Phylogenetic analysis of Mycobacterium massiliense strains having recombinant rpoB gene laterally transferred from Mycobacterium abscessus.

PubMed

Kim, Byoung-Jun; Kim, Ga-Na; Kim, Bo-Ram; Shim, Tae-Sun; Kook, Yoon-Hoh; Kim, Bum-Joon

2017-01-01

Recent multi locus sequence typing (MLST) and genome based studies indicate that lateral gene transfer (LGT) events in the rpoB gene are prevalent between Mycobacterium abscessus complex strains. To check the prevalence of the M. massiliense strains subject to rpoB LGT (Rec-mas), we applied rpoB typing (711 bp) to 106 Korean strains of M. massiliense infection that had already been identified by hsp65 sequence analysis (603 bp). The analysis indicated 6 smooth strains in M. massiliense Type I (10.0%, 6/60) genotypes but no strains in M. massiliense Type II genotypes (0%, 0/46), showing a discrepancy between the 2 typing methods. Further MLST analysis based on the partial sequencing of seven housekeeping genes, argH, cya, glpK, gnd, murC, pta and purH, as well as erm(41) PCR proved that these 6 Rec-mas strains consisted of two distinct genotypes belonging to M. massiliense and not M. abscessus. The complete rpoB sequencing analysis showed that these 6 Rec-mas strains have an identical hybrid rpoB gene, of which a 478 bp partial rpoB fragment may be laterally transferred from M. abscessus. Notably, five of the 6 Rec-mas strains showed complete identical sequences in a total of nine genes, including the seven MLST genes, hsp65, and rpoB, suggesting their clonal propagation in South Korea. In conclusion, we identified 6 M. massiliense smooth strains of 2 phylogenetically distinct genotypes with a specific hybrid rpoB gene laterally transferred from M. abscessus from Korean patients. Their clinical relevance and bacteriological traits remain to be elucidated.

Phylogenetic analysis of Mycobacterium massiliense strains having recombinant rpoB gene laterally transferred from Mycobacterium abscessus

PubMed Central

Kim, Byoung-Jun; Kim, Ga-Na; Kim, Bo-Ram; Shim, Tae-Sun; Kook, Yoon-Hoh

2017-01-01

Recent multi locus sequence typing (MLST) and genome based studies indicate that lateral gene transfer (LGT) events in the rpoB gene are prevalent between Mycobacterium abscessus complex strains. To check the prevalence of the M. massiliense strains subject to rpoB LGT (Rec-mas), we applied rpoB typing (711 bp) to 106 Korean strains of M. massiliense infection that had already been identified by hsp65 sequence analysis (603 bp). The analysis indicated 6 smooth strains in M. massiliense Type I (10.0%, 6/60) genotypes but no strains in M. massiliense Type II genotypes (0%, 0/46), showing a discrepancy between the 2 typing methods. Further MLST analysis based on the partial sequencing of seven housekeeping genes, argH, cya, glpK, gnd, murC, pta and purH, as well as erm(41) PCR proved that these 6 Rec-mas strains consisted of two distinct genotypes belonging to M. massiliense and not M. abscessus. The complete rpoB sequencing analysis showed that these 6 Rec-mas strains have an identical hybrid rpoB gene, of which a 478 bp partial rpoB fragment may be laterally transferred from M. abscessus. Notably, five of the 6 Rec-mas strains showed complete identical sequences in a total of nine genes, including the seven MLST genes, hsp65, and rpoB, suggesting their clonal propagation in South Korea. In conclusion, we identified 6 M. massiliense smooth strains of 2 phylogenetically distinct genotypes with a specific hybrid rpoB gene laterally transferred from M. abscessus from Korean patients. Their clinical relevance and bacteriological traits remain to be elucidated. PMID:28604829

Enterobacter xiangfangensis sp. nov., isolated from Chinese traditional sourdough, and reclassification of Enterobacter sacchari Zhu et al. 2013 as Kosakonia sacchari comb. nov.

PubMed

Gu, Chun Tao; Li, Chun Yan; Yang, Li Jie; Huo, Gui Cheng

2014-08-01

A Gram-stain-negative bacterial strain, 10-17(T), was isolated from traditional sourdough in Heilongjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, RNA polymerase β subunit (rpoB) gene sequence analysis, DNA gyrase (gyrB) gene sequence analysis, initiation translation factor 2 (infB) gene sequence analysis, ATP synthase β subunit (atpD) gene sequence analysis, fatty acid methyl ester analysis, determination of DNA G+C content, DNA-DNA hybridization and an analysis of phenotypic features. Strain 10-17(T) was phylogenetically related to Enterobacter hormaechei CIP 103441(T), Enterobacter cancerogenus LMG 2693(T), Enterobacter asburiae JCM 6051(T), Enterobacter mori LMG 25706(T), Enterobacter ludwigii EN-119(T) and Leclercia adecarboxylata LMG 2803(T), having 99.5%, 99.3%, 98.7%, 98.5%, 98.4% and 98.4% 16S rRNA gene sequence similarity, respectively. On the basis of polyphasic characterization data obtained in the present study, a novel species, Enterobacter xiangfangensis sp. nov., is proposed and the type strain is 10-17(T) ( = LMG 27195(T) = NCIMB 14836(T) = CCUG 62994(T)). Enterobacter sacchari Zhu et al. 2013 was reclassified as Kosakonia sacchari comb. nov. on the basis of 16S rRNA, rpoB, gyrB, infB and atpD gene sequence analysis and the type strain is strain SP1(T)( = CGMCC 1.12102(T) = LMG 26783(T)). © 2014 IUMS.

Species-specific identification of commercial probiotic strains.

PubMed

Yeung, P S M; Sanders, M E; Kitts, C L; Cano, R; Tong, P S

2002-05-01

Products containing probiotic bacteria are gaining popularity, increasing the importance of their accurate speciation. Unfortunately, studies have suggested that improper labeling of probiotic species is common in commercial products. Species identification of a bank of commercial probiotic strains was attempted using partial 16S rDNA sequencing, carbohydrate fermentation analysis, and cellular fatty acid methyl ester analysis. Results from partial 16S rDNA sequencing indicated discrepancies between species designations for 26 out of 58 strains tested, including two ATCC Lactobacillus strains. When considering only the commercial strains obtained directly from the manufacturers, 14 of 29 strains carried species designations different from those obtained by partial 16S rDNA sequencing. Strains from six commercial products were species not listed on the label. The discrepancies mainly occurred in Lactobacillus acidophilus and Lactobacillus casei groups. Carbohydrate fermentation analysis was not sensitive enough to identify species within the L. acidophilus group. Fatty acid methyl ester analysis was found to be variable and inaccurate and is not recommended to identify probiotic lactobacilli.

[Completed sequences analysis on the Chinese attenuated yellow fever 17D vaccine strain and the WHO standard yellow fever 17D vaccine strain].

PubMed

Li, Jing; Yu, Yong-Xin; Dong, Guan-Mu

2009-04-01

To compare the molecular characteristics of the Chinese attenuated yellow fever 17D vaccine strain and the WHO reference yellow fever 17D vaccine strain. The primers were designed according to the published nucleotide sequences of YFV 17D strains in GenBank. Total RNA of was extracted by the Trizol and reverse transcripted. The each fragments of the YFV genome were amplified by PCR and sequenced subsequently. The fragments of the 5' and 3' end of the two strains were cloned into the pGEM T-easy vector and then sequenced. The nucleotide acid and amino acid sequences of the homology to both strains were 99% with each other. No obvious nulceotide changes were found in the sequences of the entire genome of each 17D strains. Moreover, there was no obvious changes in the E protein genes. But the E173 of YF17D Tiantan, associted with the virulence, had mutantions. And the two live attenuated yellow fever 17D vaccine strains fell to the same lineage by the phylogenetic analysis. The results indicated that the two attenuated yellow fever 17D vaccine viruses accumulates mutations at a very low frequency and the genomes were relative stable.

Genomics sequence analysis of the United States infectious laryngotracheitis vaccine strains chicken embryo origin (CEO) and tissue culture origin (TCO)

USDA-ARS?s Scientific Manuscript database

The genomic sequences of low and high passages of the United States infectious laryngotracheitis (ILT) vaccine strains CEO and TCO were determined using hybrid next generation sequencing in order to define genomic changes associated with attenuation and reversion to virulence. Phylogenetic analysis ...

Genome sequence analysis of dengue virus 1 isolated in Key West, Florida.

PubMed

Shin, Dongyoung; Richards, Stephanie L; Alto, Barry W; Bettinardi, David J; Smartt, Chelsea T

2013-01-01

Dengue virus (DENV) is transmitted to humans through the bite of mosquitoes. In November 2010, a dengue outbreak was reported in Monroe County in southern Florida (FL), including greater than 20 confirmed human cases. The virus collected from the human cases was verified as DENV serotype 1 (DENV-1) and one isolate was provided for sequence analysis. RNA was extracted from the DENV-1 isolate and was used in reverse transcription polymerase chain reaction (RT-PCR) to amplify PCR fragments to sequence. Nucleic acid primers were designed to generate overlapping PCR fragments that covered the entire genome. The DENV-1 isolate found in Key West (KW), FL was sequenced for whole genome characterization. Sequence assembly, Genbank searches, and recombination analyses were performed to verify the identity of the genome sequences and to determine percent similarity to known DENV-1 sequences. We show that the KW DENV-1 strain is 99% identical to Nicaraguan and Mexican DENV-1 strains. Phylogenetic and recombination analyses suggest that the DENV-1 isolated in KW originated from Nicaragua (NI) and the KW strain may circulate in KW. Also, recombination analysis results detected recombination events in the KW strain compared to DENV-1 strains from Puerto Rico. We evaluate the relative growth of KW strain of DENV-1 compared to other dengue viruses to determine whether the underlying genetics of the strain is associated with a replicative advantage, an important consideration since local transmission of DENV may result because domestic tourism can spread DENVs.

Complete Genome Sequence and Comparative Analysis of the Fish Pathogen Lactococcus garvieae

PubMed Central

Oshima, Kenshiro; Yoshizaki, Mariko; Kawanishi, Michiko; Nakaya, Kohei; Suzuki, Takehito; Miyauchi, Eiji; Ishii, Yasuo; Tanabe, Soichi; Murakami, Masaru; Hattori, Masahira

2011-01-01

Lactococcus garvieae causes fatal haemorrhagic septicaemia in fish such as yellowtail. The comparative analysis of genomes of a virulent strain Lg2 and a non-virulent strain ATCC 49156 of L. garvieae revealed that the two strains shared a high degree of sequence identity, but Lg2 had a 16.5-kb capsule gene cluster that is absent in ATCC 49156. The capsule gene cluster was composed of 15 genes, of which eight genes are highly conserved with those in exopolysaccharide biosynthesis gene cluster often found in Lactococcus lactis strains. Sequence analysis of the capsule gene cluster in the less virulent strain L. garvieae Lg2-S, Lg2-derived strain, showed that two conserved genes were disrupted by a single base pair deletion, respectively. These results strongly suggest that the capsule is crucial for virulence of Lg2. The capsule gene cluster of Lg2 may be a genomic island from several features such as the presence of insertion sequences flanked on both ends, different GC content from the chromosomal average, integration into the locus syntenic to other lactococcal genome sequences, and distribution in human gut microbiomes. The analysis also predicted other potential virulence factors such as haemolysin. The present study provides new insights into understanding of the virulence mechanisms of L. garvieae in fish. PMID:21829716

[The genetical evolution of the full length genes of 5 EV 71 strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV71 infection].

PubMed

Liu, Wei-long; Yang, Gui-lin; Wei, Qing; Zhang, Ming-xia; Chen, Xin-chun; Liu, Ying-xia; Gao, Yang; Zhou, Bo-ping

2011-02-01

To investigate the characteristics of molecular epidemiology and molecular evolution of 5 EV 71 (enterovirus 71, EV71) strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV 71 infection. 5 EV 71 strains were isolated, and sequenced to analyzed the full length gene sequences in order to compare nucleotide and amino acid homology with other EV71 strains from other regions and countries as well as previous strains across the world through bioinformatics software. 5 strains of EV 71 belonged to sub-genotype C4 by analysis of nucleotide sequences of VP1 and VP4 of EV 71. The differences of nucleotide and amino acid sequences were much small with nucleotide homology of 93% and amino acid homology of 98% among these 5 strains. A phylogenetic tree analysis indicated that 2008 Shenzhen epidemic strains were the most close to 2004 Shenzhen circulating strains, and also much close to 1998 Shenzhen epidemic strains and 2008 Fuyang Anhui strains. The dead strain was very close to 2008 Fuyang Anhui epidemic strains. It can be speculated that this epidemic strains of EV 71 probably originate from the same ancient strain in the history, may from 1998 Shenzhen strain.

Bradyrhizobium sacchari sp. nov., a legume nodulating bacterium isolated from sugarcane roots.

PubMed

de Matos, Gustavo Feitosa; Zilli, Jerri Edson; de Araújo, Jean Luiz Simões; Parma, Marcia Maria; Melo, Itamar Soares; Radl, Viviane; Baldani, José Ivo; Rouws, Luc Felicianus Marie

2017-11-01

Members of the genus Bradyrhizobium are well-known as nitrogen-fixing microsymbionts of a wide variety of leguminous species, but they have also been found in different environments, notably as endophytes in non-legumes such as sugarcane. This study presents a detailed polyphasic characterization of four Bradyrhizobium strains (type strain BR 10280 T ), previously isolated from roots of sugarcane in Brazil. 16S rRNA sequence analysis, multilocus sequence analysis (MLSA) and analysis of the 16S-23S rRNA internal transcribed spacer showed that these strains form a novel clade close to, but different from B. huanghuaihaiense strain CCBAU 23303 T . Average nucleotide identity (ANI) analyses confirmed that BR 10280 T represents a novel species. Phylogenetic analysis based on nodC gene sequences also placed the strains close to CCBAU 23303 T , but different from this latter strain, the sugarcane strains did not nodulate soybean, although they effectively nodulated Vigna unguiculata, Cajanus cajan and Macroptilium atropurpureum. Physiological traits are in agreement with the placement of the strains in the genus Bradyrhizobium as a novel species for which the name Bradyrhizobium sacchari sp. nov. is proposed.

Genetic Diversity of Crimean Congo Hemorrhagic Fever Virus Strains from Iran

PubMed Central

Chinikar, Sadegh; Bouzari, Saeid; Shokrgozar, Mohammad Ali; Mostafavi, Ehsan; Jalali, Tahmineh; Khakifirouz, Sahar; Nowotny, Norbert; Fooks, Anthony R.; Shah-Hosseini, Nariman

2016-01-01

Background: Crimean Congo hemorrhagic fever virus (CCHFV) is a member of the Bunyaviridae family and Nairovirus genus. It has a negative-sense, single stranded RNA genome approximately 19.2 kb, containing the Small, Medium, and Large segments. CCHFVs are relatively divergent in their genome sequence and grouped in seven distinct clades based on S-segment sequence analysis and six clades based on M-segment sequences. Our aim was to obtain new insights into the molecular epidemiology of CCHFV in Iran. Methods: We analyzed partial and complete nucleotide sequences of the S and M segments derived from 50 Iranian patients. The extracted RNA was amplified using one-step RT-PCR and then sequenced. The sequences were analyzed using Mega5 software. Results: Phylogenetic analysis of partial S segment sequences demonstrated that clade IV-(Asia 1), clade IV-(Asia 2) and clade V-(Europe) accounted for 80 %, 4 % and 14 % of the circulating genomic variants of CCHFV in Iran respectively. However, one of the Iranian strains (Iran-Kerman/22) was associated with none of other sequences and formed a new clade (VII). The phylogenetic analysis of complete S-segment nucleotide sequences from selected Iranian CCHFV strains complemented with representative strains from GenBank revealed similar topology as partial sequences with eight major clusters. A partial M segment phylogeny positioned the Iranian strains in either association with clade III (Asia-Africa) or clade V (Europe). Conclusion: The phylogenetic analysis revealed subtle links between distant geographic locations, which we propose might originate either from international livestock trade or from long-distance carriage of CCHFV by infected ticks via bird migration. PMID:27308271

Genome Sequencing and Analysis of Yersina pestis KIM D27, an Avirulent Strain Exempt from Select Agent Regulation

PubMed Central

Losada, Liliana; Varga, John J.; Hostetler, Jessica; Radune, Diana; Kim, Maria; Durkin, Scott; Schneewind, Olaf; Nierman, William C.

2011-01-01

Yersinia pestis is the causative agent of the plague. Y. pestis KIM 10+ strain was passaged and selected for loss of the 102 kb pgm locus, resulting in an attenuated strain, KIM D27. In this study, whole genome sequencing was performed on KIM D27 in order to identify any additional differences. Initial assemblies of 454 data were highly fragmented, and various bioinformatic tools detected between 15 and 465 SNPs and INDELs when comparing both strains, the vast majority associated with A or T homopolymer sequences. Consequently, Illumina sequencing was performed to improve the quality of the assembly. Hybrid sequence assemblies were performed and a total of 56 validated SNP/INDELs and 5 repeat differences were identified in the D27 strain relative to published KIM 10+ sequence. However, further analysis showed that 55 of these SNP/INDELs and 3 repeats were errors in the KIM 10+ reference sequence. We conclude that both 454 and Illumina sequencing were required to obtain the most accurate and rapid sequence results for Y. pestis KIMD27. SNP and INDELS calls were most accurate when both Newbler and CLC Genomics Workbench were employed. For purposes of obtaining high quality genome sequence differences between strains, any identified differences should be verified in both the new and reference genomes. PMID:21559501

Genome sequencing and analysis of Yersina pestis KIM D27, an avirulent strain exempt from select agent regulation.

PubMed

Losada, Liliana; Varga, John J; Hostetler, Jessica; Radune, Diana; Kim, Maria; Durkin, Scott; Schneewind, Olaf; Nierman, William C

2011-04-29

Yersinia pestis is the causative agent of the plague. Y. pestis KIM 10+ strain was passaged and selected for loss of the 102 kb pgm locus, resulting in an attenuated strain, KIM D27. In this study, whole genome sequencing was performed on KIM D27 in order to identify any additional differences. Initial assemblies of 454 data were highly fragmented, and various bioinformatic tools detected between 15 and 465 SNPs and INDELs when comparing both strains, the vast majority associated with A or T homopolymer sequences. Consequently, Illumina sequencing was performed to improve the quality of the assembly. Hybrid sequence assemblies were performed and a total of 56 validated SNP/INDELs and 5 repeat differences were identified in the D27 strain relative to published KIM 10+ sequence. However, further analysis showed that 55 of these SNP/INDELs and 3 repeats were errors in the KIM 10+ reference sequence. We conclude that both 454 and Illumina sequencing were required to obtain the most accurate and rapid sequence results for Y. pestis KIMD27. SNP and INDELS calls were most accurate when both Newbler and CLC Genomics Workbench were employed. For purposes of obtaining high quality genome sequence differences between strains, any identified differences should be verified in both the new and reference genomes.

Genetic diversity of HIV-1 non-B strains in Sicily: evidence of intersubtype recombinants by sequence analysis of gag, pol, and env genes.

PubMed

Tramuto, Fabio; Bonura, Filippa; Perna, Anna Maria; Mancuso, Salvatrice; Firenze, Alberto; Romano, Nino; Vitale, Francesco

2007-09-01

The molecular epidemiology of HIV-1 strains in Sicily (Italy) was phylogenetically investigated by the analysis of HIV-1 gag, pol, and env gene sequences from 11 HIV-1 non-B strains from 408 HIV-1-seropositive patients observed from September 2001 to August 2006. Sequences suggestive of recombination were further investigated by bootscanning analysis of various fragments. Overall, we identified several second-generation recombinant (SGRs) strains, which contained genetic material of CRF02_AG in at least one gene. Notably, three individuals were found to be infected with subsubtype A3, and one of them showed genetic recombination with subsubtype A4. The current study emphasizes the genetic analysis of gag, pol, and env genes as a powerful tool to trace the spread of complex HIV-1 recombinant forms, and highlight the genetic diversity of HIV-1 non-B strains in Italy.

Genomic sequence analysis of the United States infectious laryngotracheitis vaccine strains chicken embryo origin (CEO) and tissue culture origin (TCO)

USDA-ARS?s Scientific Manuscript database

The genomic sequences of low and high passages of U.S. infectious laryngotracheitis (ILT) vaccine strains chicken embryo origin (CEO) and tissue culture origin (TCO) these strains were determined using hybrid next generation sequencing in order to define relevant genomic changes associated with att...

Weissella fabaria sp. nov., from a Ghanaian cocoa fermentation.

PubMed

De Bruyne, Katrien; Camu, Nicholas; De Vuyst, Luc; Vandamme, Peter

2010-09-01

Two lactic acid bacteria, strains 257(T) and 252, were isolated from traditional heap fermentations of Ghanaian cocoa beans. 16S rRNA gene sequence analysis of these strains allocated them to the genus Weissella, showing 99.5 % 16S rRNA gene sequence similarity towards Weissella ghanensis LMG 24286(T). Whole-cell protein electrophoresis, fluorescent amplified fragment length polymorphism fingerprinting of whole genomes and biochemical tests confirmed their unique taxonomic position. DNA-DNA hybridization experiments towards their nearest phylogenetic neighbour demonstrated that the two strains represent a novel species, for which we propose the name Weissella fabaria sp. nov., with strain 257(T) (=LMG 24289(T) =DSM 21416(T)) as the type strain. Additional sequence analysis using pheS gene sequences proved useful for identification of all Weissella-Leuconostoc-Oenococcus species and for the recognition of the novel species.

Phylogeny of the Defined Murine Microbiota: Altered Schaedler Flora

PubMed Central

Dewhirst, Floyd E.; Chien, Chih-Ching; Paster, Bruce J.; Ericson, Rebecca L.; Orcutt, Roger P.; Schauer, David B.; Fox, James G.

1999-01-01

The “altered Schaedler flora” (ASF) was developed for colonizing germfree rodents with a standardized microbiota. The purpose of this study was to identify each of the eight ASF strains by 16S rRNA sequence analysis. Three strains were previously identified as Lactobacillus acidophilus (strain ASF 360), Lactobacillus salivarius (strain ASF 361), and Bacteroides distasonis (strain ASF 519) based on phenotypic criteria. 16S rRNA analysis indicated that each of the strains differed from its presumptive identity. The 16S rRNA sequence of strain ASF 361 is essentially identical to the 16S rRNA sequences of the type strains of Lactobacillus murinis and Lactobacillus animalis (both isolated from mice), and all of these strains probably belong to a single species. Strain ASF 360 is a novel lactobacillus that clusters with L. acidophilus and Lactobacillus lactis. Strain ASF 519 falls into an unnamed genus containing [Bacteroides] distasonis, [Bacteroides] merdae, [Bacteroides] forsythus, and CDC group DF-3. This unnamed genus is in the Cytophaga-Flavobacterium-Bacteroides phylum and is most closely related to the genus Porphyromonas. The spiral-shaped strain, strain ASF 457, is in the Flexistipes phylum and exhibits sequence identity with rodent isolates of Robertson. The remaining four ASF strains, which are extremely oxygen-sensitive fusiform bacteria, group phylogenetically with the low-G+C-content gram-positive bacteria (Firmicutes, Bacillus-Clostridium group). ASF 356, ASF 492, and ASF 502 fall into Clostridium cluster XIV of Collins et al. Morphologically, ASF 492 resembles members of this cluster, Roseburia cecicola, and Eubacterium plexicaudatum. The 16S rRNA sequence of ASF 492 is identical to that of E. plexicaudatum. Since the type strain and other viable original isolates of E. plexicaudatum have been lost, strain ASF 492 is a candidate for a neotype strain. Strain ASF 500 branches deeply in the low-G+C-content gram-positive phylogenetic tree but is not closely related to any organisms whose 16S rRNA sequences are currently in the GenBank database. The 16S rRNA sequence information determined in the present study should allow rapid identification of ASF strains and should permit detailed analysis of the interactions of ASF organisms during development of intestinal disease in mice that are coinfected with a variety of pathogenic microorganisms. PMID:10427008

The phosphotransferase system-dependent sucrose utilization regulon in enteropathogenic Escherichia coli strains is located in a variable chromosomal region containing iap sequences.

PubMed

Treviño-Quintanilla, Luis Gerardo; Escalante, Adelfo; Caro, Alma Delia; Martínez, Alfredo; González, Ricardo; Puente, José Luis; Bolívar, Francisco; Gosset, Guillermo

2007-01-01

The capacity to utilize sucrose as a carbon and energy source (Scr(+) phenotype) is a highly variable trait among Escherichia coli strains. In this study, seven enteropathogenic E. coli (EPEC) strains from different sources were studied for their capacity to grow using sucrose. Liquid media cultures showed that all analyzed strains have the Scr(+) phenotype and two distinct groups were defined: one of five and another of two strains displaying doubling times of 67 and 125 min, respectively. The genes conferring the Scr(+) phenotype in one of the fast-growing strains (T19) were cloned and sequenced. Comparative sequence analysis revealed that this strain possesses the scr regulon genes scrKYABR, encoding phosphoenolpyruvate:phosphotransferase system-dependent sucrose transport and utilization activities. Transcript level quantification revealed sucrose-dependent induction of scrK and scrR genes in fast-growing strains, whereas no transcripts were detected in slow-growing strains. Sequence comparison analysis revealed that the scr genes in strain T19 are almost identical to those present in the scr regulon of prototype EPEC E2348/69 and in both strains, the scr genes are inserted in the chromosomal intergenic region of hypothetical genes ygcE and ygcF. Comparison of the ygcE-ygcF intergenic region sequence of strains MG1655, enterohemorrhagic EDL933, uropathogenic ECFT073 and EPEC T19-E2348/69 revealed that the number of extragenic highly repeated iap sequences corresponded to nine, four, two and none, respectively. These results show that the iap sequence-containing chromosomal ygcE-ygcF intergenic region is highly variable in E. coli. Copyright (c) 2007 S. Karger AG, Basel.

Whole genome sequence phylogenetic analysis of four Mexican rabies viruses isolated from cattle.

PubMed

Bárcenas-Reyes, I; Loza-Rubio, E; Cantó-Alarcón, G J; Luna-Cozar, J; Enríquez-Vázquez, A; Barrón-Rodríguez, R J; Milián-Suazo, F

2017-08-01

Phylogenetic analysis of the rabies virus in molecular epidemiology has been traditionally performed on partial sequences of the genome, such as the N, G, and P genes; however, that approach raises concerns about the discriminatory power compared to whole genome sequencing. In this study we characterized four strains of the rabies virus isolated from cattle in Querétaro, Mexico by comparing the whole genome sequence to that of strains from the American, European and Asian continents. Four cattle brain samples positive to rabies and characterized as AgV11, genotype 1, were used in the study. A cDNA sequence was generated by reverse transcription PCR (RT-PCR) using oligo dT. cDNA samples were sequenced in an Illumina NextSeq 500 platform. The phylogenetic analysis was performed with MEGA 6.0. Minimum evolution phylogenetic trees were constructed with the Neighbor-Joining method and bootstrapped with 1000 replicates. Three large and seven small clusters were formed with the 26 sequences used. The largest cluster grouped strains from different species in South America: Brazil, and the French Guyana. The second cluster grouped five strains from Mexico. A Mexican strain reported in a different study was highly related to our four strains, suggesting common source of infection. The phylogenetic analysis shows that the type of host is different for the different regions in the American Continent; rabies is more related to bats. It was concluded that the rabies virus in central Mexico is genetically stable and that it is transmitted by the vampire bat Desmodus rotundus. Copyright © 2017 Elsevier Ltd. All rights reserved.

Sequence analysis of porcine kobuvirus VP1 region detected in pigs in Japan and Thailand.

PubMed

Okitsu, Shoko; Khamrin, Pattara; Thongprachum, Aksara; Hidaka, Satoshi; Kongkaew, Sompreeya; Kongkaew, Apisek; Maneekarn, Niwat; Mizuguchi, Masashi; Hayakawa, Satoshi; Ushijima, Hiroshi

2012-04-01

Porcine kobuvirus is a new candidate species of the genus Kobuvirus in the family Picornaviridae, and information is still limited. The identification of porcine kobuvirus has been performed by the sequence analyses of the 3D region of the viruses. Therefore, the purpose of this study was to characterize the molecular properties of VP1 nucleotide sequences of the porcine kobuviruses isolated from porcine stool samples in Japan during 2009 and Thailand between 2006 and 2008. In addition, previous identification of a unique porcine kobuvirus; Japanese H023/2009/JP, which is a bovine kobuvirus-like strain based on sequence analysis of the 3D region, was also included in this study. All of the strains were amplified by the VP1-specific primer pair: the amplicons were subjected to direct sequencing and compared with the VP1 nucleotide sequences of reference strains. The VP1 sequences of strains from the GenBank database revealed high nucleotide sequence identity at 84.3-100%. On the other hand, the nucleotide identities among the 15 porcine kobuvirus strains analyzed in this study ranged from 78.8 to 99.8%. The results revealed that diversity of the strains in this study were higher than those of the strains in previous studies. Furthermore, it was found that the VP1 region of the bovine kobuvirus-like strain, H023/2009/JP, clustered with nine porcine kobuvirus strains that were isolated in Thailand and Japan. Since this strain was previously found to be closely related to bovine kobuviruses in the 3D gene region, it may be a natural recombinant.

Phylogenetic analysis of Hungarian goose parvovirus isolates and vaccine strains.

PubMed

Tatár-Kis, Tímea; Mató, Tamás; Markos, Béla; Palya, Vilmos

2004-08-01

Polymerase chain reaction and sequencing were used to analyse goose parvovirus field isolates and vaccine strains. Two fragments of the genome were amplified. Fragment "A" represents a region of VP3 gene, while fragment "B" represents a region upstream of the VP3 gene, encompassing part of the VP1 gene. In the region of fragment "A" the deduced amino acid sequence of the strains was identical, therefore differentiation among strains could be done only at the nucleotide level, which resulted in the formation of three groups: Hungarian, West-European and Asian strains. In the region of fragment "B", separation of groups could be done by both nucleotide and deduced amino acid sequence level. The nucleotide sequences resulted in the same groups as for fragment "A" but with a different clustering pattern among the Hungarian strains. Within the "Hungarian" group most of the recent field isolates fell into one cluster, very closely related or identical to each other, indicating a very slow evolutionary change. The attenuated strains and field isolates from 1979/80 formed a separate cluster. When vaccine strains and field isolates were compared, two specific amino acid differences were found that can be considered as possible markers for vaccinal strains. Sequence analysis of fragment "B" seems to be a suitable method for differentiation of attenuated vaccine strains from virulent strains. Copyright 2004 Houghton Trust Ltd

Complete genome sequence of the plant pathogen Erwinia amylovora strain ATCC 49946

USDA-ARS?s Scientific Manuscript database

Erwinia amylovora causes the economically important disease fire blight that affects rosaceous plants, especially pear and apple. Here we report the complete genome sequence and annotation of strain ATCC 49946. The analysis of the sequence and its comparison with sequenced genomes of closely related...

Selection and Validation of a Multilocus Variable-Number Tandem-Repeat Analysis Panel for Typing Shigella spp.▿ †

PubMed Central

Gorgé, Olivier; Lopez, Stéphanie; Hilaire, Valérie; Lisanti, Olivier; Ramisse, Vincent; Vergnaud, Gilles

2008-01-01

The Shigella genus has historically been separated into four species, based on biochemical assays. The classification within each species relies on serotyping. Recently, genome sequencing and DNA assays, in particular the multilocus sequence typing (MLST) approach, greatly improved the current knowledge of the origin and phylogenetic evolution of Shigella spp. The Shigella and Escherichia genera are now considered to belong to a unique genomospecies. Multilocus variable-number tandem-repeat (VNTR) analysis (MLVA) provides valuable polymorphic markers for genotyping and performing phylogenetic analyses of highly homogeneous bacterial pathogens. Here, we assess the capability of MLVA for Shigella typing. Thirty-two potentially polymorphic VNTRs were selected by analyzing in silico five Shigella genomic sequences and subsequently evaluated. Eventually, a panel of 15 VNTRs was selected (i.e., MLVA15 analysis). MLVA15 analysis of 78 strains or genome sequences of Shigella spp. and 11 strains or genome sequences of Escherichia coli distinguished 83 genotypes. Shigella population cluster analysis gave consistent results compared to MLST. MLVA15 analysis showed capabilities for E. coli typing, providing classification among pathogenic and nonpathogenic E. coli strains included in the study. The resulting data can be queried on our genotyping webpage (http://mlva.u-psud.fr). The MLVA15 assay is rapid, highly discriminatory, and reproducible for Shigella and Escherichia strains, suggesting that it could significantly contribute to epidemiological trace-back analysis of Shigella infections and pathogenic Escherichia outbreaks. Typing was performed on strains obtained mostly from collections. Further studies should include strains of much more diverse origins, including all pathogenic E. coli types. PMID:18216214

Outbreak Investigation Using High-Throughput Genome Sequencing within a Diagnostic Microbiology Laboratory

PubMed Central

Sherry, Norelle L.; Porter, Jessica L.; Seemann, Torsten; Watkins, Andrew; Stinear, Timothy P.

2013-01-01

Next-generation sequencing (NGS) of bacterial genomes has recently become more accessible and is now available to the routine diagnostic microbiology laboratory. However, questions remain regarding its feasibility, particularly with respect to data analysis in nonspecialist centers. To test the applicability of NGS to outbreak investigations, Ion Torrent sequencing was used to investigate a putative multidrug-resistant Escherichia coli outbreak in the neonatal unit of the Mercy Hospital for Women, Melbourne, Australia. Four suspected outbreak strains and a comparator strain were sequenced. Genome-wide single nucleotide polymorphism (SNP) analysis demonstrated that the four neonatal intensive care unit (NICU) strains were identical and easily differentiated from the comparator strain. Genome sequence data also determined that the NICU strains belonged to multilocus sequence type 131 and carried the blaCTX-M-15 extended-spectrum beta-lactamase. Comparison of the outbreak strains to all publicly available complete E. coli genome sequences showed that they clustered with neonatal meningitis and uropathogenic isolates. The turnaround time from a positive culture to the completion of sequencing (prior to data analysis) was 5 days, and the cost was approximately $300 per strain (for the reagents only). The main obstacles to a mainstream adoption of NGS technologies in diagnostic microbiology laboratories are currently cost (although this is decreasing), a paucity of user-friendly and clinically focused bioinformatics platforms, and a lack of genomics expertise outside the research environment. Despite these hurdles, NGS technologies provide unparalleled high-resolution genotyping in a short time frame and are likely to be widely implemented in the field of diagnostic microbiology in the next few years, particularly for epidemiological investigations (replacing current typing methods) and the characterization of resistance determinants. Clinical microbiologists need to familiarize themselves with these technologies and their applications. PMID:23408689

First complete genome sequence of infectious laryngotracheitis virus

PubMed Central

2011-01-01

Background Infectious laryngotracheitis virus (ILTV) is an alphaherpesvirus that causes acute respiratory disease in chickens worldwide. To date, only one complete genomic sequence of ILTV has been reported. This sequence was generated by concatenating partial sequences from six different ILTV strains. Thus, the full genomic sequence of a single (individual) strain of ILTV has not been determined previously. This study aimed to use high throughput sequencing technology to determine the complete genomic sequence of a live attenuated vaccine strain of ILTV. Results The complete genomic sequence of the Serva vaccine strain of ILTV was determined, annotated and compared to the concatenated ILTV reference sequence. The genome size of the Serva strain was 152,628 bp, with a G + C content of 48%. A total of 80 predicted open reading frames were identified. The Serva strain had 96.5% DNA sequence identity with the concatenated ILTV sequence. Notably, the concatenated ILTV sequence was found to lack four large regions of sequence, including 528 bp and 594 bp of sequence in the UL29 and UL36 genes, respectively, and two copies of a 1,563 bp sequence in the repeat regions. Considerable differences in the size of the predicted translation products of 4 other genes (UL54, UL30, UL37 and UL38) were also identified. More than 530 single-nucleotide polymorphisms (SNPs) were identified. Most SNPs were located within three genomic regions, corresponding to sequence from the SA-2 ILTV vaccine strain in the concatenated ILTV sequence. Conclusions This is the first complete genomic sequence of an individual ILTV strain. This sequence will facilitate future comparative genomic studies of ILTV by providing an appropriate reference sequence for the sequence analysis of other ILTV strains. PMID:21501528

Hepatitis a virus genotypes and strains from an endemic area of Europe, Bulgaria 2012-2014.

PubMed

Bruni, Roberto; Taffon, Stefania; Equestre, Michele; Cella, Eleonora; Lo Presti, Alessandra; Costantino, Angela; Chionne, Paola; Madonna, Elisabetta; Golkocheva-Markova, Elitsa; Bankova, Diljana; Ciccozzi, Massimo; Teoharov, Pavel; Ciccaglione, Anna Rita

2017-07-14

Hepatitis A virus (HAV) infection is endemic in Eastern European and Balkan region countries. In 2012, Bulgaria showed the highest rate (67.13 cases per 100,000) in Europe. Nevertheless, HAV genotypes and strains circulating in this country have never been described. The present study reports the molecular characterization of HAV from 105 patients from Bulgaria. Anti-HAV IgM positive serum samples collected in 2012-2014 from different towns and villages in Bulgaria were analysed by nested RT-PCR, sequencing of the VP1/2A region and phylogenetic analysis; the results were analysed together with patient and geographical data. Phylogenetic analysis revealed two main sequence groups corresponding to the IA (78/105, 74%) and IB (27/105, 26%) sub-genotypes. In the IA group, a major and a minor cluster were observed (62 and 16 sequences, respectively). Most sequences from the major cluster (44/62, 71%) belonged to either of two strains, termed "strain 1" and "strain 2", differing only for a single specific nucleotide; the remaining sequences (18/62, 29%) showed few (1 to 4) nucleotide variations respect to strain 1 and 2. Strain 2 is identical to the strain previously responsible for an outbreak in the Czech Republic in 2008 and a large multi-country European outbreak caused by contaminated mixed frozen berries in 2013. Most sequences of the IA minor cluster and the IB group were detected in large/medium centers (LMCs). Overall, sequences from the IA major cluster were more frequent in small centers (SCs), but strain 1 and strain 2 showed an opposite relative frequency in SCs and LMCs (strain 1 more frequent in SCs, strain 2 in LMCs). Genotype IA predominated in Bulgaria in 2012-2014 and phylogenetic analysis identified a major cluster of highly related or identical IA sequences, representing 59% of the analysed cases; these isolates were mostly detected in SCs, in which HAV shows higher endemicity than in LMCs. The distribution of viral sequences suggests the existence of some differences between the transmission routes in SCs and LMCs. Molecular characterization of an increased number of isolates from Bulgaria, regularly collected over time, will be useful to explore specific transmission routes and plan appropriate preventing measures.

Sequence and phylogenetic analysis of chicken anaemia virus obtained from backyard and commercial chickens in Nigeria.

PubMed

Oluwayelu, D O; Todd, D; Olaleye, O D

2008-12-01

This work reports the first molecular analysis study of chicken anaemia virus (CAV) in backyard chickens in Africa using molecular cloning and sequence analysis to characterize CAV strains obtained from commercial chickens and Nigerian backyard chickens. Partial VP1 gene sequences were determined for three CAVs from commercial chickens and for six CAV variants present in samples from a backyard chicken. Multiple alignment analysis revealed that the 6% and 4% nucleotide diversity obtained respectively for the commercial and backyard chicken strains translated to only 2% amino acid diversity for each breed. Overall, the amino acid composition of Nigerian CAVs was found to be highly conserved. Since the partial VP1 gene sequence of two backyard chicken cloned CAV strains (NGR/CI-8 and NGR/CI-9) were almost identical and evolutionarily closely related to the commercial chicken strains NGR-1, and NGR-4 and NGR-5, respectively, we concluded that CAV infections had crossed the farm boundary.

Genetic characterization of human herpesvirus type 1: Full-length genome sequence of strain obtained from an encephalitis case from India.

PubMed

Bondre, Vijay P; Sankararaman, Vasudha; Andhare, Vijaysinh; Tupekar, Manisha; Sapkal, Gajanan N

2016-11-01

Human herpes simplex virus 1 (HSV-1) is the most common cause of sporadic encephalitis in humans that contributes to >10 per cent of the encephalitis cases occurring worldwide. Availability of limited full genome sequences from a small number of isolates resulted in poor understanding of host and viral factors responsible for variable clinical outcome. In this study genetic relationship, extent and source of recombination using full-length genome sequence derived from a newly isolated HSV-1 isolate was studied in comparison with those sampled from patients with varied clinical outcome. Full genome sequence of HSV-1 isolated from cerebrospinal fluid (CSF) of a patient with acute encephalitis syndrome (AES) by inoculation in baby hamster kidney-21 (BHK-21) cells was determined using next-generation sequencing (NGS) technology. Phylogenetic analysis of the newly generated sequence in comparison with 33 additional full-length genomes defined genetic relationship with worldwide distributed strains. The bootscan and similarity plot analysis defined recombination crossovers and similarities between newly isolated Indian HSV-1 with six Asian and a total of 34 worldwide isolated strains. Mapping of 376,332 reads amplified from HSV-1 DNA by NGS generated full-length genome of 151,024 bp from newly isolated Indian HSV-1. Phylogenetic analysis classified worldwide distributed strains into three major evolutionary lineages correlating to their geographic distribution. Lineage 1 containing strains were isolated from America and Europe; lineage 2 contained all the strains from Asian countries along with the North American KOS and RE strains whereas the South African isolates were distributed into two groups under lineage 3. Recombination analysis confirmed events of recombination in Indian HSV-1 genome resulting from mixing of different strains evolved in Asian countries. Our results showed that the full-length genome sequence generated from an Indian HSV-1 isolate shared close genetic relationship with the American KOS and Chinese CR38 strains which belonged to the Asian genetic lineage. Recombination analysis of Indian isolate demonstrated multiple recombination crossover points throughout the genome. This full-length genome sequence amplified from the Indian isolate would be helpful to study HSV evolution, genetic basis of differential pathogenesis, host-virus interactions and viral factors contributing towards differential clinical outcome in human infections.

Genetic characterization of human herpesvirus type 1: Full-length genome sequence of strain obtained from an encephalitis case from India

PubMed Central

Bondre, Vijay P.; Sankararaman, Vasudha; Andhare, Vijaysinh; Tupekar, Manisha; Sapkal, Gajanan N.

2016-01-01

Background & objectives: Human herpes simplex virus 1 (HSV-1) is the most common cause of sporadic encephalitis in humans that contributes to >10 per cent of the encephalitis cases occurring worldwide. Availability of limited full genome sequences from a small number of isolates resulted in poor understanding of host and viral factors responsible for variable clinical outcome. In this study genetic relationship, extent and source of recombination using full-length genome sequence derived from a newly isolated HSV-1 isolate was studied in comparison with those sampled from patients with varied clinical outcome. Methods: Full genome sequence of HSV-1 isolated from cerebrospinal fluid (CSF) of a patient with acute encephalitis syndrome (AES) by inoculation in baby hamster kidney-21 (BHK-21) cells was determined using next-generation sequencing (NGS) technology. Phylogenetic analysis of the newly generated sequence in comparison with 33 additional full-length genomes defined genetic relationship with worldwide distributed strains. The bootscan and similarity plot analysis defined recombination crossovers and similarities between newly isolated Indian HSV-1 with six Asian and a total of 34 worldwide isolated strains. Results: Mapping of 376,332 reads amplified from HSV-1 DNA by NGS generated full-length genome of 151,024 bp from newly isolated Indian HSV-1. Phylogenetic analysis classified worldwide distributed strains into three major evolutionary lineages correlating to their geographic distribution. Lineage 1 containing strains were isolated from America and Europe; lineage 2 contained all the strains from Asian countries along with the North American KOS and RE strains whereas the South African isolates were distributed into two groups under lineage 3. Recombination analysis confirmed events of recombination in Indian HSV-1 genome resulting from mixing of different strains evolved in Asian countries. Interpretation & conclusions: Our results showed that the full-length genome sequence generated from an Indian HSV-1 isolate shared close genetic relationship with the American KOS and Chinese CR38 strains which belonged to the Asian genetic lineage. Recombination analysis of Indian isolate demonstrated multiple recombination crossover points throughout the genome. This full-length genome sequence amplified from the Indian isolate would be helpful to study HSV evolution, genetic basis of differential pathogenesis, host-virus interactions and viral factors contributing towards differential clinical outcome in human infections. PMID:28361829

Rapid identification of causative species in patients with Old World leishmaniasis.

PubMed Central

Minodier, P; Piarroux, R; Gambarelli, F; Joblet, C; Dumon, H

1997-01-01

Conventional methods for the identification of species of Leishmania parasite causing infections have limitations. By using a DNA-based alternative, the present study tries to develop a new tool for this purpose. Thirty-three patients living in Marseilles (in the south of France) were suffering from visceral or cutaneous leishmaniasis. DNA of the parasite in clinical samples (bone marrow, peripheral blood, or skin) from these patients were amplified by PCR and were directly sequenced. The sequences observed were compared to these of 30 strains of the genus causing Old World leishmaniasis collected in Europe, Africa, or Asia. In the analysis of the sequences of the strains, two different sequence patterns for Leishmania infantum, one sequence for Leishmania donovani, one sequence for Leishmania major, two sequences for Leishmania tropica, and one sequence for Leishmania aethiopica were obtained. Four sequences were observed among the strains from the patients: one was similar to the sequence for the L. major strains, two were identical to the sequences for the L. infantum strains, and the last sequence was not observed within the strains but had a high degree of homology with the sequences of the L. infantum and L. donovani strains. The L. infantum strains from all immunocompetent patients had the same sequence. The L. infantum strains from immunodeficient patients suffering from visceral leishmaniasis had three different sequences. This fact might signify that some variants of L. infantum acquire pathogenicity exclusively in immunocompromised patients. To dispense with the sequencing step, a restriction assay with HaeIII was used. Some restriction patterns might support genetic exchanges in members of the genus Leishmania. PMID:9316906

16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

PubMed

Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

1990-01-01

16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

Molecular phylogeny, population genetics, and evolution of heterocystous cyanobacteria using nifH gene sequences.

PubMed

Singh, Prashant; Singh, Satya Shila; Elster, Josef; Mishra, Arun Kumar

2013-06-01

In order to assess phylogeny, population genetics, and approximation of future course of cyanobacterial evolution based on nifH gene sequences, 41 heterocystous cyanobacterial strains collected from all over India have been used in the present study. NifH gene sequence analysis data confirm that the heterocystous cyanobacteria are monophyletic while the stigonematales show polyphyletic origin with grave intermixing. Further, analysis of nifH gene sequence data using intricate mathematical extrapolations revealed that the nucleotide diversity and recombination frequency is much greater in Nostocales than the Stigonematales. Similarly, DNA divergence studies showed significant values of divergence with greater gene conversion tracts in the unbranched (Nostocales) than the branched (Stigonematales) strains. Our data strongly support the origin of true branching cyanobacterial strains from the unbranched strains.

A Nonautochthonous U.S. Strain of Vibrio parahaemolyticus Isolated from Chesapeake Bay Oysters Caused the Outbreak in Maryland in 2010

PubMed Central

Haendiges, Julie; Jones, Jessica; Myers, Robert A.; Mitchell, Clifford S.; Butler, Erin

2016-01-01

ABSTRACT In the summer of 2010, Vibrio parahaemolyticus caused an outbreak in Maryland linked to the consumption of oysters. Strains isolated from both stool and oyster samples were indistinguishable by pulsed-field gel electrophoresis (PFGE). However, the oysters contained other potentially pathogenic V. parahaemolyticus strains exhibiting different PFGE patterns. In order to assess the identity, genetic makeup, relatedness, and potential pathogenicity of the V. parahaemolyticus strains, we sequenced 11 such strains (2 clinical strains and 9 oyster strains). We analyzed these genomes by in silico multilocus sequence typing (MLST) and determined their phylogeny using a whole-genome MLST (wgMLST) analysis. Our in silico MLST analysis identified six different sequence types (STs) (ST8, ST676, ST810, ST811, ST34, and ST768), with both of the clinical and four of the oyster strains being identified as belonging to ST8. Using wgMLST, we showed that the ST8 strains from clinical and oyster samples were nearly indistinguishable and belonged to the same outbreak, confirming that local oysters were the source of the infections. The remaining oyster strains were genetically diverse, differing in >3,000 loci from the Maryland ST8 strains. eBURST analysis comparing these strains with strains of other STs available at the V. parahaemolyticus MLST website showed that the Maryland ST8 strains belonged to a clonal complex endemic to Asia. This indicates that the ST8 isolates from clinical and oyster sources were likely not endemic to Maryland. Finally, this study demonstrates the utility of whole-genome sequencing (WGS) and associated analyses for source-tracking investigations. IMPORTANCE Vibrio parahaemolyticus is an important foodborne pathogen and the leading cause of bacterial infections in the United States associated with the consumption of seafood. In the summer of 2010, Vibrio parahaemolyticus caused an outbreak in Maryland linked to oyster consumption. Strains isolated from stool and oyster samples were indistinguishable by pulsed-field gel electrophoresis (PFGE). The oysters also contained other potentially pathogenic V. parahaemolyticus strains with different PFGE patterns. Since their identity, genetic makeup, relatedness, and potential pathogenicity were unknown, their genomes were determined by using next-generation sequencing. Whole-genome sequencing (WGS) analysis by whole-genome multilocus sequence typing (wgMLST) allowed (i) identification of clinical and oyster strains with matching PFGE profiles as belonging to ST8, (ii) determination of oyster strain diversity, and (iii) identification of the clinical strains as belonging to a clonal complex (CC) described only in Asia. Finally, WGS and associated analyses demonstrated their utility for trace-back investigations. PMID:26994080

A Nonautochthonous U.S. Strain of Vibrio parahaemolyticus Isolated from Chesapeake Bay Oysters Caused the Outbreak in Maryland in 2010.

PubMed

Haendiges, Julie; Jones, Jessica; Myers, Robert A; Mitchell, Clifford S; Butler, Erin; Toro, Magaly; Gonzalez-Escalona, Narjol

2016-06-01

In the summer of 2010, Vibrio parahaemolyticus caused an outbreak in Maryland linked to the consumption of oysters. Strains isolated from both stool and oyster samples were indistinguishable by pulsed-field gel electrophoresis (PFGE). However, the oysters contained other potentially pathogenic V. parahaemolyticus strains exhibiting different PFGE patterns. In order to assess the identity, genetic makeup, relatedness, and potential pathogenicity of the V. parahaemolyticus strains, we sequenced 11 such strains (2 clinical strains and 9 oyster strains). We analyzed these genomes by in silico multilocus sequence typing (MLST) and determined their phylogeny using a whole-genome MLST (wgMLST) analysis. Our in silico MLST analysis identified six different sequence types (STs) (ST8, ST676, ST810, ST811, ST34, and ST768), with both of the clinical and four of the oyster strains being identified as belonging to ST8. Using wgMLST, we showed that the ST8 strains from clinical and oyster samples were nearly indistinguishable and belonged to the same outbreak, confirming that local oysters were the source of the infections. The remaining oyster strains were genetically diverse, differing in >3,000 loci from the Maryland ST8 strains. eBURST analysis comparing these strains with strains of other STs available at the V. parahaemolyticus MLST website showed that the Maryland ST8 strains belonged to a clonal complex endemic to Asia. This indicates that the ST8 isolates from clinical and oyster sources were likely not endemic to Maryland. Finally, this study demonstrates the utility of whole-genome sequencing (WGS) and associated analyses for source-tracking investigations. Vibrio parahaemolyticus is an important foodborne pathogen and the leading cause of bacterial infections in the United States associated with the consumption of seafood. In the summer of 2010, Vibrio parahaemolyticus caused an outbreak in Maryland linked to oyster consumption. Strains isolated from stool and oyster samples were indistinguishable by pulsed-field gel electrophoresis (PFGE). The oysters also contained other potentially pathogenic V. parahaemolyticus strains with different PFGE patterns. Since their identity, genetic makeup, relatedness, and potential pathogenicity were unknown, their genomes were determined by using next-generation sequencing. Whole-genome sequencing (WGS) analysis by whole-genome multilocus sequence typing (wgMLST) allowed (i) identification of clinical and oyster strains with matching PFGE profiles as belonging to ST8, (ii) determination of oyster strain diversity, and (iii) identification of the clinical strains as belonging to a clonal complex (CC) described only in Asia. Finally, WGS and associated analyses demonstrated their utility for trace-back investigations. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Analysis of the genome-wide variations among multiple strains of the plant pathogenic bacterium Xylella fastidiosa

PubMed Central

Doddapaneni, Harshavardhan; Yao, Jiqiang; Lin, Hong; Walker, M Andrew; Civerolo, Edwin L

2006-01-01

Background The Gram-negative, xylem-limited phytopathogenic bacterium Xylella fastidiosa is responsible for causing economically important diseases in grapevine, citrus and many other plant species. Despite its economic impact, relatively little is known about the genomic variations among strains isolated from different hosts and their influence on the population genetics of this pathogen. With the availability of genome sequence information for four strains, it is now possible to perform genome-wide analyses to identify and categorize such DNA variations and to understand their influence on strain functional divergence. Results There are 1,579 genes and 194 non-coding homologous sequences present in the genomes of all four strains, representing a 76. 2% conservation of the sequenced genome. About 60% of the X. fastidiosa unique sequences exist as tandem gene clusters of 6 or more genes. Multiple alignments identified 12,754 SNPs and 14,449 INDELs in the 1528 common genes and 20,779 SNPs and 10,075 INDELs in the 194 non-coding sequences. The average SNP frequency was 1.08 × 10-2 per base pair of DNA and the average INDEL frequency was 2.06 × 10-2 per base pair of DNA. On an average, 60.33% of the SNPs were synonymous type while 39.67% were non-synonymous type. The mutation frequency, primarily in the form of external INDELs was the main type of sequence variation. The relative similarity between the strains was discussed according to the INDEL and SNP differences. The number of genes unique to each strain were 60 (9a5c), 54 (Dixon), 83 (Ann1) and 9 (Temecula-1). A sub-set of the strain specific genes showed significant differences in terms of their codon usage and GC composition from the native genes suggesting their xenologous origin. Tandem repeat analysis of the genomic sequences of the four strains identified associations of repeat sequences with hypothetical and phage related functions. Conclusion INDELs and strain specific genes have been identified as the main source of variations among strains, with individual strains showing different rates of genome evolution. Based on these genome comparisons, it appears that the Pierce's disease strain Temecula-1 genome represents the ancestral genome of the X. fastidiosa. Results of this analysis are publicly available in the form of a web database. PMID:16948851

Genome sequence of the pathogenic Herbaspirillum seropedicae strain Os45, isolated from rice roots.

PubMed

Zhu, Bo; Ye, Shuting; Chang, Siping; Chen, Mingyue; Sun, Li; An, Qianli

2012-12-01

Most Herbaspirillum seropedicae strains are beneficial to plants. In contrast, H. seropedicae strain Os45, isolated from rice roots, is pathogenic. The draft genome sequence of strain Os45 presented here allows an in-depth comparative genome analysis to understand the subtle mechanisms of beneficial and pathogenic Herbaspirillum-plant interactions.

Genome Sequence of the Pathogenic Herbaspirillum seropedicae Strain Os45, Isolated from Rice Roots

PubMed Central

Zhu, Bo; Ye, Shuting; Chang, Siping; Chen, Mingyue; Sun, Li

2012-01-01

Most Herbaspirillum seropedicae strains are beneficial to plants. In contrast, H. seropedicae strain Os45, isolated from rice roots, is pathogenic. The draft genome sequence of strain Os45 presented here allows an in-depth comparative genome analysis to understand the subtle mechanisms of beneficial and pathogenic Herbaspirillum-plant interactions. PMID:23209242

Complete Deletion of the Fucose Operon in Haemophilus influenzae Is Associated with a Cluster in Multilocus Sequence Analysis-Based Phylogenetic Group II Related to Haemophilus haemolyticus: Implications for Identification and Typing

PubMed Central

de Gier, Camilla; Kirkham, Lea-Ann S.

2015-01-01

Nonhemolytic variants of Haemophilus haemolyticus are difficult to differentiate from Haemophilus influenzae despite a wide difference in pathogenic potential. A previous investigation characterized a challenging set of 60 clinical strains using multiple PCRs for marker genes and described strains that could not be unequivocally identified as either species. We have analyzed the same set of strains by multilocus sequence analysis (MLSA) and near-full-length 16S rRNA gene sequencing. MLSA unambiguously allocated all study strains to either of the two species, while identification by 16S rRNA sequence was inconclusive for three strains. Notably, the two methods yielded conflicting identifications for two strains. Most of the “fuzzy species” strains were identified as H. influenzae that had undergone complete deletion of the fucose operon. Such strains, which are untypeable by the H. influenzae multilocus sequence type (MLST) scheme, have sporadically been reported and predominantly belong to a single branch of H. influenzae MLSA phylogenetic group II. We also found evidence of interspecies recombination between H. influenzae and H. haemolyticus within the 16S rRNA genes. Establishing an accurate method for rapid and inexpensive identification of H. influenzae is important for disease surveillance and treatment. PMID:26378279

[Comparison of genotype characteristics between the circulating mumps virus strain in Beijing area and the vaccine strain].

PubMed

Chen, Meng; Zhang, Tie-gang; Chen, Li-juan; Wu, Jiang; Yang, Jie; Zhang, Wei

2009-11-01

To compare the genetic characteristics of mumps virus strain circulating in Beijing with vaccine strain and to preliminarily analysis the reasons of vaccine ineffectiveness. The following methods were used: Isolation and identification of the mumps virus which had been circulating in Beijing, immunization history analysis, SH gene sequence analysis and comparison genotype homology with reference strains and analysis of the key amino acid sites of HN variation. In 38 mumps cases that virus had been isolated from, another seven cases were IgM negative. In 2007 and 2008, the positive rates on virus isolation, RT-PCR and IgM-decreased significantly, while the cases with immunization history had an increase. Cases without histories of vaccination had both higher positive rates on virus isolation and IgM. Thirty-eight strains belonged to F genotype virus, but vaccine strain was A genotype. The circulating viruses showed 5.6% sequence divergence on SH gene nucleotide and 16.0% - 18.1% from vaccine strain. Conservative hydrophobic amino acids on SH protein of some Beijing strains had changed. For example, there were 6 strains, from No.8: L-->F. The circulating viruses showed 2.3% sequence divergence on HN protein amino acid sequences and 4.2% - 5.3% from vaccine strain. Amino acids sites, which deciding the ability of cross-neutralization of the Beijing strains and vaccine strains were different. At the 354 and 356 sites, all the Beijing strains were different from the vaccine strains. The N-glycosylation sites on HN of Beijing strains were also different from those on vaccine strains. Locations 464 - 466 appeared to be NCS on Beijing strain, but locations 464 - 466 were NCR on the vaccine strains. Another 18 unknown function amino acids sites of all Beijing strains were different from those on vaccine strains. In recent years, genotype F became the main genotype of circulating strains in Beijing without genotype variation, but larger difference was found between them. There was a big difference between SH and HN protein of Beijing strains and vaccine strain, which might explain the ineffectiveness of the vaccine.

Enterobacter muelleri sp. nov., isolated from the rhizosphere of Zea mays.

