF outbreaks in the U.S. As a first step toward gaining new insight into ARF pathogenesis, we sequenced the genome of strain MGAS8232, a serotype M18 organism isolated from a patient with ARF. The genome is a circular chromosome of 1,895,017 bp, and it shares 1.7 Mb of closely related genetic material with strain SF370 (a sequenced serotype M1 strain). Strain MGAS8232 has 178 ORFs absent in SF370. Phages, phage-like elements, and insertion sequences are the major sources of variation between the genomes. The genomes of strain MGAS8232 and SF370 encode many of the same proven or putative virulence factors. Importantly, strain MGAS8232 has genes encoding many additional secreted proteins involved in human-GAS interactions, including streptococcal pyrogenic exotoxin A (scarlet fever toxin) and two uncharacterized pyrogenic exotoxin homologues, all phage-associated. DNA microarray analysis of 36 serotype M18 strains from diverse localities showed that most regions of variation were phages or phage-like elements. Two epidemics of ARF occurring 12 years apart in Salt Lake City, UT, were caused by serotype M18 strains that were genetically identical, or nearly so. Our analysis provides a critical foundation for accelerated research into ARF pathogenesis and a molecular framework to study the plasticity of GAS genomes.

Ten years of surveillance of the Yulong plague focus in China and the molecular typing and source tracing of the isolates.

PubMed

Wang, Peng; Shi, Liyuan; Zhang, Fuxin; Guo, Ying; Zhang, Zhikai; Tan, Hongli; Cui, Zhigang; Ding, Yibo; Liang, Ying; Liang, Yun; Yu, Dongzheng; Xu, Jianguo; Li, Wei; Song, Zhizhong

2018-03-01

Plague, caused by Yersinia pestis, was classified as a reemerging infectious disease by the World Health Organization. The five human pneumonic plague cases in Yulong County in 2005 gave rise to the discovery of a Yulong plague focus in Yunnan province, China. Thereafter, continuous wild rodent plague (sylvatic plague) was identified as the main plague reservoir of this focus. In this study, the epizootics in Yulong focus were described, and three molecular typing methods, including the different region (DFR) analysis, clustered regularly interspaced short palindromic repeats (CRISPRs), and the multiple-locus variable number of tandem repeats (VNTR) analysis (MLVA) (14+12), were used for the molecular typing and source tracing of Y. pestis isolates in the Yulong plague focus. Simultaneously, several isolates from the vicinity of Yunnan were used as controls. The results showed that during the 10-year period from 2006 to 2016, an animal plague epidemic occurred in 6 of those years, and 5 villages underwent an animal plague epidemic within a 30-km2 area of the Yulong plague focus. Searching for dead mice was the most effective monitoring method in this plague focus. No positive sample has been found in 6937 captured live rodents thus far, suggesting that the virulence of strains in the Yulong plague focus is stronger and the survival time of mice is shorter after infection. Strains from Lijiang, Sichuan and Tibet were of the same complex based on a typing analysis of DFR and CRISPR. The genetic relationship of Y. pestis illustrated by MLVA "14+12" demonstrates that Tibet and Sichuan strains evolved from the strains 1.IN2 (Qinghai, 1970 and Tibet, 1976), and Lijiang strains are closer to Batang strains (Batang County in Sichuan province, 2011, Himalaya marmot plague foci) in terms of genetic or phylogenic relationships. In conclusion, we have a deeper understanding of this new plague focus throughout this study, which provides a basis for effective prevention and control.

Clostridium difficile: a problem of concern in developed countries and still a mystery in Latin America.

PubMed

Balassiano, I T; Yates, E A; Domingues, R M C P; Ferreira, E O

2012-02-01

Clostridium difficile-associated disease (CDAD) is caused by a spore-forming bacterium and can result in highly variable disease, ranging from mild diarrhoea to severe clinical manifestations. Infections are most commonly seen in hospital settings and are often associated with on-going antibiotic therapy. Incidences of CDAD have shown a sustained increase worldwide over the last ten years and a hypervirulent C. difficile strain, PCR ribotype 027/REA type BI/North American pulsed-field (NAP) type 1 (027/BI/NAP-1), has caused outbreaks in North America and Europe. In contrast, only a few reports of cases in Latin America have been published and the hypervirulent strain 027/BI/NAP-1 has, so far, only been reported in Costa Rica. The potential worldwide spread of this infection calls for epidemiological studies to characterize currently circulating strains and also highlights the need for increased awareness and vigilance among healthcare professionals in currently unaffected areas, such as Latin America. This review attempts to summarize reports of C. difficile infection worldwide, especially in Latin America, and aims to provide an introduction to the problems associated with this pathogen for those countries that might face outbreaks of epidemic strains of C. difficile for the first time in the near future.

STUDIES OF ANTIGENIC DIFFERENCES AMONG STRAINS OF INFLUENZA A BY MEANS OF RED CELL AGGLUTINATION

PubMed Central

Hirst, George K.

1943-01-01

A study of cross inhibition tests among strains of influenza A virus and their antisera showed that the results obtained were subject to a certain amount of variation due to the red cells, the virus suspensions, and the ferret antisera employed. Methods have been demonstrated for handling the data obtained from such tests, so that these variables were corrected or avoided, making it possible to use the agglutination technique for antigenic comparisons. The antigenic pattern of eighteen strains of influenza A virus, obtained from the 1940–41 epidemic in the United States, has been compared by means of agglutination inhibition tests with ferret antisera. No significant antigenic differences were found among sixteen of these strains (all isolated from throat washings by the inoculation of chick embryos) although they were obtained from individuals in widely separated regions of the country. Two strains, from cases occurring early in the epidemic and isolated from throat washings by ferret and mouse passage, showed a slight but significant strain difference from the other strains and from each other. One of the 1940–41 strains on cross test resembled the PR8 strain more closely than any other stock strain tested. PMID:19871338

Porcine Epidemic Diarrhea in Europe: In-Detail Analyses of Disease Dynamics and Molecular Epidemiology.

PubMed

Hanke, Dennis; Pohlmann, Anne; Sauter-Louis, Carola; Höper, Dirk; Stadler, Julia; Ritzmann, Mathias; Steinrigl, Adi; Schwarz, Bernd-Andreas; Akimkin, Valerij; Fux, Robert; Blome, Sandra; Beer, Martin

2017-07-06

Porcine epidemic diarrhea (PED) is an acute and highly contagious enteric disease of swine caused by the eponymous virus (PEDV) which belongs to the genus Alphacoronavirus within the Coronaviridae virus family. Following the disastrous outbreaks in Asia and the United States, PEDV has been detected also in Europe. In order to better understand the overall situation, the molecular epidemiology, and factors that might influence the most variable disease impact; 40 samples from swine feces were collected from different PED outbreaks in Germany and other European countries and sequenced by shot-gun next-generation sequencing. A total of 38 new PEDV complete coding sequences were generated. When compared on a global scale, all investigated sequences from Central and South-Eastern Europe formed a rather homogeneous PEDV S INDEL cluster, suggesting a recent re-introduction. However, in-detail analyses revealed two new clusters and putative ancestor strains. Based on the available background data, correlations between clusters and location, farm type or clinical presentation could not be established. Additionally, the impact of secondary infections was explored using the metagenomic data sets. While several coinfections were observed, no correlation was found with disease courses. However, in addition to the PEDV genomes, ten complete viral coding sequences from nine different data sets were reconstructed each representing new virus strains. In detail, three pasivirus A strains, two astroviruses, a porcine sapelovirus, a kobuvirus, a porcine torovirus, a posavirus, and an enterobacteria phage were almost fully sequenced.

THE EXPERIMENTAL INFECTION OF THE HUMAN BODY LOUSE, PEDICULUS HUMANUS CORPORIS, WITH MURINE AND EPIDEMIC LOUSE-BORNE TYPHUS STRAINS

PubMed Central

Snyder, J. C.; Wheeler, C. M.

1945-01-01

Experiments are described which demonstrate that human body lice (Pediculus humanus corporis), were infected experimentally with murine and epidemic louse-borne strains of typhus fever by feeding on suitably prepared rabbits. Details of the two methods of infection, the "bleb technique" and the "I.V. technique," are presented. It is concluded that the experimental infection of human lice with typhus can be accomplished very easily and rapidly with these methods. The possible applications of the method are discussed. PMID:19871482

Genetic diversity of clinical and environmental isolates of Vibrio cholerae determined by amplified fragment length polymorphism fingerprinting.

PubMed

Jiang, S C; Matte, M; Matte, G; Huq, A; Colwell, R R

2000-01-01

Vibrio cholerae, the causative agent of major epidemics of diarrheal disease in Bangladesh, South America, Southeastern Asia, and Africa, was isolated from clinical samples and from aquatic environments during and between epidemics over the past 20 years. To determine the evolutionary relationships and molecular diversity of these strains, in order to understand sources, origin, and epidemiology, a novel DNA fingerprinting technique, amplified fragment length polymorphism (AFLP), was employed. Two sets of restriction enzyme-primer combinations were tested for fingerprinting of V. cholerae serogroup O1, O139, and non-O1, O139 isolates. Amplification of HindIII- and TaqI-digested genomic DNA produced 30 to 50 bands for each strain. However, this combination, although capable of separating environmental isolates of O1 and non-O1 strains, was unable to distinguish between O1 and O139 clinical strains. This result confirmed that clinical O1 and O139 strains are genetically closely related. On the other hand, AFLP analyses of restriction enzyme ApaI- and TaqI-digested genomic DNA yielded 20 to 30 bands for each strain, but were able to separate O1 from O139 strains. Of the 74 strains examined with the latter combination, 26 serogroup O1 strains showed identical banding patterns and were represented by the O1 El Tor strain of the seventh pandemic. A second group, represented by O139 Bengal, included 12 strains of O139 clinical isolates, with 7 from Thailand, 3 from Bangladesh, and 2 from India. Interestingly, an O1 clinical isolate from Africa also grouped with the O139 clinical isolates. Eight clinical O1 isolates from Mexico grouped separately from the O1 El Tor of the seventh pandemic, suggesting an independent origin of these isolates. Identical fingerprints were observed between an O1 environmental isolate from a river in Chile and an O1 clinical strain from Kenya, both isolated more than 10 years apart. Both strains were distinct from the O1 seventh pandemic strain. Two O139 clinical isolates from Africa clustered with environmental non-O1 isolates, independent of other O139 strains included in the study. These results suggest that although a single clone of pathogenic V. cholerae appears responsible for many cases of cholera in Asia, Africa, and Latin America during the seventh pandemic, other cases of clinical cholera were caused by toxigenic V. cholerae strains that appear to have been derived locally from environmental O1 or non-O1 strains.

Avian influenza A (H7N9) virus infection in humans: epidemiology, evolution, and pathogenesis.

PubMed

Husain, Matloob

2014-12-01

New human influenza A virus strains regularly emerge causing seasonal epidemics and occasional pandemics. Lately, several zoonotic avian influenza A strains have been reported to directly infect humans. In early 2013, a novel avian influenza A virus (H7N9) strain was discovered in China to cause severe respiratory disease in humans. Since then, over 450 human cases of H7N9 infection have been discovered and 165 of them have died. Multiple epidemiological, phylogenetic, in vivo, and in vitro studies have been done to determine the origin and pathogenesis of novel H7N9 strain. This article reviews the literature related to the epidemiology, evolution, and pathogenesis of the H7N9 strain since its discovery in February 2013 till August 2014. The data available so far indicate that H7N9 was originated by a two-step reassortment process in birds and transmitted to humans through direct contact with live-bird markets. H7N9 is a low-pathogenic avian virus and contains several molecular signatures for adaptation in mammals. The severity of the respiratory disease caused by novel H7N9 virus in humans can be partly attributed to the age, sex, and underlying medical conditions of the patients. A universal influenza vaccine is not available, though several strain-specific H7N9 candidate vaccine viruses have been developed. Further, novel H7N9 virus is resistant to antiviral drug amantadine and some H7N9 isolates have acquired the resistance to neuraminidase-inhibitors. Therefore, constant surveillance and prompt control measures combined with novel research approaches to develop alternative and effective anti-influenza strategies are needed to overcome influenza A virus. Copyright © 2014 Elsevier B.V. All rights reserved.

The dengue preface to endemic in mainland China: the historical largest outbreak by Aedes albopictus in Guangzhou, 2014.

PubMed

Luo, Lei; Jiang, Li-Yun; Xiao, Xin-Cai; Di, Biao; Jing, Qin-Long; Wang, Sheng-Yong; Tang, Jin-Ling; Wang, Ming; Tang, Xiao-Ping; Yang, Zhi-Cong

2017-09-22

Dengue was regarded as a mild epidemic in mainland China transmitted by Aedes albopictus. However, the 2014 record-breaking outbreak in Guangzhou could change the situation. In order to provide an early warning of epidemic trends and provide evidence for prevention and control strategies, we seek to characterize the 2014 outbreak through application of detailed cases and entomological data, as well as phylogenetic analysis of viral envelope (E) gene. We used case survey data identified through the Notifiable Infectious Disease Report System, entomological surveillance and population serosurvey, along with laboratory testing for IgM/IgG, NS1, and isolation of viral samples followed by E gene sequencing and phylogenetic analysis to examine the epidemiological and molecular characteristics of the outbreak. The 2014 dengue outbreak in Guangzhou accounted for nearly 80% of total reported cases that year in mainland China; a total of 37,376 cases including 37,340 indigenous cases with incidence rate 2908.3 per million and 36 imported cases were reported in Guangzhou, with 14,055 hospitalized and 5 deaths. The epidemic lasted for 193 days from June 11 to December 21, with the highest incidence observed in domestic workers, the unemployed and retirees. The inapparent infection rate was 18.00% (135/750). In total, 96 dengue virus 1 (DENV-1) and 11 dengue virus 2 (DENV-2) strains were isolated. Phylogenetic analysis indicated that the DENV-1 strains were divided into genotype I and V, similar to the strains isolated in Guangzhou and Dongguan in 2013. The DENV-2 strains isolated were similar to those imported from Thailand on May 11 in 2014 and that imported from Indonesia in 2012. The 2014 dengue epidemic was confirmed to be the first co-circulation of DENV-1 and DENV-2 in Guangzhou. The DENV-1 strain was endemic, while the DENV-2 strain was imported, being efficiently transmitted by the Aedes albopictus vector species at levels as high as Aedes aegypti.

Influenza: forecast for a pandemic.

PubMed

de la Barrera, Claudia Alvarado; Reyes-Terán, Gustavo

2005-01-01

Recently, great speculation about a possible influenza pandemic has been made. However, the facts supporting the possibility of this threat are less discussed. During the last decade highly pathogenic strains of avian influenza virus, including the H5N1 subtype, crossed the species barriers from birds to humans and caused fatal disease. The Z strain of H5N1 subtype is characterized by pathogenicity to a larger number of animal species and by resistance to the older class of antiviral drugs. At present, two out of three general conditions for the onset of a pandemic have been met; namely, the emergence of a new virus and its ability to replicate in humans causing serious illness. Should the virus achieve efficient human-to-human transmission, the next influenza pandemic might occur. This review addresses these biological and epidemiological aspects of influenza in the context of history and characteristics of previous epidemics, as well as concrete actions that can be undertaken considering current understanding of influenza pathogenesis, treatment, and control possibilities.

Molecular epidemiology of African sleeping sickness.

PubMed

Hide, G; Tait, A

2009-10-01

Human sleeping sickness in Africa, caused by Trypanosoma brucei spp. raises a number of questions. Despite the widespread distribution of the tsetse vectors and animal trypanosomiasis, human disease is only found in discrete foci which periodically give rise to epidemics followed by periods of endemicity A key to unravelling this puzzle is a detailed knowledge of the aetiological agents responsible for different patterns of disease--knowledge that is difficult to achieve using traditional microscopy. The science of molecular epidemiology has developed a range of tools which have enabled us to accurately identify taxonomic groups at all levels (species, subspecies, populations, strains and isolates). Using these tools, we can now investigate the genetic interactions within and between populations of Trypanosoma brucei and gain an understanding of the distinction between human- and nonhuman-infective subspecies. In this review, we discuss the development of these tools, their advantages and disadvantages and describe how they have been used to understand parasite genetic diversity, the origin of epidemics, the role of reservoir hosts and the population structure. Using the specific case of T.b. rhodesiense in Uganda, we illustrate how molecular epidemiology has enabled us to construct a more detailed understanding of the origins, generation and dynamics of sleeping sickness epidemics.

Origin and Evolution of the Kiwifruit Canker Pandemic

PubMed Central

Li, Li; Liu, Yifei; Li, Dawei; Pan, Hui; Zhong, Caihong; Rikkerink, Erik H.A.; Templeton, Matthew D.; Straub, Christina; Colombi, Elena

2017-01-01

Recurring epidemics of kiwifruit (Actinidia spp.) bleeding canker disease are caused by Pseudomonas syringae pv. actinidiae (Psa). In order to strengthen understanding of population structure, phylogeography, and evolutionary dynamics, we isolated Pseudomonas from cultivated and wild kiwifruit across six provinces in China. Based on the analysis of 80 sequenced Psa genomes, we show that China is the origin of the pandemic lineage but that strain diversity in China is confined to just a single clade. In contrast, Korea and Japan harbor strains from multiple clades. Distinct independent transmission events marked introduction of the pandemic lineage into New Zealand, Chile, Europe, Korea, and Japan. Despite high similarity within the core genome and minimal impact of within-clade recombination, we observed extensive variation even within the single clade from which the global pandemic arose. PMID:28369338

[Persistence of Pseudomonas aeruginosa strains in patients of Federal Scientific Center of Transplantology and Artificial Organs].

PubMed

Avetisian, L R; Voronina, O L; Chernukha, M Iu; Kunda, M S; Gabrielian, N I; Lunin, V G; Shaginian, I A

2012-01-01

Study genetic diversity of P. aeruginosa strains persisting in patients of Federal Scientific Center of Transplantology and Artificial Organs, and main factors facilitating persistence of strains in the hospital. 136 P. aeruginosa strains isolated from patients of the center for 3 years 6 months were genotyped by RAPD-PCR and MLST methods and studied for antibiotics resistance and presence of integrons. Genetic diversity of strains persisting in hospital was established. Strains of main genotypes ST235, ST446, ST598 were isolated from patients of various surgical departments. Patients were shown to be colonized by these strains during stay in reanimation and intensive therapy department (RITD) of the hospital. Strains of dominant genotype 235 were isolated from 47% of examined patients during more than 3 years. Only genotype 235 strains contained integron with cassettes of antibiotics resistance genes blaGES5 and aadA6 in the genome. The data obtained show that over the period of observation in the center 1 clone of P. aeruginosa that belonged to genotype 235 dominated. This clone was endemic for this hospital and in the process of prolonged persistence became more resistant to antibiotics. Colonization of patients with these strains occurs in RITD. This confirms the necessity of constant monitoring of hospital microflora for advance detection of potentially dangerous epidemic hospital strains able to cause hospital infections.

Genetic Diversity and Population Structure of Vibrio cholerae

PubMed Central

Beltrán, Pilar; Delgado, Gabriela; Navarro, Armando; Trujillo, Francisca; Selander, Robert K.; Cravioto, Alejandro

1999-01-01

Multilocus enzyme electrophoresis (MLEE) of 397 Vibrio cholerae isolates, including 143 serogroup reference strains and 244 strains from Mexico and Guatemala, identified 279 electrophoretic types (ETs) distributed in two major divisions (I and II). Linkage disequilibrium was demonstrated in both divisions and in subdivision Ic of division I but not in subdivision Ia, which includes 76% of the ETs. Despite this evidence of relatively frequent recombination, clonal lineages may persist for periods of time measured in at least decades. In addition to the pandemic clones of serogroups O1 and O139, which form a tight cluster of four ETs in subdivision Ia, MLEE analysis identified numerous apparent clonal lineages of non-O1 strains with intercontinental distributions. A clone of serogroup O37 that demonstrated epidemic potential in the 1960s is closely related to the pandemic O1/O139 clones, but the nontoxigenic O1 Inaba El Tor reference strain is not. A strain of serogroup O22, which has been identified as the most likely donor of exogenous rfb region DNA to the O1 progenitor of the O139 clone, is distantly related to the O1/O139 clones. The close evolutionary relationships of the O1, O139, and O37 epidemic clones indicates that new cholera clones are likely to arise by the modification of a lineage that is already epidemic or is closely related to such a clone. PMID:9986816

Genetic diversity and population structure of Vibrio cholerae.

PubMed

Beltrán, P; Delgado, G; Navarro, A; Trujillo, F; Selander, R K; Cravioto, A

1999-03-01

Multilocus enzyme electrophoresis (MLEE) of 397 Vibrio cholerae isolates, including 143 serogroup reference strains and 244 strains from Mexico and Guatemala, identified 279 electrophoretic types (ETs) distributed in two major divisions (I and II). Linkage disequilibrium was demonstrated in both divisions and in subdivision Ic of division I but not in subdivision Ia, which includes 76% of the ETs. Despite this evidence of relatively frequent recombination, clonal lineages may persist for periods of time measured in at least decades. In addition to the pandemic clones of serogroups O1 and O139, which form a tight cluster of four ETs in subdivision Ia, MLEE analysis identified numerous apparent clonal lineages of non-O1 strains with intercontinental distributions. A clone of serogroup O37 that demonstrated epidemic potential in the 1960s is closely related to the pandemic O1/O139 clones, but the nontoxigenic O1 Inaba El Tor reference strain is not. A strain of serogroup O22, which has been identified as the most likely donor of exogenous rfb region DNA to the O1 progenitor of the O139 clone, is distantly related to the O1/O139 clones. The close evolutionary relationships of the O1, O139, and O37 epidemic clones indicates that new cholera clones are likely to arise by the modification of a lineage that is already epidemic or is closely related to such a clone.

HSV-1/HSV-2 Infection-Related Cancers in Bantu Populations Driving HIV-1 Prevalence in Africa: Tracking the Origin of AIDS at the Onset of the 20th Century.

PubMed

Le Goaster, Jacqueline; Bouree, Patrice; El Sissy, Franck N; Phuong Bui, Florence; Pokossy Epee, Johanna; Rollin, Paul; Tangy, Frédéric; Haenni, Anne-Lise

2016-01-01

At the onset of the 20th century, ancient clinical observations of cancer epidemics in Bantu populations of Sub-Saharan Africa were discovered. They were reported from 1914 to 1960, but remained unexplained. In 1983, in San Francisco, Calif., USA, cancer epidemics were related to infections by the human immunodeficiency virus type 1 (HIV-1) known as AIDS disease. Yet since 1996, it is known that HIV-1 strains are not the only ones involved. In Sub-Saharan Africa, recurrent orobuccal herpes simplex virus type 1 (HSV-1) and genital recurrent herpes simplex virus type 2 (HSV-2) appeared many times prior to infection by HIV-1. Data on these ancient medical observations regarding African cancer epidemics can today be referred to as the relationship between the unfortunate immune deficiency of herpes in Bantu populations and HIV-1 viral strains. For centuries, the Bantu populations dispersed in forests were living in close proximity to chimpanzees infected by simian immunodeficiency virus (SIV) and were exposed to SIV contamination which became HIV-1 in human beings. Presently, these unexplained Bantu cancer epidemics can be linked to the viral partnership of HSV-1/HSV-2 to HIV-1 strains. The key issue is now to prevent HSV-1/HSV-2 diseases related to HIV-1. An anti-herpes treatment administered early during childhood to Bantu populations will offer a mean of preventing herpes diseases related to HIV-1 infection and hence avoid cancer epidemics.

HSV-1/HSV-2 Infection-Related Cancers in Bantu Populations Driving HIV-1 Prevalence in Africa: Tracking the Origin of AIDS at the Onset of the 20th Century

PubMed Central

Le Goaster, Jacqueline; Bouree, Patrice; El Sissy, Franck N.; Phuong Bui, Florence; Pokossy Epee, Johanna; Rollin, Paul; Tangy, Frédéric; Haenni, Anne-Lise

2016-01-01

Introduction At the onset of the 20th century, ancient clinical observations of cancer epidemics in Bantu populations of Sub-Saharan Africa were discovered. They were reported from 1914 to 1960, but remained unexplained. In 1983, in San Francisco, Calif., USA, cancer epidemics were related to infections by the human immunodeficiency virus type 1 (HIV-1) known as AIDS disease. Yet since 1996, it is known that HIV-1 strains are not the only ones involved. In Sub-Saharan Africa, recurrent orobuccal herpes simplex virus type 1 (HSV-1) and genital recurrent herpes simplex virus type 2 (HSV-2) appeared many times prior to infection by HIV-1. Case Reports Data on these ancient medical observations regarding African cancer epidemics can today be referred to as the relationship between the unfortunate immune deficiency of herpes in Bantu populations and HIV-1 viral strains. For centuries, the Bantu populations dispersed in forests were living in close proximity to chimpanzees infected by simian immunodeficiency virus (SIV) and were exposed to SIV contamination which became HIV-1 in human beings. Presently, these unexplained Bantu cancer epidemics can be linked to the viral partnership of HSV-1/HSV-2 to HIV-1 strains. Conclusion The key issue is now to prevent HSV-1/HSV-2 diseases related to HIV-1. An anti-herpes treatment administered early during childhood to Bantu populations will offer a mean of preventing herpes diseases related to HIV-1 infection and hence avoid cancer epidemics. PMID:28413399

Streptococcus pyogenes and re-emergence of scarlet fever as a public health problem.

PubMed

Wong, Samson Sy; Yuen, Kwok-Yung

2012-07-01

Explosive outbreaks of infectious diseases occasionally occur without immediately obvious epidemiological or microbiological explanations. Plague, cholera and Streptococcus pyogenes infection are some of the epidemic-prone bacterial infections. Besides epidemiological and conventional microbiological methods, the next-generation gene sequencing technology permits prompt detection of genomic and transcriptomic profiles associated with invasive phenotypes. Horizontal gene transfer due to mobile genetic elements carrying virulence factors and antimicrobial resistance, or mutations associated with the two component CovRS operon are important bacterial factors conferring survival advantage or invasiveness. The high incidence of scarlet fever in children less than 10 years old suggests that the lack of protective immunity is an important host factor. A high population density, overcrowded living environment and a low yearly rainfall are environmental factors contributing to outbreak development. Inappropriate antibiotic use is not only ineffective for treatment, but may actually drive an epidemic caused by drug-resistant strains and worsen patient outcomes by increasing the bacterial density at the site of infection and inducing toxin production. Surveillance of severe S. pyogenes infection is important because it can complicate concurrent chickenpox and influenza. Concomitant outbreaks of these two latter infections with a highly virulent and drug-resistant S. pyogenes strain can be disastrous.

Streptococcus pyogenes and re-emergence of scarlet fever as a public health problem

PubMed Central

Wong, Samson SY; Yuen, Kwok-Yung

2012-01-01

Explosive outbreaks of infectious diseases occasionally occur without immediately obvious epidemiological or microbiological explanations. Plague, cholera and Streptococcus pyogenes infection are some of the epidemic-prone bacterial infections. Besides epidemiological and conventional microbiological methods, the next-generation gene sequencing technology permits prompt detection of genomic and transcriptomic profiles associated with invasive phenotypes. Horizontal gene transfer due to mobile genetic elements carrying virulence factors and antimicrobial resistance, or mutations associated with the two component CovRS operon are important bacterial factors conferring survival advantage or invasiveness. The high incidence of scarlet fever in children less than 10 years old suggests that the lack of protective immunity is an important host factor. A high population density, overcrowded living environment and a low yearly rainfall are environmental factors contributing to outbreak development. Inappropriate antibiotic use is not only ineffective for treatment, but may actually drive an epidemic caused by drug-resistant strains and worsen patient outcomes by increasing the bacterial density at the site of infection and inducing toxin production. Surveillance of severe S. pyogenes infection is important because it can complicate concurrent chickenpox and influenza. Concomitant outbreaks of these two latter infections with a highly virulent and drug-resistant S. pyogenes strain can be disastrous. PMID:26038416

Inter-laboratory study to characterize the detection of serum antibodies against porcine epidemic diarrhoea virus.

PubMed

Strandbygaard, Bertel; Lavazza, Antonio; Lelli, Davide; Blanchard, Yannick; Grasland, Béatrice; Poder, Sophie Le; Rose, Nicolas; Steinbach, Falko; van der Poel, Wim H M; Widén, Frederik; Belsham, Graham J; Bøtner, Anette

2016-12-25

Porcine epidemic diarrhea virus (PEDV) has caused extensive economic losses to pig producers in many countries. It was recently introduced, for the first time, into North America and outbreaks have occurred again in multiple countries within Europe as well. To assess the properties of various diagnostic assays for the detection of PEDV infection, multiple panels of porcine sera have been shared and tested for the presence of antibodies against PEDV in an inter-laboratory ring trial. Different laboratories have used a variety of "in house" ELISAs and also one commercial assay. The sensitivity and specificity of each assay has been estimated using a Bayesian analysis applied to the ring trial results obtained with the different assays in the absence of a gold standard. Although different characteristics were found, it can be concluded that each of the assays used can detect infection of pigs at a herd level by either the early European strains of PEDV or the recently circulating strains (INDEL and non-INDEL). However, not all the assays seem suitable for demonstrating freedom from disease in a country. The results from individual animals, especially when the infection has occurred within an experimental situation, show more variation. Copyright © 2016. Published by Elsevier B.V.

Genomic Structural Variations Affecting Virulence During Clonal Expansion of Pseudomonas syringae pv. actinidiae Biovar 3 in Europe.

PubMed

Firrao, Giuseppe; Torelli, Emanuela; Polano, Cesare; Ferrante, Patrizia; Ferrini, Francesca; Martini, Marta; Marcelletti, Simone; Scortichini, Marco; Ermacora, Paolo

2018-01-01

Pseudomonas syringae pv. actinidiae (Psa) biovar 3 caused pandemic bacterial canker of Actinidia chinensis and Actinidia deliciosa since 2008. In Europe, the disease spread rapidly in the kiwifruit cultivation areas from a single introduction. In this study, we investigated the genomic diversity of Psa biovar 3 strains during the primary clonal expansion in Europe using single molecule real-time (SMRT), Illumina and Sanger sequencing technologies. We recorded evidences of frequent mobilization and loss of transposon Tn6212, large chromosome inversions, and ectopic integration of IS sequences (remarkably ISPsy31, ISPsy36, and ISPsy37). While no phenotype change associated with Tn6212 mobilization could be detected, strains CRAFRU 12.29 and CRAFRU 12.50 did not elicit the hypersensitivity response (HR) on tobacco and eggplant leaves and were limited in their growth in kiwifruit leaves due to insertion of ISPsy31 and ISPsy36 in the hrpS and hrpR genes, respectively, interrupting the hrp cluster. Both strains had been isolated from symptomatic plants, suggesting coexistence of variant strains with reduced virulence together with virulent strains in mixed populations. The structural differences caused by rearrangements of self-genetic elements within European and New Zealand strains were comparable in number and type to those occurring among the European strains, in contrast with the significant difference in terms of nucleotide polymorphisms. We hypothesize a relaxation, during clonal expansion, of the selection limiting the accumulation of deleterious mutations associated with genome structural variation due to transposition of mobile elements. This consideration may be relevant when evaluating strategies to be adopted for epidemics management.

Cross-protective efficacy of engineering serotype A foot-and-mouth disease virus vaccine against the two pandemic strains in swine.

PubMed

Zheng, Haixue; Lian, Kaiqi; Yang, Fan; Jin, Ye; Zhu, Zixiang; Guo, Jianhong; Cao, Weijun; Liu, Huanan; He, Jijun; Zhang, Keshan; Li, Dan; Liu, Xiangtao

2015-10-26

Foot-and-mouth disease (FMD) is a highly contagious vesicular disease that affects domestic and wild cloven-hoofed animals worldwide. Recently, a series of outbreaks of type A FMDV occurred in Southeast Asian countries, China, the Russia Federation, Mongolia, Kazakhstan and South Korea. The FMD virus (A/GDMM/CHA/2013) from China's Guangdong province (2013) is representative of those responsible for the latest epidemic, and has low amino acid identity (93.9%) in VP1 protein with the epidemic strain A/WH/CHA/09 from Wuhan, China in 2009. Both of isolates belong to the Sea-97 genotype of ASIA topotype. Therefore, the application of a new vaccine strain with cross-protective efficacy is of fundamental importance to control the spread of the two described pandemic strains. A chimeric strain rA/P1-FMDV constructed by our lab previously through replacing the P1 gene in the vaccine strain O/CHA/99 with that from the epidemic stain A/WH/CHA/09, has been demonstrated to exhibit good growth characteristics in culture, and the rA/P1-FMDV inactivated vaccine can provide protection against epidemic strain A/WH/CHA/09 in cattle. However, it is still unclear whether the vaccine produces efficient protection against the new pandemic strain (A/GDMM/CHA/2013). Here, vaccine matching and pig 50% protective dose (PD50) tests were performed to assess the vaccine potency. The vaccine matching test showed cross-reactivity of sera from full dose vaccine vaccinated pigs with A/WH/CHA/09 and A/GDMM/CHA/2013 isolates, with average r1 values of 0.94±0.12 and 0.68±0.06 (r1≥0.3), which indicates that the rA/P1-FMDV vaccine is likely to confer good cross-protection against the two isolates. When challenged with two pandemic isolates A/WH/CHA/09 and A/GDMM/CHA/2013 strain, the vaccine achieved 12.51 PD50 and 10.05 PD50 per dose (2.8μg), respectively. The results indicated that the rA/P1-FMDV inactivated vaccine could protect pigs against both A/WH/CHA/09 and A/GDMM/CHA/2013 pandemic isolates. Copyright © 2015 Elsevier Ltd. All rights reserved.

[Study on the etiological and molecular characteristics of aseptic meningitis epidemic in Zhejiang Province in 2002-2004].

PubMed

Yan, Ju-Ying; Lu, Yi-Yu; Xu, Chang-Ping; Yu, Zhao; Gong, Li-Ming; Chen, Yin; Zhang, Yan-Jun

2011-09-01

In order to confirm the cause of the outbreak of aseptic meningitis in Zhejiang Province in 2002-2004, trace the pathogen and analyze the molecular characteristics, 271 cerebrospinal fluid (CSF) and faeces specimens were collected from suspected patients. The virus strains from the specimens were isolated with RD and Hep-2 cell lines. The VP1 and VP4/VP2 genes of the isolated viruses were sequenced, and their phylogenetic and homology trees were also constructed. Of the total 271 samples, 78 Echovirus type 30 (E30) strains were isolated. All of the complete VP1 genes in 31 sequenced virus isolates of E30 were composed of 876 nt without any insertion or deletion, encoding 292 amino acids (aa). The identity of nucleotide and amino acid in VP1 gene were 84.7%-86.3% and 92.1%-94.2% between the 31 Zhejiang strains and the prototype strain Bastianni of E30, and 87.1%-99.4% and 96.2%-100% among the 31 Zhejiang strains, respectively. The Zhejiang strains of E30 in the phylogenetic tree of the VP1 gene were attributed into two branches of the G and H genotype, respectively. In G genotype, the Shangdong and Jiangsu E30 strains in 2003 among domestic strains and Ukraine E30 strain in 1999 among overseas strains had maximum similarity with the Zhejiang strains, while H genotype had maximum similarity with the Korea E30 strains in 2008. The phylogenetic tree of the VP4/VP2 genes was similar to that of VP1 gene. The results indicated that the outbreak of aseptic meningitis in Zhejiang Provinec in 2002-2004 was caused by the G and H genotypes of E30 strains existing simultaneously. The H genotype was a new variant strain, which was first isolated in Zhejiang Province in 2002.

Cholera epidemic among Rwandan refugees: experience of ICDDR,B in Goma, Zaire.

PubMed

Siddique, A K

1994-01-01

In July 1994, one of the worst cholera epidemics broke out among the nearly a million Rwandan refugees in Goma, eastern Zaire. The United Nations High Commission for Refugees estimated that nearly 12,000 people died during the epidemic. The International Centre for Diarrhoeal Disease Research, Bangladesh (ICDDR,B) sent an eight-member medical team to Goma headed by Dr AK Siddique, a senior scientist of the Center and head of the Epidemic Control Preparedness Program, Dacca, Bangladesh. During their two-week stay, the team, in collaboration with UNICEF and the Ministry of Health, Zaire, conducted epidemiological assessment, operated a temporary treatment center and provided technical advice on case management of cholera and shigellosis to other health workers. The team also set up a microbiology laboratory in Goma to identify the pathogens responsible for the epidemic and their drug sensitivity patterns. The team visited a number of temporary treatment facilities in two of the five camp sites and provided technical advice to the health-care providers. They also visited treatment facilities in Goma city, where an estimated 200,000 refugees were affected by the epidemic. Deaths from cholera even in the treatment centers were much higher than expected. The overall case-fatality rate in the treatment centers was nearly 15%. Laboratory investigations showed that the initial epidemic was indeed caused by Vibrio cholerae strains resistant to tetracycline and doxycycline. By the first week of August, the number of cholera cases was declining, but the number of dysentery cases was increasing rapidly. Predominantly Shigella dysenteriae type 1 was responsible, which was resistant to most drugs used for treating shigellosis, except mecillinam. Inappropriate rehydration therapy and inadequate experience of health workers failed to prevent deaths. The team took over the operation of temporary treatment center at Katindo in Goma city with one of the highest case-fatality rates (14.5%) and could reduce the fatality rate to less than 1%.

Detection, differentiation, and VP1 sequencing of duck hepatitis A virus type 1 and type 3 by a 1-step duplex reverse-transcription PCR assay.

PubMed

Wen, X J; Cheng, A C; Wang, M S; Jia, R Y; Zhu, D K; Chen, S; Liu, M F; Liu, F; Chen, X Y

2014-09-01

Duck hepatitis A virus (DHAV) is an infectious pathogen causing fatal duck viral hepatitis in ducklings. Although both the inactivated vaccines and live attenuated vaccines have been used to protect ducklings, DHAV-1 and DHAV-3 still cause significant serious damage to the duck industry in China and South Korea. For rapid detection, differentiation, and epidemic investigation of DHAV in China, a genotype-specific 1-step duplex reverse-transcription (RT) PCR assay was established in this study. The sensitivity and specificity of the developed RT-PCR assay was evaluated with nucleic acids extracted from 2 DHAV reference strains, and 9 other infectious viruses and bacteria. The genotype-specific primers amplified different size DNA fragments encompassing the complete VP1 gene of the DHAV-1 or DHAV-3. The assay detected the liver samples collected from experimentally infected ducklings and dead ducklings collected from different regions of China. Sequence analysis of these DNA fragments indicated that VP1 sequences of DHAV-1 can be used to distinguish wild type and vaccine strains. The phylogenetic analysis of VP1 sequences indicated that the developed RT-PCR assay can be used for epidemic investigation of DHAV-1 and DHAV-3. The developed RT-PCR assay can be used as a specific molecular tool for simultaneous detection, differentiation, and sequencing the VP1 gene of DHAV-1 and DHAV-3, which can be used for understanding the epidemiology and evolution of DHAV. © 2014 Poultry Science Association Inc.

Norovirus genotypes causing gastroenteritis outbreaks in Finland 1998-2002.

PubMed

Maunula, L; Von Bonsdorff, C-H

2005-11-01

Outbreak investigation methods for enteric viruses were improved in 1990s when gene amplification techniques were established in viral laboratories. The objective of the study was to determine the causative agents for Finnish viral gastroenteritis outbreaks. Our aim was also to further characterise the norovirus strains, reveal the temporal occurrence of norovirus (NV) genotypes and to study some epidemiological aspects concerning the outbreaks. A total of 416 Finnish viral gastroenteritis outbreaks that occurred during 5 years (1998-2002), excluding those among hospitalised children, were investigated for enteric viruses. Stool samples were screened by electron microscopy as well as analyzed by specific noro- and astrovirus RT-PCR tests. Amplicon sequence analysis was used to find out norovirus genotypes. Noroviruses caused 252 (60.6%) of the outbreaks; other viruses, astro- or rotavirus, caused four epidemics. Norovirus epidemics occurred in all kinds of settings, most often in hospitals (30.6%) and in restaurants and canteens (14.3%). Both NV genogroups were found every year, but NV GGII outbreaks always outnumbered those of GGI. All but one outbreak at hospitals and nursing homes were of genotype GII. Polymerase sequence analysis revealed a variety of NV genotypes; six GI and at least eight GII genotypes. The GI.3 Birmingham-like and GII.4 Bristol-like genotype appeared every year, whereas the other types were circulating for shorter periods or sporadically. During the study period the genotypes GII.4 (Bristol), GII.1 (Hawaii), an emerging genotype GIIb, and a new variant of GII.4 predominated in that order. Indication for rapid genetic changes in the genotype GII.4 was also noticed. Noroviruses were the most prevalent causative agents in the outbreaks. Many NV genotypes were circulating, and a shift in the predominant genotypes was evident between epidemic seasons.

Epidemiology of rubella and congenital rubella syndrome in Japan before 1989.

PubMed

Ueda, Kohji

2016-04-07

Epidemiological studies of rubella and congenital rubella syndrome (CRS) in Japan have been conducted since the first nationwide rubella epidemic of 1965-1969 and subsequent epidemics of 1975-1977, 1982, 1987-1988, and 1992-1993. Rubella was non-endemic in Japan before the 1975-1977 epidemic, and endemic thereafter. Japan started a selective rubella vaccination program for junior high school girls in 1977, and universal rubella vaccination of children of both sexes in 1989. No nationwide rubella epidemics have occurred since 1994. Only three children with CRS were reported in Japan before 1964; however, many children with CRS were identified in 1965 when a rubella epidemic struck Okinawa, which has many the United States military bases. After the 1965-1969 and 1975-1977 rubella epidemics on the Japanese mainland, small numbers of children with CRS were identified (hospital survey). These findings led to the hypothesis that, compared to U.S. rubella virus strains, Japanese strains of rubella virus are less teratogenic. This hypothesis strongly affected the development of rubella vaccines in Japan. However, retrospective seroepidemiological studies attributed the CRS in many children in Okinawa to the high rate of rubella infection in pregnant women. According to the survey conducted at special schools for the deaf, 83, 232, 77, and 167 children were born with CRS on the Japanese mainland respectively after the 1965-1969, 1975-1977, 1982, and 1987-1988 nationwide rubella epidemics, suggesting that the incidence of CRS in Japan is in fact comparable to that in the U.S. and Europe. Rubella epidemics in children have been effectively prevented since 1994. However, a rubella outbreak among adult males and CRS occurred between 2012 and 2014. Copyright © 2015 Elsevier Ltd. All rights reserved.

Genotypic and Phenotypic Characterization of Chikungunya Virus of Different Genotypes from Malaysia

PubMed Central

Sam, I-Ching; Loong, Shih-Keng; Michael, Jasmine Chandramathi; Chua, Chong-Long; Wan Sulaiman, Wan Yusoff; Vythilingam, Indra; Chan, Shie-Yien; Chiam, Chun-Wei; Yeong, Yze-Shiuan; AbuBakar, Sazaly; Chan, Yoke-Fun

2012-01-01

Background Mosquito-borne Chikungunya virus (CHIKV) has recently re-emerged globally. The epidemic East/Central/South African (ECSA) strains have spread for the first time to Asia, which previously only had endemic Asian strains. In Malaysia, the ECSA strain caused an extensive nationwide outbreak in 2008, while the Asian strains only caused limited outbreaks prior to this. To gain insight into these observed epidemiological differences, we compared genotypic and phenotypic characteristics of CHIKV of Asian and ECSA genotypes isolated in Malaysia. Methods and Findings CHIKV of Asian and ECSA genotypes were isolated from patients during outbreaks in Bagan Panchor in 2006, and Johor in 2008. Sequencing of the CHIKV strains revealed 96.8% amino acid similarity, including an unusual 7 residue deletion in the nsP3 protein of the Asian strain. CHIKV replication in cells and Aedes mosquitoes was measured by virus titration. There were no differences in mammalian cell lines. The ECSA strain reached significantly higher titres in Ae. albopictus cells (C6/36). Both CHIKV strains infected Ae. albopictus mosquitoes at a higher rate than Ae. aegypti, but when compared to each other, the ECSA strain had much higher midgut infection and replication, and salivary gland dissemination, while the Asian strain infected Ae. aegypti at higher rates. Conclusions The greater ability of the ECSA strain to replicate in Ae. albopictus may explain why it spread far more quickly and extensively in humans in Malaysia than the Asian strain ever did, particularly in rural areas where Ae. albopictus predominates. Intergenotypic genetic differences were found at E1, E2, and nsP3 sites previously reported to be determinants of host adaptability in alphaviruses. Transmission of CHIKV in humans is influenced by virus strain and vector species, which has implications for regions with more than one circulating CHIKV genotype and Aedes species. PMID:23209750

A cross-immunization model for the extinction of old influenza strains.

PubMed

Uekermann, Florian; Sneppen, Kim

2016-05-13

Given the frequent mutation of antigenic features, the constancy of genetic and antigenic diversity of influenza within a subtype is surprising. While the emergence of new strains and antigenic features is commonly attributed to selection by the human immune system, the mechanism that ensures the extinction of older strains remains controversial. To replicate this dynamics of replacement current models utilize mechanisms such as short-lived strain-transcending immunity, a direct competition for hosts, stochastic extinction or constrained antigenic evolution. Building on the idea of short-lived immunity we introduce a minimal model that exhibits the aforementioned dynamics of replacement. Our model relies only on competition due to an antigen specific immune-response in an unconstrained antigenic space. Furthermore the model explains the size of typical influenza epidemics as well as the tendency that new epidemics are associated with mutations of old antigens.