PubMed

Kämpfer, Peter; McInroy, John A; Glaeser, Stefanie P

2015-11-01

A beige-pigmented, oxidase-negative bacterial strain (JM-458T), isolated from a rhizosphere sample, was studied using a polyphasic taxonomic approach. Cells of the isolate were rod-shaped and stained Gram-negative. A comparison of the 16S rRNA gene sequence of strain JM-458T with sequences of the type strains of closely related species of the genus Enterobacter showed that it shared highest sequence similarity with Enterobacter mori (98.7 %), Enterobacter hormaechei (98.3 %), Enterobacter cloacae subsp. dissolvens, Enterobacter ludwigii and Enterobacter asburiae (all 98.2 %). 16S rRNA gene sequence similarities to all other Enterobacter species were below 98 %. Multilocus sequence analysis based on concatenated partial rpoB, gyrB, infB and atpD gene sequences showed a clear distinction of strain JM-458T from its closest related type strains. The fatty acid profile of the strain consisted of C16 : 0, C17 : 0 cyclo, iso-C15 : 0 2-OH/C16 : 1ω7c and C18 : 1ω7c as major components. DNA-DNA hybridizations between strain JM-458T and the type strains of E. mori, E. hormaechei and E. ludwigii resulted in relatedness values of 29 % (reciprocal 25 %), 24 % (reciprocal 43 %) and 16 % (reciprocal 17 %), respectively. DNA-DNA hybridization results together with multilocus sequence analysis results and differential biochemical and chemotaxonomic properties showed that strain JM-458T represents a novel species of the genus Enterobacter, for which the name Enterobacter muelleri sp. nov. is proposed. The type strain is JM-458T ( = DSM 29346T = CIP 110826T = LMG 28480T = CCM 8546T).

Organization of nif gene cluster in Frankia sp. EuIK1 strain, a symbiont of Elaeagnus umbellata.

PubMed

Oh, Chang Jae; Kim, Ho Bang; Kim, Jitae; Kim, Won Jin; Lee, Hyoungseok; An, Chung Sun

2012-01-01

The nucleotide sequence of a 20.5-kb genomic region harboring nif genes was determined and analyzed. The fragment was obtained from Frankia sp. EuIK1 strain, an indigenous symbiont of Elaeagnus umbellata. A total of 20 ORFs including 12 nif genes were identified and subjected to comparative analysis with the genome sequences of 3 Frankia strains representing diverse host plant specificities. The nucleotide and deduced amino acid sequences showed highest levels of identity with orthologous genes from an Elaeagnus-infecting strain. The gene organization patterns around the nif gene clusters were well conserved among all 4 Frankia strains. However, characteristic features appeared in the location of the nifV gene for each Frankia strain, depending on the type of host plant. Sequence analysis was performed to determine the transcription units and suggested that there could be an independent operon starting from the nifW gene in the EuIK strain. Considering the organization patterns and their total extensions on the genome, we propose that the nif gene clusters remained stable despite genetic variations occurring in the Frankia genomes.

Phylogenetic relationship of Ornithobacterium rhinotracheale strains.

PubMed

DE Oca-Jimenez, Roberto Montes; Vega-Sanchez, Vicente; Morales-Erasto, Vladimir; Salgado-Miranda, Celene; Blackall, Patrick J; Soriano-Vargas, Edgardo

2018-04-10

The bacterium Ornithobacterium rhinotracheale is associated with respiratory disease in wild birds and poultry. In this study, the phylogenetic analysis of nine reference strains of O. rhinotracheale belonging to serovars A to I, and eight Mexican isolates belonging to serovar A, was performed. The analysis was extended to include available sequences from another 23 strains available in the public domain. The analysis showed that the 40 sequences formed six clusters, I to VI. All eight Mexican field isolates were placed in cluster I. One of the reference strains appears to present genetic diversity not previously recognized and was placed in a new genetic cluster. In conclusion, the phylogenetic analysis of O. rhinotracheale strains, based on the 16S rRNA gene, is a suitable tool for epidemiologic studies.

Geographic isolates of Lymantria dispar multiple nucleopolyhedrovirus: Genome sequence analysis and pathogenicity against European and Asian gypsy moth strains

USDA-ARS?s Scientific Manuscript database

Geographic isolates of Lymantria dispar multiple nucleopolyhedrovirus: Genome sequence analysis and pathogenicity against European and Asian gypsy moth strains. To evaluate the genetic diversity of Lymantria dispar nucleopolyhedrovirus (LdMNPV) at the genomic level, the genomes of three isolates of...

First Report of a Fatal Case Associated with EV-D68 Infection in Hong Kong and Emergence of an Interclade Recombinant in China Revealed by Genome Analysis.

PubMed

Yip, Cyril C Y; Lo, Janice Y C; Sridhar, Siddharth; Lung, David C; Luk, Shik; Chan, Kwok-Hung; Chan, Jasper F W; Cheng, Vincent C C; Woo, Patrick C Y; Yuen, Kwok-Yung; Lau, Susanna K P

2017-05-16

A fatal case associated with enterovirus D68 (EV-D68) infection affecting a 10-year-old boy was reported in Hong Kong in 2014. To examine if a new strain has emerged in Hong Kong, we sequenced the partial genome of the EV-D68 strain identified from the fatal case and the complete VP1, and partial 5'UTR and 2C sequences of nine additional EV-D68 strains isolated from patients in Hong Kong. Sequence analysis indicated that a cluster of strains including the previously recognized A2 strains should belong to a separate clade, clade D, which is further divided into subclades D1 and D2. Among the 10 EV-D68 strains, 7 (including the fatal case) belonged to the previously described, newly emerged subclade B3, 2 belonged to subclade B1, and 1 belonged to subclade D1. Three EV-D68 strains, each from subclades B1, B3, and D1, were selected for complete genome sequencing and recombination analysis. While no evidence of recombination was noted among local strains, interclade recombination was identified in subclade D2 strains detected in mainland China in 2008 with VP2 acquired from clade A. This study supports the reclassification of subclade A2 into clade D1, and demonstrates interclade recombination between clades A and D2 in EV-D68 strains from China.

Enterococcus Xinjiangensis sp. nov., Isolated from Yogurt of Xinjiang, China.

PubMed

Ren, Xiaopu; Li, Mingyang; Guo, Dongqi

2016-09-01

A Gram-strain-positive bacterial strain 48(T) was isolated from traditional yogurt in Xinjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, polymerase α subunit (rpoA) gene sequence analysis, determination of DNA G+C content, DNA-DNA hybridization with the type strain of Enterococcus ratti and analysis of phenotypic features. Strain 48(T) accounted for 96.1, 95.8, 95.8, and 95.7 % with Enterococcus faecium CGMCC 1.2136(T), Enterococcus hirae ATCC 9790(T), Enterococcus durans CECT 411(T), and E. ratti ATCC 700914(T) in the 16S rRNA gene sequence similarities, respectively. The sequence of rpoA gene showed similarities of 99.0, 96.0, 96.0, and 96 % with that of E. faecium ATCC 19434(T), Enterococcus villorum LMG12287, E. hirae ATCC 9790(T), and E. durans ATCC 19432(T), respectively. Based upon of polyphasic characterization data obtained in the study, a novel species, Enterococcus xinjiangensis sp. nov., was proposed and the type strain was 48(T)(=CCTCC AB 2014041(T) = JCM 30200(T)).

Bioinformatics Analysis of the Complete Genome Sequence of the Mango Tree Pathogen Pseudomonas syringae pv. syringae UMAF0158 Reveals Traits Relevant to Virulence and Epiphytic Lifestyle

PubMed Central

Arrebola, Eva; Carrión, Víctor J.; Gutiérrez-Barranquero, José Antonio; Pérez-García, Alejandro; Ramos, Cayo; Cazorla, Francisco M.; de Vicente, Antonio

2015-01-01

The genome sequence of more than 100 Pseudomonas syringae strains has been sequenced to date; however only few of them have been fully assembled, including P. syringae pv. syringae B728a. Different strains of pv. syringae cause different diseases and have different host specificities; so, UMAF0158 is a P. syringae pv. syringae strain related to B728a but instead of being a bean pathogen it causes apical necrosis of mango trees, and the two strains belong to different phylotypes of pv.syringae and clades of P. syringae. In this study we report the complete sequence and annotation of P. syringae pv. syringae UMAF0158 chromosome and plasmid pPSS158. A comparative analysis with the available sequenced genomes of other 25 P. syringae strains, both closed (the reference genomes DC3000, 1448A and B728a) and draft genomes was performed. The 5.8 Mb UMAF0158 chromosome has 59.3% GC content and comprises 5017 predicted protein-coding genes. Bioinformatics analysis revealed the presence of genes potentially implicated in the virulence and epiphytic fitness of this strain. We identified several genetic features, which are absent in B728a, that may explain the ability of UMAF0158 to colonize and infect mango trees: the mangotoxin biosynthetic operon mbo, a gene cluster for cellulose production, two different type III and two type VI secretion systems, and a particular T3SS effector repertoire. A mutant strain defective in the rhizobial-like T3SS Rhc showed no differences compared to wild-type during its interaction with host and non-host plants and worms. Here we report the first complete sequence of the chromosome of a pv. syringae strain pathogenic to a woody plant host. Our data also shed light on the genetic factors that possibly determine the pathogenic and epiphytic lifestyle of UMAF0158. This work provides the basis for further analysis on specific mechanisms that enable this strain to infect woody plants and for the functional analysis of host specificity in the P. syringae complex. PMID:26313942

Genotyping of Chromobacterium violaceum isolates by recA PCR-RFLP analysis.

PubMed

Scholz, Holger Christian; Witte, Angela; Tomaso, Herbert; Al Dahouk, Sascha; Neubauer, Heinrich

2005-03-15

Intraspecies variation of Chromobacterium violaceum was examined by comparative sequence - and by restriction fragment length polymorphism analysis of the recombinase A gene (recA-PCR-RFLP). Primers deduced from the known recA gene sequence of the type strain C. violaceum ATCC 12472(T) allowed the specific amplification of a 1040bp recA fragment from each of the 13 C. violaceum strains investigated, whereas other closely related organisms tested negative. HindII-PstI-recA RFLP analysis generated from 13 representative C. violaceum strains enabled us to identify at least three different genospecies. In conclusion, analysis of the recA gene provides a rapid and robust nucleotide sequence-based approach to specifically identify and classify C. violaceum on genospecies level.

Genome sequencing of ovine isolates of Mycobacterium avium subspecies paratuberculosis offers insights into host association

PubMed Central

2012-01-01

Background The genome of Mycobacterium avium subspecies paratuberculosis (MAP) is remarkably homogeneous among the genomes of bovine, human and wildlife isolates. However, previous work in our laboratories with the bovine K-10 strain has revealed substantial differences compared to sheep isolates. To systematically characterize all genomic differences that may be associated with the specific hosts, we sequenced the genomes of three U.S. sheep isolates and also obtained an optical map. Results Our analysis of one of the isolates, MAP S397, revealed a genome 4.8 Mb in size with 4,700 open reading frames (ORFs). Comparative analysis of the MAP S397 isolate showed it acquired approximately 10 large sequence regions that are shared with the human M. avium subsp. hominissuis strain 104 and lost 2 large regions that are present in the bovine strain. In addition, optical mapping defined the presence of 7 large inversions between the bovine and ovine genomes (~ 2.36 Mb). Whole-genome sequencing of 2 additional sheep strains of MAP (JTC1074 and JTC7565) further confirmed genomic homogeneity of the sheep isolates despite the presence of polymorphisms on the nucleotide level. Conclusions Comparative sequence analysis employed here provided a better understanding of the host association, evolution of members of the M. avium complex and could help in deciphering the phenotypic differences observed among sheep and cattle strains of MAP. A similar approach based on whole-genome sequencing combined with optical mapping could be employed to examine closely related pathogens. We propose an evolutionary scenario for M. avium complex strains based on these genome sequences. PMID:22409516

Molecular complexity of successive bacterial epidemics deconvoluted by comparative pathogenomics.

PubMed

Beres, Stephen B; Carroll, Ronan K; Shea, Patrick R; Sitkiewicz, Izabela; Martinez-Gutierrez, Juan Carlos; Low, Donald E; McGeer, Allison; Willey, Barbara M; Green, Karen; Tyrrell, Gregory J; Goldman, Thomas D; Feldgarden, Michael; Birren, Bruce W; Fofanov, Yuriy; Boos, John; Wheaton, William D; Honisch, Christiane; Musser, James M

2010-03-02

Understanding the fine-structure molecular architecture of bacterial epidemics has been a long-sought goal of infectious disease research. We used short-read-length DNA sequencing coupled with mass spectroscopy analysis of SNPs to study the molecular pathogenomics of three successive epidemics of invasive infections involving 344 serotype M3 group A Streptococcus in Ontario, Canada. Sequencing the genome of 95 strains from the three epidemics, coupled with analysis of 280 biallelic SNPs in all 344 strains, revealed an unexpectedly complex population structure composed of a dynamic mixture of distinct clonally related complexes. We discovered that each epidemic is dominated by micro- and macrobursts of multiple emergent clones, some with distinct strain genotype-patient phenotype relationships. On average, strains were differentiated from one another by only 49 SNPs and 11 insertion-deletion events (indels) in the core genome. Ten percent of SNPs are strain specific; that is, each strain has a unique genome sequence. We identified nonrandom temporal-spatial patterns of strain distribution within and between the epidemic peaks. The extensive full-genome data permitted us to identify genes with significantly increased rates of nonsynonymous (amino acid-altering) nucleotide polymorphisms, thereby providing clues about selective forces operative in the host. Comparative expression microarray analysis revealed that closely related strains differentiated by seemingly modest genetic changes can have significantly divergent transcriptomes. We conclude that enhanced understanding of bacterial epidemics requires a deep-sequencing, geographically centric, comparative pathogenomics strategy.

Characterization of strains of Weissella fabalis sp. nov. and Fructobacillus tropaeoli from spontaneous cocoa bean fermentations.

PubMed

Snauwaert, Isabel; Papalexandratou, Zoi; De Vuyst, Luc; Vandamme, Peter

2013-05-01

Six facultatively anaerobic, non-motile lactic acid bacteria were isolated from spontaneous cocoa bean fermentations carried out in Brazil, Ecuador and Malaysia. Phylogenetic analysis revealed that one of these strains, designated M75(T), isolated from a Brazilian cocoa bean fermentation, had the highest 16S rRNA gene sequence similarity towards Weissella fabaria LMG 24289(T) (97.7%), W. ghanensis LMG 24286(T) (93.3%) and W. beninensis LMG 25373(T) (93.4%). The remaining lactic acid bacteria isolates, represented by strain M622, showed the highest 16S rRNA gene sequence similarity towards the type strain of Fructobacillus tropaeoli (99.9%), a recently described species isolated from a flower in South Africa. pheS gene sequence analysis indicated that the former strain represented a novel species, whereas pheS, rpoA and atpA gene sequence analysis indicated that the remaining five strains belonged to F. tropaeoli; these results were confirmed by DNA-DNA hybridization experiments towards their respective nearest phylogenetic neighbours. Additionally, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry proved successful for the identification of species of the genera Weissella and Fructobacillus and for the recognition of the novel species. We propose to classify strain M75(T) ( = LMG 26217(T)  = CCUG 61472(T)) as the type strain of the novel species Weissella fabalis sp. nov.

[Isolation and phylogenetic analysis of one actinomycete strain YIM 90022 exhibiting anticancer activity].

PubMed

Chen, Yi-Guang; Li, Wen-Jun; Cui, Xiao-Long; Jiang, Cheng-Lin; Xu, Li-Hua

2006-10-01

One facultative alkaliphilic actinomycete strain YIM 90022 was isolated from hypersaline alkaline soil in Qinghai province, China. An almost-complete 16S rRNA gene sequence (1500 bp) for strain YIM 90022 was obtained. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain YIM 90022 was closely related to four members of the genus Nocardiopsis with 16S rRNA gene sequence similarity values of 98.8% (N. exhalans DSM 44407T), 98.5% (N. prasina DSM 43845T), 98.4% (N. metallicus DSM 44598T) and 97.8% (N. listeri DSM 40297T), but represented a distinct phylogenetic lineage. Repetitive element sequence-based PCR (rep-PCR) genomic fingerprinting was evaluated on strain YIM 90022 and its closest relatives to investigate their genetic relatedness. The analysis of the rep-PCR genomic fingerprints showed that strain YIM 90022 was distinguishable from its closest relatives. The polyphasic taxonomic data presented in this study, including its morphology, physiological and biochemical characteristics, chemotaxonomy, 16S rRNA gene sequence-based phylogenetic analysis and rep-PCR genomic fingerprinting, supported the view that strain YIM 90022 represented a potential new species of the genus Nocardiopsis. The fermentation broth of strain YIM 90022 strongly inhibited growth of cell series of gastric cancer, lung cancer, mammary cancer, melanoma cancer, renal cancer and uterus cancer. Strain YIM 90022 grew well on most tested media, producing exuberant vegetative hyphae and aerial hyphae. The vegetative hyphae are long and fragmented. Light yellow to deep brown diffusible pigments were produced on ISP 2, ISP 3 and ISP 6. Growth of the strain occurred in the pH range 6.0-12.0, with optimal pH8.5. The NaCl tolerate range was 0-15% (W/V). Cell walls contain meso-diaminopimelic acid and have no diagnostic sugars. Polar lipids are phosphatidylcholine, phosphatidylglycerol, diphosphatidylglycerol, phosphatidylmethylethanolamine. Major menaquinones are MK-10 (H4, H6). The DNA G + C content is 71.5 mol %.

Comparative Sequence Analysis of the Plasmid-Encoded Regulator of Enteropathogenic Escherichia coli Strains

PubMed Central

Okeke, Iruka N.; Borneman, Jade A.; Shin, Sooan; Mellies, Jay L.; Quinn, Laura E.; Kaper, James B.

2001-01-01

Enteropathogenic Escherichia coli (EPEC) strains that carry the EPEC adherence factor (EAF) plasmid were screened for the presence of different EAF sequences, including those of the plasmid-encoded regulator (per). Considerable variation in gene content of EAF plasmids from different strains was seen. However, bfpA, the gene encoding the structural subunit for the bundle-forming pilus, bundlin, and per genes were found in 96.8% of strains. Sequence analysis of the per operon and its promoter region from 15 representative strains revealed that it is highly conserved. Most of the variation occurs in the 5′ two-thirds of the perA gene. In contrast, the C-terminal portion of the predicted PerA protein that contains the DNA-binding helix-turn-helix motif is 100% conserved in all strains that possess a full-length gene. In a minority of strains including the O119:H2 and canine isolates and in a subset of O128:H2 and O142:H6 strains, frameshift mutations in perA leading to premature truncation and consequent inactivation of the gene were identified. Cloned perA, -B, and -C genes from these strains, unlike those from strains with a functional operon, failed to activate the LEE1 operon and bfpA transcriptional fusions or to complement a per mutant in reference strain E2348/69. Furthermore, O119, O128, and canine strains that carry inactive per operons were deficient in virulence protein expression. The context in which the perABC operon occurs on the EAF plasmid varies. The sequence upstream of the per promoter region in EPEC reference strains E2348/69 and B171-8 was present in strains belonging to most serogroups. In a subset of O119:H2, O128:H2, and O142:H6 strains and in the canine isolate, this sequence was replaced by an IS1294-homologous sequence. PMID:11500429

[Development of Staphylococcus Haemolyticus multilocus sequencing scheme and its use for molecular-epidemiologic analysis of strains isolated in hospitals in Russian federation in 2009-2010].

PubMed

Voronina, O L; Kunda, M S; Dmitrenko, O A; Lunin, V G; Gintsburg, A L

2011-01-01

Development of Staphylococcus haemolyticus strain typing method based on multilocus sequencing for resolving problems of molecular epidemiology. 102 strains of coagulase negative staphylococci (CNS) isolated in hospitals of various specialization in N. Novgorod and Moscow were studied. Species identification of strain was performed by using tuf gene fragment sequencing, S. haemolyticus strain differentiation--by MLST results. eBURST approach was used for cluster analysis of MLST data; structural changes in tagatose-6-phosphate kinase were studied by using InterProScan platform and SWISS-MODEL site programs; MLST scheme gene allele variability analysis was performed by using MEGA4.0 program package. In the 102 strains sampled CNS was detected in 28 strains of the S. haemolyticus species. The MLST scheme developed for the first time for S. haemolyticus including mvaK, rphE, tphK, gtr, arcC, triA, aroE genes allowed the differentiation of the sampled strains by 11 genotypes. Strains with ST 3, 8, 6, 1, 4, 5 and 11 differed by highest epidemiologic significance. Cluster and phylogenetic analysis of the data obtained showed a high adaptive ability of the nosocomial S. haemolyticus strains. Multiresistance to antibacterial preparations was detected in the analyzed strains. The MLST method developed was effective in the differentiation of S. haemolyticus strains that circulate in hospitals and threaten both neonates and hospitalized adult patients.

Comparative genome analysis of the candidate functional starter culture strains Lactobacillus fermentum 222 and Lactobacillus plantarum 80 for controlled cocoa bean fermentation processes.

PubMed

Illeghems, Koen; De Vuyst, Luc; Weckx, Stefan

2015-10-12

Lactobacillus fermentum 222 and Lactobacillus plantarum 80, isolates from a spontaneous Ghanaian cocoa bean fermentation process, proved to be interesting functional starter culture strains for cocoa bean fermentations. Lactobacillus fermentum 222 is a thermotolerant strain, able to dominate the fermentation process, thereby converting citrate and producing mannitol. Lactobacillus plantarum 80 is an acid-tolerant and facultative heterofermentative strain that is competitive during cocoa bean fermentation processes. In this study, whole-genome sequencing and comparative genome analysis was used to investigate the mechanisms of these strains to dominate the cocoa bean fermentation process. Through functional annotation and analysis of the high-coverage contigs obtained through 454 pyrosequencing, plantaricin production was predicted for L. plantarum 80. For L. fermentum 222, genes encoding a complete arginine deiminase pathway were attributed. Further, in-depth functional analysis revealed the capacities of these strains associated with carbohydrate and amino acid metabolism, such as the ability to use alternative external electron acceptors, the presence of an extended pyruvate metabolism, and the occurrence of several amino acid conversion pathways. A comparative genome sequence analysis using publicly available genome sequences of strains of the species L. plantarum and L. fermentum revealed unique features of both strains studied. Indeed, L. fermentum 222 possessed genes encoding additional citrate transporters and enzymes involved in amino acid conversions, whereas L. plantarum 80 is the only member of this species that harboured a gene cluster involved in uptake and consumption of fructose and/or sorbose. In-depth genome sequence analysis of the candidate functional starter culture strains L. fermentum 222 and L. plantarum 80 revealed their metabolic capacities, niche adaptations and functionalities that enable them to dominate the cocoa bean fermentation process. Further, these results offered insights into the cocoa bean fermentation ecosystem as a whole and will facilitate the selection of appropriate starter culture strains for controlled cocoa bean fermentation processes.

Draft genome sequence of Thermoanaerobacterium sp. strain PSU-2 isolated from thermophilic hydrogen producing reactor.

PubMed

O-Thong, Sompong; Khongkliang, Peerawat; Mamimin, Chonticha; Singkhala, Apinya; Prasertsan, Poonsuk; Birkeland, Nils-Kåre

2017-06-01

Thermoanaerobacterium sp. strain PSU-2 was isolated from thermophilic hydrogen producing reactor and subjected to draft genome sequencing on 454 pyrosequencing and annotated on RAST. The draft genome sequence of strain PSU-2 contains 2,552,497 bases with an estimated G + C content of 35.2%, 2555 CDS, 8 rRNAs and 57 tRNAs. The strain had a number of genes responsible for carbohydrates metabolic, amino acids and derivatives, and protein metabolism of 17.7%, 14.39% and 9.81%, respectively. Strain PSU-2 also had gene responsible for hydrogen biosynthesis as well as the genes related to Ni-Fe hydrogenase. Comparative genomic analysis indicates strain PSU-2 shares about 94% genome sequence similarity with Thermoanaerobacterium xylanolyticum LX-11. The nucleotide sequence of this draft genome was deposited into DDBJ/ENA/GenBank under the accession MSQD00000000.

Complete Genome Sequence and Comparative Genomics of a Streptococcus pyogenes emm3 Strain M3-b isolated from a Japanese Patient with Streptococcal Toxic Shock Syndrome.

PubMed

Ogura, Kohei; Watanabe, Shinya; Kirikae, Teruo; Miyoshi-Akiyama, Tohru

2017-01-01

Epidemiologic typing of Streptococcus pyogenes (GAS) is frequently based on the genotype of the emm gene, which encodes M/Emm protein. In this study, the complete genome sequence of GAS emm3 strain M3-b, isolated from a patient with streptococcal toxic shock syndrome (STSS), was determined. This strain exhibited 99% identity with other complete genome sequences of emm3 strains MGAS315, SSI-1, and STAB902. The complete genomes of five additional strains isolated from Japanese patients with and without STSS were also sequences. Maximum-likelihood phylogenetic analysis showed that strains M3-b, M3-e, and SSI-1, all which were isolated from STSS patients, were relatively close.

Genetic diversity and recombination of enterovirus G strains in Japanese pigs: High prevalence of strains carrying a papain-like cysteine protease sequence in the enterovirus G population.

PubMed

Tsuchiaka, Shinobu; Naoi, Yuki; Imai, Ryo; Masuda, Tsuneyuki; Ito, Mika; Akagami, Masataka; Ouchi, Yoshinao; Ishii, Kazuo; Sakaguchi, Shoichi; Omatsu, Tsutomu; Katayama, Yukie; Oba, Mami; Shirai, Junsuke; Satani, Yuki; Takashima, Yasuhiro; Taniguchi, Yuji; Takasu, Masaki; Madarame, Hiroo; Sunaga, Fujiko; Aoki, Hiroshi; Makino, Shinji; Mizutani, Tetsuya; Nagai, Makoto

2018-01-01

To study the genetic diversity of enterovirus G (EV-G) among Japanese pigs, metagenomics sequencing was performed on fecal samples from pigs with or without diarrhea, collected between 2014 and 2016. Fifty-nine EV-G sequences, which were >5,000 nucleotides long, were obtained. By complete VP1 sequence analysis, Japanese EV-G isolates were classified into G1 (17 strains), G2 (four strains), G3 (22 strains), G4 (two strains), G6 (two strains), G9 (six strains), G10 (five strains), and a new genotype (one strain). Remarkably, 16 G1 and one G2 strain identified in diarrheic (23.5%; four strains) or normal (76.5%; 13 strains) fecal samples possessed a papain-like cysteine protease (PL-CP) sequence, which was recently found in the USA and Belgium in the EV-G genome, at the 2C-3A junction site. This paper presents the first report of the high prevalence of viruses carrying PL-CP in the EV-G population. Furthermore, possible inter- and intragenotype recombination events were found among EV-G strains, including G1-PL-CP strains. Our findings may advance the understanding of the molecular epidemiology and genetic evolution of EV-Gs.

Taxonomic evaluation of putative Streptomyces scabiei strains held in the ARS (NRRL) Culture Collection using multi-locus sequence analysis

USDA-ARS?s Scientific Manuscript database

Multi-locus sequence analysis has been demonstrated to be a useful tool for identification of Streptomyces species and was previously applied to phylogenetically differentiate the type strains of species pathogenic on potatoes (Solanum tuberosum L.). The ARS Culture Collection (NRRL) contains 43 str...

Clonal Relatedness of Enterotoxigenic Escherichia coli (ETEC) Strains Expressing LT and CS17 Isolated from Children with Diarrhoea in La Paz, Bolivia

PubMed Central

Rodas, Claudia; Klena, John D.; Nicklasson, Matilda; Iniguez, Volga; Sjöling, Åsa

2011-01-01

Background Enterotoxigenic Escherichia coli (ETEC) is a major cause of traveller's and infantile diarrhoea in the developing world. ETEC produces two toxins, a heat-stable toxin (known as ST) and a heat-labile toxin (LT) and colonization factors that help the bacteria to attach to epithelial cells. Methodology/Principal Findings In this study, we characterized a subset of ETEC clinical isolates recovered from Bolivian children under 5 years of age using a combination of multilocus sequence typing (MLST) analysis, virulence typing, serotyping and antimicrobial resistance test patterns in order to determine the genetic background of ETEC strains circulating in Bolivia. We found that strains expressing the heat-labile (LT) enterotoxin and colonization factor CS17 were common and belonged to several MLST sequence types but mainly to sequence type-423 and sequence type-443 (Achtman scheme). To further study the LT/CS17 strains we analysed the nucleotide sequence of the CS17 operon and compared the structure to LT/CS17 ETEC isolates from Bangladesh. Sequence analysis confirmed that all sequence type-423 strains from Bolivia had a single nucleotide polymorphism; SNPbol in the CS17 operon that was also found in some other MLST sequence types from Bolivia but not in strains recovered from Bangladeshi children. The dominant ETEC clone in Bolivia (sequence type-423/SNPbol) was found to persist over multiple years and was associated with severe diarrhoea but these strains were variable with respect to antimicrobial resistance patterns. Conclusion/Significance The results showed that although the LT/CS17 phenotype is common among ETEC strains in Bolivia, multiple clones, as determined by unique MLST sequence types, populate this phenotype. Our data also appear to suggest that acquisition and loss of antimicrobial resistance in LT-expressing CS17 ETEC clones is more dynamic than acquisition or loss of virulence factors. PMID:22140423

Clonal relatedness of enterotoxigenic Escherichia coli (ETEC) strains expressing LT and CS17 isolated from children with diarrhoea in La Paz, Bolivia.

PubMed

Rodas, Claudia; Klena, John D; Nicklasson, Matilda; Iniguez, Volga; Sjöling, Asa

2011-01-01

Enterotoxigenic Escherichia coli (ETEC) is a major cause of traveller's and infantile diarrhoea in the developing world. ETEC produces two toxins, a heat-stable toxin (known as ST) and a heat-labile toxin (LT) and colonization factors that help the bacteria to attach to epithelial cells. In this study, we characterized a subset of ETEC clinical isolates recovered from Bolivian children under 5 years of age using a combination of multilocus sequence typing (MLST) analysis, virulence typing, serotyping and antimicrobial resistance test patterns in order to determine the genetic background of ETEC strains circulating in Bolivia. We found that strains expressing the heat-labile (LT) enterotoxin and colonization factor CS17 were common and belonged to several MLST sequence types but mainly to sequence type-423 and sequence type-443 (Achtman scheme). To further study the LT/CS17 strains we analysed the nucleotide sequence of the CS17 operon and compared the structure to LT/CS17 ETEC isolates from Bangladesh. Sequence analysis confirmed that all sequence type-423 strains from Bolivia had a single nucleotide polymorphism; SNP(bol) in the CS17 operon that was also found in some other MLST sequence types from Bolivia but not in strains recovered from Bangladeshi children. The dominant ETEC clone in Bolivia (sequence type-423/SNP(bol)) was found to persist over multiple years and was associated with severe diarrhoea but these strains were variable with respect to antimicrobial resistance patterns. The results showed that although the LT/CS17 phenotype is common among ETEC strains in Bolivia, multiple clones, as determined by unique MLST sequence types, populate this phenotype. Our data also appear to suggest that acquisition and loss of antimicrobial resistance in LT-expressing CS17 ETEC clones is more dynamic than acquisition or loss of virulence factors.

Phylogenomic Study of Burkholderia glathei-like Organisms, Proposal of 13 Novel Burkholderia Species and Emended Descriptions of Burkholderia sordidicola, Burkholderia zhejiangensis, and Burkholderia grimmiae

PubMed Central

Peeters, Charlotte; Meier-Kolthoff, Jan P.; Verheyde, Bart; De Brandt, Evie; Cooper, Vaughn S.; Vandamme, Peter

2016-01-01

Partial gyrB gene sequence analysis of 17 isolates from human and environmental sources revealed 13 clusters of strains and identified them as Burkholderia glathei clade (BGC) bacteria. The taxonomic status of these clusters was examined by whole-genome sequence analysis, determination of the G+C content, whole-cell fatty acid analysis and biochemical characterization. The whole-genome sequence-based phylogeny was assessed using the Genome Blast Distance Phylogeny (GBDP) method and an extended multilocus sequence analysis (MLSA) approach. The results demonstrated that these 17 BGC isolates represented 13 novel Burkholderia species that could be distinguished by both genotypic and phenotypic characteristics. BGC strains exhibited a broad metabolic versatility and developed beneficial, symbiotic, and pathogenic interactions with different hosts. Our data also confirmed that there is no phylogenetic subdivision in the genus Burkholderia that distinguishes beneficial from pathogenic strains. We therefore propose to formally classify the 13 novel BGC Burkholderia species as Burkholderia arvi sp. nov. (type strain LMG 29317T = CCUG 68412T), Burkholderia hypogeia sp. nov. (type strain LMG 29322T = CCUG 68407T), Burkholderia ptereochthonis sp. nov. (type strain LMG 29326T = CCUG 68403T), Burkholderia glebae sp. nov. (type strain LMG 29325T = CCUG 68404T), Burkholderia pedi sp. nov. (type strain LMG 29323T = CCUG 68406T), Burkholderia arationis sp. nov. (type strain LMG 29324T = CCUG 68405T), Burkholderia fortuita sp. nov. (type strain LMG 29320T = CCUG 68409T), Burkholderia temeraria sp. nov. (type strain LMG 29319T = CCUG 68410T), Burkholderia calidae sp. nov. (type strain LMG 29321T = CCUG 68408T), Burkholderia concitans sp. nov. (type strain LMG 29315T = CCUG 68414T), Burkholderia turbans sp. nov. (type strain LMG 29316T = CCUG 68413T), Burkholderia catudaia sp. nov. (type strain LMG 29318T = CCUG 68411T) and Burkholderia peredens sp. nov. (type strain LMG 29314T = CCUG 68415T). Furthermore, we present emended descriptions of the species Burkholderia sordidicola, Burkholderia zhejiangensis and Burkholderia grimmiae. The GenBank/EMBL/DDBJ accession numbers for the 16S rRNA and gyrB gene sequences determined in this study are LT158612-LT158624 and LT158625-LT158641, respectively. PMID:27375597

Phylogenetic analysis of several Thermus strains from Rehai of Tengchong, Yunnan, China.

PubMed

Lin, Lianbing; Zhang, Jie; Wei, Yunlin; Chen, Chaoyin; Peng, Qian

2005-10-01

Several Thermus strains were isolated from 10 hot springs of the Rehai geothermal area in Tengchong, Yunnan province. The diversity of Thermus strains was examined by sequencing the 16S rRNA genes and comparing their sequences. Phylogenetic analysis showed that the 16S rDNA sequences from the Rehai geothermal isolates form four branches in the phylogenetic tree and had greater than 95.9% similarity in the phylogroup. Secondary structure comparison also indicated that the 16S rRNA from the Rehai geothermal isolates have unique secondary structure characteristics in helix 6, helix 9, and helix 10 (reference to Escherichia coli). This research is the first attempt to reveal the diversity of Thermus strains that are distributed in the Rehai geothermal area.

Complete genome sequence analysis of a duck circovirus from Guangxi pockmark ducks.

PubMed

Xie, Liji; Xie, Zhixun; Zhao, Guangyuan; Liu, Jiabo; Pang, Yaoshan; Deng, Xianwen; Xie, Zhiqin; Fan, Qing

2012-12-01

We report here the complete genomic sequence of a novel duck circovirus (DuCV) strain, GX1104, isolated from Guangxi pockmark ducks in Guangxi, China. The whole nucleotide sequence had the highest homology (97.2%) with the sequence of strain TC/2002 (GenBank accession number AY394721.1) and had a low homology (76.8% to 78.6%) with the sequences of other strains isolated from China, Germany, and the United States. This report will help to understand the epidemiology and molecular characteristics of Guangxi pockmark duck circovirus in southern China.

Genome features of moderately halophilic polyhydroxyalkanoate-producing Yangia sp. CCB-MM3.

PubMed

Lau, Nyok-Sean; Sam, Ka-Kei; Amirul, Abdullah Al-Ashraf

2017-01-01

Yangia sp. CCB-MM3 was one of several halophilic bacteria isolated from soil sediment in the estuarine Matang Mangrove, Malaysia. So far, no member from the genus Yangia , a member of the Rhodobacteraceae family, has been reported sequenced. In the current study, we present the first complete genome sequence of Yangia sp. strain CCB-MM3. The genome includes two chromosomes and five plasmids with a total length of 5,522,061 bp and an average GC content of 65%. Since a different strain of Yangia sp. (ND199) was reported to produce a polyhydroxyalkanoate copolymer, the ability for this production was tested in vitro and confirmed for strain CCB-MM3. Analysis of its genome sequence confirmed presence of a pathway for production of propionyl-CoA and gene cluster for PHA production in the sequenced strain. The genome sequence described will be a useful resource for understanding the physiology and metabolic potential of Yangia as well as for comparative genomic analysis with other Rhodobacteraceae .

Genetic and phylogenetic analysis of a novel parvovirus isolated from chickens in Guangxi, China.

PubMed

Feng, Bin; Xie, Zhixun; Deng, Xianwen; Xie, Liji; Xie, Zhiqin; Huang, Li; Fan, Qin; Luo, Sisi; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Wang, Sheng; Wang, Leyi

2016-11-01

A previously unidentified chicken parvovirus (ChPV) strain, associated with runting-stunting syndrome (RSS), is now endemic among chickens in China. To explore the genetic diversity of ChPV strains, we determined the first complete genome sequence of a novel ChPV isolate (GX-CH-PV-7) identified in chickens in Guang Xi, China, and showed moderate genome sequence similarity to reference strains. Analysis showed that the viral genome sequence is 86.4 %-93.9 % identical to those of other ChPVs. Genetic and phylogenetic analyses showed that this newly emergent GX-CH-PV-7 is closely related to Gallus gallus enteric parvovirus isolate ChPV 798 from the USA, indicating that they may share a common ancestor. The complete DNA sequence is 4612 bp long with an A+T content of 56.66 %. We determined the first complete genome sequence of a previously unidentified ChPV strain to elucidate its origin and evolutionary status.

Phylogeny of the family Moraxellaceae by 16S rDNA sequence analysis, with special emphasis on differentiation of Moraxella species.

PubMed

Pettersson, B; Kodjo, A; Ronaghi, M; Uhlén, M; Tønjum, T

1998-01-01

Thirty-three strains previously classified into 11 species in the bacterial family Moraxellaceae were subjected to phylogenetic analysis based on 16S rRNA sequences. The family Moraxellaceae formed a distinct clade consisting of four phylogenetic groups as judged from branch lengths, bootstrap values and signature nucleotides. Group I contained the classical moraxellae and strains of the coccal moraxellae, previously known as Branhamella, with 16S rRNA similarity of > or = 95%. A further division of group I into five tentative clusters is discussed. Group II consisted of two strains representing Moraxella atlantae and Moraxella osloensis. These strains were only distantly related to each other (93.4%) and also to the other members of the Moraxellaceae (< or = 93%). Therefore, reasons for reclassification of these species into separate and new genera are discussed. Group III harboured strains of the genus Psychrobacter and strain 752/52 of [Moraxella] phenylpyruvica. This strain of [M.] phenylpyruvica formed an early branch from the group III line of descent. Interestingly, a distant relationship was found between Psychrobacter phenylpyruvicus strain ATCC 23333T (formerly classified as [M.] phenylpyruvica) and [M.] phenylpyruvica strain 752/52, exhibiting less than 96% nucleotide similarity between their 16S rRNA sequences. The establishment of a new genus for [M.] phenylpyruvica strain 752/52 is therefore suggested. Group IV contained only two strains of the genus Acinetobacter. Strategies for the development of diagnostic probes and distinctive sequences for 16S rRNA-based species-specific assays within group I are suggested. Although these findings add to the classificatory placements within the Moraxellaceae, analysis of a more comprehensive selection of strains is still needed to obtain a complete classification system within this family.

Comparative pathogenomics of Clostridium tetani.

PubMed

Cohen, Jonathan E; Wang, Rong; Shen, Rong-Fong; Wu, Wells W; Keller, James E

2017-01-01

Clostridium tetani and Clostridium botulinum produce two of the most potent neurotoxins known, tetanus neurotoxin and botulinum neurotoxin, respectively. Extensive biochemical and genetic investigation has been devoted to identifying and characterizing various C. botulinum strains. Less effort has been focused on studying C. tetani likely because recently sequenced strains of C. tetani show much less genetic diversity than C. botulinum strains and because widespread vaccination efforts have reduced the public health threat from tetanus. Our aim was to acquire genomic data on the U.S. vaccine strain of C. tetani to better understand its genetic relationship to previously published genomic data from European vaccine strains. We performed high throughput genomic sequence analysis on two wild-type and two vaccine C. tetani strains. Comparative genomic analysis was performed using these and previously published genomic data for seven other C. tetani strains. Our analysis focused on single nucleotide polymorphisms (SNP) and four distinct constituents of the mobile genome (mobilome): a hypervariable flagellar glycosylation island region, five conserved bacteriophage insertion regions, variations in three CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) systems, and a single plasmid. Intact type IA and IB CRISPR/Cas systems were within 10 of 11 strains. A type IIIA CRISPR/Cas system was present in two strains. Phage infection histories derived from CRISPR-Cas sequences indicate C. tetani encounters phages common among commensal gut bacteria and soil-borne organisms consistent with C. tetani distribution in nature. All vaccine strains form a clade distinct from currently sequenced wild type strains when considering variations in these mobile elements. SNP, flagellar glycosylation island, prophage content and CRISPR/Cas phylogenic histories provide tentative evidence suggesting vaccine and wild type strains share a common ancestor.

Azospirillum zeae sp. nov., a diazotrophic bacterium isolated from rhizosphere soil of Zea mays.

PubMed

Mehnaz, Samina; Weselowski, Brian; Lazarovits, George

2007-12-01

Two free-living nitrogen-fixing bacterial strains, N6 and N7(T), were isolated from corn rhizosphere. A polyphasic taxonomic approach, including morphological characterization, Biolog analysis, DNA-DNA hybridization, and 16S rRNA, cpn60 and nifH gene sequence analysis, was taken to analyse the two strains. 16S rRNA gene sequence analysis indicated that strains N6 and N7(T) both belonged to the genus Azospirillum and were closely related to Azospirillum oryzae (98.7 and 98.8 % similarity, respectively) and Azospirillum lipoferum (97.5 and 97.6 % similarity, respectively). DNA-DNA hybridization of strains N6 and N7(T) showed reassociation values of 48 and 37 %, respectively, with A. oryzae and 43 % with A. lipoferum. Sequences of the nifH and cpn60 genes of both strains showed 99 and approximately 95 % similarity, respectively, with those of A. oryzae. Chemotaxonomic characteristics (Q-10 as quinone system, 18 : 1omega7c as major fatty acid) and G+C content of the DNA (67.6 mol%) were also similar to those of members of the genus Azospirillum. Gene sequences and Biolog and fatty acid analysis showed that strains N6 and N7(T) differed from the closely related species A. lipoferum and A. oryzae. On the basis of these results, it is proposed that these nitrogen-fixing strains represent a novel species. The name Azospirillum zeae sp. nov. is suggested, with N7(T) (=NCCB 100147(T)=LMG 23989(T)) as the type strain.

Biochemical characterization and phylogenetic analysis based on 16S rRNA sequences for V-factor dependent members of Pasteurellaceae derived from laboratory rats.

PubMed

Hayashimoto, Nobuhito; Ueno, Masami; Tkakura, Akira; Itoh, Toshio

2007-06-01

Phylogenetic analysis based on 16S rRNA sequences with sequence data of some bacterial species of Pasteurellaceae related to rodents deposited in GenBank was performed along with biochemical characterization for the 20 strains of V-factor dependent members of Pasteurellaceae derived from laboratory rats to obtain basic information and to investigate the taxonomic positions. The results of biochemical tests for all strains were identical except for three tests, the ornithine decarboxylase test, and fermentation tests of D(+) mannose and D(+) xylose. The biochemical properties of 8 of 20 strains that showed negative results for the fermentation test of D(+) xylose agreed with those of Haemophilus parainfluenzae complex. By phylogenetic analysis, the strains were divided into two clusters that agreed with the results of the fermentation test of xylose (group I: negative reaction for xylose, group II: positive reaction for xylose). The clusters were independent of other bacterial species of Pasteurellaceae tested. The sequences of the strains in group I showed 99.7-99.8% similarity and the strains in group II showed 99.3-99.7% similarity. None of the strains in group I had a close relation with Haemophilus parainfluenzae by phylogenetic analysis, although they showed the same biochemical properties. In conclusion, the strains had characteristic biochemical properties and formed two independent groups within the "rodent cluster" of Pasteurellaceae that differed in the results of the fermentation test of xylose. Therefore, they seemed to be hitherto undescribed taxa in Pasteurellaceae.

Bifidobacterium aquikefiri sp. nov., isolated from water kefir.

PubMed

Laureys, David; Cnockaert, Margo; De Vuyst, Luc; Vandamme, Peter

2016-03-01

A novel Bifidobacterium , strain LMG 28769 T , was isolated from a household water kefir fermentation process. Cells were Gram-stain-positive, non-motile, non-spore-forming, catalase-negative, oxidase-negative and facultatively anaerobic short rods. Analysis of its 16S rRNA gene sequence revealed Bifidobacterium crudilactis and Bifidobacterium psychraerophilum (97.4 and 97.1 % similarity towards the respective type strain sequences) as nearest phylogenetic neighbours. Its assignment to the genus Bifidobacterium was confirmed by the presence of fructose 6-phosphate phosphoketolase activity. Analysis of the hsp60 gene sequence revealed very low similarity with nucleotide sequences in the NCBI nucleotide database. The genotypic and phenotypic analyses allowed the differentiation of strain LMG 28769 T from all recognized Bifidobacterium species. Strain LMG 28769 T ( = CCUG 67145 T  = R 54638 T ) therefore represents a novel species, for which the name Bifidobacterium aquikefiri sp. nov. is proposed.

Strain-Level Diversity of Secondary Metabolism in Streptomyces albus

PubMed Central

Seipke, Ryan F.

2015-01-01

Streptomyces spp. are robust producers of medicinally-, industrially- and agriculturally-important small molecules. Increased resistance to antibacterial agents and the lack of new antibiotics in the pipeline have led to a renaissance in natural product discovery. This endeavor has benefited from inexpensive high quality DNA sequencing technology, which has generated more than 140 genome sequences for taxonomic type strains and environmental Streptomyces spp. isolates. Many of the sequenced streptomycetes belong to the same species. For instance, Streptomyces albus has been isolated from diverse environmental niches and seven strains have been sequenced, consequently this species has been sequenced more than any other streptomycete, allowing valuable analyses of strain-level diversity in secondary metabolism. Bioinformatics analyses identified a total of 48 unique biosynthetic gene clusters harboured by Streptomyces albus strains. Eighteen of these gene clusters specify the core secondary metabolome of the species. Fourteen of the gene clusters are contained by one or more strain and are considered auxiliary, while 16 of the gene clusters encode the production of putative strain-specific secondary metabolites. Analysis of Streptomyces albus strains suggests that each strain of a Streptomyces species likely harbours at least one strain-specific biosynthetic gene cluster. Importantly, this implies that deep sequencing of a species will not exhaust gene cluster diversity and will continue to yield novelty. PMID:25635820

Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India.

PubMed

Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj

2010-01-01

Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.

Complete Genome Sequence of the Probiotic Strain Lactobacillus salivarius LPM01

PubMed Central

Codoñer, Francisco M.; Martinez-Blanch, Juan F.; Acevedo-Piérart, Marcelo; Ormeño, M. Loreto; Ramón, Daniel

2016-01-01

Lactobacillus salivarius LPM01 (DSM 22150) is a probiotic strain able to improve health status in immunocompromised people. Here, we report its complete genome sequence deciphered by PacBio single-molecule real-time (SMRT) technology. Analysis of the sequence may provide insights into its functional activity and safety assessment. PMID:27881545

Molecular characterization of a wild poliovirus type 3 epidemic in The Netherlands (1992 and 1993).

PubMed Central

Mulders, M N; van Loon, A M; van der Avoort, H G; Reimerink, J H; Ras, A; Bestebroer, T M; Drebot, M A; Kew, O M; Koopmans, M P

1995-01-01

An outbreak of poliomyelitis due to wild poliovirus type 3 (PV3) occurred in an unvaccinated community in The Netherlands between September 1992 and February 1993. The outbreak involved 71 patients. The aim of this study was to characterize the virus at the molecular level and to analyze the molecular evolution of the epidemic virus. Molecular analysis was carried out by sequencing the VP1/2A junction region (150 nucleotides) of 50 PV3 strains isolated in association with this outbreak and the entire VP1 gene of 14 strains. In addition, the sequence of the VP1/2A junction region of strains from geographical regions endemic for PV3 (Egypt, India, and Central Asia) was analyzed and compared with the nucleotide sequence of the epidemic strain from The Netherlands. The earliest isolate was obtained from river water sampled 3 weeks before diagnosis of the first poliomyelitis patient and was found by VP1/2A sequence analysis to be genetically identical to the strain isolated from the first patient. Sequence divergence among the strains from the epidemic in The Netherlands was less than 2%. The closest genetic similarity (97.3%) was found with an Indian isolate (New Delhi, December 1991), indicating the likely source of the virus. A more than 99% sequence similarity was found in the VP1/2A region. Finally, the sequence information was used to design primers for the specific and highly sensitive molecular detection of PV3 strains during the epidemic. PMID:8586711

Three novel ascomycetous yeast species of the Kazachstania clade, Kazachstania saulgeensis sp. nov., Kazachstaniaserrabonitensis sp. nov. and Kazachstania australis sp. nov. Reassignment of Candida humilis to Kazachstania humilis f.a. comb. nov. and Candida pseudohumilis to Kazachstania pseudohumilis f.a. comb. nov.

PubMed

Jacques, Noémie; Sarilar, Véronique; Urien, Charlotte; Lopes, Mariana R; Morais, Camila G; Uetanabaro, Ana Paula T; Tinsley, Colin R; Rosa, Carlos A; Sicard, Delphine; Casaregola, Serge

2016-12-01

Five ascosporogenous yeast strains related to the genus Kazachstania were isolated. Two strains (CLIB 1764T and CLIB 1780) were isolated from French sourdoughs; three others (UFMG-CM-Y273T, UFMG-CM-Y451 and UFMG-CM-Y452) were from rotting wood in Brazil. The sequences of the French and Brazilian strains differed by one and three substitutions, respectively, in the D1/D2 large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS). The D1/D2 LSU rRNA sequence of these strains differed by 0.5 and 0.7 % from Kazachstania exigua, but their ITS sequences diverged by 8.1 and 8.3 %, respectively, from that of the closest described species Kazachstania barnettii. Analysis of protein coding sequences of RPB1, RPB2 and EF-1α distinguished the French from the Brazilian strains, with respectively 3.3, 6 and 11.7 % substitutions. Two novel species are described to accommodate these newly isolated strains: Kazachstania saulgeensis sp. nov. (type strain CLIB 1764T=CBS 14374T) and Kazachstania serrabonitensis sp. nov. (type strain UFMG-CM-Y273T=CLIB 1783T=CBS 14236T). Further analysis of culture collections revealed a strain previously assigned to the K. exigua species, but having 3.8 % difference (22 substitutions and 2 indels) in its ITS with respect to K. exigua. Hence, we describe a new taxon, Kazachstania australis sp. nov. (type strain CLIB 162T=CBS 2141T), to accommodate this strain. Finally, Candida humilis and Candida pseudohumilis are reassigned to the genus Kazachstania as new combinations. On the basis of sequence analysis, we also propose that Candida milleri and Kazachstania humilis comb. nov. are conspecific.

Right ventricular strain analysis from three-dimensional echocardiography by using temporally diffeomorphic motion estimation.

PubMed

Zhang, Zhijun; Zhu, Meihua; Ashraf, Muhammad; Broberg, Craig S; Sahn, David J; Song, Xubo

2014-12-01

Quantitative analysis of right ventricle (RV) motion is important for study of the mechanism of congenital and acquired diseases. Unlike left ventricle (LV), motion estimation of RV is more difficult because of its complex shape and thin myocardium. Although attempts of finite element models on MR images and speckle tracking on echocardiography have shown promising results on RV strain analysis, these methods can be improved since the temporal smoothness of the motion is not considered. The authors have proposed a temporally diffeomorphic motion estimation method in which a spatiotemporal transformation is estimated by optimization of a registration energy functional of the velocity field in their earlier work. The proposed motion estimation method is a fully automatic process for general image sequences. The authors apply the method by combining with a semiautomatic myocardium segmentation method to the RV strain analysis of three-dimensional (3D) echocardiographic sequences of five open-chest pigs under different steady states. The authors compare the peak two-point strains derived by their method with those estimated from the sonomicrometry, the results show that they have high correlation. The motion of the right ventricular free wall is studied by using segmental strains. The baseline sequence results show that the segmental strains in their methods are consistent with results obtained by other image modalities such as MRI. The image sequences of pacing steady states show that segments with the largest strain variation coincide with the pacing sites. The high correlation of the peak two-point strains of their method and sonomicrometry under different steady states demonstrates that their RV motion estimation has high accuracy. The closeness of the segmental strain of their method to those from MRI shows the feasibility of their method in the study of RV function by using 3D echocardiography. The strain analysis of the pacing steady states shows the potential utility of their method in study on RV diseases.

Clavibacter michiganensis subsp. phaseoli subsp. nov., pathogenic in bean.

PubMed

González, Ana J; Trapiello, Estefanía

2014-05-01

A yellow Gram-reaction-positive bacterium isolated from bean seeds (Phaseolus vulgaris L.) was identified as Clavibacter michiganensis by 16S rRNA gene sequencing. Molecular methods were employed in order to identify the subspecies. Such methods included the amplification of specific sequences by PCR, 16S amplified rDNA restriction analysis (ARDRA), RFLP and multilocus sequence analysis as well as the analysis of biochemical and phenotypic traits including API 50CH and API ZYM results. The results showed that strain LPPA 982T did not represent any known subspecies of C. michiganensis. Pathogenicity tests revealed that the strain is a bean pathogen causing a newly identified bacterial disease that we name bacterial bean leaf yellowing. On the basis of these results, strain LPPA 982T is regarded as representing a novel subspecies for which the name Clavibacter michiganensis subsp. phaseoli subsp. nov. is proposed. The type strain is LPPA 982T (=CECT 8144T=LMG 27667T).

[Phylogenetic analysis of genomes of Vibrio cholerae strains isolated on the territory of Rostov region].

PubMed

Kuleshov, K V; Markelov, M L; Dedkov, V G; Vodop'ianov, A S; Kermanov, A V; Pisanov, R V; Kruglikov, V D; Mazrukho, A B; Maleev, V V; Shipulin, G A

2013-01-01

Determination of origin of 2 Vibrio cholerae strains isolated on the territory of Rostov region by using full genome sequencing data. Toxigenic strain 2011 EL- 301 V. cholerae 01 El Tor Inaba No. 301 (ctxAB+, tcpA+) and nontoxigenic strain V. cholerae O1 Ogawa P- 18785 (ctxAB-, tcpA+) were studied. Sequencing was carried out on the MiSeq platform. Phylogenetic analysis of the genomes obtained was carried out based on comparison of conservative part of the studied and 54 previously sequenced genomes. 2011EL-301 strain genome was presented by 164 contigs with an average coverage of 100, N50 parameter was 132 kb, for strain P- 18785 - 159 contigs with a coverage of69, N50 - 83 kb. The contigs obtained for strain 2011 EL-301 were deposited in DDBJ/EMBL/GenBank databases with access code AJFN02000000, for strain P-18785 - ANHS00000000. 716 protein-coding orthologous genes were detected. Based on phylogenetic analysis strain P- 18785 belongs to PG-1 subgroup (a group of predecessor strains of the 7th pandemic). Strain 2011EL-301 belongs to groups of strains of the 7th pandemic and is included into the cluster with later isolates that are associated with cases of cholera in South Africa and cases of import of cholera to the USA from Pakistan. The data obtained allows to establish phylogenetic connections with V cholerae strains isolated earlier.

Use of phylogenetic and phenotypic analyses to identify nonhemolytic streptococci isolated from bacteremic patients.

PubMed

Hoshino, Tomonori; Fujiwara, Taku; Kilian, Mogens

2005-12-01

The aim of this study was to evaluate molecular and phenotypic methods for the identification of nonhemolytic streptococci. A collection of 148 strains consisting of 115 clinical isolates from cases of infective endocarditis, septicemia, and meningitis and 33 reference strains, including type strains of all relevant Streptococcus species, were examined. Identification was performed by phylogenetic analysis of nucleotide sequences of four housekeeping genes, ddl, gdh, rpoB, and sodA; by PCR analysis of the glucosyltransferase (gtf) gene; and by conventional phenotypic characterization and identification using two commercial kits, Rapid ID 32 STREP and STREPTOGRAM and the associated databases. A phylogenetic tree based on concatenated sequences of the four housekeeping genes allowed unequivocal differentiation of recognized species and was used as the reference. Analysis of single gene sequences revealed deviation clustering in eight strains (5.4%) due to homologous recombination with other species. This was particularly evident in S. sanguinis and in members of the anginosus group of streptococci. The rate of correct identification of the strains by both commercial identification kits was below 50% but varied significantly between species. The most significant problems were observed with S. mitis and S. oralis and 11 Streptococcus species described since 1991. Our data indicate that identification based on multilocus sequence analysis is optimal. As a more practical alternative we recommend identification based on sodA sequences with reference to a comprehensive set of sequences that is available for downloading from our server. An analysis of the species distribution of 107 nonhemolytic streptococci from bacteremic patients showed a predominance of S. oralis and S. anginosus with various underlying infections.

Defining a Core Genome Multilocus Sequence Typing Scheme for the Global Epidemiology of Vibrio parahaemolyticus

PubMed Central

Jolley, Keith A.; Reed, Elizabeth; Martinez-Urtaza, Jaime

2017-01-01

ABSTRACT Vibrio parahaemolyticus is an important human foodborne pathogen whose transmission is associated with the consumption of contaminated seafood, with a growing number of infections reported over recent years worldwide. A multilocus sequence typing (MLST) database for V. parahaemolyticus was created in 2008, and a large number of clones have been identified, causing severe outbreaks worldwide (sequence type 3 [ST3]), recurrent outbreaks in certain regions (e.g., ST36), or spreading to other regions where they are nonendemic (e.g., ST88 or ST189). The current MLST scheme uses sequences of 7 genes to generate an ST, which results in a powerful tool for inferring the population structure of this pathogen, although with limited resolution, especially compared to pulsed-field gel electrophoresis (PFGE). The application of whole-genome sequencing (WGS) has become routine for trace back investigations, with core genome MLST (cgMLST) analysis as one of the most straightforward ways to explore complex genomic data in an epidemiological context. Therefore, there is a need to generate a new, portable, standardized, and more advanced system that provides higher resolution and discriminatory power among V. parahaemolyticus strains using WGS data. We sequenced 92 V. parahaemolyticus genomes and used the genome of strain RIMD 2210633 as a reference (with a total of 4,832 genes) to determine which genes were suitable for establishing a V. parahaemolyticus cgMLST scheme. This analysis resulted in the identification of 2,254 suitable core genes for use in the cgMLST scheme. To evaluate the performance of this scheme, we performed a cgMLST analysis of 92 newly sequenced genomes, plus an additional 142 strains with genomes available at NCBI. cgMLST analysis was able to distinguish related and unrelated strains, including those with the same ST, clearly showing its enhanced resolution over conventional MLST analysis. It also distinguished outbreak-related from non-outbreak-related strains within the same ST. The sequences obtained from this work were deposited and are available in the public database (http://pubmlst.org/vparahaemolyticus). The application of this cgMLST scheme to the characterization of V. parahaemolyticus strains provided by different laboratories from around the world will reveal the global picture of the epidemiology, spread, and evolution of this pathogen and will become a powerful tool for outbreak investigations, allowing for the unambiguous comparison of strains with global coverage. PMID:28330888

Draft Genome Sequence of the Efficient Bioflocculant-Producing Bacterium Paenibacillus sp. Strain A9

PubMed Central

Liu, Jin-liang; Hu, Xiao-min

2013-01-01

Paenibacillus sp. strain A9 is an important bioflocculant-producing bacterium, isolated from a soil sample, and is pale pink-pigmented, aerobic, and Gram-positive. Here, we report the draft genome sequence and the initial findings from a preliminary analysis of strain A9, which is a novel species of Paenibacillus. PMID:23618713

[Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].