Postepizootic Persistence of Venezuelan Equine Encephalitis Virus, Venezuela

PubMed Central

Navarro, Juan-Carlos; Medina, Gladys; Vasquez, Clovis; Coffey, Lark L.; Wang, Eryu; Suárez, Alexander; Biord, Hernán; Salas, Marlene

2005-01-01

Five years after the apparent end of the major 1995 Venezuelan equine encephalitis (VEE) epizootic/epidemic, focal outbreaks of equine encephalitis occurred in Carabobo and Barinas States of western Venezuela. Virus isolates from horses in each location were nearly identical in sequence to 1995 isolates, which suggests natural persistence of subtype IC VEE virus (VEEV) strains in a genetically stable mode. Serologic evidence indicated that additional outbreaks occurred in Barinas State in 2003. Field studies identified known Culex (Melanoconion) spp. vectors and reservoir hosts of enzootic VEEV but a dearth of typical epidemic vectors. Cattle serosurveys indicated the recent circulation of enzootic VEEV strains, and possibly of epizootic strains. Persistence of VEEV subtype IC strains and infection of horses at the end of the rainy season suggest the possibility of an alternative, cryptic transmission cycle involving survival through the dry season of infected vectors or persistently infected vertebrates. PMID:16485478

Genetic divergence of Chikungunya viruses in India (1963-2006) with special reference to the 2005-2006 explosive epidemic.

PubMed

Arankalle, Vidya A; Shrivastava, Shubham; Cherian, Sarah; Gunjikar, Rashmi S; Walimbe, Atul M; Jadhav, Santosh M; Sudeep, A B; Mishra, Akhilesh C

2007-07-01

Re-emergence of Chikungunya (CHIK), caused by CHIK virus, was recorded in India during 2005-2006 after a gap of 32 years, causing 1.3 million cases in 13 states. Several islands of the Indian Ocean reported similar outbreaks in the same period. These outbreaks were attributed to the African genotype of CHIK virus. To examine relatedness of the Indian isolates (IND-06) with Reunion Island isolates (RU), full-genome sequences of five CHIK virus isolates representative of different Indian states were determined. In addition, an isolate obtained from mosquitoes in the year 2000 (Yawat-2000), identified as being of the African genotype, and two older strains isolated in 1963 and 1973 (of the Asian genotype), were sequenced. The IND-06 isolates shared 99.9 % nucleotide identity with RU isolates, confirming involvement of the same strain in these outbreaks. The IND-06 isolates shared 98.2 % identity with the Yawat-2000 isolate. Of two crucial substitutions reported for RU isolates in the E1 region, M269V was noted in the Yawat-2000 and IND-06 isolates, whereas D284E was seen only in the IND-06 isolates. The A226V shift observed with the progression of the epidemic in Reunion Island, probably associated with adaptation to the mosquito vector, was absent in all of the Indian isolates. Three unique substitutions were noted in the IND-06 isolates: two (T128K and T376M) in the Nsp1 region and one (P23S) in the capsid protein. The two Asian strains showed 99.4 % nucleotide identity to each other, indicating relative stability of the virus. No evidence of recombination of the Asian and African genotypes, or of positive selection was observed. The results may help in understanding the association, if any, of the unique mutations with the explosive nature of the CHIK outbreak.

Atlantic salmon, Salmo salar L. are broadly susceptible to isolates representing the North American genogroups of infectious hematopoietic necrosis virus

USGS Publications Warehouse

Kurath, Gael; Winton, James R.; Dale, Ole B.; Purcell, Maureen K.; Falk, Knut; Busch, Robert D.

2016-01-01

Beginning in 1992, three epidemic waves of infectious hematopoietic necrosis, often with high mortality, occurred in farmed Atlantic salmon Salmo salar L. on the west coast of North America. We compared the virulence of eleven strains of infectious hematopoietic necrosis virus (IHNV), representing the U, M and L genogroups, in experimental challenges of juvenile Atlantic salmon in freshwater. All strains caused mortality and there was wide variation within genogroups: cumulative mortality for five U-group strains ranged from 20 to 100%, four M-group strains ranged 30-63% and two L-group strains varied from 41 to 81%. Thus, unlike Pacific salmonids, there was no apparent correlation of virulence in a particular host species with virus genogroup. The mortality patterns indicated two different phenotypes in terms of kinetics of disease progression and final per cent mortality, with nine strains having moderate virulence and two strains (from the U and L genogroups) having high virulence. These phenotypes were investigated by histopathology and immunohistochemistry to describe the variation in the course of IHNV disease in Atlantic salmon. The results from this study demonstrate that IHNV may become a major threat to farmed Atlantic salmon in other regions of the world where the virus has been, or may be, introduced.

Natural attenuation of dengue virus type-2 after a series of island outbreaks: a retrospective phylogenetic study of events in the South Pacific three decades ago.

PubMed

Steel, Argon; Gubler, Duane J; Bennett, Shannon N

2010-09-30

Dengue is an expanding arboviral disease of variable severity characterized by the emergence of virus strains with greater fitness, epidemic potential and possibly virulence. To investigate the role of dengue virus (DENV) strain variation on epidemic activity we studied DENV-2 viruses from a series of South Pacific islands experiencing outbreaks of varying intensity and clinical severity. Initially appearing in 1971 in Tahiti and Fiji, the virus was responsible for subsequent epidemics in American Samoa, New Caledonia and Niue Island in 1972, reaching Tonga in 1973 where there was near-silent transmission for over a year. Based on whole-genome sequencing and phylogenetic analysis on 20 virus isolates, Tonga viruses were genetically unique, clustering in a single clade. Substitutions in the pre-membrane (prM) and nonstructural genes NS2A and NS4A correlated with the attenuation of the Tongan viruses and suggest that genetic change may play a significant role in dengue epidemic severity. Copyright 2010 Elsevier Inc. All rights reserved.

Natural attenuation of Dengue Virus Type-2 after a series of island outbreaks: a re-trospective phylogenetic study of events in the South Pacific three decades ago

PubMed Central

Steel, Argon; Gubler, Duane J.; Bennett, Shannon N.

2011-01-01

Dengue is an expanding arboviral disease of variable severity characterized by the emergence of virus strains with greater fitness, epidemic potential and possibly virulence. To investigate the role of dengue virus (DENV) strain variation on epidemic activity we studied DENV-2 viruses from a series of South Pacific islands experiencing outbreaks of varying intensity and clinical severity. Initially appearing in 1971 in Tahiti and Fiji, the virus was responsible for subsequent epidemics in American Samoa, New Caledonia and Niue Island in 1972, reaching Tonga in 1973 where there was near-silent transmission for over a year. Based on whole-genome sequencing and phylogenetic analysis on 20 virus isolates, Tonga viruses were genetically unique, clustering in a single clade. Substitutions in the pre-membrane (prM) and nonstructural genes NS2A and NS4A correlated with the attenuation of the Tongan viruses and suggest that genetic change may play a significant role in dengue epidemic severity. PMID:20663532

Selected Insights from Application of Whole Genome Sequencing for Outbreak Investigations

PubMed Central

Le, Vien Thi Minh; Diep, Binh An

2014-01-01

Purpose of review The advent of high-throughput whole genome sequencing has the potential to revolutionize the conduct of outbreak investigation. Because of its ultimate pathogen strain resolution, whole genome sequencing could augment traditional epidemiologic investigations of infectious disease outbreaks. Recent findings The combination of whole genome sequencing and intensive epidemiologic analysis provided new insights on the sources and transmission dynamics of large-scale epidemics caused by Escherichia coli and Vibrio cholerae, nosocomial outbreaks caused by methicillin-resistant Staphylococcus aureus, Klebsiella pneumonia, and Mycobacterium abscessus, community-centered outbreaks caused by Mycobacterium tuberculosis, and natural disaster-associated outbreak caused by environmentally acquired molds. Summary When combined with traditional epidemiologic investigation, whole genome sequencing has proven useful for elucidating sources and transmission dynamics of disease outbreaks. Development of a fully automated bioinformatics pipeline for analysis of whole genome sequence data is much needed to make this powerful tool more widely accessible. PMID:23856896

Identification and characterization of a peptide affinity reagent for detection of noroviruses in clinical samples.

PubMed

Rogers, Jennifer D; Ajami, Nadim J; Fryszczyn, Bartlomiej G; Estes, Mary K; Atmar, Robert L; Palzkill, Timothy

2013-06-01

Norovirus (NoV) is the most common agent of nonbacterial epidemic gastroenteritis and is estimated to cause 21 million cases of the disease in the United States annually. The antigen enzyme-linked immunosorbent assays (ELISAs) currently available for NoV diagnosis detect only certain strains and are approved for use in the United States only in epidemics where NoV is suspected. There is a clear need for simpler, more rapid, and more reliable diagnostic tools for the detection of NoV. In this study, phage display technology was used to screen a library of phage displaying random 12-mer peptides for those that bind to Norwalk virus virus-like particles (NV VLPs). Three phage clones displaying unique peptides were identified, and both the peptide-displaying phages and the peptides were confirmed to bind specifically to NV VLPs. The peptide displayed on phage clone NV-N-R5-1 was determined to bind to the protruding domain of the VP1 capsid protein. This phage also bound to NV VLPs seeded into NoV-negative stool with a limit of detection of 1.56 ng NV VLP. This value was comparable to monoclonal antibody (MAb) 3912, which is currently used in commercially available assays. Furthermore, the NV-N-R5-1 phage exhibited high specificity by detecting NV only in previously characterized NV-positive stool samples in contrast to no detection in NV-negative stool samples. These data demonstrate that the further development of NV-N-R5-1 phage as a diagnostic reagent is possible and might offer several distinct advantages over antibodies, such as decreases in the time and cost of production and ease of isolating phage against other epidemic strains currently circulating as well as those that are emerging.

Molecular epidemiology reveals emergence of a virulent infectious hematopoietic necrosis (IHN) virus strain in wild salmon and its transmission to hatchery fish

USGS Publications Warehouse

Anderson, Eric D.; Engelking, H. Mark; Emmenegger, Eveline J.; Kurath, Gael

2000-01-01

Infectious hematopoietic necrosis virus (IHNV) has been known to be a significant salmonid pathogen in the Pacific Northwest of North America for decades. The goal of this study was to characterize the IHNV genetic heterogeneity and viral traffic over time at a study site in the Deschutes River watershed in Oregon, with an emphasis on the epidemiology of IHNV types causing epidemics in wild kokanee Oncorhynchus nerkabetween 1991 and 1995. The study site included kokanee spawning grounds in the Metolius River and Lake Billy Chinook downstream, in which the IHNV epidemics occurred in 2- and 3-year-old kokanee, and the Round Butte Fish Hatchery at the outflow of the lake. Forty-two IHNV isolates collected from this area between 1975 and 1995 were characterized on a genetic basis by ribonuclease (RNase) protection fingerprint analyses of the virus nucleocapsid, glycoprotein, and nonvirion genes. Analysis of the 16 identified composite haplotypes suggested that both virus evolution and introduction of new IHNV strains contributed to the genetic diversity observed. The results indicated that the 1991–1995 epidemics in kokanee from Lake Billy Chinook were due to a newly introduced IHNV type that was first detected in spawning adult kokanee in 1988 and that this virus type was transmitted from the wild kokanee to hatchery fish downstream in 1991. Twelve IHNV haplotypes were found at Round Butte Fish Hatchery, indicating a series of virus displacement events during the 20-year period examined. This work shows that IHNV traffic can be much more complex than was previously recognized, and the results have implications for fisheries management at the hatchery and throughout the watershed.

Protective efficacy of Zika vaccine in AG129 mouse model

PubMed Central

Sumathy, K.; Kulkarni, Bharathi; Gondu, Ravi Kumar; Ponnuru, Sampath Kumar; Bonguram, Nagaraju; Eligeti, Rakesh; Gadiyaram, Sindhuja; Praturi, Usha; Chougule, Bhushan; Karunakaran, Latha; Ella, Krishna M.

2017-01-01

Zika virus (ZIKV) is a mosquito-borne flavivirus that causes asymptomatic infection or presents only mild symptoms in majority of those infected. However, vaccination for ZIKV is a public health priority due to serious congenital and neuropathological abnormalities observed as a sequelae of the virus infection in the recent epidemics. We have developed an inactivated virus vaccine with the African MR 766 strain. Here we show that two doses of the vaccine provided 100% efficacy against mortality and disease following challenge with homotypic MR 766 and the heterotypic FSS 13025 ZIKV strains in the Type I and Type II interferon deficient AG129 mice. Two doses of the vaccine elicited high titer of neutralizing antibodies in Balb/c mice, and the vaccine antisera conferred protection against virus challenge in passively immunized mice. The studies were useful to rationalize vaccine doses for protective efficacy. Furthermore, the vaccine antisera neutralized the homotypic and heterotypic ZIKV strains in vitro with equivalent efficiency. Our study suggests a single ZIKV serotype, and that the development of an effective vaccine may not be limited by the choice of virus strain. PMID:28401907

Protective efficacy of Zika vaccine in AG129 mouse model.

PubMed

Sumathy, K; Kulkarni, Bharathi; Gondu, Ravi Kumar; Ponnuru, Sampath Kumar; Bonguram, Nagaraju; Eligeti, Rakesh; Gadiyaram, Sindhuja; Praturi, Usha; Chougule, Bhushan; Karunakaran, Latha; Ella, Krishna M

2017-04-12

Zika virus (ZIKV) is a mosquito-borne flavivirus that causes asymptomatic infection or presents only mild symptoms in majority of those infected. However, vaccination for ZIKV is a public health priority due to serious congenital and neuropathological abnormalities observed as a sequelae of the virus infection in the recent epidemics. We have developed an inactivated virus vaccine with the African MR 766 strain. Here we show that two doses of the vaccine provided 100% efficacy against mortality and disease following challenge with homotypic MR 766 and the heterotypic FSS 13025 ZIKV strains in the Type I and Type II interferon deficient AG129 mice. Two doses of the vaccine elicited high titer of neutralizing antibodies in Balb/c mice, and the vaccine antisera conferred protection against virus challenge in passively immunized mice. The studies were useful to rationalize vaccine doses for protective efficacy. Furthermore, the vaccine antisera neutralized the homotypic and heterotypic ZIKV strains in vitro with equivalent efficiency. Our study suggests a single ZIKV serotype, and that the development of an effective vaccine may not be limited by the choice of virus strain.

Function of the CRISPR-Cas System of the Human Pathogen Clostridium difficile

PubMed Central

Boudry, Pierre; Semenova, Ekaterina; Monot, Marc; Datsenko, Kirill A.; Lopatina, Anna; Sekulovic, Ognjen; Ospina-Bedoya, Maicol; Fortier, Louis-Charles; Severinov, Konstantin; Dupuy, Bruno

2015-01-01

ABSTRACT Clostridium difficile is the cause of most frequently occurring nosocomial diarrhea worldwide. As an enteropathogen, C. difficile must be exposed to multiple exogenous genetic elements in bacteriophage-rich gut communities. CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) systems allow bacteria to adapt to foreign genetic invaders. Our recent data revealed active expression and processing of CRISPR RNAs from multiple type I-B CRISPR arrays in C. difficile reference strain 630. Here, we demonstrate active expression of CRISPR arrays in strain R20291, an epidemic C. difficile strain. Through genome sequencing and host range analysis of several new C. difficile phages and plasmid conjugation experiments, we provide evidence of defensive function of the CRISPR-Cas system in both C. difficile strains. We further demonstrate that C. difficile Cas proteins are capable of interference in a heterologous host, Escherichia coli. These data set the stage for mechanistic and physiological analyses of CRISPR-Cas-mediated interactions of important global human pathogen with its genetic parasites. PMID:26330515

[Epidemiology of S. aureus cross-infections in dermatological wards].

PubMed

Barrière, H; Géraut, C; Audurier, A; Litoux, P; Courtieu, A L

1976-01-01

Over a three-year period, 196 of 3115 patients admitted in a dermatological department became infected with S. aureus (6,2 %). 205 strains of S. aureus were isolated. Serologic typing, phage-typing and antibiotic sensitivity tests revealed 3 epidemic and 2 endemic strains. The 3 epidemic strains infected 24 patients: 12 from july to november 1972 were infected with a serotype 66438 S. aureus resistant to fusidic acid. 6 patients (male) were infected with a serotype III in february and march 1972; 8 patients were contaminated with a serotype 18 S. aureus from december 1973 to february 1974, after staying in a surgical department. Of the 2 endemic strains 1, phage-pattern 53/79, is non-typable by serologic-typing; this strain has been observed only in the dermatological department and 20 patients were infected with, from january to october 1974. The second endemic strain, phage-pattern 81/+ serotype I, cross-infected 16 patients during this three-year survey; 12 of them were admitted repeatedly. During this three-year survey, it could be proved that, at least, 1 out of 3 patients is infected with an epidemic or an endemic strain. We can suggest that the factors enhancing cross-infection in dermatological department are: the sex of patients (80 % were male); presence of a tween splitting enzyme by S. aureus promotes growth of Staphylococci on the skin; patients transfered from a department to another or repeatedly admitted are more often infected. But, as they are source of some outbreaks, they need special measures (asepsis and hygiene); corticoïds or immunodepressors enhance cross-infection; antibiotics must not be only limited but varied too.

Ergot: from witchcraft to biotechnology.

PubMed

Haarmann, Thomas; Rolke, Yvonne; Giesbert, Sabine; Tudzynski, Paul

2009-07-01

The ergot diseases of grasses, caused by members of the genus Claviceps, have had a severe impact on human history and agriculture, causing devastating epidemics. However, ergot alkaloids, the toxic components of Claviceps sclerotia, have been used intensively (and misused) as pharmaceutical drugs, and efficient biotechnological processes have been developed for their in vitro production. Molecular genetics has provided detailed insight into the genetic basis of ergot alkaloid biosynthesis and opened up perspectives for the design of new alkaloids and the improvement of production strains; it has also revealed the refined infection strategy of this biotrophic pathogen, opening up the way for better control. Nevertheless, Claviceps remains an important pathogen worldwide, and a source for potential new drugs for central nervous system diseases.

The rate of co-infection for piglet diarrhea viruses in China and the genetic characterization of porcine epidemic diarrhea virus and porcine kobuvirus.

PubMed

Zhao, Z-P; Yang, Z; Lin, W-D; Wang, W-Y; Yang, J; Jin, W-J; Qin, A-J

2016-03-01

Piglet diarrhea epidemics result in major economic losses for the swine industry. Four viruses are closely linked to porcine diarrhea: porcine kobuvirus (PKV), porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV), and porcine rotavirus (PRoV). We have conducted an epidemiology study to determine the frequency of infection and co-infection with these viruses in China, and characterized the genetic variation of the isolated PEDV and PKV strains. Stool and intestinal samples (n = 314) were collected from piglets with diarrhea in China from years 2012 to 2014. RT-PCR was used to detect PKV, PEDV, TGEV, and PRoV. Phylogenetic relationships between reference strains and the isolated PEDV and PKV strains were determined based on the M and 3D gene sequence. The rates of infection with PKV, PEDV, TGEV and PRoV were 29.9%, 24.2%, 1.91%, and 0.31%, respectively. Co-infections with PKV and the other three viruses were very common. Co-infection of PKV and PEDV was detected in 15.0% (47/314) of the samples. Phylogenetic analysis of the PKV 3D gene indicated that there were some phylogenetic differences in the PKV strains across regions within China. However, according to the PEDV M gene, strains clustered into three groups and the primary group was distinct from the vaccine strain CV777. This study provides insights in to the prevalence of diarrhea viruses and their prevention and control in China.

Emergence of the Epidemic Methicillin-Resistant Staphylococcus aureus Strain USA300 Coincides with Horizontal Transfer of the Arginine Catabolic Mobile Element and speG-mediated Adaptations for Survival on Skin

PubMed Central

Planet, Paul J.; LaRussa, Samuel J.; Dana, Ali; Smith, Hannah; Xu, Amy; Ryan, Chanelle; Uhlemann, Anne-Catrin; Boundy, Sam; Goldberg, Julia; Narechania, Apurva; Kulkarni, Ritwij; Ratner, Adam J.; Geoghegan, Joan A.; Kolokotronis, Sergios-Orestis; Prince, Alice

2013-01-01

ABSTRACT The arginine catabolic mobile element (ACME) is the largest genomic region distinguishing epidemic USA300 strains of methicillin-resistant Staphylococcus aureus (MRSA) from other S. aureus strains. However, the functional relevance of ACME to infection and disease has remained unclear. Using phylogenetic analysis, we have shown that the modular segments of ACME were assembled into a single genetic locus in Staphylococcus epidermidis and then horizontally transferred to the common ancestor of USA300 strains in an extremely recent event. Acquisition of one ACME gene, speG, allowed USA300 strains to withstand levels of polyamines (e.g., spermidine) produced in skin that are toxic to other closely related S. aureus strains. speG-mediated polyamine tolerance also enhanced biofilm formation, adherence to fibrinogen/fibronectin, and resistance to antibiotic and keratinocyte-mediated killing. We suggest that these properties gave USA300 a major selective advantage during skin infection and colonization, contributing to the extraordinary evolutionary success of this clone. PMID:24345744

Diversity of HIV-1 subtype C strains isolated in Romania.

PubMed

Paraschiv, Simona; Foley, Brian; Otelea, Dan

2011-03-01

Two unique aspects particularities of the HIV-1 epidemics in Romania are the high prevalence of subtype F1 strains and the large pediatric population infected in the late 1980s and early 1990s. During recent years, more infections with other subtypes have been seen in newly diagnosed patients. After subtype B, subtype C was the most frequent one. This subtype is prevalent in countries from sub-Saharan Africa and India, being responsible for half of the total HIV-1 infections in the world. We have identified 37 patients infected with subtype C, sequenced the reverse transcriptase and protease regions of their pol genes, and applied phylogenetic analyses to the sequences. We have also included 20 subtype F1 strains isolated from both teenagers (children at the time of diagnosis) and adults. The phylogenetic analysis was performed by using the PhyML method, the GTR (general time reversible) model of evolution and gamma distribution of variability of rates between sites, empirically calculated from the data. The epidemiological data indicates that the main route of transmission for the adult subjects was by heterosexual contact and a relatively small number of patients were possibly infected abroad. In three cases, blood transfusion prior to 1989 or surgical procedures at early ages were suspected to be the cause of the HIV infection and three other patients were most probably parenterally infected. The phylogenetic analyses showed that the Romanian C strains are very diverse overall, clustered in several groups characterized by common transmission route (transfusion/surgical procedures) or local geographical relatedness. The HIV-1 epidemics in Romania apparently followed different patterns for subtypes F and C. While subtype F1 seems to have been monoclonally introduced and extensively spread in the 80s, the subtype C strains, although present in the late 80s, failed to spread to the same extent. Copyright © 2010 Elsevier B.V. All rights reserved.

Scanning the landscape of genome architecture of non-O1 and non-O139 Vibrio cholerae by whole genome mapping reveals extensive population genetic diversity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chapman, Carol; Henry, Matthew; Bishop-Lilly, Kimberly A.

Historically, cholera outbreaks have been linked to V. cholerae O1 serogroup strains or its derivatives of the O37 and O139 serogroups. A genomic study on the 2010 Haiti cholera outbreak strains highlighted the putative role of non O1/non-O139 V. cholerae in causing cholera and the lack of genomic sequences of such strains from around the world. Here we address these gaps by scanning a global collection of V. cholerae strains as a first step towards understanding the population genetic diversity and epidemic potential of non O1/non-O139 strains. Whole Genome Mapping (Optical Mapping) based bar coding produces a high resolution, orderedmore » restriction map, depicting a complete view of the unique chromosomal architecture of an organism. To assess the genomic diversity of non-O1/non-O139 V. cholerae, we applied a Whole Genome Mapping strategy on a well-defined and geographically and temporally diverse strain collection, the Sakazaki serogroup type strains. Whole Genome Map data on 91 of the 206 serogroup type strains support the hypothesis that V. cholerae has an unprecedented genetic and genomic structural diversity. Interestingly, we discovered chromosomal fusions in two unusual strains that possess a single chromosome instead of the two chromosomes usually found in V. cholerae. We also found pervasive chromosomal rearrangements such as duplications and indels in many strains. The majority of Vibrio genome sequences currently in public databases are unfinished draft sequences. The Whole Genome Mapping approach presented here enables rapid screening of large strain collections to capture genomic complexities that would not have been otherwise revealed by unfinished draft genome sequencing and thus aids in assembling and finishing draft sequences of complex genomes. Furthermore, Whole Genome Mapping allows for prediction of novel V. cholerae non-O1/non-O139 strains that may have the potential to cause future cholera outbreaks.« less

Scanning the landscape of genome architecture of non-O1 and non-O139 Vibrio cholerae by whole genome mapping reveals extensive population genetic diversity.

PubMed

Chapman, Carol; Henry, Matthew; Bishop-Lilly, Kimberly A; Awosika, Joy; Briska, Adam; Ptashkin, Ryan N; Wagner, Trevor; Rajanna, Chythanya; Tsang, Hsinyi; Johnson, Shannon L; Mokashi, Vishwesh P; Chain, Patrick S G; Sozhamannan, Shanmuga

2015-01-01

Historically, cholera outbreaks have been linked to V. cholerae O1 serogroup strains or its derivatives of the O37 and O139 serogroups. A genomic study on the 2010 Haiti cholera outbreak strains highlighted the putative role of non O1/non-O139 V. cholerae in causing cholera and the lack of genomic sequences of such strains from around the world. Here we address these gaps by scanning a global collection of V. cholerae strains as a first step towards understanding the population genetic diversity and epidemic potential of non O1/non-O139 strains. Whole Genome Mapping (Optical Mapping) based bar coding produces a high resolution, ordered restriction map, depicting a complete view of the unique chromosomal architecture of an organism. To assess the genomic diversity of non-O1/non-O139 V. cholerae, we applied a Whole Genome Mapping strategy on a well-defined and geographically and temporally diverse strain collection, the Sakazaki serogroup type strains. Whole Genome Map data on 91 of the 206 serogroup type strains support the hypothesis that V. cholerae has an unprecedented genetic and genomic structural diversity. Interestingly, we discovered chromosomal fusions in two unusual strains that possess a single chromosome instead of the two chromosomes usually found in V. cholerae. We also found pervasive chromosomal rearrangements such as duplications and indels in many strains. The majority of Vibrio genome sequences currently in public databases are unfinished draft sequences. The Whole Genome Mapping approach presented here enables rapid screening of large strain collections to capture genomic complexities that would not have been otherwise revealed by unfinished draft genome sequencing and thus aids in assembling and finishing draft sequences of complex genomes. Furthermore, Whole Genome Mapping allows for prediction of novel V. cholerae non-O1/non-O139 strains that may have the potential to cause future cholera outbreaks.

Scanning the landscape of genome architecture of non-O1 and non-O139 Vibrio cholerae by whole genome mapping reveals extensive population genetic diversity

DOE PAGES

Chapman, Carol; Henry, Matthew; Bishop-Lilly, Kimberly A.; ...

2015-03-20

Historically, cholera outbreaks have been linked to V. cholerae O1 serogroup strains or its derivatives of the O37 and O139 serogroups. A genomic study on the 2010 Haiti cholera outbreak strains highlighted the putative role of non O1/non-O139 V. cholerae in causing cholera and the lack of genomic sequences of such strains from around the world. Here we address these gaps by scanning a global collection of V. cholerae strains as a first step towards understanding the population genetic diversity and epidemic potential of non O1/non-O139 strains. Whole Genome Mapping (Optical Mapping) based bar coding produces a high resolution, orderedmore » restriction map, depicting a complete view of the unique chromosomal architecture of an organism. To assess the genomic diversity of non-O1/non-O139 V. cholerae, we applied a Whole Genome Mapping strategy on a well-defined and geographically and temporally diverse strain collection, the Sakazaki serogroup type strains. Whole Genome Map data on 91 of the 206 serogroup type strains support the hypothesis that V. cholerae has an unprecedented genetic and genomic structural diversity. Interestingly, we discovered chromosomal fusions in two unusual strains that possess a single chromosome instead of the two chromosomes usually found in V. cholerae. We also found pervasive chromosomal rearrangements such as duplications and indels in many strains. The majority of Vibrio genome sequences currently in public databases are unfinished draft sequences. The Whole Genome Mapping approach presented here enables rapid screening of large strain collections to capture genomic complexities that would not have been otherwise revealed by unfinished draft genome sequencing and thus aids in assembling and finishing draft sequences of complex genomes. Furthermore, Whole Genome Mapping allows for prediction of novel V. cholerae non-O1/non-O139 strains that may have the potential to cause future cholera outbreaks.« less

Analysis of the causes of spawning of large-scale, severe malarial epidemics and their rapid total extinction in western Provence, historically a highly endemic region of France (1745–1850)

PubMed Central

2014-01-01

Background The two main puzzles of this study are the onset and then sudden stopping of severe epidemics in western Provence (a highly malaria-endemic region of Mediterranean France) without any deliberate counter-measures and in the absence of significant population flux. Methods Malaria epidemics during the period from 1745 to 1850 were analysed against temperature and rainfall records and several other potentially relevant factors. Results Statistical analyses indicated that relatively high temperatures in early spring and in September/October, rainfall during the previous winter (principally December) and even from November to September and epidemics during the previous year could have played a decisive role in the emergence of these epidemics. Moreover, the epidemics were most likely not driven by other parameters (e.g., social, cultural, agricultural and geographical). Until 1776, very severe malarial epidemics affected large areas, whereas after this date, they were rarer and generally milder for local people and were due to canal digging activities. In the latter period, decreased rainfall in December, and more extreme and variable temperatures were observed. It is known that rainfall anomalies and temperature fluctuations may be detrimental to vector and parasite development. Conclusion This study showed the particular characteristics of malaria in historical Provence. Contrary to the situation in most other Mediterranean areas, Plasmodium falciparum was most likely not involved (during the years with epidemics, the mean temperature during the months of July and August, among other factors, did not play a role) and the population had no protective mutation. The main parasite species was Plasmodium vivax, which was responsible for very severe diseases, but contrary to in northern Europe, it is likely that transmission occurred only during the period where outdoor sporogony was possible, and P. vivax sporogony was always feasible, even during colder summers. Possible key elements in the understanding of the course of malaria epidemics include changes in the virulence of P. vivax strains, the refractoriness of anophelines and/or the degree or efficiency of acquired immunity. This study could open new lines of investigation into the comprehension of the conditions of disappearance/emergence of severe malaria epidemics in highly endemic areas. PMID:24581282

Herald waves of cholera in nineteenth century London

PubMed Central

Tien, Joseph H.; Poinar, Hendrik N.; Fisman, David N.; Earn, David J. D.

2011-01-01

Deaths from cholera in London, UK, were recorded weekly from 1824 to 1901. Three features of the time series stand out: (i) cholera deaths were strongly seasonal, with peak mortality almost always in the summer, (ii) the only non-summer outbreaks occurred in the spring of 1832, the autumn of 1848 and the winter of 1853, and (iii) extraordinarily severe summer outbreaks occurred in 1832, 1849, 1854 and 1866 (the four ‘great’ cholera years). The non-summer outbreaks of 1832, 1848 and 1853 appear to have been herald waves of newly invading cholera strains. In addition, a simple mathematical model confirms that a non-summer introduction of a new cholera strain can result in an initial herald wave, followed by a severe outbreak the following summer. Through the analysis of the genomes of nineteenth-century specimens, it may be possible to identify the strains that caused these herald waves and the well-known cholera epidemics that followed. PMID:21123253

The dynamics of GII.4 Norovirus in Ho Chi Minh City, Vietnam.

PubMed

Tra My, Phan Vu; Lam, Ha Minh; Thompson, Corinne N; Phuc, Hoang Le; Tuyet, Pham Thi Ngoc; Vinh, Ha; Hoang, Nguyen Van Minh; Minh, Phamvan; Vinh, Nguyen Thanh; Thuy, Cao Thu; Nga, Tran Thi Thu; Hau, Nguyen Thi Thu; Chinh, Nguyen Tran; Thuong, Tang Chi; Tuan, Ha Manh; Campbell, James I; Clements, Archie C A; Farrar, Jeremy; Boni, Maciej F; Baker, Stephen

2013-08-01

Norovirus (NoV) is a major cause of epidemic gastroenteritis in industrialized countries, yet the epidemiological significance of NoV in industrializing countries remains poorly understood. The spatiotemporal distribution of NoV genotypes identified in 2054 enrolled children was investigated between May 2009 and December 2010, in Ho Chi Minh City (HCMC), Vietnam. A total of 315 NoV extracted from stool samples were genotyped and GPS mapped to their source. Genogroup II NoV, particularly GII.4, were predominant, and the GII.4 strains could be subgrouped into GII.4-2006b (Minerva) and GII.4-2010 (New Orleans) variants. There was no spatiotemporal structure among the endemic GII strains; yet a significant spatiotemporal signal corresponding with the novel introduction of GII.4-2010 variant was detected. These data show that NoV GII.4 variants are highly endemic in HCMC and describe a scenario of rapid NoV strain replacement occurring in HCMC in early 2010. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

Evidence for an independent third Usutu virus introduction into Germany.

PubMed

Ziegler, Ute; Fast, Christine; Eiden, Martin; Bock, Sabine; Schulze, Christoph; Hoeper, Dirk; Ochs, Andreas; Schlieben, Patricia; Keller, Markus; Zielke, Dorothee E; Luehken, Renke; Cadar, Daniel; Walther, Doreen; Schmidt-Chanasit, Jonas; Groschup, Martin H

2016-08-30

Usutu virus (USUV) is an arbovirus within the genus flavivirus, which was first introduced to Southern Europe approximately twenty years ago causing epizootics among wild and captive birds. In Germany USUV was initially discovered in wild birds, mainly Common blackbirds (Turdus merula), in the Upper Rhine valley in southwest of the country in 2011 and has not spread much northwards since. Phylogenetic analyses revealed that the still ongoing USUV epidemic is caused by two different USUV strains, USUV-Germany belonging to the USUV Europe 3 lineage and USUV-Bonn belonging to the USUV Africa 3 lineage. The two strains were introduced independently. In August 2015 a new USUV strain, named USUV-Berlin, was isolated in Vero cells from two carcasses of juvenile Great grey owls (Strix nebulosa) kept in the Zoological Garden Berlin, which had suffered from a hyperacute fatal systemic infection. Both owls carried high USUV genome loads. Full-length USUV genomes sequences were determined and phylogenetic analysis demonstrated a close relationship with a Spanish mosquito-derived sequence from 2006. Immunohistochemical antigen detection in organ samples of the owls showed the typical USUV infection patterns. According to the phylogenetic analysis, USUV-Berlin belongs to the Africa 2 lineage, and can thus be distinguished from the other strains circulating in Germany. Repeated findings of different USUV strains suggest more frequent introductions into Central Europe and a higher mobility of this virus than assumed to date. Copyright © 2016 Elsevier B.V. All rights reserved.

Epidemiological dynamics of norovirus GII.4 variant New Orleans 2009.

PubMed

Medici, Maria Cristina; Tummolo, Fabio; De Grazia, Simona; Calderaro, Adriana; De Conto, Flora; Terio, Valentina; Chironna, Maria; Bonura, Floriana; Pucci, Marzia; Bányai, Kristián; Martella, Vito; Giammanco, Giovanni Maurizio

2015-09-01

Norovirus (NoV) is one of the major causes of diarrhoeal disease with epidemic, outbreak and sporadic patterns in humans of all ages worldwide. NoVs of genotype GII.4 cause nearly 80-90 % of all NoV infections in humans. Periodically, some GII.4 strains become predominant, generating major pandemic variants. Retrospective analysis of the GII.4 NoV strains detected in Italy between 2007 and 2013 indicated that the pandemic variant New Orleans 2009 emerged in Italy in the late 2009, became predominant in 2010-2011 and continued to circulate in a sporadic fashion until April 2013. Upon phylogenetic analysis based on the small diagnostic regions A and C, the late New Orleans 2009 NoVs circulating during 2011-2013 appeared to be genetically different from the early New Orleans 2009 strains that circulated in 2010. For a selection of strains, a 3.2 kb genome portion at the 3' end was sequenced. In the partial ORF1 and in the full-length ORF2 and ORF3, the 2011-2013 New Orleans NoVs comprised at least three distinct genetic subclusters. By comparison with sequences retrieved from the databases, these subclusters were also found to circulate globally, suggesting that the local circulation reflected repeated introductions of different strains, rather than local selection of novel viruses. Phylogenetic subclustering did not correlate with changes in residues located in predicted putative capsid epitopes, although several changes affected the P2 domain in epitopes A, C, D and E.

Evolutionary clade affects resistance of Clostridium difficile spores to Cold Atmospheric Plasma

NASA Astrophysics Data System (ADS)

Connor, Mairéad; Flynn, Padrig B.; Fairley, Derek J.; Marks, Nikki; Manesiotis, Panagiotis; Graham, William G.; Gilmore, Brendan F.; McGrath, John W.

2017-02-01

Clostridium difficile is a spore forming bacterium and the leading cause of colitis and antibiotic associated diarrhoea in the developed world. Spores produced by C. difficile are robust and can remain viable for months, leading to prolonged healthcare-associated outbreaks with high mortality. Exposure of C. difficile spores to a novel, non-thermal atmospheric pressure gas plasma was assessed. Factors affecting sporicidal efficacy, including percentage of oxygen in the helium carrier gas admixture, and the effect on spores from different strains representing the five evolutionary C. difficile clades was investigated. Strains from different clades displayed varying resistance to cold plasma. Strain R20291, representing the globally epidemic ribotype 027 type, was the most resistant. However all tested strains displayed a ~3 log reduction in viable spore counts after plasma treatment for 5 minutes. Inactivation of a ribotype 078 strain, the most prevalent clinical type seen in Northern Ireland, was further assessed with respect to surface decontamination, pH, and hydrogen peroxide concentration. Environmental factors affected plasma activity, with dry spores without the presence of organic matter being most susceptible. This study demonstrates that cold atmospheric plasma can effectively inactivate C. difficile spores, and highlights factors that can affect sporicidal activity.

Characterization of Neisseria meningitidis Isolates from Recent Outbreaks in Ethiopia and Comparison with Those Recovered during the Epidemic of 1988 to 1989

PubMed Central

Norheim, Gunnstein; Rosenqvist, Einar; Aseffa, Abraham; Yassin, Mohammed Ahmed; Mengistu, Getahun; Kassu, Afework; Fikremariam, Dereje; Tamire, Wegene; Høiby, E. Arne; Alebel, Tsegaye; Berhanu, Degu; Merid, Yarid; Harboe, Morten; Caugant, Dominique A.

2006-01-01

The objectives of this study were to collect and characterize epidemic meningococcal isolates from Ethiopia from 2002 to 2003 and to compare them to 21 strains recovered during the previous large epidemic of 1988 to 1989. Ninety-five patients in all age groups with clinical signs of meningitis and a turbid cerebrospinal fluid (CSF) sample were included in the study of isolates from 2002 to 2003. Seventy-one patients (74.7%) were confirmed as having Neisseria meningitidis either by culture (n = 40) or by porA PCR (n = 31) of their CSF. The overall case fatality rate (CFR) was 11.6%; the N. meningitidis-specific CFR was 4.2%. All 40 strains were fully susceptible to all antibiotics tested except sulfonamide, were serotyped as A:4/21:P1.20,9, and belonged to sequence type 7 (ST-7). The strains from 1988 to 1989 were also equally susceptible and were characterized as A:4/21:P1.20,9, but they belonged to ST-5. Antigenic characterization of the strains revealed differences in the repertoire of lipooligosaccharides and Opa proteins between the old and the recent strains. PCR analysis of the nine lgt genes revealed the presence of the lgtAHFG genes in both old and recent strains; lgtB was present in only some of the strains, but no correlation with sequence type was observed. Further analysis showed that in addition to their pgm alleles, the Ethiopian ST-5 and ST-7 strains also differed in their tbpB, opa, fetA, and lgtA genes. The occurrence of new antigenic structures in strains sharing the same serogroup, PorA, and PorB may help explain the replacement of ST-5 by ST-7 in the African meningitis belt. PMID:16517868

Fast tracking the vaccine licensure process to control an epidemic of serogroup B meningococcal disease in New Zealand.

PubMed

Lennon, Diana; Jackson, Catherine; Wong, Sharon; Horsfall, Maraekura; Stewart, Joanna; Reid, Stewart

2009-08-15

Epidemics of serogroup B meningococcal disease are rare. Strain-specific outer membrane vesicle vaccines, which are not marketed, are the only current tool for control. A correlate of protection is ill defined, but published data suggest that measured serum bactericidal antibody levels parallel efficacy. Even infants can mount a strain-specific antibody response to a strain-specific vaccine. New Zealand's epidemic (1991-2007; peak rate [in 2001], 17.4 cases per 100,000 persons) was dominated by a single strain. After a 5-year search (1996-2001) for a manufacturer for a strain-specific outer membrane vesicle vaccine, a fast-tracked research program (2002-2004) determined the safety and immunogenicity of vaccine in infants (2 age groups: 6-10 weeks and 6-8 months), children (age, 16-24 months), and school-aged children (age, 8-12 years) after an adult trial. The vaccine was reactogenic, compared with control vaccines (meningococcal C conjugate and routine infant vaccines), but retention was high. Three vaccine doses produced antibody levels (measured by serum bactericidal assay) that were considered to be adequate for public health intervention. However, in young infants, a fourth dose was required to achieve levels equivalent to those achieved by other age groups. Provisional licensure by New Zealand's MedSafe was based on serological criteria strengthened by bridged safety data from studies of the parent outer membrane vesicle vaccine, independent assessment of manufacturing quality, and a clear plan for safety monitoring and effectiveness evaluation after licensure.

Inferring the global phylodynamics of influenza A/H3N2 viruses in Taiwan.

PubMed

Gong, Yu-Nong; Tsao, Kuo-Chien; Chen, Guang-Wu

2018-02-20

Influenza A/H3N2 viruses are characterized by highly mutated RNA genomes. In this study, we focused on tracing the phylodynamics of Taiwanese strains over the past four decades. All Taiwanese H3N2 HA1 sequences and references were downloaded from public database. A Bayesian skyline plot (BSP) and phylogenetic tree were used to analyze the evolutionary history, and Bayesian phylogeographic analysis was applied to predict the spatiotemporal migrations of influenza outbreaks. Genetic diversity was found to have peaked near the summer of 2009 in BSP, in addition to the two earlier reported ones in summer of 2005 and 2007. We predicted their spatiotemporal migrations and found the summer epidemic of 2005 from Korea, and 2007 and 2009 from the Western United States. BSP also predicted an elevated genetic diversity in 2015-2017. Quasispecies were found over approximately 20% of the strains included in this time span. In addition, a first-time seen N31S mutation was noted in Taiwan in 2016-2017. We comprehensively investigated the evolutionary history of Taiwanese strains in 1979-2017. An epidemic caution could thus be raised if genetic diversity was found to have peaked. An example showed a newly-discovered cluster in 2016-2017 strains featuring a mutation N31S together with HA-160 quasispecies. Phylogeographic analysis, moreover, provided useful insights in tracing the possible source and migrations of these epidemics around the world. We demonstrated that Asian destinations including Taiwan were the immediate followers, while U.S. continent was predicted the origin of two summer epidemics in 2007 and 2009. Copyright © 2018. Published by Elsevier B.V.

Vibrio cholerae O1 epidemic variants in Angola: a retrospective study between 1992 and 2006.

PubMed

Valia, Romy; Taviani, Elisa; Spagnoletti, Matteo; Ceccarelli, Daniela; Cappuccinelli, Piero; Colombo, Mauro M

2013-01-01

Cholera is still a major public health concern in many African countries. In Angola, after a decade of absence, cholera reemerged in 1987, spreading throughout the country until 1996, with outbreaks recurring in a seasonal pattern. In 2006 Angola was hit by one of the most severe outbreaks of the last decade, with ca. 240,000 cases reported. We analyzed 21 clinical strains isolated between 1992 and 2006 from several provinces throughout the country: Benguela, Bengo, Luanda, Cuando Cubango, and Cabinda. We used two multiplex PCR assays to investigate discriminatory mobile genetic elements (MGE) [Integrative Conjugative Elements (ICEs), VSP-II, GI12, GI14, GI15, K, and TLC phages] and we compared the profiles obtained with those of different reference V. cholerae O1 variants (prototypical, altered, and hybrid), responsible for the ongoing 7th pandemic. We also tested the strains for the presence of specific VSP-II variants and for the presence of a genomic island (GI) (WASA-1), correlated with the transmission of seventh pandemic cholera from Africa to South America. Based on the presence/absence of the analyzed genetic elements, five novel profiles were detected in the epidemic strains circulating in the 1990s. The most frequent profiles, F and G, were characterized by the absence of ICEs and the three GIs tested, and the presence of GI WASA-1 and the WASA variant of the VSP-II island. Our results identified unexpected variability within the 1990s epidemic, showing different rearrangements in a dynamic part of the genome not present in the prototypical V. cholerae O1 N16961. Moreover the 2006 strains differed from the current pandemic V. cholerae O1 strain. Taken together, our results highlight the role of horizontal gene transfer (HGT) in diversifying the genetic background of V. cholerae within a single epidemic.

Maize streak virus: an old and complex 'emerging' pathogen.

PubMed

Shepherd, Dionne N; Martin, Darren P; Van Der Walt, Eric; Dent, Kyle; Varsani, Arvind; Rybicki, Edward P

2010-01-01

Maize streak virus (MSV; Genus Mastrevirus, Family Geminiviridae) occurs throughout Africa, where it causes what is probably the most serious viral crop disease on the continent. It is obligately transmitted by as many as six leafhopper species in the Genus Cicadulina, but mainly by C. mbila Naudé and C. storeyi. In addition to maize, it can infect over 80 other species in the Family Poaceae. Whereas 11 strains of MSV are currently known, only the MSV-A strain is known to cause economically significant streak disease in maize. Severe maize streak disease (MSD) manifests as pronounced, continuous parallel chlorotic streaks on leaves, with severe stunting of the affected plant and, usuallly, a failure to produce complete cobs or seed. Natural resistance to MSV in maize, and/or maize infections caused by non-maize-adapted MSV strains, can result in narrow, interrupted streaks and no obvious yield losses. MSV epidemiology is primarily governed by environmental influences on its vector species, resulting in erratic epidemics every 3-10 years. Even in epidemic years, disease incidences can vary from a few infected plants per field, with little associated yield loss, to 100% infection rates and complete yield loss. The only virus species known to cause MSD is MSV, the type member of the Genus Mastrevirus in the Family Geminiviridae. In addition to the MSV-A strain, which causes the most severe form of streak disease in maize, 10 other MSV strains (MSV-B to MSV-K) are known to infect barley, wheat, oats, rye, sugarcane, millet and many wild, mostly annual, grass species. Seven other mastrevirus species, many with host and geographical ranges partially overlapping those of MSV, appear to infect primarily perennial grasses. MSV and all related grass mastreviruses have single-component, circular, single-stranded DNA genomes of approximately 2700 bases, encapsidated in 22 x 38-nm geminate particles comprising two incomplete T = 1 icosahedra, with 22 pentameric capsomers composed of a single 32-kDa capsid protein. Particles are generally stable in buffers of pH 4-8. In infected maize plants, streak disease initially manifests as minute, pale, circular spots on the lowest exposed portion of the youngest leaves. The only leaves that develop symptoms are those formed after infection, with older leaves remaining healthy. As the disease progresses, newer leaves emerge containing streaks up to several millimetres in length along the leaf veins, with primary veins being less affected than secondary or tertiary veins. The streaks are often fused laterally, appearing as narrow, broken, chlorotic stripes, which may extend over the entire length of severely affected leaves. Lesion colour generally varies from white to yellow, with some virus strains causing red pigmentation on maize leaves and abnormal shoot and flower bunching in grasses. Reduced photosynthesis and increased respiration usually lead to a reduction in leaf length and plant height; thus, maize plants infected at an early stage become severely stunted, producing undersized, misshapen cobs or giving no yield at all. Yield loss in susceptible maize is directly related to the time of infection: infected seedlings produce no yield or are killed, whereas plants infected at later times are proportionately less affected. Disease avoidance can be practised by only planting maize during the early season when viral inoculum loads are lowest. Leafhopper vectors can also be controlled with insecticides such as carbofuran. However, the development and use of streak-resistant cultivars is probably the most effective and economically viable means of preventing streak epidemics. Naturally occurring tolerance to MSV (meaning that, although plants become systemically infected, they do not suffer serious yield losses) has been found, which has primarily been attributed to a single gene, msv-1. However, other MSV resistance genes also exist and improved resistance has been achieved by concentrating these within individual maize genotypes. Whereas true MSV immunity (meaning that plants cannot be symptomatically infected by the virus) has been achieved in lines that include multiple small-effect resistance genes together with msv-1, it has proven difficult to transfer this immunity into commercial maize genotypes. An alternative resistance strategy using genetic engineering is currently being investigated in South Africa. http://www.mcb.uct.ac.za/MSV/mastrevirus.htm; http://www.danforthcenter.org/iltab/geminiviridae/geminiaccess/mastrevirus/Mastrevirus.htm.

Genotypic and Phenotypic Characteristics of Corynebacterium diphtheriae Strains Isolated from Patients in Belarus during an Epidemic Period

PubMed Central

Titov, Leonid; Kolodkina, Valentina; Dronina, Alina; Grimont, Francine; Grimont, Patrick A. D.; Lejay-Collin, Monique; de Zoysa, Aruni; Andronescu, Constantin; Diaconescu, Angela; Marin, Byanca; Efstratiou, Androulla

2003-01-01

One hundred two Corynebacterium diphtheriae strains (93 of the gravis biotype and nine of the mitis biotype) isolated from clinical cases during the Belarus diphtheria epidemic were characterized by biotyping, toxigenicity testing by the Elek test and an indirect hemagglutination assay, phage typing, and ribotyping. The gravis biotype strains were characterized as high and medium toxin producers, and strains of biotype mitis were characterized as low and medium toxin producers. Most strains (82 of 102) were distributed among five phage types. Seventy-two strains (64 of the gravis biotype and 8 of the mitis biotype) belonged to phage type VI ls5,34add. Hybridization of genomic DNA digested with BstEII and PvuII revealed five ribotype patterns, namely, D1, D4, D6, D7, and D13. The majority of gravis biotype strains belonged to ribotypes D1 (49 of 93) and D4 (33 of 93) and included one clonal group of C. diphtheriae. This clone predominated in all regions in Belarus. There was a statistical association between ribotypes and phage types but not between ribotypes and levels of toxin production. PMID:12624069

The role of China in the global spread of the current cholera pandemic.

PubMed

Didelot, Xavier; Pang, Bo; Zhou, Zhemin; McCann, Angela; Ni, Peixiang; Li, Dongfang; Achtman, Mark; Kan, Biao

2015-03-01

Epidemics and pandemics of cholera, a severe diarrheal disease, have occurred since the early 19th century and waves of epidemic disease continue today. Cholera epidemics are caused by individual, genetically monomorphic lineages of Vibrio cholerae: the ongoing seventh pandemic, which has spread globally since 1961, is associated with lineage L2 of biotype El Tor. Previous genomic studies of the epidemiology of the seventh pandemic identified three successive sub-lineages within L2, designated waves 1 to 3, which spread globally from the Bay of Bengal on multiple occasions. However, these studies did not include samples from China, which also experienced multiple epidemics of cholera in recent decades. We sequenced the genomes of 71 strains isolated in China between 1961 and 2010, as well as eight from other sources, and compared them with 181 published genomes. The results indicated that outbreaks in China between 1960 and 1990 were associated with wave 1 whereas later outbreaks were associated with wave 2. However, the previously defined waves overlapped temporally, and are an inadequate representation of the shape of the global genealogy. We therefore suggest replacing them by a series of tightly delineated clades. Between 1960 and 1990 multiple such clades were imported into China, underwent further microevolution there and then spread to other countries. China was thus both a sink and source during the pandemic spread of V. cholerae, and needs to be included in reconstructions of the global patterns of spread of cholera.

Genetic analysis of West Nile virus isolates from an outbreak in Idaho, United States, 2006-2007.

PubMed

Grinev, Andriyan; Chancey, Caren; Añez, Germán; Ball, Christopher; Winkelman, Valerie; Williamson, Phillip; Foster, Gregory A; Stramer, Susan L; Rios, Maria

2013-09-23

West Nile virus (WNV) appeared in the U.S. in 1999 and has since become endemic, with yearly summer epidemics causing tens of thousands of cases of serious disease over the past 14 years. Analysis of WNV strains isolated during the 2006-2007 epidemic seasons demonstrates that a new genetic variant had emerged coincidentally with an intense outbreak in Idaho during 2006. The isolates belonging to the new variant carry a 13 nt deletion, termed ID-Δ13, located at the variable region of the 3'UTR, and are genetically related. The analysis of deletions and insertions in the 3'UTR of two major lineages of WNV revealed the presence of conserved repeats and two indel motifs in the variable region of the 3'UTR. One human and two bird isolates from the Idaho 2006-2007 outbreaks were sequenced using Illumina technology and within-host variability was analyzed. Continued monitoring of new genetic variants is important for public health as WNV continues to evolve.

Seroepidemiologic Survey of Epidemic Cholera in Haiti to Assess Spectrum of Illness and Risk Factors for Severe Disease

PubMed Central

Jackson, Brendan R.; Talkington, Deborah F.; Pruckler, James M.; Fouché, M. D. Bernadette; Lafosse, Elsie; Nygren, Benjamin; Gómez, Gerardo A.; Dahourou, Georges A.; Archer, W. Roodly; Payne, Amanda B.; Hooper, W. Craig; Tappero, Jordan W.; Derado, Gordana; Magloire, Roc; Gerner-Smidt, Peter; Freeman, Nicole; Boncy, Jacques; Mintz, Eric D.

2013-01-01

To assess the spectrum of illness from toxigenic Vibrio cholerae O1 and risk factors for severe cholera in Haiti, we conducted a cross-sectional survey in a rural commune with more than 21,000 residents. During March 22–April 6, 2011, we interviewed 2,622 residents ≥ 2 years of age and tested serum specimens from 2,527 (96%) participants for vibriocidal and antibodies against cholera toxin; 18% of participants reported a cholera diagnosis, 39% had vibriocidal titers ≥ 320, and 64% had vibriocidal titers ≥ 80, suggesting widespread infection. Among seropositive participants (vibriocidal titers ≥ 320), 74.5% reported no diarrhea and 9.0% had severe cholera (reported receiving intravenous fluids and overnight hospitalization). This high burden of severe cholera is likely explained by the lack of pre-existing immunity in this population, although the virulence of the atypical El Tor strain causing the epidemic and other factors might also play a role. PMID:24106192

Genome Sequence of a Monoreassortant H1N1 Swine Influenza Virus Isolated from a Pig in Hungary

PubMed Central

Bányai, Krisztián; Kovács, Eszter; Tóth, Ádám György; Biksi, Imre; Szentpáli-Gavallér, Katalin; Bálint, Ádám; Dencső, László

2012-01-01

The genome of a porcine H1N1 influenza A strain is reported in this study. The strain proved to be a monoreassortant strain with a typical porcine N1 gene on the genetic backbone of the pandemic H1N1 influenza A virus strain. Monitoring of descendants of the pandemic 2009 H1N1 strain is needed because of concerns that more-virulent strains may emerge in forthcoming epidemic seasons. PMID:23118459

The new A/New Jersey/76 influenza strain (Memorandum)*

PubMed Central

1976-01-01

This Memorandum reviews the information available on the new strain of influenza virus, A/New Jersey/76 (Hsw1N1), that first appeared at Fort Dix, NJ, USA, in February 1976. Recommendations are given concerning measures to be taken to detect spread of this strain and to meet the challenge if an epidemic should occur. PMID:1085659

Genomic Structural Variations Affecting Virulence During Clonal Expansion of Pseudomonas syringae pv. actinidiae Biovar 3 in Europe

PubMed Central

Firrao, Giuseppe; Torelli, Emanuela; Polano, Cesare; Ferrante, Patrizia; Ferrini, Francesca; Martini, Marta; Marcelletti, Simone; Scortichini, Marco; Ermacora, Paolo

2018-01-01

Pseudomonas syringae pv. actinidiae (Psa) biovar 3 caused pandemic bacterial canker of Actinidia chinensis and Actinidia deliciosa since 2008. In Europe, the disease spread rapidly in the kiwifruit cultivation areas from a single introduction. In this study, we investigated the genomic diversity of Psa biovar 3 strains during the primary clonal expansion in Europe using single molecule real-time (SMRT), Illumina and Sanger sequencing technologies. We recorded evidences of frequent mobilization and loss of transposon Tn6212, large chromosome inversions, and ectopic integration of IS sequences (remarkably ISPsy31, ISPsy36, and ISPsy37). While no phenotype change associated with Tn6212 mobilization could be detected, strains CRAFRU 12.29 and CRAFRU 12.50 did not elicit the hypersensitivity response (HR) on tobacco and eggplant leaves and were limited in their growth in kiwifruit leaves due to insertion of ISPsy31 and ISPsy36 in the hrpS and hrpR genes, respectively, interrupting the hrp cluster. Both strains had been isolated from symptomatic plants, suggesting coexistence of variant strains with reduced virulence together with virulent strains in mixed populations. The structural differences caused by rearrangements of self-genetic elements within European and New Zealand strains were comparable in number and type to those occurring among the European strains, in contrast with the significant difference in terms of nucleotide polymorphisms. We hypothesize a relaxation, during clonal expansion, of the selection limiting the accumulation of deleterious mutations associated with genome structural variation due to transposition of mobile elements. This consideration may be relevant when evaluating strategies to be adopted for epidemics management. PMID:29675009

Survival of Acinetobacter baumannii on dry surfaces.

PubMed Central

Wendt, C; Dietze, B; Dietz, E; Rüden, H

1997-01-01

Acinetobacter spp. have frequently been reported to be the causative agents of hospital outbreaks. The circumstances of some outbreaks demonstrated the long survival of Acinetobacter in a dry, inanimate environment. In laboratory experiments, we compared the abilities of five Acinetobacter baumannii strains, three Acinetobacter sp. strains from the American Type Culture Collection (ATCC), one Escherichia coli ATCC strain, and one Enterococcus faecium ATCC strain to survive under dry conditions. Bacterial solutions of the 10 strains were inoculated onto four different material samples (ceramic, polyvinyl chloride, rubber, and stainless steel) and stored under defined conditions. We investigated the bacterial counts of the material samples immediately after inoculation, after drying, and after 4 h, 1 day, and 1, 2, 4, 8, and 16 weeks of storage. A statistical model was used to distribute the 40 resulting curves among four types of survival curves. The type of survival curve was significantly associated with the bacterial strain but not with the material. The ability of the A. baumannii strains to survive under dry conditions varied greatly and correlated well with the source of the strain. Strains isolated from dry sources survived better than those isolated from wet sources. An outbreak strain that had caused hospital-acquired respiratory tract infections survived better than the strains from wet sources, but not as well as strains from dry sources. Resistance to dry conditions may promote the transmissibility of a strain, but it is not sufficient to make a strain an epidemic one. However, in the case of an outbreak, sources of Acinetobacter must be expected in the dry environment. PMID:9163451

The Stochastic Multi-strain Dengue Model: Analysis of the Dynamics

NASA Astrophysics Data System (ADS)

Aguiar, Maíra; Stollenwerk, Nico; Kooi, Bob W.

2011-09-01

Dengue dynamics is well known to be particularly complex with large fluctuations of disease incidences. An epidemic multi-strain model motivated by dengue fever epidemiology shows deterministic chaos in wide parameter regions. The addition of seasonal forcing, mimicking the vectorial dynamics, and a low import of infected individuals, which is realistic in the dynamics of infectious diseases epidemics show complex dynamics and qualitatively a good agreement between empirical DHF monitoring data and the obtained model simulation. The addition of noise can explain the fluctuations observed in the empirical data and for large enough population size, the stochastic system can be well described by the deterministic skeleton.

The Asian house shrew Suncus murinus as a reservoir and source of human outbreaks of plague in Madagascar.

PubMed

Rahelinirina, Soanandrasana; Rajerison, Minoarisoa; Telfer, Sandra; Savin, Cyril; Carniel, Elisabeth; Duplantier, Jean-Marc

2017-11-01

Identifying key reservoirs for zoonoses is crucial for understanding variation in incidence. Plague re-emerged in Mahajanga, Madagascar in the 1990s but there has been no confirmed case since 1999. Here we combine ecological and genetic data, from during and after the epidemics, with experimental infections to examine the role of the shrew Suncus murinus in the plague epidemiological cycle. The predominance of S. murinus captures during the epidemics, their carriage of the flea vector and their infection with Yersinia pestis suggest they played an important role in the maintenance and transmission of plague. S. murinus exhibit a high but variable resistance to experimental Y. pestis infections, providing evidence of its ability to act as a maintenance host. Genetic analyses of the strains isolated from various hosts were consistent with two partially-linked transmission cycles, with plague persisting within the S. murinus population, occasionally spilling over into the rat and human populations. The recent isolation from a rat in Mahajanga of a Y. pestis strain genetically close to shrew strains obtained during the epidemics reinforces this hypothesis and suggests circulation of plague continues. The observed decline in S. murinus and Xenopsylla cheopis since the epidemics appears to have decreased the frequency of spillover events to the more susceptible rats, which act as a source of infection for humans. Although this may explain the lack of confirmed human cases in recent years, the current circulation of plague within the city highlights the continuing health threat.

Tracking the entry routes of hepatitis C virus as a surrogate of HIV in an HIV-low prevalence country, the Philippines.

PubMed

Kageyama, Seiji; Agdamag, Dorothy May D; Alesna, Evelyn T; Abellanosa-Tac-An, Ilya P; Corpuz, Aura C; Telan, Elizabeth Freda O; Que, Ernesto R; Leaño, Prisca Susan A; Jereza, Lourdes D; Emphasis, Yvonne Ethyl E; Prasetyo, Afiono A; Tanimoto, Tomoaki; Ichimura, Hiroshi

2009-07-01

From 2002 to 2007, 1,590 individuals were enrolled in an active surveillance program conducted in Metro Cebu, Philippines, where the anti-HCV-positive rate was significantly and constantly high among injecting drug users (83%, 793/960; 71-88%), especially among those living in downtown (89%, 683/770; 87-100%), despite the extremely low percentage of anti-HIV-positives (0.34%, 3/874). Sampling areas were then enlarged nationwide and the number of samples increased to 2,645 at the end of 2007. A total of 444 samples were positive for HCV RNA. Phylogenetic analysis based on NS5B and E1-E2 regions revealed that the most dominant HCV subtype was 1a, and followed by 2b, 2a, and 1b, and that the HCV strains had the largest variety in Metro Manila and its vicinity (P < 0.01). Interestingly, subtype 1b was detected solely in Metro Manila, and four HCV strains collected in this area showed higher homology to specific foreign strains retrieved from the Genbank/EMBL/DDBJ database with bootstrap values of 68-95% comparing with other strains analyzed in this nationwide study. These data suggest that HCV strains may be introduced occasionally into the Philippines possibly through Metro Manila as a main entry point. Considering the fact that an HIV epidemic started primarily via contaminated needle sharing in Asia, the constantly high rate of HCV infections and the newly introduced foreign HCV strains in the absence of HIV epidemic warrant further investigation on HCV entry and spread for early detection of an HIV epidemic in the Philippines. Copyright 2009 Wiley-Liss, Inc.

Molecular epidemiology of Vibrio cholerae associated with flood in Brahamputra River valley, Assam, India.

PubMed

Bhuyan, Soubhagya K; Vairale, Mohan G; Arya, Neha; Yadav, Priti; Veer, Vijay; Singh, Lokendra; Yadava, Pramod K; Kumar, Pramod

2016-06-01

Cholera is often caused when drinking water is contaminated through environmental sources. In recent years, the drastic cholera epidemics in Odisha (2007) and Haiti (2010) were associated with natural disasters (flood and Earthquake). Almost every year the state of Assam India witnesses flood in Brahamputra River valley during reversal of wind system (monsoon). This is often followed by outbreak of diarrheal diseases including cholera. Beside the incidence of cholera outbreaks, there is lack of experimental evidence for prevalence of the bacterium in aquatic environment and its association with cholera during/after flood in the state. A molecular surveillance during 2012-14 was carried out to study prevalence, strain differentiation, and clonality of Vibrio cholerae in inland aquatic reservoirs flooded by Brahamputra River in Assam. Water samples were collected, filtered, enriched in alkaline peptone water followed by selective culturing on thiosulfate bile salt sucrose agar. Environmental isolates were identified as V. cholerae, based on biochemical assays followed by sero-grouping and detailed molecular characterization. The incidence of the presence of the bacterium in potable water sources was higher after flood. Except one O1 isolate, all of the strains were broadly grouped under non-O1/non-O139 whereas some of them did have cholera toxin (CT). Surprisingly, we have noticed Haitian ctxB in two non-O1/non-O139 strains. MLST analyses based on pyrH, recA and rpoA genes revealed clonality in the environmental strains. The isolates showed varying degree of antimicrobial resistance including tetracycline and ciprofloxacin. The strains harbored the genetic elements SXT constins and integrons responsible for multidrug resistance. Genetic characterization is useful as phenotypic characters alone have proven to be unsatisfactory for strain discrimination. An assurance to safe drinking water, sanitation and monitoring of the aquatic reservoirs is of utmost importance for combating the impending epidemic threat in the flood affected areas. Further, the management of flood through multi-prong approaches and sustainable utilization of environmental resources would be effective in disease management. Copyright © 2015 Elsevier B.V. All rights reserved.

Modelling H5N1 in Bangladesh across spatial scales: Model complexity and zoonotic transmission risk.

PubMed

Hill, Edward M; House, Thomas; Dhingra, Madhur S; Kalpravidh, Wantanee; Morzaria, Subhash; Osmani, Muzaffar G; Yamage, Mat; Xiao, Xiangming; Gilbert, Marius; Tildesley, Michael J

2017-09-01

Highly pathogenic avian influenza H5N1 remains a persistent public health threat, capable of causing infection in humans with a high mortality rate while simultaneously negatively impacting the livestock industry. A central question is to determine regions that are likely sources of newly emerging influenza strains with pandemic causing potential. A suitable candidate is Bangladesh, being one of the most densely populated countries in the world and having an intensifying farming system. It is therefore vital to establish the key factors, specific to Bangladesh, that enable both continued transmission within poultry and spillover across the human-animal interface. We apply a modelling framework to H5N1 epidemics in the Dhaka region of Bangladesh, occurring from 2007 onwards, that resulted in large outbreaks in the poultry sector and a limited number of confirmed human cases. This model consisted of separate poultry transmission and zoonotic transmission components. Utilising poultry farm spatial and population information a set of competing nested models of varying complexity were fitted to the observed case data, with parameter inference carried out using Bayesian methodology and goodness-of-fit verified by stochastic simulations. For the poultry transmission component, successfully identifying a model of minimal complexity, which enabled the accurate prediction of the size and spatial distribution of cases in H5N1 outbreaks, was found to be dependent on the administration level being analysed. A consistent outcome of non-optimal reporting of infected premises materialised in each poultry epidemic of interest, though across the outbreaks analysed there were substantial differences in the estimated transmission parameters. The zoonotic transmission component found the main contributor to spillover transmission of H5N1 in Bangladesh was found to differ from one poultry epidemic to another. We conclude by discussing possible explanations for these discrepancies in transmission behaviour between epidemics, such as changes in surveillance sensitivity and biosecurity practices. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Life After USA300: The Rise and Fall of a Superbug

PubMed Central

2017-01-01

Abstract The community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA) epidemic in the United States is largely attributable to the meteoric rise of a single clone, referred to as USA300. This strain not only spread across the United States in just a few years to become the predominant cause of staphylococcal disease, but it also appears to have increased the overall number of skin and soft-tissue infections (SSTIs), increasing the overall disease burden. While USA300 still constitutes a major public health burden, its prevalence may be decreasing in some parts of the United States. Other than an epidemic in South America due to a closely related strain, USA300 also seems to have been largely unable to establish itself as an endemic infection in other geographic locations. While there have been several hypotheses put forward to explain the enormous success of USA300, the reasons for its failures and its potential fall remain obscure. Far from being unique to USA300, the rise and fall of specific clones of S. aureus in human populations seems to be a common process that has occurred multiple times and in multiple locations. This review charts the rise of USA300 and the evidence that suggests that it may be in decline, and it considers how best to understand the future spread, containment, and possible extinction of CA-MRSA. PMID:28375517

Lethality of First Contact Dysentery Epidemics on Pacific Islands

PubMed Central

Shanks, G. Dennis

2016-01-01

Infectious diseases depopulated many isolated Pacific islands when they were first exposed to global pathogen circulation from the 18th century. Although the mortality was great, the lack of medical observers makes determination of what happened during these historical epidemics largely speculative. Bacillary dysentery caused by Shigella is the most likely infection causing some of the most lethal island epidemics. The fragmentary historical record is reviewed to gain insight into the possible causes of the extreme lethality that was observed during first-contact epidemics in the Pacific. Immune aspects of the early dysentery epidemics and postmeasles infection resulting in subacute inflammatory enteric disease suggest that epidemiologic isolation was the major lethality risk factor on Pacific islands in the 19th century. Other possible risk factors include human leukocyte antigen homogeneity from a founder effect and pathogen-induced derangement of immune tolerance to gut flora. If this analysis is correct, then Pacific islands are currently at no greater risk of emerging disease epidemics than other developing countries despite their dark history. PMID:27185765

Characterization of a Zika Virus Isolate from Colombia

PubMed Central

Lahon, Anismrita; Arya, Ravi P.; Kneubehl, Alexander R.; Vogt, Megan B.; Dailey Garnes, Natalie J. M.; Rico-Hesse, Rebecca

2016-01-01

Background Zika virus (Flavivirus genus) is the first mosquito-borne virus known to cause high rates of microcephaly and abortion in humans. Typically, Zika virus causes a self-limiting, systemic illness; however, the current outbreak of Zika virus in the Americas has been associated with increased rates of fetal malformations and Guillain-Barré syndrome. Very few Zika virus isolates have been described in the literature, and live viruses are needed to perform studies of pathogenesis and to develop vaccines and treatments. Methodology/Clinical findings We isolated Zika virus, strain FLR, directly from the serum of an individual infected in Barranquilla, Colombia (December, 2015). Here, we describe the patient’s clinical course and characterize strain FLR by its growth characteristics in mosquito and mammalian cells and its partial resistance to UV-inactivation. The full genome sequence of FLR was also analyzed (including the 3’ un-translated region), to determine its probable geographic origin, and to pinpoint structural differences from other Zika virus strains. Conclusions/Significance We anticipate that the study of this low passage, clinical isolate of Zika virus, which is available for worldwide distribution, will help uncover the mechanisms of viral replication and host immune responses contributing to the varied and sometimes severe clinical presentations seen during the current epidemic in the Americas. PMID:27654889

[An epidemic of primary bacteremia due to an endemic strain of Serratia marcescens in an intensive care unit].

PubMed

Volkow-Fernández, P; Ponce de León-Rosales, S; Sifuentes-Osornio, J; Calva-Mercado, J J; Ruiz-Palacios, G M; Cerbón, M A

1993-01-01

An outbreak of Serratia marcescens bacteremia detected in the intensive care unit (ICU) of a tertiary care center on the last days of October, 1985, is described. The rate of primary S. marcescens nosocomial bacteremia during the pre-epidemic period (January-September 1985) was 6.25 per cent; and for the post-epidemic period compared with the epidemic were significantly different (p < 0.0001). The outbreak strains belonged to the biotype A8b, which has been endemic in our hospital. The responsible organism exhibited an unusual antimicrobial resistance pattern associated to the presence of a specific plasmid (greater than 50 kilobases), which showed similar fragments after restriction endonuclease digestion. No specific risk factors were identified in the case-control study. The outbreak was probably related to a greater influx of infected patients, resulting in less careful infection control measures, due to the emergency situation which suffered the hospital after the earthquakes in 1985. The unusual high rate of blood isolation of S. marcescens at the ICU was the first sign of the outbreak. The prompt reinforcement of infection control policies facilitated its resolution.

International dissemination of epidemic Vibrio cholerae by cargo ship ballast and other nonpotable waters.

PubMed

McCarthy, S A; Khambaty, F M

1994-07-01

In 1991 and 1992, toxigenic Vibrio cholerae O1, serotype Inaba, biotype El Tor, was recovered from nonpotable (ballast, bilge, and sewage) water from five cargo ships docked in ports of the U.S. Gulf of Mexico. Four of these ships had taken on ballast water in cholera-infected countries; the fifth took on ballast in a noninfected country. Isolates examined by pulsed-field gel electrophoresis were indistinguishable from the Latin American epidemic strain, C6707; however, they differed significantly from the endemic Gulf Coast strain (VRL 1984), the sixth-pandemic strain (569-B), and a V. cholerae non-O1 strain isolated from a ship arriving from a foreign port. On the basis of our findings, the Food and Drug Administration recommended that the U.S. Coast Guard issue an advisory to shipping agents and captains requesting that ballast waters be exchanged on the high seas before entry of ships into U.S. ports.

International dissemination of epidemic Vibrio cholerae by cargo ship ballast and other nonpotable waters.

PubMed Central

McCarthy, S A; Khambaty, F M

1994-01-01

In 1991 and 1992, toxigenic Vibrio cholerae O1, serotype Inaba, biotype El Tor, was recovered from nonpotable (ballast, bilge, and sewage) water from five cargo ships docked in ports of the U.S. Gulf of Mexico. Four of these ships had taken on ballast water in cholera-infected countries; the fifth took on ballast in a noninfected country. Isolates examined by pulsed-field gel electrophoresis were indistinguishable from the Latin American epidemic strain, C6707; however, they differed significantly from the endemic Gulf Coast strain (VRL 1984), the sixth-pandemic strain (569-B), and a V. cholerae non-O1 strain isolated from a ship arriving from a foreign port. On the basis of our findings, the Food and Drug Administration recommended that the U.S. Coast Guard issue an advisory to shipping agents and captains requesting that ballast waters be exchanged on the high seas before entry of ships into U.S. ports. Images PMID:8074532

Distribution and dynamics of epidemic and pandemic Vibrio parahaemolyticus virulence factors

PubMed Central

Ceccarelli, Daniela; Hasan, Nur A.; Huq, Anwar; Colwell, Rita R.

2013-01-01

Vibrio parahaemolyticus, autochthonous to estuarine, marine, and coastal environments throughout the world, is the causative agent of food-borne gastroenteritis. More than 80 serotypes have been described worldwide, based on antigenic properties of the somatic (O) and capsular (K) antigens. Serovar O3:K6 emerged in India in 1996 and subsequently was isolated worldwide, leading to the conclusion that the first V. parahaemolyticus pandemic had taken place. Most strains of V. parahaemolyticus isolated from the environment or seafood, in contrast to clinical strains, do not produce a thermostable direct hemolysin (TDH) and/or a TDH-related hemolysin (TRH). Type 3 secretion systems (T3SSs), needle-like apparatuses able to deliver bacterial effectors into host cytoplasm, were identified as triggering cytotoxicity and enterotoxicity. Type 6 secretion systems (T6SS) predicted to be involved in intracellular trafficking and vesicular transport appear to play a role in V. parahaemolyticus virulence. Recent advances in V. parahaemolyticus genomics identified several pathogenicity islands (VpaIs) located on either chromosome in both epidemic and pandemic strains and comprising additional colonization factors, such as restriction-modification complexes, chemotaxis proteins, classical bacterial surface virulence factors, and putative colicins. Furthermore, studies indicate strains lacking toxins and genomic regions associated with pathogenicity may also be pathogenic, suggesting other important virulence factors remain to be identified. The unique repertoire of virulence factors identified to date, their occurrence and distribution in both epidemic and pandemic strains worldwide are described, with the aim of highlighting the complexity of V. parahaemolyticus pathogenicity as well as its dynamic genome. PMID:24377090

Expanding ICU facilities in an epidemic: recommendations based on experience from the SARS epidemic in Hong Kong and Singapore.

PubMed

Gomersall, Charles D; Tai, Dessmon Y H; Loo, Shi; Derrick, James L; Goh, Mia Siang; Buckley, Thomas A; Chua, Catherine; Ho, Ka Man; Raghavan, Geeta P; Ho, Oi Man; Lee, Lay Beng; Joynt, Gavin M

2006-07-01

Epidemics have the potential to severely strain intensive care resources and may require an increase in intensive care capability. Few intensivists have direct experience of rapidly expanding intensive care services in response to an epidemic. This contribution presents the recommendations of an expert group from Hong Kong and Singapore who had direct experience of expanding intensive care services in response to the epidemic of severe acute respiratory syndrome. These recommendations cover training, infection control, staffing, communication and ethical issues. The issue of what equipment to purchase is not addressed. Early preparations should include fit testing of negative pressure respirators, training of reserve staff, sourcing of material for physical modifications to the ICU, development of infection control policies and training programmes, and discussion of triage and quarantine issues.

The first genetic characterization of a D4 measles virus strain derived from a patient with subacute sclerosing panencephalitis.

PubMed

Ivancic-Jelecki, Jelena; Baricevic, Marijana; Santak, Maja; Harcet, Matija; Tešović, Goran; Marusic Della Marina, Branka; Forcic, Dubravko

2013-07-01

Measles virus (MV) strains derived from patients with subacute sclerosing panencephalitis (SSPE), SSPE strains, possess numerous mutations when compared to viruses belonging to the same genotype and circulating in similar time period. Although many SSPE strains have been extensively characterized, none of them belongs to D4 genotype which currently predominates in Europe where it has caused a number of recent outbreaks/epidemics. We sequenced an MV derived from a patient with long-term SSPE; the virus was named MVs/Zagreb.CRO/30.06[D4] (SSPE). Initial genetic analysis showed that it belongs to D4 genotype. The sequences of genes encoding matrix and fusion proteins indicate premature protein terminations. Putative hemagglutin (H) protein is lengthened for 20 amino acids, which is the longest H protein elongation so far found in SSPE viruses. Nucleotides 1421 A, 1422 G, 1507 C and 1542 C in nucleoprotein gene open reading frame seem to be specific for this D4 strain, differentiating it from other D4 non-SSPE strains. Besides, a unique mutation at position 543 of H protein was found, histidine instead of tyrosine. As persistent MV infections are initially established by "normal" wild-type MV strains, the presented comparative analyses describe alterations that could be involved in the maintenance of persistent infection, disease development and progression. Copyright © 2013 Elsevier B.V. All rights reserved.

Enhanced nasopharyngeal infection and shedding associated with an epidemic lineage of emm3 group A Streptococcus.

PubMed

Afshar, Baharak; Turner, Claire E; Lamagni, Theresa L; Smith, Ken C; Al-Shahib, Ali; Underwood, Anthony; Holden, Matthew T G; Efstratiou, Androulla; Sriskandan, Shiranee

2017-10-03

A group A Streptococcus (GAS) lineage of genotype emm3, sequence type 15 (ST15) was associated with a 6 month upsurge in invasive GAS disease in the UK. The epidemic lineage (Lineage C) had lost 2 typical emm3 prophages, Φ315.1 and Φ315.2 associated with the superantigen ssa, but gained a different prophage (ΦUK-M3.1) associated with a different superantigen, speC and a DNAse spd1. The presence of speC and spd1 in Lineage C ST15 strains enhanced both in vitro mitogenic and DNase activities over non-Lineage C ST15 strains. Invasive disease models in Galleria mellonella and SPEC-sensitive transgenic mice, revealed no difference in overall invasiveness of Lineage C ST15 strains compared with non-Lineage C ST15 strains, consistent with clinical and epidemiological analysis. Lineage C strains did however markedly prolong murine nasal infection with enhanced nasal and airborne shedding compared with non-Lineage C strains. Deletion of speC or spd1 in 2 Lineage C strains identified a possible role for spd1 in airborne shedding from the murine nasopharynx. Nasopharyngeal infection and shedding of Lineage C strains was enhanced compared with non-Lineage C strains and this was, in part, mediated by the gain of the DNase spd1 through prophage acquisition.

Antibiotics resistance in El Tor Vibrio cholerae 01 isolated during cholera outbreaks in Mozambique from 2012 to 2015

PubMed Central

2017-01-01

Rationale Mozambique has recorded cyclically epidemic outbreaks of cholera. Antibiotic therapy is recommended in specific situations for management and control of cholera outbreaks. However, an increase in resistance rates to antibiotics by Vibrio cholerae has been reported in several epidemic outbreaks worldwide. On the other hand, there are few recent records of continuous surveillance of antibiotics susceptibility pattern of V. cholerae in Mozambique. Goals The purpose of this study was to evaluate antibiotics resistance pattern of Vibrio cholerae O1 Ogawa isolated during Cholera outbreaks in Mozambique to commonly used antibiotics. Methodology We analyzed data from samples received in the context of surveillance and response to Cholera outbreaks in the National Reference Laboratory of Microbiology from the National Institute of Health of Mozambique, 159 samples suspected of cholera from cholera treatment centers of, Metangula (09), Memba (01), Tete City (08), Moatize (01), Morrumbala (01) districts, City of Quelimane (01), Lichinga (06) and Nampula (86) districts, from 2012 to 2015. Laboratory culture and standard biochemical tests were employed to isolate and identify Vibrio cholerae; serotypes were determined by antisera agglutination reaction in blade. Biotype and presence of important virulence factors analysis was done by PCR. Antibiotics susceptibility pattern was detected by disk diffusion method Kirby Bauer. Antibiotic susceptibility and results were interpreted by following as per recommendations of CLSI (Clinical and Laboratory Standards Institute) 2014. All samples were collected and tested in the context of Africhol Project, approved by the National Bioethics Committee for Health. Results Among isolates from of Vibrio cholerae O1 El Tor Ogawa resistance to Sulphamethoxazole-trimethropim was 100% (53/53) to Trimethoprim-, being 100% (54/54) for Ampicillin, 99% (72/74) for Nalidixic Acid, 97% (64/66) to Chloramphenicol, 95% (42/44) for Nitrofurantoin and (19/20) Cotrimoxazole, 83% (80/97) Tetracycline, 56% (5/13) Doxycycline, 56% (39/70) Azithromycin and 0% (0/101) for Ciprofloxacin. PCR analysis suggested strains of V. cholerae O1 being descendants of the current seventh pandemic V. cholerae O1 CIRS 101 hybrid variant. The V. cholerae O1 currently causing cholera epidemics in north and central Mozambique confirmed a CTXΦ genotype and a molecular arrangement similar to the V. cholerae O1 CIRS 101. Conclusion Although V. cholerae infections in Mozambique are generally not treated with antibiotics circulating strains of the bacteria showed high frequency of in vitro resistance to available antibiotics. Continuous monitoring of antibiotic resistance pattern of epidemic strains is therefore crucial since the appearance of antibiotic resistance can influence cholera control strategies. PMID:28792540

Antibiotics resistance in El Tor Vibrio cholerae 01 isolated during cholera outbreaks in Mozambique from 2012 to 2015.

PubMed

Dengo-Baloi, Liliana Candida; Semá-Baltazar, Cynthia Amino; Manhique, Lena Vania; Chitio, Jucunu Elias; Inguane, Dorteia Luísa; Langa, José Paulo

2017-01-01

Mozambique has recorded cyclically epidemic outbreaks of cholera. Antibiotic therapy is recommended in specific situations for management and control of cholera outbreaks. However, an increase in resistance rates to antibiotics by Vibrio cholerae has been reported in several epidemic outbreaks worldwide. On the other hand, there are few recent records of continuous surveillance of antibiotics susceptibility pattern of V. cholerae in Mozambique. The purpose of this study was to evaluate antibiotics resistance pattern of Vibrio cholerae O1 Ogawa isolated during Cholera outbreaks in Mozambique to commonly used antibiotics. We analyzed data from samples received in the context of surveillance and response to Cholera outbreaks in the National Reference Laboratory of Microbiology from the National Institute of Health of Mozambique, 159 samples suspected of cholera from cholera treatment centers of, Metangula (09), Memba (01), Tete City (08), Moatize (01), Morrumbala (01) districts, City of Quelimane (01), Lichinga (06) and Nampula (86) districts, from 2012 to 2015. Laboratory culture and standard biochemical tests were employed to isolate and identify Vibrio cholerae; serotypes were determined by antisera agglutination reaction in blade. Biotype and presence of important virulence factors analysis was done by PCR. Antibiotics susceptibility pattern was detected by disk diffusion method Kirby Bauer. Antibiotic susceptibility and results were interpreted by following as per recommendations of CLSI (Clinical and Laboratory Standards Institute) 2014. All samples were collected and tested in the context of Africhol Project, approved by the National Bioethics Committee for Health. Among isolates from of Vibrio cholerae O1 El Tor Ogawa resistance to Sulphamethoxazole-trimethropim was 100% (53/53) to Trimethoprim-, being 100% (54/54) for Ampicillin, 99% (72/74) for Nalidixic Acid, 97% (64/66) to Chloramphenicol, 95% (42/44) for Nitrofurantoin and (19/20) Cotrimoxazole, 83% (80/97) Tetracycline, 56% (5/13) Doxycycline, 56% (39/70) Azithromycin and 0% (0/101) for Ciprofloxacin. PCR analysis suggested strains of V. cholerae O1 being descendants of the current seventh pandemic V. cholerae O1 CIRS 101 hybrid variant. The V. cholerae O1 currently causing cholera epidemics in north and central Mozambique confirmed a CTXΦ genotype and a molecular arrangement similar to the V. cholerae O1 CIRS 101. Although V. cholerae infections in Mozambique are generally not treated with antibiotics circulating strains of the bacteria showed high frequency of in vitro resistance to available antibiotics. Continuous monitoring of antibiotic resistance pattern of epidemic strains is therefore crucial since the appearance of antibiotic resistance can influence cholera control strategies.

Plague Outbreak in Libya, 2009, Unrelated to Plague in Algeria

PubMed Central

Cabanel, Nicolas; Leclercq, Alexandre; Chenal-Francisque, Viviane; Annajar, Badereddin; Rajerison, Minoarisoa; Bekkhoucha, Souad; Bertherat, Eric

2013-01-01

After 25 years of no cases of plague, this disease recurred near Tobruk, Libya, in 2009. An epidemiologic investigation identified 5 confirmed cases. We determined ribotypes, Not1 restriction profiles, and IS100 and IS1541 hybridization patterns of strains isolated during this outbreak. We also analyzed strains isolated during the 2003 plague epidemic in Algeria to determine whether there were epidemiologic links between the 2 events. Our results demonstrate unambiguously that neighboring but independent plague foci coexist in Algeria and Libya. They also indicate that these outbreaks were most likely caused by reactivation of organisms in local or regional foci believed to be dormant (Libya) or extinct (Algeria) for decades, rather than by recent importation of Yersinia pestis from distant foci. Environmental factors favorable for plague reemergence might exist in this area and lead to reactivation of organisms in other ancient foci. PMID:23347743

A review on current status of antiviral siRNA.

PubMed

Qureshi, Abid; Tantray, Vaqar Gani; Kirmani, Altaf Rehman; Ahangar, Abdul Ghani

2018-04-15

Viral diseases like influenza, AIDS, hepatitis, and Ebola cause severe epidemics worldwide. Along with their resistant strains, new pathogenic viruses continue to be discovered so creating an ongoing need for new antiviral treatments. RNA interference is a cellular gene-silencing phenomenon in which sequence-specific degradation of target mRNA is achieved by means of complementary short interfering RNA (siRNA) molecules. Short interfering RNA technology affords a potential tractable strategy to combat viral pathogenesis because siRNAs are specific, easy to design, and can be directed against multiple strains of a virus by targeting their conserved gene regions. In this review, we briefly summarize the current status of siRNA therapy for representative examples from different virus families. In addition, other aspects like their design, delivery, medical significance, bioinformatics resources, and limitations are also discussed. Copyright © 2018 John Wiley & Sons, Ltd.

Plague outbreak in Libya, 2009, unrelated to plague in Algeria.

PubMed

Cabanel, Nicolas; Leclercq, Alexandre; Chenal-Francisque, Viviane; Annajar, Badereddin; Rajerison, Minoarisoa; Bekkhoucha, Souad; Bertherat, Eric; Carniel, Elisabeth

2013-02-01

After 25 years of no cases of plague, this disease recurred near Tobruk, Libya, in 2009. An epidemiologic investigation identified 5 confirmed cases. We determined ribotypes, Not1 restriction profiles, and IS100 and IS1541 hybridization patterns of strains isolated during this outbreak. We also analyzed strains isolated during the 2003 plague epidemic in Algeria to determine whether there were epidemiologic links between the 2 events. Our results demonstrate unambiguously that neighboring but independent plague foci coexist in Algeria and Libya. They also indicate that these outbreaks were most likely caused by reactivation of organisms in local or regional foci believed to be dormant (Libya) or extinct (Algeria) for decades, rather than by recent importation of Yersinia pestis from distant foci. Environmental factors favorable for plague reemergence might exist in this area and lead to reactivation of organisms in other ancient foci.

Isolation and Characterization of a Novel Tembusu Virus Circulating in Muscovy Ducks in South China.

PubMed

Yan, Z; Shen, H; Wang, Z; Lin, W; Xie, Q; Bi, Y; Chen, F

2017-10-01

Duck Tembusu virus (DTMUV) is an infectious pathogen that can cause epidemics in egg-laying ducks. Here, we isolated and characterized a DTMUV, designated GDLH01, thought to be responsible for the noticeable egg drop in Muscovy duck flocks in South China since 2011. The genome sequence of GDLH01 shared 97-99% homology with other avian-origin Tembusu viruses, and 99.5% homology with the mosquito-borne strain SDMS recently reported in China. Phylogenetic analysis based on the nucleotide sequence of the entire open reading frame confirmed that the isolate was of avian origin and closely related to a mosquito-borne strain. Our findings characterize a novel Tembusu virus circulating in Muscovy ducks in South China and emphasize the importance of reinforcing biosecurity measures and developing vaccines to prevent the spread of this viral pathogen. © 2016 Blackwell Verlag GmbH.

Experimental pig-to-pig transmission dynamics for African swine fever virus, Georgia 2007/1 strain.

PubMed

Guinat, C; Gubbins, S; Vergne, T; Gonzales, J L; Dixon, L; Pfeiffer, D U

2016-01-01

African swine fever virus (ASFV) continues to cause outbreaks in domestic pigs and wild boar in Eastern European countries. To gain insights into its transmission dynamics, we estimated the pig-to-pig basic reproduction number (R 0) for the Georgia 2007/1 ASFV strain using a stochastic susceptible-exposed-infectious-recovered (SEIR) model with parameters estimated from transmission experiments. Models showed that R 0 is 2·8 [95% confidence interval (CI) 1·3-4·8] within a pen and 1·4 (95% CI 0·6-2·4) between pens. The results furthermore suggest that ASFV genome detection in oronasal samples is an effective diagnostic tool for early detection of infection. This study provides quantitative information on transmission parameters for ASFV in domestic pigs, which are required to more effectively assess the potential impact of strategies for the control of between-farm epidemic spread in European countries.