PubMed

Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V

2012-04-01

Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.

RT-PCR and sequence analysis of the full-length fusion protein of Canine Distemper Virus from domestic dogs.

PubMed

Romanutti, Carina; Gallo Calderón, Marina; Keller, Leticia; Mattion, Nora; La Torre, José

2016-02-01

During 2007-2014, 84 out of 236 (35.6%) samples from domestic dogs submitted to our laboratory for diagnostic purposes were positive for Canine Distemper Virus (CDV), as analyzed by RT-PCR amplification of a fragment of the nucleoprotein gene. Fifty-nine of them (70.2%) were from dogs that had been vaccinated against CDV. The full-length gene encoding the Fusion (F) protein of fifteen isolates was sequenced and compared with that of those of other CDVs, including wild-type and vaccine strains. Phylogenetic analysis using the F gene full-length sequences grouped all the Argentinean CDV strains in the SA2 clade. Sequence identity with the Onderstepoort vaccine strain was 89.0-90.6%, and the highest divergence was found in the 135 amino acids corresponding to the F protein signal-peptide, Fsp (64.4-66.7% identity). In contrast, this region was highly conserved among the local strains (94.1-100% identity). One extra putative N-glycosylation site was identified in the F gene of CDV Argentinean strains with respect to the vaccine strain. The present report is the first to analyze full-length F protein sequences of CDV strains circulating in Argentina, and contributes to the knowledge of molecular epidemiology of CDV, which may help in understanding future disease outbreaks. Copyright © 2015 Elsevier B.V. All rights reserved.

Genetic characterization of L-Zagreb mumps vaccine strain.

PubMed

Ivancic, Jelena; Gulija, Tanja Kosutic; Forcic, Dubravko; Baricevic, Marijana; Jug, Renata; Mesko-Prejac, Majda; Mazuran, Renata

2005-04-01

Eleven mumps vaccine strains, all containing live attenuated virus, have been used throughout the world. Although L-Zagreb mumps vaccine has been licensed since 1972, only its partial nucleotide sequence was previously determined (accession numbers , and ). Therefore, we sequenced the entire genome of L-Zagreb vaccine strain (Institute of Immunology Inc., Zagreb, Croatia). In order to investigate the genetic stability of the vaccine, sequences of both L-Zagreb master seed and currently produced vaccine batch were determined and no difference between them was observed. A phylogenetic analysis based on SH gene sequence has shown that L-Zagreb strain does not belong to any of established mumps genotypes and that it is most similar to old, laboratory preserved European strains (1950s-1970s). L-Zagreb nucleotide and deduced protein sequences were compared with other mumps virus sequences obtained from the GenBank. Emphasis was put on functionally important protein regions and known antigenic epitopes. The extensive comparisons of nucleotide and deduced protein sequences between L-Zagreb vaccine strain and other previously determined mumps virus sequences have shown that while the functional regions of HN, V, and L proteins are well conserved among various mumps strains, there can be a substantial amino acid difference in antigenic epitopes of all proteins and in functional regions of F protein. No molecular pattern was identified that can be used as a distinction marker between virulent and attenuated strains.

Molecular application for identification of polycyclic aromatic hydrocarbons degrading bacteria (PAHD) species isolated from oil polluted soil in Dammam, Saud Arabia.

PubMed

Ibrahim, Mohamed M; Al-Turki, Ameena; Al-Sewedi, Dona; Arif, Ibrahim A; El-Gaaly, Gehan A

2015-09-01

Soil contamination with petroleum hydrocarbon products such as diesel and engine oil is becoming one of the major environmental problems. This study describes hydrocarbons degrading bacteria (PHAD) isolated from long-standing petrol polluted soil from the eastern region, Dammam, Saudi Arabia. The isolated strains were firstly categorized by accessible shape detection, physiological and biochemistry tests. Thereafter, a technique established on the sequence analysis of a 16S rDNA gene was used. Isolation of DNA from the bacterial strains was performed, on which the PCR reaction was carried out. Strains were identified based on 16S rDNA sequence analysis, As follows amplified samples were spontaneously sequenced automatically and the attained results were matched to open databases. Among the isolated bacterial strains, S1 was identified as Staphylococcus aureus and strain S1 as Corynebacterium amycolatum.

Genome-wide analytical approaches for reverse metabolic engineering of industrially relevant phenotypes in yeast

PubMed Central

Oud, Bart; Maris, Antonius J A; Daran, Jean-Marc; Pronk, Jack T

2012-01-01

Successful reverse engineering of mutants that have been obtained by nontargeted strain improvement has long presented a major challenge in yeast biotechnology. This paper reviews the use of genome-wide approaches for analysis of Saccharomyces cerevisiae strains originating from evolutionary engineering or random mutagenesis. On the basis of an evaluation of the strengths and weaknesses of different methods, we conclude that for the initial identification of relevant genetic changes, whole genome sequencing is superior to other analytical techniques, such as transcriptome, metabolome, proteome, or array-based genome analysis. Key advantages of this technique over gene expression analysis include the independency of genome sequences on experimental context and the possibility to directly and precisely reproduce the identified changes in naive strains. The predictive value of genome-wide analysis of strains with industrially relevant characteristics can be further improved by classical genetics or simultaneous analysis of strains derived from parallel, independent strain improvement lineages. PMID:22152095

Genome-wide analytical approaches for reverse metabolic engineering of industrially relevant phenotypes in yeast.

PubMed

Oud, Bart; van Maris, Antonius J A; Daran, Jean-Marc; Pronk, Jack T

2012-03-01

Successful reverse engineering of mutants that have been obtained by nontargeted strain improvement has long presented a major challenge in yeast biotechnology. This paper reviews the use of genome-wide approaches for analysis of Saccharomyces cerevisiae strains originating from evolutionary engineering or random mutagenesis. On the basis of an evaluation of the strengths and weaknesses of different methods, we conclude that for the initial identification of relevant genetic changes, whole genome sequencing is superior to other analytical techniques, such as transcriptome, metabolome, proteome, or array-based genome analysis. Key advantages of this technique over gene expression analysis include the independency of genome sequences on experimental context and the possibility to directly and precisely reproduce the identified changes in naive strains. The predictive value of genome-wide analysis of strains with industrially relevant characteristics can be further improved by classical genetics or simultaneous analysis of strains derived from parallel, independent strain improvement lineages. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Phylogenetic Relationship in Different Commercial Strains of Pleurotus nebrodensis Based on ITS Sequence and RAPD.

PubMed

Alam, Nuhu; Shim, Mi Ja; Lee, Min Woong; Shin, Pyeong Gyun; Yoo, Young Bok; Lee, Tae Soo

2009-09-01

The molecular phylogeny in nine different commercial cultivated strains of Pleurotus nebrodensis was studied based on their internal transcribed spacer (ITS) region and RAPD. In the sequence of ITS region of selected strains, it was revealed that the total length ranged from 592 to 614 bp. The size of ITS1 and ITS2 regions varied among the strains from 219 to 228 bp and 211 to 229 bp, respectively. The sequence of ITS2 was more variable than ITS1 and the region of 5.8S sequences were identical. Phylogenetic tree of the ITS region sequences indicated that selected strains were classified into five clusters. The reciprocal homologies of the ITS region sequences ranged from 99 to 100%. The strains were also analyzed by RAPD with 20 arbitrary primers. Twelve primers were efficient to applying amplification of the genomic DNA. The sizes of the polymorphic fragments obtained were in the range of 200 to 2000 bp. RAPD and ITS analysis techniques were able to detect genetic variation among the tested strains. Experimental results suggested that IUM-1381, IUM-3914, IUM-1495 and AY-581431 strains were genetically very similar. Therefore, all IUM and NCBI gene bank strains of P. nebrodensis were genetically same with some variations.

Whole genome sequence and comparative analysis of Borrelia burgdorferi MM1

PubMed Central

Jabbari, Neda; Reddy, Panga Jaipal; Hood, Leroy

2018-01-01

Lyme disease is caused by spirochaetes of the Borrelia burgdorferi sensu lato genospecies. Complete genome assemblies are available for fewer than ten strains of Borrelia burgdorferi sensu stricto, the primary cause of Lyme disease in North America. MM1 is a sensu stricto strain originally isolated in the midwestern United States. Aside from a small number of genes, the complete genome sequence of this strain has not been reported. Here we present the complete genome sequence of MM1 in relation to other sensu stricto strains and in terms of its Multi Locus Sequence Typing. Our results indicate that MM1 is a new sequence type which contains a conserved main chromosome and 15 plasmids. Our results include the first contiguous 28.5 kb assembly of lp28-8, a linear plasmid carrying the vls antigenic variation system, from a Borrelia burgdorferi sensu stricto strain. PMID:29889842

Variation in genotype and higher virulence of a strain of Sporothrix schenckii causing disseminated cutaneous sporotrichosis.

PubMed

Zhang, Zhenying; Liu, Xiaoming; Lv, Xuelian; Lin, Jingrong

2011-12-01

Sporotrichosis is usually a localized, lymphocutaneous disease, but its disseminated type was rarely reported. The main objective of this study was to identify specific DNA sequence variation and virulence of a strain of Sporothrix schenckii isolated from the lesion of disseminated cutaneous sporotrichosis. We confirmed this strain to be S. schenckii by(®) tubulin and chitin synthase gene sequence analysis in addition to the routine mycological and partial ITS and NTS sequencing. We found a 10-bp deletion in the ribosomal NTS region of this strain, in reference to the sequence of control strains isolated from fixed cutaneous sporotrichosis. After inoculated into immunosuppressed mice, this strain caused more extensive system involvement and showed stronger virulence than the control strain isolated from a fixed cutaneous sporotrichosis. Our study thus suggests that different clinical manifestation of sporotrichosis may be associated with variation in genotype and virulence of the strain, independent of effects due to the immune status of the host.

Genome Sequencing and Analysis of Geographically Diverse Clinical Isolates of Herpes Simplex Virus 2

PubMed Central

Lamers, Susanna L.; Weiner, Brian; Ray, Stuart C.; Colgrove, Robert C.; Diaz, Fernando; Jing, Lichen; Wang, Kening; Saif, Sakina; Young, Sarah; Henn, Matthew; Laeyendecker, Oliver; Tobian, Aaron A. R.; Cohen, Jeffrey I.; Koelle, David M.; Quinn, Thomas C.; Knipe, David M.

2015-01-01

ABSTRACT Herpes simplex virus 2 (HSV-2), the principal causative agent of recurrent genital herpes, is a highly prevalent viral infection worldwide. Limited information is available on the amount of genomic DNA variation between HSV-2 strains because only two genomes have been determined, the HG52 laboratory strain and the newly sequenced SD90e low-passage-number clinical isolate strain, each from a different geographical area. In this study, we report the nearly complete genome sequences of 34 HSV-2 low-passage-number and laboratory strains, 14 of which were collected in Uganda, 1 in South Africa, 11 in the United States, and 8 in Japan. Our analyses of these genomes demonstrated remarkable sequence conservation, regardless of geographic origin, with the maximum nucleotide divergence between strains being 0.4% across the genome. In contrast, prior studies indicated that HSV-1 genomes exhibit more sequence diversity, as well as geographical clustering. Additionally, unlike HSV-1, little viral recombination between HSV-2 strains could be substantiated. These results are interpreted in light of HSV-2 evolution, epidemiology, and pathogenesis. Finally, the newly generated sequences more closely resemble the low-passage-number SD90e than HG52, supporting the use of the former as the new reference genome of HSV-2. IMPORTANCE Herpes simplex virus 2 (HSV-2) is a causative agent of genital and neonatal herpes. Therefore, knowledge of its DNA genome and genetic variability is central to preventing and treating genital herpes. However, only two full-length HSV-2 genomes have been reported. In this study, we sequenced 34 additional HSV-2 low-passage-number and laboratory viral genomes and initiated analysis of the genetic diversity of HSV-2 strains from around the world. The analysis of these genomes will facilitate research aimed at vaccine development, diagnosis, and the evaluation of clinical manifestations and transmission of HSV-2. This information will also contribute to our understanding of HSV evolution. PMID:26018166

Complete Genome Sequence of the Probiotic Strain Lactobacillus salivarius LPM01.

PubMed

Chenoll, Empar; Codoñer, Francisco M; Martinez-Blanch, Juan F; Acevedo-Piérart, Marcelo; Ormeño, M Loreto; Ramón, Daniel; Genovés, Salvador

2016-11-23

Lactobacillus salivarius LPM01 (DSM 22150) is a probiotic strain able to improve health status in immunocompromised people. Here, we report its complete genome sequence deciphered by PacBio single-molecule real-time (SMRT) technology. Analysis of the sequence may provide insights into its functional activity and safety assessment. Copyright © 2016 Chenoll et al.

The complete and fully assembled genome sequence of Aeromonas salmonicida subsp. pectinolytica and its comparative analysis with other Aeromonas species: investigation of the mobilome in environmental and pathogenic strains.

PubMed

Pfeiffer, Friedhelm; Zamora-Lagos, Maria-Antonia; Blettinger, Martin; Yeroslaviz, Assa; Dahl, Andreas; Gruber, Stephan; Habermann, Bianca H

2018-01-05

Due to the predominant usage of short-read sequencing to date, most bacterial genome sequences reported in the last years remain at the draft level. This precludes certain types of analyses, such as the in-depth analysis of genome plasticity. Here we report the finalized genome sequence of the environmental strain Aeromonas salmonicida subsp. pectinolytica 34mel, for which only a draft genome with 253 contigs is currently available. Successful completion of the transposon-rich genome critically depended on the PacBio long read sequencing technology. Using finalized genome sequences of A. salmonicida subsp. pectinolytica and other Aeromonads, we report the detailed analysis of the transposon composition of these bacterial species. Mobilome evolution is exemplified by a complex transposon, which has shifted from pathogenicity-related to environmental-related gene content in A. salmonicida subsp. pectinolytica 34mel. Obtaining the complete, circular genome of A. salmonicida subsp. pectinolytica allowed us to perform an in-depth analysis of its mobilome. We demonstrate the mobilome-dependent evolution of this strain's genetic profile from pathogenic to environmental.

Genome Analysis of Listeria monocytogenes Sequence Type 8 Strains Persisting in Salmon and Poultry Processing Environments and Comparison with Related Strains

PubMed Central

Fagerlund, Annette; Langsrud, Solveig; Schirmer, Bjørn C. T.; Møretrø, Trond; Heir, Even

2016-01-01

Listeria monocytogenes is an important foodborne pathogen responsible for the disease listeriosis, and can be found throughout the environment, in many foods and in food processing facilities. The main cause of listeriosis is consumption of food contaminated from sources in food processing environments. Persistence in food processing facilities has previously been shown for the L. monocytogenes sequence type (ST) 8 subtype. In the current study, five ST8 strains were subjected to whole-genome sequencing and compared with five additionally available ST8 genomes, allowing comparison of strains from salmon, poultry and cheese industry, in addition to a human clinical isolate. Genome-wide analysis of single-nucleotide polymorphisms (SNPs) confirmed that almost identical strains were detected in a Danish salmon processing plant in 1996 and in a Norwegian salmon processing plant in 2001 and 2011. Furthermore, we show that L. monocytogenes ST8 was likely to have been transferred between two poultry processing plants as a result of relocation of processing equipment. The SNP data were used to infer the phylogeny of the ST8 strains, separating them into two main genetic groups. Within each group, the plasmid and prophage content was almost entirely conserved, but between groups, these sequences showed strong divergence. The accessory genome of the ST8 strains harbored genetic elements which could be involved in rendering the ST8 strains resilient to incoming mobile genetic elements. These included two restriction-modification loci, one of which was predicted to show phase variable recognition sequence specificity through site-specific domain shuffling. Analysis indicated that the ST8 strains harbor all important known L. monocytogenes virulence factors, and ST8 strains are commonly identified as the causative agents of invasive listeriosis. Therefore, the persistence of this L. monocytogenes subtype in food processing facilities poses a significant concern for food safety. PMID:26953695

Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum

PubMed Central

Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

2017-01-01

Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1–3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry. PMID:28056060

Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum.

PubMed

Zhang, Xiuqing; Xu, Zhangyang; Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

2017-01-01

Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry.

Comparative sequence analysis revealed altered chromosomal organization and a novel insertion sequence encoding DNA modification and potentially stress-related functions in an Escherichia coli O157:H7 foodborne isolate

USDA-ARS?s Scientific Manuscript database

We recently described the complete genome of enterohemorrhagic Escherichia coli (EHEC) O157:H7 strain NADC 6564, an isolate of strain 86-24 linked to the 1986 disease outbreak. In the current study, we compared the chromosomal sequence of NADC 6564 to the well-characterized chromosomal sequences of ...

Genetic Analysis of Norovirus Strains that Caused Gastroenteritis Outbreaks Among River Rafters in the Grand Canyon, Arizona.

PubMed

Kitajima, Masaaki; Iker, Brandon C; Magill-Collins, Anne; Gaither, Marlene; Stoehr, James D; Gerba, Charles P

2017-06-01

Toilet solid waste samples collected from five outbreaks among rafters in the Grand Canyon were subjected to sequencing analysis of norovirus partial capsid gene. The results revealed that a GI.3 strain was associated with one outbreak, whereas the other outbreaks were caused by GII.5 whose sequences shared >98.9% homology.

Characterization of Bacteroides forsythus Strains from Cat and Dog Bite Wounds in Humans and Comparison with Monkey and Human Oral Strains

PubMed Central

Hudspeth, M. K.; Gerardo, S. Hunt; Maiden, M. F. J.; Citron, D. M.; Goldstein, E. J. C.

1999-01-01

Bacteroides forsythus strains recovered from cat and dog bite wound infections in humans (n = 3), monkey oral strains (n = 3), and the human oral ATCC 43037 type strain were characterized by using phenotypic characteristics, enzymatic tests, whole cell fatty acid analysis, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis, PCR fingerprinting, and 16S rDNA (genes coding for rRNA) sequencing. All three bite wound isolates grew on brucella agar supplemented with 5% sheep blood, vitamin K1, and hemin. These strains, unlike the ATCC strain and previously described monkey oral and human clinical strains, did not require N-acetylmuramic acid supplementation for growth as pure cultures. However, their phenotypic characteristics, except for catalase production, were similar to those of previously identified strains. PCR fingerprinting analysis showed differences in band patterns from the ATCC strain. Also, SDS-PAGE and whole cell fatty acid analysis indicated that the dog and cat bite wound strains were similar but not identical to the human B. forsythus ATCC 43037 type strain and the monkey oral strains. The rDNA sequence analysis indicated that the three bite wound isolates had 99.93% homology with each other and 98.9 and 99.22% homology with the human ATCC 43037 and monkey oral strains, respectively. These results suggest that there are host-specific variations within each group. PMID:10325363

High resolution identity testing of inactivated poliovirus vaccines

PubMed Central

Mee, Edward T.; Minor, Philip D.; Martin, Javier

2015-01-01

Background Definitive identification of poliovirus strains in vaccines is essential for quality control, particularly where multiple wild-type and Sabin strains are produced in the same facility. Sequence-based identification provides the ultimate in identity testing and would offer several advantages over serological methods. Methods We employed random RT-PCR and high throughput sequencing to recover full-length genome sequences from monovalent and trivalent poliovirus vaccine products at various stages of the manufacturing process. Results All expected strains were detected in previously characterised products and the method permitted identification of strains comprising as little as 0.1% of sequence reads. Highly similar Mahoney and Sabin 1 strains were readily discriminated on the basis of specific variant positions. Analysis of a product known to contain incorrect strains demonstrated that the method correctly identified the contaminants. Conclusion Random RT-PCR and shotgun sequencing provided high resolution identification of vaccine components. In addition to the recovery of full-length genome sequences, the method could also be easily adapted to the characterisation of minor variant frequencies and distinction of closely related products on the basis of distinguishing consensus and low frequency polymorphisms. PMID:26049003

Complete genome sequence and comparative analysis of Acetobacter pasteurianus 386B, a strain well-adapted to the cocoa bean fermentation ecosystem.

PubMed

Illeghems, Koen; De Vuyst, Luc; Weckx, Stefan

2013-08-01

Acetobacter pasteurianus 386B, an acetic acid bacterium originating from a spontaneous cocoa bean heap fermentation, proved to be an ideal functional starter culture for coca bean fermentations. It is able to dominate the fermentation process, thereby resisting high acetic acid concentrations and temperatures. However, the molecular mechanisms underlying its metabolic capabilities and niche adaptations are unknown. In this study, whole-genome sequencing and comparative genome analysis was used to investigate this strain's mechanisms to dominate the cocoa bean fermentation process. The genome sequence of A. pasteurianus 386B is composed of a 2.8-Mb chromosome and seven plasmids. The annotation of 2875 protein-coding sequences revealed important characteristics, including several metabolic pathways, the occurrence of strain-specific genes such as an endopolygalacturonase, and the presence of mechanisms involved in tolerance towards various stress conditions. Furthermore, the low number of transposases in the genome and the absence of complete phage genomes indicate that this strain might be more genetically stable compared with other A. pasteurianus strains, which is an important advantage for the use of this strain as a functional starter culture. Comparative genome analysis with other members of the Acetobacteraceae confirmed the functional properties of A. pasteurianus 386B, such as its thermotolerant nature and unique genetic composition. Genome analysis of A. pasteurianus 386B provided detailed insights into the underlying mechanisms of its metabolic features, niche adaptations, and tolerance towards stress conditions. Combination of these data with previous experimental knowledge enabled an integrated, global overview of the functional characteristics of this strain. This knowledge will enable improved fermentation strategies and selection of appropriate acetic acid bacteria strains as functional starter culture for cocoa bean fermentation processes.

Characterization of Vibrio parahaemolyticus clinical strains from Maryland (2012-2013) and comparisons to a locally and globally diverse V. parahaemolyticus strains by whole-genome sequence analysis.

PubMed

Haendiges, Julie; Timme, Ruth; Allard, Marc W; Myers, Robert A; Brown, Eric W; Gonzalez-Escalona, Narjol

2015-01-01

Vibrio parahaemolyticus is the leading cause of foodborne illnesses in the US associated with the consumption of raw shellfish. Previous population studies of V. parahaemolyticus have used Multi-Locus Sequence Typing (MLST) or Pulsed Field Gel Electrophoresis (PFGE). Whole genome sequencing (WGS) provides a much higher level of resolution, but has been used to characterize only a few United States (US) clinical isolates. Here we report the WGS characterization of 34 genomes of V. parahaemolyticus strains that were isolated from clinical cases in the state of Maryland (MD) during 2 years (2012-2013). These 2 years saw an increase of V. parahaemolyticus cases compared to previous years. Among these MD isolates, 28% were negative for tdh and trh, 8% were tdh positive only, 11% were trh positive only, and 53% contained both genes. We compared this set of V. parahaemolyticus genomes to those of a collection of 17 archival strains from the US (10 previously sequenced strains and 7 from NCBI, collected between 1988 and 2004) and 15 international strains, isolated from geographically-diverse environmental and clinical sources (collected between 1980 and 2010). A WGS phylogenetic analysis of these strains revealed the regional outbreak strains from MD are highly diverse and yet genetically distinct from the international strains. Some MD strains caused outbreaks 2 years in a row, indicating a local source of contamination (e.g., ST631). Advances in WGS will enable this type of analysis to become routine, providing an excellent tool for improved surveillance. Databases built with phylogenetic data will help pinpoint sources of contamination in future outbreaks and contribute to faster outbreak control.

Characterization of Vibrio parahaemolyticus clinical strains from Maryland (2012–2013) and comparisons to a locally and globally diverse V. parahaemolyticus strains by whole-genome sequence analysis

PubMed Central

Haendiges, Julie; Timme, Ruth; Allard, Marc W.; Myers, Robert A.; Brown, Eric W.; Gonzalez-Escalona, Narjol

2015-01-01

Vibrio parahaemolyticus is the leading cause of foodborne illnesses in the US associated with the consumption of raw shellfish. Previous population studies of V. parahaemolyticus have used Multi-Locus Sequence Typing (MLST) or Pulsed Field Gel Electrophoresis (PFGE). Whole genome sequencing (WGS) provides a much higher level of resolution, but has been used to characterize only a few United States (US) clinical isolates. Here we report the WGS characterization of 34 genomes of V. parahaemolyticus strains that were isolated from clinical cases in the state of Maryland (MD) during 2 years (2012–2013). These 2 years saw an increase of V. parahaemolyticus cases compared to previous years. Among these MD isolates, 28% were negative for tdh and trh, 8% were tdh positive only, 11% were trh positive only, and 53% contained both genes. We compared this set of V. parahaemolyticus genomes to those of a collection of 17 archival strains from the US (10 previously sequenced strains and 7 from NCBI, collected between 1988 and 2004) and 15 international strains, isolated from geographically-diverse environmental and clinical sources (collected between 1980 and 2010). A WGS phylogenetic analysis of these strains revealed the regional outbreak strains from MD are highly diverse and yet genetically distinct from the international strains. Some MD strains caused outbreaks 2 years in a row, indicating a local source of contamination (e.g., ST631). Advances in WGS will enable this type of analysis to become routine, providing an excellent tool for improved surveillance. Databases built with phylogenetic data will help pinpoint sources of contamination in future outbreaks and contribute to faster outbreak control. PMID:25745421

Multilocus Sequence Typing of Cronobacter Strains Isolated from Retail Foods and Environmental Samples.

PubMed

Killer, Jiří; Skřivanová, Eva; Hochel, Igor; Marounek, Milan

2015-06-01

Cronobacter spp. are bacterial pathogens that affect children and immunocompromised adults. In this study, we used multilocus sequence typing (MLST) to determine sequence types (STs) in 11 Cronobacter spp. strains isolated from retail foods, 29 strains from dust samples obtained from vacuum cleaners, and 4 clinical isolates. Using biochemical tests, species-specific polymerase chain reaction, and MLST analysis, 36 strains were identified as Cronobacter sakazakii, and 6 were identified as Cronobacter malonaticus. In addition, one strain that originated from retail food and one from a dust sample from a vacuum cleaner were identified on the basis of MLST analysis as Cronobacter dublinensis and Cronobacter turicensis, respectively. Cronobacter spp. strains isolated from the retail foods were assigned to eight different MLST sequence types, seven of which were newly identified. The strains isolated from the dust samples were assigned to 7 known STs and 14 unknown STs. Three clinical isolates and one household dust isolate were assigned to ST4, which is the predominant ST associated with neonatal meningitis. One clinical isolate was classified based on MLST analysis as Cronobacter malonaticus and belonged to an as-yet-unknown ST. Three strains isolated from the household dust samples were assigned to ST1, which is another clinically significant ST. It can be concluded that Cronobacter spp. strains of different origin are genetically quite variable. The recovery of C. sakazakii strains belonging to ST1 and ST4 from the dust samples suggests the possibility that contamination could occur during food preparation. All of the novel STs and alleles for C. sakazakii, C. malonaticus, C. dublinensis, and C. turicensis determined in this study were deposited in the Cronobacter MLST database available online ( http://pubmlst.org/cronobacter/).

Genome sequence and comparative microarray analysis of serotype M18 group A Streptococcus strains associated with acute rheumatic fever outbreaks.

PubMed

Smoot, James C; Barbian, Kent D; Van Gompel, Jamie J; Smoot, Laura M; Chaussee, Michael S; Sylva, Gail L; Sturdevant, Daniel E; Ricklefs, Stacy M; Porcella, Stephen F; Parkins, Larye D; Beres, Stephen B; Campbell, David S; Smith, Todd M; Zhang, Qing; Kapur, Vivek; Daly, Judy A; Veasy, L George; Musser, James M

2002-04-02

Acute rheumatic fever (ARF), a sequelae of group A Streptococcus (GAS) infection, is the most common cause of preventable childhood heart disease worldwide. The molecular basis of ARF and the subsequent rheumatic heart disease are poorly understood. Serotype M18 GAS strains have been associated for decades with ARF outbreaks in the U.S. As a first step toward gaining new insight into ARF pathogenesis, we sequenced the genome of strain MGAS8232, a serotype M18 organism isolated from a patient with ARF. The genome is a circular chromosome of 1,895,017 bp, and it shares 1.7 Mb of closely related genetic material with strain SF370 (a sequenced serotype M1 strain). Strain MGAS8232 has 178 ORFs absent in SF370. Phages, phage-like elements, and insertion sequences are the major sources of variation between the genomes. The genomes of strain MGAS8232 and SF370 encode many of the same proven or putative virulence factors. Importantly, strain MGAS8232 has genes encoding many additional secreted proteins involved in human-GAS interactions, including streptococcal pyrogenic exotoxin A (scarlet fever toxin) and two uncharacterized pyrogenic exotoxin homologues, all phage-associated. DNA microarray analysis of 36 serotype M18 strains from diverse localities showed that most regions of variation were phages or phage-like elements. Two epidemics of ARF occurring 12 years apart in Salt Lake City, UT, were caused by serotype M18 strains that were genetically identical, or nearly so. Our analysis provides a critical foundation for accelerated research into ARF pathogenesis and a molecular framework to study the plasticity of GAS genomes.

Isolation and Whole-genome Sequence Analysis of the Imipenem Heteroresistant Acinetobacter baumannii Clinical Isolate HRAB-85.

PubMed

Li, Puyuan; Huang, Yong; Yu, Lan; Liu, Yannan; Niu, Wenkai; Zou, Dayang; Liu, Huiying; Zheng, Jing; Yin, Xiuyun; Yuan, Jing; Yuan, Xin; Bai, Changqing

2017-09-01

Heteroresistance is a phenomenon in which there are various responses to antibiotics from bacterial cells within the same population. Here, we isolated and characterised an imipenem heteroresistant Acinetobacter baumannii strain (HRAB-85). The genome of strain HRAB-85 was completely sequenced and analysed to understand its antibiotic resistance mechanisms. Population analysis and multilocus sequence typing were performed. Subpopulations grew in the presence of imipenem at concentrations of up to 64μg/mL, and the strain was found to belong to ST208. The total length of strain HRAB-85 was 4,098,585bp with a GC content of 39.98%. The genome harboured at least four insertion sequences: the common ISAba1, ISAba22, ISAba24, and newly reported ISAba26. Additionally, 19 antibiotic-resistance genes against eight classes of antimicrobial agents were found, and 11 genomic islands (GIs) were identified. Among them, GI3, GI10, and GI11 contained many ISs and antibiotic-resistance determinants. The existence of imipenem heteroresistant phenotypes in A. baumannii was substantiated in this hospital, and imipenem pressure, which could induce imipenem-heteroresistant subpopulations, may select for highly resistant strains. The complete genome sequencing and bioinformatics analysis of HRAB-85 could improve our understanding of the epidemiology and resistance mechanisms of carbapenem-heteroresistant A. baumannii. Copyright © 2017. Published by Elsevier Ltd.

The Draft Genome Sequence of a Novel High-Efficient Butanol-Producing Bacterium Clostridium Diolis Strain WST.

PubMed

Chen, Chaoyang; Sun, Chongran; Wu, Yi-Rui

2018-03-21

A wild-type solventogenic strain Clostridium diolis WST, isolated from mangrove sediments, was characterized to produce high amount of butanol and acetone with negligible level of ethanol and acids from glucose via a unique acetone-butanol (AB) fermentation pathway. Through the genomic sequencing, the assembled draft genome of strain WST is calculated to be 5.85 Mb with a GC content of 29.69% and contains 5263 genes that contribute to the annotation of 5049 protein-coding sequences. Within these annotated genes, the butanol dehydrogenase gene (bdh) was determined to be in a higher amount from strain WST compared to other Clostridial strains, which is positively related to its high-efficient production of butanol. Therefore, we present a draft genome sequence analysis of strain WST in this article that should facilitate to further understand the solventogenic mechanism of this special microorganism.

Identification and complete genome sequence analysis of a genotype XIV Newcastle disease virus from Nigeria

USDA-ARS?s Scientific Manuscript database

The first complete genome sequence of a strain of Newcastle disease virus from genotype XIV is reported here. Strain duck/Nigeria/NG-695/KG.LOM.11-16/2009 was isolated from an apparently healthy domestic duck from a live bird market in Kogi State, Nigeria, in 2009. This strain is classified as a m...

Draft Genome Sequence of the Fish Pathogen Flavobacterium columnare Genomovar III Strain PH-97028 (=CIP 109753).

PubMed

Criscuolo, Alexis; Chesneau, Olivier; Clermont, Dominique; Bizet, Chantal

2018-04-05

Flavobacterium columnare strain PH-97028 (=CIP 109753) is a genomovar III reference strain that was isolated from a diseased Ayu fish in Japan. We report here the analysis of the first available genomovar III sequence of this species to aid in identification, epidemiological tracking, and virulence studies. Copyright © 2018 Criscuolo et al.

Complete Genome Sequence of a Highly Virulent Newcastle Disease Virus Currently Circulating in Mexico

PubMed Central

Xiao, Sa; Paldurai, Anandan; Nayak, Baibaswata; Mirande, Armando; Collins, Peter L.

2013-01-01

The complete genome sequence was determined for a highly virulent Newcastle disease virus strain from vaccinated chicken farms in Mexico during outbreaks in 2010. On the basis of phylogenetic analysis this strain was classified into genotype V in the class II cluster that was closely related to Mexican strains that appeared in 2004–2006. PMID:23409252

Identification, characterization and description of Arcobacter faecis sp. nov., isolated from a human waste septic tank.

PubMed

Whiteduck-Léveillée, Kerri; Whiteduck-Léveillée, Jenni; Cloutier, Michel; Tambong, James T; Xu, Renlin; Topp, Edward; Arts, Michael T; Chao, Jerry; Adam, Zaky; Lévesque, C André; Lapen, David R; Villemur, Richard; Khan, Izhar U H

2016-03-01

A study on the taxonomic classification of Arcobacter species was performed on the cultures isolated from various fecal sources where an Arcobacter strain AF1078(T) from human waste septic tank near Ottawa, Ontario, Canada was characterized using a polyphasic approach. Genetic investigations including 16S rRNA, atpA, cpn60, gyrA, gyrB and rpoB gene sequences of strain AF1078(T) are unique in comparison with other arcobacters. Phylogenetic analysis based on the 16S rRNA gene sequence revealed that the strain is most closely related to Arcobacter lanthieri and Arcobacter cibarius. Analyses of atpA, cpn60, gyrA, gyrB and rpoB gene sequences suggested that strain AF1078(T) formed a phylogenetic lineage independent of other species in the genus. Whole-genome sequence, DNA-DNA hybridization, fatty acid profile and phenotypic analysis further supported the conclusion that strain AF1078(T) represents a novel Arcobacter species, for which the name Arcobacter faecis sp. nov. is proposed, with type strain AF1078(T) (=LMG 28519(T); CCUG 66484(T)). Crown Copyright © 2015. Published by Elsevier GmbH. All rights reserved.

The Mouse Genomes Project: a repository of inbred laboratory mouse strain genomes.

PubMed

Adams, David J; Doran, Anthony G; Lilue, Jingtao; Keane, Thomas M

2015-10-01

The Mouse Genomes Project was initiated in 2009 with the goal of using next-generation sequencing technologies to catalogue molecular variation in the common laboratory mouse strains, and a selected set of wild-derived inbred strains. The initial sequencing and survey of sequence variation in 17 inbred strains was completed in 2011 and included comprehensive catalogue of single nucleotide polymorphisms, short insertion/deletions, larger structural variants including their fine scale architecture and landscape of transposable element variation, and genomic sites subject to post-transcriptional alteration of RNA. From this beginning, the resource has expanded significantly to include 36 fully sequenced inbred laboratory mouse strains, a refined and updated data processing pipeline, and new variation querying and data visualisation tools which are available on the project's website ( http://www.sanger.ac.uk/resources/mouse/genomes/ ). The focus of the project is now the completion of de novo assembled chromosome sequences and strain-specific gene structures for the core strains. We discuss how the assembled chromosomes will power comparative analysis, data access tools and future directions of mouse genetics.

Reclassification of non-type strain Clostridium pasteurianum NRRL B-598 as Clostridium beijerinckii NRRL B-598.

PubMed

Sedlar, Karel; Kolek, Jan; Provaznik, Ivo; Patakova, Petra

2017-02-20

The complete genome sequence of non-type strain Clostridium pasteurianum NRRL B-598 was introduced last year; it is an oxygen tolerant, spore-forming, mesophilic heterofermentative bacterium with high hydrogen production and acetone-butanol fermentation ability. The basic genome statistics have shown its similarity to C. beijerinckii rather than the C. pasteurianum species. Here, we present a comparative analysis of the strain with several other complete clostridial genome sequences. Besides a 16S rRNA gene sequence comparison, digital DNA-DNA hybridization (dDDH) and phylogenomic analysis confirmed an inaccuracy of the taxonomic status of strain Clostridium pasteurianum NRRL B-598. Therefore, we suggest its reclassification to be Clostridium beijerinckii NRRL B-598. This is a specific strain and is not identical to other C. beijerinckii strains. This misclassification explains its unexpected behavior, different from other C. pasteurianum strains; it also permits better understanding of the bacterium for a future genetic manipulation that might increase its biofuel production potential. Copyright © 2017 Elsevier B.V. All rights reserved.

Analysis of the beak and feather disease viral genome indicates the existence of several genotypes which have a complex psittacine host specificity.

PubMed

de Kloet, E; de Kloet, S R

2004-12-01

A study was made of the phylogenetic relationships between fifteen complete nucleotide sequences as well as 43 nucleotide sequences of the putative coat protein gene of different strains belonging to the virus species Beak and feather disease virus obtained from 39 individuals of 16 psittacine species. The species included among others, cockatoos ( Cacatuini), African grey parrots ( Psittacus erithacus) and peach-faced lovebirds ( Agapornis roseicollis), which were infected at different geographical locations, within and outside Australia, the native origin of the virus. The derived amino acid sequences of the putative coat protein were highly diverse, with differences between some strains amounting to 50 of the 250 amino acids. Phylogenetic analysis demonstrated that the putative coat gene sequences form six clusters which show a varying degree of psittacine species specificity. Most, but not all strains infecting African grey parrots formed a single cluster as did the strains infecting the cockatoos. Strains infecting the lovebirds clustered with those infecting such Australasian species as Eclectus roratus, Psittacula kramerii and Psephotus haematogaster. Although individual birds included in this study were, where studied, often infected by closely related strains, infection by highly diverged trains was also detected. The possible relationship between BFD viral strains and clinical disease signs is discussed.

Genetic Relatedness among Hepatitis A Virus Strains Associated with Food-Borne Outbreaks

PubMed Central

Vaughan, Gilberto; Xia, Guoliang; Forbi, Joseph C.; Purdy, Michael A.; Rossi, Lívia Maria Gonçalves; Spradling, Philip R.; Khudyakov, Yury E.

2013-01-01

The genetic characterization of hepatitis A virus (HAV) strains is commonly accomplished by sequencing subgenomic regions, such as the VP1/P2B junction. HAV genome is not extensively variable, thus presenting opportunity for sharing sequences of subgenomic regions among genetically unrelated isolates. The degree of misrepresentation of phylogenetic relationships by subgenomic regions is especially important for tracking transmissions. Here, we analyzed whole-genome (WG) sequences of 101 HAV strains identified from 4 major multi-state, food-borne outbreaks of hepatitis A in the Unites States and from 14 non-outbreak-related HAV strains that shared identical VP1/P2B sequences with the outbreak strains. Although HAV strains with an identical VP1/P2B sequence were specific to each outbreak, WG were different, with genetic diversity reaching 0.31% (mean 0.09%). Evaluation of different subgenomic regions did not identify any other section of the HAV genome that could accurately represent phylogenetic relationships observed using WG sequences. The identification of 2–3 dominant HAV strains in 3 out of 4 outbreaks indicates contamination of the implicated food items with a heterogeneous HAV population. However, analysis of intra-host HAV variants from eight patients involved in one outbreak showed that only a single sequence variant established infection in each patient. Four non-outbreak strains were found closely related to strains from 2 outbreaks, whereas ten were genetically different from the outbreak strains. Thus, accurate tracking of HAV strains can be accomplished using HAV WG sequences, while short subgenomic regions are useful for identification of transmissions only among cases with known epidemiological association. PMID:24223112

Flavivirus and Filovirus EvoPrinters: New alignment tools for the comparative analysis of viral evolution.

PubMed

Brody, Thomas; Yavatkar, Amarendra S; Park, Dong Sun; Kuzin, Alexander; Ross, Jermaine; Odenwald, Ward F

2017-06-01

Flavivirus and Filovirus infections are serious epidemic threats to human populations. Multi-genome comparative analysis of these evolving pathogens affords a view of their essential, conserved sequence elements as well as progressive evolutionary changes. While phylogenetic analysis has yielded important insights, the growing number of available genomic sequences makes comparisons between hundreds of viral strains challenging. We report here a new approach for the comparative analysis of these hemorrhagic fever viruses that can superimpose an unlimited number of one-on-one alignments to identify important features within genomes of interest. We have adapted EvoPrinter alignment algorithms for the rapid comparative analysis of Flavivirus or Filovirus sequences including Zika and Ebola strains. The user can input a full genome or partial viral sequence and then view either individual comparisons or generate color-coded readouts that superimpose hundreds of one-on-one alignments to identify unique or shared identity SNPs that reveal ancestral relationships between strains. The user can also opt to select a database genome in order to access a library of pre-aligned genomes of either 1,094 Flaviviruses or 460 Filoviruses for rapid comparative analysis with all database entries or a select subset. Using EvoPrinter search and alignment programs, we show the following: 1) superimposing alignment data from many related strains identifies lineage identity SNPs, which enable the assessment of sublineage complexity within viral outbreaks; 2) whole-genome SNP profile screens uncover novel Dengue2 and Zika recombinant strains and their parental lineages; 3) differential SNP profiling identifies host cell A-to-I hyper-editing within Ebola and Marburg viruses, and 4) hundreds of superimposed one-on-one Ebola genome alignments highlight ultra-conserved regulatory sequences, invariant amino acid codons and evolutionarily variable protein-encoding domains within a single genome. EvoPrinter allows for the assessment of lineage complexity within Flavivirus or Filovirus outbreaks, identification of recombinant strains, highlights sequences that have undergone host cell A-to-I editing, and identifies unique input and database SNPs within highly conserved sequences. EvoPrinter's ability to superimpose alignment data from hundreds of strains onto a single genome has allowed us to identify unique Zika virus sublineages that are currently spreading in South, Central and North America, the Caribbean, and in China. This new set of integrated alignment programs should serve as a useful addition to existing tools for the comparative analysis of these viruses.

Complete Genome Sequence of Lactobacillus rhamnosus Strain BPL5 (CECT 8800), a Probiotic for Treatment of Bacterial Vaginosis.

PubMed

Chenoll, Empar; Codoñer, Francisco M; Martinez-Blanch, Juan F; Ramón, Daniel; Genovés, Salvador; Menabrito, Marco

2016-04-21

ITALIC! Lactobacillus rhamnosusBPL5 (CECT 8800), is a probiotic strain suitable for the treatment of bacterial vaginosis. Here, we report its complete genome sequence deciphered by PacBio single-molecule real-time (SMRT) technology. Analysis of the sequence may provide insight into its functional activity. Copyright © 2016 Chenoll et al.

Spatiotemporal Phylogenetic Analysis and Molecular Characterisation of Infectious Bursal Disease Viruses Based on the VP2 Hyper-Variable Region

PubMed Central

Dolz, Roser; Valle, Rosa; Perera, Carmen L.; Bertran, Kateri; Frías, Maria T.; Majó, Natàlia; Ganges, Llilianne; Pérez, Lester J.

2013-01-01

Background Infectious bursal disease is a highly contagious and acute viral disease caused by the infectious bursal disease virus (IBDV); it affects all major poultry producing areas of the world. The current study was designed to rigorously measure the global phylogeographic dynamics of IBDV strains to gain insight into viral population expansion as well as the emergence, spread and pattern of the geographical structure of very virulent IBDV (vvIBDV) strains. Methodology/Principal Findings Sequences of the hyper-variable region of the VP2 (HVR-VP2) gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank database; Cuban sequences were obtained in the current work. All sequences were analysed by Bayesian phylogeographic analysis, implemented in the Bayesian Evolutionary Analysis Sampling Trees (BEAST), Bayesian Tip-association Significance testing (BaTS) and Spatial Phylogenetic Reconstruction of Evolutionary Dynamics (SPREAD) software packages. Selection pressure on the HVR-VP2 was also assessed. The phylogeographic association-trait analysis showed that viruses sampled from individual countries tend to cluster together, suggesting a geographic pattern for IBDV strains. Spatial analysis from this study revealed that strains carrying sequences that were linked to increased virulence of IBDV appeared in Iran in 1981 and spread to Western Europe (Belgium) in 1987, Africa (Egypt) around 1990, East Asia (China and Japan) in 1993, the Caribbean Region (Cuba) by 1995 and South America (Brazil) around 2000. Selection pressure analysis showed that several codons in the HVR-VP2 region were under purifying selection. Conclusions/Significance To our knowledge, this work is the first study applying the Bayesian phylogeographic reconstruction approach to analyse the emergence and spread of vvIBDV strains worldwide. PMID:23805195

Spatiotemporal Phylogenetic Analysis and Molecular Characterisation of Infectious Bursal Disease Viruses Based on the VP2 Hyper-Variable Region.

PubMed

Alfonso-Morales, Abdulahi; Martínez-Pérez, Orlando; Dolz, Roser; Valle, Rosa; Perera, Carmen L; Bertran, Kateri; Frías, Maria T; Majó, Natàlia; Ganges, Llilianne; Pérez, Lester J

2013-01-01

Infectious bursal disease is a highly contagious and acute viral disease caused by the infectious bursal disease virus (IBDV); it affects all major poultry producing areas of the world. The current study was designed to rigorously measure the global phylogeographic dynamics of IBDV strains to gain insight into viral population expansion as well as the emergence, spread and pattern of the geographical structure of very virulent IBDV (vvIBDV) strains. Sequences of the hyper-variable region of the VP2 (HVR-VP2) gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank database; Cuban sequences were obtained in the current work. All sequences were analysed by Bayesian phylogeographic analysis, implemented in the Bayesian Evolutionary Analysis Sampling Trees (BEAST), Bayesian Tip-association Significance testing (BaTS) and Spatial Phylogenetic Reconstruction of Evolutionary Dynamics (SPREAD) software packages. Selection pressure on the HVR-VP2 was also assessed. The phylogeographic association-trait analysis showed that viruses sampled from individual countries tend to cluster together, suggesting a geographic pattern for IBDV strains. Spatial analysis from this study revealed that strains carrying sequences that were linked to increased virulence of IBDV appeared in Iran in 1981 and spread to Western Europe (Belgium) in 1987, Africa (Egypt) around 1990, East Asia (China and Japan) in 1993, the Caribbean Region (Cuba) by 1995 and South America (Brazil) around 2000. Selection pressure analysis showed that several codons in the HVR-VP2 region were under purifying selection. To our knowledge, this work is the first study applying the Bayesian phylogeographic reconstruction approach to analyse the emergence and spread of vvIBDV strains worldwide.

Isolation of an insertion sequence (IS1051) from Xanthomonas campestris pv. dieffenbachiae with potential use for strain identification and characterization.

PubMed Central

Berthier, Y; Thierry, D; Lemattre, M; Guesdon, J L

1994-01-01

A new insertion sequence was isolated from Xanthomonas campestris pv. dieffenbachiae. Sequence analysis showed that this element is 1,158 bp long and has 15-bp inverted repeat ends containing two mismatches. Comparison of this sequence with sequences in data bases revealed significant homology with Escherichia coli IS5. IS1051, which detected multiple restriction fragment length polymorphisms, was used as a probe to characterize strains from the pathovar dieffenbachiae. Images PMID:7906933

Lactobacillus wasatchensis sp. nov., a non-starter lactic acid bacteria isolated from aged Cheddar cheese.

PubMed

Oberg, Craig J; Oberg, Taylor S; Culumber, Michele D; Ortakci, Fatih; Broadbent, Jeffery R; McMahon, Donald J

2016-01-01

A Gram-stain positive, rod-shaped, non-spore-forming strain (WDC04T), which may be associated with late gas production in cheese, was isolated from aged Cheddar cheese following incubation on MRS agar (pH 5.2) at 6 °C for 35 days. Strain WDC04T had 97 % 16S rRNA gene sequence similarity with Lactobacillus hokkaidonensis DSM 26202T, Lactobacillus oligofermentans 533, 'Lactobacillus danicus' 9M3, Lactobacillus suebicus CCUG 32233T and Lactobacillus vaccinostercus DSM 20634T. API 50 CH carbohydrate fermentation panels indicated strain WDC04T could only utilize one of the 50 substrates tested, ribose, although it does slowly utilize galactose. In the API ZYM system, strain WDC04T was positive for leucine arylamidase, valine arylamidase, cysteine arylamidase (weakly), naphthol-AS-BI-phosphohydrolase and β-galactosidase activities. Total genomic DNA was sequenced from strain WDC04T using a whole-genome shotgun strategy on a 454 GS Titanium pyrosequencer. The sequence was assembled into a 1.90 Mbp draft genome consisting of 105 contigs with preliminary genome annotation performed using the RAST algorithm (rast.nmpdr.org). Genome analysis confirmed the pentose phosphate pathway for ribose metabolism as well as galactose, N-acetylglucosamine, and glycerol fermentation pathways. Genomic analysis places strain WDC04T in the obligately heterofermentative group of lactobacilli and metabolic results confirm this conclusion. The result of genome sequencing, along with 16S rRNA gene sequence analysis, indicates WDC04T represents a novel species of the genus Lactobacillus, for which the name Lactobacillus wasatchensis sp. nov. is proposed. The type strain is WDC04T ( = DSM 29958T = LMG 28678T).

Whole-genome comparative analysis of three phytopathogenic Xylella fastidiosa strains.

PubMed

Bhattacharyya, Anamitra; Stilwagen, Stephanie; Ivanova, Natalia; D'Souza, Mark; Bernal, Axel; Lykidis, Athanasios; Kapatral, Vinayak; Anderson, Iain; Larsen, Niels; Los, Tamara; Reznik, Gary; Selkov, Eugene; Walunas, Theresa L; Feil, Helene; Feil, William S; Purcell, Alexander; Lassez, Jean-Louis; Hawkins, Trevor L; Haselkorn, Robert; Overbeek, Ross; Predki, Paul F; Kyrpides, Nikos C

2002-09-17

Xylella fastidiosa (Xf) causes wilt disease in plants and is responsible for major economic and crop losses globally. Owing to the public importance of this phytopathogen we embarked on a comparative analysis of the complete genome of Xf pv citrus and the partial genomes of two recently sequenced strains of this species: Xf pv almond and Xf pv oleander, which cause leaf scorch in almond and oleander plants, respectively. We report a reanalysis of the previously sequenced Xf 9a5c (CVC, citrus) strain and the two "gapped" Xf genomes revealing ORFs encoding critical functions in pathogenicity and conjugative transfer. Second, a detailed whole-genome functional comparison was based on the three sequenced Xf strains, identifying the unique genes present in each strain, in addition to those shared between strains. Third, an "in silico" cellular reconstruction of these organisms was made, based on a comparison of their core functional subsystems that led to a characterization of their conjugative transfer machinery, identification of potential differences in their adhesion mechanisms, and highlighting of the absence of a classical quorum-sensing mechanism. This study demonstrates the effectiveness of comparative analysis strategies in the interpretation of genomes that are closely related.

Lactobacillus fabifermentans sp. nov. and Lactobacillus cacaonum sp. nov., isolated from Ghanaian cocoa fermentations.

PubMed

De Bruyne, Katrien; Camu, Nicholas; De Vuyst, Luc; Vandamme, Peter

2009-01-01

Two Gram-positive bacterial strains, LMG 24284T and LMG 24285T, were isolated from different spontaneous cocoa bean heap fermentations in Ghana. Analysis of their 16S rRNA gene sequences indicated that they were members of the Lactobacillus plantarum and Lactobacillus salivarius species groups, respectively. DNA-DNA hybridization experiments with their nearest phylogenetic neighbours demonstrated that both strains represented novel species that could be differentiated from their nearest neighbours by pheS sequence analysis, whole-cell protein electrophoresis, fluorescent amplified fragment length polymorphism analysis and biochemical characterization. Therefore, two novel Lactobacillus species are proposed, Lactobacillus fabifermentans sp. nov. (type strain LMG 24284T =DSM 21115T) and Lactobacillus cacaonum sp. nov. (type strain LMG 24285T =DSM 21116T).

Methylobacterium phyllosphaerae sp. nov., a pink-pigmented, facultative methylotroph from the phyllosphere of rice.

PubMed

Madhaiyan, Munusamy; Poonguzhali, Selvaraj; Kwon, Soon-Wo; Sa, Tong-Min

2009-01-01

A pink-pigmented, aerobic, facultatively methylotrophic bacterial strain, CBMB27T, isolated from leaf tissues of rice (Oryza sativa L. 'Dong-Jin'), was analysed using a polyphasic taxonomic approach. Comparative 16S rRNA gene sequence-based phylogenetic analysis placed the strain in a clade with the species Methylobacterium oryzae, Methylobacterium fujisawaense and Methylobacterium mesophilicum; strain CBMB27T showed sequence similarities of 98.3, 98.5 and 97.3 %, respectively, to the type strains of these three species. DNA-DNA hybridization experiments revealed low levels (<38 %) of DNA-DNA relatedness between strain CBMB27T and its closest relatives. The sequence of the 1-aminocyclopropane-1-carboxylate deaminase gene (acdS) in strain CBMB27T differed from those of close relatives. The major fatty acid of the isolate was C(18 : 1)omega7c and the G+C content of the genomic DNA was 66.8 mol%. Based on the results of 16S rRNA gene sequence analysis, DNA-DNA hybridization, and physiological and biochemical characterization, which enabled the isolate to be differentiated from all recognized species of the genus Methylobacterium, it was concluded that strain CBMB27T represents a novel species in the genus Methylobacterium for which the name Methylobacterium phyllosphaerae sp. nov. is proposed (type strain CBMB27T =LMG 24361T =KACC 11716T =DSM 19779T).

Genome Sequence of African Swine Fever Virus BA71, the Virulent Parental Strain of the Nonpathogenic and Tissue-Culture Adapted BA71V.

PubMed

Rodríguez, Javier M; Moreno, Leticia Tais; Alejo, Alí; Lacasta, Anna; Rodríguez, Fernando; Salas, María L

2015-01-01

The strain BA71V has played a key role in African swine fever virus (ASFV) research. It was the first genome sequenced, and remains the only genome completely determined. A large part of the studies on the function of ASFV genes, viral transcription, replication, DNA repair and morphogenesis, has been performed using this model. This avirulent strain was obtained by adaptation to grow in Vero cells of the highly virulent BA71 strain. We report here the analysis of the genome sequence of BA71 in comparison with that of BA71V. They possess the smallest genomes for a virulent or an attenuated ASFV, and are essentially identical except for a relatively small number of changes. We discuss the possible contribution of these changes to virulence. Analysis of the BA71 sequence allowed us to identify new similarities among ASFV proteins, and with database proteins including two ASFV proteins that could function as a two-component signaling network.

Added Value of Next-Generation Sequencing for Multilocus Sequence Typing Analysis of a Pneumocystis jirovecii Pneumonia Outbreak1.

PubMed

Charpentier, Elena; Garnaud, Cécile; Wintenberger, Claire; Bailly, Sébastien; Murat, Jean-Benjamin; Rendu, John; Pavese, Patricia; Drouet, Thibault; Augier, Caroline; Malvezzi, Paolo; Thiébaut-Bertrand, Anne; Mallaret, Marie-Reine; Epaulard, Olivier; Cornet, Muriel; Larrat, Sylvie; Maubon, Danièle

2017-08-01

Pneumocystis jirovecii is a major threat for immunocompromised patients, and clusters of pneumocystis pneumonia (PCP) have been increasingly described in transplant units during the past decade. Exploring an outbreak transmission network requires complementary spatiotemporal and strain-typing approaches. We analyzed a PCP outbreak and demonstrated the added value of next-generation sequencing (NGS) for the multilocus sequence typing (MLST) study of P. jirovecii strains. Thirty-two PCP patients were included. Among the 12 solid organ transplant patients, 5 shared a major and unique genotype that was also found as a minor strain in a sixth patient. A transmission map analysis strengthened the suspicion of nosocomial acquisition of this strain for the 6 patients. NGS-MLST enables accurate determination of subpopulation, which allowed excluding other patients from the transmission network. NGS-MLST genotyping approach was essential to deciphering this outbreak. This innovative approach brings new insights for future epidemiologic studies on this uncultivable opportunistic fungus.

Added Value of Next-Generation Sequencing for Multilocus Sequence Typing Analysis of a Pneumocystis jirovecii Pneumonia Outbreak1

PubMed Central

Charpentier, Elena; Garnaud, Cécile; Wintenberger, Claire; Bailly, Sébastien; Murat, Jean-Benjamin; Rendu, John; Pavese, Patricia; Drouet, Thibault; Augier, Caroline; Malvezzi, Paolo; Thiébaut-Bertrand, Anne; Mallaret, Marie-Reine; Epaulard, Olivier; Cornet, Muriel; Larrat, Sylvie

2017-01-01

Pneumocystis jirovecii is a major threat for immunocompromised patients, and clusters of pneumocystis pneumonia (PCP) have been increasingly described in transplant units during the past decade. Exploring an outbreak transmission network requires complementary spatiotemporal and strain-typing approaches. We analyzed a PCP outbreak and demonstrated the added value of next-generation sequencing (NGS) for the multilocus sequence typing (MLST) study of P. jirovecii strains. Thirty-two PCP patients were included. Among the 12 solid organ transplant patients, 5 shared a major and unique genotype that was also found as a minor strain in a sixth patient. A transmission map analysis strengthened the suspicion of nosocomial acquisition of this strain for the 6 patients. NGS-MLST enables accurate determination of subpopulation, which allowed excluding other patients from the transmission network. NGS-MLST genotyping approach was essential to deciphering this outbreak. This innovative approach brings new insights for future epidemiologic studies on this uncultivable opportunistic fungus. PMID:28726611

Characterization of Powassan viruses from Far Eastern Russia.

PubMed

Leonova, Galina N; Kondratov, Ilia G; Ternovoi, Vladimir A; Romanova, Elena V; Protopopova, Elena V; Chausov, Eugene V; Pavlenko, Elena V; Ryabchikova, Elena I; Belikov, Sergey I; Loktev, Valery B

2009-01-01

We report the isolation and detailed characterization of the novel strain, Partizansk/2006, of Powassan virus (POWV) from a human case of infection, which occurred in Primorsky krai, Russia, in 2006. Comparative complete genome sequence analysis of the Far Eastern strains Spassk-9 (1975), Nadezdinsk-1991 and Partizansk/2006 of POWV revealed that these strains are 99.8% similar to the LB strain, which was isolated in Canada in 1958. Phylogenetic analysis of 5' UTR sequences of five other strains of POWV isolated from 1972 to 1986 in Primorsky krai produced similar results. Presumably, Far Eastern POWV has common putative ancestor with LB strain POWV from North America, and the time of divergence of these POWVs is relatively short. We conclude that POWV has become endemic in Far Eastern Russia.

Genomic analyses of Clostridium perfringens isolates from five toxinotypes.

PubMed

Hassan, Karl A; Elbourne, Liam D H; Tetu, Sasha G; Melville, Stephen B; Rood, Julian I; Paulsen, Ian T

2015-05-01

Clostridium perfringens can be isolated from a range of environments, including soil, marine and fresh water sediments, and the gastrointestinal tracts of animals and humans. Some C. perfringens strains have attractive industrial applications, e.g., in the degradation of waste products or the production of useful chemicals. However, C. perfringens has been most studied as the causative agent of a range of enteric and soft tissue infections of varying severities in humans and animals. Host preference and disease type in C. perfringens are intimately linked to the production of key extracellular toxins and on this basis toxigenic C. perfringens strains have been classified into five toxinotypes (A-E). To date, twelve genome sequences have been generated for a diverse collection of C. perfringens isolates, including strains associated with human and animal infections, a human commensal strain, and a strain with potential industrial utility. Most of the sequenced strains are classified as toxinotype A. However, genome sequences of representative strains from each of the other four toxinotypes have also been determined. Analysis of this collection of sequences has highlighted a lack of features differentiating toxinotype A strains from the other isolates, indicating that the primary defining characteristic of toxinotype A strains is their lack of key plasmid-encoded extracellular toxin genes associated with toxinotype B to E strains. The representative B-E strains sequenced to date each harbour many unique genes. Additional genome sequences are needed to determine if these genes are characteristic of their respective toxinotypes. Copyright © 2014. Published by Elsevier Masson SAS.

Chromosomal Copy Number Variation in Saccharomyces pastorianus Is Evidence for Extensive Genome Dynamics in Industrial Lager Brewing Strains.

PubMed

van den Broek, M; Bolat, I; Nijkamp, J F; Ramos, E; Luttik, M A H; Koopman, F; Geertman, J M; de Ridder, D; Pronk, J T; Daran, J-M

2015-09-01

Lager brewing strains of Saccharomyces pastorianus are natural interspecific hybrids originating from the spontaneous hybridization of Saccharomyces cerevisiae and Saccharomyces eubayanus. Over the past 500 years, S. pastorianus has been domesticated to become one of the most important industrial microorganisms. Production of lager-type beers requires a set of essential phenotypes, including the ability to ferment maltose and maltotriose at low temperature, the production of flavors and aromas, and the ability to flocculate. Understanding of the molecular basis of complex brewing-related phenotypic traits is a prerequisite for rational strain improvement. While genome sequences have been reported, the variability and dynamics of S. pastorianus genomes have not been investigated in detail. Here, using deep sequencing and chromosome copy number analysis, we showed that S. pastorianus strain CBS1483 exhibited extensive aneuploidy. This was confirmed by quantitative PCR and by flow cytometry. As a direct consequence of this aneuploidy, a massive number of sequence variants was identified, leading to at least 1,800 additional protein variants in S. pastorianus CBS1483. Analysis of eight additional S. pastorianus strains revealed that the previously defined group I strains showed comparable karyotypes, while group II strains showed large interstrain karyotypic variability. Comparison of three strains with nearly identical genome sequences revealed substantial chromosome copy number variation, which may contribute to strain-specific phenotypic traits. The observed variability of lager yeast genomes demonstrates that systematic linking of genotype to phenotype requires a three-dimensional genome analysis encompassing physical chromosomal structures, the copy number of individual chromosomes or chromosomal regions, and the allelic variation of copies of individual genes. Copyright © 2015, van den Broek et al.

Chromosomal Copy Number Variation in Saccharomyces pastorianus Is Evidence for Extensive Genome Dynamics in Industrial Lager Brewing Strains

PubMed Central

van den Broek, M.; Bolat, I.; Nijkamp, J. F.; Ramos, E.; Luttik, M. A. H.; Koopman, F.; Geertman, J. M.; de Ridder, D.; Pronk, J. T.

2015-01-01

Lager brewing strains of Saccharomyces pastorianus are natural interspecific hybrids originating from the spontaneous hybridization of Saccharomyces cerevisiae and Saccharomyces eubayanus. Over the past 500 years, S. pastorianus has been domesticated to become one of the most important industrial microorganisms. Production of lager-type beers requires a set of essential phenotypes, including the ability to ferment maltose and maltotriose at low temperature, the production of flavors and aromas, and the ability to flocculate. Understanding of the molecular basis of complex brewing-related phenotypic traits is a prerequisite for rational strain improvement. While genome sequences have been reported, the variability and dynamics of S. pastorianus genomes have not been investigated in detail. Here, using deep sequencing and chromosome copy number analysis, we showed that S. pastorianus strain CBS1483 exhibited extensive aneuploidy. This was confirmed by quantitative PCR and by flow cytometry. As a direct consequence of this aneuploidy, a massive number of sequence variants was identified, leading to at least 1,800 additional protein variants in S. pastorianus CBS1483. Analysis of eight additional S. pastorianus strains revealed that the previously defined group I strains showed comparable karyotypes, while group II strains showed large interstrain karyotypic variability. Comparison of three strains with nearly identical genome sequences revealed substantial chromosome copy number variation, which may contribute to strain-specific phenotypic traits. The observed variability of lager yeast genomes demonstrates that systematic linking of genotype to phenotype requires a three-dimensional genome analysis encompassing physical chromosomal structures, the copy number of individual chromosomes or chromosomal regions, and the allelic variation of copies of individual genes. PMID:26150454

Comparative genomic analysis of clinical and environmental strains provides insight into the pathogenicity and evolution of Vibrio parahaemolyticus.

PubMed

Li, Lei; Wong, Hin-chung; Nong, Wenyan; Cheung, Man Kit; Law, Patrick Tik Wan; Kam, Kai Man; Kwan, Hoi Shan

2014-12-18

Vibrio parahaemolyticus is a Gram-negative halophilic bacterium. Infections with the bacterium could become systemic and can be life-threatening to immunocompromised individuals. Genome sequences of a few clinical isolates of V. parahaemolyticus are currently available, but the genome dynamics across the species and virulence potential of environmental strains on a genome-scale have not been described before. Here we present genome sequences of four V. parahaemolyticus clinical strains from stool samples of patients and five environmental strains in Hong Kong. Phylogenomics analysis based on single nucleotide polymorphisms revealed a clear distinction between the clinical and environmental isolates. A new gene cluster belonging to the biofilm associated proteins of V. parahaemolyticus was found in clincial strains. In addition, a novel small genomic island frequently found among clinical isolates was reported. A few environmental strains were found harboring virulence genes and prophage elements, indicating their virulence potential. A unique biphenyl degradation pathway was also reported. A database for V. parahaemolyticus (http://kwanlab.bio.cuhk.edu.hk/vp) was constructed here as a platform to access and analyze genome sequences and annotations of the bacterium. We have performed a comparative genomics analysis of clinical and environmental strains of V. parahaemolyticus. Our analyses could facilitate understanding of the phylogenetic diversity and niche adaptation of this bacterium.

Nucleotide sequence analysis of a DNA region involved in capsular polysaccharide biosynthesis reveals the molecular basis of the nontypeability of two Actinobacillus pleuropneumoniae isolates.

PubMed

Ito, Hiroya; Ogawa, Torata; Fukamizu, Dai; Morinaga, Yuiko; Kusumoto, Masahiro

2016-11-01

The aim of our study was to reveal the molecular basis of the serologic nontypeability of 2 Actinobacillus pleuropneumoniae field isolates. Nine field strains of A. pleuropneumoniae, the causative agent of porcine pleuropneumonia, were isolated from pigs raised on the same farm and sent to our diagnostic laboratory for serotyping. Seven of the 9 strains were identified as serovar 15 strains by immunodiffusion tests. However, 2 strains, designated FH24-2 and FH24-5, could not be serotyped with antiserum prepared against serovars 1-15. Strain FH24-5 showed positive results in 2 serovar 15-specific PCR tests, whereas strain FH24-2 was only positive in 1 of the 2 PCR tests. The nucleotide sequence analysis of gene clusters involved in capsular polysaccharide biosynthesis of the 2 nontypeable strains revealed that both had been rendered nontypeable by the action of ISApl1, a transposable element of A. pleuropneumoniae belonging to the IS30 family. The results showed that ISApl1 of A. pleuropneumoniae can interfere with both the serologic and molecular typing methods, and that nucleotide sequence analysis across the capsular gene clusters is the best means of determining the cause of serologic nontypeability in A. pleuropneumoniae. © 2016 The Author(s).

Population Structure and Antimicrobial Resistance Profiles of Streptococcus suis Serotype 2 Sequence Type 25 Strains.

PubMed

Athey, Taryn B T; Teatero, Sarah; Takamatsu, Daisuke; Wasserscheid, Jessica; Dewar, Ken; Gottschalk, Marcelo; Fittipaldi, Nahuel

2016-01-01

Strains of serotype 2 Streptococcus suis are responsible for swine and human infections. Different serotype 2 genetic backgrounds have been defined using multilocus sequence typing (MLST). However, little is known about the genetic diversity within each MLST sequence type (ST). Here, we used whole-genome sequencing to test the hypothesis that S. suis serotype 2 strains of the ST25 lineage are genetically heterogeneous. We evaluated 51 serotype 2 ST25 S. suis strains isolated from diseased pigs and humans in Canada, the United States of America, and Thailand. Whole-genome sequencing revealed numerous large-scale rearrangements in the ST25 genome, compared to the genomes of ST1 and ST28 S. suis strains, which result, among other changes, in disruption of a pilus island locus. We report that recombination and lateral gene transfer contribute to ST25 genetic diversity. Phylogenetic analysis identified two main and distinct Thai and North American clades grouping most strains investigated. These clades also possessed distinct patterns of antimicrobial resistance genes, which correlated with acquisition of different integrative and conjugative elements (ICEs). Some of these ICEs were found to be integrated at a recombination hot spot, previously identified as the site of integration of the 89K pathogenicity island in serotype 2 ST7 S. suis strains. Our results highlight the limitations of MLST for phylogenetic analysis of S. suis, and the importance of lateral gene transfer and recombination as drivers of diversity in this swine pathogen and zoonotic agent.

Population Structure and Antimicrobial Resistance Profiles of Streptococcus suis Serotype 2 Sequence Type 25 Strains

PubMed Central

Athey, Taryn B. T.; Teatero, Sarah; Takamatsu, Daisuke; Wasserscheid, Jessica; Dewar, Ken; Gottschalk, Marcelo; Fittipaldi, Nahuel

2016-01-01

Strains of serotype 2 Streptococcus suis are responsible for swine and human infections. Different serotype 2 genetic backgrounds have been defined using multilocus sequence typing (MLST). However, little is known about the genetic diversity within each MLST sequence type (ST). Here, we used whole-genome sequencing to test the hypothesis that S. suis serotype 2 strains of the ST25 lineage are genetically heterogeneous. We evaluated 51 serotype 2 ST25 S. suis strains isolated from diseased pigs and humans in Canada, the United States of America, and Thailand. Whole-genome sequencing revealed numerous large-scale rearrangements in the ST25 genome, compared to the genomes of ST1 and ST28 S. suis strains, which result, among other changes, in disruption of a pilus island locus. We report that recombination and lateral gene transfer contribute to ST25 genetic diversity. Phylogenetic analysis identified two main and distinct Thai and North American clades grouping most strains investigated. These clades also possessed distinct patterns of antimicrobial resistance genes, which correlated with acquisition of different integrative and conjugative elements (ICEs). Some of these ICEs were found to be integrated at a recombination hot spot, previously identified as the site of integration of the 89K pathogenicity island in serotype 2 ST7 S. suis strains. Our results highlight the limitations of MLST for phylogenetic analysis of S. suis, and the importance of lateral gene transfer and recombination as drivers of diversity in this swine pathogen and zoonotic agent. PMID:26954687

[Phylogenetic and diversity analysis of Acidithiobacillus spp. based on 16S rRNA and RubisCO genes homologues].

PubMed

Liu, Minrui; Lin, Pengwu; Qi, Xing'e; Ni, Yongqing

2016-04-14

The purpose of the study was to reveal geographic region-related Acidithiobacillus spp. distribution and allopatric speciation. Phylogenetic and diversity analysis was done to expand our knowledge on microbial phylogeography, diversity-maintaining mechanisms and molecular biogeography. We amplified 16S rRNA gene and RubisCO genes to construct corresponding phylogenetic trees based on the sequence homology and analyzed genetic diversity of Acidithiobacillus spp.. Thirty-five strains were isolated from three different regions in China (Yunnan, Hubei, Xinjiang). The whole isolates were classified into five groups. Four strains were identified as A. ferrivorans, six as A. ferridurans, YNTR4-15 Leptspirillum ferrooxidans and HBDY3-31 as Leptospirillum ferrodiazotrophum. The remaining strains were identified as A. ferrooxidans. Analysis of cbbL and cbbM genes sequences of representative 26 strains indicated that cbbL gene of 19 were two copies (cbbL1 and cbbL2) and 7 possessed only cbbL1. cbbM gene was single copy. In nucleotide-based trees, cbbL1 gene sequences of strains were separated into three sequence types, and the cbbL2 was similar to cbbL1 with three types. Codon bias of RubisCO genes was not obvious in Acidithiobacillus spp.. Strains isolated from three different regions in China indicated a great genetic diversity in Acidithiobacillus spp. and their 16S rRNA/RubisCO genes sequence was of significant difference. Phylogenetic tree based on 16S rRNA genes and RubisCO genes was different in Acidithiobacillus spp..

What constitutes an Arabian Helicobacter pylori? Lessons from comparative genomics.

PubMed

Kumar, Narender; Albert, M John; Al Abkal, Hanan; Siddique, Iqbal; Ahmed, Niyaz

2017-02-01

Helicobacter pylori, the human gastric pathogen, causes a variety of gastric diseases ranging from mild gastritis to gastric cancer. While the studies on H. pylori are dominated by those based on either East Asian or Western strains, information regarding H. pylori strains prevalent in the Middle East remains scarce. Therefore, we carried out whole-genome sequencing and comparative analysis of three H. pylori strains isolated from three native Arab, Kuwaiti patients. H. pylori strains were sequenced using Illumina platform. The sequence reads were filtered and draft genomes were assembled and annotated. Various pathogenicity-associated regions and phages present within the genomes were identified. Phylogenetic analysis was carried out to determine the genetic relatedness of Kuwaiti strains to various lineages of H. pylori. The core genome content and virulence-related genes were analyzed to assess the pathogenic potential. The three genomes clustered along with HpEurope strains in the phylogenetic tree comprising various H. pylori lineages. A total of 1187 genes spread among various functional classes were identified in the core genome analysis. The three genomes possessed a complete cagPAI and also retained most of the known outer membrane proteins as well as virulence-related genes. The cagA gene in all three strains consisted of an AB-C type EPIYA motif. The comparative genomic analysis of Kuwaiti H. pylori strains revealed a European ancestry and a high pathogenic potential. © 2016 John Wiley & Sons Ltd.

Genome Sequence of a Heterotrophic Nitrifier and Aerobic Denitrifier, Paracoccus denitrificans Strain ISTOD1, Isolated from Wastewater

PubMed Central

Medhi, Kristina; Mishra, Arti

2018-01-01

ABSTRACT We report here the draft genome sequence of Paracoccus denitrificans strain ISTOD1 of 4.9 Mb, isolated from wastewater. It has been identified as a heterotrophic nitrifying and aerobic denitrifying bacterium. Genomic analysis revealed genes related to nitrogen and phosphorus removal, showing that the strain holds potential for bioremediation and biorefinery uses. PMID:29650568

Campylobacter iguaniorum sp. nov., isolated from reptiles.

PubMed

Gilbert, Maarten J; Kik, Marja; Miller, William G; Duim, Birgitta; Wagenaar, Jaap A

2015-03-01

During sampling of reptiles for members of the class Epsilonproteobacteria, strains representing a member of the genus Campylobacter not belonging to any of the established taxa were isolated from lizards and chelonians. Initial amplified fragment length polymorphism, PCR and 16S rRNA sequence analysis showed that these strains were most closely related to Campylobacter fetus and Campylobacter hyointestinalis. A polyphasic study was undertaken to determine the taxonomic position of five strains. The strains were characterized by 16S rRNA and atpA sequence analysis, matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry and conventional phenotypic testing. Whole-genome sequences were determined for strains 1485E(T) and 2463D, and the average nucleotide and amino acid identities were determined for these strains. The strains formed a robust phylogenetic clade, divergent from all other species of the genus Campylobacter. In contrast to most currently known members of the genus Campylobacter, the strains showed growth at ambient temperatures, which might be an adaptation to their reptilian hosts. The results of this study clearly show that these strains isolated from reptiles represent a novel species within the genus Campylobacter, for which the name Campylobacter iguaniorum sp. nov. is proposed. The type strain is 1485E(T) ( = LMG 28143(T) = CCUG 66346(T)). © 2015 IUMS.

Analysis on the DNA Fingerprinting of Aspergillus Oryzae Mutant Induced by High Hydrostatic Pressure

NASA Astrophysics Data System (ADS)

Wang, Hua; Zhang, Jian; Yang, Fan; Wang, Kai; Shen, Si-Le; Liu, Bing-Bing; Zou, Bo; Zou, Guang-Tian

2011-01-01

The mutant strains of aspergillus oryzae (HP300a) are screened under 300 MPa for 20 min. Compared with the control strains, the screened mutant strains have unique properties such as genetic stability, rapid growth, lots of spores, and high protease activity. Random amplified polymorphic DNA (RAPD) and inter simple sequence repeats (ISSR) are used to analyze the DNA fingerprinting of HP300a and the control strains. There are 67.9% and 51.3% polymorphic bands obtained by these two markers, respectively, indicating significant genetic variations between HP300a and the control strains. In addition, comparison of HP300a and the control strains, the genetic distances of random sequence and simple sequence repeat of DNA are 0.51 and 0.34, respectively.

Genome Sequence of Microbulbifer mangrovi DD-13T Reveals Its Versatility to Degrade Multiple Polysaccharides.

PubMed

Imran, Md; Pant, Poonam; Shanbhag, Yogini P; Sawant, Samir V; Ghadi, Sanjeev C

2017-02-01

Microbulbifer mangrovi strain DD-13 T is a novel-type species isolated from the mangroves of Goa, India. The draft genome sequence of strain DD-13 comprised 4,528,106 bp with G+C content of 57.15%. Out of 3479 open reading frames, functions for 3488 protein coding sequences were predicted on the basis of similarity with the cluster of orthologous groups. In addition to protein coding sequences, 34 tRNA genes and 3 rRNA genes were detected. Analysis of nucleotide sequence of predicted gene using a Carbohydrate-Active Enzymes (CAZymes) Analysis Toolkit indicates that strain DD-13 encodes a large set of CAZymes including 255 glycoside hydrolases, 76 carbohydrate esterases, 17 polysaccharide lyases, and 113 carbohydrate-binding modules (CBMs). Many genes from strain DD-13 were annotated as carbohydrases specific for degradation of agar, alginate, carrageenan, chitin, xylan, pullulan, cellulose, starch, β-glucan, pectin, etc. Some of polysaccharide-degrading genes were highly modular and were appended at least with one CBM indicating the versatility of strain DD-13 to degrade complex polysaccharides. The cell growth of strain DD-13 was validated using pure polysaccharides such as agarose or alginate as carbon source as well as by using red and brown seaweed powder as substrate. The homologous carbohydrase produced by strain DD-13 during growth degraded the polysaccharide, ensuring the production of metabolizable reducing sugars. Additionally, several other polysaccharides such as carrageenan, xylan, pullulan, pectin, starch, and carboxymethyl cellulose were also corroborated as growth substrate for strain DD-13 and were associated with concomitant production of homologous carbohydrase.

Comprehensive genomic analysis of a plant growth-promoting rhizobacterium Pantoea agglomerans strain P5.

PubMed

Shariati J, Vahid; Malboobi, Mohammad Ali; Tabrizi, Zeinab; Tavakol, Elahe; Owilia, Parviz; Safari, Maryam

2017-11-15

In this study, we provide a comparative genomic analysis of Pantoea agglomerans strain P5 and 10 closely related strains based on phylogenetic analyses. A next-generation shotgun strategy was implemented using the Illumina HiSeq 2500 technology followed by core- and pan-genome analysis. The genome of P. agglomerans strain P5 contains an assembly size of 5082485 bp with 55.4% G + C content. P. agglomerans consists of 2981 core and 3159 accessory genes for Coding DNA Sequences (CDSs) based on the pan-genome analysis. Strain P5 can be grouped closely with strains PG734 and 299 R using pan and core genes, respectively. All the predicted and annotated gene sequences were allocated to KEGG pathways. Accordingly,  genes involved in plant growth-promoting (PGP) ability, including phosphate solubilization, IAA and siderophore production, acetoin and 2,3-butanediol synthesis and bacterial secretion, were assigned. This study provides an in-depth view of the PGP characteristics of strain P5, highlighting its potential use in agriculture as a biofertilizer.

Defining a Core Genome Multilocus Sequence Typing Scheme for the Global Epidemiology of Vibrio parahaemolyticus.

PubMed

Gonzalez-Escalona, Narjol; Jolley, Keith A; Reed, Elizabeth; Martinez-Urtaza, Jaime

2017-06-01

Vibrio parahaemolyticus is an important human foodborne pathogen whose transmission is associated with the consumption of contaminated seafood, with a growing number of infections reported over recent years worldwide. A multilocus sequence typing (MLST) database for V. parahaemolyticus was created in 2008, and a large number of clones have been identified, causing severe outbreaks worldwide (sequence type 3 [ST3]), recurrent outbreaks in certain regions (e.g., ST36), or spreading to other regions where they are nonendemic (e.g., ST88 or ST189). The current MLST scheme uses sequences of 7 genes to generate an ST, which results in a powerful tool for inferring the population structure of this pathogen, although with limited resolution, especially compared to pulsed-field gel electrophoresis (PFGE). The application of whole-genome sequencing (WGS) has become routine for trace back investigations, with core genome MLST (cgMLST) analysis as one of the most straightforward ways to explore complex genomic data in an epidemiological context. Therefore, there is a need to generate a new, portable, standardized, and more advanced system that provides higher resolution and discriminatory power among V. parahaemolyticus strains using WGS data. We sequenced 92 V. parahaemolyticus genomes and used the genome of strain RIMD 2210633 as a reference (with a total of 4,832 genes) to determine which genes were suitable for establishing a V. parahaemolyticus cgMLST scheme. This analysis resulted in the identification of 2,254 suitable core genes for use in the cgMLST scheme. To evaluate the performance of this scheme, we performed a cgMLST analysis of 92 newly sequenced genomes, plus an additional 142 strains with genomes available at NCBI. cgMLST analysis was able to distinguish related and unrelated strains, including those with the same ST, clearly showing its enhanced resolution over conventional MLST analysis. It also distinguished outbreak-related from non-outbreak-related strains within the same ST. The sequences obtained from this work were deposited and are available in the public database (http://pubmlst.org/vparahaemolyticus). The application of this cgMLST scheme to the characterization of V. parahaemolyticus strains provided by different laboratories from around the world will reveal the global picture of the epidemiology, spread, and evolution of this pathogen and will become a powerful tool for outbreak investigations, allowing for the unambiguous comparison of strains with global coverage. Copyright © 2017 Gonzalez-Escalona et al.

Full-length genome sequence analysis of four subgroup J avian leukosis virus strains isolated from chickens with clinical hemangioma.

PubMed

Lin, Lulu; Wang, Peikun; Yang, Yongli; Li, Haijuan; Huang, Teng; Wei, Ping

2017-12-01

Since 2014, cases of hemangioma associated with avian leukosis virus subgroup J (ALV-J) have been emerging in commercial chickens in Guangxi. In this study, four strains of the subgroup J avian leukosis virus (ALV-J), named GX14HG01, GX14HG04, GX14LT07, and GX14ZS14, were isolated from chickens with clinical hemangioma in 2014 by DF-1 cell culture and then identified with ELISA detection of ALV group specific antigen p27, the detection of subtype specific PCR and indirect immunofluorescence assay (IFA) with ALV-J specific monoclonal antibody. The complete genomes of the isolates were sequenced and it was found that the gag and pol were relatively conservative, while env was variable especially the gp85 gene. Homology analysis of the env gene sequences showed that the env gene of all the four isolates had higher similarities with the hemangioma (HE)-type reference strains than that of the myeloid leukosis (ML)-type strains, and moreover, the HE-type strains' specific deletion of 205-bp sequence covering the rTM and DR1 in 3'UTR fragment was also found in the four isolates. Further analysis on the sequences of subunits of env gene revealed an interesting finding: the gp85 of isolates GX14ZS14 and GX14HG04 had a higher similarity with HPRS-103 and much lower similarity with the HE-type reference strains resulting in GX14ZS14, GX14HG04, and HPRS-103 being clustered in the same branch, while gp37 had higher similarities with the HE-type reference strains when compared to that of HPRS-103, resulted in GX14ZS14, GX14HG04, and HE-type reference strains being clustered in the same branch. The results suggested that isolates GX14ZS14 and GX14HG04 may be the recombinant strains of the foreign strain HPRS-103 with the local epidemic HE-type strains of ALV-J.

Novel Molecular Method for Identification of Streptococcus pneumoniae Applicable to Clinical Microbiology and 16S rRNA Sequence-Based Microbiome Studies

PubMed Central

Scholz, Christian F. P.; Poulsen, Knud

2012-01-01

The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered specific for S. pneumoniae hamper the exact identification of S. pneumoniae. Based on sequence analysis of 16S rRNA genes of a collection of 634 streptococcal strains, identified by multilocus sequence analysis, we detected a cytosine at position 203 present in all 440 strains of S. pneumoniae but replaced by an adenosine residue in all strains representing other species of mitis group streptococci. The S. pneumoniae-specific sequence signature could be demonstrated by sequence analysis or indirectly by restriction endonuclease digestion of a PCR amplicon covering the site. The S. pneumoniae-specific signature offers an inexpensive means for validation of the identity of clinical isolates and should be used as an integrated marker in the annotation procedure employed in 16S rRNA-based molecular studies of complex human microbiotas. This may avoid frequent misidentifications such as those we demonstrate to have occurred in previous reports and in reference sequence databases. PMID:22442329

High resolution identity testing of inactivated poliovirus vaccines.

PubMed

Mee, Edward T; Minor, Philip D; Martin, Javier

2015-07-09

Definitive identification of poliovirus strains in vaccines is essential for quality control, particularly where multiple wild-type and Sabin strains are produced in the same facility. Sequence-based identification provides the ultimate in identity testing and would offer several advantages over serological methods. We employed random RT-PCR and high throughput sequencing to recover full-length genome sequences from monovalent and trivalent poliovirus vaccine products at various stages of the manufacturing process. All expected strains were detected in previously characterised products and the method permitted identification of strains comprising as little as 0.1% of sequence reads. Highly similar Mahoney and Sabin 1 strains were readily discriminated on the basis of specific variant positions. Analysis of a product known to contain incorrect strains demonstrated that the method correctly identified the contaminants. Random RT-PCR and shotgun sequencing provided high resolution identification of vaccine components. In addition to the recovery of full-length genome sequences, the method could also be easily adapted to the characterisation of minor variant frequencies and distinction of closely related products on the basis of distinguishing consensus and low frequency polymorphisms. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Draft Genome Sequences of Mycobacterium setense Type Strain DSM-45070 and the Nonpathogenic Strain Manresensis, Isolated from the Bank of the Cardener River in Manresa, Catalonia, Spain

PubMed Central

Vilaplana, Cristina; Velasco, Juan; Pluvinet, Raquel; Santín, Sheila; Prat, Cristina; Julián, Esther; Alcaide, Fernando; Comas, Iñaki; Sumoy, Lauro; Cardona, Pere-Joan

2015-01-01

We present here the draft genome sequences of two Mycobacterium setense strains. One of them corresponds to the M. setense type strain DSM-45070, originally isolated from a patient with a posttraumatic chronic skin abscess. The other one corresponds to the nonpathogenic M. setense strain Manresensis, isolated from the Cardener River crossing Manresa, Catalonia, Spain. A comparative genomic analysis shows a smaller genome size and fewer genes in M. setense strain Manresensis relative to those of the type strain, and it shows the genome segments unique to each strain. PMID:25657273

Genomic sequence analysis of the Illinois strain of the Agrotis ipsilon multiple nucleopolyhedrovirus

USDA-ARS?s Scientific Manuscript database

The Agrotis ipsilon multiple nucleopolyhedrovirus (AgipMNPV) is a group II nucleopolyhedrovirus (NPV) from the black cutworm, A. ipsilon, with potential as a biopesticide to control infestations of cutworm larvae. The genome of the Illinois strain of AgipMNPV was completely sequenced. The AgipMNPV...

Lactobacillus gorillae sp. nov., isolated from the faeces of captive and wild western lowland gorillas (Gorilla gorilla gorilla).

PubMed

Tsuchida, Sayaka; Kitahara, Maki; Nguema, Pierre Philippe Mbehang; Norimitsu, Saeko; Fujita, Shiho; Yamagiwa, Juichi; Ngomanda, Alfred; Ohkuma, Moriya; Ushida, Kazunari

2014-12-01

Four strains of Gram-staining-positive, anaerobic rods were isolated from the faeces of western lowland gorillas (Gorilla gorilla gorilla). Three strains, KZ01(T), KZ02 and KZ03, were isolated at the Kyoto City Zoo, Japan, and one strain, GG02, was isolated in the Moukalaba-Doudou National Park, Gabon. These strains were investigated taxonomically. These strains belonged to the Lactobacillus reuteri phylogenetic group according to phylogenetic analysis based on 16S rRNA gene sequences and specific phenotypic characteristics. Phylogenetic analysis of their 16S rRNA gene sequences revealed that strains KZ01(T), KZ02, KZ03 and GG02 formed a single monophyletic cluster and had a distinct line of descent. Based on sequence similarity of the 16S rRNA gene, Lactobacillus fermentum JCM 1173(T) (96.6 %) was the closest neighbour to these novel strains, although it was clear that these strains belonged to a different species. Partial pheS sequences also supported these relationships. DNA-DNA relatedness between strain KZ01(T) and L. fermentum JCM 1173(T) was less than 22 % and the DNA G+C content of strain KZ01(T) was 50.7 mol%. The cell-wall peptidoglycan type was A4β (l-Orn-d-Asp) and the major fatty acids were C16 : 0, C18 : 1ω9c and C19 : 1 cyclo 9,10. Therefore, based on phylogenetic, phenotypic and physiological evidence, these strains represent a novel species of the genus Lactobacillus, for which the name Lactobacillus gorillae sp. nov. is proposed. The type strain is KZ01(T) ( = JCM 19575(T) = DSM 28356(T)). © 2014 IUMS.

Phylogenetic analysis of canine distemper virus in domestic dogs in Nanjing, China.

PubMed

Bi, Zhenwei; Wang, Yongshan; Wang, Xiaoli; Xia, Xingxia

2015-02-01

Canine distemper virus (CDV) infects a broad range of carnivores, including wild and domestic Canidae. The hemagglutinin gene, which encodes the attachment protein that determines viral tropism, has been widely used to determine the relationship between CDV strains of different lineages circulating worldwide. We determined the full-length H gene sequences of seven CDV field strains detected in domestic dogs in Nanjing, China. A phylogenetic analysis of the H gene sequences of CDV strains from different geographic regions and vaccine strains was performed. Four of the seven CDV strains were grouped in the same cluster of the Asia-1 lineage to which the vast majority of Chinese CDV strains belong, whereas the other three were clustered within the Asia-4 lineage, which has never been detected in China. This represents the first record of detection of strains of the Asia-4 lineage in China since this lineage was reported in Thailand in 2013.

Complete sequence of the genome of avian paramyxovirus type 2 (strain Yucaipa) and comparison with other paramyxoviruses

PubMed Central

Subbiah, Madhuri; Xiao, Sa; Collins, Peter L.; Samal, Siba K

2009-01-01

The complete RNA genome sequence of avian paramyxovirus (APMV) serotype 2, strain Yucaipa isolated from chicken has been determined. With genome size of 14,904 nucleotides (nt), strain Yucaipa is consistent with the “rule of six” and is the smallest virus reported to date among the members of subfamily Paramyxovirinae. The genome contains six non-overlapping genes in the order 3′-N-P/V-M-F-HN-L-5′. The genes are flanked on either side by highly-conserved transcription start and stop signals and have intergenic sequences varying in length from 3 to 23 nt. The genome contains a 55 nt leader sequence at 3′ end and a 154 nt trailer sequence at 5′ end. Alignment and phylogenetic analysis of the predicted amino acid sequences of strain Yucaipa proteins with the cognate proteins of viruses of all of the five genera of family Paramyxoviridae showed that APMV-2 strain Yucaipa is more closely related to APMV-6 than APMV-1. PMID:18603323

Identification and Characterization of Putative Integron-Like Elements of the Heavy-Metal-Hypertolerant Strains of Pseudomonas spp.

PubMed

Ciok, Anna; Adamczuk, Marcin; Bartosik, Dariusz; Dziewit, Lukasz

2016-11-28

Pseudomonas strains isolated from the heavily contaminated Lubin copper mine and Zelazny Most post-flotation waste reservoir in Poland were screened for the presence of integrons. This analysis revealed that two strains carried homologous DNA regions composed of a gene encoding a DNA_BRE_C domain-containing tyrosine recombinase (with no significant sequence similarity to other integrases of integrons) plus a three-component array of putative integron gene cassettes. The predicted gene cassettes encode three putative polypeptides with homology to (i) transmembrane proteins, (ii) GCN5 family acetyltransferases, and (iii) hypothetical proteins of unknown function (homologous proteins are encoded by the gene cassettes of several class 1 integrons). Comparative sequence analyses identified three structural variants of these novel integron-like elements within the sequenced bacterial genomes. Analysis of their distribution revealed that they are found exclusively in strains of the genus Pseudomonas .

Species Distribution and In Vitro Azole Susceptibility of Aspergillus Section Nigri Isolates from Clinical and Environmental Settings

PubMed Central

Iatta, Roberta; Nuccio, Federica; Immediato, Davide; Mosca, Adriana; De Carlo, Carmela; Miragliotta, Giuseppe; Parisi, Antonio; Crescenzo, Giuseppe; Otranto, Domenico

2016-01-01

Aspergillus section Nigri includes species of interest for animal and human health, although studies on species distribution are limited to human cases. Data on the antifungal susceptibilities and the molecular mechanism of triazole resistance in strains belonging to this section are scant. Forty-two black Aspergillus strains from human patients (16 isolates), animals (14 isolates), and the environment (12 isolates) were molecularly characterized and their in vitro triazole susceptibilities investigated. Aspergillus tubingensis was isolated from humans, animals, and environmental settings, whereas Aspergillus awamori and Aspergillus niger were isolated exclusively from humans. Phylogenetic analyses of β-tubulin and calmodulin gene sequences were concordant in differentiating A. tubingensis from A. awamori and A. niger. Voriconazole and posaconazole (PSZ) were the most active triazoles. One A. tubingensis strain was resistant to itraconazole and PSZ and one A. niger strain to PSZ. Sequence analysis of the cyp51A gene revealed different sequence types within a species, and A. tubingensis strains were also phylogenetically distinct from A. awamori/A. niger strains according to the strain origin and susceptibility profile. Genetic analysis of the cyp51A sequences suggests that two nonsynonymous mutations resulting in amino acid substitutions in the CYP51A protein (changes of L to R at position 21 [L21R] and of Q to R at position 228 [Q228R]) might be involved in azole resistance. Though azole resistance in black Aspergillus isolates from animals and rural environments does not represent a threat to public health in Southern Italy, the use of triazoles in the clinical setting needs to better monitored. The cyp51A sequence is useful for the molecular identification of black Aspergillus, and point mutations in protein sequences could be responsible for azole resistance phenomena. PMID:27413191

Identification and Complete Genome Sequence Analysis of a Genotype XIV Newcastle Disease Virus from Nigeria

PubMed Central

Shittu, Ismaila; Sharma, Poonam; Volkening, Jeremy D.; Solomon, Ponman; Sulaiman, Lanre K.; Joannis, Tony M.; Williams-Coplin, Dawn; Miller, Patti J.; Dimitrov, Kiril M.

2016-01-01

The first complete genome sequence of a strain of Newcastle disease virus (NDV) from genotype XIV is reported here. Strain duck/Nigeria/NG-695/KG.LOM.11-16/2009 was isolated from an apparently healthy domestic duck from a live bird market in Kogi State, Nigeria, in 2009. This strain is classified as a member of subgenotype XIVb of class II. PMID:26823576

Genome Sequence of a Heterotrophic Nitrifier and Aerobic Denitrifier, Paracoccus denitrificans Strain ISTOD1, Isolated from Wastewater.

PubMed

Medhi, Kristina; Mishra, Arti; Thakur, Indu Shekhar

2018-04-12

We report here the draft genome sequence of Paracoccus denitrificans strain ISTOD1 of 4.9 Mb, isolated from wastewater. It has been identified as a heterotrophic nitrifying and aerobic denitrifying bacterium. Genomic analysis revealed genes related to nitrogen and phosphorus removal, showing that the strain holds potential for bioremediation and biorefinery uses. Copyright © 2018 Medhi et al.

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis and proposals to emend the description of Streptomyces albus and describe Streptomyces pathocidini sp. nov.

PubMed Central

Doroghazi, J. R.; Ju, K.-S.; Metcalf, W. W.

2014-01-01

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T forms a cluster with five other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these other species, including Streptomyces almquistii NRRL B-1685T, Streptomyces flocculus NRRL B-2465T, Streptomyces gibsonii NRRL B-1335T and Streptomyces rangoonensis NRRL B-12378T are quite similar. This cluster is of particular taxonomic interest because Streptomyces albus is the type species of the genus Streptomyces. The related strains were subjected to multilocus sequence analysis (MLSA) utilizing partial sequences of the housekeeping genes atpD, gyrB, recA, rpoB and trpB and confirmation of previously reported phenotypic characteristics. The five strains formed a coherent cluster supported by a 100 % bootstrap value in phylogenetic trees generated from sequence alignments prepared by concatenating the sequences of the housekeeping genes, and identical tree topology was observed using various different tree-making algorithms. Moreover, all but one strain, S. flocculus NRRL B-2465T, exhibited identical sequences for all of the five housekeeping gene loci sequenced, but NRRL B-2465T still exhibited an MLSA evolutionary distance of 0.005 from the other strains, a value that is lower than the 0.007 MLSA evolutionary distance threshold proposed for species-level relatedness. These data support a proposal to reclassify S. almquistii, S. flocculus, S. gibsonii and S. rangoonensis as later heterotypic synonyms of S. albus with NRRL B-1811T as the type strain. The MLSA sequence database also demonstrated utility for quickly and conclusively confirming that numerous strains within the ARS Culture Collection had been previously misidentified as subspecies of S. albus and that Streptomyces albus subsp. pathocidicus should be redescribed as a novel species, Streptomyces pathocidini sp. nov., with the type strain NRRL B-24287T. PMID:24277863

Comparative genomics of citric-acid-producing Aspergillus niger ATCC 1015 versus enzyme-producing CBS 513.88

PubMed Central

Andersen, Mikael R.; Salazar, Margarita P.; Schaap, Peter J.; van de Vondervoort, Peter J.I.; Culley, David; Thykaer, Jette; Frisvad, Jens C.; Nielsen, Kristian F.; Albang, Richard; Albermann, Kaj; Berka, Randy M.; Braus, Gerhard H.; Braus-Stromeyer, Susanna A.; Corrochano, Luis M.; Dai, Ziyu; van Dijck, Piet W.M.; Hofmann, Gerald; Lasure, Linda L.; Magnuson, Jon K.; Menke, Hildegard; Meijer, Martin; Meijer, Susan L.; Nielsen, Jakob B.; Nielsen, Michael L.; van Ooyen, Albert J.J.; Pel, Herman J.; Poulsen, Lars; Samson, Rob A.; Stam, Hein; Tsang, Adrian; van den Brink, Johannes M.; Atkins, Alex; Aerts, Andrea; Shapiro, Harris; Pangilinan, Jasmyn; Salamov, Asaf; Lou, Yigong; Lindquist, Erika; Lucas, Susan; Grimwood, Jane; Grigoriev, Igor V.; Kubicek, Christian P.; Martinez, Diego; van Peij, Noël N.M.E.; Roubos, Johannes A.; Nielsen, Jens; Baker, Scott E.

2011-01-01

The filamentous fungus Aspergillus niger exhibits great diversity in its phenotype. It is found globally, both as marine and terrestrial strains, produces both organic acids and hydrolytic enzymes in high amounts, and some isolates exhibit pathogenicity. Although the genome of an industrial enzyme-producing A. niger strain (CBS 513.88) has already been sequenced, the versatility and diversity of this species compel additional exploration. We therefore undertook whole-genome sequencing of the acidogenic A. niger wild-type strain (ATCC 1015) and produced a genome sequence of very high quality. Only 15 gaps are present in the sequence, and half the telomeric regions have been elucidated. Moreover, sequence information from ATCC 1015 was used to improve the genome sequence of CBS 513.88. Chromosome-level comparisons uncovered several genome rearrangements, deletions, a clear case of strain-specific horizontal gene transfer, and identification of 0.8 Mb of novel sequence. Single nucleotide polymorphisms per kilobase (SNPs/kb) between the two strains were found to be exceptionally high (average: 7.8, maximum: 160 SNPs/kb). High variation within the species was confirmed with exo-metabolite profiling and phylogenetics. Detailed lists of alleles were generated, and genotypic differences were observed to accumulate in metabolic pathways essential to acid production and protein synthesis. A transcriptome analysis supported up-regulation of genes associated with biosynthesis of amino acids that are abundant in glucoamylase A, tRNA-synthases, and protein transporters in the protein producing CBS 513.88 strain. Our results and data sets from this integrative systems biology analysis resulted in a snapshot of fungal evolution and will support further optimization of cell factories based on filamentous fungi. PMID:21543515

Diversity of Micromonospora strains isolated from nitrogen fixing nodules and rhizosphere of Pisum sativum analyzed by multilocus sequence analysis.

PubMed

Carro, Lorena; Spröer, Cathrin; Alonso, Pilar; Trujillo, Martha E

2012-03-01

It was recently reported that Micromonospora inhabits the intracellular tissues of nitrogen fixing nodules of the wild legume Lupinus angustifolius. To determine if Micromonospora populations are also present in nitrogen fixing nodules of cultivated legumes such as Pisum sativum, we carried out the isolation of this actinobacterium from P. sativum plants collected in two man-managed fields in the region of Castilla and León (Spain). In this work, we describe the isolation of 93 Micromonospora strains recovered from nitrogen fixing nodules and the rhizosphere of P. sativum. The genomic diversity of the strains was analyzed by amplified ribosomal DNA restriction analysis (ARDRA). Forty-six isolates and 34 reference strains were further analyzed using a multilocus sequence analysis scheme developed to address the phylogeny of the genus Micromonospora and to evaluate the species distribution in the two studied habitats. The MLSA results were evaluated by DNA-DNA hybridization to determine their usefulness for the delineation of Micromonospora at the species level. In most cases, DDH values below 70% were obtained with strains that shared a sequence similarity of 98.5% or less. Thus, MLSA studies clearly supported the established taxonomy of the genus Micromonospora and indicated that genomic species could be delineated as groups of strains that share > 98.5% sequence similarity based on the 5 genes selected. The species diversity of the strains isolated from both the rhizosphere and nodules was very high and in many cases the new strains could not be related to any of the currently described species. Copyright © 2011 Elsevier GmbH. All rights reserved.

'Candidatus Phytoplasma phoenicium' associated with almond witches'-broom disease: from draft genome to genetic diversity among strain populations.

PubMed

Quaglino, Fabio; Kube, Michael; Jawhari, Maan; Abou-Jawdah, Yusuf; Siewert, Christin; Choueiri, Elia; Sobh, Hana; Casati, Paola; Tedeschi, Rosemarie; Lova, Marina Molino; Alma, Alberto; Bianco, Piero Attilio

2015-07-30

Almond witches'-broom (AlmWB), a devastating disease of almond, peach and nectarine in Lebanon, is associated with 'Candidatus Phytoplasma phoenicium'. In the present study, we generated a draft genome sequence of 'Ca. P. phoenicium' strain SA213, representative of phytoplasma strain populations from different host plants, and determined the genetic diversity among phytoplasma strain populations by phylogenetic analyses of 16S rRNA, groEL, tufB and inmp gene sequences. Sequence-based typing and phylogenetic analysis of the gene inmp, coding an integral membrane protein, distinguished AlmWB-associated phytoplasma strains originating from diverse host plants, whereas their 16S rRNA, tufB and groEL genes shared 100 % sequence identity. Moreover, dN/dS analysis indicated positive selection acting on inmp gene. Additionally, the analysis of 'Ca. P. phoenicium' draft genome revealed the presence of integral membrane proteins and effector-like proteins and potential candidates for interaction with hosts. One of the integral membrane proteins was predicted as BI-1, an inhibitor of apoptosis-promoting Bax factor. Bioinformatics analyses revealed the presence of putative BI-1 in draft and complete genomes of other 'Ca. Phytoplasma' species. The genetic diversity within 'Ca. P. phoenicium' strain populations in Lebanon suggested that AlmWB disease could be associated with phytoplasma strains derived from the adaptation of an original strain to diverse hosts. Moreover, the identification of a putative inhibitor of apoptosis-promoting Bax factor (BI-1) in 'Ca. P. phoenicium' draft genome and within genomes of other 'Ca. Phytoplasma' species suggested its potential role as a phytoplasma fitness-increasing factor by modification of the host-defense response.

Whole Genome Sequence and Phylogenetic Analysis Show Helicobacter pylori Strains from Latin America Have Followed a Unique Evolution Pathway

PubMed Central

Muñoz-Ramírez, Zilia Y.; Mendez-Tenorio, Alfonso; Kato, Ikuko; Bravo, Maria M.; Rizzato, Cosmeri; Thorell, Kaisa; Torres, Roberto; Aviles-Jimenez, Francisco; Camorlinga, Margarita; Canzian, Federico; Torres, Javier

2017-01-01

Helicobacter pylori (HP) genetics may determine its clinical outcomes. Despite high prevalence of HP infection in Latin America (LA), there have been no phylogenetic studies in the region. We aimed to understand the structure of HP populations in LA mestizo individuals, where gastric cancer incidence remains high. The genome of 107 HP strains from Mexico, Nicaragua and Colombia were analyzed with 59 publicly available worldwide genomes. To study bacterial relationship on whole genome level we propose a virtual hybridization technique using thousands of high-entropy 13 bp DNA probes to generate fingerprints. Phylogenetic virtual genome fingerprint (VGF) was compared with Multi Locus Sequence Analysis (MLST) and with phylogenetic analyses of cagPAI virulence island sequences. With MLST some Nicaraguan and Mexican strains clustered close to Africa isolates, whereas European isolates were spread without clustering and intermingled with LA isolates. VGF analysis resulted in increased resolution of populations, separating European from LA strains. Furthermore, clusters with exclusively Colombian, Mexican, or Nicaraguan strains were observed, where the Colombian cluster separated from Europe, Asia, and Africa, while Nicaraguan and Mexican clades grouped close to Africa. In addition, a mixed large LA cluster including Mexican, Colombian, Nicaraguan, Peruvian, and Salvadorian strains was observed; all LA clusters separated from the Amerind clade. With cagPAI sequence analyses LA clades clearly separated from Europe, Asia and Amerind, and Colombian strains formed a single cluster. A NeighborNet analyses suggested frequent and recent recombination events particularly among LA strains. Results suggests that in the new world, H. pylori has evolved to fit mestizo LA populations, already 500 years after the Spanish colonization. This co-adaption may account for regional variability in gastric cancer risk. PMID:28293542

Comparative genome analysis and characterization of the Salmonella Typhimurium strain CCRJ_26 isolated from swine carcasses using whole-genome sequencing approach.

PubMed

Panzenhagen, P H N; Cabral, C C; Suffys, P N; Franco, R M; Rodrigues, D P; Conte-Junior, C A

2018-04-01

Salmonella pathogenicity relies on virulence factors many of which are clustered within the Salmonella pathogenicity islands. Salmonella also harbours mobile genetic elements such as virulence plasmids, prophage-like elements and antimicrobial resistance genes which can contribute to increase its pathogenicity. Here, we have genetically characterized a selected S. Typhimurium strain (CCRJ_26) from our previous study with Multiple Drugs Resistant profile and high-frequency PFGE clonal profile which apparently persists in the pork production centre of Rio de Janeiro State, Brazil. By whole-genome sequencing, we described the strain's genome virulent content and characterized the repertoire of bacterial plasmids, antibiotic resistance genes and prophage-like elements. Here, we have shown evidence that strain CCRJ_26 genome possible represent a virulence-associated phenotype which may be potentially virulent in human infection. Whole-genome sequencing technologies are still costly and remain underexplored for applied microbiology in Brazil. Hence, this genomic description of S. Typhimurium strain CCRJ_26 will provide help in future molecular epidemiological studies. The analysis described here reveals a quick and useful pipeline for bacterial virulence characterization using whole-genome sequencing approach. © 2018 The Society for Applied Microbiology.

Development of new strains and related SCAR markers for an edible mushroom, Hypsizygus marmoreus.

PubMed

Lee, Chang Y; Park, Jeong-Eun; Lee, Jia; Kim, Jong-Kuk; Ro, Hyeon-Su

2012-02-01

New fast-growing and less bitter varieties of Hypsizygus marmoreus were developed by crossing monokaryotic mycelia from a commercial strain (Hm1-1) and a wild strain (Hm3-10). Six of the better tasting new strains with a shorter cultivation period were selected from 400 crosses in a large-scale cultivation experiment. We attempted to develop sequence characterized amplified region (SCAR) markers to identify the new strain from other commercial strains. For the SCAR markers, we conducted molecular genetic analysis on a wild strain and the eight most cultivated H. marmoreus strains collected from various areas in East Asia by randomly amplified polymorphic DNA. Ten unique DNA bands for a commercial Hm1-1 strain and the Hm3-10 strain were extracted and their sequences were determined. Primer sets were designed based on the determined sequences. PCR reactions with the primer sets revealed that four primer sets successfully discriminated the new strains from other commercial strains and are thus suitable for commercial purposes. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Nucleotide Sequence and Genetic Structure of a Novel Carbaryl Hydrolase Gene (cehA) from Rhizobium sp. Strain AC100

PubMed Central

Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito

2002-01-01

Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471

Typing Clostridium difficile strains based on tandem repeat sequences

PubMed Central

2009-01-01

Background Genotyping of epidemic Clostridium difficile strains is necessary to track their emergence and spread. Portability of genotyping data is desirable to facilitate inter-laboratory comparisons and epidemiological studies. Results This report presents results from a systematic screen for variation in repetitive DNA in the genome of C. difficile. We describe two tandem repeat loci, designated 'TR6' and 'TR10', which display extensive sequence variation that may be useful for sequence-based strain typing. Based on an investigation of 154 C. difficile isolates comprising 75 ribotypes, tandem repeat sequencing demonstrated excellent concordance with widely used PCR ribotyping and equal discriminatory power. Moreover, tandem repeat sequences enabled the reconstruction of the isolates' largely clonal population structure and evolutionary history. Conclusion We conclude that sequence analysis of the two repetitive loci introduced here may be highly useful for routine typing of C. difficile. Tandem repeat sequence typing resolves phylogenetic diversity to a level equivalent to PCR ribotypes. DNA sequences may be stored in databases accessible over the internet, obviating the need for the exchange of reference strains. PMID:19133124

Genome sequence and analysis of a stress-tolerant, wild-derived strain of Saccharomyces cerevisiae used in biofuels research

DOE Office of Scientific and Technical Information (OSTI.GOV)

McIlwain, Sean J.; Peris, Davis; Sardi, Maria

The genome sequences of more than 100 strains of the yeast Saccharomyces cerevisiae have been published. Unfortunately, most of these genome assemblies contain dozens to hundreds of gaps at repetitive sequences, including transposable elements, tRNAs, and subtelomeric regions, which is where novel genes generally reside. Relatively few strains have been chosen for genome sequencing based on their biofuel production potential, leaving an additional knowledge gap. Here, we describe the nearly complete genome sequence of GLBRCY22-3 (Y22-3), a strain of S. cerevisiae derived from the stress-tolerant wild strain NRRL YB-210 and subsequently engineered for xylose metabolism. After benchmarking several genome assemblymore » approaches, we developed a pipeline to integrate Pacific Biosciences (PacBio) and Illumina sequencing data and achieved one of the highest quality genome assemblies for any S. cerevisiae strain. Specifically, the contig N50 is 693 kbp, and the sequences of most chromosomes, the mitochondrial genome, and the 2-micron plasmid are complete. Our annotation predicts 92 genes that are not present in the reference genome of the laboratory strain S288c, over 70% of which were expressed. We predicted functions for 43 of these genes, 28 of which were previously uncharacterized and unnamed. Remarkably, many of these genes are predicted to be involved in stress tolerance and carbon metabolism and are shared with a Brazilian bioethanol production strain, even though the strains differ dramatically at most genetic loci. Lastly, the Y22-3 genome sequence provides an exceptionally high-quality resource for basic and applied research in bioenergy and genetics.« less

Genome sequence and analysis of a stress-tolerant, wild-derived strain of Saccharomyces cerevisiae used in biofuels research

DOE PAGES

McIlwain, Sean J.; Peris, Davis; Sardi, Maria; ...

2016-04-20

The genome sequences of more than 100 strains of the yeast Saccharomyces cerevisiae have been published. Unfortunately, most of these genome assemblies contain dozens to hundreds of gaps at repetitive sequences, including transposable elements, tRNAs, and subtelomeric regions, which is where novel genes generally reside. Relatively few strains have been chosen for genome sequencing based on their biofuel production potential, leaving an additional knowledge gap. Here, we describe the nearly complete genome sequence of GLBRCY22-3 (Y22-3), a strain of S. cerevisiae derived from the stress-tolerant wild strain NRRL YB-210 and subsequently engineered for xylose metabolism. After benchmarking several genome assemblymore » approaches, we developed a pipeline to integrate Pacific Biosciences (PacBio) and Illumina sequencing data and achieved one of the highest quality genome assemblies for any S. cerevisiae strain. Specifically, the contig N50 is 693 kbp, and the sequences of most chromosomes, the mitochondrial genome, and the 2-micron plasmid are complete. Our annotation predicts 92 genes that are not present in the reference genome of the laboratory strain S288c, over 70% of which were expressed. We predicted functions for 43 of these genes, 28 of which were previously uncharacterized and unnamed. Remarkably, many of these genes are predicted to be involved in stress tolerance and carbon metabolism and are shared with a Brazilian bioethanol production strain, even though the strains differ dramatically at most genetic loci. Lastly, the Y22-3 genome sequence provides an exceptionally high-quality resource for basic and applied research in bioenergy and genetics.« less

Genetic discovery in Xylella fastidiosa through sequence analysis of selected randomly amplified polymorphic DNAs.

PubMed

Chen, Jianchi; Civerolo, Edwin L; Jarret, Robert L; Van Sluys, Marie-Anne; de Oliveira, Mariana C

2005-02-01

Xylella fastidiosa causes many important plant diseases including Pierce's disease (PD) in grape and almond leaf scorch disease (ALSD). DNA-based methodologies, such as randomly amplified polymorphic DNA (RAPD) analysis, have been playing key roles in genetic information collection of the bacterium. This study further analyzed the nucleotide sequences of selected RAPDs from X. fastidiosa strains in conjunction with the available genome sequence databases and unveiled several previously unknown novel genetic traits. These include a sequence highly similar to those in the phage family of Podoviridae. Genome comparisons among X. fastidiosa strains suggested that the "phage" is currently active. Two other RAPDs were also related to horizontal gene transfer: one was part of a broadly distributed cryptic plasmid and the other was associated with conjugal transfer. One RAPD inferred a genomic rearrangement event among X. fastidiosa PD strains and another identified a single nucleotide polymorphism of evolutionary value.

Burkholderia cordobensis sp. nov., from agricultural soils.

PubMed

Draghi, Walter O; Peeters, Charlotte; Cnockaert, Margo; Snauwaert, Cindy; Wall, Luis G; Zorreguieta, Angeles; Vandamme, Peter

2014-06-01

Two Gram-negative, rod-shaped bacteria were isolated from agricultural soils in Córdoba province in central Argentina. Their 16S rRNA gene sequences demonstrated that they belong to the genus Burkholderia, with Burkholderia zhejiangensis as most closely related formally named species; this relationship was confirmed through comparative gyrB sequence analysis. Whole-cell fatty acid analysis supported their assignment to the genus Burkholderia. Burkholderia sp. strain YI23, for which a whole-genome sequence is available, represents the same taxon, as demonstrated by its highly similar 16S rRNA (100% similarity) and gyrB (99.1-99.7%) gene sequences. The results of DNA-DNA hybridization experiments and physiological and biochemical characterization further substantiated the genotypic and phenotypic distinctiveness of the Argentinian soil isolates, for which the name Burkholderia cordobensis sp. nov. is proposed, with strain MMP81(T) ( = LMG 27620(T) = CCUG 64368(T)) as the type strain. © 2014 IUMS.

A Wide Variety of Clostridium perfringens Type A Food-Borne Isolates That Carry a Chromosomal cpe Gene Belong to One Multilocus Sequence Typing Cluster

PubMed Central

Xiao, Yinghua; Wagendorp, Arjen; Moezelaar, Roy; Abee, Tjakko

2012-01-01

Of 98 suspected food-borne Clostridium perfringens isolates obtained from a nationwide survey by the Food and Consumer Product Safety Authority in The Netherlands, 59 strains were identified as C. perfringens type A. Using PCR-based techniques, the cpe gene encoding enterotoxin was detected in eight isolates, showing a chromosomal location for seven isolates and a plasmid location for one isolate. Further characterization of these strains by using (GTG)5 fingerprint repetitive sequence-based PCR analysis distinguished C. perfringens from other sulfite-reducing clostridia but did not allow for differentiation between various types of C. perfringens strains. To characterize the C. perfringens strains further, multilocus sequence typing (MLST) analysis was performed on eight housekeeping genes of both enterotoxic and non-cpe isolates, and the data were combined with a previous global survey covering strains associated with food poisoning, gas gangrene, and isolates from food or healthy individuals. This revealed that the chromosomal cpe strains (food strains and isolates from food poisoning cases) belong to a distinct cluster that is significantly distant from all the other cpe plasmid-carrying and cpe-negative strains. These results suggest that different groups of C. perfringens have undergone niche specialization and that a distinct group of food isolates has specific core genome sequences. Such findings have epidemiological and evolutionary significance. Better understanding of the origin and reservoir of enterotoxic C. perfringens may allow for improved control of this organism in foods. PMID:22865060

Sequence analysis of the msp4 gene of Anaplasma ovis strains

USGS Publications Warehouse

de la Fuente, J.; Atkinson, M.W.; Naranjo, V.; Fernandez de Mera, I. G.; Mangold, A.J.; Keating, K.A.; Kocan, K.M.