[Epidemic parotiditis, a reportable disease].

PubMed

Boverhoff, J C; Baart, J A

2013-01-01

Three consecutive patients with an acute swelling of one of the cheeks, were diagnosed with epidemic parotiditis. The first phase of the diagnostic procedure for an acute cheek swelling is to eliminate the possibility of odontogenic causes. When odontogenic problems have been excluded, non-dentition-related causes may be considered. An acute, progressive swelling in the preauricular area can often be attributed to an inflammation of the parotid gland, but epidemic parotiditis should also be considered. Epidemic parotiditis, or mumps, is caused by the mumps virus. Contamination occurs aerogenically. In the Netherlands, mumps vaccine is an ingredient of the governmental combined mump-measles-rubella inoculation programme. However, in recent years several small-scale parotiditis epidemics have broken out, predominantly among young, inoculated adults. Oropharyngeal mucus and blood samples are needed to diagnose the disease. Each case of the disease should be reported to the community healthcare service.

Culex pipiens, an Experimental Efficient Vector of West Nile and Rift Valley Fever Viruses in the Maghreb Region

PubMed Central

Amraoui, Fadila; Krida, Ghazi; Bouattour, Ali; Rhim, Adel; Daaboub, Jabeur; Harrat, Zoubir; Boubidi, Said-Chawki; Tijane, Mhamed; Sarih, Mhammed; Failloux, Anna-Bella

2012-01-01

West Nile fever (WNF) and Rift Valley fever (RVF) are emerging diseases causing epidemics outside their natural range of distribution. West Nile virus (WNV) circulates widely and harmlessly in the old world among birds as amplifying hosts, and horses and humans as accidental dead-end hosts. Rift Valley fever virus (RVFV) re-emerges periodically in Africa causing massive outbreaks. In the Maghreb, eco-climatic and entomologic conditions are favourable for WNV and RVFV emergence. Both viruses are transmitted by mosquitoes belonging to the Culex pipiens complex. We evaluated the ability of different populations of Cx. pipiens from North Africa to transmit WNV and the avirulent RVFV Clone 13 strain. Mosquitoes collected in Algeria, Morocco, and Tunisia during the summer 2010 were experimentally infected with WNV and RVFV Clone 13 strain at titers of 107.8 and 108.5 plaque forming units/mL, respectively. Disseminated infection and transmission rates were estimated 14–21 days following the exposure to the infectious blood-meal. We show that 14 days after exposure to WNV, all mosquito st developed a high disseminated infection and were able to excrete infectious saliva. However, only 69.2% of mosquito strains developed a disseminated infection with RVFV Clone 13 strain, and among them, 77.8% were able to deliver virus through saliva. Thus, Cx. pipiens from the Maghreb are efficient experimental vectors to transmit WNV and to a lesser extent, RVFV Clone 13 strain. The epidemiologic importance of our findings should be considered in the light of other parameters related to mosquito ecology and biology. PMID:22693557

Ten putative contributors to the obesity epidemic

USDA-ARS?s Scientific Manuscript database

The obesity epidemic is a global issue and shows no signs of abating, while the cause of this epidemic remains unclear. Marketing practices of energy-dense foods and institutionally-driven declines in physical activity are the alleged perpetrators for the epidemic, despite a lack of solid evidence t...

Virulence determinants of pandemic influenza viruses

PubMed Central

Tscherne, Donna M.; García-Sastre, Adolfo

2011-01-01

Influenza A viruses cause recurrent, seasonal epidemics and occasional global pandemics with devastating levels of morbidity and mortality. The ability of influenza A viruses to adapt to various hosts and undergo reassortment events ensures constant generation of new strains with unpredictable degrees of pathogenicity, transmissibility, and pandemic potential. Currently, the combination of factors that drives the emergence of pandemic influenza is unclear, making it impossible to foresee the details of a future outbreak. Identification and characterization of influenza A virus virulence determinants may provide insight into genotypic signatures of pathogenicity as well as a more thorough understanding of the factors that give rise to pandemics. PMID:21206092

Amino acid and structural variability of Yersinia pestis LcrV protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anisimov, A P; Dentovskaya, S V; Panfertsev, E A

2009-11-09

The LcrV protein is a multifunctional virulence factor and protective antigen of the plague bacterium which is generally conserved between the epidemic strains of Yersinia pestis. They investigated the diversity in the LcrV sequences among non-epidemic Y. pestis strains which have a limited virulence in selected animal models and for humans. Sequencing of lcrV genes from ten Y. pestis strains belonging to different phylogenetic groups (subspecies) showed that the LcrV proteins possess four major variable hotspots at positions 18, 72, 273, and 324-326. These major variations, together with other minor substitutions in amino acid sequences, allowed them to classify themore » LcrV alleles into five sequence types (A-E). They observed that the strains of different Y. pestis subspecies can have the same typ of LcrV, and different types of LcrV can exist within the same natural plague focus. The LcrV polymorphisms were structurally analyzed by comparing the modeled structures of LcrV from all available strains. All changes except one occurred either in flexible regions or on the surface of the protein, but local chemical properties (i.e. those of a hydrophobic, hydrophilic, amphipathic, or charged nature) were conserved across all of the strains. Polymorphisms in flexible and surface regions are likely subject to less selective pressure, and have a limited impact on the structure. In contrast, the substitution of tryptophan at position 113 with either glutamic acid or glycine likely has a serious influence on the regional structure of the protein, and these mutations might have an effect on the function of LcrV. The polymorphisms at positions 18, 72 and 273 were accountable for differences in oligomerization of LcrV. The importance of the latter property in emergence of epidemic strains of Y. pestis during evolution of this pathogen will need to be further investigated.« less

Attenuation of an original US porcine epidemic diarrhea virus strain PC22A via serial cell culture passage.

PubMed

Lin, Chun-Ming; Hou, Yixuan; Marthaler, Douglas G; Gao, Xiang; Liu, Xinsheng; Zheng, Lanlan; Saif, Linda J; Wang, Qiuhong

2017-03-01

Although porcine epidemic diarrhea (PED) has caused huge economic losses in the pork industry worldwide, an effective live, attenuated vaccine is lacking. In this study, an original US, highly virulent PED virus (PEDV) strain PC22A was serially passaged in Vero CCL81 and Vero BI cells. The virus growth kinetics in cell culture, virulence in neonatal pigs and the whole genomic sequences of selected passages were examined. Increased virus titers and sizes of syncytia were observed at the 65th passage level (P65) and P120, respectively. Based on the severity of clinical signs, histopathological lesions and the distribution of PEDV antigens in the gut, the virulence of P100 and above, but not P95C13 (CCL81), was markedly reduced in 4-day-old, caesarian-derived, colostrum-deprived piglets. Subsequently, the attenuation of P120 and P160 was confirmed in 4-day-old, conventional suckling piglets. Compared with P120, P160 replicated less efficiently in the intestine of pigs and induced a lower rate of protection after challenge. Sequence analysis revealed that the virulent viruses [P3 and P95C13 (CCL81)] had one, one, sixteen (including an early termination of nine amino acids) and two amino acid differences in non-structure protein 1 (nsp1), nsp4, spike and membrane proteins, respectively, from the fully attenuated P160. However, the overall pattern of attenuation-related genetic changes in PC22A differed from those of the other four pairs of PEDV wild type strains and their attenuated derivatives. These results suggest that PEDV attenuation can occur through multiple molecular mechanisms. The knowledge provides insights into potential molecular mechanisms of PEDV attenuation. Copyright © 2017 Elsevier B.V. All rights reserved.

Comparative analysis of the virulence characteristics of epidemic methicillin-resistant Staphylococcus aureus (MRSA) strains isolated from Chinese children: ST59 MRSA highly expresses core gene-encoded toxin.

PubMed

Li, Shipeng; Sun, Jing; Zhang, Jianzhong; Li, Xiangmei; Tao, Xiaoxia; Wang, Lijuan; Sun, Mingjiao; Liu, Yingchao; Li, Juan; Qiao, Yanhong; Yu, Sangjie; Yao, Kaihu; Yang, Yonghong; Shen, Xuzhuang

2014-02-01

This study aims to investigate the prevalence of a novel cell wall-anchored protein gene, sasX, and to obtain information on the genetic basis for the pathogenic potential of the MRSA strains isolated from Chinese children. The molecular and virulence characteristics of the clinical strains were analyzed. Twenty-two sequence types (STs) were obtained, with six epidemic clones ST59, ST239, ST1, ST910, ST88, and ST338 accounting for 35.8, 22, 6.6, 6.6, 5.3, and 4.1% respectively. The expression levels of hla, psmα, and RNAIII were higher in ST59 than in other STs (p < 0.05). The sasX gene was detected in 26 (10.7%) MRSA isolates. ST239-MRSA-SCCmecIII-t037 (61.5%) was the predominant sasX-positive MRSA clone. The expressions of PSMα and RNAIII were higher in sasX-positive ST239 isolates than in sasX-negative ST239 ones (p < 0.01). Notably, the percentage of invasive infection in infections caused by sasX-positive ST239 MRSA was higher than that by sasX-negative ST239 MRSA (p = 0.008). This study indicated that ST59 was the predominant clone in the MRSA isolates obtained from Chinese children and might have stronger pathogenic potential. The prevalence of the sasX gene in the MRSA isolates from children was relatively low. Furthermore, the sasX gene might be related to the expressions of PSMα and RNAIII and infection invasiveness. © 2013 APMIS Published by John Wiley & Sons Ltd.

Insight into the molecular basis of pathogen abundance: group A Streptococcus inhibitor of complement inhibits bacterial adherence and internalization into human cells.

PubMed

Hoe, Nancy P; Ireland, Robin M; DeLeo, Frank R; Gowen, Brian B; Dorward, David W; Voyich, Jovanka M; Liu, Mengyao; Burns, Eugene H; Culnan, Derek M; Bretscher, Anthony; Musser, James M

2002-05-28

Streptococcal inhibitor of complement (Sic) is a secreted protein made predominantly by serotype M1 Group A Streptococcus (GAS), which contributes to persistence in the mammalian upper respiratory tract and epidemics of human disease. Unexpectedly, an isogenic sic-negative mutant adhered to human epithelial cells significantly better than the wild-type parental strain. Purified Sic inhibited the adherence of a sic negative serotype M1 mutant and of non-Sic-producing GAS strains to human epithelial cells. Sic was rapidly internalized by human epithelial cells, inducing cell flattening and loss of microvilli. Ezrin and moesin, human proteins that functionally link the cytoskeleton to the plasma membrane, were identified as Sic-binding proteins by affinity chromatography and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis. Sic colocalized with ezrin inside epithelial cells and bound to the F-actin-binding site region located in the carboxyl terminus of ezrin and moesin. Synthetic peptides corresponding to two regions of Sic had GAS adherence-inhibitory activity equivalent to mature Sic and inhibited binding of Sic to ezrin. In addition, the sic mutant was phagocytosed and killed by human polymorphonuclear leukocytes significantly better than the wild-type strain, and Sic colocalized with ezrin in discrete regions of polymorphonuclear leukocytes. The data suggest that binding of Sic to ezrin alters cellular processes critical for efficient GAS contact, internalization, and killing. Sic enhances bacterial survival by enabling the pathogen to avoid the intracellular environment. This process contributes to the abundance of M1 GAS in human infections and their ability to cause epidemics.

The molecular epidemiology of influenza viruses: a lesson from a highly epidemic season.

PubMed

D'Agaro, P; Rossi, T; Burgnich, P; Molin, G Dal; Coppola, N; Rocco, G; Campello, C

2008-03-01

To analyse the epidemiological and molecular features of a long-lasting epidemic (12 weeks) of influenza in north-eastern Italy during the 2004-05 season. Morbidity rates were analysed by time and age. Influenza virus isolates (93 strains) were submitted to antigenic evaluation by haemagglutination inhibition test and to molecular assessment by sequencing. The incidence peak (16.4 per thousand) was the highest recorded over the last six years in north-eastern Italy. The epidemic was sustained by two subsequent waves of circulating viruses: an H3N2 variant and two type B variants, respectively. In addition, scattered isolation of an H1N1 variant occurred. Antigenic and molecular characterisation showed the emergence of an H3N2 virus drifted with respect to vaccine strain, which also had a substantial impact on morbidity in vaccinated subjects. Moreover, a single K145N substitution in the HA1 site of H3N2 was the starting point of two evolutionary branches. No change was observed in H1N1 isolates. B-type virus was mainly represented by Victoria-lineage strains, though Yamagata-lineage viruses were also identified. The fluctuating circulation of these two clades has characterised B virus epidemics in recent years. The assessment of the H3N2 molecular change in this area was in line with results used for establishing the vaccine composition for the incoming season. The particular epidemiological features of two B virus clades, namely Yamagata-like and Victoria-like, may be considered for introduction into the influenza vaccine.

The Asian house shrew Suncus murinus as a reservoir and source of human outbreaks of plague in Madagascar

PubMed Central

Rajerison, Minoarisoa; Telfer, Sandra; Savin, Cyril; Carniel, Elisabeth; Duplantier, Jean-Marc

2017-01-01

Identifying key reservoirs for zoonoses is crucial for understanding variation in incidence. Plague re-emerged in Mahajanga, Madagascar in the 1990s but there has been no confirmed case since 1999. Here we combine ecological and genetic data, from during and after the epidemics, with experimental infections to examine the role of the shrew Suncus murinus in the plague epidemiological cycle. The predominance of S. murinus captures during the epidemics, their carriage of the flea vector and their infection with Yersinia pestis suggest they played an important role in the maintenance and transmission of plague. S. murinus exhibit a high but variable resistance to experimental Y. pestis infections, providing evidence of its ability to act as a maintenance host. Genetic analyses of the strains isolated from various hosts were consistent with two partially-linked transmission cycles, with plague persisting within the S. murinus population, occasionally spilling over into the rat and human populations. The recent isolation from a rat in Mahajanga of a Y. pestis strain genetically close to shrew strains obtained during the epidemics reinforces this hypothesis and suggests circulation of plague continues. The observed decline in S. murinus and Xenopsylla cheopis since the epidemics appears to have decreased the frequency of spillover events to the more susceptible rats, which act as a source of infection for humans. Although this may explain the lack of confirmed human cases in recent years, the current circulation of plague within the city highlights the continuing health threat. PMID:29155827

Cellular and molecular investigations of the adhesion and mechanics of Listeria monocytogenes

NASA Astrophysics Data System (ADS)

Eskhan, Asma Omar

Atomic force microscopy has been used to quantify the adherence and mechanical properties of an array of L. monocytogenes strains and their surface biopolymers. First, eight L. monocytogenes strains that represented the two major lineages of the species were compared for their adherence and mechanics at cellular and molecular levels. Our results indicated that strains of lineage' II were characterized by higher adhesion and Young's moduli, longer and more rigid surface biopolymers and lower specific and nonspecific forces when compared to lineage' I strains. Additionally, adherence and mechanical properties of eight L. monocytogenes epidemic and environmental strains were probed. Our results pointed to that environmental and epidemic strains representative of a given lineage were similar in their adherence and mechanical properties when investigated at a cellular level. However, when the molecular properties of the strains were considered, epidemic strains were characterized by higher specific and nonspecific forces, shorter, denser and more flexible biopolymers compared to environmental strains. Second, the role of environmental pH conditions of growth on the adhesion and mechanics of a pathogenic L. monocytogenes EGDe was investigated. Our results pointed to a transition in the adhesion energies for cells cultured at pH 7. In addition, when the types of molecular forces that govern the adhesion were quantified using Poisson statistical approach and using a new proposed method, specific hydrogen-bond energies dominated the bacterial adhesion process. Such a finding is instrumental to researchers designing methods to control bacterial adhesion. Similarly, bacterial cells underwent a transition in their mechanical properties. We have shown that cells cultured at pH 7 were the most rigid compared to those cultured in lower or higher pH conditions of growth. Due to transitions observed in adherence and mechanics when cells were cultured at pH 7, we hypothesized that adhesion and mechanics are correlated. To test this hypothesis, nonadhesive and adhesive models of contact mechanics were used to estimate Young's moduli. Our results indicated that the nonadhesive model of contact mechanics estimated 18 % more rigid bacterial cells. Our results thus point to the importance of considering molecular details when investigating bacterial adhesion and mechanics.

Phylogenetic analysis of Tomato spotted wilt virus (TSWV) NSs protein demonstrates the isolated emergence of resistance-breaking strains in pepper.

PubMed

Almási, Asztéria; Csilléry, Gábor; Csömör, Zsófia; Nemes, Katalin; Palkovics, László; Salánki, Katalin; Tóbiás, István

2015-02-01

Resurgence of Tomato spotted wilt virus (TSWV) worldwide as well as in Hungary causing heavy economic losses directed the attention to the factors contributing to the outbreak of this serious epidemics. The introgression of Tsw resistance gene into various pepper cultivars seemed to solve TSWV control, but widely used resistant pepper cultivars bearing the same, unique resistance locus evoked the rapid emergence of resistance-breaking (RB) TSWV strains. In Hungary, the sporadic appearance of RB strains in pepper-producing region was first observed in 2010-2011, but in 2012 it was detected frequently. Previously, the non-structural protein (NSs) encoded by small RNA (S RNA) of TSWV was verified as the avirulence factor for Tsw resistance, therefore we analyzed the S RNA of the Hungarian RB and wild type (WT) isolates and compared to previously analyzed TSWV strains with RB properties from different geographical origins. Phylogenetic analysis demonstrated that the different RB strains had the closest relationship with the local WT isolates and there is no conserved mutation present in all the NSs genes of RB isolates from different geographical origins. According to these results, we concluded that the RB isolates evolved separately in geographic point of view, and also according to the RB mechanism.

Inactivation of Campylobacter jejuni by chlorine and monochloramine.

PubMed Central

Blaser, M J; Smith, P F; Wang, W L; Hoff, J C

1986-01-01

Campylobacter jejuni and closely related organisms are important bacterial causes of acute diarrheal illness in the United States. Both endemic and epidemic infections have been associated with consuming untreated or improperly treated surface water. We compared susceptibility of three C. jejuni strains and Escherichia coli ATCC 11229 with standard procedures used to disinfect water. Inactivation of bacterial preparations with 0.1 mg of chlorine and 1.0 mg of monochloramine per liter was determined at pH 6 and 8 and at 4 and 25 degrees C. Under virtually every condition tested, each of the three C. jejuni strains was more susceptible than the E. coli control strain, with greater than 99% inactivation after 15 min of contact with 1.0 mg of monochloramine per liter or 5 min of contact with 0.1 mg of free chlorine per liter. Results of experiments in which an antibiotic-containing medium was used suggest that a high proportion of the remaining cells were injured. An animal-passaged C. jejuni strain was as susceptible to chlorine disinfection as were laboratory-passaged strains. These results suggest that disinfection procedures commonly used for treatment of drinking water to remove coliform bacteria are adequate to eliminate C. jejuni and further correlate with the absence of outbreaks associated with properly treated water. PMID:3954344

Extensive T cell cross-reactivity between diverse seasonal influenza strains in the ferret model.

PubMed

Reber, Adrian J; Music, Nedzad; Kim, Jin Hyang; Gansebom, Shane; Chen, Jufu; York, Ian

2018-04-17

Influenza virus causes widespread, yearly epidemics by accumulating surface protein mutations to escape neutralizing antibodies established from prior exposure. In contrast to antibody epitopes, T cell mediated immunity targets influenza epitopes that are more highly conserved and have potential for cross-protection. The extent of T cell cross-reactivity between a diverse array of contemporary and historical influenza strains was investigated in ferrets challenged with 2009 pandemic H1N1 influenza or the seasonal H3N2 strain, A/Perth/16/2009. Post-challenge cell-mediated immune responses demonstrated extensive cross-reactivity with a wide variety of contemporary and historical influenza A strains as well as influenza B. Responses in peripheral blood were undetectable by 36d post-challenge, but cross-reactivity persisted in spleen. The strongest responses targeted peptides from the NP protein and demonstrated cross-reactivity in both the CD4+ and CD8+ T cell populations. Cross-reactive CD4+ T cells also targeted HA and NA epitopes, while cross-reactive CD8+ T cells targeted internal M1, NS2, and PA. T cell epitopes demonstrated extensive cross-reactivity between diverse influenza strains in outbred animals, with NP implicated as a significant antigenic target demonstrating extensive cross-reactivity for both CD4+ and CD8+ T cells.

[Genetic Characterization of Hemagglutinin on Measles Virus Epidemic Strain Genotype H1a in Liaoning Province (China) from 1997 to 2014].

PubMed

Wang, Yan; Ma, Yan; Xu, Xiaoting; Hao, Shuang; Han, Yue; Yao, Wenqing; Zhao, Zhuo

2015-07-01

To wished to characterize the hemagglutinin (H) gene of the measles virus epidemic strain H1a in Liaoning Province (China) from 1997-2014 to provide a basis for the control and elimination of measles. All 63 measles virus strains were the H1a genotype. Fragments of the H gene (1854 nucleotides) and nucleoprotein (N) gene (450 nucleotides) were amplified by reverse transcription-polymerase chain reaction (RT-PCR) and the PCR products sequenced and analyzed. Phylogenetic-trees were constructed with reference strains of the genotype-H measles virus downloaded from GenBank, including Chinese measles virus strains isolated in 1993-1994 and the vaccine reference strains S-191 and C-47. Sixty-three strains of the measles virus in 1997-2014 belonged to genotype H1a. The mean evolutionary rate for gene N-450 was higher than that for the H gene. All 63 strains of the measles virus were mutated from: serine (Ser S) to asparagine (Asn N) in the 240th amino acid; arginine (Arg R) to glycine (Gly G) in the 243th; and tyrosine (Tyr Y) to Asn N in the 481th amino acid. All measles virus strains in cluster 2 were mutated from proline (Pro P) to leucine (Leu L) in the 397th amino acid. The other neutralization sites showed no apparent difference when comparing the nucleotides/amino acids of the H gene of S191 vaccine strains.

Analysis of Multilocus Sequence Typing and Virulence Characterization of Listeria monocytogenes Isolates from Chinese Retail Ready-to-Eat Food

PubMed Central

Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Guo, Weipeng

2016-01-01

Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE) food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST), virulence-associate genes, epidemic clones (ECs), and sequence analysis of the important virulence factor: internalin A (inlA). The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs). With the exception of four new STs (ST804, ST805, ST806, and ST807), all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly, and llsX) were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80) of strains harbored the listeriolysin S genes (llsX). A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80) of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC) within a novel PMSCs at position 326 (GAA → TAA). MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen. PMID:26909076

Analysis of Multilocus Sequence Typing and Virulence Characterization of Listeria monocytogenes Isolates from Chinese Retail Ready-to-Eat Food.

PubMed

Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Guo, Weipeng

2016-01-01

Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE) food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST), virulence-associate genes, epidemic clones (ECs), and sequence analysis of the important virulence factor: internalin A (inlA). The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs). With the exception of four new STs (ST804, ST805, ST806, and ST807), all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly, and llsX) were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80) of strains harbored the listeriolysin S genes (llsX). A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80) of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC) within a novel PMSCs at position 326 (GAA → TAA). MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.

Valine/isoleucine variants drive selective pressure in the VP1 sequence of EV-A71 enteroviruses.

PubMed

Duy, Nghia Ngu; Huong, Le Thi Thanh; Ravel, Patrice; Huong, Le Thi Song; Dwivedi, Ankit; Sessions, October Michael; Hou, Yan'An; Chua, Robert; Kister, Guilhem; Afelt, Aneta; Moulia, Catherine; Gubler, Duane J; Thiem, Vu Dinh; Thanh, Nguyen Thi Hien; Devaux, Christian; Duong, Tran Nhu; Hien, Nguyen Tran; Cornillot, Emmanuel; Gavotte, Laurent; Frutos, Roger

2017-05-08

In 2011-2012, Northern Vietnam experienced its first large scale hand foot and mouth disease (HFMD) epidemic. In 2011, a major HFMD epidemic was also reported in South Vietnam with fatal cases. This 2011-2012 outbreak was the first one to occur in North Vietnam providing grounds to study the etiology, origin and dynamic of the disease. We report here the analysis of the VP1 gene of strains isolated throughout North Vietnam during the 2011-2012 outbreak and before. The VP1 gene of 106 EV-A71 isolates from North Vietnam and 2 from Central Vietnam were sequenced. Sequence alignments were analyzed at the nucleic acid and protein level. Gene polymorphism was also analyzed. A Factorial Correspondence Analysis was performed to correlate amino acid mutations with clinical parameters. The sequences were distributed into four phylogenetic clusters. Three clusters corresponded to the subgenogroup C4 and the last one corresponded to the subgenogroup C5. Each cluster displayed different polymorphism characteristics. Proteins were highly conserved but three sites bearing only Isoleucine (I) or Valine (V) were characterized. The isoleucine/valine variability matched the clusters. Spatiotemporal analysis of the I/V variants showed that all variants which emerged in 2011 and then in 2012 were not the same but were all present in the region prior to the 2011-2012 outbreak. Some correlation was found between certain I/V variants and ethnicity and severity. The 2011-2012 outbreak was not caused by an exogenous strain coming from South Vietnam or elsewhere but by strains already present and circulating at low level in North Vietnam. However, what triggered the outbreak remains unclear. A selective pressure is applied on I/V variants which matches the genetic clusters. I/V variants were shown on other viruses to correlate with pathogenicity. This should be investigated in EV-A71. I/V variants are an easy and efficient way to survey and identify circulating EV-A71 strains.

Epidemic Pseudomonas aeruginosa infection in patients with cystic fibrosis is not a risk factor for poor clinical Outcomes following lung transplantation.

PubMed

Pritchard, Julia; Thakrar, Mitesh V; Somayaji, Ranjani; Surette, Michael G; Rabin, Harvey R; Helmersen, Doug; Lien, Dale; Purighalla, Swathi; Waddell, Barbara; Parkins, Michael D

2016-05-01

Epidemic strains of Pseudomonas aeruginosa (ePA) causing infection in cystic fibrosis (CF) have been commonly identified from clinics around the world. ePA disproportionally impacts CF patient pre-transplant outcomes manifesting in increased exacerbation frequency, worsened treatment burden and increased rate of lung function decline, and disproportionally leads to death and/or transplantation. As other CF factors such as pre-transplant infection with multi-resistant organisms, and isolation of P. aeruginosa in the post transplant graft, may impact post-transplant outcomes, we sought to determine if infection with ePA similarly adversely impact post-transplant outcomes. Between 1991-2014, 53 CF patients from our center received lung transplants. Bacterial strain typing was performed retrospectively on isolates collected prior to transplantation. Comprehensive chart reviews were performed to obtain baseline patient characteristics and post-transplant outcomes. Of the 53 transplanted patients, 57% of patients were infected with ePA prior to transplant; the other 43% of patients had unique strains of P. aeruginosa. Mean age at transplant was 29.0years for ePA and 33.3years for unique (p=0.04). There were no differences in overall survival (HR=0.75, 95% CI 0.31-1.79), bronchiolitis obliterans syndrome (BOS) free survival (HR 1.43, 95% CI 0.54-4.84) or all other assessed outcomes including exacerbation frequency, chronic renal failure, acute cellular rejections, Aspergillus infection, airway stenosis, and post-transplant lymphoproliferative disorder. Unlike pre-transplant outcomes, CF patients infected with ePA do not experience worse post-transplant outcomes than those infected with unique strains. Therefore, lung transplantation should be considered for all patients with P. aeruginosa infection and end stage lung disease, irrespective of infection with ePA. Copyright © 2015 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

Lethality of First Contact Dysentery Epidemics on Pacific Islands.

PubMed

Shanks, G Dennis

2016-08-03

Infectious diseases depopulated many isolated Pacific islands when they were first exposed to global pathogen circulation from the 18th century. Although the mortality was great, the lack of medical observers makes determination of what happened during these historical epidemics largely speculative. Bacillary dysentery caused by Shigella is the most likely infection causing some of the most lethal island epidemics. The fragmentary historical record is reviewed to gain insight into the possible causes of the extreme lethality that was observed during first-contact epidemics in the Pacific. Immune aspects of the early dysentery epidemics and postmeasles infection resulting in subacute inflammatory enteric disease suggest that epidemiologic isolation was the major lethality risk factor on Pacific islands in the 19th century. Other possible risk factors include human leukocyte antigen homogeneity from a founder effect and pathogen-induced derangement of immune tolerance to gut flora. If this analysis is correct, then Pacific islands are currently at no greater risk of emerging disease epidemics than other developing countries despite their dark history. © The American Society of Tropical Medicine and Hygiene.

The HIV-1 Epidemic: Low- to Middle-Income Countries

PubMed Central

Shao, Yiming; Williamson, Carolyn

2012-01-01

Low- to middle-income countries bear the overwhelming burden of the human immunodeficiency virus type 1 (HIV-1) epidemic in terms of the numbers of their citizens living with HIV/AIDS (acquired immunodeficiency syndrome), the high degrees of viral diversity often involving multiple HIV-1 clades circulating within their populations, and the social and economic factors that compromise current control measures. Distinct epidemics have emerged in different geographical areas. These epidemics differ in their severity, the population groups they affect, their associated risk behaviors, and the viral strains that drive them. In addition to inflicting great human cost, the high burden of HIV infection has a major impact on the social and economic development of many low- to middle-income countries. Furthermore, the high degrees of viral diversity associated with multiclade HIV epidemics impacts viral diagnosis and pathogenicity and treatment and poses daunting challenges for effective vaccine development. PMID:22393534

Epidemics of mold poisoning past and present.

PubMed

Meggs, William J

2009-01-01

Molds are ubiquitous throughout the biosphere of planet earth and cause infectious, allergic, and toxic diseases. Toxic diseases arise from exposure to mycotoxins produced by molds. Throughout history, there have been a number of toxic epidemics associated with exposure to mycotoxins. Acute epidemics of ergotism are caused by consumption of grain infested by fungi of the genus Claviceps, which produce the bioactive amine ergotamine that mimics the neurotransmitters norepinephrine, serotonin, and dopamine. Acute aflatoxin outbreaks have occurred from ingestion of corn stored in damp conditions that potentiate growth of the molds of the species Aspergillus. Contemporary construction methods that use cellulose substrates such as fiber board and indoor moisture have caused an outbreak of contaminated buildings with Stachybotrys chartarum, with the extent of health effects still a subject of debate and ongoing research. This article reviews several of the more prominent epidemics and discusses the nature of the toxins. Two diseases that were leading causes of childhood mortality in England in the 1970s and vanished with changing dietary habits, putrid malignant fever, and slow nervous fever were most likely toxic mold epidemics.

Advances in the Microbiome: Applications to Clostridium difficile Infection

PubMed Central

Culligan, Eamonn P.; Sleator, Roy D.

2016-01-01

Clostridium difficile is a major cause of morbidity and mortality worldwide, causing over 400,000 infections and approximately 29,000 deaths in the United States alone each year. C. difficile is the most common cause of nosocomial diarrhoea in the developed world, and, in recent years, the emergence of hyper-virulent (mainly ribotypes 027 and 078, sometimes characterised by increased toxin production), epidemic strains and an increase in the number of community-acquired infections has caused further concern. Antibiotic therapy with metronidazole, vancomycin or fidaxomicin is the primary treatment for C. difficile infection (CDI). However, CDI is unique, in that, antibiotic use is also a major risk factor for acquiring CDI or recurrent CDI due to disruption of the normal gut microbiota. Therefore, there is an urgent need for alternative, non-antibiotic therapeutics to treat or prevent CDI. Here, we review a number of such potential treatments which have emerged from advances in the field of microbiome research. PMID:27657145

Cholera between 1991 and 1997 in Mexico Was Associated with Infection by Classical, El Tor, and El Tor Variants of Vibrio cholerae▿

PubMed Central

Alam, Munirul; Nusrin, Suraia; Islam, Atiqul; Bhuiyan, Nurul A.; Rahim, Niaz; Delgado, Gabriela; Morales, Rosario; Mendez, Jose Luis; Navarro, Armando; Gil, Ana I.; Watanabe, Haruo; Morita, Masatomo; Nair, G. Balakrish; Cravioto, Alejandro

2010-01-01

Vibrio cholerae O1 biotype El Tor (ET), the cause of the current 7th pandemic, has recently been replaced in Asia and Africa by an altered ET biotype possessing cholera toxin (CTX) of the classical (CL) biotype that originally caused the first six pandemics before becoming extinct in the 1980s. Until recently, the ET prototype was the biotype circulating in Peru; a detailed understanding of the evolutionary trend of V. cholerae causing endemic cholera in Latin America is lacking. The present retrospective microbiological, molecular, and phylogenetic study of V. cholerae isolates recovered in Mexico (n = 91; 1983 to 1997) shows the existence of the pre-1991 CL biotype and the ET and CL biotypes together with the altered ET biotype in both epidemic and endemic cholera between 1991 and 1997. According to sero- and biotyping data, the altered ET, which has shown predominance in Mexico since 1991, emerged locally from ET and CL progenitors that were found coexisting until 1997. In Latin America, ET and CL variants shared a variable number of phenotypic markers, while the altered ET strains had genes encoding the CL CTX (CTXCL) prophage, ctxBCL and rstRCL, in addition to resident rstRET, as the underlying regional signature. The distinct regional fingerprints for ET in Mexico and Peru and their divergence from ET in Asia and Africa, as confirmed by subclustering patterns in a pulsed-field gel electrophoresis (NotI)-based dendrogram, suggest that the Mexico epidemic in 1991 may have been a local event and not an extension of the epidemics occurring in Asia and South America. Finally, the CL biotype reservoir in Mexico is unprecedented and must have contributed to the changing epidemiology of global cholera in ways that need to be understood. PMID:20668130

Cholera between 1991 and 1997 in Mexico was associated with infection by classical, El Tor, and El Tor variants of Vibrio cholerae.

PubMed

Alam, Munirul; Nusrin, Suraia; Islam, Atiqul; Bhuiyan, Nurul A; Rahim, Niaz; Delgado, Gabriela; Morales, Rosario; Mendez, Jose Luis; Navarro, Armando; Gil, Ana I; Watanabe, Haruo; Morita, Masatomo; Nair, G Balakrish; Cravioto, Alejandro

2010-10-01

Vibrio cholerae O1 biotype El Tor (ET), the cause of the current 7th pandemic, has recently been replaced in Asia and Africa by an altered ET biotype possessing cholera toxin (CTX) of the classical (CL) biotype that originally caused the first six pandemics before becoming extinct in the 1980s. Until recently, the ET prototype was the biotype circulating in Peru; a detailed understanding of the evolutionary trend of V. cholerae causing endemic cholera in Latin America is lacking. The present retrospective microbiological, molecular, and phylogenetic study of V. cholerae isolates recovered in Mexico (n = 91; 1983 to 1997) shows the existence of the pre-1991 CL biotype and the ET and CL biotypes together with the altered ET biotype in both epidemic and endemic cholera between 1991 and 1997. According to sero- and biotyping data, the altered ET, which has shown predominance in Mexico since 1991, emerged locally from ET and CL progenitors that were found coexisting until 1997. In Latin America, ET and CL variants shared a variable number of phenotypic markers, while the altered ET strains had genes encoding the CL CTX (CTX(CL)) prophage, ctxB(CL) and rstR(CL), in addition to resident rstR(ET), as the underlying regional signature. The distinct regional fingerprints for ET in Mexico and Peru and their divergence from ET in Asia and Africa, as confirmed by subclustering patterns in a pulsed-field gel electrophoresis (NotI)-based dendrogram, suggest that the Mexico epidemic in 1991 may have been a local event and not an extension of the epidemics occurring in Asia and South America. Finally, the CL biotype reservoir in Mexico is unprecedented and must have contributed to the changing epidemiology of global cholera in ways that need to be understood.

New vaccines against influenza virus

PubMed Central

Lee, Young-Tae; Kim, Ki-Hye; Ko, Eun-Ju; Lee, Yu-Na; Kim, Min-Chul; Kwon, Young-Man; Tang, Yinghua; Cho, Min-Kyoung; Lee, Youn-Jeong

2014-01-01

Vaccination is one of the most effective and cost-benefit interventions that prevent the mortality and reduce morbidity from infectious pathogens. However, the licensed influenza vaccine induces strain-specific immunity and must be updated annually based on predicted strains that will circulate in the upcoming season. Influenza virus still causes significant health problems worldwide due to the low vaccine efficacy from unexpected outbreaks of next epidemic strains or the emergence of pandemic viruses. Current influenza vaccines are based on immunity to the hemagglutinin antigen that is highly variable among different influenza viruses circulating in humans and animals. Several scientific advances have been endeavored to develop universal vaccines that will induce broad protection. Universal vaccines have been focused on regions of viral proteins that are highly conserved across different virus subtypes. The strategies of universal vaccines include the matrix 2 protein, the hemagglutinin HA2 stalk domain, and T cell-based multivalent antigens. Supplemented and/or adjuvanted vaccination in combination with universal target antigenic vaccines would have much promise. This review summarizes encouraging scientific advances in the field with a focus on novel vaccine designs. PMID:24427759

Occurrence and phylogenetic analysis of bovine respiratory syncytial virus in outbreaks of respiratory disease in Norway

PubMed Central

2014-01-01

Background Bovine respiratory syncytial virus (BRSV) is one of the major pathogens involved in the bovine respiratory disease (BRD) complex. The seroprevalence to BRSV in Norwegian cattle herds is high, but its role in epidemics of respiratory disease is unclear. The aims of the study were to investigate the etiological role of BRSV and other respiratory viruses in epidemics of BRD and to perform phylogenetic analysis of Norwegian BRSV strains. Results BRSV infection was detected either serologically and/or virologically in 18 (86%) of 21 outbreaks and in most cases as a single viral agent. When serology indicated that bovine coronavirus and/or bovine parainfluenza virus 3 were present, the number of BRSV positive animals in the herd was always higher, supporting the view of BRSV as the main pathogen. Sequencing of the G gene of BRSV positive samples showed that the current circulating Norwegian BRSVs belong to genetic subgroup II, along with other North European isolates. One isolate from an outbreak in Norway in 1976 was also investigated. This strain formed a separate branch in subgroup II, clearly different from the current Scandinavian sequences. The currently circulating BRSV could be divided into two different strains that were present in the same geographical area at the same time. The sequence variations between the two strains were in an antigenic important part of the G protein. Conclusion The results demonstrated that BRSV is the most important etiological agent of epidemics of BRD in Norway and that it often acts as the only viral agent. The phylogenetic analysis of the Norwegian strains of BRSV and several previously published isolates supported the theory of geographical and temporal clustering of BRSV. PMID:24423030

Clinical, virological and epidemiological characterization of dengue outbreak in Myanmar, 2015.

PubMed

Kyaw, A K; Ngwe Tun, M M; Moi, M L; Nabeshima, T; Soe, K T; Thwe, S M; Myint, A A; Maung, K T T; Aung, W; Hayasaka, D; Buerano, C C; Thant, K Z; Morita, K

2017-07-01

Hospital-based surveillance was conducted at two widely separated regions in Myanmar during the 2015 dengue epidemic. Acute phase serum samples were collected from 332 clinically diagnosed dengue patients during the peak season of dengue cases. Viremia levels were measured by quantitative real-time PCR and plaque assays using FcγRIIA-expressing and non-FcγRIIA-expressing BHK cells to specifically determine the infectious virus particles. By serology and molecular techniques, 280/332 (84·3%) were confirmed as dengue patients. All four serotypes of dengue virus (DENV) were isolated from among 104 laboratory-confirmed patients including two cases infected with two DENV serotypes. High percentage of primary infection was noted among the severe dengue patients. Patients with primary infection or DENV IgM negative demonstrated significantly higher viral loads but there was no significant difference among the severity groups. Viremia levels among dengue patients were notably high for a long period which was assumed to support the spread of the virus by the mosquito vector during epidemic. Phylogenetic analyses of the envelope gene of the epidemic strains revealed close similarity with the strains previously isolated in Myanmar and neighboring countries. DENV-1 dominated the epidemic in 2015 and the serotype (except DENV-3) and genotype distributions were similar in both study sites.

A murine model of infection with Rickettsia prowazekii: implications for pathogenesis of epidemic typhus.

PubMed

Bechah, Yassina; Capo, Christian; Grau, Georges E; Raoult, Didier; Mege, Jean-Louis

2007-06-01

Epidemic typhus remains a major disease threat, furthermore, its etiologic agent, Rickettsia prowazekii, is classified as a bioterrorism agent. We describe here a murine model of epidemic typhus that reproduced some features of the human disease. When BALB/c mice were inoculated intravenously with R. prowazekii (Breinl strain), they survived but did not clear R. prowazekii infection. Immunohistological analysis of tissues and quantitative PCR showed that R. prowazekii was present in blood, liver, lungs and brain 1 day after infection and persisted for at least 9 days. Importantly, infected mice developed interstitial pneumonia, with consolidation of the alveoli, hemorrhages in lungs, multifocal granulomas in liver, and hemorrhages in brain, as seen in humans. Circulating antibodies directed against R. prowazekii were detected at day 4 post-infection and steadily increased for up to 21 days, demonstrating that R. prowazekii lesions were independent of humoral immune response. R. prowazekii-induced lesions were associated with inflammatory response, as demonstrated by elevated levels of inflammatory cytokines including interferon-gamma, tumor necrosis factor and the CC chemokine RANTES in the lesions. We concluded that the BALB/c mouse strain provides a useful model for studying the pathogenic mechanisms of epidemic typhus and its control by the immune system.

Cholera Outbreaks in Nigeria Are Associated with Multidrug Resistant Atypical El Tor and Non-O1/Non-O139 Vibrio cholerae

PubMed Central

Marin, Michel A.; Thompson, Cristiane C.; Freitas, Fernanda S.; Fonseca, Erica L.; Aboderin, A. Oladipo; Zailani, Sambo B.; Quartey, Naa Kwarley E.; Okeke, Iruka N.; Vicente, Ana Carolina P.

2013-01-01

Background The current millennium has seen a steep rise in the number, size and case-fatalities of cholera outbreaks in many African countries. Over 40,000 cases of cholera were reported from Nigeria in 2010. Variants of Vibrio cholerae O1 El Tor biotype have emerged but very little is known about strains causing cholera outbreaks in West Africa, which is crucial for the implementation of interventions to control epidemic cholera. Methodology/Principal Findings V. cholerae isolates from outbreaks of acute watery diarrhea in Nigeria from December, 2009 to October, 2010 were identified by standard culture methods. Fifteen O1 and five non-O1/non-O139 strains were analyzed; PCR and sequencing targeted regions associated with virulence, resistance and biotype were performed. We also studied genetic interrelatedness among the strains by multilocus sequence analysis and pulsed-field gel electrophoresis. The antibiotic susceptibility was tested by the disk diffusion method and E-test. We found that multidrug resistant atypical El Tor strains, with reduced susceptibility to ciprofloxacin and chloramphenicol, characterized by the presence of the SXT element, and gyrA Ser83Ile/parC Ser85Leu alleles as well CTX phage and TCP cluster characterized by rstR ElTor, ctxB-7 and tcpA CIRS alleles, respectively, were largely responsible for cholera outbreaks in 2009 and 2010. We also identified and characterized a V. cholerae non-O1/non-O139 lineage from cholera-like diarrhea cases in Nigeria. Conclusions/Significance The recent Nigeria outbreaks have been determined by multidrug resistant atypical El Tor and non-O1/non-O139 V. cholerae strains, and it seems that the typical El Tor, from the beginning of seventh cholera pandemic, is no longer epidemic/endemic in this country. This scenario is similar to the East Africa, Asia and Caribbean countries. The detection of a highly virulent, antimicrobial resistant lineage in Nigeria is worrisome and points to a need for vaccine-based control of the disease. This study has also revealed the putative importance of non-O1/non-O139 V. cholerae in diarrheal disease in Nigeria. PMID:23459673

Genomic Variation and Evolution of Vibrio parahaemolyticus ST36 over the Course of a Transcontinental Epidemic Expansion.

PubMed

Martinez-Urtaza, Jaime; van Aerle, Ronny; Abanto, Michel; Haendiges, Julie; Myers, Robert A; Trinanes, Joaquin; Baker-Austin, Craig; Gonzalez-Escalona, Narjol

2017-11-14

Vibrio parahaemolyticus is the leading cause of seafood-related infections with illnesses undergoing a geographic expansion. In this process of expansion, the most fundamental change has been the transition from infections caused by local strains to the surge of pandemic clonal types. Pandemic clone sequence type 3 (ST3) was the only example of transcontinental spreading until 2012, when ST36 was detected outside the region where it is endemic in the U.S. Pacific Northwest causing infections along the U.S. northeast coast and Spain. Here, we used genome-wide analyses to reconstruct the evolutionary history of the V. parahaemolyticus ST36 clone over the course of its geographic expansion during the previous 25 years. The origin of this lineage was estimated to be in ~1985. By 1995, a new variant emerged in the region and quickly replaced the old clone, which has not been detected since 2000. The new Pacific Northwest (PNW) lineage was responsible for the first cases associated with this clone outside the Pacific Northwest region. After several introductions into the northeast coast, the new PNW clone differentiated into a highly dynamic group that continues to cause illness on the northeast coast of the United States. Surprisingly, the strains detected in Europe in 2012 diverged from this ancestral group around 2000 and have conserved genetic features present only in the old PNW lineage. Recombination was identified as the major driver of diversification, with some preliminary observations suggesting a trend toward a more specialized lifestyle, which may represent a critical element in the expansion of epidemics under scenarios of coastal warming. IMPORTANCE Vibrio parahaemolyticus and Vibrio cholerae represent the only two instances of pandemic expansions of human pathogens originating in the marine environment. However, while the current pandemic of V. cholerae emerged more than 50 years ago, the global expansion of V. parahaemolyticus is a recent phenomenon. These modern expansions provide an exceptional opportunity to study the evolutionary process of these pathogens at first hand and gain an understanding of the mechanisms shaping the epidemic dynamics of these diseases, in particular, the emergence, dispersal, and successful introduction in new regions facilitating global spreading of infections. In this study, we used genomic analysis to examine the evolutionary divergence that has occurred over the course of the most recent transcontinental expansion of a pathogenic Vibrio , the spreading of the V. parahaemolyticus sequence type 36 clone from the region where it is endemic on the Pacific coast of North America to the east coast of the United States and finally to the west coast of Europe.