2007-01-01

Anaplasma ovis (Rickettsiales: Anaplasmataceae) is a tick-borne pathogen of sheep, goats and wild ruminants. The genetic diversity of A. ovis strains has not been well characterized due to the lack of sequence information. In this study, we evaluated bighorn sheep (Ovis canadensis) and mule deer (Odocoileus hemionus) from Montana for infection with A. ovis by serology and sequence analysis of the msp4 gene. Antibodies to Anaplasma spp. were detected in 37% and 39% of bighorn sheep and mule deer analyzed, respectively. Four new msp4 genotypes were identified. The A. ovis msp4 sequences identified herein were analyzed together with sequences reported previously for the characterization of the genetic diversity of A. ovis strains in comparison with other Anaplasma spp. The results of these studies demonstrated that although A. ovis msp4 genotypes may vary among geographic regions and between sheep and deer hosts, the variation observed was less than the variation observed between A. marginale and A. phagocytophilum strains. The results reported herein further confirm that A. ovis infection occurs in natural wild ruminant populations in Western United States and that bighorn sheep and mule deer may serve as wildlife reservoirs of A. ovis. ?? 2006.

16S-23S rRNA gene internal transcribed spacer sequences for analysis of the phylogenetic relationships among species of the genus Porphyromonas.

PubMed

Conrads, Georg; Citron, Diane M; Tyrrell, Kerin L; Horz, Hans-Peter; Goldstein, Ellie J C

2005-03-01

The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of 11 reference strains of Porphyromonas species, together with Bacteroides distasonis and Tannerella forsythensis, were analysed to examine interspecies relationships. Compared with the phylogenetic tree generated using 16S rRNA gene sequences, the resolution of the ITS sequence-based tree was higher, but species positioning and clustering were similar with both approaches. The recent separation of Porphyromonas gulae and Porphyromonas gingivalis into distinct species was confirmed by the ITS data. In addition, analysis of the ITS sequences of 24 clinical isolates of Porphyromonas asaccharolytica plus the type strain ATCC 25260(T) divided the sequences into two clusters, of which one was alpha-fucosidase-positive (like the type strain) while the other was alpha-fucosidase-negative. The latter resembled the previously studied unusual extra-oral isolates of 'Porphyromonas endodontalis-like organisms' (PELOs) which could therefore be called 'Porphyromonas asaccharolytica-like organisms' (PALOs), based on the genetic identification. Moreover, the proposal of alpha-fucosidase-negative P. asaccharolytica strains as a new species should also be considered.

Draft Genome Sequence of Pedobacter sp. Strain V48, Isolated from a Coastal Sand Dune in the Netherlands

PubMed Central

Bitzer, Adam S.; Garbeva, Paolina

2014-01-01

Pedobacter sp. strain V48 participates in an interaction with Pseudomonas fluorescens which elicits interaction-induced phenotypes. We report the draft genome sequence of Pedobacter sp. V48, consisting of 6.46 Mbp. The sequence will contribute to improved understanding of the genus and facilitate genomic analysis of the model interspecies interaction with P. fluorescens. PMID:24578271

Comparative Genomics of Completely Sequenced Lactobacillus helveticus Genomes Provides Insights into Strain-Specific Genes and Resolves Metagenomics Data Down to the Strain Level.

PubMed

Schmid, Michael; Muri, Jonathan; Melidis, Damianos; Varadarajan, Adithi R; Somerville, Vincent; Wicki, Adrian; Moser, Aline; Bourqui, Marc; Wenzel, Claudia; Eugster-Meier, Elisabeth; Frey, Juerg E; Irmler, Stefan; Ahrens, Christian H

2018-01-01

Although complete genome sequences hold particular value for an accurate description of core genomes, the identification of strain-specific genes, and as the optimal basis for functional genomics studies, they are still largely underrepresented in public repositories. Based on an assessment of the genome assembly complexity for all lactobacilli, we used Pacific Biosciences' long read technology to sequence and de novo assemble the genomes of three Lactobacillus helveticus starter strains, raising the number of completely sequenced strains to 12. The first comparative genomics study for L. helveticus -to our knowledge-identified a core genome of 988 genes and sets of unique, strain-specific genes ranging from about 30 to more than 200 genes. Importantly, the comparison of MiSeq- and PacBio-based assemblies uncovered that not only accessory but also core genes can be missed in incomplete genome assemblies based on short reads. Analysis of the three genomes revealed that a large number of pseudogenes were enriched for functional Gene Ontology categories such as amino acid transmembrane transport and carbohydrate metabolism, which is in line with a reductive genome evolution in the rich natural habitat of L. helveticus . Notably, the functional Clusters of Orthologous Groups of proteins categories "cell wall/membrane biogenesis" and "defense mechanisms" were found to be enriched among the strain-specific genes. A genome mining effort uncovered examples where an experimentally observed phenotype could be linked to the underlying genotype, such as for cell envelope proteinase PrtH3 of strain FAM8627. Another possible link identified for peptidoglycan hydrolases will require further experiments. Of note, strain FAM22155 did not harbor a CRISPR/Cas system; its loss was also observed in other L. helveticus strains and lactobacillus species, thus questioning the value of the CRISPR/Cas system for diagnostic purposes. Importantly, the complete genome sequences proved to be very useful for the analysis of natural whey starter cultures with metagenomics, as a larger percentage of the sequenced reads of these complex mixtures could be unambiguously assigned down to the strain level.

Comparative Genomics of Completely Sequenced Lactobacillus helveticus Genomes Provides Insights into Strain-Specific Genes and Resolves Metagenomics Data Down to the Strain Level

PubMed Central

Schmid, Michael; Muri, Jonathan; Melidis, Damianos; Varadarajan, Adithi R.; Somerville, Vincent; Wicki, Adrian; Moser, Aline; Bourqui, Marc; Wenzel, Claudia; Eugster-Meier, Elisabeth; Frey, Juerg E.; Irmler, Stefan; Ahrens, Christian H.

2018-01-01

Although complete genome sequences hold particular value for an accurate description of core genomes, the identification of strain-specific genes, and as the optimal basis for functional genomics studies, they are still largely underrepresented in public repositories. Based on an assessment of the genome assembly complexity for all lactobacilli, we used Pacific Biosciences' long read technology to sequence and de novo assemble the genomes of three Lactobacillus helveticus starter strains, raising the number of completely sequenced strains to 12. The first comparative genomics study for L. helveticus—to our knowledge—identified a core genome of 988 genes and sets of unique, strain-specific genes ranging from about 30 to more than 200 genes. Importantly, the comparison of MiSeq- and PacBio-based assemblies uncovered that not only accessory but also core genes can be missed in incomplete genome assemblies based on short reads. Analysis of the three genomes revealed that a large number of pseudogenes were enriched for functional Gene Ontology categories such as amino acid transmembrane transport and carbohydrate metabolism, which is in line with a reductive genome evolution in the rich natural habitat of L. helveticus. Notably, the functional Clusters of Orthologous Groups of proteins categories “cell wall/membrane biogenesis” and “defense mechanisms” were found to be enriched among the strain-specific genes. A genome mining effort uncovered examples where an experimentally observed phenotype could be linked to the underlying genotype, such as for cell envelope proteinase PrtH3 of strain FAM8627. Another possible link identified for peptidoglycan hydrolases will require further experiments. Of note, strain FAM22155 did not harbor a CRISPR/Cas system; its loss was also observed in other L. helveticus strains and lactobacillus species, thus questioning the value of the CRISPR/Cas system for diagnostic purposes. Importantly, the complete genome sequences proved to be very useful for the analysis of natural whey starter cultures with metagenomics, as a larger percentage of the sequenced reads of these complex mixtures could be unambiguously assigned down to the strain level. PMID:29441050

Genome Sequence Analysis of New Isolates of the Winona Strain of Plum pox virus and the First Definitive Evidence of Intrastrain Recombination Events.

PubMed

James, Delano; Sanderson, Dan; Varga, Aniko; Sheveleva, Anna; Chirkov, Sergei

2016-04-01

Plum pox virus (PPV) is genetically diverse with nine different strains identified. Mutations, indel events, and interstrain recombination events are known to contribute to the genetic diversity of PPV. This is the first report of intrastrain recombination events that contribute to PPV's genetic diversity. Fourteen isolates of the PPV strain Winona (W) were analyzed including nine new strain W isolates sequenced completely in this study. Isolates of other strains of PPV with more than one isolate with the complete genome sequence available in GenBank were included also in this study for comparison and analysis. Five intrastrain recombination events were detected among the PPV W isolates, one among PPV C strain isolates, and one among PPV M strain isolates. Four (29%) of the PPV W isolates analyzed are recombinants; one of which (P2-1) is a mosaic, with three recombination events identified. A new interstrain recombinant event was identified between a strain M isolate and a strain Rec isolate, a known recombinant. In silico recombination studies and pairwise distance analyses of PPV strain D isolates indicate that a threshold of genetic diversity exists for the detectability of recombination events, in the range of approximately 0.78×10(-2) to 1.33×10(-2) mean pairwise distance. RDP4 analyses indicate that in the case of PPV Rec isolates there may be a recombinant breakpoint distinct from the obvious transition point of strain sequences. Evidence was obtained that indicates that the frequency of PPV recombination is underestimated, which may be true for other RNA viruses where low genetic diversity exists.

Genomic and Proteomic Characterization of Bacteriocin-Producing Leuconostoc mesenteroides Strains Isolated from Raw Camel Milk in Two Southwest Algerian Arid Zones

PubMed Central

Benmechernene, Zineb; Fernández-No, Inmaculada; Quintela-Baluja, Marcos; Kihal, Mebrouk; Calo-Mata, Pilar; Barros-Velázquez, Jorge

2014-01-01

Information on the microbiology of camel milk is very limited. In this work, the genetic characterization and proteomic identification of 13 putative producing bacteriocin Leuconostoc strains exhibiting antilisterial activity and isolated from camel milk were performed. DNA sequencing of the 13 selected strains revealed high homology among the 16S rRNA genes for all strains. In addition, 99% homology with Leuconostoc mesenteroides was observed when these sequences were analysed by the BLAST tool against other sequences from reference strains deposited in the Genbank. Furthermore, the isolates were characterized by matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDITOF MS) which allowed for the identification of 2 mass peaks 6242 m/z and 5118 m/z that resulted to be specific to the species L. mesenteroides. Remarkably, the phyloproteomic tree provided more intraspecific information of L. mesenteroides than phylogenetic analysis. Accordingly, phyloproteomic analysis grouped L. mesenteroides strains into different subbranches, while all L. mesenteroides isolates were grouped in the same branch according to phylogenetic analysis. This study represents, to our knowledge, the first report on the use of MALDI-TOF MS on the identification of LAB isolated from camel milk. PMID:24809059

Phylogenetic analysis of the alfalfa weevil complex (Coleoptera: Curculionidae) in North America.

PubMed

Böttger, Jorge A Achata; Bundy, C Scott; Oesterle, Naomi; Hanson, Stephen F

2013-02-01

The Eastern, Western, and Egyptian strains of alfalfa weevil are pests introduced to North America on three separate occasions, now they share partially overlapping geographic ranges, covering most of the continental United States. Behavior, susceptibility to parasites, and subtle morphological differences separate the strains. The difficulty in differentiating among these strains morphologically has led to the application of molecular phylogeny approaches including restriction fragment-length polymorphism characterization and sequencing of mitochondrial genes. While valuable for strain identification, this approach cannot identify interstrain hybrids because mitochondrial markers are maternally inherited. The work reported here extends previous findings by comparing over 7 Kb of sequence from two mitochondrial and four nuclear loci to increase the resolution of molecular phylogeny for these weevils. The related clover leaf weevil, also an occasional pest of alfalfa, was included in the analysis because the molecular phylogeny of this weevil has not been examined to date. Analysis of nuclear loci indicate that the clover weevil is a distinct species. Furthermore, while the three alfalfa weevil strains are separable based on mitochondrial sequence data they cannot be separated using nuclearloci suggesting that they are all recently diverged members of the same species. These data refine the relationships among these strains and may find application in design of better control strategies.

Whole genome sequencing and phylogenetic analysis of Bluetongue virus serotype 2 strains isolated in the Americas including a novel strain from the western United States.

PubMed

Gaudreault, Natasha N; Mayo, Christie E; Jasperson, Dane C; Crossley, Beate M; Breitmeyer, Richard E; Johnson, Donna J; Ostlund, Eileen N; MacLachlan, N James; Wilson, William C

2014-07-01

Bluetongue is a potentially fatal arboviral disease of domestic and wild ruminants that is characterized by widespread edema and tissue necrosis. Bluetongue virus (BTV) serotypes 10, 11, 13, and 17 occur throughout much of the United States, whereas serotype 2 (BTV-2) was previously only detected in the southeastern United States. Since 1998, 10 other BTV serotypes have also been isolated from ruminants in the southeastern United States. In 2010, BTV-2 was identified in California for the first time, and preliminary sequence analysis indicated that the virus isolate was closely related to BTV strains circulating in the southeastern United States. In the current study, the whole genome sequence of the California strain of BTV-2 was compared with those of other BTV-2 strains in the Americas. The results of the analysis suggest co-circulation of genetically distinct viruses in the southeastern United States, and further suggest that the 2010 western isolate is closely related to southeastern strains of BTV. Although it remains uncertain as to how this novel virus was translocated to California, the findings of the current study underscore the need for ongoing surveillance of this economically important livestock disease.

Noncytopathogenic Pestivirus Strains Generated by Nonhomologous RNA Recombination: Alterations in the NS4A/NS4B Coding Region

PubMed Central

Gallei, Andreas; Orlich, Michaela; Thiel, Heinz-Juergen; Becher, Paul

2005-01-01

Several studies have demonstrated that cytopathogenic (cp) pestivirus strains evolve from noncytopathogenic (noncp) viruses by nonhomologous RNA recombination. In addition, two recent reports showed the rapid emergence of noncp Bovine viral diarrhea virus (BVDV) after a few cell culture passages of cp BVDV strains by homologous recombination between identical duplicated viral sequences. To allow the identification of recombination sites from noncp BVDV strains that evolve from cp viruses, we constructed the cp BVDV strains CP442 and CP552. Both harbor duplicated viral sequences of different origin flanking the cellular insertion Nedd8*; the latter is a prerequisite for their cytopathogenicity. In contrast to the previous studies, isolation of noncp strains was possible only after extensive cell culture passages of CP442 and CP552. Sequence analysis of 15 isolated noncp BVDVs confirmed that all recombinant strains lack at least most of Nedd8*. Interestingly, only one strain resulted from homologous recombination while the other 14 strains were generated by nonhomologous recombination. Accordingly, our data suggest that the extent of sequence identity between participating sequences influences both frequency and mode (homologous versus nonhomologous) of RNA recombination in pestiviruses. Further analyses of the noncp recombinant strains revealed that a duplication of 14 codons in the BVDV nonstructural protein 4B (NS4B) gene does not interfere with efficient viral replication. Moreover, an insertion of viral sequences between the NS4A and NS4B genes was well tolerated. These findings thus led to the identification of two genomic loci which appear to be suited for the insertion of heterologous sequences into the genomes of pestiviruses and related viruses. PMID:16254361

Analysis of the genome sequence of the pathogenic Muscovy duck parvovirus strain YY reveals a 14-nucleotide-pair deletion in the inverted terminal repeats.

PubMed

Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang

2016-09-01

Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.

Analysis of intra-host genetic diversity of Prunus necrotic ringspot virus (PNRSV) using amplicon next generation sequencing.

PubMed

Kinoti, Wycliff M; Constable, Fiona E; Nancarrow, Narelle; Plummer, Kim M; Rodoni, Brendan

2017-01-01

PCR amplicon next generation sequencing (NGS) analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV) from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored.

Molecular characterization and phylogenetic analysis of infectious bursal disease viruses isolated from chicken in South China in 2011.

PubMed

Liu, Di; Zhang, Xiang-Bin; Yan, Zhuan-Qiang; Chen, Feng; Ji, Jun; Qin, Jian-Ping; Li, Hai-Yan; Lu, Jun-Peng; Xue, Yu; Liu, Jia-Jia; Xie, Qing-Mei; Ma, Jing-Yun; Xue, Chun-Yi; Bee, Ying-Zuo

2013-06-01

Infectious bursal disease virus (IBDV) is a double-stranded RNA virus that causes immunosuppressive disease in young chickens. Thousands of cases of IBDV infection are reported each year in South China, and these infections can result in considerable economic losses to the poultry industry. To monitor variations of the virus during the outbreaks, 30 IBDVs were identified from vaccinated chicken flocks from nine provinces in South China in 2011. VP2 fragments from different virus strains were sequenced and analyzed by comparison with the published sequences of IBDV strains from China and around the world. Phylogenetic analysis of hypervariable regions of the VP2 (vVP2) gene showed that 29 of the isolates were very virulent (vv) IBDVs, and were closely related to vvIBDV strains from Europe and Asia. Alignment analysis of the deduced amino acid (aa) sequences of vVP2 showed the 29 vv isolates had high uniformity, indicated low variability and slow evolution of the virus. The non-vvIBDV isolate JX2-11 was associated with higher than expected mortality, and had high deduced aa sequence similarity (99.2 %) with the attenuated vaccine strain B87 (BJ). The present study has demonstrated the continued circulation of IBDV strains in South China, and emphasizes the importance of reinforcing IBDV surveillance.

Genetic characterization of Anaplasma marginale strains from Tunisia using single and multiple gene typing reveals novel variants with an extensive genetic diversity.

PubMed

Ben Said, Mourad; Ben Asker, Alaa; Belkahia, Hanène; Ghribi, Raoua; Selmi, Rachid; Messadi, Lilia

2018-05-12

Anaplasma marginale, which is responsible for bovine anaplasmosis in tropical and subtropical regions, is a tick-borne obligatory intraerythrocytic bacterium of cattle and wild ruminants. In Tunisia, information about the genetic diversity and the phylogeny of A. marginale strains are limited to the msp4 gene analysis. The purpose of this study is to investigate A. marginale isolates infecting 16 cattle located in different bioclimatic areas of northern Tunisia with single gene analysis and multilocus sequence typing methods on the basis of seven partial genes (dnaA, ftsZ, groEL, lipA, secY, recA and sucB). The single gene analysis confirmed the presence of different and novel heterogenic A. marginale strains infecting cattle from the north of Tunisia. The concatenated sequence analysis showed a phylogeographical resolution at the global level and that most of the Tunisian sequence types (STs) formed a separate cluster from a South African isolate and from all New World isolates and strains. By combining the characteristics of each single locus with those of the multi-loci scheme, these results provide a more detailed understanding on the diversity and the evolution of Tunisian A. marginale strains. Copyright © 2018 Elsevier GmbH. All rights reserved.

Molecular characterization of the probiotic strain Bacillus cereus var. toyoi NCIMB 40112 and differentiation from food poisoning strains.

PubMed

Klein, Günter

2011-07-01

Bacillus cereus var. toyoi strain NCIMB 40112 (Toyocerin), a probiotic authorized in the European Union as feed additive for swine, bovines, poultry, and rabbits, was characterized by DNA fingerprinting applying pulsed-field gel electrophoresis and multilocus sequence typing and was compared with reference strains (of clinical and environmental origins). The probiotic strain was clearly characterized by pulsed-field gel electrophoresis using the restriction enzymes Apa I and Sma I resulting in unique DNA patterns. The comparison to the clinical reference strain B. cereus DSM 4312 was done with the same restriction enzymes, and again a clear differentiation of the two strains was possible by the resulting DNA patterns. The use of the restriction enzymes Apa I and Sma I is recommended for further studies. Furthermore, multilocus sequence typing analysis revealed a sequence type (ST 111) that was different from all known STs of B. cereus strains from food poisoning incidents. Thus, a strain characterization and differentiation from food poisoning strains for the probiotic strain was possible. Copyright ©, International Association for Food Protection

Molecular and comparative analysis of Salmonella enterica Senftenberg from humans and animals using PFGE, MLST and NARMS.

PubMed

Stepan, Ryan M; Sherwood, Julie S; Petermann, Shana R; Logue, Catherine M

2011-06-27

Salmonella species are recognized worldwide as a significant cause of human and animal disease. In this study the molecular profiles and characteristics of Salmonella enterica Senftenberg isolated from human cases of illness and those recovered from healthy or diagnostic cases in animals were assessed. Included in the study was a comparison with our own sequenced strain of S. Senfteberg recovered from production turkeys in North Dakota. Isolates examined in this study were subjected to antimicrobial susceptibility profiling using the National Antimicrobial Resistance Monitoring System (NARMS) panel which tested susceptibility to 15 different antimicrobial agents. The molecular profiles of all isolates were determined using Pulsed Field Gel Electrophoresis (PFGE) and the sequence types of the strains were obtained using Multi-Locus Sequence Type (MLST) analysis based on amplification and sequence interrogation of seven housekeeping genes (aroC, dnaN, hemD, hisD, purE, sucA, and thrA). PFGE data was input into BioNumerics analysis software to generate a dendrogram of relatedness among the strains. The study found 93 profiles among 98 S. Senftenberg isolates tested and there were primarily two sequence types associated with humans and animals (ST185 and ST14) with overlap observed in all host types suggesting that the distribution of S. Senftenberg sequence types is not host dependent. Antimicrobial resistance was observed among the animal strains, however no resistance was detected in human isolates suggesting that animal husbandry has a significant influence on the selection and promotion of antimicrobial resistance. The data demonstrates the circulation of at least two strain types in both animal and human health suggesting that S. Senftenberg is relatively homogeneous in its distribution. The data generated in this study could be used towards defining a pathotype for this serovar.

Complete Genome Sequence of Akkermansia glycaniphila Strain PytT, a Mucin-Degrading Specialist of the Reticulated Python Gut

PubMed Central

Ouwerkerk, Janneke P.; Schaap, Peter J.; Ritari, Jarmo; Paulin, Lars; Belzer, Clara

2017-01-01

ABSTRACT Akkermansia glycaniphila is a novel Akkermansia species that was isolated from the intestine of the reticulated python and shares the capacity to degrade mucin with the human strain Akkermansia muciniphila MucT. Here, we report the complete genome sequence of strain PytT of 3,074,121 bp. The genomic analysis reveals genes for mucin degradation and aerobic respiration. PMID:28057747

Draft Genome Sequence of Lactobacillus salivarius SGL 03, a Novel Potential Probiotic Strain.

PubMed

Federici, Federica; Manna, Laura; Rizzi, Eleonora; Galantini, Elena; Marini, Umberto

2017-12-07

In this work, we report the draft genome sequence of Lactobacillus salivarius SGL 03, a novel potential probiotic strain isolated from healthy infant stools. Antibiotic resistance analysis revealed the presence of a tetracycline resistance gene without elements potentially responsible for interspecific horizontal gene transfer. Copyright © 2017 Federici et al.

Comparison and phylogenetic analysis of the ISS gene in two predominant avian pathogenic E. coli serogroups isolated from avian colibacillosis in Iran.

PubMed

Zahraei Salehi, Taghi; Derakhshandeh, Abdollah; Tadjbakhsh, Hasan; Karimi, Vahid

2013-02-01

The ISS (increased serum survival) gene and its protein product (ISS) of avian pathogenic Escherichia coli (APEC) are important characteristics of resistance to the complement system. The aims of this study were to clone, sequence and characterize sequence diversity of the ISS gene between two predominant serogroups in Iran and among those previously deposited in Genbank. The ISS gene of 309 bp from the APEC χ1390 strain was amplified by PCR, cloned and sequenced using pTZ57R/T vector. The ISS gene from the χ1390 strain has 100% identity among different serogroups of APEC in different geographical regions throughout the world. Phylogenetic analysis shows two different phylogenic groups among the different strains. Strong association of nucleotide sequences among different E. coli strains suggests that it may be a conserved gene and could be a suitable antigen to control and detect avian pathogenic E. coli, at least in our region. Currently, our group is working on the ISS protein as candidate vaccine in SPF poultry. Copyright © 2012 Elsevier Ltd. All rights reserved.

Community-led comparative genomic and phenotypic analysis of the aquaculture pathogen Pseudomonas baetica a390T sequenced by Ion semiconductor and Nanopore technologies

PubMed Central

Beaton, Ainsley; Lood, Cédric; Cunningham-Oakes, Edward; MacFadyen, Alison; Mullins, Alex J; Bestawy, Walid El; Botelho, João; Chevalier, Sylvie; Dalzell, Chloe; Dolan, Stephen K; Faccenda, Alberto; Ghequire, Maarten G K; Higgins, Steven; Kutschera, Alexander; Murray, Jordan; Redway, Martha; Salih, Talal; Smith, Brian A; Smits, Nathan; Thomson, Ryan; Woodcock, Stuart; Cornelis, Pierre; Lavigne, Rob; van Noort, Vera

2018-01-01

Abstract Pseudomonas baetica strain a390T is the type strain of this recently described species and here we present its high-contiguity draft genome. To celebrate the 16th International Conference on Pseudomonas, the genome of P. baetica strain a390T was sequenced using a unique combination of Ion Torrent semiconductor and Oxford Nanopore methods as part of a collaborative community-led project. The use of high-quality Ion Torrent sequences with long Nanopore reads gave rapid, high-contiguity and -quality, 16-contig genome sequence. Whole genome phylogenetic analysis places P. baetica within the P. koreensis clade of the P. fluorescens group. Comparison of the main genomic features of P. baetica with a variety of other Pseudomonas spp. suggests that it is a highly adaptable organism, typical of the genus. This strain was originally isolated from the liver of a diseased wedge sole fish, and genotypic and phenotypic analyses show that it is tolerant to osmotic stress and to oxytetracycline. PMID:29579234

Genome Sequence of African Swine Fever Virus BA71, the Virulent Parental Strain of the Nonpathogenic and Tissue-Culture Adapted BA71V

PubMed Central

Rodríguez, Javier M.; Moreno, Leticia Tais; Alejo, Alí; Lacasta, Anna; Rodríguez, Fernando; Salas, María L.

2015-01-01

The strain BA71V has played a key role in African swine fever virus (ASFV) research. It was the first genome sequenced, and remains the only genome completely determined. A large part of the studies on the function of ASFV genes, viral transcription, replication, DNA repair and morphogenesis, has been performed using this model. This avirulent strain was obtained by adaptation to grow in Vero cells of the highly virulent BA71 strain. We report here the analysis of the genome sequence of BA71 in comparison with that of BA71V. They possess the smallest genomes for a virulent or an attenuated ASFV, and are essentially identical except for a relatively small number of changes. We discuss the possible contribution of these changes to virulence. Analysis of the BA71 sequence allowed us to identify new similarities among ASFV proteins, and with database proteins including two ASFV proteins that could function as a two-component signaling network. PMID:26618713

[Molecular epidemiology and transmission of HIV-1 infection in Zhejiang province, 2015].

PubMed

Yang, J Z; Chen, W J; Zhang, W J; He, L; Zhang, J F; Pan, X H

2017-11-10

Objective: To understand the distribution of HIV-1 subtype diversity and its transmission characteristics in Zhejiang province. Methods: A total of 302 newly diagnosed HIV-1 positive patients were selected through stratified random sampling in Zhejiang in 2015. HIV-1 pol genes were sequenced successfully with reverse transcription PCR/nested PCR and phylogenetic analysis was conducted for 276 patients. Then a molecular epidemiologic study was performed combined with field epidemiological investigation. Results: Of 276 sequence samples analyzed, 122 CRF07_BC strains (44.2%), 103 CRF01_AE strains (37.3%), 17 CRF08_BC strains (6.1%), 9 B strains (3.2%), 6 CRF55_01B strains (2.2%), 5 C strains (1.8%), 1 CRF59_01B strain (0.4%), 1 CRF67_01B strain (0.4%), 1 A1 strain (0.4%), and 11 URFs strains (4.0%) were identified. Phylogenetic analysis revealed 16 clusters with only 15.1% (34/225) sequences involved among CRF07_BC and CRF01_AE strains. The clustered cases in MSM were higher than that in populations with other transmission routes. And clusters existed between the populations with different transmission routes. Conclusion: The major strains of HIV-1 in Zhejiang are CRF07_BC and CRF01_AE. The HIV subtypes showed more complexity in Zhejiang. It is necessary to strengthen the surveillance for HIV subtypes, carry out classified management and conduct effective prevention and control in the population at high risk.

Whole genome analysis of an MDR Beijing/W strain of Mycobacterium tuberculosis with large genomic deletions associated with resistance to isoniazid.

PubMed

Zhang, Qiufen; Wan, Baoshan; Zhou, Aiping; Ni, Jinjing; Xu, Zhihong; Li, Shuxian; Tao, Jing; Yao, YuFeng

2016-05-15

Mycobacterium tuberculosis (M.tb) is one of the most prevalent bacterial pathogens in the world. With geographical wide spread and hypervirulence, Beijing/W family is the most successful M.tb lineage. China is a country of high tuberculosis (TB) and high multiple drug-resistant TB (MDR-TB) burden, and the Beijing/W family strains take the largest share of MDR strains. To study the genetic basis of Beijing/W family strains' virulence and drug resistance, we performed the whole genome sequencing of M.tb strain W146, a clinical Beijing/W genotype MDR isolated from Wuxi, Jiangsu province, China. Compared with genome sequence of M.tb strain H37Rv, we found that strain W146 lacks three large fragments and the missing of furA-katG operon confers isoniazid resistance. Besides the missing of furA-katG operon, strain W146 harbored almost all known drug resistance-associated mutations. Comparison analysis of single nucleotide polymorphisms (SNPs) and indels between strain W146 and Beijing/W genotype strains and non-Beijing/W genotype strains revealed that strain W146 possessed some unique mutations, which may be related to drug resistance, transmission and pathogenicity. These findings will help to understand the large sequence polymorphisms (LSPs) and the transmission and drug resistance related genetic characteristics of the Beijing/W genotype of M.tb. Copyright © 2016 Elsevier B.V. All rights reserved.

Clostridium botulinum strains producing BoNT/F4 or BoNT/F5.

PubMed

Raphael, Brian H; Bradshaw, Marite; Kalb, Suzanne R; Joseph, Lavin A; Lúquez, Carolina; Barr, John R; Johnson, Eric A; Maslanka, Susan E

2014-05-01

Botulinum neurotoxin type F (BoNT/F) may be produced by Clostridium botulinum alone or in combination with another toxin type such as BoNT/A or BoNT/B. Type F neurotoxin gene sequences have been further classified into seven toxin subtypes. Recently, the genome sequence of one strain of C. botulinum (Af84) was shown to contain three neurotoxin genes (bont/F4, bont/F5, and bont/A2). In this study, eight strains containing bont/F4 and seven strains containing bont/F5 were examined. Culture supernatants produced by these strains were incubated with BoNT/F-specific peptide substrates. Cleavage products of these peptides were subjected to mass spectral analysis, allowing detection of the BoNT/F subtypes present in the culture supernatants. PCR analysis demonstrated that a plasmid-specific marker (PL-6) was observed only among strains containing bont/F5. Among these strains, Southern hybridization revealed the presence of an approximately 242-kb plasmid harboring bont/F5. Genome sequencing of four of these strains revealed that the genomic backgrounds of strains harboring either bont/F4 or bont/F5 are diverse. None of the strains analyzed in this study were shown to produce BoNT/F4 and BoNT/F5 simultaneously, suggesting that strain Af84 is unusual. Finally, these data support a role for the mobility of a bont/F5-carrying plasmid among strains of diverse genomic backgrounds.

Molecular Cloning and Sequence Analysis of the Sta58 Major Antigen Gene of Rickettsia tsutsugamushi: Sequence homology and Antigenic Comparison of Sta58 to the 60-Kilodalton Family of Stress Proteins

DTIC Science & Technology

1990-05-01

Sta58 antigen and the Sta56 strain- GroES, C. burnetii HtpA, Mycobacterium tuberculosis 12- specific major antigen of R. tsutsugamushi (strain Karp...kb HindlIl fragment carrying the gene for the Sta58 tuberculosis, and Mycobacterium smegmatis (65-kDa anti- protein was subjected to DNA sequence...the Hsp6O and HsplO proteins. R. tsu., R. isutsugamushi; M. lep., Mvtcobacteriutn leprae : C. bur., C. burneiii; Synech.. Synechococcus strain 6301; T

Draft genome analysis of Dietzia sp. 111N12-1, isolated from the South China Sea with bioremediation activity.

PubMed

Yang, Shanjun; Yu, Mingjia; Chen, Jianming

Dietzia sp. 111N12-1, isolated from the seawater of South China Sea, shows strong petroleum hydrocarbons degradation activity. Here, we report the draft sequence of approximately 3.7-Mbp genome of this strain. To the best of our knowledge, this is the first genome sequence of Dietzia strain isolated from the sea. The genome sequence may provide fundamental molecular information on elucidating the metabolic pathway of hydrocarbons degradation in this strain. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Study of Streptococcus thermophilus population on a world-wide and historical collection by a new MLST scheme.

PubMed

Delorme, Christine; Legravet, Nicolas; Jamet, Emmanuel; Hoarau, Caroline; Alexandre, Bolotin; El-Sharoud, Walid M; Darwish, Mohamed S; Renault, Pierre

2017-02-02

We analyzed 178 Streptococcus thermophilus strains isolated from diverse products, from around the world, over a 60-year period with a new multilocus sequence typing (MLST) scheme. This collection included isolates from two traditional cheese-making sites with different starter-use practices, in sampling campaigns carried out over a three years period. The nucleotide diversity of the S. thermophilus population was limited, but 116 sequence types (ST) were identified. Phylogenetic analysis of the concatenated sequences of the six housekeeping genes revealed the existence of groups confirmed by eBURST analysis. Deeper analyses performed on 25 strains by CRISPR and whole-genome analysis showed that phylogenies obtained by MLST and whole-genome analysis were in agreement but differed from that inferred by CRISPR analysis. Strains isolated from traditional products could cluster in specific groups indicating their origin, but also be mixed in groups containing industrial starter strains. In the traditional cheese-making sites, we found that S. thermophilus persisted on dairy equipment, but that occasionally added starter strains may become dominant. It underlined the impact of starter use that may reshape S. thermophilus populations including in traditional products. This new MLST scheme thus provides a framework for analyses of S. thermophilus populations and the management of its biodiversity. Copyright © 2016 Elsevier B.V. All rights reserved.

Serratia bozhouensis sp. nov., Isolated from Sewage Samples of a Dairy Farm.

PubMed

Shang, Fei; Xue, Ting; Wang, Man; Chen, Xiaolin; Yu, Li; Zhang, Ming

2017-07-01

A Gram-negative, rod-shaped, salt-tolerant, non-pigmented, and non-spore-forming bacterium, designated strain W1 T (type strain CICC 23797 = CGMCC1.14949), was isolated from sewage samples of a dairy farm in Bozhou, Anhui, China. Strain W1 was resistant to lincomycin, troleandomycin, rifamycin, and vancomycin. Sequence analysis of the 16S rDNA gene revealed that the strain showed sequence similarity of 98.2% with the closest related species Serratia quinivorans CP6a T . The genomic DNA G+C content of the isolate was 52.8 mol%. The biochemical characteristics of strain W1 T assessed by the API 20E and Biolog GEN III analysis were different from those of the members of the genus Serratia. On the basis of the phenotypic and genotypic differences, strain W1 was proposed to be a novel Serratia species, Serratia bozhouensis sp. nov W1 T .

Whole-Genome Sequence Variation among Multiple Isolates of Pseudomonas aeruginosa

PubMed Central

Spencer, David H.; Kas, Arnold; Smith, Eric E.; Raymond, Christopher K.; Sims, Elizabeth H.; Hastings, Michele; Burns, Jane L.; Kaul, Rajinder; Olson, Maynard V.

2003-01-01

Whole-genome shotgun sequencing was used to study the sequence variation of three Pseudomonas aeruginosa isolates, two from clonal infections of cystic fibrosis patients and one from an aquatic environment, relative to the genomic sequence of reference strain PAO1. The majority of the PAO1 genome is represented in these strains; however, at least three prominent islands of PAO1-specific sequence are apparent. Conversely, ∼10% of the sequencing reads derived from each isolate fail to align with the PAO1 backbone. While average sequence variation among all strains is roughly 0.5%, regions of pronounced differences were evident in whole-genome scans of nucleotide diversity. We analyzed two such divergent loci, the pyoverdine and O-antigen biosynthesis regions, by complete resequencing. A thorough analysis of isolates collected over time from one of the cystic fibrosis patients revealed independent mutations resulting in the loss of O-antigen synthesis alternating with a mucoid phenotype. Overall, we conclude that most of the PAO1 genome represents a core P. aeruginosa backbone sequence while the strains addressed in this study possess additional genetic material that accounts for at least 10% of their genomes. Approximately half of these additional sequences are novel. PMID:12562802

AGAPE (Automated Genome Analysis PipelinE) for Pan-Genome Analysis of Saccharomyces cerevisiae

PubMed Central

Song, Giltae; Dickins, Benjamin J. A.; Demeter, Janos; Engel, Stacia; Dunn, Barbara; Cherry, J. Michael

2015-01-01

The characterization and public release of genome sequences from thousands of organisms is expanding the scope for genetic variation studies. However, understanding the phenotypic consequences of genetic variation remains a challenge in eukaryotes due to the complexity of the genotype-phenotype map. One approach to this is the intensive study of model systems for which diverse sources of information can be accumulated and integrated. Saccharomyces cerevisiae is an extensively studied model organism, with well-known protein functions and thoroughly curated phenotype data. To develop and expand the available resources linking genomic variation with function in yeast, we aim to model the pan-genome of S. cerevisiae. To initiate the yeast pan-genome, we newly sequenced or re-sequenced the genomes of 25 strains that are commonly used in the yeast research community using advanced sequencing technology at high quality. We also developed a pipeline for automated pan-genome analysis, which integrates the steps of assembly, annotation, and variation calling. To assign strain-specific functional annotations, we identified genes that were not present in the reference genome. We classified these according to their presence or absence across strains and characterized each group of genes with known functional and phenotypic features. The functional roles of novel genes not found in the reference genome and associated with strains or groups of strains appear to be consistent with anticipated adaptations in specific lineages. As more S. cerevisiae strain genomes are released, our analysis can be used to collate genome data and relate it to lineage-specific patterns of genome evolution. Our new tool set will enhance our understanding of genomic and functional evolution in S. cerevisiae, and will be available to the yeast genetics and molecular biology community. PMID:25781462

Kribbella albertanoniae sp. nov., isolated from a Roman catacomb, and emended description of the genus Kribbella.

PubMed

Everest, Gareth J; Curtis, Sarah M; De Leo, Filomena; Urzì, Clara; Meyers, Paul R

2013-10-01

A novel actinobacterium, strain BC640(T), was isolated from a biofilm sample collected in 2009 in the Saint Callistus Roman catacombs. Analysis of the 16S rRNA gene sequence showed that the strain belonged to the genus Kribbella. Phylogenetic analysis using the 16S rRNA gene and concatenated gyrB, rpoB, relA, recA and atpD gene sequences showed that strain BC640(T) was most closely related to the type strains of Kribbella yunnanensis and Kribbella sandramycini. Based on gyrB genetic distance analysis, strain BC640(T) was shown to be distinct from all Kribbella type strains. DNA-DNA hybridization experiments confirmed that strain BC640(T) represents a genomic species distinct from its closest phylogenetic relatives, K. yunnanensis DSM 15499(T) (53.5±7.8 % DNA relatedness) and K. sandramycini DSM 15626(T) (33.5±5.0 %). Physiological comparisons further showed that strain BC640(T) is phenotypically distinct from the type strains of K. yunnanensis and K. sandramycini. Strain BC640(T) ( = DSM 26744(T) = NRRL B-24917(T)) is thus presented as the type strain of a novel species, for which the name Kribbella albertanoniae sp. nov. is proposed.

Erwinia amylovora CRISPR Elements Provide New Tools for Evaluating Strain Diversity and for Microbial Source Tracking

PubMed Central

McGhee, Gayle C.; Sundin, George W.

2012-01-01

Clustered regularly interspaced short palindromic repeats (CRISPRs) comprise a family of short DNA repeat sequences that are separated by non repetitive spacer sequences and, in combination with a suite of Cas proteins, are thought to function as an adaptive immune system against invading DNA. The number of CRISPR arrays in a bacterial chromosome is variable, and the content of each array can differ in both repeat number and in the presence or absence of specific spacers. We utilized a comparative sequence analysis of CRISPR arrays of the plant pathogen Erwinia amylovora to uncover previously unknown genetic diversity in this species. A total of 85 E. amylovora strains varying in geographic isolation (North America, Europe, New Zealand, and the Middle East), host range, plasmid content, and streptomycin sensitivity/resistance were evaluated for CRISPR array number and spacer variability. From these strains, 588 unique spacers were identified in the three CRISPR arrays present in E. amylovora, and these arrays could be categorized into 20, 17, and 2 patterns types, respectively. Analysis of the relatedness of spacer content differentiated most apple and pear strains isolated in the eastern U.S. from western U.S. strains. In addition, we identified North American strains that shared CRISPR genotypes with strains isolated on other continents. E. amylovora strains from Rubus and Indian hawthorn contained mostly unique spacers compared to apple and pear strains, while strains from loquat shared 79% of spacers with apple and pear strains. Approximately 23% of the spacers matched known sequences, with 16% targeting plasmids and 5% targeting bacteriophage. The plasmid pEU30, isolated in E. amylovora strains from the western U.S., was targeted by 55 spacers. Lastly, we used spacer patterns and content to determine that streptomycin-resistant strains of E. amylovora from Michigan were low in diversity and matched corresponding streptomycin-sensitive strains from the background population. PMID:22860008

Erwinia amylovora CRISPR elements provide new tools for evaluating strain diversity and for microbial source tracking.

PubMed

McGhee, Gayle C; Sundin, George W

2012-01-01

Clustered regularly interspaced short palindromic repeats (CRISPRs) comprise a family of short DNA repeat sequences that are separated by non repetitive spacer sequences and, in combination with a suite of Cas proteins, are thought to function as an adaptive immune system against invading DNA. The number of CRISPR arrays in a bacterial chromosome is variable, and the content of each array can differ in both repeat number and in the presence or absence of specific spacers. We utilized a comparative sequence analysis of CRISPR arrays of the plant pathogen Erwinia amylovora to uncover previously unknown genetic diversity in this species. A total of 85 E. amylovora strains varying in geographic isolation (North America, Europe, New Zealand, and the Middle East), host range, plasmid content, and streptomycin sensitivity/resistance were evaluated for CRISPR array number and spacer variability. From these strains, 588 unique spacers were identified in the three CRISPR arrays present in E. amylovora, and these arrays could be categorized into 20, 17, and 2 patterns types, respectively. Analysis of the relatedness of spacer content differentiated most apple and pear strains isolated in the eastern U.S. from western U.S. strains. In addition, we identified North American strains that shared CRISPR genotypes with strains isolated on other continents. E. amylovora strains from Rubus and Indian hawthorn contained mostly unique spacers compared to apple and pear strains, while strains from loquat shared 79% of spacers with apple and pear strains. Approximately 23% of the spacers matched known sequences, with 16% targeting plasmids and 5% targeting bacteriophage. The plasmid pEU30, isolated in E. amylovora strains from the western U.S., was targeted by 55 spacers. Lastly, we used spacer patterns and content to determine that streptomycin-resistant strains of E. amylovora from Michigan were low in diversity and matched corresponding streptomycin-sensitive strains from the background population.

Molecular characterization of two hantavirus strains from different rattus species in Singapore

PubMed Central

2010-01-01

Background Hantaviruses cause human disease in endemic regions around the world. Outbreaks of hantaviral diseases have been associated with changes in rodent population density and adaptation to human settlements leading to their proliferation in close proximity to human dwellings. In a parallel study initiated to determine the prevalence of pathogens in Singapore's wild rodent population, 1206 rodents were trapped and screened. The findings established a hantavirus seroprevalence of 34%. This paper describes the molecular characterization of hantaviruses from Rattus norvegicus and Rattus tanezumi, the predominant rodents caught in urban Singapore. Methodology Pan-hanta RT-PCR performed on samples of Rattus norvegicus and Rattus tanezumi indicated that 27 (2.24%) of the animals were positive. sequence analysis of the S and M segments established that two different hantavirus strains circulate in the rodent population of Singapore. Notably, the hantavirus strains found in Rattus norvegicus clusters with other Asian Seoul virus sequences, while the virus strains found in Rattus tanezumi had the highest sequence similarity to the Serang virus from Rattus tanezumi in Indonesia, followed by Cambodian hantavirus isolates and the Thailand virus isolated from Bandicota indica. Conclusions Sequence analysis of the S and M segments of hantavirus strains found in Rattus norvegicus (Seoul virus strain Singapore) and Rattus tanezumi (Serang virus strain Jurong TJK/06) revealed that two genetically different hantavirus strains were found in rodents of Singapore. Evidently, together with Serang, Cambodian and Thailand virus the Jurong virus forms a distinct phylogroup. Interestingly, these highly similar virus strains have been identified in different rodent hosts. Further studies are underway to analyze the public health significance of finding hantavirus strains in Singapore rodents. PMID:20096099

Fontibacillus aquaticus gen. nov., sp. nov., isolated from a warm spring.

PubMed

Saha, P; Krishnamurthi, S; Bhattacharya, A; Sharma, R; Chakrabarti, T

2010-02-01

A novel facultatively anaerobic strain, designated GPTSA 19(T), was isolated from a warm spring and characterized using a polyphasic approach. The strain behaved as Gram-negative in the Gram staining procedure but showed a Gram-positive reaction in the aminopeptidase test. The novel strain was a mesophilic rod with ellipsoidal endospores. On the basis of 16S rRNA gene sequence analysis, the strain showed closest similarity (96.0 %) with Paenibacillus motobuensis MC10(T). The gene sequence similarity of the novel strain with other species of the genus Paenibacillus was <95.8 %. The novel strain also had PAEN 515F and 682F signature sequence stretches in the 16S rRNA gene that are usually found in most species of the genus Paenibacillus. The strain possessed anteiso-C(15 : 0) as the major fatty acid and MK-7 as the predominant menaquinone. Polar lipids included diphosphatidylglycerol (DPG), phosphatidylglycerol (PG), phosphatidylethanolamine (PE), six unknown phospholipids (PLs), one aminophospholipid (PN), three glycolipids (GLs), two aminolipids (ALs), one aminophosphoglycolipid (APGL) and three unknown lipids (ULs). The polar lipid profile of the novel strain, especially as regards ALs, GLs and PLs, distinguished it from the recognized type species of the genus Paenibacillus, Paenibacillus polymyxa, as well as from its closest relative P. motobuensis. Based on phenotypic and chemotaxonomic characteristics and analysis of the 16S rRNA gene sequence, the new strain merits the rank of a novel genus for which the name Fontibacillus gen. nov. is proposed. The type species of the new genus is Fontibacillus aquaticus gen. nov., sp. nov. with the type strain GPTSA 19(T) (=MTCC 7155(T)=DSM 17643(T)).

Delineation of the Species Haemophilus influenzae by Phenotype, Multilocus Sequence Phylogeny, and Detection of Marker Genes▿ †

PubMed Central

Nørskov-Lauritsen, Niels; Overballe, Merete D.; Kilian, Mogens

2009-01-01

To obtain more information on the much-debated definition of prokaryotic species, we investigated the borders of Haemophilus influenzae by comparative analysis of H. influenzae reference strains with closely related bacteria including strains assigned to Haemophilus haemolyticus, cryptic genospecies biotype IV, and the never formally validated species “Haemophilus intermedius”. Multilocus sequence phylogeny based on six housekeeping genes separated a cluster encompassing the type and the reference strains of H. influenzae from 31 more distantly related strains. Comparison of 16S rRNA gene sequences supported this delineation but was obscured by a conspicuously high number of polymorphic sites in many of the strains that did not belong to the core group of H. influenzae strains. The division was corroborated by the differential presence of genes encoding H. influenzae adhesion and penetration protein, fuculokinase, and Cu,Zn-superoxide dismutase, whereas immunoglobulin A1 protease activity or the presence of the iga gene was of limited discriminatory value. The existence of porphyrin-synthesizing strains (“H. intermedius”) closely related to H. influenzae was confirmed. Several chromosomally encoded hemin biosynthesis genes were identified, and sequence analysis showed these genes to represent an ancestral genotype rather than recent transfers from, e.g., Haemophilus parainfluenzae. Strains previously assigned to H. haemolyticus formed several separate lineages within a distinct but deeply branching cluster, intermingled with strains of “H. intermedius” and cryptic genospecies biotype IV. Although H. influenzae is phenotypically more homogenous than some other Haemophilus species, the genetic diversity and multicluster structure of strains traditionally associated with H. influenzae make it difficult to define the natural borders of that species. PMID:19060144

Molecular Typing of Clinical Adenovirus Specimens by an Algorithm which Permits Detection of Adenovirus Coinfections and Intermediate Adenovirus Strains

PubMed Central

McCarthy, Troy; Lebeck, Mark G.; Capuano, Ana W.; Schnurr, David P.; Gray, Gregory C.

2009-01-01

Background Epidemiological data suggest that clinical outcomes of human adenovirus (HAdV) infection may be influenced by virus serotype, coinfection with multiple strains, or infection with novel intermediate strains. In this report, we propose a clinical algorithm for detecting HAdV coinfection and intermediate strains. Study Design We PCR amplified and sequenced subregions of the hexon and fiber genes of 342 HAdV positive clinical specimens obtained from 14 surveillance laboratories. Sequences were then compared with those from 52 HAdV prototypic strains. HAdV positive specimens that showed nucleotide sequence identity with a corresponding prototype strain were designated as being of that strain. When hexon and fiber gene sequences disagreed, or sequence identity was low, the specimens were further characterized by viral culture, plaque purification, repeat PCR with sequencing, and genome restriction enzyme digest analysis. Results Of the 342 HAdV-positive clinical specimens, 328 (95.9%) were single HAdV strain infections, 12 (3.5%) were coinfections, and 2 (0.6%) had intermediate strains. Coinfected specimens and intermediate HAdV strains considered together were more likely to be associated with severe illness compared to other HAdv-positive specimens (OR=3.8; 95% CI = 1.2–11.9). Conclusions The majority of severe cases of HAdV illness cases occurred among immunocompromised patients. The analytic algorithm we describe here can be used to screen clinical specimens for evidence of HAdV coinfection and novel intermediate HAdV strains. This algorithm may be especially useful in investigating HAdV outbreaks and clusters of unusually severe HAdV disease. PMID:19577957

Genetic characterization and phylogenetic analysis of porcine circovirus type 2 (PCV2) in Serbia.

PubMed

Savic, Bozidar; Milicevic, Vesna; Jakic-Dimic, Dobrila; Bojkovski, Jovan; Prodanovic, Radisa; Kureljusic, Branislav; Potkonjak, Aleksandar; Savic, Borivoje

2012-01-01

Porcine circovirus type 2 (PCV2) is the main causative agent of postweaning multisystemic wasting syndrome (PMWS). To characterize and determine the genetic diversity of PCV2 in the porcine population of Serbia, nucleotide and deduced amino acid sequences of the open reading frame 2 (ORF2) of PCV2 collected from the tissues of pigs that either had died as a result of PMWS or did not exhibit disease symptoms were analyzed. Sequencing and phylogenetic analysis showed considerable diversity among PCV2 ORF2 sequences and the existence of two main PCV2 genotypes, PCV2b and PCV2a, with at least three clusters, 1A/B, 1C and 2D. In order to provide further proof that the 1C strain is circulating in the porcine population, the whole viral genome of one PCV2 isolate was sequenced. Genotyping and phylogenetic analysis using the entire viral genome sequences confirmed that there was a PMWS-associated 1C strain emerging in Serbia. Our analysis also showed that PCV2b is dominant in the porcine population, and that it is exclusively associated with PMWS occurrences in the country. These data constitute a useful basis for further epidemiological studies regarding the heterogeneity of PCV2 strains on the European continent.

Comparative methylome analysis of the occasional ruminant respiratory pathogen Bibersteinia trehalosi

USDA-ARS?s Scientific Manuscript database

Four strains of Bibersteinia trehalosi have been sequenced and both their genomes and methylomes compared. Three of the strains, 188, 189 and 192, are very similar while strain 190 is significantly different in several aspects. Within these strains differential methylation patterns are observed an...

Analysis of ChimeriVax Japanese Encephalitis Virus envelope for T-cell epitopes and comparison to circulating strain sequences.

PubMed

De Groot, Anne S; Martin, William; Moise, Leonard; Guirakhoo, Farshad; Monath, Thomas

2007-11-19

T-cell epitope variability is associated with viral immune escape and may influence the outcome of vaccination against the highly variable Japanese Encephalitis Virus (JEV). We computationally analyzed the ChimeriVax-JEV vaccine envelope sequence for T helper epitopes that are conserved in 12 circulating JEV strains and discovered 75% conservation among putative epitopes. Among non-identical epitopes, only minor amino acid changes that would not significantly affect HLA-binding were present. Therefore, in most cases, circulating strain epitopes could be restricted by the same HLA and are likely to stimulate a cross-reactive T-cell response. Based on this analysis, we predict no significant abrogation of ChimeriVax-JEV-conferred protection against circulating JEV strains.

Whole Genome Sequence Analysis Using JSpecies Tool Establishes Clonal Relationships between Listeria monocytogenes Strains from Epidemiologically Unrelated Listeriosis Outbreaks

DOE PAGES

Burall, Laurel S.; Grim, Christopher J.; Mammel, Mark K.; ...

2016-03-07

In an effort to build a comprehensive genomic approach to food safety challenges, the FDA has implemented a whole genome sequencing effort, GenomeTrakr, which involves the sequencing and analysis of genomes of foodborne pathogens. As a part of this effort, we routinely sequence whole genomes of Listeria monocytogenes (Lm) isolates associated with human listeriosis outbreaks, as well as those isolated through other sources. To rapidly establish genetic relatedness of these genomes, we evaluated tetranucleotide frequency analysis via the JSpecies program to provide a cursory analysis of strain relatedness. The JSpecies tetranucleotide (tetra) analysis plots standardized (z-score) tetramer word frequencies ofmore » two strains against each other and uses linear regression analysis to determine similarity (r 2). This tool was able to validate the close relationships between outbreak related strains from four different outbreaks. Included in this study was the analysis of Lm strains isolated during the recent caramel apple outbreak and stone fruit incident in 2014. We identified that many of the isolates from these two outbreaks shared a common 4b variant (4bV) serotype, also designated as IVb-v1, using a qPCR protocol developed in our laboratory. The 4bV serotype is characterized by the presence of a 6.3 Kb DNA segment normally found in serotype 1/2a, 3a, 1/2c and 3c strains but not in serotype 4b or 1/2b strains. We decided to compare these strains at a genomic level using the JSpecies Tetra tool. Specifically, we compared several 4bV and 4b isolates and identified a high level of similarity between the stone fruit and apple 4bV strains, but not the 4b strains co-identified in the caramel apple outbreak or other 4b or 4bV strains in our collection. This finding was further substantiated by a SNP-based analysis. Additionally, we were able to identify close relatedness between isolates from clinical cases from 1993–1994 and a single case from 2011 as well as links between two isolates from over 30 years ago. The identification of these potential links shows that JSpecies Tetra analysis can be a useful tool in rapidly assessing genetic relatedness of Lm isolates during outbreak investigations and for comparing historical isolates. In conclusion, our analyses led to the identification of a highly related clonal group involved in two separate outbreaks, stone fruit and caramel apple, and suggests the possibility of a new genotype that may be better adapted for certain foods and/or environment.« less

Whole Genome Sequence Analysis Using JSpecies Tool Establishes Clonal Relationships between Listeria monocytogenes Strains from Epidemiologically Unrelated Listeriosis Outbreaks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burall, Laurel S.; Grim, Christopher J.; Mammel, Mark K.

In an effort to build a comprehensive genomic approach to food safety challenges, the FDA has implemented a whole genome sequencing effort, GenomeTrakr, which involves the sequencing and analysis of genomes of foodborne pathogens. As a part of this effort, we routinely sequence whole genomes of Listeria monocytogenes (Lm) isolates associated with human listeriosis outbreaks, as well as those isolated through other sources. To rapidly establish genetic relatedness of these genomes, we evaluated tetranucleotide frequency analysis via the JSpecies program to provide a cursory analysis of strain relatedness. The JSpecies tetranucleotide (tetra) analysis plots standardized (z-score) tetramer word frequencies ofmore » two strains against each other and uses linear regression analysis to determine similarity (r 2). This tool was able to validate the close relationships between outbreak related strains from four different outbreaks. Included in this study was the analysis of Lm strains isolated during the recent caramel apple outbreak and stone fruit incident in 2014. We identified that many of the isolates from these two outbreaks shared a common 4b variant (4bV) serotype, also designated as IVb-v1, using a qPCR protocol developed in our laboratory. The 4bV serotype is characterized by the presence of a 6.3 Kb DNA segment normally found in serotype 1/2a, 3a, 1/2c and 3c strains but not in serotype 4b or 1/2b strains. We decided to compare these strains at a genomic level using the JSpecies Tetra tool. Specifically, we compared several 4bV and 4b isolates and identified a high level of similarity between the stone fruit and apple 4bV strains, but not the 4b strains co-identified in the caramel apple outbreak or other 4b or 4bV strains in our collection. This finding was further substantiated by a SNP-based analysis. Additionally, we were able to identify close relatedness between isolates from clinical cases from 1993–1994 and a single case from 2011 as well as links between two isolates from over 30 years ago. The identification of these potential links shows that JSpecies Tetra analysis can be a useful tool in rapidly assessing genetic relatedness of Lm isolates during outbreak investigations and for comparing historical isolates. In conclusion, our analyses led to the identification of a highly related clonal group involved in two separate outbreaks, stone fruit and caramel apple, and suggests the possibility of a new genotype that may be better adapted for certain foods and/or environment.« less

Empirical Validation of Pooled Whole Genome Population Re-Sequencing in Drosophila melanogaster

PubMed Central

Zhu, Yuan; Bergland, Alan O.; González, Josefa; Petrov, Dmitri A.

2012-01-01

The sequencing of pooled non-barcoded individuals is an inexpensive and efficient means of assessing genome-wide population allele frequencies, yet its accuracy has not been thoroughly tested. We assessed the accuracy of this approach on whole, complex eukaryotic genomes by resequencing pools of largely isogenic, individually sequenced Drosophila melanogaster strains. We called SNPs in the pooled data and estimated false positive and false negative rates using the SNPs called in individual strain as a reference. We also estimated allele frequency of the SNPs using “pooled” data and compared them with “true” frequencies taken from the estimates in the individual strains. We demonstrate that pooled sequencing provides a faithful estimate of population allele frequency with the error well approximated by binomial sampling, and is a reliable means of novel SNP discovery with low false positive rates. However, a sufficient number of strains should be used in the pooling because variation in the amount of DNA derived from individual strains is a substantial source of noise when the number of pooled strains is low. Our results and analysis confirm that pooled sequencing is a very powerful and cost-effective technique for assessing of patterns of sequence variation in populations on genome-wide scales, and is applicable to any dataset where sequencing individuals or individual cells is impossible, difficult, time consuming, or expensive. PMID:22848651

Next-Generation Sequencing Reveals Frequent Opportunities for Exposure to Hepatitis C Virus in Ghana

PubMed Central

Phillips, Richard O.; Mora, Nallely; Xia, Guo-liang; Campo, David S.; Purdy, Michael A.; Dimitrova, Zoya E.; Owusu, Dorcas O.; Punkova, Lili T.; Skums, Pavel; Owusu-Ofori, Shirley; Sarfo, Fred Stephen; Vaughan, Gilberto; Roh, Hajung; Opare-Sem, Ohene K.; Cooper, Richard S.; Khudyakov, Yury E.