Meningococcal B Vaccination (4CMenB) in Infants and Toddlers

PubMed Central

Esposito, Susanna; Tagliabue, Claudia; Bosis, Samantha

2015-01-01

Neisseria meningitidis is a Gram-negative pathogen that actively invades its human host and leads to the development of life-threatening pathologies. One of the leading causes of death in the world, N. meningitidis can be responsible for nearly 1,000 new infections per 100,000 subjects during an epidemic period. The bacterial species are classified into 12 serogroups, five of which (A, B, C, W, and Y) cause the majority of meningitides. The three purified protein conjugate vaccines currently available target serogroups A, C, W, and Y. Serogroup B has long been a challenge but the discovery of the complete genome sequence of an MenB strain has allowed the development of a specific four-component vaccine (4CMenB). This review describes the pathogenetic role of N. meningitidis and the recent literature concerning the new meningococcal vaccine. PMID:26351647

Genetic Analysis of West Nile Virus Isolates from an Outbreak in Idaho, United States, 2006–2007

PubMed Central

Grinev, Andriyan; Chancey, Caren; Añez, Germán; Ball, Christopher; Winkelman, Valerie; Williamson, Phillip; Foster, Gregory A.; Stramer, Susan L.; Rios, Maria

2013-01-01

West Nile virus (WNV) appeared in the U.S. in 1999 and has since become endemic, with yearly summer epidemics causing tens of thousands of cases of serious disease over the past 14 years. Analysis of WNV strains isolated during the 2006–2007 epidemic seasons demonstrates that a new genetic variant had emerged coincidentally with an intense outbreak in Idaho during 2006. The isolates belonging to the new variant carry a 13 nt deletion, termed ID-Δ13, located at the variable region of the 3′UTR, and are genetically related. The analysis of deletions and insertions in the 3′UTR of two major lineages of WNV revealed the presence of conserved repeats and two indel motifs in the variable region of the 3′UTR. One human and two bird isolates from the Idaho 2006–2007 outbreaks were sequenced using Illumina technology and within-host variability was analyzed. Continued monitoring of new genetic variants is important for public health as WNV continues to evolve. PMID:24065039

The absence of a flagellum leads to altered colony morphology, biofilm development and virulence in Vibrio cholerae O139

PubMed Central

Watnick, Paula I.; Lauriano, Crystal M.; Klose, Karl E.; Croal, Laura; Kolter, Roberto

2010-01-01

Summary Throughout most of history, epidemic and pandemic cholera was caused by Vibrio cholerae of the serogroup O1. In 1992, however, a V. cholerae strain of the serogroup O139 emerged as a new agent of epidemic cholera. Interestingly, V. cholerae O139 forms biofilms on abiotic surfaces more rapidly than V. cholerae O1 biotype El Tor, perhaps because regulation of exopolysaccharide synthesis in V. cholerae O139 differs from that in O1 El Tor. Here, we show that all flagellar mutants of V. cholerae O139 have a rugose colony morphology that is dependent on the vps genes. This suggests that the absence of the flagellar structure constitutes a signal to increase exopolysaccharide synthesis. Furthermore, although exopolysaccharide production is required for the development of a three-dimensional biofilm, inappropriate exopolysaccharide production leads to inefficient colonization of the infant mouse intestinal epithelium by flagellar mutants. Thus, precise regulation of exopolysaccharide synthesis is an important factor in the survival of V. cholerae O139 in both aquatic environments and the mammalian intestine. PMID:11136445

Lessons learned during active epidemiological surveillance of Ebola and Marburg viral hemorrhagic fever epidemics in Africa.

PubMed

Allaranga, Yokouide; Kone, Mamadou Lamine; Formenty, Pierre; Libama, Francois; Boumandouki, Paul; Woodfill, Celia J I; Sow, Idrissa; Duale, Sambe; Alemu, Wondimagegnehu; Yada, Adamou

2010-03-01

To review epidemiological surveillance approaches used during Ebola and Marburg hemorrhagic fever epidemics in Africa in the past fifteen years. Overall, 26 hemorrhagic epidemic outbreaks have been registered in 12 countries; 18 caused by the Ebola virus and eight by the Marburg virus. About 2551 cases have been reported, among which 268 were health workers (9,3%). Based on articles and epidemic management reports, this review analyses surveillance approaches, route of introduction of the virus into the population (urban and rural), the collaboration between the human health sector and the wildlife sector and factors that have affected epidemic management. Several factors affecting the epidemiological surveillance during Ebola and Marburg viruses hemorrhagic epidemics have been observed. During epidemics in rural settings, outbreak investigations have shown multiple introductions of the virus into the human population through wildlife. In contrast, during epidemics in urban settings a single introduction of the virus in the community was responsible for the epidemic. Active surveillance is key to containing outbreaks of Ebola and Marburg viruses Collaboration with those in charge of the conservation of wildlife is essential for the early detection of viral hemorrhagic fever epidemics. Hemorrhagic fever epidemics caused by Ebola and Marburg viruses are occurring more and more frequently in Sub-Saharan Africa and only an adapted epidemiological surveillance system will allow for early detection and effective response.

Phylogenetic analysis of canine distemper virus in South America clade 1 reveals unique molecular signatures of the local epidemic.

PubMed

Fischer, Cristine D B; Gräf, Tiago; Ikuta, Nilo; Lehmann, Fernanda K M; Passos, Daniel T; Makiejczuk, Aline; Silveira, Marcos A T; Fonseca, André S K; Canal, Cláudio W; Lunge, Vagner R

2016-07-01

Canine distemper virus (CDV) is a highly contagious pathogen for domestic dogs and several wild carnivore species. In Brazil, natural infection of CDV in dogs is very high due to the large non-vaccinated dog population, a scenario that calls for new studies on the molecular epidemiology. This study investigates the phylodynamics and amino-acid signatures of CDV epidemic in South America by analyzing a large dataset compiled from publicly available sequences and also by collecting new samples from Brazil. A population of 175 dogs with canine distemper (CD) signs was sampled, from which 89 were positive for CDV, generating 42 new CDV sequences. Phylogenetic analysis of the new and publicly available sequences revealed that Brazilian sequences mainly clustered in South America 1 (SA1) clade, which has its origin estimated to the late 1980's. The reconstruction of the demographic history in SA1 clade showed an epidemic expanding until the recent years, doubling in size every nine years. SA1 clade epidemic distinguished from the world CDV epidemic by the emergence of the R580Q strain, a very rare and potentially detrimental substitution in the viral genome. The R580Q substitution was estimated to have happened in one single evolutionary step in the epidemic history in SA1 clade, emerging shortly after introduction to the continent. Moreover, a high prevalence (11.9%) of the Y549H mutation was observed among the domestic dogs sampled here. This finding was associated (p<0.05) with outcome-death and higher frequency in mixed-breed dogs, the later being an indicator of a continuous exchange of CDV strains circulating among wild carnivores and domestic dogs. The results reported here highlight the diversity of the worldwide CDV epidemic and reveal local features that can be valuable for combating the disease. Copyright © 2016 Elsevier B.V. All rights reserved.

Monitoring the fitness of antiviral-resistant influenza strains during an epidemic: A mathematical modeling study

PubMed Central

Leung, Kathy; Lipsitch, Marc; Yuen, Kwok Yung; Wu, Joseph T

2017-01-01

Summary Background Antivirals (e.g. oseltamivir) are important for mitigating influenza epidemics. In 2007, an oseltamivir-resistant seasonal A(H1N1) strain emerged and spread to global fixation within one year. This showed that antiviral-resistant (AVR) strains can be intrinsically more transmissible than their contemporaneous antiviral-sensitive (AVS) counterpart. Surveillance of AVR fitness is therefore essential. Methods We define the fitness of AVR strains as their reproductive number relative to their co-circulating AVS counterparts. We develop a simple method for real-time estimation of AVR fitness from surveillance data. This method requires only information on generation time without other specific details regarding transmission dynamics. We first use simulations to validate this method by showing that it yields unbiased and robust fitness estimates in most epidemic scenarios. We then apply this method to two retrospective case studies and one hypothetical case study. Findings We estimate that (i) the oseltamivir-resistant A(H1N1) strain that emerged in 2007 was 4% (3–5%) more transmissible than its oseltamivir-sensitive predecessor and (ii) the oseltamivir-resistant pandemic A(H1N1) strain that emerged and circulated in Japan during 2013–2014 was 24% (17–30%) less transmissible than its oseltamivir-sensitive counterpart. We show that in the event of large-scale antiviral interventions during a pandemic with co-circulation of AVS and AVR strains, our method can be used to inform optimal use of antivirals by monitoring intrinsic AVR fitness and drug pressure on the AVS strain. Conclusions We have developed a simple method that can be easily integrated into contemporary influenza surveillance systems to provide reliable estimates of AVR fitness in real time. Funding Research Fund for the Control of Infectious Disease (09080792) and a commissioned grant from the Health and Medical Research Fund from the Government of the Hong Kong Special Administrative Region, Harvard Center for Communicable Disease Dynamics from the National Institute of General Medical Sciences (grant no. U54 GM088558), Area of Excellence Scheme of the Hong Kong University Grants Committee (grant no. AoE/M-12/06). PMID:27914853

Molecular characterization of two Rocio flavivirus strains isolated during the encephalitis epidemic in São Paulo State, Brazil and the development of a one-step RT-PCR assay for diagnosis.

PubMed

Coimbra, Terezinha Lisieux Moraes; Santos, Raimundo N; Petrella, Selma; Nagasse-Sugahara, Teresa Keico; Castrignano, Silvana Beres; Santos, Cecília L Simões

2008-01-01

Rocio virus (ROCV) was responsible for an explosive encephalitis epidemic in the 1970s affecting about 1,000 residents of 20 coastland counties in São Paulo State, Brazil. ROCV was first isolated in 1975 from the cerebellum of a fatal human case of encephalitis. Clinical manifestations of the illness are similar to those described for St. Louis encephalitis. ROCV shows intense antigenic cross-reactivity with Japanese encephalitis complex (JEC) viruses, particularly with Ilheus (ILHV), St. Louis encephalitis, Murray Valley and West Nile viruses. In this study, we report a specific RT-PCR assay for ROCV diagnosis and the molecular characterization of the SPAn37630 and SPH37623 strains. Partial nucleotide sequences of NS5 and E genes determined from both strains were used in phylogenetic analysis. The results indicated that these strains are closely related to JEC viruses, but forming a distinct subclade together with ILHV, in accordance with results recently reported by Medeiros et al. (2007).

Evolution of Sequence Type 4821 Clonal Complex Meningococcal Strains in China from Prequinolone to Quinolone Era, 1972–2013

PubMed Central

Guo, Qinglan; Mustapha, Mustapha M.; Chen, Mingliang; Qu, Di; Zhang, Xi; Harrison, Lee H.

2018-01-01

The expansion of hypervirulent sequence type 4821 clonal complex (CC4821) lineage Neisseria meningitidis bacteria has led to a shift in meningococcal disease epidemiology in China, from serogroup A (MenA) to MenC. Knowledge of the evolution and genetic origin of the emergent MenC strains is limited. In this study, we subjected 76 CC4821 isolates collected across China during 1972–1977 and 2005–2013 to phylogenetic analysis, traditional genotyping, or both. We show that successive recombination events within genes encoding surface antigens and acquisition of quinolone resistance mutations possibly played a role in the emergence of CC4821 as an epidemic clone in China. MenC and MenB CC4821 strains have spread across China and have been detected in several countries in different continents. Capsular switches involving serogroups B and C occurred among epidemic strains, raising concerns regarding possible increases in MenB disease, given that vaccines in use in China do not protect against MenB. PMID:29553310

Enterobacterial repetitive intergenic consensus sequences and the PCR to generate fingerprints of genomic DNAs from Vibrio cholerae O1, O139, and non-O1 strains.

PubMed

Rivera, I G; Chowdhury, M A; Huq, A; Jacobs, D; Martins, M T; Colwell, R R

1995-08-01

Enterobacterial repetitive intergenic consensus (ERIC) sequence polymorphism was studied in Vibrio Cholerae strains isolated before and after the cholera epidemic in Brazil (in 1991), along with epidemic strains from Peru, Mexico, and India, by PCR. A total of 17 fingerprint patterns (FPs) were detected in the V. cholerae strains examined; 96.7% of the toxigenic V. cholerae O1 strains and 100% of the O139 serogroup strains were found to belong to the same FP group comprising four fragments (FP1). The nontoxigenic V. cholerae O1 also yielded four fragments but constituted a different FP group (FP2). A total of 15 different patterns were observed among the V. cholerae non-O1 strains. Two patterns were observed most frequently for V. cholerae non-01 strains, 25% of which have FP3, with five fragments, and 16.7% of which have FP4, with two fragments. Three fragments, 1.75, 0.79, and 0.5 kb, were found to be common to both toxigenic and nontoxigenic V. cholerae O1 strains as well as to group FP3, containing V. cholerae non-O1 strains. Two fragments of group FP3, 1.3 and 1.0 kb, were present in FP1 and FP2 respectively. The 0.5-kb fragment was common to all strains and serogroups of V. cholerae analyzed. It is concluded from the results of this study, based on DNA FPs of environmental isolates, that it is possible to detect an emerging virulent strain in a cholera-endemic region. ERIC-PCR constitutes a powerful tool for determination of the virulence potential of V. cholerae O1 strains isolated in surveillance programs and for molecular epidemiological investigations.

Variation analysis of the severe acute respiratory syndrome coronavirus putative non-structural protein 2 gene and construction of three-dimensional model.

PubMed

Lu, Jia-hai; Zhang, Ding-mei; Wang, Guo-ling; Guo, Zhong-min; Zhang, Chuan-hai; Tan, Bing-yan; Ouyang, Li-ping; Lin, Li; Liu, Yi-min; Chen, Wei-qing; Ling, Wen-hua; Yu, Xin-bing; Zhong, Nan-shan

2005-05-05

The rapid transmission and high mortality rate made severe acute respiratory syndrome (SARS) a global threat for which no efficacious therapy is available now. Without sufficient knowledge about the SARS coronavirus (SARS-CoV), it is impossible to define the candidate for the anti-SARS targets. The putative non-structural protein 2 (nsp2) (3CL(pro), following the nomenclature by Gao et al, also known as nsp5 in Snidjer et al) of SARS-CoV plays an important role in viral transcription and replication, and is an attractive target for anti-SARS drug development, so we carried on this study to have an insight into putative polymerase nsp2 of SARS-CoV Guangdong (GD) strain. The SARS-CoV strain was isolated from a SARS patient in Guangdong, China, and cultured in Vero E6 cells. The nsp2 gene was amplified by reverse transcription-polymerase chain reaction (RT-PCR) and cloned into eukaryotic expression vector pCI-neo (pCI-neo/nsp2). Then the recombinant eukaryotic expression vector pCI-neo/nsp2 was transfected into COS-7 cells using lipofectin reagent to express the nsp2 protein. The expressive protein of SARS-CoV nsp2 was analyzed by 7% sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE). The nucleotide sequence and protein sequence of GD nsp2 were compared with that of other SARS-CoV strains by nucleotide-nucleotide basic local alignment search tool (BLASTN) and protein-protein basic local alignment search tool (BLASTP) to investigate its variance trend during the transmission. The secondary structure of GD strain and that of other strains were predicted by Garnier-Osguthorpe-Robson (GOR) Secondary Structure Prediction. Three-dimensional-PSSM Protein Fold Recognition (Threading) Server was employed to construct the three-dimensional model of the nsp2 protein. The putative polymerase nsp2 gene of GD strain was amplified by RT-PCR. The eukaryotic expression vector (pCI-neo/nsp2) was constructed and expressed the protein in COS-7 cells successfully. The result of sequencing and sequence comparison with other SARS-CoV strains showed that nsp2 gene was relatively conservative during the transmission and total five base sites mutated in about 100 strains investigated, three of which in the early and middle phases caused synonymous mutation, and another two base sites variation in the late phase resulted in the amino acid substitutions and secondary structure changes. The three-dimensional structure of the nsp2 protein was successfully constructed. The results suggest that polymerase nsp2 is relatively stable during the phase of epidemic. The amino acid and secondary structure change may be important for viral infection. The fact that majority of single nucleotide variations (SNVs) are predicted to cause synonymous, as well as the result of low mutation rate of nsp2 gene in the epidemic variations, indicates that the nsp2 is conservative and could be a target for anti-SARS drugs. The three-dimensional structure result indicates that the nsp2 protein of GD strain is high homologous with 3CL(pro) of SARS-CoV urbani strain, 3CL(pro) of transmissible gastroenteritis virus and 3CL(pro) of human coronavirus 229E strain, which further suggests that nsp2 protein of GD strain possesses the activity of 3CL(pro).

Progenitor “Mycobacterium canettii” clone responsible for lymph node tuberculosis epidemic, Djibouti.

PubMed

Blouin, Yann; Cazajous, Géraldine; Dehan, Céline; Soler, Charles; Vong, Rithy; Hassan, Mohamed Osman; Hauck, Yolande; Boulais, Christian; Andriamanantena, Dina; Martinaud, Christophe; Martin, Émilie; Pourcel, Christine; Vergnaud, Gilles

2014-01-01

“Mycobacterium canettii,” an opportunistic human pathogen living in an unknown environmental reservoir, is the progenitor species from which Mycobacterium tuberculosis emerged. Since its discovery in 1969, most of the ≈70 known M. canettii strains were isolated in the Republic of Djibouti, frequently from expatriate children and adults. We show here, by whole-genome sequencing, that most strains collected from February 2010 through March 2013, and associated with 2 outbreaks of lymph node tuberculosis in children, belong to a unique epidemic clone within M. canettii. Evolution of this clone, which has been recovered regularly since 1983, may mimic the birth of M. tuberculosis. Thus, recognizing this organism and identifying its reservoir are clinically important.

Progenitor “Mycobacterium canettii” Clone Responsible for Lymph Node Tuberculosis Epidemic, Djibouti

PubMed Central

Blouin, Yann; Cazajous, Géraldine; Dehan, Céline; Soler, Charles; Vong, Rithy; Hassan, Mohamed Osman; Hauck, Yolande; Boulais, Christian; Andriamanantena, Dina; Martinaud, Christophe; Martin, Émilie; Pourcel, Christine

2014-01-01

“Mycobacterium canettii,” an opportunistic human pathogen living in an unknown environmental reservoir, is the progenitor species from which Mycobacterium tuberculosis emerged. Since its discovery in 1969, most of the ≈70 known M. canettii strains were isolated in the Republic of Djibouti, frequently from expatriate children and adults. We show here, by whole-genome sequencing, that most strains collected from February 2010 through March 2013, and associated with 2 outbreaks of lymph node tuberculosis in children, belong to a unique epidemic clone within M. canettii. Evolution of this clone, which has been recovered regularly since 1983, may mimic the birth of M. tuberculosis. Thus, recognizing this organism and identifying its reservoir are clinically important. PMID:24520560

[Epidemiologic diagnostic of nosocomial suppurative-septic infections of Pseudomonas etiology based on intraspecies typing of causative agent].

PubMed

Fel'dblium, I V; Zakharova, Iu A; Nikolaeva, A M; Fedotova, O S

2013-01-01

Scientific justification of optimization of epidemiologic diagnostic of suppurative-septic infection (SSI) caused by Pseudomonas aeruginosa based on comparability of antibiotic sensitivity and beta-lactamase production. Intraspecies typing of 37 P. aeruginosa strains isolated during microbiological monitoring of 106 patients and 131 objects of clinical environment of surgical and obstetrician hospitals by using a complex ofphenotypic and molecular-biological methods including determination of sensitivity to antibiotics by serial dilutions method and PCR-diagnostics with determination of TEM, SHV, CTX, OXA, MBL, VIM genes was performed. P. aeruginosa strains combined into groups by isolation location during studies turned out to be heterogeneous by sensitivity to antibiotics and beta-lactamase production that allowed to form subgroups of strains by focality attribute. Isolates recovered from different SSI foci had significant differences in minimal inhibitory concentration (MIC) reaching 1024 times. MIC parameter within subgroups did not exceed 8 - 16 consequent dilutions. Use of a complex of phenotypic and molecular-biologic methods of causative agent typing including determination of sensitivity to antibiotics by serial dilutions method and evaluation of beta-lactamase production allowed to establish a mechanism of development of SSI epidemic process caused by P. aeruginosa, detect origins and reservoirs of infection in hospital, modes and factors of transmission and reach maximum justification of epidemiologic control and prophylaxis measures of localization of foci of nosocomial infections of pseudomonas etiology.

Intrahost Evolution of Methicillin-Resistant Staphylococcus aureus USA300 Among Individuals With Reoccurring Skin and Soft-Tissue Infections

PubMed Central

Azarian, Taj; Daum, Robert S.; Petty, Lindsay A.; Steinbeck, Jenny L.; Yin, Zachary; Nolan, David; Boyle-Vavra, Susan; Hanage, W. P.; Salemi, Marco; David, Michael Z.

2016-01-01

Background. Methicillin-resistant Staphylococcus aureus (MRSA) USA300 is the leading cause of MRSA infections in the United States and has caused an epidemic of skin and soft-tissue infections. Recurrent infections with USA300 MRSA are common, yet intrahost evolution during persistence on an individual has not been studied. This gap hinders the ability to clinically manage recurrent infections and reconstruct transmission networks. Methods. To characterize bacterial intrahost evolution, we examined the clinical courses of 4 subjects with 3–6 recurrent USA300 MRSA infections, using patient clinical data, including antibiotic exposure history, and whole-genome sequencing and phylogenetic analysis of all available MRSA isolates (n = 29). Results. Among sequential isolates, we found variability in diversity, accumulation of mutations, and mobile genetic elements. Selection for antimicrobial-resistant populations was observed through both an increase in the number of plasmids conferring multidrug resistance and strain replacement by a resistant population. Two of 4 subjects had strain replacement with a genetically distinct USA300 MRSA population. Discussions. During a 5-year period in 4 subjects, we identified development of antimicrobial resistance, intrahost evolution, and strain replacement among isolates from patients with recurrent MRSA infections. This calls into question the efficacy of decolonization to prevent recurrent infections and highlights the adaptive potential of USA300 and the need for effective sampling. PMID:27288537

Secondary Bacterial Infections Associated with Influenza Pandemics

PubMed Central

Morris, Denise E.; Cleary, David W.; Clarke, Stuart C.

2017-01-01

Lower and upper respiratory infections are the fourth highest cause of global mortality (Lozano et al., 2012). Epidemic and pandemic outbreaks of respiratory infection are a major medical concern, often causing considerable disease and a high death toll, typically over a relatively short period of time. Influenza is a major cause of epidemic and pandemic infection. Bacterial co/secondary infection further increases morbidity and mortality of influenza infection, with Streptococcus pneumoniae, Haemophilus influenzae, and Staphylococcus aureus reported as the most common causes. With increased antibiotic resistance and vaccine evasion it is important to monitor the epidemiology of pathogens in circulation to inform clinical treatment and development, particularly in the setting of an influenza epidemic/pandemic. PMID:28690590

Characterization of the 2013 dengue epidemic in Myanmar with dengue virus 1 as the dominant serotype.

PubMed

Ngwe Tun, Mya Myat; Kyaw, Aung Kyaw; Makki, Nader; Muthugala, Rohitha; Nabeshima, Takeshi; Inoue, Shingo; Hayasaka, Daisuke; Moi, Meng Ling; Buerano, Corazon C; Thwe, Saw Myat; Thant, Kyaw Zin; Morita, Kouichi

2016-09-01

In 2013 in Myanmar, dengue epidemic occurred with 20,255 cases including 84 deaths. This study aimed to determine the serological and molecular characteristics of dengue virus (DENV) infection among children with clinical diagnosis of dengue hemorrhagic fever (DHF) or dengue shock syndrome (DSS) during this period. Single acute serum samples were collected from 300 children in Mandalay Children Hospital, Mandalay, Myanmar. Out of the 300 children, 175 (58.3%) and 183 (61%) were positive for anti-dengue IgM and anti-dengue IgG, respectively. Among the IgM positives, 41 (23.4%) had primary DENV infection. Thirty-nine DENV strains (23 DENV-1, 10 DENV-2 and 6 DENV-4) were successfully isolated after inoculation of the patient serum samples onto C6/36 cells. DENV 1 was the dominant serotype in the 2013 epidemic. There was no correlation between the infecting serotypes and clinical severities. The DENV-1 strains belonged to three lineages of the genotype 1; the DENV-2 strains were of the Asian I genotype and were separated into two lineages; and DENV-4 strains belonged to the same lineage of genotype I. It is of interest to note the diversity of DENV-1 and -2 circulating in the same location during June-August 2013. These DENV isolates were genetically close (98%-100%) to the other previously reported isolates from Myanmar and its neighboring countries, namely China, Thailand, Sri Lanka, Cambodia and Vietnam. Primary DENV infection was still high among the severe dengue cases. Different serotypes of DENV were co-circulating in 2013, however, genotype shift was not observed. Additionally, amino acid mutations were detected in the study strains not seen in the previously reported strains from other countries and Myanmar. This paper provided information on the circulating serotypes for the last 15years and the recent dengue situation in Mandalay, Myanmar after 2006. Copyright © 2016 Elsevier B.V. All rights reserved.

Immunogenicity, reactogenicity, and safety of a P1.7b,4 strain-specific serogroup B meningococcal vaccine given to preteens.

PubMed

Hosking, Jamie; Rasanathan, Kumanan; Mow, Florina Chan; Jackson, Catherine; Martin, Diana; O'Hallahan, Jane; Oster, Philipp; Ypma, Ellen; Reid, Stewart; Aaberge, Ingeborg; Crengle, Sue; Stewart, Joanna; Lennon, Diana

2007-11-01

New Zealand (NZ) has experienced a Neisseria meningitidis serogroup B epidemic since 1991. MeNZB, a strain-specific outer membrane vesicle vaccine made using an NZ epidemic strain isolate, NZ98/254 (B:4:P1.7b,4), from two manufacturing sites, the Norwegian Institute of Public Health (NIPH) and Chiron Vaccines (CV; now Novartis), was evaluated for safety, immunogenicity, and reactogenicity in this observer-blind trial with 8- to 12-year-old children. In year 1, cohort A (n = 302) was randomized 4:1 for receipt of NIPH-MeNZB or MenBvac (Norwegian parent vaccine strain 44/76; B:15:P1.7,16). In year 2, cohort B (n = 313) was randomized 4:1 for receipt of CV-MeNZB or NIPH-MeNZB. Participants all received three vaccinations 6 weeks apart. Local and systemic reactions were monitored for 7 days. Seroresponse was defined as a fourfold or greater rise in the serum bactericidal antibody titer from the baseline titer as measured by a serum bactericidal assay. Those with baseline titers of <1:4 required titers of >/=1:8 to serorespond. Intention-to-treat (ITT) and per protocol (PP) analyses are presented. In cohort A, 74% (ITT) and 73% (PP) of NIPH-MeNZB recipients demonstrated seroresponses against NZ98/254 after three doses, versus 32% (ITT and PP) of MenBvac recipients. In cohort B, seroresponses against NZ98/254 after three doses occurred in 79% (ITT and PP) of CV-MeNZB versus 75% (ITT) and 76% (PP) of NIPH-MeNZB recipients. Vaccines were tolerable, with no vaccine-related serious adverse events. In conclusion, the NZ strain meningococcal B vaccine (MeNZB) from either manufacturing site was immunogenic against New Zealand epidemic vaccine strain meningococci with no safety concerns when given in three doses to these 8- to 12-year-old children.

Immunogenicity, Reactogenicity, and Safety of a P1.7b,4 Strain-Specific Serogroup B Meningococcal Vaccine Given to Preteens▿

PubMed Central

Hosking, Jamie; Rasanathan, Kumanan; Mow, Florina Chan; Jackson, Catherine; Martin, Diana; O'Hallahan, Jane; Oster, Philipp; Ypma, Ellen; Reid, Stewart; Aaberge, Ingeborg; Crengle, Sue; Stewart, Joanna; Lennon, Diana

2007-01-01

New Zealand (NZ) has experienced a Neisseria meningitidis serogroup B epidemic since 1991. MeNZB, a strain-specific outer membrane vesicle vaccine made using an NZ epidemic strain isolate, NZ98/254 (B:4:P1.7b,4), from two manufacturing sites, the Norwegian Institute of Public Health (NIPH) and Chiron Vaccines (CV; now Novartis), was evaluated for safety, immunogenicity, and reactogenicity in this observer-blind trial with 8- to 12-year-old children. In year 1, cohort A (n = 302) was randomized 4:1 for receipt of NIPH-MeNZB or MenBvac (Norwegian parent vaccine strain 44/76; B:15:P1.7,16). In year 2, cohort B (n = 313) was randomized 4:1 for receipt of CV-MeNZB or NIPH-MeNZB. Participants all received three vaccinations 6 weeks apart. Local and systemic reactions were monitored for 7 days. Seroresponse was defined as a fourfold or greater rise in the serum bactericidal antibody titer from the baseline titer as measured by a serum bactericidal assay. Those with baseline titers of <1:4 required titers of ≥1:8 to serorespond. Intention-to-treat (ITT) and per protocol (PP) analyses are presented. In cohort A, 74% (ITT) and 73% (PP) of NIPH-MeNZB recipients demonstrated seroresponses against NZ98/254 after three doses, versus 32% (ITT and PP) of MenBvac recipients. In cohort B, seroresponses against NZ98/254 after three doses occurred in 79% (ITT and PP) of CV-MeNZB versus 75% (ITT) and 76% (PP) of NIPH-MeNZB recipients. Vaccines were tolerable, with no vaccine-related serious adverse events. In conclusion, the NZ strain meningococcal B vaccine (MeNZB) from either manufacturing site was immunogenic against New Zealand epidemic vaccine strain meningococci with no safety concerns when given in three doses to these 8- to 12-year-old children. PMID:17898183

Direct and indirect effectiveness of influenza vaccination delivered to children at school preceding an epidemic caused by 3 new influenza virus variants.

PubMed

Glezen, W Paul; Gaglani, Manjusha J; Kozinetz, Claudia A; Piedra, Pedro A

2010-12-01

Influenza is an uncontrolled epidemic disease that is vaccine preventable. New recommendations for universal immunization present a challenge to the implementation of vaccine delivery. This field trial examines the effectiveness of school-based clinics for vaccine delivery before an epidemic caused by 3 new influenza virus variants not contained in the vaccine. Live attenuated influenza vaccine (LAIV) was offered to eligible children in elementary schools of eastern Bell County, Texas. Age-specific rates of medically attended acute respiratory illness for health plan members at the intervention site were compared with those for members at comparison sites during the epidemic, defined by viral surveillance at all sites. Almost 48% of children in elementary schools were vaccinated. Significant herd protection attributed to LAIV was detected for all age groups except 12-17-year-old students, who were not offered free vaccine. Approximately 2500 medical encounters were prevented at the intervention site. Inactivated vaccine provided marginal protection against the epidemic viruses. LAIV delivered to elementary-school children before an epidemic caused by 3 new variant influenza viruses generated significant cross-protection for the recipients and indirect (herd) protection for the community.

Shift within age-groups of mumps incidence, hospitalizations and severe complications in a highly vaccinated population. Spain, 1998-2014.

PubMed

López-Perea, Noemí; Masa-Calles, Josefa; Torres de Mier, María de Viarce; Fernández-García, Aurora; Echevarría, Juan E; De Ory, Fernando; Martínez de Aragón, María Victoria

2017-08-03

The mumps vaccine (Jeryl-Lynn-strain) was introduced in Spain in 1981, and a vaccination policy which included a second dose was added in 1995. From 1992-1999, a Rubini-strain based vaccine was administered in many regions but later withdrawn due to lack of effectiveness. Despite high levels of vaccination coverage, epidemics have continued to appear. We characterized the three epidemic waves of mumps between 1998 and 2014, identifying major changes in susceptible populations using Poisson regression. For the period 1998-2003 (P1), the most affected group was from 1 to 4years old (y) [Incidence Rate (IR)=71.7 cases/100,000 population]; in the periods 2004-2009 (P2) and 2010-2014 (P3) IR ratio (IRR) increased among 15-24y (P2=1.46; P3=2.68) and 25-34y (P2=2.17; P3=4.05). Hospitalization rate (HR), complication rate (CR) and neurological complication rate (NR) among hospitalized subjects decreased across the epidemics, except for 25-34y which increased: HR ratio (HRR) (P2=2.18; P3=2.16), CRR (P3=2.48), NRR (P3=2.41). In Spain mumps incidence increased, while an overall decrease of hospitalizations and severe complications occurred across the epidemics. Cohorts born during periods of low vaccination coverage and those vaccinated with Rubini-strain were the most affected populations, leading to a shift in mumps cases from children to adolescents and young adults; this also reveals the waning immunity provided by the mumps vaccine. Despite not preventing all mumps cases, the vaccine appears to prevent serious forms of the disease. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Hepatitis A virus strains circulating during 1997-2015 in Campania, a Southern Italy region with periodic outbreaks.

PubMed

Costantino, Angela; Coppola, Nicola; Spada, Enea; Bruni, Roberto; Taffon, Stefania; Equestre, Michele; Marcantonio, Cinzia; Sagnelli, Caterina; Dell'Isola, Chiara; Tosone, Grazia; Mascolo, Silvia; Sagnelli, Evangelista; Ciccaglione, Anna Rita

2017-11-01

In Italy, the incidence of hepatitis A has progressively declined over the last 30 years, though not homogeneously throughout the country. In Campania, Southern Italy, high annual incidence rates have been reported and several periodic outbreaks have occurred. To investigate the phylogenetic and epidemiologic relationships among HAV strains circulating in Campania over the period 1997-2015, 87 hepatitis A cases were investigated. The most frequent risk factor was the consumption of raw/undercooked shellfish (75/87, 86.2%). During 1997-2002 most viral strains were subtype IA (16/23, 70%); the phylogenetic pattern suggests that the incidence peaks observed in 2000-2001 had likely been caused by multiple strains. During a large 2004 outbreak, almost all viral variants were subtype IB (38/41, 93%); most of them (22/38, 58%) were recognized to be one of two main strains (differing for just a single nucleotide), the remaining sequences were strictly related variants. In 2014/2015, only IA strains were observed; two phylogenetically related but distinct strains were responsible, respectively, for a small cluster in 2014 and an outbreak in 2015. In each outbreak, several strains unrelated to those responsible for most cases were detected in a minority of patients, documenting a background of sporadic cases occurring even in the course of outbreaks; some of them proved to be identical to strains detected 11-14 years previously. Overall, the data suggest that several related and unrelated HAV strains have endemically circulated over the last 15 years in Campania, with some strains gaining epidemic transmission likely because of a local combination of multiple factors, including inadequate waste water purification and dietary habits. © 2017 Wiley Periodicals, Inc.

A mouse model of paralytic myelitis caused by enterovirus D68

PubMed Central

Yu, Guixia; Leser, J. Smith; Yagi, Shigeo; Tyler, Kenneth L.

2017-01-01

In 2014, the United States experienced an epidemic of acute flaccid myelitis (AFM) cases in children coincident with a nationwide outbreak of enterovirus D68 (EV-D68) respiratory disease. Up to half of the 2014 AFM patients had EV-D68 RNA detected by RT-PCR in their respiratory secretions, although EV-D68 was only detected in cerebrospinal fluid (CSF) from one 2014 AFM patient. Given previously described molecular and epidemiologic associations between EV-D68 and AFM, we sought to develop an animal model by screening seven EV-D68 strains for the ability to induce neurological disease in neonatal mice. We found that four EV-D68 strains from the 2014 outbreak (out of five tested) produced a paralytic disease in mice resembling human AFM. The remaining 2014 strain, as well as 1962 prototype EV-D68 strains Fermon and Rhyne, did not produce, or rarely produced, paralysis in mice. In-depth examination of the paralysis caused by a representative 2014 strain, MO/14-18947, revealed infectious virus, virion particles, and viral genome in the spinal cords of paralyzed mice. Paralysis was elicited in mice following intramuscular, intracerebral, intraperitoneal, and intranasal infection, in descending frequency, and was associated with infection and loss of motor neurons in the anterior horns of spinal cord segments corresponding to paralyzed limbs. Virus isolated from spinal cords of infected mice transmitted disease when injected into naïve mice, fulfilling Koch’s postulates in this model. Finally, we found that EV-D68 immune sera, but not normal mouse sera, protected mice from development of paralysis and death when administered prior to viral challenge. These studies establish an experimental model to study EV-D68-induced myelitis and to better understand disease pathogenesis and develop potential therapies. PMID:28231269

Diversity of methicillin-resistant Staphylococcus aureus CC22-MRSA-IV from Saudi Arabia and the Gulf region.

PubMed

Senok, Abiola; Somily, Ali; Raji, Adeola; Gawlik, Darius; Al-Shahrani, Fatimah; Baqi, Shehla; Boswihi, Samar; Skakni, Leila; Udo, Edet E; Weber, Stefan; Ehricht, Ralf; Monecke, Stefan

2016-10-01

CC22-MRSA-IV, UK-EMRSA-15/Barnim EMRSA, is a common and pandemic strain of methicillin-resistant Staphylococcus aureus (MRSA) that has been found mainly in Western Europe, but also in other parts of the world including some Gulf countries. One suspected case of an infection with this strain in a patient who was admitted to the surgical unit in Riyadh, Kingdom of Saudi Arabia (KSA) was investigated in order to check whether this strain has reached KSA. Besides the index isolate, 46 additional isolates of CC22-MRSA-IV from patients from KSA, Abu Dhabi, Kuwait, and Germany (patients with a history of travel in the Middle East), were characterized by microarray hybridization. The study revealed a regional presence of as many as six distinct 'strains' of CC22-MRSA-IV that could be distinguished based on carriage of SCCmec IV subtypes and virulence factors. No true UK-EMRSA-15/Barnim EMRSA was identified in Riyadh; all suspected isolates from Riyadh were assigned to other, albeit related strains. However, this strain was identified in Abu Dhabi and Kuwait. CC22-MRSA-IV from KSA could be linked to other epidemic strains from the Middle East and possibly India, rather than to the Western European UK-EMRSA-15/Barnim EMRSA. High-resolution typing methods, including SCCmec subtyping, might help to differentiate related epidemic strains and to monitor routes of transmission. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Clostridium difficile infection

PubMed Central

Smits, Wiep Klaas; Lyras, Dena; Lacy, D. Borden; Wilcox, Mark H.; Kuijper, Ed J.

2017-01-01

Infection of the colon with the Gram-positive bacterium Clostridium difficile is potentially life threatening, especially in elderly people and in patients who have dysbiosis of the gut microbiota following antimicrobial drug exposure. C. difficile is the leading cause of health-care-associated infective diarrhoea. The life cycle of C. difficile is influenced by antimicrobial agents, the host immune system, and the host microbiota and its associated metabolites. The primary mediators of inflammation in C. difficile infection (CDI) are large clostridial toxins, toxin A (TcdA) and toxin B (TcdB), and, in some bacterial strains, the binary toxin CDT. The toxins trigger a complex cascade of host cellular responses to cause diarrhoea, inflammation and tissue necrosis — the major symptoms of CDI. The factors responsible for the epidemic of some C. difficile strains are poorly understood. Recurrent infections are common and can be debilitating. Toxin detection for diagnosis is important for accurate epidemiological study, and for optimal management and prevention strategies. Infections are commonly treated with specific antimicrobial agents, but faecal microbiota transplants have shown promise for recurrent infections. Future biotherapies for C. difficile infections are likely to involve defined combinations of key gut microbiota. PMID:27158839

Molecular typing and whole genome next generation sequencing of human adenovirus 8 strains recovered from four 2012 outbreaks of keratoconjunctivitis in New York State.

PubMed

Lamson Bs, Daryl M; Kajon, Adriana E; Shudt, Matthew; Quinn, Monica; Newman, Alexandra; Whitehouse, Joan; Greenko, Jane; Adams, Eleanor; St George, Kirsten

2018-05-11

Ocular infections caused by human adenovirus (HAdV) are highly contagious. The most severe are usually caused by members of species HAdV-D (types HAdV8, 19, 37, 53, 54, and 56) and can manifest as epidemic keratoconjunctivitis (EKC), often resulting in prolonged impairment of vision. During the early months of 2012, EKC outbreaks occurred in neonatal intensive care units (NICUs) in 3 hospitals in New York State (New York and Suffolk Counties). A total of 32 neonates were affected. For 14 of them, HAdV8 was laboratory-confirmed as the causative agent. Nine healthcare workers were also affected with 3 laboratory-confirmed, HAdV-positive EKC. A fourth EKC outbreak was documented among patients attending a private ophthalmology practice in Ulster County involving a total of 35 cases. Epidemiological linkage between the neonatal intensive care unit outbreaks was demonstrated by molecular typing of virus isolates with restriction enzyme analysis and next generation whole genome sequencing. The strain isolated from the ophthalmology clinic was easily distinguishable from the others by restriction enzyme analysis. © 2018 Wiley Periodicals, Inc.

Severe acute bovine viral diarrhea in Ontario, 1993-1995.

PubMed

Carman, S; van Dreumel, T; Ridpath, J; Hazlett, M; Alves, D; Dubovi, E; Tremblay, R; Bolin, S; Godkin, A; Anderson, N

1998-01-01

In 1993, noncytopathic bovine viral diarrhea virus (BVDV) strains with enhanced virulence caused unprecedented outbreaks of severe acute bovine viral diarrhea (BVD) in dairy, beef, and veal herds in Ontario (Canada). Fever, pneumonia, diarrhea, and sudden death occurred in all age groups of cattle. Abortions often occurred in pregnant animals. Gross lesions in the alimentary tract were similar to those associated with mucosal disease, especially in animals >6 months of age. Cattle of all age groups had microscopic lesions in the alimentary tract similar to those seen with mucosal disease. The epidemic peaked in the summer of 1993, with 15% of all bovine accessions from diseased cattle presented to the diagnostic laboratory being associated with BVDV. The virus strains involved in the outbreak were analyzed using monoclonal and polyclonal antibodies and the polymerase chain reaction. The virus isolates from these outbreaks of severe disease were determined to be type 2 BVDV. Type 2 BVDV has been present in Ontario at least since 1981 without causing widespread outbreaks of severe acute BVD, which suggests that type 2 designation in itself does not imply enhanced virulence. Cattle properly vaccinated with type 1 BVDV vaccines appear to be protected from clinical disease.

[Epidemics and pandemics in general practice. What can we learn from the swine flu (H1N1) and EHEC outbreak?].

PubMed

Eisele, M; Hansen, H; Wagner, H-O; von Leitner, E; Pohontsch, N; Scherer, M

2014-06-01

As primary care givers with a coordinating function, general practitioners (GP) play a key role in dealing with epidemics and pandemics. As of yet, there are no studies in Germany describing the difficulties experienced by GPs in patient care during epidemics/pandemics. This study aimed at identifying the problem areas in GPs' patient care during the H1N1 and EHEC (enterohemorrhagic strain of Escherichia coli) outbreaks. With this information, recommendations for guaranteeing proper patient care during future epidemics/pandemics can be derived. In all, 12 qualitative, semi-structured, open guideline interviews with GPs in Hamburg and Lübeck were conducted, transcribed, and evaluated with qualitative content analysis. Five areas in ambulatory patient care were identified in which changes are needed from the primary care perspective: provision of information for GPs, workload, financing of epidemic-related measures, organization of the practices, care of those taken ill. The workload of GPs in particular can and should be reduced through successful, centralized information distribution during epidemics/pandemics. The GP's function as a coordinator should be supported and consolidated, in order to relieve the in-patient sector in cases of an epidemic/pandemic. Secured financing of epidemic-associated measures can help ensure patient care.

Evolutionary enhancement of Zika virus infectivity in Aedes aegypti mosquitoes

PubMed Central

Liu, Yang; Liu, Jianying; Du, Senyan; Shan, Chao; Nie, Kaixiao; Zhang, Rudian; Li, Xiao-Feng; Zhang, Renli; Wang, Tao; Qin, Cheng-Feng; Wang, Penghua; Shi, Pei-Yong; Cheng, Gong

2017-01-01

Summary Zika virus (ZIKV) remained obscure until the recent explosive outbreaks in French Polynesia (2013-2014) and South America (2015-2016). Phylogenetic studies reveal that ZIKV has evolved into African and Asian lineages. The Asian lineage of ZIKV is responsible for the recent epidemics in the Americas. However, the underlying mechanisms through which ZIKV rapidly and explosively spread from Asia to the Americas are limited. We have recently shown that nonstructural protein 1 (NS1) facilitates flavivirus acquisition by mosquitoes from an infected mammalian host and subsequently enhances viral prevalence in mosquitoes. Here, we report that the antigenemia of NS1 determines ZIKV infectivity in its mosquito vector Aedes aegypti, which acquires ZIKV via a blood meal. Clinical isolates from the most recent outbreak in the Americas were much more infectious in mosquitoes than the FSS13025 strain, which was isolated in Cambodia in 2010. Further analyses showed that these epidemic strains have more robust NS1 antigenemia than the FSS13025 strain because of an alanine-to-valine amino acid substitution at the 188th residue in NS1. ZIKV infectivity was enhanced by this residue substitution in the ZIKV FSS13025 strain in mosquitoes that acquired ZIKV from a viremic Type I and II interferon receptor-deficient (ifnagr-/-) C57BL/6 (AG6) mouse. Our results reveal that ZIKV evolved to acquire a spontaneous mutation in its NS1 protein, resulting in increased antigenemia of the protein. Enhancement of NS1 antigenemia in infected hosts promotes ZIKV infectivity and prevalence in mosquitoes, which potentially facilitates transmission during the recent ZIKV epidemics. PMID:28514450

Evolutionary enhancement of Zika virus infectivity in Aedes aegypti mosquitoes.