2015-01-01

Globally, hepatitis C Virus (HCV) infection is responsible for a large proportion of persons with liver disease, including cancer. The infection is highly prevalent in sub-Saharan Africa. West Africa was identified as a geographic origin of two HCV genotypes. However, little is known about the genetic composition of HCV populations in many countries of the region. Using conventional and next-generation sequencing (NGS), we identified and genetically characterized 65 HCV strains circulating among HCV-positive blood donors in Kumasi, Ghana. Phylogenetic analysis using consensus sequences derived from 3 genomic regions of the HCV genome, 5'-untranslated region, hypervariable region 1 (HVR1) and NS5B gene, consistently classified the HCV variants (n = 65) into genotypes 1 (HCV-1, 15%) and genotype 2 (HCV-2, 85%). The Ghanaian and West African HCV-2 NS5B sequences were found completely intermixed in the phylogenetic tree, indicating a substantial genetic heterogeneity of HCV-2 in Ghana. Analysis of HVR1 sequences from intra-host HCV variants obtained by NGS showed that three donors were infected with >1 HCV strain, including infections with 2 genotypes. Two other donors share an HCV strain, indicating HCV transmission between them. The HCV-2 strain sampled from one donor was replaced with another HCV-2 strain after only 2 months of observation, indicating rapid strain switching. Bayesian analysis estimated that the HCV-2 strains in Ghana were expanding since the 16th century. The blood donors in Kumasi, Ghana, are infected with a very heterogeneous HCV population of HCV-1 and HCV-2, with HCV-2 being prevalent. The detection of three cases of co- or super-infections and transmission linkage between 2 cases suggests frequent opportunities for HCV exposure among the blood donors and is consistent with the reported high HCV prevalence. The conditions for effective HCV-2 transmission existed for ~ 3–4 centuries, indicating a long epidemic history of HCV-2 in Ghana. PMID:26683463

Geodermatophilus tzadiensis sp. nov., a UV radiation-resistant bacterium isolated from sand of the Saharan desert.

PubMed

Montero-Calasanz, Maria del Carmen; Göker, Markus; Broughton, William J; Cattaneo, Arlette; Favet, Jocelyne; Pötter, Gabriele; Rohde, Manfred; Spröer, Cathrin; Schumann, Peter; Klenk, Hans-Peter; Gorbushina, Anna A

2013-05-01

Three novel Gram-positive, aerobic, actinobacterial strains, CF5/2(T), CF5/1 and CF7/1, were isolated in 2007 during environmental screening of arid desert soil in the Sahara desert, Chad. Results from riboprinting, MALDI-TOF protein spectra and 16S rRNA sequence analysis confirmed that all three strains belonged to the same species. Phylogenetic analysis of 16S rRNA sequences with the strains' closest relatives indicated that they represented a distinct species. The three novel strains also shared a number of physiological and biochemical characteristics distinct from previously named Geodermatophilus species. The novel strains' peptidoglycan contained meso-diaminopimelic acid; their main phospholipids were phosphatidylcholine, phosphatidylethanolamine, diphosphatidylglycerol, phosphatidylinositol and a small amount of phosphatidylglycerol; MK-9(H4) was the dominant menaquinone. The major cellular fatty acids were the branched-chain saturated acids iso-C16:0 and iso-C15:0. Galactose was detected as diagnostic sugar. Based on these chemotaxonomic results, 16S rRNA gene sequence analysis and DNA-DNA hybridization between strain CF5/2(T) and the type strains of Geodermatophilus saharensis, Geodermatophilus arenarius, Geodermatophilus nigrescens, Geodermatophilus telluris and Geodermatophilus siccatus, the isolates CF5/2(T), CF5/1 and CF7/1 are proposed to represent a novel species, Geodermatophilus tzadiensis, with type strain CF5/2(T)=DSM 45416=MTCC 11411 and two reference strains, CF5/1 (DSM 45415) and CF7/1 (DSM 45420). Copyright © 2013 Elsevier GmbH. All rights reserved.

Classification of Plant Associated Bacteria Using RIF, a Computationally Derived DNA Marker

PubMed Central

Schneider, Kevin L.; Marrero, Glorimar; Alvarez, Anne M.; Presting, Gernot G.

2011-01-01

A DNA marker that distinguishes plant associated bacteria at the species level and below was derived by comparing six sequenced genomes of Xanthomonas, a genus that contains many important phytopathogens. This DNA marker comprises a portion of the dnaA replication initiation factor (RIF). Unlike the rRNA genes, dnaA is a single copy gene in the vast majority of sequenced bacterial genomes, and amplification of RIF requires genus-specific primers. In silico analysis revealed that RIF has equal or greater ability to differentiate closely related species of Xanthomonas than the widely used ribosomal intergenic spacer region (ITS). Furthermore, in a set of 263 Xanthomonas, Ralstonia and Clavibacter strains, the RIF marker was directly sequenced in both directions with a success rate approximately 16% higher than that for ITS. RIF frameworks for Xanthomonas, Ralstonia and Clavibacter were constructed using 682 reference strains representing different species, subspecies, pathovars, races, hosts and geographic regions, and contain a total of 109 different RIF sequences. RIF sequences showed subspecific groupings but did not place strains of X. campestris or X. axonopodis into currently named pathovars nor R. solanacearum strains into their respective races, confirming previous conclusions that pathovar and race designations do not necessarily reflect genetic relationships. The RIF marker also was sequenced for 24 reference strains from three genera in the Enterobacteriaceae: Pectobacterium, Pantoea and Dickeya. RIF sequences of 70 previously uncharacterized strains of Ralstonia, Clavibacter, Pectobacterium and Dickeya matched, or were similar to, those of known reference strains, illustrating the utility of the frameworks to classify bacteria below the species level and rapidly match unknown isolates to reference strains. The RIF sequence frameworks are available at the online RIF database, RIFdb, and can be queried for diagnostic purposes with RIF sequences obtained from unknown strains in both chromatogram and FASTA format. PMID:21533033

Whole Genome Sequence of Two Wild-Derived Mus musculus domesticus Inbred Strains, LEWES/EiJ and ZALENDE/EiJ, with Different Diploid Numbers

PubMed Central

Morgan, Andrew P.; Didion, John P.; Doran, Anthony G.; Holt, James M.; McMillan, Leonard; Keane, Thomas M.; de Villena, Fernando Pardo-Manuel

2016-01-01

Wild-derived mouse inbred strains are becoming increasingly popular for complex traits analysis, evolutionary studies, and systems genetics. Here, we report the whole-genome sequencing of two wild-derived mouse inbred strains, LEWES/EiJ and ZALENDE/EiJ, of Mus musculus domesticus origin. These two inbred strains were selected based on their geographic origin, karyotype, and use in ongoing research. We generated 14× and 18× coverage sequence, respectively, and discovered over 1.1 million novel variants, most of which are private to one of these strains. This report expands the number of wild-derived inbred genomes in the Mus genus from six to eight. The sequence variation can be accessed via an online query tool; variant calls (VCF format) and alignments (BAM format) are available for download from a dedicated ftp site. Finally, the sequencing data have also been stored in a lossless, compressed, and indexed format using the multi-string Burrows-Wheeler transform. All data can be used without restriction. PMID:27765810

Complete Genome Sequence of Akkermansia glycaniphila Strain PytT, a Mucin-Degrading Specialist of the Reticulated Python Gut.

PubMed

Ouwerkerk, Janneke P; Koehorst, Jasper J; Schaap, Peter J; Ritari, Jarmo; Paulin, Lars; Belzer, Clara; de Vos, Willem M

2017-01-05

Akkermansia glycaniphila is a novel Akkermansia species that was isolated from the intestine of the reticulated python and shares the capacity to degrade mucin with the human strain Akkermansia muciniphila Muc T Here, we report the complete genome sequence of strain Pyt T of 3,074,121 bp. The genomic analysis reveals genes for mucin degradation and aerobic respiration. Copyright © 2017 Ouwerkerk et al.

Molecular cloning of a gene encoding translation initiation factor (TIF) from Candida albicans.

PubMed

Mirbod, F; Nakashima, S; Kitajima, Y; Ghannoum, M A; Cannon, R D; Nozawa, Y

1996-01-01

The differential display technique was applied to compare mRNAs from two clinical isolates of Candida albicans with different virulence; high (potent strain, 16240) and low (weak strain, 18084) extracellular phospholipase activities. Complementary DNA fragments corresponding to several apparently differentially expressed mRNAs were recovered and sequenced. A complementary DNA fragment seen distinctly in the potent phospholipase producing strain was highly homologous to the yeast translation initiation factor (TIF). The selected DNA fragment was then used as a probe to isolate its corresponding complementary DNA clone from a library of C. albicans genomic DNA. The sequence of isolated gene revealed an open reading frame of 1194 nucleotides with the potential to encode a protein of 397 amino acids with a predicted molecular weight of 43 kDa. Over its entire length, the amino acid sequence showed strong homology (78-89%) to Saccharomyces cerevisiae TIF and (63-80%) to mouse eIF-4A proteins. Therefore, our C. albicans gene was identified to be TIF (Ca TIF). Northern blot analysis in the two strains of C. albicans revealed that Ca TIF expression is 1.5-fold higher in the potent phospholipase producing strain. The restriction endonuclease digestion of genomic DNA from this potent strain revealed at least two hybridized bands in Southern blot analysis, suggesting two or more closely related sequences in the C. albicans genome.

Natural and Unanticipated Modifiers of RNAi Activity in Caenorhabditis elegans

PubMed Central

Asad, Nadeem; Aw, Wen Yih; Timmons, Lisa

2012-01-01

Organisms used as model genomics systems are maintained as isogenic strains, yet evidence of sequence differences between independently maintained wild-type stocks has been substantiated by whole-genome resequencing data and strain-specific phenotypes. Sequence differences may arise from replication errors, transposon mobilization, meiotic gene conversion, or environmental or chemical assault on the genome. Low frequency alleles or mutations with modest effects on phenotypes can contribute to natural variation, and it has proven possible for such sequences to become fixed by adapted evolutionary enrichment and identified by resequencing. Our objective was to identify and analyze single locus genetic defects leading to RNAi resistance in isogenic strains of Caenorhabditis elegans. In so doing, we uncovered a mutation that arose de novo in an existing strain, which initially frustrated our phenotypic analysis. We also report experimental, environmental, and genetic conditions that can complicate phenotypic analysis of RNAi pathway defects. These observations highlight the potential for unanticipated mutations, coupled with genetic and environmental phenomena, to enhance or suppress the effects of known mutations and cause variation between wild-type strains. PMID:23209671

Molecular characterization of infectious bursal disease viruses from Pakistan.

PubMed

Shabbir, Muhammad Zubair; Ali, Muhammad; Abbas, Muhammad; Chaudhry, Umer Naveed; Zia-Ur-Rehman; Munir, Muhammad

2016-07-01

Since the first report of infectious bursal disease in Pakistan in 1987, outbreaks have been common even in vaccinated flocks. Despite appropriate administration of vaccines, concerns arise if the circulating strains are different from the ones used in the vaccine. Here, we sequenced the hypervariable region (HVR) of the VP2 gene of circulating strains of infectious bursal disease virus (IBDV) originating from outbreaks (n = 4) in broiler flocks in Pakistan. Nucleotide sequencing followed by phylogeny and deduced amino acid sequence analysis showed the circulating strains to be very virulent (vv) and identified characteristic residues at position 222 (A), 242 (I), 256 (I), 294 (I) and 299 (S). In addition, a substitution at positions 221 (Q→H) was found to be exclusive to Pakistani strains in our analysis, although a larger dataset is required to confirm this finding. Compared to vaccine strains that are commonly used in Pakistan, substitution mutations were found at key amino acid positions in VP2 that may be responsible for potential changes in neutralization epitopes and vaccine failure.

Bradyrhizobium tropiciagri sp. nov. and Bradyrhizobium embrapense sp. nov., nitrogen-fixing symbionts of tropical forage legumes.

PubMed

Delamuta, Jakeline Renata Marçon; Ribeiro, Renan Augusto; Ormeño-Orrillo, Ernesto; Parma, Marcia Maria; Melo, Itamar Soares; Martínez-Romero, Esperanza; Hungria, Mariangela

2015-12-01

Biological nitrogen fixation is a key process for agricultural production and environmental sustainability, but there are comparatively few studies of symbionts of tropical pasture legumes, as well as few described species of the genus Bradyrhizobium, although it is the predominant rhizobial genus in the tropics. A detailed polyphasic study was conducted with two strains of the genus Bradyrhizobium used in commercial inoculants for tropical pastures in Brazil, CNPSo 1112T, isolated from perennial soybean (Neonotonia wightii), and CNPSo 2833T, from desmodium (Desmodium heterocarpon). Based on 16S-rRNA gene phylogeny, both strains were grouped in the Bradyrhizobium elkanii superclade, but were not clearly clustered with any known species. Multilocus sequence analysis of three (glnII, gyrB and recA) and five (plus atpD and dnaK) housekeeping genes confirmed that the strains are positioned in two distinct clades. Comparison with intergenic transcribed spacer sequences of type strains of described species of the genus Bradyrhizobium showed similarity lower than 93.1 %, and differences were confirmed by BOX-PCR analysis. Nucleotide identity of three housekeeping genes with type strains of described species ranged from 88.1 to 96.2 %. Average nucleotide identity of genome sequences showed values below the threshold for distinct species of the genus Bradyrhizobium ( < 90.6 %), and the value between the two strains was also below this threshold (91.2 %). Analysis of nifH and nodC gene sequences positioned the two strains in a clade distinct from other species of the genus Bradyrhizobium. Morphophysiological, genotypic and genomic data supported the description of two novel species in the genus Bradyrhizobium, Bradyrhizobium tropiciagri sp. nov. (type strain CNPSo 1112T = SMS 303T = BR 1009T = SEMIA 6148T = LMG 28867T) and Bradyrhizobium embrapense sp. nov. (type strain CNPSo 2833T = CIAT 2372T = BR 2212T = SEMIA 6208T = U674T = LMG 2987).

Phenotypic, Genotypic, and Antimicrobial Characteristics of Streptococcus halichoeri Isolates from Humans, Proposal To Rename Streptococcus halichoeri as Streptococcus halichoeri subsp. halichoeri, and Description of Streptococcus halichoeri subsp. hominis subsp. nov., a Bacterium Associated with Human Clinical Infections.

PubMed

Shewmaker, P L; Whitney, A M; Humrighouse, B W

2016-03-01

Phenotypic, genotypic, and antimicrobial characteristics of six phenotypically distinct human clinical isolates that most closely resembled the type strain of Streptococcus halichoeri isolated from a seal are presented. Sequencing of the 16S rRNA, rpoB, sodA, and recN genes; comparative whole-genome analysis; conventional biochemical and Rapid ID 32 Strep identification methods; and antimicrobial susceptibility testing were performed on the human isolates, the type strain of S. halichoeri, and type strains of closely related species. The six human clinical isolates were biochemically indistinguishable from each other and showed 100% 16S rRNA, rpoB, sodA, and recN gene sequence similarity. Comparative 16S rRNA gene sequencing analysis revealed 98.6% similarity to S. halichoeri CCUG 48324(T), 97.9% similarity to S. canis ATCC 43496(T), and 97.8% similarity to S. ictaluri ATCC BAA-1300(T). A 3,530-bp fragment of the rpoB gene was 98.8% similar to the S. halichoeri type strain, 84.6% to the S. canis type strain, and 83.8% to the S. ictaluri type strain. The S. halichoeri type strain and the human clinical isolates were susceptible to the antimicrobials tested based on CLSI guidelines for Streptococcus species viridans group with the exception of tetracycline and erythromycin. The human isolates were phenotypically distinct from the type strain isolated from a seal; comparative whole-genome sequence analysis confirmed that the human isolates were S. halichoeri. On the basis of these results, a novel subspecies, Streptococcus halichoeri subsp. hominis, is proposed for the human isolates and Streptococcus halichoeri subsp. halichoeri is proposed for the gray seal isolates. The type strain of the novel subspecies is SS1844(T) = CCUG 67100(T) = LMG 28801(T). Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing.

PubMed

Naveed, Muhammad; Mubeen, Samavia; Khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

2014-01-01

In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

PubMed Central

Naveed, Muhammad; Mubeen, Samavia; khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

2014-01-01

In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization. PMID:25477935

Distribution of a Nocardia brasiliensis catalase gene fragment in members of the genera Nocardia, Gordona, and Rhodococcus.

PubMed

Vera-Cabrera, L; Johnson, W M; Welsh, O; Resendiz-Uresti, F L; Salinas-Carmona, M C

1999-06-01

An immunodominant protein from Nocardia brasiliensis, P61, was subjected to amino-terminal and internal sequence analysis. Three sequences of 22, 17, and 38 residues, respectively, were obtained and compared with the protein database from GenBank by using the BLAST system. The sequences showed homology to some eukaryotic catalases and to a bromoperoxidase-catalase from Streptomyces violaceus. Its identity as a catalase was confirmed by analysis of its enzymatic activity on H2O2 and by a double-staining method on a nondenaturing polyacrylamide gel with 3,3'-diaminobenzidine and ferricyanide; the result showed only catalase activity, but no peroxidase. By using one of the internal amino acid sequences and a consensus catalase motif (VGNNTP), we were able to design a PCR assay that generated a 500-bp PCR product. The amplicon was analyzed, and the nucleotide sequence was compared to the GenBank database with the observation of high homology to other bacterial and eukaryotic catalases. A PCR assay based on this target sequence was performed with primers NB10 and NB11 to confirm the presence of the NB10-NB11 gene fragment in several N. brasiliensis strains isolated from mycetoma. The same assay was used to determine whether there were homologous sequences in several type strains from the genera Nocardia, Rhodococcus, Gordona, and Streptomyces. All of the N. brasiliensis strains presented a positive result but only some of the actinomycetes species tested were positive in the PCR assay. In order to confirm these findings, genomic DNA was subjected to Southern blot analysis. A 1.7-kbp band was observed in the N. brasiliensis strains, and bands of different molecular weight were observed in cross-reacting actinomycetes. Sequence analysis of the amplicons of selected actinomycetes showed high homology in this catalase fragment, thus demonstrating that this protein is highly conserved in this group of bacteria.

Streptomyces tritici sp. nov., a novel actinomycete isolated from rhizosphere soil of wheat (Triticum aestivum L.).

PubMed

Zhao, Junwei; Shi, Linlin; Li, Wenchao; Wang, Jiabin; Wang, Han; Tian, Yuanyuan; Xiang, Wensheng; Wang, Xiangjing

2018-02-01

Two novel actinomycete isolates, designated strains NEAU-A4 T and NEAU-A3, were isolated from rhizosphere soil of wheat (Triticumaestivum L.) and characterized using a polyphasic approach. Morphological and chemotaxonomic characteristics of the two strains coincided with those of the genus Streptomyces. The 16S rRNA gene sequence analysis showed that the two isolates exhibited 99.6 % 16S rRNA gene sequence similarity with each other and that they were most closely related to Streptomyces violaceorectus DSM 40279 T (98.8, 99.0 %). Phylogenetic analysis based on 16S rRNA gene sequences indicated that the two strains clustered together and formed a separate subclade. Furthermore, a combination of DNA-DNA hybridization results and some physiological and biochemical properties demonstrated that the two strains could be distinguished from its closest relative. Therefore, it is proposed that strains NEAU-A4 T and NEAU-A3 should be classified as representatives of a novel species of the genus Streptomyces, for which the name Streptomycestritici sp. nov. is proposed. The type strain is NEAU-A4 T (=CGMCC 4.7393 T =DSM 104540 T ).

Isolation and sequence characterization of DNA-A genome of a new begomovirus strain associated with severe leaf curling symptoms of Jatropha curcas L.

PubMed

Chauhan, Sushma; Rahman, Hifzur; Mastan, Shaik G; Pamidimarri, D V N Sudheer; Reddy, Muppala P

2018-07-20

Begomoviruses belong to the family Geminiviridae are associated with several disease symptoms, such as mosaic and leaf curling in Jatropha curcas. The molecular characterization of these viral strains will help in developing management strategies to control the disease. In this study, J. curcas that was infected with begomovirus and showed acute leaf curling symptoms were identified. DNA-A segment from pathogenic viral strain was isolated and sequenced. The sequenced genome was assembled and characterized in detail. The full-length DNA-A sequence was covered by primer walking. The genome sequence showed the general organization of DNA-A from begomovirus by the distribution of ORFs in both viral and anti-viral strands. The genome size ranged from 2844 bp-2852 bp. Three strains with minor nucleotide variations were identified, and a phylogenetic analysis was performed by comparing the DNA-A segments from other reported begomovirus isolates. The maximum sequence similarity was observed with Euphorbia yellow mosaic virus (FN435995). In the phylogenetic tree, no clustering was observed with previously reported begomovirus strains isolated from J. curcas host. The strains isolated in this study belong to new begomoviral strain that elicits symptoms of leaf curling in J. curcas. The results indicate that the probable origin of the strains is from Jatropha mosaic virus infecting J. gassypifolia. The strains isolated in this study are referred as Jatropha curcas leaf curl India virus (JCLCIV) based on the major symptoms exhibited by host J. curcas. Copyright © 2018 Elsevier B.V. All rights reserved.

Draft genome sequence of Bradyrhizobium manausense strain BR 3351T, an effective symbiont isolated from Amazon rainforest.

PubMed

Simões-Araújo, Jean Luiz; Rumjanek, Norma Gouvêa; Xavier, Gustavo Ribeiro; Zilli, Jerri Édson

The strain BR 3351 T (Bradyrhizobium manausense) was obtained from nodules of cowpea (Vigna unguiculata L. Walp) growing in soil collected from Amazon rainforest. Furthermore, it was observed that the strain has high capacity to fix nitrogen symbiotically in symbioses with cowpea. We report here the draft genome sequence of strain BR 3351 T . The information presented will be important for comparative analysis of nodulation and nitrogen fixation for diazotrophic bacteria. A draft genome with 9,145,311bp and 62.9% of GC content was assembled in 127 scaffolds using 100bp pair-end Illumina MiSeq system. The RAST annotation identified 8603 coding sequences, 51 RNAs genes, classified in 504 subsystems. Published by Elsevier Editora Ltda.

Complex Population Structure and Virulence Differences among Serotype 2 Streptococcus suis Strains Belonging to Sequence Type 28

PubMed Central

Athey, Taryn B. T.; Auger, Jean-Philippe; Teatero, Sarah; Dumesnil, Audrey; Takamatsu, Daisuke; Wasserscheid, Jessica; Dewar, Ken; Gottschalk, Marcelo; Fittipaldi, Nahuel

2015-01-01

Streptococcus suis is a major swine pathogen and a zoonotic agent. Serotype 2 strains are the most frequently associated with disease. However, not all serotype 2 lineages are considered virulent. Indeed, sequence type (ST) 28 serotype 2 S. suis strains have been described as a homogeneous group of low virulence. However, ST28 strains are often isolated from diseased swine in some countries, and at least four human ST28 cases have been reported. Here, we used whole-genome sequencing and animal infection models to test the hypothesis that the ST28 lineage comprises strains of different genetic backgrounds and different virulence. We used 50 S. suis ST28 strains isolated in Canada, the United States and Japan from diseased pigs, and one ST28 strain from a human case isolated in Thailand. We report a complex population structure among the 51 ST28 strains. Diversity resulted from variable gene content, recombination events and numerous genome-wide polymorphisms not attributable to recombination. Phylogenetic analysis using core genome single-nucleotide polymorphisms revealed four discrete clades with strong geographic structure, and a fifth clade formed by US, Thai and Japanese strains. When tested in experimental animal models, strains from this latter clade were significantly more virulent than a Canadian ST28 reference strain, and a closely related Canadian strain. Our results highlight the limitations of MLST for both phylogenetic analysis and virulence prediction and raise concerns about the possible emergence of ST28 strains in human clinical cases. PMID:26375680

Analysis of simple sequence repeat (SSR) structure and sequence within Epichloë endophyte genomes reveals impacts on gene structure and insights into ancestral hybridization events.

PubMed

Clayton, William; Eaton, Carla Jane; Dupont, Pierre-Yves; Gillanders, Tim; Cameron, Nick; Saikia, Sanjay; Scott, Barry

2017-01-01

Epichloë grass endophytes comprise a group of filamentous fungi of both sexual and asexual species. Known for the beneficial characteristics they endow upon their grass hosts, the identification of these endophyte species has been of great interest agronomically and scientifically. The use of simple sequence repeat loci and the variation in repeat elements has been used to rapidly identify endophyte species and strains, however, little is known of how the structure of repeat elements changes between species and strains, and where these repeat elements are located in the fungal genome. We report on an in-depth analysis of the structure and genomic location of the simple sequence repeat locus B10, commonly used for Epichloë endophyte species identification. The B10 repeat was found to be located within an exon of a putative bZIP transcription factor, suggesting possible impacts on polypeptide sequence and thus protein function. Analysis of this repeat in the asexual endophyte hybrid Epichloë uncinata revealed that the structure of B10 alleles reflects the ancestral species that hybridized to give rise to this species. Understanding the structure and sequence of these simple sequence repeats provides a useful set of tools for readily distinguishing strains and for gaining insights into the ancestral species that have undergone hybridization events.

Near-Complete Genome Sequence of Thalassospira sp. Strain KO164 Isolated from a Lignin-Enriched Marine Sediment Microcosm

DOE PAGES

Woo, Hannah L.; O’Dell, Kaela B.; Utturkar, Sagar; ...

2016-11-23

We isolated Thalassospirasp. strain KO164 from eastern Mediterranean seawater and sediment laboratory microcosms enriched on insoluble organosolv lignin under oxic conditions. Furthermore, an analysis of the deep-ocean bacterium’s ability to degrade recalcitrant organics such as lignin near-complete genome sequence, will be presented here.

Near-Complete Genome Sequence of Thalassospira sp. Strain KO164 Isolated from a Lignin-Enriched Marine Sediment Microcosm

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woo, Hannah L.; O’Dell, Kaela B.; Utturkar, Sagar

We isolated Thalassospirasp. strain KO164 from eastern Mediterranean seawater and sediment laboratory microcosms enriched on insoluble organosolv lignin under oxic conditions. Furthermore, an analysis of the deep-ocean bacterium’s ability to degrade recalcitrant organics such as lignin near-complete genome sequence, will be presented here.

Actinomyces timonensis sp. nov., isolated from a human clinical osteo-articular sample.

PubMed

Renvoise, Aurélie; Raoult, Didier; Roux, Véronique

2010-07-01

Gram-positive, non-spore-forming rods were isolated from a human osteo-articular sample (strain 7400942(T)). Based on cellular morphology and the results of biochemical analysis, this strain was tentatively identified as a novel species of the genus Actinomyces. Phylogenetic analysis based on 16S rRNA gene sequence comparisons showed that the bacterium was closely related to the type strain of Actinomyces denticolens (96.9 % 16S rRNA gene sequence similarity). A comparison of biochemical traits showed that strain 7400942(T) was distinct from A. denticolens in a number of characteristics, i.e. in contrast with A. denticolens, strain 7400942(T) was negative for nitrate reduction and for beta-galactosidase, alpha-glucosidase and alanine arylamidase activities, it was positive for acid production from N-acetylglucosamine, melezitose and glycogen, and it was negative for acid production from turanose. Matrix-assisted laser-desorption/ionization time-of-flight MS protein analysis confirmed that strain 7400942(T) represents a novel species, as scores obtained for its spectra were significant (>2.2) only with strain 7400942(T). On the basis of phenotypic data and phylogenetic inference, it is proposed that this strain should be designated Actinomyces timonensis sp. nov.; the type strain is strain 7400942(T) (=CSUR P35(T)=CCUG 55928(T)).

Phylogenetic and Genome-Wide Deep-Sequencing Analyses of Canine Parvovirus Reveal Co-Infection with Field Variants and Emergence of a Recent Recombinant Strain

PubMed Central

Pérez, Ruben; Calleros, Lucía; Marandino, Ana; Sarute, Nicolás; Iraola, Gregorio; Grecco, Sofia; Blanc, Hervé; Vignuzzi, Marco; Isakov, Ofer; Shomron, Noam; Carrau, Lucía; Hernández, Martín; Francia, Lourdes; Sosa, Katia; Tomás, Gonzalo; Panzera, Yanina

2014-01-01

Canine parvovirus (CPV), a fast-evolving single-stranded DNA virus, comprises three antigenic variants (2a, 2b, and 2c) with different frequencies and genetic variability among countries. The contribution of co-infection and recombination to the genetic variability of CPV is far from being fully elucidated. Here we took advantage of a natural CPV population, recently formed by the convergence of divergent CPV-2c and CPV-2a strains, to study co-infection and recombination. Complete sequences of the viral coding region of CPV-2a and CPV-2c strains from 40 samples were generated and analyzed using phylogenetic tools. Two samples showed co-infection and were further analyzed by deep sequencing. The sequence profile of one of the samples revealed the presence of CPV-2c and CPV-2a strains that differed at 29 nucleotides. The other sample included a minor CPV-2a strain (13.3% of the viral population) and a major recombinant strain (86.7%). The recombinant strain arose from inter-genotypic recombination between CPV-2c and CPV-2a strains within the VP1/VP2 gene boundary. Our findings highlight the importance of deep-sequencing analysis to provide a better understanding of CPV molecular diversity. PMID:25365348

Candida ruelliae sp. nov., a novel yeast species isolated from flowers of Ruellia sp. (Acanthaceae).

PubMed

Saluja, Puja; Prasad, Gandham S

2008-06-01

Two novel yeast strains designated as 16Q1 and 16Q3 were isolated from flowers of the Ruellia species of the Acanthaceae family. The D1/D2 domain and ITS sequences of these two strains were identical. Sequence analysis of the D1/D2 domain of large-subunit rRNA gene indicated their relationship to species of the Candida haemulonii cluster. However, they differ from C. haemulonii by 14% nucleotide sequence divergence, from Candida pseudohaemulonii by 16.1% and from C. haemulonii type II by 16.5%. These strains also differ in 18 physiological tests from the type strain of C. haemulonii, and 12 and 16 tests, respectively, from C. pseudohaemulonii and C. haemulonii type II. They also differ from C. haemulonii and other related species by more than 13% sequence divergence in the internal transcribed spacer region. In the SSU rRNA gene sequences, strain 16Q1 differs by 1.7% nucleotide divergence from C. haemulonii. Sporulation was not observed in pure or mixed cultures on several media examined. All these data support the assignment of these strains to a novel species; we have named them as Candida ruelliae sp. nov., and designate strain 16Q1(T)=MTCC 7739(T)=CBS10815(T) as type strain of the novel species.

Draft Genome Sequence of Vancomycin-Heteroresistant Staphylococcus epidermidis Strain UC7032, Isolated from Food

PubMed Central

Pietta, Ester; Bassi, Daniela; Fontana, Cecilia; Puglisi, Edoardo; Cappa, Fabrizio; Cocconcelli, Pier Sandro

2013-01-01

Staphylococcus epidermidis strain UC7032 was isolated from ready-to-eat cured meat and is heteroresistant to glycopeptide antibiotics. The draft whole-genome analysis revealed that this strain shows common characteristics typical of strains that are involved in nosocomial infections. PMID:24072859

A novel prophage identified in strains from Salmonella enterica serovar Enteritidis is a phylogenetic signature of the lineage ST-1974

PubMed Central

D'Alessandro, Bruno; Pérez Escanda, Victoria; Balestrazzi, Lucía; Iriarte, Andrés; Pickard, Derek; Yim, Lucía; Chabalgoity, José Alejandro; Betancor, Laura

2018-01-01

Salmonella enterica serovar Enteritidis is a major agent of foodborne diseases worldwide. In Uruguay, this serovar was almost negligible until the mid 1990s but since then it has become the most prevalent. Previously, we characterized a collection of strains isolated from 1988 to 2005 and found that the two oldest strains were the most genetically divergent. In order to further characterize these strains, we sequenced and annotated eight genomes including those of the two oldest isolates. We report on the identification and characterization of a novel 44 kbp Salmonella prophage found exclusively in these two genomes. Sequence analysis reveals that the prophage is a mosaic, with homologous regions in different Salmonella prophages. It contains 60 coding sequences, including two genes, gogB and sseK3, involved in virulence and modulation of host immune response. Analysis of serovar Enteritidis genomes available in public databases confirmed that this prophage is absent in most of them, with the exception of a group of 154 genomes. All 154 strains carrying this prophage belong to the same sequence type (ST-1974), suggesting that its acquisition occurred in a common ancestor. We tested this by phylogenetic analysis of 203 genomes representative of the intraserovar diversity. The ST-1974 forms a distinctive monophyletic lineage, and the newly described prophage is a phylogenetic signature of this lineage that could be used as a molecular marker. The phylogenetic analysis also shows that the major ST (ST-11) is polyphyletic and might have given rise to almost all other STs, including ST-1974. PMID:29509137

Phenotypic and molecular identification of Fonsecaea pedrosoi strains isolated from chromoblastomycosis patients in Mexico and Venezuela.

PubMed

Carolina Rojas, O; León-Cachón, Rafael B R; Pérez-Maya, Antonio Alí; Aguirre-Garza, Marcelino; Moreno-Treviño, María G; González, Gloria M

2015-05-01

Chromoblastomycosis is a chronic granulomatous disease caused frequently by fungi of the Fonsecaea genus. The objective of this study was the phenotypic and molecular identification of F. pedrosoi strains isolated from chromoblastomycosis patients in Mexico and Venezuela. Ten strains were included in this study. For phenotypic identification, we used macroscopic and microscopic morphologies, carbohydrate assimilation test, urea hydrolysis, cixcloheximide tolerance, proteolitic activity and the thermotolerance test. The antifungal activity of five drugs was evaluated against the isolates. Molecular identification was performed by sequencing the internal transcribed spacer (ITS) ribosomal DNA regions of the isolated strains. The physiological analysis and morphological features were variable and the precise identification was not possible. All isolates were susceptible to itraconazole, terbinafine, voriconazole and posaconazole. Amphotericin B was the least effective drug. The alignment of the 559-nucleotide ITS sequences from our strains compared with sequences of GenBank revealed high homology with F. pedrosoi (EU285266.1). In this study, all patients were from rural areas, six from Mexico and four from Venezuela. Ten isolates were identified by phenotypic and molecular analysis, using ITS sequence and demonstrated that nine isolates from Mexico and Venezuela were 100% homologous and one isolate showed a small genetic distance. © 2015 Blackwell Verlag GmbH.

Detection and analysis of hemolysin genes in Aeromonas hydrophila isolated from Gouramy (Osphronemus gouramy) by polymerase chain reaction (PCR)

NASA Astrophysics Data System (ADS)

Rozi; Rahayu, K.; Daruti, D. N.

2018-04-01

The goal of this study was to detect of Aeromonas hydrophila carrying the hlyA gene in guramy by PCR assay. A total of 5 A. hydrophila strains were isolated from gouramy with different location and furthermore genotypic of all A. hydrophila strains havedetected by PCR assay for 16S rRNA gene. The primers used in the PCR targeted a 592-bp fragment of the hlyA gene coding for the hemolysin gene. Particularly hlyA genes are responsible for haemolysin toxins production in this genus. After gel electrophoresis, the amplicons from representative strains of the A. hydrophila were purified using extraction kit and were subjected to the DNA sequencing analysis. The results showed that: (i) the 592bp amplicon of the hlyA gene was detected in 5/6 of the A. hydrophila; (ii) the nucleotide blast results of hemolysin gene sequences of the strains of A. hydrophila revealed a high homology of 90-97 % with published sequences, and;(iii) the protein blast showed 95-98 % homology when compared to the published sequences. The PCR clearly identified the haemolysin-producing strains of A. hydrophila by detection in hlyA genes and may have application as a rapid species-specific virulence test.

Identification, Purification and Characterization of Laterosporulin, a Novel Bacteriocin Produced by Brevibacillus sp. Strain GI-9

PubMed Central

Singh, Pradip Kumar; Chittpurna; Ashish; Sharma, Vikas; Patil, Prabhu B.; Korpole, Suresh

2012-01-01

Background Bacteriocins are antimicrobial peptides that are produced by bacteria as a defense mechanism in complex environments. Identification and characterization of novel bacteriocins in novel strains of bacteria is one of the important fields in bacteriology. Methodology/Findings The strain GI-9 was identified as Brevibacillus sp. by 16 S rRNA gene sequence analysis. The bacteriocin produced by strain GI-9, namely, laterosporulin was purified from supernatant of the culture grown under optimal conditions using hydrophobic interaction chromatography and reverse-phase HPLC. The bacteriocin was active against a wide range of Gram-positive and Gram-negative bacteria. MALDI-TOF experiments determined the precise molecular mass of the peptide to be of 5.6 kDa and N-terminal sequencing of the thermo-stable peptide revealed low similarity with existing antimicrobial peptides. The putative open reading frame (ORF) encoding laterosporulin and its surrounding genomic region was fished out from the draft genome sequence of GI-9. Sequence analysis of the putative bacteriocin gene did not show significant similarity to any reported bacteriocin producing genes in database. Conclusions We have identified a bacteriocin producing strain GI-9, belonging to the genus Brevibacillus sp. Biochemical and genomic characterization of laterosporulin suggests it as a novel bacteriocin with broad spectrum antibacterial activity. PMID:22403615

Identification, purification and characterization of laterosporulin, a novel bacteriocin produced by Brevibacillus sp. strain GI-9.

PubMed

Singh, Pradip Kumar; Chittpurna; Ashish; Sharma, Vikas; Patil, Prabhu B; Korpole, Suresh

2012-01-01

Bacteriocins are antimicrobial peptides that are produced by bacteria as a defense mechanism in complex environments. Identification and characterization of novel bacteriocins in novel strains of bacteria is one of the important fields in bacteriology. The strain GI-9 was identified as Brevibacillus sp. by 16 S rRNA gene sequence analysis. The bacteriocin produced by strain GI-9, namely, laterosporulin was purified from supernatant of the culture grown under optimal conditions using hydrophobic interaction chromatography and reverse-phase HPLC. The bacteriocin was active against a wide range of Gram-positive and Gram-negative bacteria. MALDI-TOF experiments determined the precise molecular mass of the peptide to be of 5.6 kDa and N-terminal sequencing of the thermo-stable peptide revealed low similarity with existing antimicrobial peptides. The putative open reading frame (ORF) encoding laterosporulin and its surrounding genomic region was fished out from the draft genome sequence of GI-9. Sequence analysis of the putative bacteriocin gene did not show significant similarity to any reported bacteriocin producing genes in database. We have identified a bacteriocin producing strain GI-9, belonging to the genus Brevibacillus sp. Biochemical and genomic characterization of laterosporulin suggests it as a novel bacteriocin with broad spectrum antibacterial activity.

Pseudomonas aestus sp. nov., a plant growth-promoting bacterium isolated from mangrove sediments.

PubMed

Vasconcellos, Rafael L F; Santos, Suikinai Nobre; Zucchi, Tiago Domingues; Silva, Fábio Sérgio Paulino; Souza, Danilo Tosta; Melo, Itamar Soares

2017-10-01

Strain CMAA 1215 T , a Gram-reaction-negative, aerobic, catalase positive, polarly flagellated, motile, rod-shaped (0.5-0.8 × 1.3-1.9 µm) bacterium, was isolated from mangrove sediments, Cananéia Island, Brazil. Analysis of the 16S rRNA gene sequences showed that strain CMAA 1215 T forms a distinct phyletic line within the Pseudomonas putida subclade, being closely related to P. plecoglossicida ATCC 700383 T , P. monteilii NBRC 103158 T , and P. taiwanensis BCRC 17751 T of sequence similarity of 98.86, 98.73, and 98.71%, respectively. Genomic comparisons of the strain CMAA 1215 T with its closest phylogenetic type strains using average nucleotide index (ANI) and DNA:DNA relatedness approaches revealed 84.3-85.3% and 56.0-63.0%, respectively. A multilocus sequence analysis (MLSA) performed concatenating 16S rRNA, gyrB and rpoB gene sequences from the novel species was related with Pseudomonas putida subcluster and formed a new phylogenetic lineage. The phenotypic, physiological, biochemical, and genetic characteristics support the assignment of CMAA 1215 T to the genus Pseudomonas, representing a novel species. The name Pseudomonas aestus sp.nov. is proposed, with CMAA 1215 T (=NRRL B-653100 T  = CBMAI 1962 T ) as the type strain.

Multilocus sequence analysis and rpoB sequencing of Mycobacterium abscessus (sensu lato) strains.

PubMed

Macheras, Edouard; Roux, Anne-Laure; Bastian, Sylvaine; Leão, Sylvia Cardoso; Palaci, Moises; Sivadon-Tardy, Valérie; Gutierrez, Cristina; Richter, Elvira; Rüsch-Gerdes, Sabine; Pfyffer, Gaby; Bodmer, Thomas; Cambau, Emmanuelle; Gaillard, Jean-Louis; Heym, Beate

2011-02-01

Mycobacterium abscessus, Mycobacterium bolletii, and Mycobacterium massiliense (Mycobacterium abscessus sensu lato) are closely related species that currently are identified by the sequencing of the rpoB gene. However, recent studies show that rpoB sequencing alone is insufficient to discriminate between these species, and some authors have questioned their current taxonomic classification. We studied here a large collection of M. abscessus (sensu lato) strains by partial rpoB sequencing (752 bp) and multilocus sequence analysis (MLSA). The final MLSA scheme developed was based on the partial sequences of eight housekeeping genes: argH, cya, glpK, gnd, murC, pgm, pta, and purH. The strains studied included the three type strains (M. abscessus CIP 104536(T), M. massiliense CIP 108297(T), and M. bolletii CIP 108541(T)) and 120 isolates recovered between 1997 and 2007 in France, Germany, Switzerland, and Brazil. The rpoB phylogenetic tree confirmed the existence of three main clusters, each comprising the type strain of one species. However, divergence values between the M. massiliense and M. bolletii clusters all were below 3% and between the M. abscessus and M. massiliense clusters were from 2.66 to 3.59%. The tree produced using the concatenated MLSA gene sequences (4,071 bp) also showed three main clusters, each comprising the type strain of one species. The M. abscessus cluster had a bootstrap value of 100% and was mostly compact. Bootstrap values for the M. massiliense and M. bolletii branches were much lower (71 and 61%, respectively), with the M. massiliense cluster having a fuzzy aspect. Mean (range) divergence values were 2.17% (1.13 to 2.58%) between the M. abscessus and M. massiliense clusters, 2.37% (1.5 to 2.85%) between the M. abscessus and M. bolletii clusters, and 2.28% (0.86 to 2.68%) between the M. massiliense and M. bolletii clusters. Adding the rpoB sequence to the MLSA-concatenated sequence (total sequence, 4,823 bp) had little effect on the clustering of strains. We found 10/120 (8.3%) isolates for which the concatenated MLSA gene sequence and rpoB sequence were discordant (e.g., M. massiliense MLSA sequence and M. abscessus rpoB sequence), suggesting the intergroup lateral transfers of rpoB. In conclusion, our study strongly supports the recent proposal that M. abscessus, M. massiliense, and M. bolletii should constitute a single species. Our findings also indicate that there has been a horizontal transfer of rpoB sequences between these subgroups, precluding the use of rpoB sequencing alone for the accurate identification of the two proposed M. abscessus subspecies.

Identification, cloning and sequencing of Escherichia coli strain chi1378 (O78:K80) iss gene isolated from poultry colibacillosis in Iran.

PubMed

Derakhshandeh, A; Zahraei Salehi, T; Tadjbakhsh, H; Karimi, V

2009-09-01

To identify, clone and sequence the iss (increased serum survival) gene from E. coli strain chi1378 isolated from Iranian poultry and to predict its protein product, Iss. The iss gene from E. coli strain chi1378 was amplified and cloned into the pTZ57R/T vector and sequenced. From the DNA sequence, the Iss predictive protein was evaluated using bioinformatics. Iss from strain chi1378 had 100% identity with other E. coli serotypes and isolates from different origins and also 98% identity with E. coli O157:H7 Iss protein. Phylogenetic analysis showed no significant different phylogenic groups among E. coli strains. The strong association of predicted Iss protein among different E. coli strains suggests that it could be a good antigen to control and detect avian pathogenic E. coli (APEC). Because the exact pathogenesis and the role of virulence factors are unknown, the Iss protein could be used as a target for vaccination in the future, but further research is required.

Isolation of a new heterolobosean amoeba from a rice field soil: Vrihiamoeba italica gen. nov., sp. nov.

PubMed

Murase, Jun; Kawasaki, Michio; De Jonckheere, Johan F

2010-08-01

A heterolobosean amoeba strain 6_5F was isolated from an Italian rice field soil. Although 18S rRNA gene sequence analysis demonstrated that the new isolate was closely related to Stachyamoeba sp. ATCC 50324, further molecular analysis and morphological observation showed distinct differences amongst the two. The 5.8S rRNA gene was successfully amplified and sequenced for strain 6_5F but not for strain ATCC 50324. Trophozoites of strain ATCC 50324 transform into flagellate forms in the late stage of incubation before encystment, while strain 6_5F do not show flagellate forms under different conditions of the flagellation test. Light and electron microscopic observation showed the structural difference of cysts of strain 6_5F from strain ATCC 50324 and also from the type strain Stachyamoeba lipophora. The results show that the strain 6_5F is distinct from Stachyamoeba spp. and we propose a new genus and species for this isolate, Vrihiamoeba italica gen. nov., sp. nov. Copyright (c) 2010 Elsevier GmbH. All rights reserved.

Multi locus sequence analysis and symbiotic characterization of novel Ensifer strains nodulating Tephrosia spp. in the Indian Thar Desert.

PubMed

Tak, Nisha; Awasthi, Esha; Bissa, Garima; Meghwal, Raju Ram; James, Euan K; Sprent, Janet S; Gehlot, Hukam S

2016-12-01

Phylogenetically diverse Ensifer strains associated with five species of Tephrosia growing in alkaline soils of semi-arid regions of the Thar Desert were characterized using multi locus sequence analysis. Based on 16S rRNA and four protein-coding housekeeping gene (recA, atpD, glnII and dnaK) sequences, the Tephrosia-Ensifer strains were genetically different from the type strains of Ensifer saheli, Ensifer kostiensis, Ensifer terangae (African origin) and Ensifer psoraleae (Asiatic origin). One strain, Ensifer sp. TL4, showed maximum similarity (99%) to Ensifer adhaerens LMG 20216 T and formed a separate lineage close to it. Phylogenetic incongruence between sym and housekeeping genes was observed. The monophyletic origin of symbiotic genes from Asia in the Tephrosia-Ensifer strains from the Thar Desert suggests that they might have been acquired from a common ancestor and horizontally transferred. These novel strains are promiscuous, cross-nodulating some papilionoid crop species, mimosoid trees and the caesalpinioid Chamaecrista pumila. This study improves understanding of the distribution of Ensifer in unexplored and threatened alkaline arid regions of the Thar Desert and how this relates to other similar regions in the world. Copyright © 2016 Elsevier GmbH. All rights reserved.

Identification, Classification, and Phylogeny of the Pathogenic Species Exophiala jeanselmei and Related Species by Mitochondrial Cytochrome b Gene Analysis

PubMed Central

Wang, Li; Yokoyama, Koji; Miyaji, Makoto; Nishimura, Kazuko

2001-01-01

We analyzed a 402-bp sequence of the mitochondrial cytochrome b gene of 34 strains of Exophiala jeanselmei and 16 strains representing 12 related species. The strains of E. jeanselmei were classified into 20 DNA types and 17 amino acid types. The differences between these strains were found in 1 to 60 nucleotides and 1 to 17 amino acids. On the basis of the identities and similarities of nucleotide and amino acid sequences, some strains were reidentified: i.e., two strains of E. jeanselmei var. hetermorpha and one strain of E. castellanii as E. dermatitidis (including the type strain), three strains of E. jeanselmei as E. jeanselmei var. lecanii-corni (including the type strain), three strains of E. jeanselmei as E. bergeri (including the type strain), seven strains of E. jeanselmei as E. pisciphila (including the type strain), seven strains of E. jeanselmei as E. jeanselmei var. jeanselmei (including the type strain), one strain of E. jeanselmei as Fonsecaea pedrosoi (including the type strain), and one strain of E. jeanselmei as E. spinifera (including the type strain). Some E. jeanselmei strains showed distinct nucleotide and amino acid sequences. The amino-acid-based UPGMA (unweighted pair group method with the arithmetic mean) tree exhibited nearly the same topology as those of the DNA-based trees obtained by neighbor joining, maximum parsimony, and maximum likelihood methods. PMID:11724862

Polynucleobacter meluiroseus sp. nov., a bacterium isolated from a lake located in the mountains of the Mediterranean island of Corsica.

PubMed

Pitt, Alexandra; Schmidt, Johanna; Lang, Elke; Whitman, William B; Woyke, Tanja; Hahn, Martin W

2018-06-01

Strain AP-Melu-1000-B4 was isolated from a lake located in the mountains of the Mediterranean island of Corsica (France). Phenotypic, chemotaxonomic and genomic traits were investigated. Phylogenetic analyses based on 16S rRNA gene sequencing referred the strain to the cryptic species complex PnecC within the genus Polynucleobacter. The strain encoded genes for biosynthesis of proteorhodopsin and retinal. When pelleted by centrifugation the strain showed an intense rose colouring. Major fatty acids were C16 : 1ω7c, C16 : 0, C18 : 1ω7c and summed feature 2 (C16 : 1 isoI and C14 : 0-3OH). The sequence of the 16S rRNA gene contained an indel which was not present in any previously described Polynucleobacter species. Genome sequencing revealed a genome size of 1.89 Mbp and a G+C content of 46.6 mol%. In order to resolve the phylogenetic position of the new strain within subcluster PnecC, its phylogeny was reconstructed from sequences of 319 shared genes. To represent all currently described Polynucleobacter species by whole genome sequences, three type strains were additionally sequenced. Our phylogenetic analysis revealed that strain AP-Melu-100-B4 occupied a basal position compared with previously described PnecC strains. Pairwise determined whole genome average nucleotide identity (gANI) values suggested that strain AP-Melu-1000-B4 represents a new species, for which we propose the name Polynucleobacter meluiroseus sp. nov. with the type strain AP-Melu-1000-B4 T (=DSM 103591 T =CIP 111329 T ).

Weissella ghanensis sp. nov., isolated from a Ghanaian cocoa fermentation.

PubMed

De Bruyne, Katrien; Camu, Nicholas; Lefebvre, Karen; De Vuyst, Luc; Vandamme, Peter

2008-12-01

During a study on lactic acid bacteria (and their species diversity) in spontaneous heap fermentations of Ghanaian cocoa beans, two strains, designated 215(T) and 194B, were isolated. A phylogenetic analysis based on 16S rRNA gene sequences demonstrated that these strains represented a distinct lineage close to the genus Weissella and showing only 92.1 % 16S rRNA gene sequence similarity with respect to their closest neighbour, Weissella soli LMG 20113(T). Whole-cell protein electrophoresis, fluorescent amplified fragment length polymorphism fingerprinting of whole genomes and physiological and biochemical tests confirmed the unique taxonomic position of the two novel isolates. On the basis of the results of the morphological and biochemical tests and 16S rRNA gene sequence analysis, strains 215(T) and 194B represent the most peripheral lineage of the genus Weissella, for which we propose the name Weissella ghanensis sp. nov. The type strain is 215(T) (=LMG 24286(T)=DSM 19935(T)).

Complete genome sequence of Klebsiella pneumoniae J1, a protein-based microbial flocculant-producing bacterium.

PubMed

Pang, Changlong; Li, Ang; Cui, Di; Yang, Jixian; Ma, Fang; Guo, Haijuan

2016-02-20

Klebsiella pneumoniae J1 is a Gram-negative strain, which belongs to a protein-based microbial flocculant-producing bacterium. However, little genetic information is known about this species. Here we carried out a whole-genome sequence analysis of this strain and report the complete genome sequence of this organism and its genetic basis for carbohydrate metabolism, capsule biosynthesis and transport system. Copyright © 2016 Elsevier B.V. All rights reserved.

Rapid identification of oral Actinomyces species cultivated from subgingival biofilm by MALDI-TOF-MS

PubMed Central

Stingu, Catalina S.; Borgmann, Toralf; Rodloff, Arne C.; Vielkind, Paul; Jentsch, Holger; Schellenberger, Wolfgang; Eschrich, Klaus

2015-01-01

Background Actinomyces are a common part of the residential flora of the human intestinal tract, genitourinary system and skin. Isolation and identification of Actinomyces by conventional methods is often difficult and time consuming. In recent years, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) has become a rapid and simple method to identify bacteria. Objective The present study evaluated a new in-house algorithm using MALDI-TOF-MS for rapid identification of different species of oral Actinomyces cultivated from subgingival biofilm. Design Eleven reference strains and 674 clinical strains were used in this study. All the strains were preliminarily identified using biochemical methods and then subjected to MALDI-TOF-MS analysis using both similarity-based analysis and classification methods (support vector machine [SVM]). The genotype of the reference strains and of 232 clinical strains was identified by sequence analysis of the 16S ribosomal RNA (rRNA). Results The sequence analysis of the 16S rRNA gene of all references strains confirmed their previous identification. The MALDI-TOF-MS spectra obtained from the reference strains and the other clinical strains undoubtedly identified as Actinomyces by 16S rRNA sequencing were used to create the mass spectra reference database. Already a visual inspection of the mass spectra of different species reveals both similarities and differences. However, the differences between them are not large enough to allow a reliable differentiation by similarity analysis. Therefore, classification methods were applied as an alternative approach for differentiation and identification of Actinomyces at the species level. A cross-validation of the reference database representing 14 Actinomyces species yielded correct results for all species which were represented by more than two strains in the database. Conclusions Our results suggest that a combination of MALDI-TOF-MS with powerful classification algorithms, such as SVMs, provide a useful tool for the differentiation and identification of oral Actinomyces. PMID:25597306

Heterogeneity of the Epstein-Barr Virus (EBV) Major Internal Repeat Reveals Evolutionary Mechanisms of EBV and a Functional Defect in the Prototype EBV Strain B95-8.

PubMed

Ba Abdullah, Mohammed M; Palermo, Richard D; Palser, Anne L; Grayson, Nicholas E; Kellam, Paul; Correia, Samantha; Szymula, Agnieszka; White, Robert E

2017-12-01

Epstein-Barr virus (EBV) is a ubiquitous pathogen of humans that can cause several types of lymphoma and carcinoma. Like other herpesviruses, EBV has diversified through both coevolution with its host and genetic exchange between virus strains. Sequence analysis of the EBV genome is unusually challenging because of the large number and lengths of repeat regions within the virus. Here we describe the sequence assembly and analysis of the large internal repeat 1 of EBV (IR1; also known as the BamW repeats) for more than 70 strains. The diversity of the latency protein EBV nuclear antigen leader protein (EBNA-LP) resides predominantly within the exons downstream of IR1. The integrity of the putative BWRF1 open reading frame (ORF) is retained in over 80% of strains, and deletions truncating IR1 always spare BWRF1. Conserved regions include the IR1 latency promoter (Wp) and one zone upstream of and two within BWRF1. IR1 is heterogeneous in 70% of strains, and this heterogeneity arises from sequence exchange between strains as well as from spontaneous mutation, with interstrain recombination being more common in tumor-derived viruses. This genetic exchange often incorporates regions of <1 kb, and allelic gene conversion changes the frequency of small regions within the repeat but not close to the flanks. These observations suggest that IR1-and, by extension, EBV-diversifies through both recombination and breakpoint repair, while concerted evolution of IR1 is driven by gene conversion of small regions. Finally, the prototype EBV strain B95-8 contains four nonconsensus variants within a single IR1 repeat unit, including a stop codon in the EBNA-LP gene. Repairing IR1 improves EBNA-LP levels and the quality of transformation by the B95-8 bacterial artificial chromosome (BAC). IMPORTANCE Epstein-Barr virus (EBV) infects the majority of the world population but causes illness in only a small minority of people. Nevertheless, over 1% of cancers worldwide are attributable to EBV. Recent sequencing projects investigating virus diversity to see if different strains have different disease impacts have excluded regions of repeating sequence, as they are more technically challenging. Here we analyze the sequence of the largest repeat in EBV (IR1). We first characterized the variations in protein sequences encoded across IR1. In studying variations within the repeat of each strain, we identified a mutation in the main laboratory strain of EBV that impairs virus function, and we suggest that tumor-associated viruses may be more likely to contain DNA mixed from two strains. The patterns of this mixing suggest that sequences can spread between strains (and also within the repeat) by copying sequence from another strain (or repeat unit) to repair DNA damage. Copyright © 2017 Ba abdullah et al.

The genome sequence of E. coli W (ATCC 9637): comparative genome analysis and an improved genome-scale reconstruction of E. coli

PubMed Central

2011-01-01

Background Escherichia coli is a model prokaryote, an important pathogen, and a key organism for industrial biotechnology. E. coli W (ATCC 9637), one of four strains designated as safe for laboratory purposes, has not been sequenced. E. coli W is a fast-growing strain and is the only safe strain that can utilize sucrose as a carbon source. Lifecycle analysis has demonstrated that sucrose from sugarcane is a preferred carbon source for industrial bioprocesses. Results We have sequenced and annotated the genome of E. coli W. The chromosome is 4,900,968 bp and encodes 4,764 ORFs. Two plasmids, pRK1 (102,536 bp) and pRK2 (5,360 bp), are also present. W has unique features relative to other sequenced laboratory strains (K-12, B and Crooks): it has a larger genome and belongs to phylogroup B1 rather than A. W also grows on a much broader range of carbon sources than does K-12. A genome-scale reconstruction was developed and validated in order to interrogate metabolic properties. Conclusions The genome of W is more similar to commensal and pathogenic B1 strains than phylogroup A strains, and therefore has greater utility for comparative analyses with these strains. W should therefore be the strain of choice, or 'type strain' for group B1 comparative analyses. The genome annotation and tools created here are expected to allow further utilization and development of E. coli W as an industrial organism for sucrose-based bioprocesses. Refinements in our E. coli metabolic reconstruction allow it to more accurately define E. coli metabolism relative to previous models. PMID:21208457

High Throughput Sequence Analysis for Disease Resistance in Maize

USDA-ARS?s Scientific Manuscript database

Preliminary results of a computational analysis of high throughput sequencing data from Zea mays and the fungus Aspergillus are reported. The Illumina Genome Analyzer was used to sequence RNA samples from two strains of Z. mays (Va35 and Mp313) collected over a time course as well as several specie...

Bioremediation potential of a highly mercury resistant bacterial strain Sphingobium SA2 isolated from contaminated soil.

PubMed

Mahbub, Khandaker Rayhan; Krishnan, Kannan; Megharaj, Mallavarapu; Naidu, Ravi

2016-02-01

A mercury resistant bacterial strain, SA2, was isolated from soil contaminated with mercury. The 16S rRNA gene sequence of this isolate showed 99% sequence similarity to the genera Sphingobium and Sphingomonas of α-proteobacteria group. However, the isolate formed a distinct phyletic line with the genus Sphingobium suggesting the strain belongs to Sphingobium sp. Toxicity studies indicated resistance to high levels of mercury with estimated EC50 values 4.5 mg L(-1) and 44.15 mg L(-1) and MIC values 5.1 mg L(-1) and 48.48 mg L(-1) in minimal and rich media, respectively. The strain SA2 was able to volatilize mercury by producing mercuric reductase enzyme which makes it potential candidate for remediating mercury. ICP-QQQ-MS analysis of Hg supplemented culture solutions confirmed that almost 79% mercury in the culture suspension was volatilized in 6 h. A very small amount of mercury was observed to accumulate in cell pellets which was also evident according to ESEM-EDX analysis. The mercuric reductase gene merA was amplified and sequenced. The deduced amino acid sequence demonstrated sequence homology with α-proteobacteria and Ascomycota group. Copyright © 2015 Elsevier Ltd. All rights reserved.