PubMed

Liu, Yang; Liu, Jianying; Du, Senyan; Shan, Chao; Nie, Kaixiao; Zhang, Rudian; Li, Xiao-Feng; Zhang, Renli; Wang, Tao; Qin, Cheng-Feng; Wang, Penghua; Shi, Pei-Yong; Cheng, Gong

2017-05-25

Zika virus (ZIKV) remained obscure until the recent explosive outbreaks in French Polynesia (2013-2014) and South America (2015-2016). Phylogenetic studies have shown that ZIKV has evolved into African and Asian lineages. The Asian lineage of ZIKV was responsible for the recent epidemics in the Americas. However, the underlying mechanisms through which ZIKV rapidly and explosively spread from Asia to the Americas are unclear. Non-structural protein 1 (NS1) facilitates flavivirus acquisition by mosquitoes from an infected mammalian host and subsequently enhances viral prevalence in mosquitoes. Here we show that NS1 antigenaemia determines ZIKV infectivity in its mosquito vector Aedes aegypti, which acquires ZIKV via a blood meal. Clinical isolates from the most recent outbreak in the Americas were much more infectious in mosquitoes than the FSS13025 strain, which was isolated in Cambodia in 2010. Further analyses showed that these epidemic strains have higher NS1 antigenaemia than the FSS13025 strain because of an alanine-to-valine amino acid substitution at residue 188 in NS1. ZIKV infectivity was enhanced by this amino acid substitution in the ZIKV FSS13025 strain in mosquitoes that acquired ZIKV from a viraemic C57BL/6 mouse deficient in type I and II interferon (IFN) receptors (AG6 mouse). Our results reveal that ZIKV evolved to acquire a spontaneous mutation in its NS1 protein, resulting in increased NS1 antigenaemia. Enhancement of NS1 antigenaemia in infected hosts promotes ZIKV infectivity and prevalence in mosquitoes, which could have facilitated transmission during recent ZIKV epidemics.

Molecular characterization of the spike gene of the porcine epidemic diarrhea virus in Mexico, 2013-2016.

PubMed

Lara-Romero, Rocío; Gómez-Núñez, Luis; Cerriteño-Sánchez, José Luis; Márquez-Valdelamar, Laura; Mendoza-Elvira, Susana; Ramírez-Mendoza, Humberto; Rivera-Benítez, José Francisco

2018-04-01

In Mexico, the first outbreaks suggestive of the circulation of the porcine epidemic diarrhea virus (PEDV) were identified at the beginning of July 2013. To identify the molecular characteristics of the PEDV Spike (S) gene in Mexico, 116 samples of the intestine and diarrhea of piglets with clinical signs of porcine epidemic diarrhea (PED) were obtained. Samples were collected from 14 farms located in six states of Mexico (Jalisco, Puebla, Sonora, Veracruz, Guanajuato, and Michoacán) from 2013 to 2016. To identify PEDV, we used real-time RT-PCR to discriminate between non-INDEL and INDEL strains. We chose samples according to state and year to characterize the S gene. After amplification of the S gene, the obtained products were sequenced and assembled. The complete amino acid sequences of the spike protein were used to perform an epitope analysis, which was used to determine null mutations in regions SS2, SS6, and 2C10 compared to the sequences of G2. A phylogenetic analysis determined the circulation of G2b and INDEL strains in Mexico. However, several mutations were recorded in the collagenase equivalent (COE) region that were related to the change in polarity and charge of the amino acid residues. The PEDV strain circulating in Jalisco in 2016 has an insertion of three amino acids ( 232 LGL 234 ) and one change in the antigenic site of the COE region, and strains from the years 2015 and 2016 changed the index of the surface probability, which could be related to the re-emergence of disease outbreaks.

[The cholera epidemic in Latin America].

PubMed

Olsvik, O

1992-05-30

An outbreak of cholera started in Peru in January 1991 and spread through most Latin American countries within a year. This was the first known epidemic of cholera in America for more than a century. In 1991, 321,334 persons were reported to have cholera in Peru, 119,063 were hospitalized, and 2,906 died. Other countries like Ecuador, Colombia, Guatemala, Brazil, Mexico, Bolivia, Chile, El Salvador, Venezuela and Honduras were also affected, but these countries combined accounted for only 20% of the cases registered in Peru. In April 1992, all Latin American countries except Uruguay, Paraguay and French Guyana have reported cholera. The mortality rate for the epidemic in Latin America was only 1%, mainly owing to good oral rehydration treatment provided by Local health services and the Pan American Health Organization. The causative organism was Vibrio cholerae, serogroup O1, serotype Inaba (and Ogawa) of the El Tor biotype. Genetic characterization shows this strain to be unique, and the designation is reserved for the Latin American strain, distinguishing it from the other El Tor isolates from the 7th pandemic.

Measuring the severity of Clostridium difficile infection: implications for management and drug development.

PubMed

Belmares, Jaime; Gerding, Dale N; Tillotson, Glenn; Johnson, Stuart

2008-12-01

The appropriate management of Clostridium difficile infection (CDI) has become a growing clinical and economic issue, as a new epidemic strain with enhanced virulence is causing increased morbidity and mortality. Presently, only two antibiotics (metronidazole and vancomycin) are routinely used to treat CDI. Both increasing disease severity and recurrent infections have been an impetus not only to develop new agents, but also to better recognize which patients are at highest risk for treatment failure and/or recurrence so that treatments can be optimized from the outset. The availability of a standardized and validated system for stratifying CDI severity could improve patient management and potentially accelerate the development of new treatment agents.

Epidemics in small world networks

NASA Astrophysics Data System (ADS)

Telo da Gama, M. M.; Nunes, A.

2006-03-01

For many infectious diseases, a small-world network on an underlying regular lattice is a suitable simplified model for the contact structure of the host population. It is well known that the contact network, described in this setting by a single parameter, the small-world parameter p, plays an important role both in the short term and in the long term dynamics of epidemic spread. We have studied the effect of the network structure on models of immune for life diseases and found that in addition to the reduction of the effective transmission rate, through the screening of infectives, spatial correlations may strongly enhance the stochastic fluctuations. As a consequence, time series of unforced Susceptible-Exposed-Infected-Recovered (SEIR) models provide patterns of recurrent epidemics with realistic amplitudes, suggesting that these models together with complex networks of contacts are the key ingredients to describe the prevaccination dynamical patterns of diseases such as measles and pertussis. We have also studied the role of the host contact strucuture in pathogen antigenic variation, through its effect on the final outcome of an invasion by a viral strain of a population where a very similar virus is endemic. Similar viral strains are modelled by the same infection and reinfection parameters, and by a given degree of cross immunity that represents the antigenic distance between the competing strains. We have found, somewhat surprisingly, that clustering on the network decreases the potential to sustain pathogen diversity.

Clonal origins of Vibrio cholerae O1 El Tor strains, Papua New Guinea, 2009-2011.

PubMed

Horwood, Paul F; Collins, Deirdre; Jonduo, Marinjho H; Rosewell, Alexander; Dutta, Samir R; Dagina, Rosheila; Ropa, Berry; Siba, Peter M; Greenhill, Andrew R

2011-11-01

We used multilocus sequence typing and variable number tandem repeat analysis to determine the clonal origins of Vibrio cholerae O1 El Tor strains from an outbreak of cholera that began in 2009 in Papua New Guinea. The epidemic is ongoing, and transmission risk is elevated within the Pacific region.

First epidemic of echovirus 16 meningitis in Cuba.

PubMed

Sarmiento, L; Mas, P; Goyenechea, A; Palomera, R; Morier, L; Capó, V; Quintana, I; Santin, M

2001-01-01

From April to September 2000, an epidemic of aseptic meningitis spread throughout Cuba, with 16,943 reported cases. Virologic studies identified echovirus 16 as the cause of this epidemic. This is the first reported isolate of echovirus 16 from patients with viral meningitis in Cuba.

Cuban epidemic neuropathy, 1991 to 1994: history repeats itself a century after the "amblyopia of the blockade".

PubMed Central

Ordúñez-García, P O; Nieto, F J; Espinosa-Brito, A D; Caballero, B

1996-01-01

The 1991 to 1994 epidemic of neuropathy in Cuba has been one of the more devastating in recent history, affecting more than 50,000 people throughout the entire country with clinical manifestations of optic and peripheral neuropathy. Although the causes are not entirely clear, it seems that a combination of acute nutritional deficiency and the toxic effects of tobacco and possibly other unidentified toxic substances is involved. The epidemic coincided with the acute worsening of the economic situation on the island following political changes in Eastern European countries and a tightening of the US economic embargo. This paper reviews reports of a strikingly similar epidemic known as the "Amblyopia of the Blockade," which occurred in Cuba almost a century ago when the island was undergoing a US naval blockade during the Cuban-Spanish-American war. It discusses the parallelism with the recent epidemic as well as the implications of this historical evidence to clarify further the ultimate causes of these epidemics. PMID:8629731

The epidemic of Tuberculosis on vaccinated population

NASA Astrophysics Data System (ADS)

Syahrini, Intan; Sriwahyuni; Halfiani, Vera; Meurah Yuni, Syarifah; Iskandar, Taufiq; Rasudin; Ramli, Marwan

2017-09-01

Tuberculosis is an infectious disease which has caused a large number of mortality in Indonesia. This disease is caused by Mycrobacterium tuberculosis. Besides affecting lung, this disease also affects other organs such as lymph gland, intestine, kidneys, uterus, bone, and brain. This article discusses the epidemic of tuberculosis through employing the SEIR model. Here, the population is divided into four compartments which are susceptible, exposed, infected and recovered. The susceptible population is further grouped into two which are vaccinated group and unvaccinated group. The behavior of the epidemic is investigated through analysing the equilibrium of the model. The result shows that administering vaccine to the susceptible population contributes to the reduction of the tuberculosis epidemic rate.

Hypervariability of biofilm formation and oxacillin resistance in a Staphylococcus epidermidis strain causing persistent severe infection in an immunocompromised patient.

PubMed

Weisser, Maja; Schoenfelder, Sonja M K; Orasch, Christina; Arber, Caroline; Gratwohl, Alois; Frei, Reno; Eckart, Martin; Flückiger, Ursula; Ziebuhr, Wilma

2010-07-01

We report on a leukemic patient who suffered from a persistent, generalized, and eventually fatal Staphylococcus epidermidis infection during prolonged aplasia. Over a 6-week period, we isolated a genetically and phenotypically unstable S. epidermidis strain related to an epidemic clone associated with hospital infections worldwide. Strikingly, the strain showed a remarkable degree of variability, with evidence of selection and increasing predominance of biofilm-producing and oxacillin-resistant variants over time. Thus, in the early stages of the infection, the strain was found to generate subpopulations which had spontaneously lost the biofilm-mediating ica locus along with the oxacillin resistance-conferring mecA gene. These deletion mutants were obviously outcompeted by the ica- and mecA-positive wild-type genotype, with the selection and predominance of strongly biofilm-forming and oxacillin-resistant variants in the later stages of the infection. Also, a switch from protein- to polysaccharide intercellular adhesin/poly-N-acetylglucosamine (PIA/PNAG)-mediated-biofilm production was detected among ica-positive variants in the course of the infection. The data highlight the impact of distinct S. epidermidis clonal lineages as serious nosocomial pathogens that, through the generation and selection of highly pathogenic variants, may critically determine disease progression and outcome.

Coexistence of SHV-4- and TEM-24-Producing Enterobacter aerogenes Strains before a Large Outbreak of TEM-24-Producing Strains in a French Hospital

PubMed Central

Mammeri, H.; Laurans, G.; Eveillard, M.; Castelain, S.; Eb, F.

2001-01-01

In 1996, a monitoring program was initiated at the teaching hospital of Amiens, France, and carried out for 3 years. All extended-spectrum β-lactamase (ESBL)-producing Enterobacter aerogenes isolates recovered from clinical specimens were collected for investigation of their epidemiological relatedness by pulsed-field gel electrophoresis and enterobacterial repetitive intergenic consensus PCR (ERIC-PCR) and determination of the type of ESBL harbored by isoelectric focusing and DNA sequencing. Molecular typing revealed the endemic coexistence, during the first 2 years, of two clones expressing, respectively, SHV-4 and TEM-24 ESBLs, while an outbreak of the TEM-24-producing strain raged in the hospital during the third year, causing the infection or colonization of 165 patients. Furthermore, this strain was identified as the prevalent clone responsible for outbreaks in many French hospitals since 1996. This study shows that TEM-24-producing E. aerogenes is an epidemic clone that is well established in the hospital's ecology and able to spread throughout wards. The management of the outbreak at the teaching hospital of Amiens, which included the reinforcement of infection control measures, failed to obtain complete eradication of the clone, which has become an endemic pathogen. PMID:11376055

Molecular characterisation of measles virus strains among refugees from Central African Republic in Cameroon in 2014.

PubMed

Ndombo, P K; Ndze, V N; Mbarga, F D; Anderson, R; Acho, A; Ebua Chia, J; Njamnshi, A K; Rota, P A; Waku-Kouomou, D

2018-02-01

Measles is a highly infectious human viral disease caused by measles virus (MeV). An estimated 114 900 measles deaths occurred worldwide in 2014. There are currently eight clades (A-H) comprised 24 MeV genotypes. We sought to characterise MeVs among Central African Republic (CAR) refugees during the 2014 measles epidemic in Cameroon. Samples were collected from children <15 years with suspected measles infections in two refugee camps in the east region of Cameroon. Viral RNA was extracted directly from urine samples. RNA detection of MeV RNA was performed with real-time reverse transcription polymerase chain reaction (PCR) to amplify a 634 bp nucleotide fragment of the N gene. The sequence of the PCR product was obtained to determine the genotype. MeV RNA was detected in 25 out of 30 samples from suspected cases, and among the 25 positive samples, MeV sequences were obtained from 20. The MeV strains characterised were all genotype B3. The MeV strains from genotype B3 found in this outbreak were more similar to those circulating in Northern Cameroon in 2010-2011 than to MeV strains circulating in the CAR in 2011. Surveillance system should be improved to focus on refugees for early detection of and response to outbreaks.

Resurgence of cholera in Hong Kong.

PubMed Central

Lee, S. H.; Lai, S. T.; Lai, J. Y.; Leung, N. K.

1996-01-01

Cholera is one of the three diseases subject to the International Health Regulations. After a period of over 30 years, the seventh pandemic of cholera, which started in South East Asia in 1961, still shows no sign of a decline. On the contrary, it has increased its severity and invaded many other countries in Africa and Latin America. In the last two years, there has been a recrudescence of the disease in South East Asia and Western Pacific Regions. The discovery of a new strain of Vibrio cholerae 0139 in these regions is causing concern in view of its potential to cause major epidemics and higher mortality. Hong Kong had two intensive outbreaks of cholera in the last two years. The cause of these outbreaks was not clear, but adverse environmental conditions and increasing pollution of coastal waters have been implicated. The spread of cholera knows no geographical boundaries. There is a need for intensified efforts among health authorities in the affected areas to prevent the international spread of the disease. PMID:8760949

Novel vaccines against influenza viruses

PubMed Central

Kang, Sang-Moo; Song, Jae-Min; Compans, Richard W.

2011-01-01

Killed and live attenuated influenza virus vaccines are effective in preventing and curbing the spread of influenza epidemics when the strains present in the vaccines are closely matched with the predicted epidemic strains. These vaccines are primarily targeted to induce immunity to the variable major target antigen, hemagglutinin (HA) of influenza virus. However, current vaccines are not effective in preventing the emergence of new pandemic or highly virulent viruses. New approaches are being investigated to develop universal influenza virus vaccines as well as to apply more effective vaccine delivery methods. Conserved vaccine targets including the influenza M2 ion channel protein and HA stalk domains are being developed using recombinant technologies to improve the level of cross protection. In addition, recent studies provide evidence that vaccine supplements can provide avenues to further improve current vaccination. PMID:21968298

Complete Genome Sequences of Two Vesicular Stomatitis New Jersey Viruses Representing the 2012 U.S. Epidemic Strain and Its Closest Relative Endemic Strain from Southern Mexico

PubMed Central

Velazquez-Salinas, Lauro; Pauszek, Steven J.; Verdugo-Rodriguez, Antonio

2018-01-01

ABSTRACT We report here the complete genome sequences of two vesicular stomatitis New Jersey virus (VSNJV) field strains isolated from epithelial lesions from naturally infected animals in Mexico and the United States. The close phylogenetic relationship of these isolates makes them an ideal model for assessing potential genetic factors linked with the emergence of VSNJV in the United States. PMID:29449388

Fatal Cases of Seasonal Influenza in Russia in 2015-2016.

PubMed

Ilyicheva, T; Durymanov, A; Susloparov, I; Kolosova, N; Goncharova, N; Svyatchenko, S; Petrova, O; Bondar, A; Mikheev, V; Ryzhikov, A

2016-01-01

The influenza epidemic in 2015-2016 in Russia is characterized by a sharp increase of influenza cases (beginning from the second week of 2016) with increased fatalities. Influenza was confirmed in 20 fatal cases registered among children (0-10 years), in 5 cases among pregnant women, and in 173 cases among elderly people (60 years and older). Two hundred and ninety nine people died from influenza were patients with some chronic problems. The overwhelming majority among the deceased (more than 98%) were not vaccinated against influenza. We isolated 109 influenza A(H1N1)pdm09 and one A(H3N2) virus strains from 501 autopsy material samples. The antigenic features of the strains were similar to the vaccine strains. A phylogenic analysis of hemagglutinin revealed that influenza A(H1N1)pdm09 virus strains belonged to 6B genetic group that had two main dominant subgroups during the 2015-2016 season. In Russia strains of the first group predominated. We registered an increased proportion of strains with D222G mutation in receptor-binding site. A herd immunity analysis carried out immediately prior to the epidemic showed that 34.4% blood sera samples collected in different regions of Russia were positive to A/California/07/09(H1N1)pdm09. We came to a conclusion that public awareness enhancement is necessary to reduce unreasonable refusals of vaccination.

Tracking the Origin and Deciphering the Phylogenetic Relationship of Porcine Epidemic Diarrhea Virus in Ecuador

PubMed Central

Barrera, Maritza; Garrido-Haro, Ana; Vaca, María S.; Granda, Danilo; Acosta-Batallas, Alfredo

2017-01-01

In 2010, new Chinese strains of porcine epidemic diarrhea virus (PEDV), clinically more severe than the classical strains, emerged. These strains were spread to United States in 2013 through an intercontinental transmission from China with further spreading across the world, evidencing the emergent nature of these strains. In the present study, an analysis of PEDV field sequences from Ecuador was conducted by comparing all the PEDV S gene sequences available in the GenBank database. Phylogenetic comparisons and Bayesian phylogeographic inference based on complete S gene sequences were also conducted to track the origin and putative route of PEDV. The sequence from the PED-outbreak in Ecuador was grouped into the clade II of PEDV genogroup 2a together with other sequences of isolates from Mexico, Canada, and United States. The phylogeographic study revealed the emergence of the Chinese PEDV strains, followed by spreading to US in 2013, from US to Korea, and later the introduction of PEDV to Canada, Mexico, and Ecuador directly from the US. The sources of imports of live swine in Ecuador in 2014 were mainly from Chile and US. Thus, this movement of pigs is suggested as the main way for introducing PEDV to Ecuador. PMID:29379796

The complete genome sequence of Yersinia pseudotuberculosis IP31758, the causative agent of Far East scarlet-like fever.

PubMed

Eppinger, Mark; Rosovitz, M J; Fricke, Wolfgang Florian; Rasko, David A; Kokorina, Galina; Fayolle, Corinne; Lindler, Luther E; Carniel, Elisabeth; Ravel, Jacques

2007-08-01

The first reported Far East scarlet-like fever (FESLF) epidemic swept the Pacific coastal region of Russia in the late 1950s. Symptoms of the severe infection included erythematous skin rash and desquamation, exanthema, hyperhemic tongue, and a toxic shock syndrome. The term FESLF was coined for the infection because it shares clinical presentations with scarlet fever caused by group A streptococci. The causative agent was later identified as Yersinia pseudotuberculosis, although the range of morbidities was vastly different from classical pseudotuberculosis symptoms. To understand the origin and emergence of the peculiar clinical features of FESLF, we have sequenced the genome of the FESLF-causing strain Y. pseudotuberculosis IP31758 and compared it with that of another Y. pseudotuberculosis strain, IP32953, which causes classical gastrointestinal symptoms. The unique gene pool of Y pseudotuberculosis IP31758 accounts for more than 260 strain-specific genes and introduces individual physiological capabilities and virulence determinants, with a significant proportion horizontally acquired that likely originated from Enterobacteriaceae and other soil-dwelling bacteria that persist in the same ecological niche. The mobile genome pool includes two novel plasmids phylogenetically unrelated to all currently reported Yersinia plasmids. An icm/dot type IVB secretion system, shared only with the intracellular persisting pathogens of the order Legionellales, was found on the larger plasmid and could contribute to scarlatinoid fever symptoms in patients due to the introduction of immunomodulatory and immunosuppressive capabilities. We determined the common and unique traits resulting from genome evolution and speciation within the genus Yersinia and drew a more accurate species border between Y. pseudotuberculosis and Y. pestis. In contrast to the lack of genetic diversity observed in the evolutionary young descending Y. pestis lineage, the population genetics of Y. pseudotuberculosis is more heterogenous. Both Y. pseudotuberculosis strains IP31758 and the previously sequenced Y. pseudotuberculosis strain IP32953 have evolved by the acquisition of specific plasmids and by the horizontal acquisition and incorporation of different genetic information into the chromosome, which all together or independently seems to potentially impact the phenotypic adaptation of these two strains.

The Complete Genome Sequence of Yersinia pseudotuberculosis IP31758, the Causative Agent of Far East Scarlet-Like Fever

PubMed Central

Eppinger, Mark; Rosovitz, M. J; Fricke, Wolfgang Florian; Rasko, David A; Kokorina, Galina; Fayolle, Corinne; Lindler, Luther E; Carniel, Elisabeth; Ravel, Jacques

2007-01-01

The first reported Far East scarlet-like fever (FESLF) epidemic swept the Pacific coastal region of Russia in the late 1950s. Symptoms of the severe infection included erythematous skin rash and desquamation, exanthema, hyperhemic tongue, and a toxic shock syndrome. The term FESLF was coined for the infection because it shares clinical presentations with scarlet fever caused by group A streptococci. The causative agent was later identified as Yersinia pseudotuberculosis, although the range of morbidities was vastly different from classical pseudotuberculosis symptoms. To understand the origin and emergence of the peculiar clinical features of FESLF, we have sequenced the genome of the FESLF-causing strain Y. pseudotuberculosis IP31758 and compared it with that of another Y. pseudotuberculosis strain, IP32953, which causes classical gastrointestinal symptoms. The unique gene pool of Y pseudotuberculosis IP31758 accounts for more than 260 strain-specific genes and introduces individual physiological capabilities and virulence determinants, with a significant proportion horizontally acquired that likely originated from Enterobacteriaceae and other soil-dwelling bacteria that persist in the same ecological niche. The mobile genome pool includes two novel plasmids phylogenetically unrelated to all currently reported Yersinia plasmids. An icm/dot type IVB secretion system, shared only with the intracellular persisting pathogens of the order Legionellales, was found on the larger plasmid and could contribute to scarlatinoid fever symptoms in patients due to the introduction of immunomodulatory and immunosuppressive capabilities. We determined the common and unique traits resulting from genome evolution and speciation within the genus Yersinia and drew a more accurate species border between Y. pseudotuberculosis and Y. pestis. In contrast to the lack of genetic diversity observed in the evolutionary young descending Y. pestis lineage, the population genetics of Y. pseudotuberculosis is more heterogenous. Both Y. pseudotuberculosis strains IP31758 and the previously sequenced Y. pseudotuberculosis strain IP32953 have evolved by the acquisition of specific plasmids and by the horizontal acquisition and incorporation of different genetic information into the chromosome, which all together or independently seems to potentially impact the phenotypic adaptation of these two strains. PMID:17784789

Staphylococcus aureus Infections: Epidemiology, Pathophysiology, Clinical Manifestations, and Management

PubMed Central

Davis, Joshua S.; Eichenberger, Emily; Holland, Thomas L.

2015-01-01

SUMMARY Staphylococcus aureus is a major human pathogen that causes a wide range of clinical infections. It is a leading cause of bacteremia and infective endocarditis as well as osteoarticular, skin and soft tissue, pleuropulmonary, and device-related infections. This review comprehensively covers the epidemiology, pathophysiology, clinical manifestations, and management of each of these clinical entities. The past 2 decades have witnessed two clear shifts in the epidemiology of S. aureus infections: first, a growing number of health care-associated infections, particularly seen in infective endocarditis and prosthetic device infections, and second, an epidemic of community-associated skin and soft tissue infections driven by strains with certain virulence factors and resistance to β-lactam antibiotics. In reviewing the literature to support management strategies for these clinical manifestations, we also highlight the paucity of high-quality evidence for many key clinical questions. PMID:26016486

Scrum kidney: epidemic pyoderma caused by a nephritogenic Streptococcus pyogenes in a rugby team.

PubMed

Ludlam, H; Cookson, B

1986-08-09

In December, 1984, an outbreak of pyoderma affected five scrum players in the St Thomas' Hospital rugby team. The causative organism, Streptococcus pyogenes, was acquired during a match against a team experiencing an outbreak of impetigo, and was transmitted to two front row players of another team a week later, and to two girlfriends of affected St Thomas' players a month later. The strain was M-type 49, tetracycline-resistant, and virulent. It caused salpingitis in a girlfriend and acute glomerulonephritis in one rugby player. No case of subclinical glomerulonephritis was detected in eight patients with pyoderma. Screening of the St Thomas' Hospital team revealed four further cases of non-streptococcal skin infection, with evidence for contemporaneous spread of Staphylococcus aureus. Teams should not field players with sepsis, and it may be advisable to apply a skin antiseptic to traumatised skin after the match.

Emerging influenza viruses and the prospect of a universal influenza virus vaccine.

PubMed

Krammer, Florian

2015-05-01

Influenza viruses cause annual seasonal epidemics and pandemics at irregular intervals. Several cases of human infections with avian and swine influenza viruses have been detected recently, warranting enhanced surveillance and the development of more effective countermeasures to address the pandemic potential of these viruses. The most effective countermeasure against influenza virus infection is the use of prophylactic vaccines. However, vaccines that are currently in use for seasonal influenza viruses have to be re-formulated and re-administered in a cumbersome process every year due to the antigenic drift of the virus. Furthermore, current seasonal vaccines are ineffective against novel pandemic strains. This paper reviews zoonotic influenza viruses with pandemic potential and technological advances towards better vaccines that induce broad and long lasting protection from influenza virus infection. Recent efforts have focused on the development of broadly protective/universal influenza virus vaccines that can provide immunity against drifted seasonal influenza virus strains but also against potential pandemic viruses. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The role of Australian mosquito species in the transmission of endemic and exotic West Nile virus strains.

PubMed

Jansen, Cassie C; Ritchie, Scott A; van den Hurk, Andrew F

2013-08-19

Recent epidemic activity and its introduction into the Western Hemisphere have drawn attention to West Nile virus (WNV) as an international public health problem. Of particular concern has been the ability for the virus to cause outbreaks of disease in highly populated urban centers. Incrimination of Australian mosquito species is an essential component in determining the receptivity of Australia to the introduction and/or establishment of an exotic strain of WNV and can guide potential management strategies. Based on vector competence experiments and ecological studies, we suggest candidate Australian mosquito species that would most likely be involved in urban transmission of WNV, along with consideration of the endemic WNV subtype, Kunjin. We then examine the interaction of entomological factors with virological and vertebrate host factors, as well as likely mode of introduction, which may influence the potential for exotic WNV to become established and be maintained in urban transmission cycles in Australia.

Re-analysis of human immunodeficiency virus type 1 isolates from Cyprus and Greece, initially designated 'subtype I', reveals a unique complex A/G/H/K/? mosaic pattern.

PubMed

Paraskevis, D; Magiorkinis, M; Vandamme, A M; Kostrikis, L G; Hatzakis, A

2001-03-01

Human immunodeficiency virus type 1 (HIV-1) has been classified into three main groups and 11 distinct subtypes. Moreover, several circulating recombinant forms (CRFs) of HIV-1 have been recently documented to have spread widely causing extensive HIV-1 epidemics. A subtype, initially designated I (CRF04_cpx), was documented in Cyprus and Greece and was found to comprise regions of sequence derived from subtypes A and G as well as regions of unclassified sequence. Re-analysis of the three full-length CRF04_cpx sequences that were available revealed a mosaic genomic organization of unique complexity comprising regions of sequence from at least five distinct subtypes, A, G, H, K and unclassified regions. These strains account for approximately 2% of the total HIV-1-infected population in Greece, thus providing evidence of the great capability of HIV-1 to recombine and produce highly divergent strains which can be spread successfully through different infection routes.

Molecular characterisation of dengue virus type 1 reveals lineage replacement during circulation in Brazilian territory.

PubMed

Carneiro, Adriana Ribeiro; Cruz, Ana Cecília Ribeiro; Vallinoto, Marcelo; Melo, Diego de Vasconcelos; Ramos, Rommel Thiago J; Medeiros, Daniele Barbosa Almeida; Silva, Eliana Vieira Pinto da; Vasconcelos, Pedro Fernando da Costa

2012-09-01

Dengue fever is the most important arbovirus infection found in tropical regions around the world. Dispersal of the vector and an increase in migratory flow between countries have led to large epidemics and severe clinical outcomes, such as dengue haemorrhagic fever and dengue shock syndrome. This study analysed the genetic variability of the dengue virus serotype 1 (DENV-1) in Brazil with regard to the full-length structural genes C/prM/M/E among 34 strains isolated during epidemics that occurred in the country between 1994-2011. Virus phylogeny and time of divergence were also evaluated with only the E gene of the strains isolated from 1994-2008. An analysis of amino acid differences between these strains and the French Guiana strain (FGA/89) revealed the presence of important nonsynonymous substitutions in the amino acid sequences, including residues E297 (Met→Thr) and E338 (Ser→Leu). A phylogenetic analysis of E proteins comparing the studied isolates and other strains selected from the GenBank database showed that the Brazilian DENV-1 strains since 1982 belonged to genotype V. This analysis also showed that different introductions of strains from the 1990s represented lineage replacement, with the identification of three lineages that cluster all isolates from the Americas. An analysis of the divergence time of DENV-1 indicated that the lineage circulating in Brazil emerged from an ancestral lineage that originated approximately 44.35 years ago.

The biological characteristics of predominant strains of HIV-1 genotype: modeling of HIV-1 infection among men who have sex with men.

PubMed

Dai, Di; Shang, Hong; Han, Xiao-Xu; Zhao, Bin; Liu, Jing; Ding, Hai-Bo; Xu, Jun-Jie; Chu, Zhen-Xing

2015-04-01

To investigate the molecular subtypes of prevalent HIV-1 strains and characterize the genetics of dominant strains among men who have sex with men. Molecular epidemiology surveys in this study concentrated on the prevalent HIV-1 strains in Liaoning province by year. 229 adult patients infected with HIV-1 and part of a high-risk group of men who have sex with men were recruited. Reverse transcription and nested PCR amplification were performed. Sequencing reactions were conducted and edited, followed by codon-based alignment. NJ phylogenetic tree analyses detected two distinct CRF01_AE phylogenetic clusters, designated clusters 1 and 2. Clusters 1 and 2 accounted for 12.8% and 84.2% of sequences in the pol gene and 17.6% and 73.1% of sequences in the env gene, respectively. Another six samples were distributed on other phylogenetic clusters. Cluster 1 increased significantly from 5.6% to 20.0%, but cluster 2 decreased from 87.5% to 80.0%. Genetic distance analysis indicated that CRF01_AE cluster 1 in Liaoning was homologous to epidemic CRF01_AE strains, but CRF01_AE cluster 2 was different from other scattered strains. Additionally, significant differences were found in tetra-peptide motifs at the tip of V3 loop between cluster 1 and 2; however, differences in coreceptor usage were not detected. This study shows that subtype CRF01_AE strain may be the most prevalent epidemic strain in the men who have sex with men. Genetic characteristics of the subtype CRF01_AE cluster strain in Liaoning showed homology to the prevalent strains of men who have sex with men in other parts of China. © 2015 Wiley Periodicals, Inc.

Fluctuations in epidemic modeling - disease extinction and control

NASA Astrophysics Data System (ADS)

Schwartz, Ira

2009-03-01

The analysis of infectious disease fluctuations has recently seen an increasing rise in the use of new tools and models from stochastic dynamics and statistical physics. Examples arise in modeling fluctuations of multi-strain diseases, in modeling adaptive social behavior and its impact on disease fluctuations, and in the analysis of disease extinction in finite population models. Proper stochastic model reduction [1] allows one to predict unobserved fluctuations from observed data in multi-strain models [2]. Degree alteration and power law behavior is predicted in adaptive network epidemic models [3,4]. And extinction rates derived from large fluctuation theory exhibit scaling with respect to distance to the bifurcation point of disease onset with an unusual exponent [5]. In addition to outbreak prediction, another main goal of epidemic modeling is one of eliminating the disease to extinction through various control mechanisms, such as vaccine implementation or quarantine. In this talk, a description will be presented of the fluctuational behavior of several epidemic models and their extinction rates. A general framework and analysis of the effect of non-Gaussian control actuations which enhance the rate to disease extinction will be described. In particular, in it is shown that even in the presence of a small Poisson distributed vaccination program, there is an exponentially enhanced rate to disease extinction. These ideas may lead to improved methods of controlling disease where random vaccinations are prevalent. [4pt] Recent papers:[0pt] [1] E. Forgoston and I. B. Schwartz, ``Escape Rates in a Stochastic Environment with Multiple Scales,'' arXiv:0809.1345 2008.[0pt] [2] L. B. Shaw, L. Billings, I. B. Schwartz, ``Using dimension reduction to improve outbreak predictability of multi-strain diseases,'' J. Math. Bio. 55, 1 2007.[0pt] [3] L. B. Shaw and I. B. Schwartz, ``Fluctuating epidemics on adaptive networks,'' Physical Review E 77, 066101 2008.[0pt] [4] L. B. Shaw and I. B. Schwartz, ``Noise induced dynamics in adaptivenetworks with applications to epidemiology,'' arXiv:0807.3455 2008.[0pt] [5] M. I. Dykman, I. B. Schwartz, A. S. Landsman, ``Disease Extinction in the Presence of Random Vaccination,'' Phys. Rev. Letts. 101, 078101 2008.

Clonal Origins of Vibrio cholerae O1 El Tor Strains, Papua New Guinea, 2009–2011

PubMed Central

Collins, Deirdre; Jonduo, Marinjho H.; Rosewell, Alexander; Dutta, Samir R.; Dagina, Rosheila; Ropa, Berry; Siba, Peter M.; Greenhill, Andrew R.

2011-01-01

We used multilocus sequence typing and variable number tandem repeat analysis to determine the clonal origins of Vibrio cholerae O1 El Tor strains from an outbreak of cholera that began in 2009 in Papua New Guinea. The epidemic is ongoing, and transmission risk is elevated within the Pacific region. PMID:22099099

Deep sequencing of viral small-RNAs of citrus tristeza virus (CTV) reveals genomic differences between two Italian isolates of CTV

USDA-ARS?s Scientific Manuscript database

A recent Citrus tristeza virus (CTV) epidemic of quick decline (QD) killed many sweet orange trees grafted on sour orange rootstock in Sicily but left some asymptomatic trees in the same field. Recent reports indicated cross-protection involves exclusion of a severe CTV strain by a mild strain of th...

Antigenic and Genomic Diversity of Human Rotavirus VP4 in Two Consecutive Epidemic Seasons in Mexico

PubMed Central

Padilla-Noriega, Luis; Méndez-Toss, Martha; Menchaca, Griselda; Contreras, Juan F.; Romero-Guido, Pedro; Puerto, Fernando I.; Guiscafré, Héctor; Mota, Felipe; Herrera, Ismael; Cedillo, Roberto; Muñoz, Onofre; Calva, Juan; Guerrero, María de Lourdes; Coulson, Barbara S.; Greenberg, Harry B.; López, Susana; Arias, Carlos F.

1998-01-01

In the present investigation we characterized the antigenic diversity of the VP4 and VP7 proteins in 309 and 261 human rotavirus strains isolated during two consecutive epidemic seasons, respectively, in three different regions of Mexico. G3 was found to be the prevalent VP7 serotype during the first year, being superseded by serotype G1 strains during the second season. To antigenically characterize the VP4 protein of the strains isolated, we used five neutralizing monoclonal antibodies (MAbs) which showed specificity for VP4 serotypes P1A, P1B, and P2 in earlier studies. Eight different patterns of reactivity with these MAbs were found, and the prevalence of three of these patterns varied from one season to the next. The P genotype of a subset of 52 samples was determined by PCR. Among the strains characterized as genotype P[4] and P[8] there were three and five different VP4 MAb reactivity patterns, respectively, indicating that the diversity of neutralization epitopes in VP4 is greater than that previously appreciated by the genomic typing methods. PMID:9620401

[Circulation of West Nile virus (Flaviviridae, Flavivirus) and some other arboviruses in the ecosystems of Volga delta, Volga-Akhtuba flood-lands and adjoining arid regions (2000-2002)].

PubMed

L'vov, D K; Kovtunov, A I; Iashkulov, K B; Gromashevskiĭ, V L; Dzharkenov, A F; Shchelkanov, M Iu; Kulikova, L N; Savage, H M; Chimidova, N M; Mikhaliaeva, L B; Vasil'ev, A V; Galkina, I V; Prilipov, A G; Kinney, R M; Samokhvalov, E I; Bushkieva, B Ts; Gubler, D J; Al'khovskiĭ, S K; Aristova, V A; Deriabin, P G; Butenko, A M; Moskvina, T M; L'vov, D N; Zlobina, L V; Liapina, O V; Sadykova, G K; Shatalov, A G; Usachev, V E; Voronina, A G; Luneva, L I

2004-01-01

Comprehensive virological, serological as well as genetic studies of the ecology of West Nile Virus (WNV) as well as of some other arboviruses were undertaken in different ecosystems in the territories of the Astrakhan Region and of the Kalmyk Republic. The main carriers (mosquitoes, ticks, birds and mammals) were defined as involved in the circulation of viruses within the natural and anthropogenic biocenosis. Phylogenetic examinations of isolated strains and samples, which were positive in RT-PCR, showed an absolute predominance of genotype I virus that was most closely related to American and Israeli strains. At the same time, epidemic strains had up to 6% of nucleotide differences versus the historic strains isolated in the same region 20-30 years ago. Besides, the circulation of genotype IV was discovered; it was characterized by a lower pathogenicity, which, possibly, ensures the shaping of a pronounced immune interlayer bearing no epidemic consequences. An analysis of the study results on the WNV ecology denotes the epicenter of the endemic territory located in the middle part of the Volga delta.

Yersinia pestis DNA from skeletal remains from the 6(th) century AD reveals insights into Justinianic Plague.

PubMed

Harbeck, Michaela; Seifert, Lisa; Hänsch, Stephanie; Wagner, David M; Birdsell, Dawn; Parise, Katy L; Wiechmann, Ingrid; Grupe, Gisela; Thomas, Astrid; Keim, Paul; Zöller, Lothar; Bramanti, Barbara; Riehm, Julia M; Scholz, Holger C

2013-01-01

Yersinia pestis, the etiologic agent of the disease plague, has been implicated in three historical pandemics. These include the third pandemic of the 19(th) and 20(th) centuries, during which plague was spread around the world, and the second pandemic of the 14(th)-17(th) centuries, which included the infamous epidemic known as the Black Death. Previous studies have confirmed that Y. pestis caused these two more recent pandemics. However, a highly spirited debate still continues as to whether Y. pestis caused the so-called Justinianic Plague of the 6(th)-8(th) centuries AD. By analyzing ancient DNA in two independent ancient DNA laboratories, we confirmed unambiguously the presence of Y. pestis DNA in human skeletal remains from an Early Medieval cemetery. In addition, we narrowed the phylogenetic position of the responsible strain down to major branch 0 on the Y. pestis phylogeny, specifically between nodes N03 and N05. Our findings confirm that Y. pestis was responsible for the Justinianic Plague, which should end the controversy regarding the etiology of this pandemic. The first genotype of a Y. pestis strain that caused the Late Antique plague provides important information about the history of the plague bacillus and suggests that the first pandemic also originated in Asia, similar to the other two plague pandemics.

Epidemiological and genetic analysis of a 2014 outbreak of hepatitis A in Japan.

PubMed

Ishii, Koji; Kiyohara, Tomoko; Yoshizaki, Sayaka; Kawabata, Kunio; Kanayama, Atsuhiro; Yahata, Yuichiro; Takahashi, Takuri; Kinoshita, Hitomi; Saitou, Takehito; Sunagawa, Tomimasa; Oishi, Kazunori; Uema, Masashi; Noda, Mamoru; Wakita, Takaji

2015-11-09

Hepatitis A virus (HAV) is one of the most common causes of feces-transmitted acute hepatitis worldwide. In Japan, most of HAV infections have been sporadic cases and a relatively low number of cases (approximately 100-150) of acute hepatitis A were reported in 2012 and 2013. However, in 2014, 342 cases were reported as of week 22. In order to characterize the viral agents causing this outbreak, we collected stool or sera (and both for three case) from patients with hepatitis A from many regions throughout Japan and performed genotyping of the VP1/P2A regions of HAV. We then used a multiple-alignment algorithm to compare the nucleotide sequences with those of reference strains. Phylogenetic tree analyses revealed that the 159 HAV isolates were divided into three subgenotypes: IA (137 cases), IB (4 cases), and IIIA (18 cases). The most unique feature of this outbreak was that for most subgenotype IA cases (103 out of 137 IA cases) the sequences analyzed shared 100% homology. Interestingly, the peak week for these IA infections was almost the same nationwide, suggesting that the epidemic of hepatitis A caused by this subgenotype IA strain may have expanded from a single source possibly because of one food-borne or waterborne source that was distributed nationwide at once. Copyright © 2015 Elsevier Ltd. All rights reserved.

Development of an immunochromatographic lateral flow device for rapid diagnosis of Vibrio cholerae O1 serotype Ogawa.

PubMed

Chen, Weixian; Zhang, Jun; Lu, Gang; Yuan, Zuowei; Wu, Qian; Li, Jingjing; Xu, Guiping; He, An; Zheng, Jian; Zhang, Juan

2014-04-01

Cholera is an acute malignant infectious disease caused by the bacteria Vibrio cholerae leading to severe dehydrating diarrhea and vomiting, even high rates of mortality in some cases. However, the prevention of the epidemic disease is achievable if proper sanitation practices are followed, provided the accurate and prompt diagnosis of each prevalent serotype in cholera epidemic. The current gold standard of bacterial culture is inadequate for rapid diagnosis. Our aim is to develop an immunochromatographic test format for O1 serotype Ogawa diagnosis and provide the need for better epidemic prevention and early response. The monoclonal antibodies were raised in conventional method and subsequently screened for a match pair. A variety of related and unrelated bacteria strains recruited were employed to test their sensitivity, specificity etc. by indirect ELISA. The human fecal samples were used to test the final lateral-flow device product to satisfy the measurement requirement. A new monoclonal antibody (McAb) pair, named IXiao₃G₆ and IXiao₁D₉, was generated, which is specifically against V. cholerae O1 serotype Ogawa. Additionally, we developed an immunochromatographic lateral flow device (LFD) using this McAb pair for the highly specific and rapid (5 min) detection of Ogawa. Our product has advantages of simplicity and precision, and can benefit the scene and elementary medical institutions. Copyright © 2013 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

[Newcastle disease in southern Chad: peak epidemic periods and the impact of vaccination].

PubMed

Maho, A; Ndeledje Gondje, N; Mopate, L Y; Ganda Kana, S

2004-12-01

In spite of its universally acknowledged importance, backyard chicken production is still being hampered by Newcastle disease in some parts of the world. In Chad, the disease has been reported almost everywhere in the country and confirmed in several regions, but there are no control measures in place. A survey was conducted at three sites in south-eastern Chad in July and August 2001, based on face-to-face interviews with 20% of the peasant farmers keeping chickens at these sites. The aim was to collect information on peak epidemic periods and on ways in which the infection spreads. The survey revealed that the peak epidemic periods for Newcastle disease are April, during the mango harvesting and selling period, and December, when trade increases for the seasonal festivities. The survey also showed that peasant farmers attach great importance to chicken farming. The survey was followed by a vaccination trial in November 2001 and February 2002, using the La Sota strain administered ocularly. All of the birds vaccinated during the trial were successfully protected from the disease and both chicken production and the income of the villagers increased. The authors conclude that in order to sustain poultry farming and maximise production in the southern zone, vaccination programmes must be urgently introduced, campaigns to raise awareness of Newcastle disease should be carried out and financial support to pay for vaccines should be provided. Efforts to combat other causes of poultry mortality must also be undertaken.

Sudden increase in human infection with avian influenza A(H7N9) virus in China, September–December 2016

PubMed Central

Zhou, Lei; Ren, Ruiqi; Yang, Lei; Bao, Changjun; Wu, Jiabing; Wang, Dayan; Li, Chao; Xiang, Nijuan; Wang, Yali; Li, Dan; Sui, Haitian; Shu, Yuelong; Feng, Zijian; Li, Qun

2017-01-01

Since the first outbreak of avian influenza A(H7N9) virus in humans was identified in 2013, there have been five seasonal epidemics observed in China. An earlier start and a steep increase in the number of humans infected with H7N9 virus was observed between September and December 2016, raising great public concern in domestic and international societies. The epidemiological characteristics of the recently reported confirmed H7N9 cases were analysed. The results suggested that although more cases were reported recently, most cases in the fifth epidemic were still highly sporadically distributed without any epidemiology links; the main characteristics remained unchanged and the genetic characteristics of virus strains that were isolated in this epidemic remained similar to earlier epidemics. Interventions included live poultry market closures in several cities that reported more H7N9 cases recently. PMID:28409054

Current concepts on the virulence mechanisms of meticillin-resistant Staphylococcus aureus

PubMed Central

David, Michael Z.; Salata, Robert A.

2012-01-01

Meticillin-resistant Staphylococcus aureus (MRSA) strains are prevalent bacterial pathogens that cause both health care and community-associated infections. Increasing resistance to commonly prescribed antibiotics has made MRSA a serious threat to public health throughout the world. The USA300 strain of MRSA has been responsible for an epidemic of community-associated infections in the US, mostly involving skin and soft tissue but also more serious invasive syndromes such as pneumonia, severe sepsis and endocarditis. MRSA strains are particularly serious and potentially lethal pathogens that possess virulence mechanisms including toxins, adhesins, enzymes and immunomodulators. One of these is Panton–Valentine leukocidin (PVL), a toxin associated with abscess formation and severe necrotizing pneumonia. Earlier studies suggested that PVL was a major virulence factor in community-associated MRSA infections. However, some recent data have not supported this association while others have, leading to controversy. Therefore, investigators continue to search for additional mechanisms of pathogenesis. In this review, we summarize the current understanding of the biological basis of MRSA virulence and explore future directions for research, including potential vaccines and antivirulence therapies under development that might allow clinicians to more successfully treat and prevent MRSA infections. PMID:22745137

Norovirus contamination levels in ground water treatment systems used for food-catering facilities in South Korea.

PubMed

Lee, Bo-Ram; Lee, Sung-Geun; Park, Jong-Hyun; Kim, Kwang-Yup; Ryu, Sang-Ryeol; Rhee, Ok-Jae; Park, Jeong-Woong; Lee, Jeong-Su; Paik, Soon-Young

2013-07-02

This study aimed to inspect norovirus contamination of groundwater treatment systems used in food-catering facilities located in South Korea. A nationwide study was performed in 2010. Water samples were collected and, for the analysis of water quality, the temperature, pH, turbidity, and residual chlorine content were assessed. To detect norovirus genotypes GI and GII, RT-PCR and semi-nested PCR were performed with specific NV-GI and NV-GII primer sets, respectively. The PCR products amplified from the detected strains were then subjected to sequence analyses. Of 1,090 samples collected in 2010, seven (0.64%) were found to be norovirus-positive. Specifically, one norovirus strain was identified to have the GI-6 genotype, and six GII strains had the GII, GII-3, GII-4, and GII-17 genotypes. The very low detection rate of norovirus most likely reflects the preventative measures used. However, this virus can spread rapidly from person to person in crowded, enclosed places such as the schools investigated in this study. To promote better public health and sanitary conditions, it is necessary to periodically monitor noroviruses that frequently cause epidemic food poisoning in South Korea.

Norovirus Contamination Levels in Ground Water Treatment Systems Used for Food-Catering Facilities in South Korea

PubMed Central

Lee, Bo-Ram; Lee, Sung-Geun; Park, Jong-Hyun; Kim, Kwang-Yup; Ryu, Sang-Ryeol; Rhee, Ok-Jae; Park, Jeong-Woong; Lee, Jeong-Su; Paik, Soon-Young

2013-01-01

This study aimed to inspect norovirus contamination of groundwater treatment systems used in food-catering facilities located in South Korea. A nationwide study was performed in 2010. Water samples were collected and, for the analysis of water quality, the temperature, pH, turbidity, and residual chlorine content were assessed. To detect norovirus genotypes GI and GII, RT-PCR and semi-nested PCR were performed with specific NV-GI and NV-GII primer sets, respectively. The PCR products amplified from the detected strains were then subjected to sequence analyses. Of 1,090 samples collected in 2010, seven (0.64%) were found to be norovirus-positive. Specifically, one norovirus strain was identified to have the GI-6 genotype, and six GII strains had the GII, GII-3, GII-4, and GII-17 genotypes. The very low detection rate of norovirus most likely reflects the preventative measures used. However, this virus can spread rapidly from person to person in crowded, enclosed places such as the schools investigated in this study. To promote better public health and sanitary conditions, it is necessary to periodically monitor noroviruses that frequently cause epidemic food poisoning in South Korea. PMID:23820792

High Prevalence and Onward Transmission of Non-Pandemic HIV-1 Subtype B Clades in Northern and Northeastern Brazilian Regions

PubMed Central

Divino, Flavia; de Lima Guerra Corado, Andre; Gomes Naveca, Felipe; Stefani, Mariane M. A.; Bello, Gonzalo

2016-01-01

The Human immunodeficiency virus type-1 (HIV-1) epidemic in Brazil is mainly driven by the subtype B pandemic lineage (BPANDEMIC), while Caribbean non-pandemic subtype B clades (BCAR) seem to account for a very low fraction of HIV-infections in this country. The molecular characteristics of the HIV-1 subtype B strains disseminated in the Northern and Northeastern Brazilian regions, however, have not been explored so far. In this study, we estimate the prevalence of the HIV-1 BPANDEMIC and BCAR clades across different Brazilian regions and we reconstruct the spatiotemporal dynamics of dissemination of the major Brazilian BCAR clades. A total of 2,682 HIV-1 subtype B pol sequences collected from 21 different Brazilian states from the five country regions between 1998 and 2013 were analyzed. Maximum Likelihood phylogenetic analyses revealed that the BCAR strains reached 16 out 21 Brazilian states here analyzed. The BCAR clades comprise a low fraction (<10%) of subtype B infections in most Brazilian states analyzed, with exception of Roraima (41%), Amazonas (14%) and Maranhão (14%). Bayesian phylogeographic analyses indicate that BCAR strains originally from the Hispaniola and Trinidad and Tobago were introduced at multiple times into different states from all Brazilian regions and a few of those strains, probably introduced into Roraima, Maranhão and São Paulo between the late 1970s and the early 1980s, established secondary outbreaks in the Brazilian population. These results support that the HIV-1 subtype B epidemics in some Brazilian states from the Northern and Northeastern regions display a unique molecular pattern characterized by the high prevalence of BCAR lineages, which probably reflects a strong epidemiological link with the HIV-1 epidemics in the Caribbean region. PMID:27603317

Multi-scale modeling for the transmission of influenza and the evaluation of interventions toward it.

PubMed

Guo, Dongmin; Li, King C; Peters, Timothy R; Snively, Beverly M; Poehling, Katherine A; Zhou, Xiaobo

2015-03-11

Mathematical modeling of influenza epidemic is important for analyzing the main cause of the epidemic and finding effective interventions towards it. The epidemic is a dynamic process. In this process, daily infections are caused by people's contacts, and the frequency of contacts can be mainly influenced by their cognition to the disease. The cognition is in turn influenced by daily illness attack rate, climate, and other environment factors. Few existing methods considered the dynamic process in their models. Therefore, their prediction results can hardly be explained by the mechanisms of epidemic spreading. In this paper, we developed a heterogeneous graph modeling approach (HGM) to describe the dynamic process of influenza virus transmission by taking advantage of our unique clinical data. We built social network of studied region and embedded an Agent-Based Model (ABM) in the HGM to describe the dynamic change of an epidemic. Our simulations have a good agreement with clinical data. Parameter sensitivity analysis showed that temperature influences the dynamic of epidemic significantly and system behavior analysis showed social network degree is a critical factor determining the size of an epidemic. Finally, multiple scenarios for vaccination and school closure strategies were simulated and their performance was analyzed.

Predictive analysis effectiveness in determining the epidemic disease infected area

NASA Astrophysics Data System (ADS)

Ibrahim, Najihah; Akhir, Nur Shazwani Md.; Hassan, Fadratul Hafinaz

2017-10-01

Epidemic disease outbreak had caused nowadays community to raise their great concern over the infectious disease controlling, preventing and handling methods to diminish the disease dissemination percentage and infected area. Backpropagation method was used for the counter measure and prediction analysis of the epidemic disease. The predictive analysis based on the backpropagation method can be determine via machine learning process that promotes the artificial intelligent in pattern recognition, statistics and features selection. This computational learning process will be integrated with data mining by measuring the score output as the classifier to the given set of input features through classification technique. The classification technique is the features selection of the disease dissemination factors that likely have strong interconnection between each other in causing infectious disease outbreaks. The predictive analysis of epidemic disease in determining the infected area was introduced in this preliminary study by using the backpropagation method in observation of other's findings. This study will classify the epidemic disease dissemination factors as the features for weight adjustment on the prediction of epidemic disease outbreaks. Through this preliminary study, the predictive analysis is proven to be effective method in determining the epidemic disease infected area by minimizing the error value through the features classification.

Molecular analysis of carbapenem-resistant strains of Pseudomonas aeruginosa isolated from patients hospitalized in various transplantation wards between 2008 and 2011.

PubMed

Kosykowska, E; Szymanek-Majchrzak, K; Walter de Walthoffen, S; Izdebski, R; Mlynarczyk, A; Ciszek, M; Chmura, A; Durlik, M; Paczek, L; Deborska-Materkowska, D; Sawicka-Grzelak, A; Mlynarczyk, G

2014-10-01

Recent years have seen a concerning increase in the number of carbapenem-resistant Pseudomonas aeruginosa strains. P aeruginosa is one of the most dangerous factors causing nosocomial infections, and immunosuppressed patients constitute a special risk group. The purpose of our study was to conduct a molecular analysis of 22 clinical isolates of carbapenem-resistant P aeruginosa obtained between 2008 and 2011. Metallo-beta-lactamase (MBL) phenotype tests were conducted. A polymerase chain reaction technique was used to detect VIM, IMP, NDM, and GIM carbapenemase-encoding genes. The minimum inhibitory concentrations were determined for imipenem, meropenem, and doripenem. Molecular typing was conducted with the use of restriction fragment length polymorphism/pulsed-field gel electrophoresis (RFLP-PFGE). Of the 22 strains initially resistant to at least one carbapenem, we selected 18 that exhibited the MBL phenotype. Of those 18, we identified 15 strains expressing VIM carbapenemase-encoding genes. None of the other evaluated genes were detected. VIM-positive isolates exhibited higher levels of resistance than the other ones. The RFLP technique revealed 10 different PFGE types and 6 epidemic foci. Identical strains were isolated over the period of up to 3 years. The reason for resistance to carbapenems in the majority (68%) of P aeruginosa strains isolated at the evaluated hospital was the presence of VIM carbapenemase. It is safe to say that the VIM carbapenemase is responsible for a higher level of resistance than unidentified mechanisms. Carbapenem-resistant strains of P aeruginosa spread clonally within individual wards and are likely to be of hospital origin.

Epidemics with pathogen mutation on small-world networks

NASA Astrophysics Data System (ADS)

Shao, Zhi-Gang; Tan, Zhi-Jie; Zou, Xian-Wu; Jin, Zhun-Zhi

2006-05-01

We study the dynamical behavior of the epidemiological model with pathogen mutation on small-world networks, and discuss the influence of the immunity duration τR, the cross-immunity threshold hthr, and system size N on epidemic dynamics. A decaying oscillation occurs because of the interplay between the immune response and the pathogen mutation. These results have implications for the interpretation of longitudinal epidemiological data on strain abundance, and they will be helpful to assess the threat of highly pathogenic and mutative viruses, such as avian influenza.

Long-term clinical outcomes of 'Prairie Epidemic Strain' Pseudomonas aeruginosa infection in adults with cystic fibrosis.

PubMed

Somayaji, Ranjani; Lam, John C; Surette, Michael G; Waddell, Barbara; Rabin, Harvey R; Sibley, Christopher D; Purighalla, Swathi; Parkins, Michael D

2017-04-01

Epidemic Pseudomonas aeruginosa (PA) plays an important role in cystic fibrosis (CF) lung disease. A novel strain, the 'Prairie Epidemic Strain' (PES), has been identified in up to 30% of patients in Prairie-based Canadian CF centres. To determine the incidence, prevalence and long-term clinical impact of PES infection. A cohort of adults with CF was followed from 1980 to 2014 where bacteria isolated from clinical encounters were prospectively collected. Strain typing was performed using pulse-field gel electrophoresis and multilocus sequence typing. Patients were divided into one of four cohorts: no PA, transient PA, chronic PA with unique strains and chronic PES. Proportional Cox hazard and linear mixed models were used to assess for CF-associated respiratory death or transplantation, and rates of %FEV 1 and body mass index (BMI) decline. 274 patients (51.7% male) were analysed: 44--no PA, 29--transient PA, 137--unique PA, 64--PES. A total of 92 patients (33.6%) died or underwent lung transplantation (2423.0 patient-years). PES infection was associated with greater risk of respiratory death or lung transplant compared with the no PA group (aHR, 3.94 (95% CI 1.18 to 13.1); p=0.03) and unique PA group (aHR, 1.75 (95% CI 1.05 to 2.92) p=0.03). Rate of lung function decline (%FEV 1 predicted) was greatest in the PES group (1.73%/year (95% CI 1.63% to 1.82%); p<0.001). BMI improved over time but at an attenuated rate in the PES group (p=0.001). Infection with PES was associated with increased patient morbidity through three decades and manifested in an increased risk of respiratory death and/or lung transplantation. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Early Strains of Multidrug-Resistant Salmonella enterica Serovar Kentucky Sequence Type 198 from Southeast Asia Harbor Salmonella Genomic Island 1-J Variants with a Novel Insertion Sequence

PubMed Central

Le Hello, Simon; Weill, François-Xavier; Guibert, Véronique; Praud, Karine; Cloeckaert, Axel

2012-01-01

Salmonella genomic island 1 (SGI1) is a 43-kb integrative mobilizable element that harbors a great diversity of multidrug resistance gene clusters described in numerous Salmonella enterica serovars and also in Proteus mirabilis. The majority of SGI1 variants contain an In104-derivative complex class 1 integron inserted between resolvase gene res and open reading frame (ORF) S044 in SGI1. Recently, the international spread of ciprofloxacin-resistant S. enterica serovar Kentucky sequence type 198 (ST198) containing SGI1-K variants has been reported. A retrospective study was undertaken to characterize ST198 S. Kentucky strains isolated before the spread of the epidemic ST198-SGI1-K population in Africa and the Middle East. Here, we characterized 12 ST198 S. Kentucky strains isolated between 1969 and 1999, mainly from humans returning from Southeast Asia (n = 10 strains) or Israel (n = 1 strain) or from meat in Egypt (n = 1 strain). All these ST198 S. Kentucky strains did not belong to the XbaI pulsotype X1 associated with the African epidemic clone but to pulsotype X2. SGI1-J subgroup variants containing different complex integrons with a partial transposition module and inserted within ORF S023 of SGI1 were detected in six strains. The SGI1-J4 variant containing a partially deleted class 1 integron and thus showing a narrow resistance phenotype to sulfonamides was identified in two epidemiologically unrelated strains from Indonesia. The four remaining strains harbored a novel SGI1-J variant, named SGI1-J6, which contained aadA2, floR2, tetR(G)-tetA(G), and sul1 resistance genes within its complex integron. Moreover, in all these S. Kentucky isolates, a novel insertion sequence related to the IS630 family and named ISSen5 was found inserted upstream of the SGI1 complex integron in ORF S023. Thus, two subpopulations of S. Kentucky ST198 independently and exclusively acquired the SGI1 during the 1980s and 1990s. Unlike the ST198-X1 African epidemic subpopulation, the ST198-X2 subpopulation mainly from Asia harbors variants of the SGI1-J subgroup that are encountered mainly in the Far East, as previously described for S. enterica serovars Emek and Virchow. PMID:22802251

Early strains of multidrug-resistant Salmonella enterica serovar Kentucky sequence type 198 from Southeast Asia harbor Salmonella genomic island 1-J variants with a novel insertion sequence.

PubMed

Le Hello, Simon; Weill, François-Xavier; Guibert, Véronique; Praud, Karine; Cloeckaert, Axel; Doublet, Benoît

2012-10-01

Salmonella genomic island 1 (SGI1) is a 43-kb integrative mobilizable element that harbors a great diversity of multidrug resistance gene clusters described in numerous Salmonella enterica serovars and also in Proteus mirabilis. The majority of SGI1 variants contain an In104-derivative complex class 1 integron inserted between resolvase gene res and open reading frame (ORF) S044 in SGI1. Recently, the international spread of ciprofloxacin-resistant S. enterica serovar Kentucky sequence type 198 (ST198) containing SGI1-K variants has been reported. A retrospective study was undertaken to characterize ST198 S. Kentucky strains isolated before the spread of the epidemic ST198-SGI1-K population in Africa and the Middle East. Here, we characterized 12 ST198 S. Kentucky strains isolated between 1969 and 1999, mainly from humans returning from Southeast Asia (n = 10 strains) or Israel (n = 1 strain) or from meat in Egypt (n = 1 strain). All these ST198 S. Kentucky strains did not belong to the XbaI pulsotype X1 associated with the African epidemic clone but to pulsotype X2. SGI1-J subgroup variants containing different complex integrons with a partial transposition module and inserted within ORF S023 of SGI1 were detected in six strains. The SGI1-J4 variant containing a partially deleted class 1 integron and thus showing a narrow resistance phenotype to sulfonamides was identified in two epidemiologically unrelated strains from Indonesia. The four remaining strains harbored a novel SGI1-J variant, named SGI1-J6, which contained aadA2, floR2, tetR(G)-tetA(G), and sul1 resistance genes within its complex integron. Moreover, in all these S. Kentucky isolates, a novel insertion sequence related to the IS630 family and named ISSen5 was found inserted upstream of the SGI1 complex integron in ORF S023. Thus, two subpopulations of S. Kentucky ST198 independently and exclusively acquired the SGI1 during the 1980s and 1990s. Unlike the ST198-X1 African epidemic subpopulation, the ST198-X2 subpopulation mainly from Asia harbors variants of the SGI1-J subgroup that are encountered mainly in the Far East, as previously described for S. enterica serovars Emek and Virchow.

An inactivated vaccine made from a U.S. field isolate of porcine epidemic disease virus is immunogenic in pigs as demonstrated by a dose-titration.

PubMed

Collin, Emily A; Anbalagan, Srivishnupriya; Okda, Faten; Batman, Ron; Nelson, Eric; Hause, Ben M

2015-03-15

Porcine epidemic diarrhea virus (PEDV), a highly pathogenic and transmissible virus in swine, was first detected in the U.S. in May, 2013, and has caused tremendous losses to the swine industry. Due to the difficulty in isolating and growing this virus in cell culture, few vaccine studies using cell culture propagated PEDV have been performed on U.S. strains in pigs. Therefore, the objective of this study was to evaluate the humoral immune response to the selected inactivated PEDV vaccine candidate in a dose-titration manner. PEDV was isolated from a pig with diarrhea and complete genome sequencing found >99% nucleotide identity to other U.S. PEDV. Inactivated adjuvanted monovalent vaccines were administered intramuscularly to five week old pigs in a dose titration experimental design, ranging from 6.0-8.0 log10 tissue culture infective dose (TCID50/mL), to evaluate immunogenicity using a fluorescent foci neutralization assay (FFN), fluorescent microsphere immunoassay (FMIA), and enzyme-linked immunosorbent assay (ELISA) on sera. Pigs vaccinated with 8.0 log10 TCID50/mL inactivated virus showed significantly higher FFN titers as well as FMIA and ELISA values than 6.0 log10 TCID50/mL vaccinates and the negative controls. These results demonstrate the immunogenicity of a PEDV inactivated viral vaccine with a U.S. strain via dose-titration. A future vaccination-challenge study would illustrate the efficacy of an inactivated vaccine and help evaluate protective FFN titers and ELISA and FMIA responses.

A naturally occurring variant of the human prion protein completely prevents prion disease.

PubMed

Asante, Emmanuel A; Smidak, Michelle; Grimshaw, Andrew; Houghton, Richard; Tomlinson, Andrew; Jeelani, Asif; Jakubcova, Tatiana; Hamdan, Shyma; Richard-Londt, Angela; Linehan, Jacqueline M; Brandner, Sebastian; Alpers, Michael; Whitfield, Jerome; Mead, Simon; Wadsworth, Jonathan D F; Collinge, John

2015-06-25

Mammalian prions, transmissible agents causing lethal neurodegenerative diseases, are composed of assemblies of misfolded cellular prion protein (PrP). A novel PrP variant, G127V, was under positive evolutionary selection during the epidemic of kuru--an acquired prion disease epidemic of the Fore population in Papua New Guinea--and appeared to provide strong protection against disease in the heterozygous state. Here we have investigated the protective role of this variant and its interaction with the common, worldwide M129V PrP polymorphism. V127 was seen exclusively on a M129 PRNP allele. We demonstrate that transgenic mice expressing both variant and wild-type human PrP are completely resistant to both kuru and classical Creutzfeldt-Jakob disease (CJD) prions (which are closely similar) but can be infected with variant CJD prions, a human prion strain resulting from exposure to bovine spongiform encephalopathy prions to which the Fore were not exposed. Notably, mice expressing only PrP V127 were completely resistant to all prion strains, demonstrating a different molecular mechanism to M129V, which provides its relative protection against classical CJD and kuru in the heterozygous state. Indeed, this single amino acid substitution (G→V) at a residue invariant in vertebrate evolution is as protective as deletion of the protein. Further study in transgenic mice expressing different ratios of variant and wild-type PrP indicates that not only is PrP V127 completely refractory to prion conversion but acts as a potent dose-dependent inhibitor of wild-type prion propagation.

Current developments in understanding of West Nile virus central nervous system disease.

PubMed

Tyler, Kenneth L

2014-06-01

West Nile virus (WNV) is the most important cause of epidemic encephalitis in the United States. We review articles published in the last 18 months related to the epidemiology, immunology, clinical features, and treatment of this disease. There was a resurgence in WNV disease in the United States in 2012. The WNV strain now predominant in the United States (NA/WN02) differs from the initial emergent isolate in 1999 (NY99). However, differences in the genetics of currently circulating United States WNV strains do not explain variations in epidemic magnitude or disease severity. Innate and acquired immunity are critical in control of WNV, and in some cases pathways are central nervous system specific. The clinical features of infection are now well understood, although nonconfirmed observations of chronic viral excretion in urine remain controversial. There is no specific antiviral therapy for WNV, but studies of antivirals specific for other flaviviruses may identify agents with promise against WNV. Phase I and II human WNV vaccine clinical trials have established that well tolerated and immunogenic WNV vaccines can be developed. WNV remains an important public health problem. Although recent studies have significantly increased our understanding of host immune and genetic factors involved in control of WNV infection, no specific therapy is yet available. Development of a well tolerated, immunogenic, and effective vaccine against WNV is almost certainly feasible, but economic factors and the lack of predictability of the magnitude and location of outbreaks are problematic for designing phase III trials and ultimate licensure.

Genetic evolution of Human Enterovirus A71 subgenotype C4 in Shenzhen, China, 1998-2013.

PubMed

He, Yaqing; Zou, Linjie; Chong, Marc Ka Chun; Men, Ruoting; Xu, Wenbo; Yang, Hong; Yao, Xiangjie; Chen, Long; Xian, Huixia; Zhang, Hailong; Luo, Min; Cheng, Jinquan; Ma, Hanwu; Feng, Qianjin; Huang, Yun; Wang, Yujie; Yeoh, Eng-Kiong; Zee, Benny Chung-Ying; Zhou, Yuanping; He, Ming-Liang; Wang, Maggie Haitian

2016-06-01

Human Enterovirus A71 (EV-A71) is one of the severest enteroviruses that causes hand, foot, and mouth disease (HFMD) among children. This study identified the mutations of EV-A71 VP1 amino acid residues over a number of years and explored the possible association of identified mutations and HFMD epidemic outbreaks in Shenzhen, China. A total of 3760 stool specimens were collected from HFMD patients by Shenzhen Centers for Disease Control and Prevention (CDC) between 1998 and 2013. In total 289 VP1 strains were sequenced in this study, and amino acids mutation frequency was calculated. There were 2040 China nationwide sequences downloaded from Genebank as replication data. In our samples, 1036 subjects (27.6%) were EV-A71 infected. Three amino acid positions on VP1 protein were found to have high mutation prevalence. These are Q22H, S283T, and A289H. Site 22 showed a fast mutation fixation in the year 2008, at the time of the large scale epidemic outbreak in Shenzhen. Analysis of the nationwide data replicated the same trend of mutation prevalence of the three sites. The switching from Q to H on site 22 of the EV-A71 VP1 strain might be associated with the HFMD outbreak in Shenzhen in 2008. The identified amino acid sites 22, 283 and 289 provided information for developing anti-viral drugs against EV-A71 in the future. Copyright © 2016 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

Intrahost Evolution of Methicillin-Resistant Staphylococcus aureus USA300 Among Individuals With Reoccurring Skin and Soft-Tissue Infections.

PubMed

Azarian, Taj; Daum, Robert S; Petty, Lindsay A; Steinbeck, Jenny L; Yin, Zachary; Nolan, David; Boyle-Vavra, Susan; Hanage, W P; Salemi, Marco; David, Michael Z

2016-09-15

Methicillin-resistant Staphylococcus aureus (MRSA) USA300 is the leading cause of MRSA infections in the United States and has caused an epidemic of skin and soft-tissue infections. Recurrent infections with USA300 MRSA are common, yet intrahost evolution during persistence on an individual has not been studied. This gap hinders the ability to clinically manage recurrent infections and reconstruct transmission networks. To characterize bacterial intrahost evolution, we examined the clinical courses of 4 subjects with 3-6 recurrent USA300 MRSA infections, using patient clinical data, including antibiotic exposure history, and whole-genome sequencing and phylogenetic analysis of all available MRSA isolates (n = 29). Among sequential isolates, we found variability in diversity, accumulation of mutations, and mobile genetic elements. Selection for antimicrobial-resistant populations was observed through both an increase in the number of plasmids conferring multidrug resistance and strain replacement by a resistant population. Two of 4 subjects had strain replacement with a genetically distinct USA300 MRSA population. During a 5-year period in 4 subjects, we identified development of antimicrobial resistance, intrahost evolution, and strain replacement among isolates from patients with recurrent MRSA infections. This calls into question the efficacy of decolonization to prevent recurrent infections and highlights the adaptive potential of USA300 and the need for effective sampling. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Proteomics of Pseudomonas aeruginosa Australian epidemic strain 1 (AES-1) cultured under conditions mimicking the cystic fibrosis lung reveals increased iron acquisition via the siderophore pyochelin.

PubMed

Hare, Nathan J; Soe, Cho Zin; Rose, Barbara; Harbour, Colin; Codd, Rachel; Manos, Jim; Cordwell, Stuart J

2012-02-03

Pseudomonas aeruginosa is an opportunistic pathogen that is the major cause of morbidity and mortality in patients with cystic fibrosis (CF). While most CF patients are thought to acquire P. aeruginosa from the environment, person-to-person transmissible strains have been identified in CF clinics worldwide, and the molecular basis for transmissibility remains poorly understood. We undertook a complementary proteomics approach to characterize protein profiles from a transmissible, acute isolate of the Australian epidemic strain 1 (AES-1R), the virulent burns/wound isolate PA14, and the poorly virulent, laboratory-associated strain PAO1 when grown in an artificial medium that mimics the CF lung environment compared to growth in standard laboratory medium. Proteins elevated in abundance in AES-1R included those involved in methionine and S-adenosylmethionine biosynthesis and in the synthesis of phenazines. Proteomic data were validated by measuring culture supernatant levels of the virulence factor pyocyanin, which is the final product of the phenazine pathway. AES-1R and PAO1 released higher extracellular levels of pyocyanin compared to PA14 when grown in conditions that mimic the CF lung. Proteins associated with biosynthesis of the iron-scavenging siderophore pyochelin (PchDEFGH and FptA) were also present at elevated abundance in AES-1R and at much higher levels than in PAO1, whereas they were reduced in PA14. These protein changes resulted phenotypically in increased extracellular iron acquisition potential and, specifically, elevated pyochelin levels in AES-1R culture supernatants as detected by chrome azurol-S assay and fluorometry, respectively. Transcript analysis of pyochelin genes (pchDFG and fptA) showed they were highly expressed during the early stage of growth in artificial sputum medium (18 h) but returned to basal levels following the establishment of microcolony growth (72 h) consistent with that observed in the CF lung. This provides further evidence that iron acquisition by pyochelin may play a role in the early stages of transmissible CF infection associated with AES-1R.

Immunogenetic Mechanisms Driving Norovirus GII.4 Antigenic Variation

PubMed Central

Donaldson, Eric F.; Corti, Davide; Swanstrom, Jesica; Debbink, Kari; Lanzavecchia, Antonio; Baric, Ralph S.

2012-01-01

Noroviruses are the principal cause of epidemic gastroenteritis worldwide with GII.4 strains accounting for 80% of infections. The major capsid protein of GII.4 strains is evolving rapidly, resulting in new epidemic strains with altered antigenic potentials. To test if antigenic drift may contribute to GII.4 persistence, human memory B cells were immortalized and the resulting human monoclonal antibodies (mAbs) characterized for reactivity to a panel of time-ordered GII.4 virus-like particles (VLPs). Reflecting the complex exposure history of the volunteer, human anti-GII.4 mAbs grouped into three VLP reactivity patterns; ancestral (1987–1997), contemporary (2004–2009), and broad (1987–2009). NVB 114 reacted exclusively to the earliest GII.4 VLPs by EIA and blockade. NVB 97 specifically bound and blocked only contemporary GII.4 VLPs, while NBV 111 and 43.9 exclusively reacted with and blocked variants of the GII.4.2006 Minerva strain. Three mAbs had broad GII.4 reactivity. Two, NVB 37.10 and 61.3, also detected other genogroup II VLPs by EIA but did not block any VLP interactions with carbohydrate ligands. NVB 71.4 cross-neutralized the panel of time-ordered GII.4 VLPs, as measured by VLP-carbohydrate blockade assays. Using mutant VLPs designed to alter predicted antigenic epitopes, two evolving, GII.4-specific, blockade epitopes were mapped. Amino acids 294–298 and 368–372 were required for binding NVB 114, 111 and 43.9 mAbs. Amino acids 393–395 were essential for binding NVB 97, supporting earlier correlations between antibody blockade escape and carbohydrate binding variation. These data inform VLP vaccine design, provide a strategy for expanding the cross-blockade potential of chimeric VLP vaccines, and identify an antibody with broadly neutralizing therapeutic potential for the treatment of human disease. Moreover, these data support the hypothesis that GII.4 norovirus evolution is heavily influenced by antigenic variation of neutralizing epitopes and consequently, antibody-driven receptor switching; thus, protective herd immunity is a driving force in norovirus molecular evolution. PMID:22615565

Australian epidemic strain pseudomonas (AES-1) declines further in a cohort segregated cystic fibrosis clinic.

PubMed

Griffiths, Amanda L; Wurzel, Danielle F; Robinson, Phil J; Carzino, Rosemary; Massie, John

2012-01-01

To evaluate changes in prevalence of an epidemic strain of Pseudomonas aeruginosa (AES-1, Australian epidemic strain, type 1) in a paediatric cystic fibrosis (CF) centre practising cohort segregation, to describe the patients' clinical characteristics at acquisition and observe mortality rates. Cohort segregation was introduced in our paediatric CF clinic January 2000. The prevalence of AES-1 was analysed in 1999, 2002 and 2007. Age at acquisition, lung function, presence of bronchiectasis, hospitalisations, prior P. aeruginosa infection and mortality rates were collected. AES-1 infection was determined by pulse-field-gel-electrophoresis (PFGE) on airway specimen cultures taken three monthly. The prevalence of AES-1 declined from 21% in 1999 to 14% in 2002 (risk difference 7% (95% CI 1,13) p=0.0256) and to 6% in 2007 (risk difference 8% (95% CI 3,13) p=0.0018). New acquisitions after the introduction of cohort segregation were uncommon (10 by 2002 and another 7 by 2007) with a declining incidence of 3.3 cases/year (1999 to 2002) compared to 1.4 cases/year (2002 to 2007). Twenty-two of 32 (69%) deaths between 1999 and 2007 occurred in patients infected with AES-1. Cohort segregation has been associated with reductions in the prevalence of AES-1 in our CF clinic. Mortality was higher in patients infected with AES-1 than other organisms. Copyright © 2011 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

Status of vaccines for porcine epidemic diarrhea virus in the United States and Canada

USDA-ARS?s Scientific Manuscript database

In 2013, porcine epidemic diarrhea virus (PEDV) emerged in the United States as a rapidly spreading epidemic causing dramatic death losses in suckling piglets. Neonatal piglets are most vulnerable to clinical disease and their only protection is passive immunity from their dam. At the end of the thi...

Ten Putative Contributors to the Obesity Epidemic

PubMed Central

McAllister, Emily J.; Dhurandhar, Nikhil V.; Keith, Scott W.; Aronne, Louis J.; Barger, Jamie; Baskin, Monica; Benca, Ruth M.; Biggio, Joseph; Boggiano, Mary M.; Eisenmann, Joe C.; Elobeid, Mai; Fontaine, Kevin R.; Gluckman, Peter; Hanlon, Erin C.; Katzmarzyk, Peter; Pietrobelli, Angelo; Redden, David T.; Ruden, Douglas M.; Wang, Chenxi; Waterland, Robert A.; Wright, Suzanne M.; Allison, David B.

2010-01-01

The obesity epidemic is a global issue and shows no signs of abating, while the cause of this epidemic remains unclear. Marketing practices of energy-dense foods and institutionally-driven declines in physical activity are the alleged perpetrators for the epidemic, despite a lack of solid evidence to demonstrate their causal role. While both may contribute to obesity, we call attention to their unquestioned dominance in program funding and public efforts to reduce obesity, and propose several alternative putative contributors that would benefit from equal consideration and attention. Evidence for microorganisms, epigenetics, increasing maternal age, greater fecundity among people with higher adiposity, assortative mating, sleep debt, endocrine disruptors, pharmaceutical iatrogenesis, reduction in variability of ambient temperatures, and intrauterine and intergenerational effects, as contributing factors to the obesity epidemic are reviewed herein. While the evidence is strong for some contributors such as pharmaceutical-induced weight gain, it is still emerging for other reviewed factors. Considering the role of such putative etiological factors of obesity may lead to comprehensive, cause specific, and effective strategies for prevention and treatment of this global epidemic. PMID:19960394

Epidemic spread on interconnected metapopulation networks

NASA Astrophysics Data System (ADS)

Wang, Bing; Tanaka, Gouhei; Suzuki, Hideyuki; Aihara, Kazuyuki

2014-09-01

Numerous real-world networks have been observed to interact with each other, resulting in interconnected networks that exhibit diverse, nontrivial behavior with dynamical processes. Here we investigate epidemic spreading on interconnected networks at the level of metapopulation. Through a mean-field approximation for a metapopulation model, we find that both the interaction network topology and the mobility probabilities between subnetworks jointly influence the epidemic spread. Depending on the interaction between subnetworks, proper controls of mobility can efficiently mitigate epidemics, whereas an extremely biased mobility to one subnetwork will typically cause a severe outbreak and promote the epidemic spreading. Our analysis provides a basic framework for better understanding of epidemic behavior in related transportation systems as well as for better control of epidemics by guiding human mobility patterns.

Protection to homologous and heterologous challenge in pigs immunized with vaccine against foot-and-mouth disease type O caused an epidemic in East Asia during 2010/2011.

PubMed

Park, Jeong-Nam; Lee, Seo-Yong; Chu, Jia-Qi; Lee, Yeo-Joo; Kim, Rae-Hyung; Lee, Kwang-Nyeong; Kim, Su-Mi; Tark, Dong-Seob; Kim, Byounghan; Park, Jong-Hyeon

2014-04-01

Foot-and-mouth disease (FMD) is a highly contagious infectious disease, and the use of vaccines is known to be effective for its prevention. In 2010/2011, there was an epidemic of the South East Asia (SEA) topotype in East Asian countries. We adapted the SEA topotype virus isolated in November 2010 in Korea in cells to analyze the characteristics of the virus and evaluate its possibility as a vaccine. After cell culture adaptation, the FMD virus particle 146S was purified to develop an inactivated oil vaccine for SEA or other topotypes. To measure its immunogenicity, pigs were inoculated with the experimental vaccine at different concentrations of the antigen. The results indicated that the groups immunized with at least 7.5 μg antigen were protected from homologous challenge. The immunized pigs were also protected against heterologous virus (ME-SA topotype) challenge. The genetic variations between the two field isolates and the adapted vaccine strains were identified in six amino acids by complete genome sequencing. Copyright © 2014 Elsevier Ltd. All rights reserved.

Viral vector-based influenza vaccines

PubMed Central

de Vries, Rory D.; Rimmelzwaan, Guus F.

2016-01-01

ABSTRACT Antigenic drift of seasonal influenza viruses and the occasional introduction of influenza viruses of novel subtypes into the human population complicate the timely production of effective vaccines that antigenically match the virus strains that cause epidemic or pandemic outbreaks. The development of game-changing vaccines that induce broadly protective immunity against a wide variety of influenza viruses is an unmet need, in which recombinant viral vectors may provide. Use of viral vectors allows the delivery of any influenza virus antigen, or derivative thereof, to the immune system, resulting in the optimal induction of virus-specific B- and T-cell responses against this antigen of choice. This systematic review discusses results obtained with vectored influenza virus vaccines and advantages and disadvantages of the currently available viral vectors. PMID:27455345

Viral vector-based influenza vaccines.

PubMed

de Vries, Rory D; Rimmelzwaan, Guus F

2016-11-01

Antigenic drift of seasonal influenza viruses and the occasional introduction of influenza viruses of novel subtypes into the human population complicate the timely production of effective vaccines that antigenically match the virus strains that cause epidemic or pandemic outbreaks. The development of game-changing vaccines that induce broadly protective immunity against a wide variety of influenza viruses is an unmet need, in which recombinant viral vectors may provide. Use of viral vectors allows the delivery of any influenza virus antigen, or derivative thereof, to the immune system, resulting in the optimal induction of virus-specific B- and T-cell responses against this antigen of choice. This systematic review discusses results obtained with vectored influenza virus vaccines and advantages and disadvantages of the currently available viral vectors.

Roles of the Putative Type IV-like Secretion System Key Component VirD4 and PrsA in Pathogenesis of Streptococcus suis Type 2

PubMed Central

Jiang, Xiaowu; Yang, Yunkai; Zhou, Jingjing; Zhu, Lexin; Gu, Yuanxing; Zhang, Xiaoyan; Li, Xiaoliang; Fang, Weihuan

2016-01-01

Streptococcus suis type 2 (SS2) is a zoonotic pathogen causing septic infection, meningitis and pneumonia in pigs and humans. SS2 may cause streptococcal toxic shock syndrome (STSS) probably due to excessive release of inflammatory cytokines. A previous study indicated that the virD4 gene in the putative type IV-like secretion system (T4SS) within the 89K pathogenicity island specific for recent epidemic strains contributed to the development of STSS. However, the functional basis of VirD4 in STSS remains unclear. Here we show that deletion of virD4 led to reduced virulence as shown by about 65% higher LD50, lower bacterial load in liver and brain, and lower level of expression of inflammatory cytokines in mice and cell lines than its parent strain. The ΔVirD4 mutant was more easily phagocytosed, suggesting its role as an anti-phagocytic factor. Oxidative stress that mimic bacterial exposure to respiratory burst of phagocytes upregulated expression of virD4. Proteomic analysis identified 10 secreted proteins of significant differences between the parent and mutant strains under oxidative stress, including PrsA, a peptidyl-prolyl isomerase. The SS2 PrsA expressed in E. coli caused a dose-dependent cell death and increased expression of proinflammatory IL-1β, IL-6 and TNF-α in murine macrophage cells. Our data provide novel insights into the contribution of the VirD4 factor to STSS pathogenesis, possibly via its anti-phagocytic activity, upregulation of its expression upon oxidative stress and its involvement in increased secretion of PrsA as a cell death inducer and proinflammatory effector. PMID:27995095

Laboratory and Molecular Characterization of Dengue Viruses in a 2014 Outbreak in Guangfo Region, Southern China.

PubMed

Luo, Zhao-Fan; Hu, Bo; Zhang, Feng-Yi; Lin, Xiang-Hua; Xie, Xiao-Ying; Pan, Kun-Yi; Li, Hong-Yu; Ren, Rui-Wen; Zhao, Wen-Zhong

2017-09-25

Non-specific symptoms and low viremia levels make early diagnosis of dengue virus (DENV) infection challenging. This study aimed to i) identify laboratory markers that can be used to predict a DENV-positive diagnosis and ii) perform a molecular characterization of DENVs from the 2014 Guangdong epidemic. This retrospective study analyzed 1,044 patients from the Guangdong epidemic who were clinically suspected cases of dengue. Viral RNA was detected by real-time RT-PCR, and viral-specific NS1 antigen was detected using enzyme-linked immuno sorbent assay. A molecular phylogenetic analysis was performed for the with the DENV C-prM gene junction. Patients with dengue infection had leukopenia (2.8 × 10 9 /L), thrombocytopenia (109.0 × 10 9 /L), elevated aspartate aminotransferase (56.0 IU/L) and alanine aminotransferase (43.5 IU/L), and prolonged activated partial thromboplastin time (APTT, 33.5 s) (all P ＜ 0.001) compared to patients without dengue. The positive predictive value of leukopenia and thrombocytopenia for DENV infection were 96.9% and 93.0%, respectively. Leukopenia, thrombocytopenia, elevated aminotransferases, and prolonged APTT were useful predictive markers for an early diagnosis of DENV infection. Phylogenetic analysis indicated that the DENVs from the 2014 epidemic were closely related to a 2010 New Delhi strain and a 2013 Guangzhou strain. The 2014 epidemic consisted of co-circulating DENV-1 genotypes I and V from multiple origins. Efficient dengue surveillance can facilitate rapid response to future outbreaks.

[Smallpox--in the past or not?].

PubMed

Kuljić-Kapulica, Nada

2004-01-01

Smallpox is a potentially deadly illness caused by the variola virus, an orthopoxvirus. Severe illness followed by blister-like body rash is the sign of smallpox. Smallpox symptoms develop about 12 days after exposure. V. variole can spread very readily by aerosol, which may lead to explosive epidemics. For centuries, smallpox has been a worldwide cause of death, killing about 30% of the infected people. In 1972, the epidemic of smallpox in ex-Yugoslavia was the largest postwar smallpox epidemic in Europe. The total number of the affected was 175, out of whom 35 with fatal outcome, accounting for 20% of mortality. However, after a decade-long vaccination effort, the last natural case of smallpox occurred in 1977. The only way to prevent smallpox epidemic is by vaccination and patients' isolation. The possibility of future bioterrorism attacks, which may cause a new outbreak of smallpox and return variola, is very serious. World population is not immune, because of lack of vaccination. In 1980, the World Health Organization (WHO) declared the disease fully eradicated.

Directed mutagenesis of the Rickettsia prowazekii pld gene encoding phospholipase D.

PubMed

Driskell, Lonnie O; Yu, Xue-jie; Zhang, Lihong; Liu, Yan; Popov, Vsevolod L; Walker, David H; Tucker, Aimee M; Wood, David O

2009-08-01

Rickettsia prowazekii, the causative agent of epidemic typhus, is an obligately intracytoplasmic bacterium, a lifestyle that imposes significant barriers to genetic manipulation. The key to understanding how this unique bacterium evades host immunity is the mutagenesis of selected genes hypothesized to be involved in virulence. The R. prowazekii pld gene, encoding a protein with phospholipase D activity, has been associated with phagosomal escape. To demonstrate the feasibility of site-directed knockout mutagenesis of rickettsial genes and to generate a nonrevertible vaccine strain, we utilized homologous recombination to generate a pld mutant of the virulent R. prowazekii strain Madrid Evir. Using linear DNA for transformation, a double-crossover event resulted in the replacement of the rickettsial wild-type gene with a partially deleted pld gene. Linear DNA was used to prevent potentially revertible single-crossover events resulting in plasmid insertion. Southern blot and PCR analyses were used to confirm the presence of the desired mutation and to demonstrate clonality. While no phenotypic differences were observed between the mutant and wild-type strains when grown in tissue culture, the pld mutant exhibited attenuated virulence in the guinea pig model. In addition, animals immunized with the mutant strain were protected against subsequent challenge with the virulent Breinl strain, suggesting that this transformant could serve as a nonrevertible, attenuated vaccine strain. This study demonstrates the feasibility of generating site-directed rickettsial gene mutants, providing a new tool for understanding rickettsial biology and furthering advances in the prevention of epidemic typhus.

[Differences on geographic distribution of rabies virus lineages in China].