[Discovery and whole genome sequences analysis of a dengue virus type 1 strain isolated in Henan province].

PubMed

Du, Yanhua; Zhang, Baifan; Li, Yi; Ma, Hongxia; Huang, Xueyong; Xu, Bianli

2015-10-01

To diagnose imported dengue fever case from Henan province, and to sequence and analyze the characteristics of whole genome sequence, and to explore the possible viral origin source. A suspected dengue fever case was reported in Yuzhou city, Henan province. The patient returned from foshan, Guangdong province on September 19, 2014, after the epidemiological investigation and serum specimen collected, which dengue fever case was diagnosed in the laboratory, then it was inoculated on Vero cells. Whole genome sequence was amplified by several pairs primers and characterized using biologic software. The imported case was diagnosed as dengue virus 1 serotype infection. Dengue 1 strain was isolated using Vero cells successfully. Whole genome was 10,670 nt, which belonged to dengue virus 1 serotype V genotype and didn't found any recombination event. The phylogenetic analysis demonstrated that the strain was closed to Indian starins isolated in 2008-2011, and the homology of nucleotide sequence was between 98.2%-99.4%. It was the first time to discover imported dengue 1 serotype case in Henan province. However, according to the patient has been to Guangdong province before onset, it inferred that the Indian strain had been imported to Guangdong province before this case in Henan province.

Evolution and Diversity in Human Herpes Simplex Virus Genomes

PubMed Central

Gatherer, Derek; Ochoa, Alejandro; Greenbaum, Benjamin; Dolan, Aidan; Bowden, Rory J.; Enquist, Lynn W.; Legendre, Matthieu; Davison, Andrew J.

2014-01-01

Herpes simplex virus 1 (HSV-1) causes a chronic, lifelong infection in >60% of adults. Multiple recent vaccine trials have failed, with viral diversity likely contributing to these failures. To understand HSV-1 diversity better, we comprehensively compared 20 newly sequenced viral genomes from China, Japan, Kenya, and South Korea with six previously sequenced genomes from the United States, Europe, and Japan. In this diverse collection of passaged strains, we found that one-fifth of the newly sequenced members share a gene deletion and one-third exhibit homopolymeric frameshift mutations (HFMs). Individual strains exhibit genotypic and potential phenotypic variation via HFMs, deletions, short sequence repeats, and single-nucleotide polymorphisms, although the protein sequence identity between strains exceeds 90% on average. In the first genome-scale analysis of positive selection in HSV-1, we found signs of selection in specific proteins and residues, including the fusion protein glycoprotein H. We also confirmed previous results suggesting that recombination has occurred with high frequency throughout the HSV-1 genome. Despite this, the HSV-1 strains analyzed clustered by geographic origin during whole-genome distance analysis. These data shed light on likely routes of HSV-1 adaptation to changing environments and will aid in the selection of vaccine antigens that are invariant worldwide. PMID:24227835

Insights from the Genome Sequence of Acidovorax citrulli M6, a Group I Strain of the Causal Agent of Bacterial Fruit Blotch of Cucurbits.

PubMed

Eckshtain-Levi, Noam; Shkedy, Dafna; Gershovits, Michael; Da Silva, Gustavo M; Tamir-Ariel, Dafna; Walcott, Ron; Pupko, Tal; Burdman, Saul

2016-01-01

Acidovorax citrulli is a seedborne bacterium that causes bacterial fruit blotch of cucurbit plants including watermelon and melon. A. citrulli strains can be divided into two major groups based on DNA fingerprint analyses and biochemical properties. Group I strains have been generally isolated from non-watermelon cucurbits, while group II strains are closely associated with watermelon. In the present study, we report the genome sequence of M6, a group I model A. citrulli strain, isolated from melon. We used comparative genome analysis to investigate differences between the genome of strain M6 and the genome of the group II model strain AAC00-1. The draft genome sequence of A. citrulli M6 harbors 139 contigs, with an overall approximate size of 4.85 Mb. The genome of M6 is ∼500 Kb shorter than that of strain AAC00-1. Comparative analysis revealed that this size difference is mainly explained by eight fragments, ranging from ∼35-120 Kb and distributed throughout the AAC00-1 genome, which are absent in the M6 genome. In agreement with this finding, while AAC00-1 was found to possess 532 open reading frames (ORFs) that are absent in strain M6, only 123 ORFs in M6 were absent in AAC00-1. Most of these M6 ORFs are hypothetical proteins and most of them were also detected in two group I strains that were recently sequenced, tw6 and pslb65. Further analyses by PCR assays and coverage analyses with other A. citrulli strains support the notion that some of these fragments or significant portions of them are discriminative between groups I and II strains of A. citrulli. Moreover, GC content, effective number of codon values and cluster of orthologs' analyses indicate that these fragments were introduced into group II strains by horizontal gene transfer events. Our study reports the genome sequence of a model group I strain of A. citrulli, one of the most important pathogens of cucurbits. It also provides the first comprehensive comparison at the genomic level between the two major groups of strains of this pathogen.

Insights from the Genome Sequence of Acidovorax citrulli M6, a Group I Strain of the Causal Agent of Bacterial Fruit Blotch of Cucurbits

PubMed Central

Eckshtain-Levi, Noam; Shkedy, Dafna; Gershovits, Michael; Da Silva, Gustavo M.; Tamir-Ariel, Dafna; Walcott, Ron; Pupko, Tal; Burdman, Saul

2016-01-01

Acidovorax citrulli is a seedborne bacterium that causes bacterial fruit blotch of cucurbit plants including watermelon and melon. A. citrulli strains can be divided into two major groups based on DNA fingerprint analyses and biochemical properties. Group I strains have been generally isolated from non-watermelon cucurbits, while group II strains are closely associated with watermelon. In the present study, we report the genome sequence of M6, a group I model A. citrulli strain, isolated from melon. We used comparative genome analysis to investigate differences between the genome of strain M6 and the genome of the group II model strain AAC00-1. The draft genome sequence of A. citrulli M6 harbors 139 contigs, with an overall approximate size of 4.85 Mb. The genome of M6 is ∼500 Kb shorter than that of strain AAC00-1. Comparative analysis revealed that this size difference is mainly explained by eight fragments, ranging from ∼35–120 Kb and distributed throughout the AAC00-1 genome, which are absent in the M6 genome. In agreement with this finding, while AAC00-1 was found to possess 532 open reading frames (ORFs) that are absent in strain M6, only 123 ORFs in M6 were absent in AAC00-1. Most of these M6 ORFs are hypothetical proteins and most of them were also detected in two group I strains that were recently sequenced, tw6 and pslb65. Further analyses by PCR assays and coverage analyses with other A. citrulli strains support the notion that some of these fragments or significant portions of them are discriminative between groups I and II strains of A. citrulli. Moreover, GC content, effective number of codon values and cluster of orthologs’ analyses indicate that these fragments were introduced into group II strains by horizontal gene transfer events. Our study reports the genome sequence of a model group I strain of A. citrulli, one of the most important pathogens of cucurbits. It also provides the first comprehensive comparison at the genomic level between the two major groups of strains of this pathogen. PMID:27092114

Comparative genomic analysis shows that Streptococcus suis meningitis isolate SC070731 contains a unique 105K genomic island.

PubMed

Wu, Zongfu; Wang, Weixue; Tang, Min; Shao, Jing; Dai, Chen; Zhang, Wei; Fan, Hongjie; Yao, Huochun; Zong, Jie; Chen, Dai; Wang, Junning; Lu, Chengping

2014-02-10

Streptococcus suis (SS) is an important swine pathogen worldwide that occasionally causes serious infections in humans. SS infection may result in meningitis in pigs and humans. The pathogenic mechanisms of SS are poorly understood. Here, we provide the complete genome sequence of S. suis serotype 2 (SS2) strain SC070731 isolated from a pig with meningitis. The chromosome is 2,138,568bp in length. There are 1933 predicted protein coding sequences and 96.7% (57/59) of the known virulence-associated genes are present in the genome. Strain SC070731 showed similar virulence with SS2 virulent strains HA9801 and ZY05719, but was more virulent than SS2 virulent strain P1/7 in the zebrafish infection model. Comparative genomic analysis revealed a unique 105K genomic island in strain SC070731 that is absent in seven other sequenced SS2 strains. Further analysis of the 105K genomic island indicated that it contained a complete nisin locus similar to the nisin U locus in S. uberis strain 42, a prophage similar to S. oralis phage PH10 and several antibiotic resistance genes. Several proteins in the 105K genomic island, including nisin and RelBE toxin-antitoxin system, contribute to the bacterial fitness and virulence in other pathogenic bacteria. Further investigation of newly identified gene products, including four putative new virulence-associated surface proteins, will improve our understanding of SS pathogenesis. Copyright © 2013 Elsevier B.V. All rights reserved.

Methylobacterium platani sp. nov., isolated from a leaf of the tree Platanus orientalis.

PubMed

Kang, Yoon-Suk; Kim, Juhyun; Shin, Hyeon-Dong; Nam, Young-Do; Bae, Jin-Woo; Jeon, Che Ok; Park, Woojun

2007-12-01

A novel bacterial strain, designated PMB02(T), was isolated from a leaf of the tree Platanus orientalis. Colonies grown on TYG agar plates were circular, pink-pigmented and slow-growing, being 0.2-1.5 mm in diameter after 3 days growth. The cells of strain PMB02(T) were Gram-negative, aerobic, motile rods that possessed oxidase and catalase activities and grew at 20-30 degrees C, pH 6-8 and in media containing less than 1 % NaCl. The major respiratory quinone was identified as Q-10. A phylogenetic analysis based on 16S rRNA gene sequence comparisons indicated that strain PMB02(T) was related to members of the genus Methylobacterium. A comparative 16S rRNA gene sequence-based phylogenetic analysis placed the strain in a clade with the species Methylobacterium aquaticum and Methylobacterium variabile, with which it showed sequence similarities of 97.7 and 97.4 %, respectively. The values for DNA-DNA hybridization between strain PMB02(T) and M. aquaticum CCM 7218(T) and M. variabile GR3(T) were less than 32 %. On the basis of the phenotypic characterization, the phylogenetic analysis and the DNA-DNA relatedness data, strain PMB02(T) is considered to represent a novel species of the genus Methylobacterium, for which the name Methylobacterium platani sp. nov. is proposed. The type strain is PMB02(T) (=KCTC 12901(T)=JCM 14648(T)).

Comparative genome analysis of Pediococcus damnosus LMG 28219, a strain well-adapted to the beer environment.

PubMed

Snauwaert, Isabel; Stragier, Pieter; De Vuyst, Luc; Vandamme, Peter

2015-04-03

Pediococcus damnosus LMG 28219 is a lactic acid bacterium dominating the maturation phase of Flemish acid beer productions. It proved to be capable of growing in beer, thereby resisting this environment, which is unfavorable for microbial growth. The molecular mechanisms underlying its metabolic capabilities and niche adaptations were unknown up to now. In the present study, whole-genome sequencing and comparative genome analysis were used to investigate this strain's mechanisms to reside in the beer niche, with special focus on not only stress and hop resistances but also folate biosynthesis and exopolysaccharide (EPS) production. The draft genome sequence of P. damnosus LMG 28219 harbored 183 contigs, including an intact prophage region and several coding sequences involved in plasmid replication. The annotation of 2178 coding sequences revealed the presence of many transporters and transcriptional regulators and several genes involved in oxidative stress response, hop resistance, de novo folate biosynthesis, and EPS production. Comparative genome analysis of P. damnosus LMG 28219 with Pediococcus claussenii ATCC BAA-344(T) (beer origin) and Pediococcus pentosaceus ATCC 25745 (plant origin) revealed that various hop resistance genes and genes involved in de novo folate biosynthesis were unique to the strains isolated from beer. This contrasted with the genes related to osmotic stress responses, which were shared between the strains compared. Furthermore, transcriptional regulators were enriched in the genomes of bacteria capable of growth in beer, suggesting that those cause rapid up- or down-regulation of gene expression. Genome sequence analysis of P. damnosus LMG 28219 provided insights into the underlying mechanisms of its adaptation to the beer niche. The results presented will enable analysis of the transcriptome and proteome of P. damnosus LMG 28219, which will result in additional knowledge on its metabolic activities.

Stress-induced rearrangement of Fusarium retrotransposon sequences.

PubMed

Anaya, N; Roncero, M I

1996-11-27

Rearrangement of fusarium oxysporum retrotransposon skippy was induced by growth in the presence of potassium chlorate. Three fungal strains, one sensitive to chlorate (Co60) and two resistant to chlorate and deficient for nitrate reductase (Co65 and Co94), were studied by Southern analysis of their genomic DNA. Polymorphism was detected in their hybridization banding pattern, relative to the wild type grown in the absence of chlorate, using various enzymes with or without restriction sites within the retrotransposon. Results were consistent with the assumption that three different events had occurred in strain Co60: genomic amplification of skippy yielding tandem arrays of the element, generation of new skippy sequences, and deletion of skippy sequences. Amplification of Co60 genomic DNA using the polymerase chain reaction and divergent primers derived from the retrotransposon generated a new band, corresponding to one long terminal repeat plus flanking sequences, that was not present in the wild-type strain. Molecular analysis of nitrate reductase-deficient mutants showed that generation and deletion of skippy sequences, but not genomic amplification in tandem repeats, had occurred in their genomes.

[Expression and analysis of the nucleoprotein of paramyxovirus Tianjin strain].

PubMed

Wang, Qing; Li, Mei; Shi, Li-Ying; Yuan, Li-Jun; Wang, Wen-Xiu

2008-05-01

Paramyxovirus Tianjin strain is a novel strain of virus causing common cotton-eared marmoset fatal infection. To investigate the relationship between the gene structure and function of nucleoprotein (NP) of Tianjin strain, NP gene of paramyxovirus Tianjin strain was cloned and three domains of NP were expressed. The homologous and phylogenetic analysis of NP sequences among the paramyxovirus Tianjin strain and eight strains of Sendai viruses from GenBank were performed. The results indicated the recombinant proteins NP1, NP2 and NP3 showed the native antigenicity to the polyclonal antiserum of paramyxovirus Tianjin strain, ranking as NP3>NP1>NP2 (precedence order). The homology of NP nucleotide and the deduced amino acid sequences between paramyxovirus Tianjin strain and Sendai virus BB1 strain were 94.5%, 96.2%, respectively, whereas the identity were 85.1% - 88.7% and 92.4% - 94.7% among Tianjin strain and the 7 strains of Sendai viruses from GenBank respectively. There were 15 unique amino acid substitutions in Tianjin strain NP protein and 11 common amino acid substitutions same with BB1 strain. This research confirmed that paramyxovirus Tianjin strain might be a new genotype of Sendai virus and can be helpful in the establishment of detection assay applying recombinant NP as antigen instead of the whole virions.

Molecular evidence of Burkholderia pseudomallei genotypes based on geographical distribution.

PubMed

Zulkefli, Noorfatin Jihan; Mariappan, Vanitha; Vellasamy, Kumutha Malar; Chong, Chun Wie; Thong, Kwai Lin; Ponnampalavanar, Sasheela; Vadivelu, Jamuna; Teh, Cindy Shuan Ju

2016-01-01

Background. Central intermediary metabolism (CIM) in bacteria is defined as a set of metabolic biochemical reactions within a cell, which is essential for the cell to survive in response to environmental perturbations. The genes associated with CIM are commonly found in both pathogenic and non-pathogenic strains. As these genes are involved in vital metabolic processes of bacteria, we explored the efficiency of the genes in genotypic characterization of Burkholderia pseudomallei isolates, compared with the established pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) schemes. Methods. Nine previously sequenced B. pseudomallei isolates from Malaysia were characterized by PFGE, MLST and CIM genes. The isolates were later compared to the other 39 B. pseudomallei strains, retrieved from GenBank using both MLST and sequence analysis of CIM genes. UniFrac and hierachical clustering analyses were performed using the results generated by both MLST and sequence analysis of CIM genes. Results. Genetic relatedness of nine Malaysian B. pseudomallei isolates and the other 39 strains was investigated. The nine Malaysian isolates were subtyped into six PFGE profiles, four MLST profiles and five sequence types based on CIM genes alignment. All methods demonstrated the clonality of OB and CB as well as CMS and THE. However, PFGE showed less than 70% similarity between a pair of morphology variants, OS and OB. In contrast, OS was identical to the soil isolate, MARAN. To have a better understanding of the genetic diversity of B. pseudomallei worldwide, we further aligned the sequences of genes used in MLST and genes associated with CIM for the nine Malaysian isolates and 39 B. pseudomallei strains from NCBI database. Overall, based on the CIM genes, the strains were subtyped into 33 profiles where majority of the strains from Asian countries were clustered together. On the other hand, MLST resolved the isolates into 31 profiles which formed three clusters. Hierarchical clustering using UniFrac distance suggested that the isolates from Australia were genetically distinct from the Asian isolates. Nevertheless, statistical significant differences were detected between isolates from Malaysia, Thailand and Australia. Discussion. Overall, PFGE showed higher discriminative power in clustering the nine Malaysian B. pseudomallei isolates and indicated its suitability for localized epidemiological study. Compared to MLST, CIM genes showed higher resolution in distinguishing those non-related strains and better clustering of strains from different geographical regions. A closer genetic relatedness of Malaysian isolates with all Asian strains in comparison to Australian strains was observed. This finding was supported by UniFrac analysis which resulted in geographical segregation between Australia and the Asian countries.

Haemophilus ducreyi Cutaneous Ulcer Strains Diverged from Both Class I and Class II Genital Ulcer Strains: Implications for Epidemiological Studies.

PubMed

Gangaiah, Dharanesh; Spinola, Stanley M

2016-12-01

Haemophilus ducreyi has emerged as a major cause of cutaneous ulcers (CU) in yaws-endemic regions of the tropics in the South Pacific, South East Asia and Africa. H. ducreyi was once thought only to cause the genital ulcer (GU) disease chancroid; GU strains belong to 2 distinct classes, class I and class II. Using whole-genome sequencing of 4 CU strains from Samoa, 1 from Vanuatu and 1 from Papua New Guinea, we showed that CU strains diverged from the class I strain 35000HP and that one CU strain expressed β-lactamase. Recently, the Center for Disease Control and Prevention released the genomes of 11 additional CU strains from Vanuatu and Ghana; however, the evolutionary relationship of these CU strains to previously-characterized CU and GU strains is unknown. We performed phylogenetic analysis of 17 CU and 10 GU strains. Class I and class II GU strains formed two distinct clades. The class I strains formed two subclades, one containing 35000HP and HD183 and the other containing the remainder of the class I strains. Twelve of the CU strains formed a subclone under the class I 35000HP subclade, while 2 CU strains formed a subclone under the other class I subclade. Unexpectedly, 3 of the CU strains formed a subclone under the class II clade. Phylogenetic analysis of dsrA-hgbA-ncaA sequences yielded a tree similar to that of whole-genome phylogenetic tree. CU strains diverged from multiple lineages within both class I and class II GU strains. Multilocus sequence typing of dsrA-hgbA-ncaA could be reliably used for epidemiological investigation of CU and GU strains. As class II strains grow relatively poorly and are relatively more susceptible to vancomycin than class I strains, these findings have implications for methods to recover CU strains. Comparison of contemporary CU and GU isolates would help clarify the relationship between these entities.

Genetic and Metabolic Intraspecific Biodiversity of Ganoderma lucidum

PubMed Central

Pawlik, Anna; Janusz, Grzegorz; Dębska, Iwona; Siwulski, Marek; Frąc, Magdalena; Rogalski, Jerzy

2015-01-01

Fourteen Ganoderma lucidum strains from different geographic regions were identified using ITS region sequencing. Based on the sequences obtained, the genomic relationship between the analyzed strains was determined. All G. lucidum strains were also genetically characterized using the AFLP technique. G. lucidum strains included in the analysis displayed an AFLP profile similarity level in the range from 9.6 to 33.9%. Biolog FF MicroPlates were applied to obtain data on utilization of 95 carbon sources and mitochondrial activity. The analysis allowed comparison of functional diversity of the fungal strains. The substrate utilization profiles for the isolates tested revealed a broad variability within the analyzed G. lucidum species and proved to be a good profiling technology for studying the diversity in fungi. Significant differences have been demonstrated in substrate richness values. Interestingly, the analysis of growth and biomass production also differentiated the strains based on the growth rate on the agar and sawdust substrate. In general, the mycelial growth on the sawdust substrate was more balanced and the fastest fungal growth was observed for GRE3 and FCL192. PMID:25815332

Analysis and Dynamics of the Chromosomal Complements of Wild Sparkling-Wine Yeast Strains

PubMed Central

Nadal, Dolors; Carro, David; Fernández-Larrea, Juan; Piña, Benjamin

1999-01-01

We isolated Saccharomyces cerevisiae yeast strains that are able to carry out the second fermentation of sparkling wine from spontaneously fermenting musts in El Penedès (Spain) by specifically designed selection protocols. All of them (26 strains) showed one of two very similar mitochondrial DNA (mtDNA) restriction patterns, whereas their karyotypes differed. These strains showed high rates of karyotype instability, which were dependent on both the medium and the strain, during vegetative growth. In all cases, the mtDNA restriction pattern was conserved in strains kept under the same conditions. Analysis of different repetitive sequences in their genomes suggested that ribosomal DNA repeats play an important role in the changes in size observed in chromosome XII, whereas SUC genes or Ty elements did not show amplification or transposition processes that could be related to rearrangements of the chromosomes showing these sequences. Karyotype changes also occurred in monosporidic diploid derivatives. We propose that these changes originated mainly from ectopic recombination between repeated sequences interspersed in the genome. None of the rearranged karyotypes provided a selective advantage strong enough to allow the strains to displace the parental strains. The nature and frequency of these changes suggest that they may play an important role in the establishment and maintenance of the genetic diversity observed in S. cerevisiae wild populations. PMID:10103269

Population analysis of Vibrio parahaemolyticus originating from different geographical regions demonstrates a high genetic diversity.

PubMed

Urmersbach, Sara; Alter, Thomas; Koralage, Madura Sanjeevani Gonsal; Sperling, Lisa; Gerdts, Gunnar; Messelhäusser, Ute; Huehn, Stephan

2014-03-08

Vibrio parahaemolyticus is frequently isolated from environmental and seafood samples and associated with gastroenteritis outbreakes in American, European, Asian and African countries. To distinguish between different lineages of V. parahaemolyticus various genotyping techniques have been used, incl. multilocus sequence typing (MLST). Even though some studies have already applied MLST analysis to characterize V. parahaemolyticus strain sets, these studies have been restricted to specific geographical areas (e.g. U.S. coast, Thailand and Peru), have focused exclusively on pandemic or non-pandemic pathogenic isolates or have been based on a limited strain number. To generate a global picture of V. parahaemolyticus genotype distribution, a collection of 130 environmental and seafood related V. parahaemolyticus isolates of different geographical origins (Sri Lanka, Ecuador, North Sea and Baltic Sea as well as German retail) was subjected to MLST analysis after modification of gyrB and recA PCRs. The V. parahaemolyticus population was composed of 82 unique Sequence Types (STs), of which 68 (82.9%) were new to the pubMLST database. After translating the in-frame nucleotide sequences into amino acid sequences, less diversity was detectable: a total of 31 different peptide Sequence Types (pSTs) with 19 (61.3%) new pSTs were generated from the analyzed isolates. Most STs did not show a global dissemination, but some were supra-regionally distributed and clusters of STs were dependent on geographical origin. On peptide level no general clustering of strains from specific geographical regions was observed, thereby the most common pSTs were found on all continents (Asia, South America and Europe) and rare pSTs were restricted to distinct countries or even geographical regions. One lineage of pSTs associated only with strains from North and Baltic Sea strains was identified. Our study reveals a high genetic diversity in the analyzed V. parahaemolyticus strain set as well as for geographical strain subsets, with a high proportion of newly discovered alleles and STs. Differences between the subsets were identified. Our data support the postulated population structure of V. parahaemolyticus which follows the 'epidemic' model of clonal expansion. Application of peptide based AA-MLST allowed the identification of reliable relationships between strains.

Genome sequence of Shigella flexneri strain SP1, a diarrheal isolate that encodes an extended-spectrum β-lactamase (ESBL).

PubMed

Shen, Ping; Fan, Jianzhong; Guo, Lihua; Li, Jiahua; Li, Ang; Zhang, Jing; Ying, Chaoqun; Ji, Jinru; Xu, Hao; Zheng, Beiwen; Xiao, Yonghong

2017-05-12

Shigellosis is the most common cause of gastrointestinal infections in developing countries. In China, the species most frequently responsible for shigellosis is Shigella flexneri. S. flexneri remains largely unexplored from a genomic standpoint and is still described using a vocabulary based on biochemical and serological properties. Moreover, increasing numbers of ESBL-producing Shigella strains have been isolated from clinical samples. Despite this, only a few cases of ESBL-producing Shigella have been described in China. Therefore, a better understanding of ESBL-producing Shigella from a genomic standpoint is required. In this study, a S. flexneri type 1a isolate SP1 harboring bla CTX-M-14 , which was recovered from the patient with diarrhea, was subjected to whole genome sequencing. The draft genome assembly of S. flexneri strain SP1 consisted of 4,592,345 bp with a G+C content of 50.46%. RAST analysis revealed the genome contained 4798 coding sequences (CDSs) and 100 RNA-encoding genes. We detected one incomplete prophage and six candidate CRISPR loci in the genome. In vitro antimicrobial susceptibility testing demonstrated that strain SP1 is resistant to ampicillin, amoxicillin/clavulanic acid, cefazolin, ceftriaxone and trimethoprim. In silico analysis detected genes mediating resistance to aminoglycosides, β-lactams, phenicol, tetracycline, sulphonamides, and trimethoprim. The bla CTX-M-14 gene was located on an IncFII2 plasmid. A series of virulence factors were identified in the genome. In this study, we report the whole genome sequence of a bla CTX-M-14 -encoding S. flexneri strain SP1. Dozens of resistance determinants were detected in the genome and may be responsible for the multidrug-resistance of this strain, although further confirmation studies are warranted. Numerous virulence factors identified in the strain suggest that isolate SP1 is potential pathogenic. The availability of the genome sequence and comparative analysis with other S. flexneri strains provides the basis to further address the evolution of drug resistance mechanisms and pathogenicity in S. flexneri.

Brucella papionis sp. nov., isolated from baboons (Papio spp.)

PubMed Central

Davison, Nicholas; Cloeckaert, Axel; Al Dahouk, Sascha; Zygmunt, Michel S.; Brew, Simon D.; Perrett, Lorraine L.; Koylass, Mark S.; Vergnaud, Gilles; Quance, Christine; Scholz, Holger C.; Dick, Edward J.; Hubbard, Gene; Schlabritz-Loutsevitch, Natalia E.

2014-01-01

Two Gram-negative, non-motile, non-spore-forming coccoid bacteria (strains F8/08-60T and F8/08-61) isolated from clinical specimens obtained from baboons (Papio spp.) that had delivered stillborn offspring were subjected to a polyphasic taxonomic study. On the basis of 16S rRNA gene sequence similarities, both strains, which possessed identical sequences, were assigned to the genus Brucella. This placement was confirmed by extended multilocus sequence analysis (MLSA), where both strains possessed identical sequences, and whole-genome sequencing of a representative isolate. All of the above analyses suggested that the two strains represent a novel lineage within the genus Brucella. The strains also possessed a unique profile when subjected to the phenotyping approach classically used to separate species of the genus Brucella, reacting only with Brucella A monospecific antiserum, being sensitive to the dyes thionin and fuchsin, being lysed by bacteriophage Wb, Bk2 and Fi phage at routine test dilution (RTD) but only partially sensitive to bacteriophage Tb, and with no requirement for CO2 and no production of H2S but strong urease activity. Biochemical profiling revealed a pattern of enzyme activity and metabolic capabilities distinct from existing species of the genus Brucella. Molecular analysis of the omp2 locus genes showed that both strains had a novel combination of two highly similar omp2b gene copies. The two strains shared a unique fingerprint profile of the multiple-copy Brucella-specific element IS711. Like MLSA, a multilocus variable number of tandem repeat analysis (MLVA) showed that the isolates clustered together very closely, but represent a distinct group within the genus Brucella. Isolates F8/08-60T and F8/08-61 could be distinguished clearly from all known species of the genus Brucellaand their biovars by both phenotypic and molecular properties. Therefore, by applying the species concept for the genus Brucellasuggested by the ICSP Subcommittee on the Taxonomy of Brucella, they represent a novel species within the genus Brucella, for which the name Brucella papionis sp. nov. is proposed, with the type strain F8/08-60T ( = NCTC 13660T = CIRMBP 0958T). PMID:25242540

Extending the Bacillus cereus group genomics to putative food-borne pathogens of different toxicity.

PubMed

Lapidus, Alla; Goltsman, Eugene; Auger, Sandrine; Galleron, Nathalie; Ségurens, Béatrice; Dossat, Carole; Land, Miriam L; Broussolle, Veronique; Brillard, Julien; Guinebretiere, Marie-Helene; Sanchis, Vincent; Nguen-The, Christophe; Lereclus, Didier; Richardson, Paul; Wincker, Patrick; Weissenbach, Jean; Ehrlich, S Dusko; Sorokin, Alexei

2008-01-30

The Bacillus cereus group represents sporulating soil bacteria containing pathogenic strains which may cause diarrheic or emetic food poisoning outbreaks. Multiple locus sequence typing revealed a presence in natural samples of these bacteria of about 30 clonal complexes. Application of genomic methods to this group was however biased due to the major interest for representatives closely related to Bacillus anthracis. Albeit the most important food-borne pathogens were not yet defined, existing data indicate that they are scattered all over the phylogenetic tree. The preliminary analysis of the sequences of three genomes discussed in this paper narrows down the gaps in our knowledge of the B. cereus group. The strain NVH391-98 is a rare but particularly severe food-borne pathogen. Sequencing revealed that the strain should be a representative of a novel bacterial species, for which the name Bacillus cytotoxis or Bacillus cytotoxicus is proposed. This strain has a reduced genome size compared to other B. cereus group strains. Genome analysis revealed absence of sigma B factor and the presence of genes encoding diarrheic Nhe toxin, not detected earlier. The strain B. cereus F837/76 represents a clonal complex close to that of B. anthracis. Including F837/76, three such B. cereus strains had been sequenced. Alignment of genomes suggests that B. anthracis is their common ancestor. Since such strains often emerge from clinical cases, they merit a special attention. The third strain, KBAB4, is a typical facultative psychrophile generally found in soil. Phylogenic studies show that in nature it is the most active group in terms of gene exchange. Genomic sequence revealed high presence of extra-chromosomal genetic material (about 530kb) that may account for this phenomenon. Genes coding Nhe-like toxin were found on a big plasmid in this strain. This may indicate a potential mechanism of toxicity spread from the psychrophile strain community. The results of this genomic work and ecological compartments of different strains incite to consider a necessity of creating prophylactic vaccines against bacteria closely related to NVH391-98 and F837/76. Presumably developing of such vaccines can be based on the properties of non-pathogenic strains such as KBAB4 or ATCC14579 reported here or earlier. By comparing the protein coding genes of strains being sequenced in this project to others we estimate the shared proteome, or core genome, in the B. cereus group to be 3000+/-200 genes and the total proteome, or pan-genome, to be 20-25,000 genes.

Phylogenetic analysis of human G9P[8] rotavirus strains circulating in Jiangsu, China between 2010 and 2016.

PubMed

Xu, Cheng; Fu, Jianguang; Ai, Jing; Zhang, Jun; Liu, Cheng; Huo, Xiang; Bao, Changjun; Zhu, Yefei

2018-05-02

Rotavirus A (RVA) is the leading cause of acute viral gastroenteritis in children under 5 years of age worldwide. G9P[8] is a common RVA genotype that has been persistently prevalent in Jiangsu, China. To determine the genetic diversity of G9P[8] RVAs, 7 representative G9P[8] strains collected from Suzhou Children's Hospital between 2010 and 2016 (named JS2010-JS2016) were analyzed through whole-genome sequencing. All evaluated strains showed the Wa-like constellation G9-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-H1. Furthermore, phylogenetic analysis revealed that the VP7 genes of all strains clustered into lineage G9-III and G9-VI. With the exception of strain JS2012 (P[8]-4), the VP4 sequences of all strains belonged to the P[8]-3 lineage. Sequencing further revealed that amino acid substitutions were present in the antigenic regions of the VP7 and VP4 genes of all strains. Moreover, there were multiple substitutions in antigenic sites I and II of the nonstructural protein 4 (NSP4) genes, whereas the other NSP genes were relatively conserved. In conclusion, our phylogenetic analysis of these 7 G9P[8] strains suggests that RVA varied across regions and time. Therefore, our findings suggest that continued surveillance is necessary to explore the molecular evolutionary characteristics of RVA for better prevention and treatment of acute viral gastroenteritis. © 2018 Wiley Periodicals, Inc.

Molecular analysis of the rRNA genes of Babesia spp and Ehrlichia canis detected in dogs from RibeirÃo Preto, Brazil

PubMed Central

Oliveira, L.P.; Cardozo, G.P.; Santos, E.V.; Mansur, M.A.B.; Donini, I.A.N.; Zissou, V.G.; Roberto, P.G.; Marins, M.

2009-01-01

The partial DNA sequences of the 18S rRNA gene of Babesia canis and the 16S rRNA gene of Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil, were compared to sequences from other strains deposited in GenBank. The E. canis strain circulating in Ribeirão Preto is identical to other strains previously detected in the region, whereas the subspecies Babesia canis vogeli is the main Babesia strain circulating in dogs from Ribeirão Preto. PMID:24031351

Draft Genome Sequence of Lactococcus lactis subsp. lactis bv. diacetylactis CRL264, a Citrate-Fermenting Strain

PubMed Central

Zuljan, Federico; Espariz, Martín; Blancato, Victor S.; Esteban, Luis; Alarcón, Sergio

2016-01-01

We report the draft genome sequence of Lactococcus lactis subsp. lactis bv. diacetylactis CRL264, a natural strain isolated from artisanal cheese from northwest Argentina. L. lactis subsp. lactis bv. diacetylactis is one of the most important microorganisms used as starter culture around the world. The CRL264 strain constitutes a model microorganism in the studies on the generation of aroma compounds (diacetyl, acetoin, and 2,3-butanediol) by lactic acid bacteria. Our genome analysis shows similar genetic organization to other available genomes of L. lactis bv. diacetylactis strains. PMID:26847906

Species Distribution and In Vitro Azole Susceptibility of Aspergillus Section Nigri Isolates from Clinical and Environmental Settings.

PubMed

Iatta, Roberta; Nuccio, Federica; Immediato, Davide; Mosca, Adriana; De Carlo, Carmela; Miragliotta, Giuseppe; Parisi, Antonio; Crescenzo, Giuseppe; Otranto, Domenico; Cafarchia, Claudia

2016-09-01

Aspergillus section Nigri includes species of interest for animal and human health, although studies on species distribution are limited to human cases. Data on the antifungal susceptibilities and the molecular mechanism of triazole resistance in strains belonging to this section are scant. Forty-two black Aspergillus strains from human patients (16 isolates), animals (14 isolates), and the environment (12 isolates) were molecularly characterized and their in vitro triazole susceptibilities investigated. Aspergillus tubingensis was isolated from humans, animals, and environmental settings, whereas Aspergillus awamori and Aspergillus niger were isolated exclusively from humans. Phylogenetic analyses of β-tubulin and calmodulin gene sequences were concordant in differentiating A. tubingensis from A. awamori and A. niger Voriconazole and posaconazole (PSZ) were the most active triazoles. One A. tubingensis strain was resistant to itraconazole and PSZ and one A. niger strain to PSZ. Sequence analysis of the cyp51A gene revealed different sequence types within a species, and A. tubingensis strains were also phylogenetically distinct from A. awamori/A. niger strains according to the strain origin and susceptibility profile. Genetic analysis of the cyp51A sequences suggests that two nonsynonymous mutations resulting in amino acid substitutions in the CYP51A protein (changes of L to R at position 21 [L21R] and of Q to R at position 228 [Q228R]) might be involved in azole resistance. Though azole resistance in black Aspergillus isolates from animals and rural environments does not represent a threat to public health in Southern Italy, the use of triazoles in the clinical setting needs to better monitored. The cyp51A sequence is useful for the molecular identification of black Aspergillus, and point mutations in protein sequences could be responsible for azole resistance phenomena. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Influence of Seasonality on the Genetic Diversity of Vibrio parahaemolyticus in New Hampshire Shellfish Waters as Determined by Multilocus Sequence Analysis

PubMed Central

Ellis, Crystal N.; Schuster, Brian M.; Striplin, Megan J.; Jones, Stephen H.; Whistler, Cheryl A.

2012-01-01

Risk of gastric infection with Vibrio parahaemolyticus increases with favorable environmental conditions and population shifts that increase prevalence of infective strains. Genetic analysis of New Hampshire strains revealed a unique population with some isolates similar to outbreak-causing strains and high-level diversity that increased as waters warmed. PMID:22407686

Influence of seasonality on the genetic diversity of Vibrio parahaemolyticus in New Hampshire shellfish waters as determined by multilocus sequence analysis.

PubMed

Ellis, Crystal N; Schuster, Brian M; Striplin, Megan J; Jones, Stephen H; Whistler, Cheryl A; Cooper, Vaughn S

2012-05-01

Risk of gastric infection with Vibrio parahaemolyticus increases with favorable environmental conditions and population shifts that increase prevalence of infective strains. Genetic analysis of New Hampshire strains revealed a unique population with some isolates similar to outbreak-causing strains and high-level diversity that increased as waters warmed.

Genetic diversity reflects geographical origin of Ralstonia solanacearum strains isolated from plant and water sources in Spain.

PubMed

Caruso, Paola; Biosca, Elena G; Bertolini, Edson; Marco-Noales, Ester; Gorris, María Teresa; Licciardello, Concetta; López, María M

2017-12-01

The characterization and intraspecific diversity of a collection of 45 Ralstonia solanacearum strains isolated in Spain from different sources and geographical origins is reported. To test the influence of the site and the host on strain diversity, phenotypic and genotypic analysis were performed by a polyphasic approach. Biochemical and metabolic profiles were compared. Serological relationship was evaluated by Indirect-ELISA using polyclonal and monoclonal antibodies. For genotypic analysis, hrpB and egl DNA sequence analysis, repetitive sequences (rep-PCR), amplified fragment length polymorphism (AFLP) profiles and macrorestriction with XbaI followed by pulsed field gel electrophoresis (PFGE) were performed. The biochemical and metabolic characterization, serological tests, rep-PCR typing and phylogenetic analysis showed that all analysed strains belonged to phylotype II sequevar 1 and shared homogeneous profiles. However, interesting differences among strains were found by AFLP and macrorestriction with XbaI followed by PFGE techniques, some profiles being related to the geographical origin of the strains. Diversity results obtained offer new insights into the biogeography of this quarantine organism and its possible sources and reservoirs in Spain and Mediterranean countries. Copyright© by the Spanish Society for Microbiology and Institute for Catalan Studies.

Analysis of the vp2 gene sequence of a new mutated mink enteritis parvovirus strain in PR China

PubMed Central

2010-01-01

Background Mink enteritis virus (MEV) causes a highly contagious viral disease of mink with a worldwide distribution. MEV has a linear, single-stranded, negative-sense DNA with a genome length of approximately 5,000 bp. The VP2 protein is the major structural protein of the parvovirus encoded by the vp2 gene. VP2 is highly antigenic and plays important roles in determining viral host ranges and tissue tropisms. This study describes the bionomics and vp2 gene analysis of a mutated strain, MEV-DL, which was isolated recently in China and outlines its homologous relationships with other selected strains registered in Genbank. Results The MEV-DL strain can infect F81 cells with cytopathic effects. Pig erythrocytes were agglutinated by the MEV-DL strain. The generation of MEV-DL in F81 cells could infect mink within three months and cause a disease that was similar to that caused by wild-type MEV. A comparative analysis of the vp2 gene nucleotide (nt) sequence of MEV-DL showed that this was more than 99% homologous with other mink enteritis parvoviruses in Genbank. However, the nucleotide residues at positions 1,065 and 1,238 in the MEV-DL strain of the vp2 gene differed from those of all the other MEV strains described previously. It is noteworthy that the mutation at the nucleotide residues position 1,238 led to Asp/Gly replacement. This may lead to structural changes. A phylogenetic tree and sequence distance table were obtained, which showed that the MEV-DL and ZYL-1 strains had the closest inheritance distance. Conclusions A new variation of the vp2 gene exists in the MEV-DL strain, which may lead to structural changes of the VP2 protein. Phylogenetic analysis showed that MEV-DL may originate from the ZYL-1 strain in DaLian. PMID:20540765

Complete Genome Sequence of a Yersinia enterocolitica “Old World” (3/O:9) Strain and Comparison with the “New World” (1B/O:8) Strain▿†

PubMed Central

Wang, Xin; Li, Yang; Jing, Huaiqi; Ren, Yan; Zhou, Zhemin; Wang, Shaojing; Kan, Biao; Xu, Jianguo; Wang, Lei

2011-01-01

Yersinia enterocolitica is a heterogeneous bacterial species with a wide range of animal reservoirs through which human intestinal illness can be facilitated. In contrast to the epidemiological pattern observed in the United States, infections in China present a pattern similar to those in European countries and Japan, wherein “Old World” strains (biotypes 2 to 5) are prevalent. To gain insights into the evolution of Y. enterocolitica and pathogenic properties toward human hosts, we sequenced the genome of a biotype 3 strain, 105.5R(r) (O:9), obtained from a Chinese patient. Comparative genome sequence analysis with strain 8081 (1B/O:8) revealed new insights into Y. enterocolitica. Both strains have more than 14% specific genes. In strain 105.5R(r), putative virulence factors were found in strain-specific genomic pathogenicity islands that comprised a novel type III secretion system and rtx-like genes. Many of the loci representing ancestral clusters, which are believed to contribute to enteric survival and pathogenesis, are present in strain 105.5R(r) but lost in strain 8081. Insertion elements in 105.5R(r) have a pattern distinct from those in strain 8081 and were exclusively located in a strain-specific region. In summary, our comparative genome analysis indicates that these two strains may have attained their pathogenicity by completely separate evolutionary events, and the 105.5R(r) strain, a representative of the Old World biogroup, lies in a branch of Y. enterocolitica that is distinct from the “New World” 8081 strain. PMID:21325549

Feasibility and reproducibility of feature-tracking-based strain and strain rate measures of the left ventricle in different diseases and genders.

PubMed

Maceira, Alicia M; Tuset-Sanchis, Luis; López-Garrido, Miguel; San Andres, Marta; López-Lereu, M Pilar; Monmeneu, Jose V; García-González, M Pilar; Higueras, Laura

2018-05-01

The measurement of myocardial deformation by strain analysis is an evolving tool to quantify regional and global myocardial function. To assess the feasibility and reproducibility of myocardial strain/strain rate measurements with magnetic resonance feature tracking (MR-FT) in healthy subjects and in patient groups. Prospective study. Sixty patients (20 hypertensives with left ventricular (LV) hypertrophy (H); 20 nonischemic dilated cardiomyopathy (D); 20 ischemic heart disease (I); as well as 20 controls (C) were included, 10 men and 10 women in each group. A 1.5T MR protocol including steady-state free precession (SSFP) cine sequences in the standard views and late enhancement sequences. LV volumes, mass, global and regional radial, circumferential, and longitudinal strain/strain rate were measured using CVI42 software. The analysis time was recorded. Intraobserver and interobserver agreement and intraclass correlation coefficients (ICC) were obtained for reproducibility assessment as well as differences according to gender and group of pertinence. Strain/strain rate analysis could be achieved in all subjects. The average analysis time was 14 ± 3 minutes. The average intraobserver ICC was excellent (ICC >0.90) for strain and good (ICC >0.75) for strain rate. Reproducibility of strain measurements was good to excellent (ICC >0.75) for all groups of subjects and both genders. Reproducibility of strain measurements was good for basal segments (ICC >0.75) and excellent for middle and apical segments (ICC >0.90). Reproducibility of strain rate measurements was moderate for basal segments (ICC >0.50) and good for middle and apical segments. MR-FT for strain/strain rate analysis is a feasible and highly reproducible technique. CVI42 FT analysis was equally feasible and reproducible in various pathologies and between genders. Better reproducibility was seen globally for middle and apical segments, which needs further clarification. 3 Technical Efficacy Stage 2 J. Magn. Reson. Imaging 2018;47:1415-1425. © 2017 International Society for Magnetic Resonance in Medicine.

Stochastic precision analysis of 2D cardiac strain estimation in vivo

NASA Astrophysics Data System (ADS)

Bunting, E. A.; Provost, J.; Konofagou, E. E.

2014-11-01

Ultrasonic strain imaging has been applied to echocardiography and carries great potential to be used as a tool in the clinical setting. Two-dimensional (2D) strain estimation may be useful when studying the heart due to the complex, 3D deformation of the cardiac tissue. Increasing the framerate used for motion estimation, i.e. motion estimation rate (MER), has been shown to improve the precision of the strain estimation, although maintaining the spatial resolution necessary to view the entire heart structure in a single heartbeat remains challenging at high MERs. Two previously developed methods, the temporally unequispaced acquisition sequence (TUAS) and the diverging beam sequence (DBS), have been used in the past to successfully estimate in vivo axial strain at high MERs without compromising spatial resolution. In this study, a stochastic assessment of 2D strain estimation precision is performed in vivo for both sequences at varying MERs (65, 272, 544, 815 Hz for TUAS; 250, 500, 1000, 2000 Hz for DBS). 2D incremental strains were estimated during left ventricular contraction in five healthy volunteers using a normalized cross-correlation function and a least-squares strain estimator. Both sequences were shown capable of estimating 2D incremental strains in vivo. The conditional expected value of the elastographic signal-to-noise ratio (E(SNRe|ɛ)) was used to compare strain estimation precision of both sequences at multiple MERs over a wide range of clinical strain values. The results here indicate that axial strain estimation precision is much more dependent on MER than lateral strain estimation, while lateral estimation is more affected by strain magnitude. MER should be increased at least above 544 Hz to avoid suboptimal axial strain estimation. Radial and circumferential strain estimations were influenced by the axial and lateral strain in different ways. Furthermore, the TUAS and DBS were found to be of comparable precision at similar MERs.

Species identification of mutans streptococci by groESL gene sequence.

PubMed

Hung, Wei-Chung; Tsai, Jui-Chang; Hsueh, Po-Ren; Chia, Jean-San; Teng, Lee-Jene

2005-09-01

The near full-length sequences of the groESL genes were determined and analysed among eight reference strains (serotypes a to h) representing five species of mutans group streptococci. The groES sequences from these reference strains revealed that there are two lengths (285 and 288 bp) in the five species. The intergenic spacer between groES and groEL appears to be a unique marker for species, with a variable size (ranging from 111 to 310 bp) and sequence. Phylogenetic analysis of groES and groEL separated the eight serotypes into two major clusters. Strains of serotypes b, c, e and f were highly related and had groES gene sequences of the same length, 288 bp, while strains of serotypes a, d, g and h were also closely related and their groES gene sequence lengths were 285 bp. The groESL sequences in clinical isolates of three serotypes of S. mutans were analysed for intraspecies polymorphism. The results showed that the groESL sequences could provide information for differentiation among species, but were unable to distinguish serotypes of the same species. Based on the determined sequences, a PCR assay was developed that could differentiate members of the mutans streptococci by amplicon size and provide an alternative way for distinguishing mutans streptococci from other viridans streptococci.

Complete genome sequence of a genotype XVII Newcastle disease virus, isolated from an apparently healthy domestic duck in Nigeria

USDA-ARS?s Scientific Manuscript database

The first complete genome sequence of a strain of Newcastle disease virus (NDV) of genotype XVII is described here. A velogenic strain (duck/Nigeria/903/KUDU-113/1992) was isolated from an apparently healthy free-roaming domestic duck sampled in Kuru, Nigeria, in 1992. Phylogenetic analysis of the f...

Genome Sequence of Gammaproteobacterial Pseudohaliea rubra Type Strain DSM 19751, Isolated from Coastal Seawater of the Mediterranean Sea

PubMed Central

Fiebig, Anne; Riedel, Thomas; Göker, Markus; Klenk, Hans-Peter

2014-01-01

Pseudohaliea rubra strain DSM 19751T is an aerobic marine gammaproteobacterium that was isolated from surface coastal seawater of the Mediterranean Sea. Here, we present its genome sequence and annotation. Genome analysis revealed the presence of genes involved in the synthesis of bacteriochlorophyll-a and the reserve compound glycogen. PMID:25414506

Novel nonsense mutation in the katA gene of a catalase-negative Staphylococcus aureus strain.

PubMed

Lagos, Jaime; Alarcón, Pedro; Benadof, Dona; Ulloa, Soledad; Fasce, Rodrigo; Tognarelli, Javier; Aguayo, Carolina; Araya, Pamela; Parra, Bárbara; Olivares, Berta; Hormazábal, Juan Carlos; Fernández, Jorge

2016-01-01

We report the first description of a rare catalase-negative strain of Staphylococcus aureus in Chile. This new variant was isolated from blood and synovial tissue samples of a pediatric patient. Sequencing analysis revealed that this catalase-negative strain is related to ST10 strain, which has earlier been described in relation to S. aureus carriers. Interestingly, sequence analysis of the catalase gene katA revealed presence of a novel nonsense mutation that causes premature translational truncation of the C-terminus of the enzyme leading to a loss of 222 amino acids. Our study suggests that loss of catalase activity in this rare catalase-negative Chilean strain is due to this novel nonsense mutation in the katA gene, which truncates the enzyme to just 283 amino acids. Copyright © 2015 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

DNA-DNA hybridization values and their relationship to whole-genome sequence similarities.

PubMed

Goris, Johan; Konstantinidis, Konstantinos T; Klappenbach, Joel A; Coenye, Tom; Vandamme, Peter; Tiedje, James M

2007-01-01

DNA-DNA hybridization (DDH) values have been used by bacterial taxonomists since the 1960s to determine relatedness between strains and are still the most important criterion in the delineation of bacterial species. Since the extent of hybridization between a pair of strains is ultimately governed by their respective genomic sequences, we examined the quantitative relationship between DDH values and genome sequence-derived parameters, such as the average nucleotide identity (ANI) of common genes and the percentage of conserved DNA. A total of 124 DDH values were determined for 28 strains for which genome sequences were available. The strains belong to six important and diverse groups of bacteria for which the intra-group 16S rRNA gene sequence identity was greater than 94 %. The results revealed a close relationship between DDH values and ANI and between DNA-DNA hybridization and the percentage of conserved DNA for each pair of strains. The recommended cut-off point of 70 % DDH for species delineation corresponded to 95 % ANI and 69 % conserved DNA. When the analysis was restricted to the protein-coding portion of the genome, 70 % DDH corresponded to 85 % conserved genes for a pair of strains. These results reveal extensive gene diversity within the current concept of "species". Examination of reciprocal values indicated that the level of experimental error associated with the DDH method is too high to reveal the subtle differences in genome size among the strains sampled. It is concluded that ANI can accurately replace DDH values for strains for which genome sequences are available.

Draft genome sequence for virulent and avirulent strains of Xanthomonas arboricola isolated from Prunus spp. in Spain.

PubMed

Garita-Cambronero, Jerson; Palacio-Bielsa, Ana; López, María M; Cubero, Jaime

2016-01-01

Xanthomonas arboricola is a species in genus Xanthomonas which is mainly comprised of plant pathogens. Among the members of this taxon, X. arboricola pv. pruni, the causal agent of bacterial spot disease of stone fruits and almond, is distributed worldwide although it is considered a quarantine pathogen in the European Union. Herein, we report the draft genome sequence, the classification, the annotation and the sequence analyses of a virulent strain, IVIA 2626.1, and an avirulent strain, CITA 44, of X. arboricola associated with Prunus spp. The draft genome sequence of IVIA 2626.1 consists of 5,027,671 bp, 4,720 protein coding genes and 50 RNA encoding genes. The draft genome sequence of strain CITA 44 consists of 4,760,482 bp, 4,250 protein coding genes and 56 RNA coding genes. Initial comparative analyses reveals differences in the presence of structural and regulatory components of the type IV pilus, the type III secretion system, the type III effectors as well as variations in the number of the type IV secretion systems. The genome sequence data for these strains will facilitate the development of molecular diagnostics protocols that differentiate virulent and avirulent strains. In addition, comparative genome analysis will provide insights into the plant-pathogen interaction during the bacterial spot disease process.

Muricauda antarctica sp. nov., a marine member of the Flavobacteriaceae isolated from Antarctic seawater.

PubMed

Wu, Yue-Hong; Yu, Pei-Song; Zhou, Ya-Dong; Xu, Lin; Wang, Chun-Sheng; Wu, Min; Oren, Aharon; Xu, Xue-Wei

2013-09-01

A Gram-stain-negative, rod-shaped bacterium with appendages, designated Ar-22(T), was isolated from a seawater sample collected from the western part of Prydz Bay, near Cape Darnley, Antarctica. Strain Ar-22(T) grew optimally at 35 °C, at pH 7.5 and in the presence of 1-3% (w/v) NaCl. The isolate was positive for casein, gelatin and Tween 20 decomposition and negative for H2S production and indole formation. Chemotaxonomic analysis showed that MK-6 was the major isoprenoid quinone and phosphatidylethanolamine was the major polar lipid. The major fatty acids were iso-C(17:0) 3-OH, iso-C(15:1) G, iso-C(15:0) and C(16:1)ω7c/iso-C(15:0) 2OH. The genomic DNA G+C content was 44.8 mol%. Comparative 16S rRNA gene sequence analysis revealed that strain Ar-22(T) is closely related to members of the genus Muricauda, sharing 94.2-97.3% sequence similarity with the type strains of species of the genus Muricauda and being most closely related to the Muricauda aquimarina. Phylogenetic analysis based on the 16S rRNA gene sequence comparison confirmed that strain Ar-22(T) formed a deep lineage with Muricauda flavescens. Sequence similarity between strain Ar-22(T) and Muricauda ruestringensis DSM 13258(T), the type species of the genus Muricauda, was 96.9%. Strain Ar-22(T) exhibited mean DNA-DNA relatedness values of 40.1%, 49.4% and 25.7% to M. aquimarina JCM 11811(T), M. flavescens JCM 11812(T) and Muricauda lutimaris KCTC 22173(T), respectively. On the basis of phenotypic and genotypic data, strain Ar-22(T) represents a novel species of the genus Muricauda, for which the name Muricauda antarctica sp. nov. (type strain Ar-22(T) =CGMCC 1.12174(T) = JCM 18450(T)) is proposed.

Genomic and Genetic Diversity within the Pseudomonas fluorescens Complex

PubMed Central

Garrido-Sanz, Daniel; Meier-Kolthoff, Jan P.; Göker, Markus; Martín, Marta; Rivilla, Rafael; Redondo-Nieto, Miguel

2016-01-01

The Pseudomonas fluorescens complex includes Pseudomonas strains that have been taxonomically assigned to more than fifty different species, many of which have been described as plant growth-promoting rhizobacteria (PGPR) with potential applications in biocontrol and biofertilization. So far the phylogeny of this complex has been analyzed according to phenotypic traits, 16S rDNA, MLSA and inferred by whole-genome analysis. However, since most of the type strains have not been fully sequenced and new species are frequently described, correlation between taxonomy and phylogenomic analysis is missing. In recent years, the genomes of a large number of strains have been sequenced, showing important genomic heterogeneity and providing information suitable for genomic studies that are important to understand the genomic and genetic diversity shown by strains of this complex. Based on MLSA and several whole-genome sequence-based analyses of 93 sequenced strains, we have divided the P. fluorescens complex into eight phylogenomic groups that agree with previous works based on type strains. Digital DDH (dDDH) identified 69 species and 75 subspecies within the 93 genomes. The eight groups corresponded to clustering with a threshold of 31.8% dDDH, in full agreement with our MLSA. The Average Nucleotide Identity (ANI) approach showed inconsistencies regarding the assignment to species and to the eight groups. The small core genome of 1,334 CDSs and the large pan-genome of 30,848 CDSs, show the large diversity and genetic heterogeneity of the P. fluorescens complex. However, a low number of strains were enough to explain most of the CDSs diversity at core and strain-specific genomic fractions. Finally, the identification and analysis of group-specific genome and the screening for distinctive characters revealed a phylogenomic distribution of traits among the groups that provided insights into biocontrol and bioremediation applications as well as their role as PGPR. PMID:26915094

Correcting names of bacteria deposited in National Microbial Repositories: an analysed sequence data necessary for taxonomic re-categorization of misclassified bacteria-ONE example, genus Lysinibacillus.

PubMed

Rekadwad, Bhagwan N; Gonzalez, Juan M

2017-08-01

A report on 16S rRNA gene sequence re-analysis and digitalization is presented using Lysinibacillus species (one example) deposited in National Microbial Repositories in India. Lysinibacillus species 16S rRNA gene sequences were digitalized to provide quick response (QR) codes, Chaose Game Representation (CGR) and Frequency of Chaose Game Representation (FCGR). GC percentage, phylogenetic analysis, and principal component analysis (PCA) are tools used for the differentiation and reclassification of the strains under investigation. The seven reasons supporting the statements made by us as misclassified Lysinibacillus species deposited in National Microbial Depositories are given in this paper. Based on seven reasons, bacteria deposited in National Microbial Repositories such as Lysinibacillus and many other needs reanalyses for their exact identity. Leaves of identity with type strains of related species shows difference 2 to 8 % suggesting that reclassification is needed to correctly assign species names to the analyzed Lysinibacillus strains available in National Microbial Repositories.

Sequencing of emerging canine distemper virus strain reveals new distinct genetic lineage in the United States associated with disease in wildlife and domestic canine populations.

PubMed

Riley, Matthew C; Wilkes, Rebecca P

2015-12-18

Recent outbreaks of canine distemper have prompted examination of strains from clinical samples submitted to the University of Tennessee College of Veterinary Medicine (UTCVM) Clinical Virology Lab. We previously described a new strain of CDV that significantly diverged from all genotypes reported to date including America 2, the genotype proposed to be the main lineage currently circulating in the US. The aim of this study was to determine when this new strain appeared and how widespread it is in animal populations, given that it has also been detected in fully vaccinated adult dogs. Additionally, we sequenced complete viral genomes to characterize the strain and determine if variation is confined to known variable regions of the genome or if the changes are also present in more conserved regions. Archived clinical samples were genotyped using real-time RT-PCR amplification and sequencing. The genomes of two unrelated viruses from a dog and fox each from a different state were sequenced and aligned with previously published genomes. Phylogenetic analysis was performed using coding, non-coding and genome-length sequences. Virus neutralization assays were used to evaluate potential antigenic differences between this strain and a vaccine strain and mixed ANOVA test was used to compare the titers. Genotyping revealed this strain first appeared in 2011 and was detected in dogs from multiple states in the Southeast region of the United States. It was the main strain detected among the clinical samples that were typed from 2011-2013, including wildlife submissions. Genome sequencing demonstrated that it is highly conserved within a new lineage and preliminary serologic testing showed significant differences in neutralizing antibody titers between this strain and the strain commonly used in vaccines. This new strain represents an emerging CDV in domestic dogs in the US, may be associated with a stable reservoir in the wildlife population, and could facilitate vaccine escape.

Whole-Genome Sequence Analysis of Streptococcus pneumoniae Strains That Cause Hospital-Acquired Pneumonia Infections.