PubMed

Wang, Q; Li, M L; Chen, Y; Wang, B; Tao, X Y; Zhu, W Y

2018-04-10

Objective: To study the lineages of rabies virus and the epidemic characteristics in different provincial populations of China, to provide information for the development of control and prevention measures in each respective provinces. Methods: Full length N and G genes and full-genome of epidemic strains of rabies virus collected in China were downloaded from GenBank and combined with newly sequenced strains by our lab. Each strain was classified under six lineages of China rabies by constructing phylogenetic trees based on the N or G sequences. Numbers of strains and lineages in each province were counted and compared. Results: Six lineages (China Ⅰ-Ⅵ) were prevalent in China, with 4 found in Yunnan and Hunan. In 6 provinces, including Henan and Fujian, 3 lineages were found. In 8 provinces, including Shanghai and Jiangxi, 2 lineages were found Only 1 lineage, were found in Beijing, Tianjin and other 12 provinces. the China Ⅰ, was the dominant one in 25 provinces. In recent years, China Ⅲ had been found in wild animals and spread over livestock in Inner Mongolia and Xinjiang areas. Qinghai and Tibet had been influenced by China Ⅳ, which also been found in wild animals of Inner Mongolia and Heilongjiang. Conclusion: There had been obvious differences in lineages and strain numbers of rabies virus identified in different provinces in China.

New emergence pattern with variant porcine epidemic diarrhea viruses, South Korea, 2012-2015.

PubMed

Chung, Hee-Chun; Lee, Jee-Hoon; Nguyen, Van Giap; Huynh, Thi My Le; Lee, Ga-Eun; Moon, Hyoung-Joon; Park, Seong-Jun; Kim, Hye-Kwon; Park, Bong Kyun

2016-12-02

Since outbreaks of porcine epidemic diarrhea virus (PEDV) in the United States in 2013, explosive outbreaks of PED in South Korea have infected all age groups of pigs in 2014-2015year. This study analyzed a large collection of the Spike protein coding gene to infer the spatial-temporal diffusion history of PEDV. The studying results suggested that PEDVs in Korea belonged to different genogroups. While classical G1 was continuingly circulating between provinces of Korea, the pandemic G2a were recently introduced from China and USA. By the application of Bayesian phylogeographical analysis, this study demonstrated the spatial-temporal transmission of PEDVs within Korea. Of the recent emerged G2a viruses, J3142 strains showed potential recombination breakpoint (376-2,143nt) of S1 gene between KNU1303_Korea strain_G2a (KJ451046) and 45RWVCF0712_Thailand strain_G2b (KF724935). The pandemic G2a virus was partial neutralized by the antibodies invoked by the G1- based PED vaccine virus. Copyright © 2016. Published by Elsevier B.V.

Characterization of methicillin-resistant Staphylococcus aureus isolated at Tripoli Medical Center, Libya, between 2008 and 2014.

PubMed

BenDarif, Elloulu; Khalil, Asma; Rayes, Abdunnabi; Bennour, Emad; Dhawi, Abdulgader; Lowe, John J; Gibbs, Shawn; Goering, Richard V

2016-12-01

Bacterial pathogens such as methicillin-resistant Staphylococcus aureus (MRSA) represent a well-known public health problem affecting both healthcare-associated and community populations. Past studies have clearly shown the value of characterizing problem organisms including MRSA through the use of molecular techniques (i.e. strain typing), with the aim of informing local, regional and national efforts in epidemiological analysis and infection control. The country of Libya represents a challenge for such analysis due to limited historical infectious disease information and major political unrest culminating in the Libyan Civil War (Libyan Revolution) in 2011. A MRSA study population of 202 isolates, cultured from patients in Tripoli Medical Center through this historical period (2008-2014), was characterized by both phenotypic and molecular methods. The results revealed a diversification of epidemic MRSA strains over time with generally increasing resistance to fluoroquinolone antibiotics. The study identified prevalent MRSA in comparison to known global epidemic types, providing unique insight into the change of strains and/or characteristics over time especially with reference to the potential influence of the political revolution (i.e. pre- and post-2011).

In Silico Prediction and Experimental Confirmation of HA Residues Conferring Enhanced Human Receptor Specificity of H5N1 Influenza A Viruses.

PubMed

Schmier, Sonja; Mostafa, Ahmed; Haarmann, Thomas; Bannert, Norbert; Ziebuhr, John; Veljkovic, Veljko; Dietrich, Ursula; Pleschka, Stephan

2015-06-19

Newly emerging influenza A viruses (IAV) pose a major threat to human health by causing seasonal epidemics and/or pandemics, the latter often facilitated by the lack of pre-existing immunity in the general population. Early recognition of candidate pandemic influenza viruses (CPIV) is of crucial importance for restricting virus transmission and developing appropriate therapeutic and prophylactic strategies including effective vaccines. Often, the pandemic potential of newly emerging IAV is only fully recognized once the virus starts to spread efficiently causing serious disease in humans. Here, we used a novel phylogenetic algorithm based on the informational spectrum method (ISM) to identify potential CPIV by predicting mutations in the viral hemagglutinin (HA) gene that are likely to (differentially) affect critical interactions between the HA protein and target cells from bird and human origin, respectively. Predictions were subsequently validated by generating pseudotyped retrovirus particles and genetically engineered IAV containing these mutations and characterizing potential effects on virus entry and replication in cells expressing human and avian IAV receptors, respectively. Our data suggest that the ISM-based algorithm is suitable to identify CPIV among IAV strains that are circulating in animal hosts and thus may be a new tool for assessing pandemic risks associated with specific strains.

In Silico Prediction and Experimental Confirmation of HA Residues Conferring Enhanced Human Receptor Specificity of H5N1 Influenza A Viruses

NASA Astrophysics Data System (ADS)

Schmier, Sonja; Mostafa, Ahmed; Haarmann, Thomas; Bannert, Norbert; Ziebuhr, John; Veljkovic, Veljko; Dietrich, Ursula; Pleschka, Stephan

2015-06-01

Newly emerging influenza A viruses (IAV) pose a major threat to human health by causing seasonal epidemics and/or pandemics, the latter often facilitated by the lack of pre-existing immunity in the general population. Early recognition of candidate pandemic influenza viruses (CPIV) is of crucial importance for restricting virus transmission and developing appropriate therapeutic and prophylactic strategies including effective vaccines. Often, the pandemic potential of newly emerging IAV is only fully recognized once the virus starts to spread efficiently causing serious disease in humans. Here, we used a novel phylogenetic algorithm based on the informational spectrum method (ISM) to identify potential CPIV by predicting mutations in the viral hemagglutinin (HA) gene that are likely to (differentially) affect critical interactions between the HA protein and target cells from bird and human origin, respectively. Predictions were subsequently validated by generating pseudotyped retrovirus particles and genetically engineered IAV containing these mutations and characterizing potential effects on virus entry and replication in cells expressing human and avian IAV receptors, respectively. Our data suggest that the ISM-based algorithm is suitable to identify CPIV among IAV strains that are circulating in animal hosts and thus may be a new tool for assessing pandemic risks associated with specific strains.

Molecular Epidemiology of a Pseudomonas aeruginosa Hospital Outbreak Driven by a Contaminated Disinfectant-Soap Dispenser

PubMed Central

Lanini, Simone; D'Arezzo, Silvia; Puro, Vincenzo; Martini, Lorena; Imperi, Francesco; Piselli, Pierluca; Montanaro, Marco; Paoletti, Simonetta; Visca, Paolo; Ippolito, Giuseppe

2011-01-01

Background and Objective Pseudomonas aeruginosa infection represents a main cause of morbidity and mortality among immunocompromised patients. This study describes a fatal epidemic of P. aeruginosa that occurred in a hematology unit in Italy. Methods Retrospective cohort study, prospective surveillance, auditing, extensive testing on healthcare workers and environmental investigation were performed to define the dynamics and potential causes of transmission. RAPD, macrorestriction analyses and sequence typing were used to define relationships between P. aeruginosa isolates. Results Eighteen cases of infection were identified in the different phases of the investigation. Of these, five constitute a significant molecular cluster of infection. A P. aeruginosa strain with the same genetic fingerprint and sequence type (ST175) as clinical isolates strain was also isolated from a heavily contaminated triclosan soap dispenser. Discussion and Conclusions Our results are consistent with the hypothesis that patients became indirectly infected, e.g., during central venous catheter handling through contaminated items, and that the triclosan soap dispenser acted as a common continuous source of P. aeruginosa infection. Since P. aeruginosa is intrinsically unsusceptible to triclosan, the use of triclosan-based disinfectant formulations should be avoided in those healthcare settings hosting patients at high risk of P. aeruginosa infection. PMID:21359222

Vibriosis, not cholera: toxigenic Vibrio cholerae non-O1, non-O139 infections in the United States, 1984-2014.

PubMed

Crowe, S J; Newton, A E; Gould, L H; Parsons, M B; Stroika, S; Bopp, C A; Freeman, M; Greene, K; Mahon, B E

2016-11-01

Toxigenic strains of Vibrio cholerae serogroups O1 and O139 have caused cholera epidemics, but other serogroups - such as O75 or O141 - can also produce cholera toxin and cause severe watery diarrhoea similar to cholera. We describe 31 years of surveillance for toxigenic non-O1, non-O139 infections in the United States and map these infections to the state where the exposure probably originated. While serogroups O75 and O141 are closely related pathogens, they differ in how and where they infect people. Oysters were the main vehicle for O75 infection. The vehicles for O141 infection include oysters, clams, and freshwater in lakes and rivers. The patients infected with serogroup O75 who had food traceback information available ate raw oysters from Florida. Patients infected with O141 ate oysters from Florida and clams from New Jersey, and those who only reported being exposed to freshwater were exposed in Arizona, Michigan, Missouri, and Texas. Improving the safety of oysters, specifically, should help prevent future illnesses from these toxigenic strains and similar pathogenic Vibrio species. Post-harvest processing of raw oysters, such as individual quick freezing, heat-cool pasteurization, and high hydrostatic pressurization, should be considered.

Provenance and geographic spread of St. Louis encephalitis virus.

PubMed

Kopp, Anne; Gillespie, Thomas R; Hobelsberger, Daniel; Estrada, Alejandro; Harper, James M; Miller, Richard A; Eckerle, Isabella; Müller, Marcel A; Podsiadlowski, Lars; Leendertz, Fabian H; Drosten, Christian; Junglen, Sandra

2013-06-11

St. Louis encephalitis virus (SLEV) is the prototypic mosquito-borne flavivirus in the Americas. Birds are its primary vertebrate hosts, but amplification in certain mammals has also been suggested. The place and time of SLEV emergence remain unknown. In an ecological investigation in a tropical rainforest in Palenque National Park, Mexico, we discovered an ancestral variant of SLEV in Culex nigripalpus mosquitoes. Those SLEV-Palenque strains form a highly distinct phylogenetic clade within the SLEV species. Cell culture studies of SLEV-Palenque versus epidemic SLEV (MSI-7) revealed no growth differences in insect cells but a clear inability of SLEV-Palenque to replicate in cells from birds, cotton rats, and free-tailed bats permissive for MSI-7 replication. Only cells from nonhuman primates and neotropical fruit bats were moderately permissive. Phylogeographic reconstruction identified the common ancestor of all epidemic SLEV strains to have existed in an area between southern Mexico and Panama ca. 330 years ago. Expansion of the epidemic lineage occurred in two waves, the first representing emergence near the area of origin and the second involving almost parallel appearances of the virus in the lower Mississippi and Amazon delta regions. Early diversification events overlapped human habitat invasion during the post-Columbian era. Several documented SLEV outbreaks, such as the 1964 Houston epidemic or the 1990 Tampa epidemic, were predated by the arrival of novel strains between 1 and 4 years before the outbreaks. Collectively, our data provide insight into the putative origins of SLEV, suggesting that virus emergence was driven by human invasion of primary rainforests. IMPORTANCE St. Louis encephalitis virus (SLEV) is the prototypic mosquito-transmitted flavivirus of the Americas. Unlike the West Nile virus, which we know was recently introduced into North America from the Old World, the provenience of SLEV is obscure. In an ecological investigation in a primary rainforest area of Palenque National Park, Mexico, we have discovered an ancestral variant of SLEV. The ancestral virus was much less active than the epidemic virus in cell cultures, reflecting its incomplete adaptation to hosts encountered outside primary rainforests. Knowledge of this virus enabled a spatiotemporal reconstruction of the common ancestor of all SLEVs and how the virus spread from there. We can infer that the cosmopolitan SLEV lineage emerged from Central America in the 17th century, a period of post-Columbian colonial history marked by intense human invasion of primary rainforests. Further spread followed major bird migration pathways over North and South America.

Temporal fluctuations and the role of disturbance in disease progression of the sudden oak death epidemic

Treesearch

Melina Kozanitas; Todd W. Osmundson; Matteo Garbelotto

2013-01-01

With its high host mortality and ability to cause landscape-scale alterations in forest cover and composition, sudden oak death (SOD) (etiological agent Phytophthora ramorum, Stramenopila, Oomycota) mirrors past forest disease epidemics such as Chestnut Blight and Dutch Elm Disease. In contrast with these past epidemics, however, the appearance of...

Predictive Validation of an Influenza Spread Model

PubMed Central

Hyder, Ayaz; Buckeridge, David L.; Leung, Brian

2013-01-01

Background Modeling plays a critical role in mitigating impacts of seasonal influenza epidemics. Complex simulation models are currently at the forefront of evaluating optimal mitigation strategies at multiple scales and levels of organization. Given their evaluative role, these models remain limited in their ability to predict and forecast future epidemics leading some researchers and public-health practitioners to question their usefulness. The objective of this study is to evaluate the predictive ability of an existing complex simulation model of influenza spread. Methods and Findings We used extensive data on past epidemics to demonstrate the process of predictive validation. This involved generalizing an individual-based model for influenza spread and fitting it to laboratory-confirmed influenza infection data from a single observed epidemic (1998–1999). Next, we used the fitted model and modified two of its parameters based on data on real-world perturbations (vaccination coverage by age group and strain type). Simulating epidemics under these changes allowed us to estimate the deviation/error between the expected epidemic curve under perturbation and observed epidemics taking place from 1999 to 2006. Our model was able to forecast absolute intensity and epidemic peak week several weeks earlier with reasonable reliability and depended on the method of forecasting-static or dynamic. Conclusions Good predictive ability of influenza epidemics is critical for implementing mitigation strategies in an effective and timely manner. Through the process of predictive validation applied to a current complex simulation model of influenza spread, we provided users of the model (e.g. public-health officials and policy-makers) with quantitative metrics and practical recommendations on mitigating impacts of seasonal influenza epidemics. This methodology may be applied to other models of communicable infectious diseases to test and potentially improve their predictive ability. PMID:23755236

The Role of Epidemic Resistance Plasmids and International High-Risk Clones in the Spread of Multidrug-Resistant Enterobacteriaceae

PubMed Central

Mathers, Amy J.; Peirano, Gisele

2015-01-01

SUMMARY Escherichia coli sequence type 131 (ST131) and Klebsiella pneumoniae ST258 emerged in the 2000s as important human pathogens, have spread extensively throughout the world, and are responsible for the rapid increase in antimicrobial resistance among E. coli and K. pneumoniae strains, respectively. E. coli ST131 causes extraintestinal infections and is often fluoroquinolone resistant and associated with extended-spectrum β-lactamase production, especially CTX-M-15. K. pneumoniae ST258 causes urinary and respiratory tract infections and is associated with carbapenemases, most often KPC-2 and KPC-3. The most prevalent lineage within ST131 is named fimH30 because it contains the H30 variant of the type 1 fimbrial adhesin gene, and recent molecular studies have demonstrated that this lineage emerged in the early 2000s and was then followed by the rapid expansion of its sublineages H30-R and H30-Rx. K. pneumoniae ST258 comprises 2 distinct lineages, namely clade I and clade II. Moreover, it seems that ST258 is a hybrid clone that was created by a large recombination event between ST11 and ST442. Epidemic plasmids with blaCTX-M and blaKPC belonging to incompatibility group F have contributed significantly to the success of these clones. E. coli ST131 and K. pneumoniae ST258 are the quintessential examples of international multidrug-resistant high-risk clones. PMID:25926236

Molecular epidemiology of porcine reproductive and respiratory syndrome virus in Central China since 2014: The prevalence of NADC30-like PRRSVs.

PubMed

Wang, Lin-Jian; Xie, Weitao; Chen, Xin-Xin; Qiao, Songlin; Zhao, Mengmeng; Gu, Yu; Zhao, Bao-Lei; Zhang, Gaiping

2017-08-01

Porcine reproductive and respiratory syndrome (PRRS), characterized by respiratory disorders in piglets and reproductive failure in sows, is still the great threat of swine industry. Recently, Emergence of the novel NADC30-like PRRS viruses (PRRSVs) has caused widespread outbreaks of PRRS. To investigate the epidemic characteristics of PRRSVs in Central China since 2014, 6372 clinical serum samples were tested by ELISA, 250 tissue samples were tested by RT-PCR, and among these, 30 ORF5 and 17 Nsp2 genes sequences were analyzed. Phylogenetic tree based on ORF5 revealed that, 17 isolates were clustered into subgroup 1, represented by the NADC30. And for the Nsp2, The strains which had a discontinuous 131-amino-acid deletion in Nsp2, called NADC30-like strains, were clustered into subgroup 2. Our data suggested that the NADC30-like PRRSV strains spread quickly and are now circulating and prevalent in Central China as well as the classical HP-PRRSV strains. In addition, amino acid variation analysis of GP5 revealed that the amino acid sequences of NADC30-like PRRSV strains underwent rapid evolution and contained extensive amino acid substitutions in important motifs, such as potential neutralization epitope and the N-glycosylation sites. In summary, our data would provide a large amount of detailed information on molecular variation and genetic diversity of PRRSV in central China. Copyright © 2017. Published by Elsevier Ltd.

Increasing Clinical Severity during a Dengue Virus Type 3 Cuban Epidemic: Deep Sequencing of Evolving Viral Populations

PubMed Central

Blanc, Hervé; Bordería, Antonio V.; Díaz, Gisell; Henningsson, Rasmus; Gonzalez, Daniel; Santana, Emidalys; Alvarez, Mayling; Castro, Osvaldo; Fontes, Magnus; Vignuzzi, Marco; Guzman, Maria G.

2016-01-01

ABSTRACT During the dengue virus type 3 (DENV-3) epidemic that occurred in Havana in 2001 to 2002, severe disease was associated with the infection sequence DENV-1 followed by DENV-3 (DENV-1/DENV-3), while the sequence DENV-2/DENV-3 was associated with mild/asymptomatic infections. To determine the role of the virus in the increasing severity demonstrated during the epidemic, serum samples collected at different time points were studied. A total of 22 full-length sequences were obtained using a deep-sequencing approach. Bayesian phylogenetic analysis of consensus sequences revealed that two DENV-3 lineages were circulating in Havana at that time, both grouped within genotype III. The predominant lineage is closely related to Peruvian and Ecuadorian strains, while the minor lineage is related to Venezuelan strains. According to consensus sequences, relatively few nonsynonymous mutations were observed; only one was fixed during the epidemic at position 4380 in the NS2B gene. Intrahost genetic analysis indicated that a significant minor population was selected and became predominant toward the end of the epidemic. In conclusion, greater variability was detected during the epidemic's progression in terms of significant minority variants, particularly in the nonstructural genes. An increasing trend of genetic diversity toward the end of the epidemic was observed only for synonymous variant allele rates, with higher variability in secondary cases. Remarkably, significant intrahost genetic variation was demonstrated within the same patient during the course of secondary infection with DENV-1/DENV-3, including changes in the structural proteins premembrane (PrM) and envelope (E). Therefore, the dynamic of evolving viral populations in the context of heterotypic antibodies could be related to the increasing clinical severity observed during the epidemic. IMPORTANCE Based on the evidence that DENV fitness is context dependent, our research has focused on the study of viral factors associated with intraepidemic increasing severity in a unique epidemiological setting. Here, we investigated the intrahost genetic diversity in acute human samples collected at different time points during the DENV-3 epidemic that occurred in Cuba in 2001 to 2002 using a deep-sequencing approach. We concluded that greater variability in significant minor populations occurred as the epidemic progressed, particularly in the nonstructural genes, with higher variability observed in secondary infection cases. Remarkably, for the first time significant intrahost genetic variation was demonstrated within the same patient during the course of secondary infection with DENV-1/DENV-3, including changes in structural proteins. These findings indicate that high-resolution approaches are needed to unravel molecular mechanisms involved in dengue pathogenesis. PMID:26889031

Genetic diversity of environmental Vibrio cholerae O1 strains isolated in Northern Vietnam.

PubMed

Takemura, Taichiro; Murase, Kazunori; Maruyama, Fumito; Tran, Thi Luong; Ota, Atsushi; Nakagawa, Ichiro; Nguyen, Dong Tu; Ngo, Tu Cuong; Nguyen, Thi Hang; Tokizawa, Asako; Morita, Masatomo; Ohnishi, Makoto; Nguyen, Binh Minh; Yamashiro, Tetsu

2017-10-01

Cholera epidemics have been recorded periodically in Vietnam during the seventh cholera pandemic. Since cholera is a water-borne disease, systematic monitoring of environmental waters for Vibrio cholerae presence is important for predicting and preventing cholera epidemics. We conducted monitoring, isolation, and genetic characterization of V. cholerae strains in Nam Dinh province of Northern Vietnam from Jul 2013 to Feb 2015. In this study, four V. cholerae O1 strains were detected and isolated from 110 analyzed water samples (3.6%); however, none of them carried the cholera toxin gene, ctxA, in their genomes. Whole genome sequencing and phylogenetic analysis revealed that the four O1 isolates were separated into two independent clusters, and one of them diverged from a common ancestor with pandemic strains. The analysis of pathogenicity islands (CTX prophage, VPI-I, VPI-II, VSP-I, and VSP-II) indicated that one strain (VNND_2014Jun_6SS) harbored an unknown prophage-like sequence with high homology to vibriophage KSF-1 phi and VCY phi, identified from Bangladesh and the USA, respectively, while the other three strains carried tcpA gene with a distinct sequence demonstrating a separate clonal lineage. These results suggest that the aquatic environment can harbor highly divergent V. cholera strains and serve as a reservoir for multiple V. cholerae virulence-associated genes which may be exchanged via mobile genetic elements. Therefore, continuous monitoring and genetic characterization of V. cholerae strains in the environment should contribute to the early detection of the sources of infection and prevention of cholera outbreaks as well as to understanding the natural ecology and evolution of V. cholerae. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

There is nothing permanent except change. The emergence of new virus diseases.

PubMed

Truyen, U; Parrish, C R; Harder, T C; Kaaden, O R

1995-02-01

The sudden appearance of apparently new viruses with pathogenic potential is of fundamental importance in medical microbiology and a constant threat to humans and animals. The emergence of a "new" pathogen is not an isolated event, as for instance the frequent appearance of new influenza virus strains demonstrates. Often the new virus strains co-circulate with the older strains in a susceptible population, but a replacement of the older strains has been also observed. In rare instances the new viruses can cause dramatic epidemics or pandemics, such as those observed with the human immunodeficiency virus, canine parvovirus, or most recently, with the agent of bovine spongiform encephalopathy in the United Kingdom. The mechanisms of the emergence are not always clearly understood, but an altered host range appears to be a common event. Whether a true change in host range occurs, or whether the virus adapted to the host and replicated more efficiently, is often unknown. This review tries to summarize the facts that are known about a wide variety of "new" viruses of mammals, such as the simian, human and feline lentiviruses, the feline coronaviruses, the feline parvoviruses, the carnivore morbilliviruses, the influenza A viruses, and the transmissible spongiform encephalopathies. A particular emphasis will be put on the genetic mechanisms that might have taken place and that might have been responsible for their sudden appearance.

Variable ligand- and receptor-binding hot spots in key strains of influenza neuraminidase

PubMed Central

Votapka, Lane; Demir, Özlem; Swift, Robert V; Walker, Ross C; Amaro, Rommie E

2012-01-01

Influenza A continues to be a major public health concern due to its ability to cause epidemic and pandemic disease outbreaks in humans. Computational investigations of structural dynamics of the major influenza glycoproteins, especially the neuraminidase (NA) enzyme, are able to provide key insights beyond what is currently accessible with standard experimental techniques. In particular, all-atom molecular dynamics simulations reveal the varying degrees of flexibility for such enzymes. Here we present an analysis of the relative flexibility of the ligand- and receptor-binding area of three key strains of influenza A: highly pathogenic H5N1, the 2009 pandemic H1N1, and a human N2 strain. Through computational solvent mapping, we investigate the various ligand- and receptor-binding “hot spots” that exist on the surface of NA which interacts with both sialic acid receptors on the host cells and antiviral drugs. This analysis suggests that the variable cavities found in the different strains and their corresponding capacities to bind ligand functional groups may play an important role in the ability of NA to form competent reaction encounter complexes with other species of interest, including antiviral drugs, sialic acid receptors on the host cell surface, and the hemagglutinin protein. Such considerations may be especially useful for the prediction of how such complexes form and with what binding capacity. PMID:22872804

[Prokaryotic expression of vp3 gene of Muscovy duck parvovirus, and its antiserum preparation for detection of virus multiplication].

PubMed

Huang, Yu; Zhu, Yumin; Dong, Shijuan; Yu, Ruisong; Zhang, Yuanshu; Li, Zhen

2015-01-01

New epidemic broke out in recent year which was suspected to be caused by variant Muscovy duck parvovirus (MDPV). For this reason, new MDPV detection methods are needed for the new virus strains. In this study, a pair of primers were designed according to the full-length genome of MDPV strain SAAS-SHNH, which were identified in 2012, and were used to amplify the vp3 gene of MDPV by polymerase chain reaction. After being sequenced, the vp3 gene was subcloned into the prokaryotic expression vector PET28a. The recombinant plasmid was transformed into E. coli BL21 and induced with IPTG. SDS-PAGE and Western blotting analysis showed the MDPV vp3 gene was successfully expressed. After being purified by Ni2+ affinity chromatography system, the recombinant protein was used as antigen to immunize rabbits to obtain antiserum. Western blotting analysis showed that the acquired antiserum could react specifically with VP3 protein of J3D6 strain and MDPV vaccine strain. The antiserum could also be used for detection of cultured MDPV from primary duck embryo fibroblasts by immune fluorescence assay (IFA). It could be concluded that the VP3 protein and its antibody prepared in the research could be used for detection of VP3 antiserum and antigen respectively.

[Influenza virus].

PubMed

Juozapaitis, Mindaugas; Antoniukas, Linas

2007-01-01

Every year, especially during the cold season, many people catch an acute respiratory disease, namely flu. It is easy to catch this disease; therefore, it spreads very rapidly and often becomes an epidemic or a global pandemic. Airway inflammation and other body ailments, which form in a very short period, torment the patient several weeks. After that, the symptoms of the disease usually disappear as quickly as they emerged. The great epidemics of flu have rather unique characteristics; therefore, it is possible to identify descriptions of such epidemics in historic sources. Already in the 4th century bc, Hippocrates himself wrote about one of them. It is known now that flu epidemics emerge rather frequently, but there are no regular intervals between those events. The epidemics can differ in their consequences, but usually they cause an increased mortality of elderly people. The great flu epidemics of the last century took millions of human lives. In 1918-19, during "The Spanish" pandemic of flu, there were around 40-50 millions of deaths all over the world; "Pandemic of Asia" in 1957 took up to one million lives, etc. Influenza virus can cause various disorders of the respiratory system: from mild inflammations of upper airways to acute pneumonia that finally results in the patient's death. Scientist Richard E. Shope, who investigated swine flu in 1920, had a suspicion that the cause of this disease might be a virus. Already in 1933, scientists from the National Institute for Medical Research in London - Wilson Smith, Sir Christopher Andrewes, and Sir Patrick Laidlaw - for the first time isolated the virus, which caused human flu. Then scientific community started the exhaustive research of influenza virus, and the great interest in this virus and its unique features is still active even today.

Concurrent epidemics of skin and soft tissue infection and bloodstream infection due to community-associated methicillin-resistant Staphylococcus aureus.

PubMed

Tattevin, Pierre; Schwartz, Brian S; Graber, Christopher J; Volinski, Joann; Bhukhen, Akta; Bhukhen, Arti; Mai, Thuy T; Vo, Nhung H; Dang, Denise N; Phan, Tiffany HaiVan; Basuino, Li; Perdreau-Remington, Françoise; Chambers, Henry F; Diep, Binh An

2012-09-01

Since its emergence in 2000, epidemic spread of the methicillin-resistant Staphylococcus aureus (MRSA) clone USA300 has led to a high burden of skin and soft tissue infections (SSTIs) in the United States, yet its impact on MRSA bloodstream infections (BSIs) is poorly characterized. To assess clonality of the MRSA isolates causing SSTI and BSI during the epidemic period, a stratified, random sample of 1350 unique infection isolates (from a total of 7252) recovered at the Community Health Network of San Francisco from 2000 to 2008 were selected for genotyping. Risk factors and outcomes for 549 BSI cases caused by the USA300 epidemic clone and non-USA300 MRSA clones were assessed by retrospective review of patient medical records. From 2000 to 2008, secular trends of USA300 SSTI and USA300 BSI were strongly correlated (Pearson r = 0.953). USA300 accounted for 55% (304/549) of BSIs as it was the predominant MRSA clone that caused community-associated (115/160), healthcare-associated community-onset (125/207), and hospital-onset (64/182) BSIs. Length of hospitalization after BSI diagnosis and mortality rates for USA300 and non-USA300 were similar. Two independent risk factors for USA300 BSI were identified: concurrent SSTI (adjusted relative risk, 1.4 [95% confidence interval {CI}, 1.2-1.6]) and anti-MRSA antimicrobial use in the preceding 30 days (0.7 [95% CI, .6-.8]). Isolates from concurrent SSTI were indistinguishable genotypically from the USA300 isolates that caused BSI. USA300 SSTIs serve as a source for BSI. Strategies to control the USA300 SSTI epidemic may lessen the severity of the concurrent USA300 BSI epidemic.

Classification of a Hypervirulent Aeromonas hydrophila Pathotype Responsible for Epidemic Outbreaks in Warm-Water Fishes.

PubMed

Rasmussen-Ivey, Cody R; Hossain, Mohammad J; Odom, Sara E; Terhune, Jeffery S; Hemstreet, William G; Shoemaker, Craig A; Zhang, Dunhua; Xu, De-Hai; Griffin, Matt J; Liu, Yong-Jie; Figueras, Maria J; Santos, Scott R; Newton, Joseph C; Liles, Mark R

2016-01-01

Lineages of hypervirulent Aeromonas hydrophila (vAh) are the cause of persistent outbreaks of motile Aeromonas septicemia in warm-water fishes worldwide. Over the last decade, this virulent lineage of A. hydrophila has resulted in annual losses of millions of tons of farmed carp and catfish in the People's Republic of China and the United States (US). Multiple lines of evidence indicate US catfish and Asian carp isolates of A. hydrophila affiliated with sequence type 251 (ST251) share a recent common ancestor. To address the genomic context for the putative intercontinental transfer and subsequent geographic spread of this pathogen, we conducted a core genome phylogenetic analysis on 61 Aeromonas spp. genomes, of which 40 were affiliated with A. hydrophila , with 26 identified as epidemic strains. Phylogenetic analyses indicate all ST251 strains form a coherent lineage affiliated with A. hydrophila . Within this lineage, conserved genetic loci unique to A. hydrophila were identified, with some genes present in consistently higher copy numbers than in non-epidemic A. hydrophila isolates. In addition, results from analyses of representative ST251 isolates support the conclusion that multiple lineages are present within US vAh isolated from Mississippi, whereas vAh isolated from Alabama appear clonal. This is the first report of genomic heterogeneity within US vAh isolates, with some Mississippi isolates showing closer affiliation with the Asian grass carp isolate ZC1 than other vAh isolated in the US. To evaluate the biological significance of the identified heterogeneity, comparative disease challenges were conducted with representatives of different vAh genotypes. These studies revealed that isolate ZC1 yielded significantly lower mortality in channel catfish, relative to Alabama and Mississippi vAh isolates. Like other Asian vAh isolates, the ZC1 lineage contains all core genes for a complete type VI secretion system (T6SS). In contrast, more virulent US isolates retain only remnants of the T6SS ( clpB, hcp, vgrG , and vasH ) which may have functional implications. Collectively, these results characterize a hypervirulent A. hydrophila pathotype that affects farmed fish on multiple continents.

Porcine Epidemic Diarrhea Virus 3C-Like Protease-Mediated Nucleocapsid Processing: Possible Link to Viral Cell Culture Adaptability.

PubMed

Jaru-Ampornpan, Peera; Jengarn, Juggragarn; Wanitchang, Asawin; Jongkaewwattana, Anan

2017-01-15

Porcine epidemic diarrhea virus (PEDV) causes severe diarrhea and high mortality rates in newborn piglets, leading to massive losses to the swine industry worldwide during recent epidemics. Intense research efforts are now focusing on defining viral characteristics that confer a growth advantage, pathogenicity, or cell adaptability in order to better understand the PEDV life cycle and identify suitable targets for antiviral or vaccine development. Here, we report a unique phenomenon of PEDV nucleocapsid (N) cleavage by the PEDV-encoded 3C-like protease (3Cpro) during infection. The identification of the 3Cpro cleavage site at the C terminus of N supported previous observations that PEDV 3Cpro showed a substrate requirement slightly different from that of severe acute respiratory syndrome coronavirus (SARS-CoV) 3Cpro and revealed a greater flexibility in its substrate recognition site. This cleavage motif is present in the majority of cell culture-adapted PEDV strains but is missing in emerging field isolates. Remarkably, reverse-genetics-derived cell culture-adapted PEDV AVCT12 harboring uncleavable N displayed growth retardation in Vero E6-APN cells compared to the wild-type virus. These observations altogether shed new light on the investigation and characterization of the PEDV nucleocapsid protein and its possible link to cell culture adaptation. Recurrent PEDV outbreaks have resulted in enormous economic losses to swine industries worldwide. To gain the upper hand in combating this disease, it is necessary to understand how this virus replicates and evades host immunity. Characterization of viral proteins provides important clues to mechanisms by which viruses survive and spread. Here, we characterized an intriguing phenomenon in which the nucleocapsids of some PEDV strains are proteolytically processed by the virally encoded main protease. Growth retardation in recombinant PEDV carrying uncleavable N suggests a replication advantage provided by the cleavage event, at least in the cell culture system. These findings may direct us to a more complete understanding of PEDV replication and pathogenicity. Copyright © 2017 American Society for Microbiology.

Classification of a Hypervirulent Aeromonas hydrophila Pathotype Responsible for Epidemic Outbreaks in Warm-Water Fishes

PubMed Central

Rasmussen-Ivey, Cody R.; Hossain, Mohammad J.; Odom, Sara E.; Terhune, Jeffery S.; Hemstreet, William G.; Shoemaker, Craig A.; Zhang, Dunhua; Xu, De-Hai; Griffin, Matt J.; Liu, Yong-Jie; Figueras, Maria J.; Santos, Scott R.; Newton, Joseph C.; Liles, Mark R.

2016-01-01

Lineages of hypervirulent Aeromonas hydrophila (vAh) are the cause of persistent outbreaks of motile Aeromonas septicemia in warm-water fishes worldwide. Over the last decade, this virulent lineage of A. hydrophila has resulted in annual losses of millions of tons of farmed carp and catfish in the People's Republic of China and the United States (US). Multiple lines of evidence indicate US catfish and Asian carp isolates of A. hydrophila affiliated with sequence type 251 (ST251) share a recent common ancestor. To address the genomic context for the putative intercontinental transfer and subsequent geographic spread of this pathogen, we conducted a core genome phylogenetic analysis on 61 Aeromonas spp. genomes, of which 40 were affiliated with A. hydrophila, with 26 identified as epidemic strains. Phylogenetic analyses indicate all ST251 strains form a coherent lineage affiliated with A. hydrophila. Within this lineage, conserved genetic loci unique to A. hydrophila were identified, with some genes present in consistently higher copy numbers than in non-epidemic A. hydrophila isolates. In addition, results from analyses of representative ST251 isolates support the conclusion that multiple lineages are present within US vAh isolated from Mississippi, whereas vAh isolated from Alabama appear clonal. This is the first report of genomic heterogeneity within US vAh isolates, with some Mississippi isolates showing closer affiliation with the Asian grass carp isolate ZC1 than other vAh isolated in the US. To evaluate the biological significance of the identified heterogeneity, comparative disease challenges were conducted with representatives of different vAh genotypes. These studies revealed that isolate ZC1 yielded significantly lower mortality in channel catfish, relative to Alabama and Mississippi vAh isolates. Like other Asian vAh isolates, the ZC1 lineage contains all core genes for a complete type VI secretion system (T6SS). In contrast, more virulent US isolates retain only remnants of the T6SS (clpB, hcp, vgrG, and vasH) which may have functional implications. Collectively, these results characterize a hypervirulent A. hydrophila pathotype that affects farmed fish on multiple continents. PMID:27803692

Persistence of a Distinct Corynebacterium diphtheriae Clonal Group within Two Communities in the United States and Canada Where Diphtheria Is Endemic

PubMed Central

Marston, Chung K.; Jamieson, Frances; Cahoon, Fred; Lesiak, Gail; Golaz, Anne; Reeves, Mike; Popovic, Tanja

2001-01-01

Molecular characterization of 53 U.S. and Canadian Corynebacterium diphtheriae isolates by multilocus enzyme electrophoresis, ribotyping, and random amplified polymorphic DNA showed that strains with distinct molecular subtypes have persisted in the United States and Canada for at least 25 years. These strains are endemic rather than imported from countries with current endemic or epidemic diphtheria. PMID:11283092

Application of PCR for detection of toxigenic Corynebacterium diphtheriae strains isolated during the Russian diphtheria epidemic, 1990 through 1994.

PubMed Central

Mikhailovich, V M; Melnikov, V G; Mazurova, I K; Wachsmuth, I K; Wenger, J D; Wharton, M; Nakao, H; Popovic, T

1995-01-01

A total of 250 Corynebacterium diphtheriae isolates from clinical cases and carriers in Russia were assayed by PCR directed at the A subunit of the diphtheria toxin gene to distinguish toxigenic from nontoxigenic strains; 170 strains were positive as indicated by the presence of the 248-bp amplicon. The results of this PCR assay were in complete concordance with those of the standard immunoprecipitation assay (Elek), and the PCR assay is a useful tool for rapid identification in clinical laboratories. PMID:8576378

Species composition and succession in yellow pine stands following southern pine beetle outbreaks in Tennessee-preliminary results

Treesearch

Christopher M. Oswalt; Sonja N. Oswalt; Jason R. Meade

2016-01-01

The southern pine beetle (Dendroctonus frontalis) is a bark beetle that is native to the Southern United States, including Tennessee. The beetle is periodically epidemic and can cause high levels of mortalityduring epidemic years, particularly in dense or aging pine (Pinus spp.) stands. An epidemic outbreak of the Southern pine...

Comparative genome analysis of VSP-II and SNPs reveals heterogenic variation in contemporary strains of Vibrio cholerae O1 isolated from cholera patients in Kolkata, India

PubMed Central

Sekizuka, Tsuyoshi; Mizuno, Tamaki; Takemura, Taichiro; Yamashiro, Tetsu; Chowdhury, Goutam; Pazhani, Gururaja P.; Mukhopadhyay, Asish K.; Ramamurthy, Thandavarayan; Miyoshi, Shin-ichi; Kuroda, Makoto; Shinoda, Sumio; Ohnishi, Makoto

2017-01-01

Cholera is an acute diarrheal disease and a major public health problem in many developing countries in Asia, Africa, and Latin America. Since the Bay of Bengal is considered the epicenter for the seventh cholera pandemic, it is important to understand the genetic dynamism of Vibrio cholerae from Kolkata, as a representative of the Bengal region. We analyzed whole genome sequence data of V. cholerae O1 isolated from cholera patients in Kolkata, India, from 2007 to 2014 and identified the heterogeneous genomic region in these strains. In addition, we carried out a phylogenetic analysis based on the whole genome single nucleotide polymorphisms to determine the genetic lineage of strains in Kolkata. This analysis revealed the heterogeneity of the Vibrio seventh pandemic island (VSP)-II in Kolkata strains. The ctxB genotype was also heterogeneous and was highly related to VSP-II types. In addition, phylogenetic analysis revealed the shifts in predominant strains in Kolkata. Two distinct lineages, 1 and 2, were found between 2007 and 2010. However, the proportion changed markedly in 2010 and lineage 2 strains were predominant thereafter. Lineage 2 can be divided into four sublineages, I, II, III and IV. The results of this study indicate that lineages 1 and 2-I were concurrently prevalent between 2007 and 2009, and lineage 2-III observed in 2010, followed by the predominance of lineage 2-IV in 2011 and continued until 2014. Our findings demonstrate that the epidemic of cholera in Kolkata was caused by several distinct strains that have been constantly changing within the genetic lineages of V. cholerae O1 in recent years. PMID:28192431

Comparative genome analysis of VSP-II and SNPs reveals heterogenic variation in contemporary strains of Vibrio cholerae O1 isolated from cholera patients in Kolkata, India.

PubMed

Imamura, Daisuke; Morita, Masatomo; Sekizuka, Tsuyoshi; Mizuno, Tamaki; Takemura, Taichiro; Yamashiro, Tetsu; Chowdhury, Goutam; Pazhani, Gururaja P; Mukhopadhyay, Asish K; Ramamurthy, Thandavarayan; Miyoshi, Shin-Ichi; Kuroda, Makoto; Shinoda, Sumio; Ohnishi, Makoto

2017-02-01

Cholera is an acute diarrheal disease and a major public health problem in many developing countries in Asia, Africa, and Latin America. Since the Bay of Bengal is considered the epicenter for the seventh cholera pandemic, it is important to understand the genetic dynamism of Vibrio cholerae from Kolkata, as a representative of the Bengal region. We analyzed whole genome sequence data of V. cholerae O1 isolated from cholera patients in Kolkata, India, from 2007 to 2014 and identified the heterogeneous genomic region in these strains. In addition, we carried out a phylogenetic analysis based on the whole genome single nucleotide polymorphisms to determine the genetic lineage of strains in Kolkata. This analysis revealed the heterogeneity of the Vibrio seventh pandemic island (VSP)-II in Kolkata strains. The ctxB genotype was also heterogeneous and was highly related to VSP-II types. In addition, phylogenetic analysis revealed the shifts in predominant strains in Kolkata. Two distinct lineages, 1 and 2, were found between 2007 and 2010. However, the proportion changed markedly in 2010 and lineage 2 strains were predominant thereafter. Lineage 2 can be divided into four sublineages, I, II, III and IV. The results of this study indicate that lineages 1 and 2-I were concurrently prevalent between 2007 and 2009, and lineage 2-III observed in 2010, followed by the predominance of lineage 2-IV in 2011 and continued until 2014. Our findings demonstrate that the epidemic of cholera in Kolkata was caused by several distinct strains that have been constantly changing within the genetic lineages of V. cholerae O1 in recent years.

Reemergence of enterovirus 71 epidemic in northern Taiwan, 2012.

PubMed

Luo, Shu-Ting; Chiang, Pai-Shan; Chung, Wan-Yu; Chia, Min-Yuan; Tsao, Kuo-Chien; Wang, Ying-Hsiang; Lin, Tzou-Yien; Lee, Min-Shi

2015-01-01

Enterovirus 71 (EV71) belongs to picornavirus family and could be classified phylogenetically into three major genogroups (A, B and C) including 11 genotypes (A, B1-B5 and C1-C5). Since 1997, EV71 has caused large-scale of epidemics with neurological complications in Asian children. In Taiwan, nationwide EV71 epidemics with different predominant genotypes have occurred cyclically since 1998. A nationwide EV71 epidemic occurred again in 2012. We conducted genetic and antigenic characterizations of the 2012 epidemic. Chang Gung Memorial Hospital (CGMH) is a medical center in northern Taiwan. In CGMH, specimens were collected from pediatric inpatients with suspected enterovirus infections for virus isolation. Enterovirus isolates were serotyped and genotyped and sera from EV71 inpatients were collected for measuring neutralizing antibody titers. There were 10, 16 and 99 EV71 inpatients identified in 2010, 2011 and 2012, respectively. There were 82 EV71 isolates genotyped, which identified 17 genotype C4a viruses and 65 genotype B5 viruses. The genotype B5 viruses were not detected until November 2011 and caused epidemics in 2012. Interestingly, the B5-2011 viruses were genetically distinguishable from the B5 viruses causing the 2008 epidemic and are likely introduced from China or Southeastern Asia. Based on antigenic analysis, minor antigenic variations were detected among the B5-2008, B5-2011, C4a-2008 and C4a-2012 viruses but these viruses antigenically differed from genotype A. Genotype B5 and C4a viruses antigenically differ from genotype A viruses which have disappeared globally for 30 years but have been detected in China since 2008. Enterovirus surveillance should monitor genetic and antigenic variations of EV71.

MeNZB vaccine and epidemic control: when do you stop vaccinating?

PubMed

Loring, Belinda J; Turner, Nikki; Petousis-Harris, Helen

2008-11-05

New Zealand developed a strain-specific group B meningococcal vaccine to control an epidemic. Following a mass vaccination campaign of three doses to the population under 20 years of age, commencing in July 2004, the vaccine continued to be offered routinely as a four-dose schedule from 6 weeks of age. There is little international data on when to cease epidemic vaccination campaigns. The decision to stop using this vaccine needed to take into account a range of factors. These included epidemiology, vaccine effectiveness and duration of immunity, vaccine coverage, concomitant use with other vaccinations being added to the infant schedule, vaccine supply and cost-benefit criteria. This paper discusses these issues, along with the potential challenges for communication to both health professionals and the public.