PubMed

Chang, Bin; Morita, Masatomo; Lee, Ken-Ichi; Ohnishi, Makoto

2018-05-01

Streptococcus pneumoniae colonizes the nasopharyngeal mucus in healthy individuals and can cause otitis media, pneumonia, and invasive pneumococcal diseases. In this study, we analyzed S. pneumoniae strains that caused 19 pneumonia episodes in long-term inpatients with severe underlying disease in a hospital during a period of 14 months (from January 2014 to February 2015). Serotyping and whole-genome sequencing analyses revealed that 18 of the 19 pneumonia cases were caused by S. pneumoniae strains belonging to 3 genetically distinct groups: clonal complex 9999 (CC9999), sequence type 282 (ST282), and ST166. The CC9999 and ST282 strains appeared to have emerged separately by a capsule switch from the pandemic PMEN 1 strain (Spain 23F -ST81). After all the long-term inpatients were inoculated with the 23-valent pneumococcal polysaccharide vaccine, no other nosocomial pneumonia infections occurred until March 2016. Copyright © 2018 American Society for Microbiology.

Deep sequencing revealed genome-wide single-nucleotide polymorphism and plasmid content of Erwinia amylovora strains isolated in Middle Atlas, Morocco.

PubMed

Hannou, Najat; Mondy, Samuel; Planamente, Sara; Moumni, Mohieddine; Llop, Pablo; López, María; Manceau, Charles; Barny, Marie-Anne; Faure, Denis

2013-10-01

Erwinia amylovora causes economic losses that affect pear and apple production in Morocco. Here, we report comparative genomics of four Moroccan E. amylovora strains with the European strain CFBP1430 and North-American strain ATCC49946. Analysis of single nucleotide polymorphisms (SNPs) revealed genetic homogeneity of Moroccan's strains and their proximity to the European strain CFBP1430. Moreover, the collected sequences allowed the assembly of a 65 kpb plasmid, which is highly similar to the plasmid pEI70 harbored by several European E. amylovora isolates. This plasmid was found in 33% of the 40 E. amylovora strains collected from several host plants in 2009 and 2010 in Morocco. Copyright © 2013 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Genetic Analysis of Vibrio parahaemolyticus O3:K6 Strains That Have Been Isolated in Mexico Since 1998

PubMed Central

Licea-Navarro, Alexei Fedorovish; Revilla-Castellanos, Valeria Jeanette; Wong-Chang, Irma; González-Sánchez, Ricardo

2017-01-01

Vibrio parahaemolyticus is an important human pathogen that has been isolated worldwide from clinical cases, most of which have been associated with seafood consumption. Environmental and clinical toxigenic strains of V. parahaemolyticus that were isolated in Mexico from 1998 to 2012, including those from the only outbreak that has been reported in this country, were characterized genetically to assess the presence of the O3:K6 pandemic clone, and their genetic relationship to strains that are related to the pandemic clonal complex (CC3). Pathogenic tdh+ and tdh+/trh+ strains were analyzed by pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Also, the entire genome of a Mexican O3:K6 strain was sequenced. Most of the strains were tdh/ORF8-positive and corresponded to the O3:K6 serotype. By PFGE and MLST, there was very close genetic relationship between ORF8/O3:K6 strains, and very high genetic diversities from non-pandemic strains. The genetic relationship is very close among O3:K6 strains that were isolated in Mexico and sequences that were available for strains in the CC3, based on the PubMLST database. The whole-genome sequence of CICESE-170 strain had high similarity with that of the reference RIMD 2210633 strain, and harbored 7 pathogenicity islands, including the 4 that denote O3:K6 pandemic strains. These results indicate that pandemic strains that have been isolated in Mexico show very close genetic relationship among them and with those isolated worldwide. PMID:28099500

Molecular and Biochemical Analysis of the Galactose Phenotype of Dairy Streptococcus thermophilus Strains Reveals Four Different Fermentation Profiles

PubMed Central

de Vin, Filip; Rådström, Peter; Herman, Lieve; De Vuyst, Luc

2005-01-01

Lactose-limited fermentations of 49 dairy Streptococcus thermophilus strains revealed four distinct fermentation profiles with respect to galactose consumption after lactose depletion. All the strains excreted galactose into the medium during growth on lactose, except for strain IMDOST40, which also displayed extremely high galactokinase (GalK) activity. Among this strain collection eight galactose-positive phenotypes sensu stricto were found and their fermentation characteristics and Leloir enzyme activities were measured. As the gal promoter seems to play an important role in the galactose phenotype, the galR-galK intergenic region was sequenced for all strains yielding eight different nucleotide sequences (NS1 to NS8). The gal promoter played an important role in the Gal-positive phenotype but did not determine it exclusively. Although GalT and GalE activities were detected for all Gal-positive strains, GalK activity could only be detected for two out of eight Gal-positive strains. This finding suggests that the other six S. thermophilus strains metabolize galactose via an alternative route. For each type of fermentation profile obtained, a representative strain was chosen and four complete Leloir gene clusters were sequenced. It turned out that Gal-positive strains contained more amino acid differences within their gal genes than Gal-negative strains. Finally, the biodiversity regarding lactose-galactose utilization among the different S. thermophilus strains used in this study was shown by RAPD-PCR. Five Gal-positive strains that contain nucleotide sequence NS2 in their galR-galK intergenic region were closely related. PMID:16000774

Analysis of intra-host genetic diversity of Prunus necrotic ringspot virus (PNRSV) using amplicon next generation sequencing

PubMed Central

Constable, Fiona E.; Nancarrow, Narelle; Plummer, Kim M.; Rodoni, Brendan

2017-01-01

PCR amplicon next generation sequencing (NGS) analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV) from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored. PMID:28632759

Production of haemolysins by strains of the Actinobacillus minor/"porcitonsillarum" complex.

PubMed

Arya, Gitanjali; Niven, Donald F

2010-03-24

Actinobacillus minor and "Actinobacillus porcitonsillarum" are distinguished by their haemolytic activities, the latter organism being haemolytic and the former, non-haemolytic. Analysis of a whole genome shotgun sequence, however, revealed that A. minor strain 202, like "A. porcitonsillarum", possesses a haemolysin-encoding apxII operon. The purpose of this study was therefore to investigate haemolysin production by this organism and also by three additional members of the A. minor/"porcitonsillarum" complex, strains 33PN and 7ATS and A. minor strain NM305(T). Primers based on sequences within the apxII genes of strain 202 allowed the amplification of appropriately sized fragments from DNA from strain 33PN suggesting that this organism also possesses an apxII operon. Analysis of a whole genome shotgun sequence failed to reveal any trace of an apxII operon in strain NM305(T) and attempts to amplify apxII genes from DNA from strain 7ATS also failed. Strains 202 and 33PN, and surprisingly, the type strain of A. minor and strain 7ATS, were all found to be haemolysin-positive as growth media from cultures of these organisms could promote the lysis of erythrocytes in suspension. The erythrocyte specificities of the haemolysins produced by strains 202 and 33PN indicated that the haemolytic activities exhibited by these organisms were due to ApxII. In keeping with the apparent lack of apxII genes in strains NM305(T) and 7ATS, the haemolysins produced by these organisms were not erythrocyte-specific and with both organisms, haemolytic activity appeared to be due to a combination of heat-stable and heat-labile components. The identities of these components, however, remain unknown. Copyright 2009 Elsevier B.V. All rights reserved.

Genome Sequencing and Comparative Analysis of Saccharomyces cerevisiae Strains of the Peterhof Genetic Collection

PubMed Central

Drozdova, Polina B.; Tarasov, Oleg V.; Matveenko, Andrew G.; Radchenko, Elina A.; Sopova, Julia V.; Polev, Dmitrii E.; Inge-Vechtomov, Sergey G.; Dobrynin, Pavel V.

2016-01-01

The Peterhof genetic collection of Saccharomyces cerevisiae strains (PGC) is a large laboratory stock that has accumulated several thousands of strains for over than half a century. It originated independently of other common laboratory stocks from a distillery lineage (race XII). Several PGC strains have been extensively used in certain fields of yeast research but their genomes have not been thoroughly explored yet. Here we employed whole genome sequencing to characterize five selected PGC strains including one of the closest to the progenitor, 15V-P4, and several strains that have been used to study translation termination and prions in yeast (25-25-2V-P3982, 1B-D1606, 74-D694, and 6P-33G-D373). The genetic distance between the PGC progenitor and S288C is comparable to that between two geographically isolated populations. The PGC seems to be closer to two bakery strains than to S288C-related laboratory stocks or European wine strains. In genomes of the PGC strains, we found several loci which are absent from the S288C genome; 15V-P4 harbors a rare combination of the gene cluster characteristic for wine strains and the RTM1 cluster. We closely examined known and previously uncharacterized gene variants of particular strains and were able to establish the molecular basis for known phenotypes including phenylalanine auxotrophy, clumping behavior and galactose utilization. Finally, we made sequencing data and results of the analysis available for the yeast community. Our data widen the knowledge about genetic variation between Saccharomyces cerevisiae strains and can form the basis for planning future work in PGC-related strains and with PGC-derived alleles. PMID:27152522

Whole genome phylogenetic investigation of a West Nile virus strain isolated from a tick sampled from livestock in north eastern Kenya.

PubMed

Lwande, Olivia Wesula; Venter, Marietjie; Lutomiah, Joel; Michuki, George; Rumberia, Cecilia; Gakuya, Francis; Obanda, Vincent; Tigoi, Caroline; Odhiambo, Collins; Nindo, Fredrick; Symekher, Samwel; Sang, Rosemary

2014-11-28

West Nile virus (WNV) has a wide geographical distribution and has been associated to cause neurological disease in humans and horses. Mosquitoes are the traditional vectors for WNV; however, the virus has also been isolated from tick species in North Africa and Europe which could be a means of introduction and spread of the virus over long distances through migratory birds. Although WNV has been isolated in mosquitoes in Kenya, paucity of genetic and pathogenicity data exists. We previously reported the isolation of WNV from ticks collected from livestock and wildlife in Ijara District of Kenya, a hotspot for arbovirus activity. Here we report the full genome sequence and phylogenetic investigation of their origin and relation to strains from other regions. A total of 10,488 ticks were sampled from animal hosts, classified to species and processed in pools of up to eight ticks per pool. Virus screening was performed by cell culture, RT-PCR and sequencing. Phylogenetic analysis was carried out to determine the evolutionary relationships of our isolate. Among other viruses, WNV was isolated from a pool of Rhipicephalus pulchellus sampled from cattle, sequenced and submitted to GenBank (Accession number: KC243146). Comparative analysis with 27 different strains revealed that our isolate belongs to lineage 1 and clustered relatively closely to isolates from North Africa and Europe, Russia and the United States. Overall, Bayesian analysis based on nucleotide sequences showed that lineage 1 strains including the Kenyan strain had diverged 200 years ago from lineage 2 strains of southern Africa. Ijara strain collected from a tick sampled on livestock was closest to another Kenyan strain and had diverged 20 years ago from strains detected in Morocco and Europe and 30 years ago from strains identified in the USA. To our knowledge, this is the first characterized WNV strain isolated from R. pulchellus. The epidemiological role of this tick in WNV transmission and dissemination remains equivocal but presents tick verses mosquito virus transmission has been neglected. Genetic data of this strain suggest that lineage 1 strains from Africa could be dispersed through tick vectors by wild migratory birds to Europe and beyond.

Flagellin diversity in Clostridium botulinum groups I and II: a new strategy for strain identification.

PubMed

Paul, Catherine J; Twine, Susan M; Tam, Kevin J; Mullen, James A; Kelly, John F; Austin, John W; Logan, Susan M

2007-05-01

Strains of Clostridium botulinum are traditionally identified by botulinum neurotoxin type; however, identification of an additional target for typing would improve differentiation. Isolation of flagellar filaments and analysis by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) showed that C. botulinum produced multiple flagellin proteins. Nano-liquid chromatography-tandem mass spectrometry (nLC-MS/MS) analysis of in-gel tryptic digests identified peptides in all flagellin bands that matched two homologous tandem flagellin genes identified in the C. botulinum Hall A genome. Designated flaA1 and flaA2, these open reading frames encode the major structural flagellins of C. botulinum. Colony PCR and sequencing of flaA1/A2 variable regions classified 80 environmental and clinical strains into group I or group II and clustered isolates into 12 flagellar types. Flagellar type was distinct from neurotoxin type, and epidemiologically related isolates clustered together. Sequencing a larger PCR product, obtained during amplification of flaA1/A2 from type E strain Bennett identified a second flagellin gene, flaB. LC-MS analysis confirmed that flaB encoded a large type E-specific flagellin protein, and the predicted molecular mass for FlaB matched that observed by SDS-PAGE. In contrast, the molecular mass of FlaA was 2 to 12 kDa larger than the mass predicted by the flaA1/A2 sequence of a given strain, suggesting that FlaA is posttranslationally modified. While identification of FlaB, and the observation by SDS-PAGE of different masses of the FlaA proteins, showed the flagellin proteins of C. botulinum to be diverse, the presence of the flaA1/A2 gene in all strains examined facilitates single locus sequence typing of C. botulinum using the flagellin variable region.

aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species.

PubMed

Lescat, Mathilde; Hoede, Claire; Clermont, Olivier; Garry, Louis; Darlu, Pierre; Tuffery, Pierre; Denamur, Erick; Picard, Bertrand

2009-12-29

Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. We identified the gene encoding esterase B as the acetyl-esterase gene (aes) using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR) strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

Ruminococcus champanellensis sp. nov., a cellulose-degrading bacterium from human gut microbiota.

PubMed

Chassard, Christophe; Delmas, Eve; Robert, Céline; Lawson, Paul A; Bernalier-Donadille, Annick

2012-01-01

A strictly anaerobic, cellulolytic strain, designated 18P13(T), was isolated from a human faecal sample. Cells were Gram-positive non-motile cocci. Strain 18P13(T) was able to degrade microcrystalline cellulose but the utilization of soluble sugars was restricted to cellobiose. Acetate and succinate were the major end products of cellulose and cellobiose fermentation. 16S rRNA gene sequence analysis revealed that the isolate belonged to the genus Ruminococcus of the family Ruminococcaceae. The closest phylogenetic relative was the ruminal cellulolytic strain Ruminococcus flavefaciens ATCC 19208(T) (<95% 16S rRNA gene sequence similarity). The DNA G+C content of strain 18P13(T) was 53.05±0.7 mol%. On the basis of phylogenetic analysis, and morphological and physiological data, strain 18P13(T) can be differentiated from other members of the genus Ruminococcus with validly published names. The name Ruminococcus champanellensis sp. nov. is proposed, with 18P13(T) (=DSM 18848(T)=JCM 17042(T)) as the type strain.

Verrucosispora sonchi sp. nov., a novel endophytic actinobacterium isolated from the leaves of common sowthistle (Sonchus oleraceus L.).

PubMed

Ma, Zhaoxu; Zhao, Shanshan; Cao, Tingting; Liu, Chongxi; Huang, Ying; Gao, Yuhang; Yan, Kai; Xiang, Wensheng; Wang, Xiangjing

2016-12-01

A novel actinobacterium, designated strain NEAU-QY3T, was isolated from the leaves of Sonchus oleraceus L. and examined using a polyphasic taxonomic approach. The organism formed single spores with smooth surface on substrate mycelia. Phylogenetic analysis based on the 16S rRNA gene sequence indicated that the strain had a close association with the genus Verrucosispora and shared the highest sequence similarity with Verrucosispora qiuiae RtIII47T (99.17 %), an association that was supported by a bootstrap value of 94 % in the neighbour-joining tree and also recovered with the maximum-likelihood algorithm. The strain also showed high 16S rRNA gene sequence similarities to Xiangella phaseoli NEAU-J5T (98.78 %), Jishengella endophytica 202201T (98.51 %), Micromonospora eburnea LK2-10T (98.28 %), Verrucosispora lutea YIM 013T (98.23 %) and Salinispora pacifica CNR-114T (98.23 %). Furthermore, phylogenetic analysis based on the gyrB gene sequences supported the conclusion that strain NEAU-QY3T should be assigned to the genus Verrucosispora. However, the DNA-DNA hybridization relatedness values between strain NEAU-QY3T and V. qiuiae RtIII47T and V. lutea YIM 013T were below 70 %. With reference to phenotypic characteristics, phylogenetic data and DNA-DNA hybridization results, strain NEAU-QY3T was readily distinguished from its most closely related strains and classified as a new species, for which the name Verrucosispora sonchi sp. nov. is proposed. The type strain is NEAU-QY3T (=CGMCC 4.7312T=DSM 101530T).

Draft genome sequence of Escherichia coli ST977: A clinical multidrug-resistant strain harbouring blaNDM-3 isolated from a bloodstream infection.

PubMed

Li, Xi; Sun, Long; Zhu, Yongze; Shen, Mengyuan; Tu, Yuexing

2018-04-14

The emergence of carbapenem-resistant Escherichia coli has become a serious challenge to manage in the clinic because of multidrug resistance. Here we report the draft genome sequence of NDM-3-producing E. coli strain NT1 isolated from a bloodstream infection in China. Whole genomic DNA of E. coli strain NT1 was extracted and was sequenced using an Illumina HiSeq™ X Ten platform. The generated sequence reads were assembled using CLC Genomics Workbench. The draft genome was annotated using Rapid Annotation using Subsystem Technology (RAST). Bioinformatics analysis was further performed. The genome size was calculated at 5,353 620bp, with 5297 protein-coding sequences and the presence of genes conferring resistance to aminoglycosides, β-lactams, quinolones, macrolides, phenicols, sulphonamides, tetracycline and trimethoprim. In addition, genes encoding virulence factors were also identified. To our knowledge, this is the first report of an E. coli strain producing NDM-3 isolated from a human bloodstream infection. The genome sequence will provide valuable information to understand antibiotic resistance mechanisms and pathogenic mechanisms in this strain. Close surveillance is urgently needed to monitor the spread of NDM-3-producing isolates. Copyright © 2018 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

Genotyping of ancient Mycobacterium tuberculosis strains reveals historic genetic diversity.

PubMed

Müller, Romy; Roberts, Charlotte A; Brown, Terence A

2014-04-22

The evolutionary history of the Mycobacterium tuberculosis complex (MTBC) has previously been studied by analysis of sequence diversity in extant strains, but not addressed by direct examination of strain genotypes in archaeological remains. Here, we use ancient DNA sequencing to type 11 single nucleotide polymorphisms and two large sequence polymorphisms in the MTBC strains present in 10 archaeological samples from skeletons from Britain and Europe dating to the second-nineteenth centuries AD. The results enable us to assign the strains to groupings and lineages recognized in the extant MTBC. We show that at least during the eighteenth-nineteenth centuries AD, strains of M. tuberculosis belonging to different genetic groups were present in Britain at the same time, possibly even at a single location, and we present evidence for a mixed infection in at least one individual. Our study shows that ancient DNA typing applied to multiple samples can provide sufficiently detailed information to contribute to both archaeological and evolutionary knowledge of the history of tuberculosis.

Lactobacillus allii sp. nov. isolated from scallion kimchi.

PubMed

Jung, Min Young; Lee, Se Hee; Lee, Moeun; Song, Jung Hee; Chang, Ji Yoon

2017-12-01

A novel strain of lactic acid bacteria, WiKim39 T , was isolated from a scallion kimchi sample consisting of fermented chili peppers and vegetables. The isolate was a Gram-positive, rod-shaped, non-motile, catalase-negative and facultatively anaerobic lactic acid bacterium. Phylogenetic analysis of the 16S rRNA gene sequence showed that strain WiKim39 T belonged to the genus Lactobacillus, and shared 97.1-98.2 % pair-wise sequence similarities with related type strains, Lactobacillus nodensis, Lactobacillus insicii, Lactobacillus versmoldensis, Lactobacillus tucceti and Lactobacillus furfuricola. The G+C content of the strain based on its genome sequence was 35.3 mol%. The ANI values between WiKim39 T and the closest relatives were lower than 80 %. Based on the phenotypic, biochemical, and phylogenetic analyses, strain WiKim39 T represents a novel species of the genus Lactobacillus, for which the name Lactobacillus allii sp. nov. is proposed. The type strain is WiKim39 T (=KCTC 21077 T =JCM 31938 T ).

Lactobacillus allii sp. nov. isolated from scallion kimchi

PubMed Central

Jung, Min Young; Lee, Se Hee; Lee, Moeun; Song, Jung Hee; Chang, Ji Yoon

2017-01-01

A novel strain of lactic acid bacteria, WiKim39T, was isolated from a scallion kimchi sample consisting of fermented chili peppers and vegetables. The isolate was a Gram-positive, rod-shaped, non-motile, catalase-negative and facultatively anaerobic lactic acid bacterium. Phylogenetic analysis of the 16S rRNA gene sequence showed that strain WiKim39T belonged to the genus Lactobacillus, and shared 97.1–98.2 % pair-wise sequence similarities with related type strains, Lactobacillus nodensis, Lactobacillus insicii, Lactobacillus versmoldensis, Lactobacillus tucceti and Lactobacillus furfuricola. The G+C content of the strain based on its genome sequence was 35.3 mol%. The ANI values between WiKim39T and the closest relatives were lower than 80 %. Based on the phenotypic, biochemical, and phylogenetic analyses, strain WiKim39T represents a novel species of the genus Lactobacillus, for which the name Lactobacillus allii sp. nov. is proposed. The type strain is WiKim39T (=KCTC 21077T=JCM 31938T). PMID:29043955

Chromosome evolution in the Thermotogales: large-scale inversions and strain diversification of CRISPR sequences.

PubMed

DeBoy, Robert T; Mongodin, Emmanuel F; Emerson, Joanne B; Nelson, Karen E

2006-04-01

In the present study, the chromosomes of two members of the Thermotogales were compared. A whole-genome alignment of Thermotoga maritima MSB8 and Thermotoga neapolitana NS-E has revealed numerous large-scale DNA rearrangements, most of which are associated with CRISPR DNA repeats and/or tRNA genes. These DNA rearrangements do not include the putative origin of DNA replication but move within the same replichore, i.e., the same replicating half of the chromosome (delimited by the replication origin and terminus). Based on cumulative GC skew analysis, both the T. maritima and T. neapolitana lineages contain one or two major inverted DNA segments. Also, based on PCR amplification and sequence analysis of the DNA joints that are associated with the major rearrangements, the overall chromosome architecture was found to be conserved at most DNA joints for other strains of T. neapolitana. Taken together, the results from this analysis suggest that the observed chromosomal rearrangements in the Thermotogales likely occurred by successive inversions after their divergence from a common ancestor and before strain diversification. Finally, sequence analysis shows that size polymorphisms in the DNA joints associated with CRISPRs can be explained by expansion and possibly contraction of the DNA repeat and spacer unit, providing a tool for discerning the relatedness of strains from different geographic locations.

Veillonella infantium sp. nov., an anaerobic, Gram-stain-negative coccus isolated from tongue biofilm of a Thai child.

PubMed

Mashima, Izumi; Liao, Yu-Chieh; Miyakawa, Hiroshi; Theodorea, Citra F; Thawboon, Boonyanit; Thaweboon, Sroisiri; Scannapieco, Frank A; Nakazawa, Futoshi

2018-04-01

A strain of a novel anaerobic, Gram-stain-negative coccus was isolated from the tongue biofilm of a Thai child. This strain was shown, at the phenotypic level and based on 16S rRNA gene sequencing, to be a member of the genus Veillonella. Comparative analysis of the 16S rRNA, dnaK and rpoB gene sequences indicated that phylogenetically the strain comprised a distinct novel branch within the genus Veillonella. The novel strain showed 99.8, 95.1 and 95.9 % similarity to partial 16S rRNA, dnaK and rpoB gene sequences, respectively, to the type strains of the two most closely related species, Veillonelladispar ATCC 17748 T and Veillonellatobetsuensis ATCC BAA-2400 T . The novel strain could be discriminated from previously reported species of the genus Veillonella based on partial dnaK and rpoB gene sequencing and average nucleotide identity values. The major acid end-product produced by this strain was acetic acid under anaerobic conditions in trypticase-yeast extract-haemin with 1 % (w/v) glucose or fructose medium. Lactate was fermented to acetic acid and propionic acid. Based on these observations, this strain represents a novel species, for which the name Veillonella infantium sp. nov. is proposed. The type strain is T11011-4 T (=JCM 31738 T =TSD-88 T ).

Molecular phylogenetic analysis of non-sexually transmitted strains of Haemophilus ducreyi.

PubMed

Gaston, Jordan R; Roberts, Sally A; Humphreys, Tricia L

2015-01-01

Haemophilus ducreyi, the etiologic agent of chancroid, has been previously reported to show genetic variance in several key virulence factors, placing strains of the bacterium into two genetically distinct classes. Recent studies done in yaws-endemic areas of the South Pacific have shown that H. ducreyi is also a major cause of cutaneous limb ulcers (CLU) that are not sexually transmitted. To genetically assess CLU strains relative to the previously described class I, class II phylogenetic hierarchy, we examined nucleotide sequence diversity at 11 H. ducreyi loci, including virulence and housekeeping genes, which encompass approximately 1% of the H. ducreyi genome. Sequences for all 11 loci indicated that strains collected from leg ulcers exhibit DNA sequences homologous to class I strains of H. ducreyi. However, sequences for 3 loci, including a hemoglobin receptor (hgbA), serum resistance protein (dsrA), and a collagen adhesin (ncaA) contained informative amounts of variation. Phylogenetic analyses suggest that these non-sexually transmitted strains of H. ducreyi comprise a sub-clonal population within class I strains of H. ducreyi. Molecular dating suggests that CLU strains are the most recently developed, having diverged approximately 0.355 million years ago, fourteen times more recently than the class I/class II divergence. The CLU strains' divergence falls after the divergence of humans from chimpanzees, making it the first known H. ducreyi divergence event directly influenced by the selective pressures accompanying human hosts.

Genetic Diversity among Clostridium botulinum Strains Harboring bont/A2 and bont/A3 Genes

PubMed Central

Raphael, Brian H.; Joseph, Lavin A.; Meno, Sarah R.; Fernández, Rafael A.; Maslanka, Susan E.

2012-01-01

Clostridium botulinum type A strains are known to be genetically diverse and widespread throughout the world. Genetic diversity studies have focused mainly on strains harboring one type A botulinum toxin gene, bont/A1, although all reported bont/A gene variants have been associated with botulism cases. Our study provides insight into the genetic diversity of C. botulinum type A strains, which contain bont/A2 (n = 42) and bont/A3 (n = 4) genes, isolated from diverse samples and geographic origins. Genetic diversity was assessed by using bont nucleotide sequencing, content analysis of the bont gene clusters, multilocus sequence typing (MLST), and pulsed-field gel electrophoresis (PFGE). Sequences of bont genes obtained in this study showed 99.9 to 100% identity with other bont/A2 or bont/A3 gene sequences available in public databases. The neurotoxin gene clusters of the subtype A2 and A3 strains analyzed in this study were similar in gene content. C. botulinum strains harboring bont/A2 and bont/A3 genes were divided into six and two MLST profiles, respectively. Four groups of strains shared a similarity of at least 95% by PFGE; the largest group included 21 out of 46 strains. The strains analyzed in this study showed relatively limited genetic diversity using either MLST or PFGE. PMID:23042179

Molecular and comparative analysis of Salmonella enterica Senftenberg from humans and animals using PFGE, MLST and NARMS

PubMed Central

2011-01-01

Background Salmonella species are recognized worldwide as a significant cause of human and animal disease. In this study the molecular profiles and characteristics of Salmonella enterica Senftenberg isolated from human cases of illness and those recovered from healthy or diagnostic cases in animals were assessed. Included in the study was a comparison with our own sequenced strain of S. Senfteberg recovered from production turkeys in North Dakota. Isolates examined in this study were subjected to antimicrobial susceptibility profiling using the National Antimicrobial Resistance Monitoring System (NARMS) panel which tested susceptibility to 15 different antimicrobial agents. The molecular profiles of all isolates were determined using Pulsed Field Gel Electrophoresis (PFGE) and the sequence types of the strains were obtained using Multi-Locus Sequence Type (MLST) analysis based on amplification and sequence interrogation of seven housekeeping genes (aroC, dnaN, hemD, hisD, purE, sucA, and thrA). PFGE data was input into BioNumerics analysis software to generate a dendrogram of relatedness among the strains. Results The study found 93 profiles among 98 S. Senftenberg isolates tested and there were primarily two sequence types associated with humans and animals (ST185 and ST14) with overlap observed in all host types suggesting that the distribution of S. Senftenberg sequence types is not host dependent. Antimicrobial resistance was observed among the animal strains, however no resistance was detected in human isolates suggesting that animal husbandry has a significant influence on the selection and promotion of antimicrobial resistance. Conclusion The data demonstrates the circulation of at least two strain types in both animal and human health suggesting that S. Senftenberg is relatively homogeneous in its distribution. The data generated in this study could be used towards defining a pathotype for this serovar. PMID:21708021

Complete genome sequencing and phylogenetic analysis of dengue type 1 virus isolated from Jeddah, Saudi Arabia.

PubMed

Azhar, Esam I; Hashem, Anwar M; El-Kafrawy, Sherif A; Abol-Ela, Said; Abd-Alla, Adly M M; Sohrab, Sayed Sartaj; Farraj, Suha A; Othman, Norah A; Ben-Helaby, Huda G; Ashshi, Ahmed; Madani, Tariq A; Jamjoom, Ghazi

2015-01-16

Dengue viruses (DENVs) are mosquito-borne viruses which can cause disease ranging from mild fever to severe dengue infection. These viruses are endemic in several tropical and subtropical regions. Multiple outbreaks of DENV serotypes 1, 2 and 3 (DENV-1, DENV-2 and DENV-3) have been reported from the western region in Saudi Arabia since 1994. Strains from at least two genotypes of DENV-1 (Asia and America/Africa genotypes) have been circulating in western Saudi Arabia until 2006. However, all previous studies reported from Saudi Arabia were based on partial sequencing data of the envelope (E) gene without any reports of full genome sequences for any DENV serotypes circulating in Saudi Arabia. Here, we report the isolation and the first complete genome sequence of a DENV-1 strain (DENV-1-Jeddah-1-2011) isolated from a patient from Jeddah, Saudi Arabia in 2011. Whole genome sequence alignment and phylogenetic analysis showed high similarity between DENV-1-Jeddah-1-2011 strain and D1/H/IMTSSA/98/606 isolate (Asian genotype) reported from Djibouti in 1998. Further analysis of the full envelope gene revealed a close relationship between DENV-1-Jeddah-1-2011 strain and isolates reported between 2004-2006 from Jeddah as well as recent isolates from Somalia, suggesting the widespread of the Asian genotype in this region. These data suggest that strains belonging to the Asian genotype might have been introduced into Saudi Arabia long before 2004 most probably by African pilgrims and continued to circulate in western Saudi Arabia at least until 2011. Most importantly, these results indicate that pilgrims from dengue endemic regions can play an important role in the spread of new DENVs in Saudi Arabia and the rest of the world. Therefore, availability of complete genome sequences would serve as a reference for future epidemiological studies of DENV-1 viruses.

Discrimination of the Lactobacillus acidophilus group using sequencing, species-specific PCR and SNaPshot mini-sequencing technology based on the recA gene.

PubMed

Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Mu-Chiou; Wang, Li-Tin; Huang, Lina; Lee, Fwu-Ling

2012-10-01

To clearly identify specific species and subspecies of the Lactobacillus acidophilus group using phenotypic and genotypic (16S rDNA sequence analysis) techniques alone is difficult. The aim of this study was to use the recA gene for species discrimination in the L. acidophilus group, as well as to develop a species-specific primer and single nucleotide polymorphism primer based on the recA gene sequence for species and subspecies identification. The average sequence similarity for the recA gene among type strains was 80.0%, and most members of the L. acidophilus group could be clearly distinguished. The species-specific primer was designed according to the recA gene sequencing, which was employed for polymerase chain reaction with the template DNA of Lactobacillus strains. A single 231-bp species-specific band was found only in L. delbrueckii. A SNaPshot mini-sequencing assay using recA as a target gene was also developed. The specificity of the mini-sequencing assay was evaluated using 31 strains of L. delbrueckii species and was able to unambiguously discriminate strains belonging to the subspecies L. delbrueckii subsp. bulgaricus. The phylogenetic relationships of most strains in the L. acidophilus group can be resolved using recA gene sequencing, and a novel method to identify the species and subspecies of the L. delbrueckii and L. delbrueckii subsp. bulgaricus was developed by species-specific polymerase chain reaction combined with SNaPshot mini-sequencing. Copyright © 2012 Society of Chemical Industry.

Multilocus sequence typing and virulence analysis of Haemophilus parasuis strains isolated in five provinces of China.

PubMed

Wang, Liyan; Ma, Lina; Liu, Yongan; Gao, Pengcheng; Li, Youquan; Li, Xuerui; Liu, Yongsheng

2016-10-01

Haemophilus parasuis is the etiological agent of Glässers disease, which causes high morbidity and mortality in swine herds. Although H. parasuis strains can be classified into 15 serovars with the Kielstein-Rapp-Gabrielson serotyping scheme, a large number of isolates cannot be classified and have been designated 'nontypeable' strains. In this study, multilocus sequence typing (MLST) of H. parasuis was used to analyze 48 H. parasuis field strains isolated in China and two strains from Australia. Twenty-six new alleles and 29 new sequence types (STs) were detected, enriching the H. parasuis MLST databases. A BURST analysis indicated that H. parasuis lacks stable population structure and is highly heterogeneous, and that there is no association between STs and geographic area. When an UPGMA dendrogram was constructed, two major clades, clade A and clade B, were defined. Animal experiments, in which guinea pigs were challenged intraperitoneally with the bacterial isolates, supported the hypothesis that the H. parasuis STs in clade A are generally avirulent or weakly virulent, whereas the STs in clade B tend to be virulent. Copyright © 2016 Elsevier B.V. All rights reserved.

Investigation of a Possible Link Between Vaccination and the 2010 Sheep Pox Epizootic in Morocco.

PubMed

Haegeman, A; Zro, K; Sammin, D; Vandenbussche, F; Ennaji, M M; De Clercq, K

2016-12-01

Sheep pox is endemic in most parts of Northern Africa and has the potential to cause severe economic problems. Live attenuated vaccines are used in Morocco, and in many other countries, to control the disease. Sheep pox virus (SPPV) re-appeared in 2010 causing a nodular clinical form previously not observed in Morocco. The severe clinical signs observed during the course of this outbreak and initial reports citing similarity in nucleotide sequence between the Moroccan vaccine strain and field isolates warranted a more in depth analysis of this epizootic. In this study, sequence analysis showed that isolates obtained from four provinces of eastern Morocco were identical, demonstrating that a single SPPV strain was responsible for the 2010 epizootic. In addition, the genome fragments sequenced and phylogenetic analyses undertaken as part of this study showed significant differences between field isolates and the Moroccan vaccine strain. New PCR methods were developed to differentiate between wild-type isolates and vaccine strains of SPPV. Using these methods, no trace of wild-type SPPV was found in the vaccine and no evidence was found to suggest that the vaccine strain was causing clinical disease. © 2015 Blackwell Verlag GmbH.

Analysis of the genomic sequences and metabolites of Serratia surfactantfaciens sp. nov. YD25T that simultaneously produces prodigiosin and serrawettin W2.

PubMed

Su, Chun; Xiang, Zhaoju; Liu, Yibo; Zhao, Xinqing; Sun, Yan; Li, Zhi; Li, Lijun; Chang, Fan; Chen, Tianjun; Wen, Xinrong; Zhou, Yidan; Zhao, Furong

2016-11-03

Gram-negative bacteria of the genus Serratia are potential producers of many useful secondary metabolites, such as prodigiosin and serrawettins, which have potential applications in environmental bioremediation or in the pharmaceutical industry. Several Serratia strains produce prodigiosin and serrawettin W1 as the main bioactive compounds, and the biosynthetic pathways are co-regulated by quorum sensing (QS). In contrast, the Serratia strain, which can simultaneously produce prodigiosin and serrawettin W2, has not been reported. This study focused on analyzing the genomic sequence of Serratia sp. strain YD25 T isolated from rhizosphere soil under continuously planted burley tobacco collected from Yongding, Fujian province, China, which is unique in producing both prodigiosin and serrawettin W2. A hybrid polyketide synthases (PKS)-non-ribosomal peptide synthetases (NRPS) gene cluster putatively involved in biosynthesis of antimicrobial serrawettin W2 was identified in the genome of YD25 T , and its biosynthesis pathway was proposed. We found potent antimicrobial activity of serrawettin W2 purified from YD25 T against various pathogenic bacteria and fungi as well as antitumor activity against Hela cells. Subsequently, comparative genomic analyses were performed among a total of 133 Serratia species. The prodigiosin biosynthesis gene cluster in YD25 T belongs to the type I pig cluster, which is the main form of pig-encoding genes existing in most of the pigmented Serratia species. In addition, a complete autoinducer-2 (AI-2) system (including luxS, lsrBACDEF, lsrGK, and lsrR) as a conserved bacterial operator is found in the genome of Serratia sp. strain YD25 T . Phylogenetic analysis based on concatenated Lsr and LuxS proteins revealed that YD25 T formed an independent branch and was clearly distant from the strains that solely produce either prodigiosin or serrawettin W2. The Fe (III) ion reduction assay confirmed that strain YD25 T could produce an AI-2 signal molecule. Phylogenetic analysis using the genomic sequence of YD25 T combined with phylogenetic and phenotypic analyses support this strain as a member of a novel and previously uncharacterized Serratia species. Genomic sequence and metabolite analysis of Serratia surfactantfaciens YD25 T indicate that this strain can be further explored for the production of useful metabolites. Unveiling the genomic sequence of S. surfactantfaciens YD25 T benefits the usage of this unique strain as a model system for studying the biosynthesis regulation of both prodigiosin and serrawettin W2 by the QS system.

Occurrence and Phylogenetic Diversity of Sphingomonas Strains in Soils Contaminated with Polycyclic Aromatic Hydrocarbons

PubMed Central

Leys, Natalie M. E. J.; Ryngaert, Annemie; Bastiaens, Leen; Verstraete, Willy; Top, Eva M.; Springael, Dirk

2004-01-01

Bacterial strains of the genus Sphingomonas are often isolated from contaminated soils for their ability to use polycyclic aromatic hydrocarbons (PAH) as the sole source of carbon and energy. The direct detection of Sphingomonas strains in contaminated soils, either indigenous or inoculated, is, as such, of interest for bioremediation purposes. In this study, a culture-independent PCR-based detection method using specific primers targeting the Sphingomonas 16S rRNA gene combined with denaturing gradient gel electrophoresis (DGGE) was developed to assess Sphingomonas diversity in PAH-contaminated soils. PCR using the new primer pair on a set of template DNAs of different bacterial genera showed that the method was selective for bacteria belonging to the family Sphingomonadaceae. Single-band DGGE profiles were obtained for most Sphingomonas strains tested. Strains belonging to the same species had identical DGGE fingerprints, and in most cases, these fingerprints were typical for one species. Inoculated strains could be detected at a cell concentration of 104 CFU g of soil−1. The analysis of Sphingomonas population structures of several PAH-contaminated soils by the new PCR-DGGE method revealed that soils containing the highest phenanthrene concentrations showed the lowest Sphingomonas diversity. Sequence analysis of cloned PCR products amplified from soil DNA revealed new 16S rRNA gene Sphingomonas sequences significantly different from sequences from known cultivated isolates (i.e., sequences from environmental clones grouped phylogenetically with other environmental clone sequences available on the web and that possibly originated from several potential new species). In conclusion, the newly designed Sphingomonas-specific PCR-DGGE detection technique successfully analyzed the Sphingomonas communities from polluted soils at the species level and revealed different Sphingomonas members not previously detected by culture-dependent detection techniques. PMID:15066784

Phylogenetic and nucleotide sequence analysis of influenza A (H1N1) HA and NA genes of strains isolated from Saudi Arabia.

PubMed

Al-Qahtani, Ahmed Ali; Mubin, Muhammad; Dela Cruz, Damian M; Althawadi, Sahar Isa; Ul Rehman, Muhammad Shah Nawaz; Bohol, Marie Fe F; Al-Ahdal, Mohammed N

2017-01-30

In early 2009, a novel influenza A (H1N1) virus appeared in Mexico and rapidly disseminated worldwide. Little is known about the phylogeny and evolutionary dynamics of the H1N1 strain found in Saudi Arabia. Nucleotide sequencing and bioinformatics analyses were used to study molecular variation between the virus isolates. In this report, 72 hemagglutinin (HA) and 45 neuraminidase (NA) H1N1 virus gene sequences, isolated in 2009 from various regions of Saudi Arabia, were analyzed. Genetic characterization indicated that viruses from two different clades, 6 and 7, were circulating in the region, with clade 7, the most widely circulating H1N1 clade globally in 2009, being predominant. Sequence analysis of the HA and NA genes revealed a high degree of sequence identity with the corresponding genes from viruses circulating in the South East Asia region and with the A/California/7/2009 strain. New mutations in the HA gene of pandemic H1N1 (pH1N1) viruses, that could alter viral fitness, were identified. Relaxed-clock and Bayesian Skyline Plot analyses, based on the isolates used in this study and closely related globally representative strains, indicated marginally higher substitution rates than the type strain (5.14×10-3 and 4.18×10-3 substitutions/nucleotide/year in the HA and NA genes, respectively). The Saudi isolates were antigenically homogeneous and closely related to the prototype vaccine strain A/California/7/2009. The antigenic site of the HA gene had acquired novel mutations in some isolates, making continued monitoring of these viruses vital for the identification of potentially highly virulent and drug resistant variants.

Study of canine parvovirus evolution: comparative analysis of full-length VP2 gene sequences from Argentina and international field strains.

PubMed

Gallo Calderón, Marina; Wilda, Maximiliano; Boado, Lorena; Keller, Leticia; Malirat, Viviana; Iglesias, Marcela; Mattion, Nora; La Torre, Jose

2012-02-01

The continuous emergence of new strains of canine parvovirus (CPV), poorly protected by current vaccination, is a concern among breeders, veterinarians, and dog owners around the world. Therefore, the understanding of the genetic variation in emerging CPV strains is crucial for the design of disease control strategies, including vaccines. In this paper, we obtained the sequences of the full-length gene encoding for the main capsid protein (VP2) of 11 canine parvovirus type 2 (CPV-2) Argentine representative field strains, selected from a total of 75 positive samples studied in our laboratory in the last 9 years. A comparative sequence analysis was performed on 9 CPV-2c, one CPV-2a, and one CPV-2b Argentine strains with respect to international strains reported in the GenBank database. In agreement with previous reports, a high degree of identity was found among CPV-2c Argentine strains (99.6-100% and 99.7-100% at nucleotide and amino acid levels, respectively). However, the appearance of a new substitution in the 440 position (T440A) in four CPV-2c Argentine strains obtained after the year 2009 gives support to the variability observed for this position located within the VP2, three-fold spike. This is the first report on the genetic characterization of the full-length VP2 gene of emerging CPV strains in South America and shows that all the Argentine CPV-2c isolates cluster together with European and North American CPV-2c strains.

Draft Genome Sequence of Exiguobacterium sp. Strain BMC-KP, an Environmental Isolate from Bryn Mawr, Pennsylvania.

PubMed

Hyson, Peter; Shapiro, Joshua A; Wien, Michelle W

2015-10-08

Exiguobacterium sp. strain BMC-KP was isolated as part of a student environmental sampling project at Bryn Mawr College, PA. Sequencing of bacterial DNA assembled a 3.32-Mb draft genome. Analysis suggests the presence of genes for tolerance to cold and toxic metals, broad carbohydrate metabolism, and genes derived from phage. Copyright © 2015 Hyson et al.

Biased distribution of IS629 among strains in different lineages of enterohemorrhagic Escherichia coli serovar O157.

PubMed

Yokoyama, Eiji; Hashimoto, Ruiko; Etoh, Yoshiki; Ichihara, Sachiko; Horikawa, Kazumi; Uchimura, Masako

2011-01-01

The distribution of insertion sequence (IS) 629 among strains of enterohemorrhagic Escherichia coli serovar O157 (O157) was investigated and compared with the strain lineages defined by lineage specific polymorphism assay-6 (LSPA-6) to demonstrate the effectiveness of IS629 analysis for population genetics analysis. Using pulsed-field gel electrophoresis and variable-number tandem repeat typing, 140 strains producing both VT1 and VT2 and 98 strains producing only VT2 were selected from a total of 592 strains isolated from patients and asymptomatic carriers in Chiba Prefecture, Japan, during 2003-2008. By LSPA-6 analysis, six strains had atypical amplicon sizes in their Z5935 loci and five strains had atypical amplicon sizes in their arp-iclR intergenic regions. Sequence analyses of PCR amplified DNAs showed that five of the six loci used for LSPA-6 analysis had tandem repeats and the allele changes were due to changes in the number of tandem repeats. Subculturing and long-term incubation was found to have no detectable effect on the lineages defined by LSPA-6 analysis, demonstrating the robustness of LSPA-6 analysis. Minimum spanning tree analysis reconstruction revealed that strains in lineage I, I/II, and II clustered on separate branches, indicating that the distribution of IS629 was biased among O157 strains in different lineages. Strains with LSPA-6 codes 231111, 211113, and 211114 had atypical amplicon sizes and were clustered in lineage I/II branch, and strains with LSPA-6 codes 212114, 221123, 221223, 222123, 222224, 242123, 252123, and 242222 had atypical amplicon sizes and clustered in lineage II branches. Linkage disequilibrium was observed in strains in every lineage when the standardized index of association was calculated using IS629 distribution data. Therefore, the distribution analysis of IS629 may be effective for population genetics analysis of O157 due to the biased IS629 distribution among strains in the three O157 lineages. Copyright © 2010 Elsevier B.V. All rights reserved.

Exploring the Genomic Traits of Non-toxigenic Vibrio parahaemolyticus Strains Isolated in Southern Chile

PubMed Central

Castillo, Daniel; Pérez-Reytor, Diliana; Plaza, Nicolás; Ramírez-Araya, Sebastián; Blondel, Carlos J.; Corsini, Gino; Bastías, Roberto; Loyola, David E.; Jaña, Víctor; Pavez, Leonardo; García, Katherine

2018-01-01

Vibrio parahaemolyticus is the leading cause of seafood-borne gastroenteritis worldwide. As reported in other countries, after the rise and fall of the pandemic strain in Chile, other post-pandemic strains have been associated with clinical cases, including strains lacking the major toxins TDH and TRH. Since the presence or absence of tdh and trh genes has been used for diagnostic purposes and as a proxy of the virulence of V. parahaemolyticus isolates, the understanding of virulence in V. parahaemolyticus strains lacking toxins is essential to detect these strains present in water and marine products to avoid possible food-borne infection. In this study, we characterized the genome of four environmental and two clinical non-toxigenic strains (tdh-, trh-, and T3SS2-). Using whole-genome sequencing, phylogenetic, and comparative genome analysis, we identified the core and pan-genome of V. parahaemolyticus of strains of southern Chile. The phylogenetic tree based on the core genome showed low genetic diversity but the analysis of the pan-genome revealed that all strains harbored genomic islands carrying diverse virulence and fitness factors or prophage-like elements that encode toxins like Zot and RTX. Interestingly, the three strains carrying Zot-like toxin have a different sequence, although the alignment showed some conserved areas with the zot sequence found in V. cholerae. In addition, we identified an unexpected diversity in the genetic architecture of the T3SS1 gene cluster and the presence of the T3SS2 gene cluster in a non-pandemic environmental strain. Our study sheds light on the diversity of V. parahaemolyticus strains from the southern Pacific which increases our current knowledge regarding the global diversity of this organism. PMID:29472910

Nodulation of Lupinus albus by Strains of Ochrobactrum lupini sp. nov.

PubMed Central

Trujillo, Martha E.; Willems, Anne; Abril, Adriana; Planchuelo, Ana-María; Rivas, Raúl; Ludeña, Dolores; Mateos, Pedro F.; Martínez-Molina, Eustoquio; Velázquez, Encarna

2005-01-01

The nodulation of legumes has for more than a century been considered an exclusive capacity of a group of microorganisms commonly known as rhizobia and belonging to the α-Proteobacteria. However, in the last 3 years four nonrhizobial species, belonging to α and β subclasses of the Proteobacteria, have been described as legume-nodulating bacteria. In the present study, two fast-growing strains, LUP21 and LUP23, were isolated from nodules of Lupinus honoratus. The phylogenetic analysis based on the 16S and 23S rRNA gene sequences showed that the isolates belong to the genus Ochrobactrum. The strains were able to reinfect Lupinus plants. A plasmid profile analysis showed the presence of three plasmids. The nodD and nifH genes were located on these plasmids, and their sequences were obtained. These sequences showed a close resemblance to the nodD and nifH genes of rhizobial species, suggesting that the nodD and nifH genes carried by strain LUP21T were acquired by horizontal gene transfer. A polyphasic study including phenotypic, chemotaxonomic, and molecular features of the strains isolated in this study showed that they belong to a new species of the genus Ochrobactrum for which we propose the name Ochrobactrum lupini sp. nov. Strain LUP21T (LMG 20667T) is the type strain. PMID:15746334

Phylogenetic analysis of canine parvovirus isolates from Sichuan and Gansu provinces of China in 2011.

PubMed

Xu, J; Guo, H-C; Wei, Y-Q; Shu, L; Wang, J; Li, J-S; Cao, S-Z; Sun, S-Q

2015-02-01

Canine parvovirus causes serious disease in dogs. Study of the genetic variation in emerging CPV strains is important for disease control strategy. The antigenic property of CPV is connected with specific amino acid changes, mainly in the capsid protein VP2. This study was carried out to characterize VP2 gene of CPV viruses from two provinces of China in 2011. The complete VP2 genes of the CPV-positive samples were amplified and sequenced. Genetic analysis based on the VP2 genes of CPV was conducted. All of the isolates screened and sequenced in this study were typed as CPV-2a except GS-K11 strain, which was typed as CPV-2b. Sequence comparison showed nucleotide identities of 98.8-100% among CPV strains, whereas the Aa similarities were 99.6-100%. Compared with the reference strains, there are three distinctive amino acid changes at VP2 gene residue 267, 324 and 440 of the strains isolated in this study. Of the 27 strains, fourteen (51.85%) had the 267 (Phe-Tyr) and 440 (Thr-Ala) substitution, all the 27 (100%) had 324 (Tyr-Ile) substitution. Phylogenetically, all of the strains isolated in this study formed a major monophyletic cluster together with one South Korean isolate, two Thailand isolates and four Chinese former isolates. © 2013 Blackwell Verlag GmbH.

Detection of VIM-2-, IMP-1- and NDM-1-producing multidrug resistant Pseudomonas aeruginosa in Malaysia.

PubMed

Liew, Siew Mun; Rajasekaram, Ganeswrei; Puthucheary, Savithri D; Chua, Kek Heng

2018-02-09

The increasing incidence of carbapenem-resistant Pseudomonas aeruginosa along with the discovery of novel metallo-β-lactamases (MBLs) is of concern. In this study, the isolation of Malaysian MBL-producing P. aeruginosa clinical strains was investigated. Fifty-three P. aeruginosa clinical strains were isolated from different patients in Sultanah Aminah Hospital, Johor Bahru, Malaysia in 2015. Antimicrobial susceptibility test was conducted. Minimum inhibitory concentrations (MICs) of imipenem and meropenem were determined by Etest. The carbapenem-resistant strains were screened for MBL production by IMP-EDTA double disk synergy test (DDST), MBL imipenem/imipenem-inhibitor (IP/IPI) Etest and polymerase chain reaction (PCR). Genotyping was performed by multilocus sequence typing (MLST) analysis. Three (5.7%) clinical strains were identified as MBL producers. Multidrug resistance was observed in the three strains, and two were resistant to all the antimicrobials tested. Sequencing analysis confirmed the three strains to harbour carbapenemase genes: one with bla IMP-1 , one with bla VIM-2 and the other with bla NDM-1 genes. These multidrug resistant strains were identified as sequence type (ST) 235 and ST308. None of the bla IMP-1 and bla NDM-1 genes have been reported in Malaysian P. aeruginosa. The emergence of imipenemase 1 (IMP-1)- and New Delhi metallo-β-lactamase 1 (NDM-1)-producing P. aeruginosa in Malaysia maybe travel-associated. Copyright © 2018. Published by Elsevier Ltd.

Isolation and characterization of an isoproturon mineralizing Sphingomonas sp. strain SH from a French agricultural soil.

PubMed

Hussain, Sabir; Devers-Lamrani, Marion; El Azhari, Najoi; Martin-Laurent, Fabrice

2011-06-01

The phenylurea herbicide isoproturon, 3-(4-isopropylphenyl)-1,1-dimethylurea (IPU), was found to be rapidly mineralized in an agricultural soil in France that had been periodically exposed to IPU. Enrichment cultures from samples of this soil isolated a bacterial strain able to mineralize IPU. 16S rRNA sequence analysis showed that this strain belonged to the phylogeny of the genus Sphingomonas (96% similarity with Sphingomonas sp. JEM-14, AB219361) and was designated Sphingomonas sp. strain SH. From this strain, a partial sequence of a 1,2-dioxygenase (catA) gene coding for an enzyme degrading catechol putatively formed during IPU mineralization was amplified. Phylogenetic analysis revealed that the catA sequence was related to Sphingomonas spp. and showed a lack of congruence between the catA and 16S rRNA based phylogenies, implying horizontal gene transfer of the catA gene cluster between soil microbiota. The IPU degrading ability of strain SH was strongly influenced by pH with maximum degradation taking place at pH 7.5. SH was only able to mineralize IPU and its known metabolites including 4-isopropylaniline and it could not degrade other structurally related phenylurea herbicides such as diuron, linuron, monolinuron and chlorotoluron or their aniline derivatives. These observations suggest that the catabolic abilities of the strain SH are highly specific to the metabolism of IPU.

Whole Genome Sequencing for Genomics-Guided Investigations of Escherichia coli O157:H7 Outbreaks.

PubMed

Rusconi, Brigida; Sanjar, Fatemeh; Koenig, Sara S K; Mammel, Mark K; Tarr, Phillip I; Eppinger, Mark

2016-01-01

Multi isolate whole genome sequencing (WGS) and typing for outbreak investigations has become a reality in the post-genomics era. We applied this technology to strains from Escherichia coli O157:H7 outbreaks. These include isolates from seven North America outbreaks, as well as multiple isolates from the same patient and from different infected individuals in the same household. Customized high-resolution bioinformatics sequence typing strategies were developed to assess the core genome and mobilome plasticity. Sequence typing was performed using an in-house single nucleotide polymorphism (SNP) discovery and validation pipeline. Discriminatory power becomes of particular importance for the investigation of isolates from outbreaks in which macrogenomic techniques such as pulse-field gel electrophoresis or multiple locus variable number tandem repeat analysis do not differentiate closely related organisms. We also characterized differences in the phage inventory, allowing us to identify plasticity among outbreak strains that is not detectable at the core genome level. Our comprehensive analysis of the mobilome identified multiple plasmids that have not previously been associated with this lineage. Applied phylogenomics approaches provide strong molecular evidence for exceptionally little heterogeneity of strains within outbreaks and demonstrate the value of intra-cluster comparisons, rather than basing the analysis on archetypal reference strains. Next generation sequencing and whole genome typing strategies provide the technological foundation for genomic epidemiology outbreak investigation utilizing its significantly higher sample throughput, cost efficiency, and phylogenetic relatedness accuracy. These phylogenomics approaches have major public health relevance in translating information from the sequence-based survey to support timely and informed countermeasures. Polymorphisms identified in this work offer robust phylogenetic signals that index both short- and long-term evolution and can complement currently employed typing schemes for outbreak ex- and inclusion, diagnostics, surveillance, and forensic studies.

Whole Genome Sequencing for Genomics-Guided Investigations of Escherichia coli O157:H7 Outbreaks

PubMed Central

Rusconi, Brigida; Sanjar, Fatemeh; Koenig, Sara S. K.; Mammel, Mark K.; Tarr, Phillip I.; Eppinger, Mark

2016-01-01

Multi isolate whole genome sequencing (WGS) and typing for outbreak investigations has become a reality in the post-genomics era. We applied this technology to strains from Escherichia coli O157:H7 outbreaks. These include isolates from seven North America outbreaks, as well as multiple isolates from the same patient and from different infected individuals in the same household. Customized high-resolution bioinformatics sequence typing strategies were developed to assess the core genome and mobilome plasticity. Sequence typing was performed using an in-house single nucleotide polymorphism (SNP) discovery and validation pipeline. Discriminatory power becomes of particular importance for the investigation of isolates from outbreaks in which macrogenomic techniques such as pulse-field gel electrophoresis or multiple locus variable number tandem repeat analysis do not differentiate closely related organisms. We also characterized differences in the phage inventory, allowing us to identify plasticity among outbreak strains that is not detectable at the core genome level. Our comprehensive analysis of the mobilome identified multiple plasmids that have not previously been associated with this lineage. Applied phylogenomics approaches provide strong molecular evidence for exceptionally little heterogeneity of strains within outbreaks and demonstrate the value of intra-cluster comparisons, rather than basing the analysis on archetypal reference strains. Next generation sequencing and whole genome typing strategies provide the technological foundation for genomic epidemiology outbreak investigation utilizing its significantly higher sample throughput, cost efficiency, and phylogenetic relatedness accuracy. These phylogenomics approaches have major public health relevance in translating information from the sequence-based survey to support timely and informed countermeasures. Polymorphisms identified in this work offer robust phylogenetic signals that index both short- and long-term evolution and can complement currently employed typing schemes for outbreak ex- and inclusion, diagnostics, surveillance, and forensic studies. PMID:27446025

Draft genome sequence of Halomonas lutea strain YIM 91125 T (DSM 23508 T) isolated from the alkaline Lake Ebinur in Northwest China

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Xiao-Yang; Zhi, Xiao-Yang; Li, Hong-Wei

Species of the genus Halomonas are halophilic and their flexible adaption to changes of salinity and temperature brings considerable potential biotechnology applications, such as degradation of organic pollutants and enzyme production. The type strain Halomonas lutea YIM 91125 T was isolated from a hypersaline lake in China. The genome of strain YIM 91125 T becomes the twelfth species sequenced in Halomonas, and the thirteenth species sequenced in Halomonadaceae. We described the features of H. lutea YIM 91125 T, together with the high quality draft genome sequence and annotation of its type strain. The 4,533,090 bp long genome of strain YIMmore » 91125 T with its 4,284 protein-coding and 84 RNA genes is a part of Genomic Encyclopedia of Type Strains, Phase I: the one thousand microbial genomes (KMG-I) project. From the viewpoint of comparative genomics, H. lutea has a larger genome size and more specific genes, which indicated acquisition of function bringing better adaption to its environment. Finally, DDH analysis demonstrated that H. lutea is a distinctive species, and halophilic features and nitrogen metabolism related genes were discovered in its genome.« less

Draft genome sequence of Halomonas lutea strain YIM 91125 T (DSM 23508 T) isolated from the alkaline Lake Ebinur in Northwest China

DOE PAGES

Gao, Xiao-Yang; Zhi, Xiao-Yang; Li, Hong-Wei; ...

2015-01-20

Species of the genus Halomonas are halophilic and their flexible adaption to changes of salinity and temperature brings considerable potential biotechnology applications, such as degradation of organic pollutants and enzyme production. The type strain Halomonas lutea YIM 91125 T was isolated from a hypersaline lake in China. The genome of strain YIM 91125 T becomes the twelfth species sequenced in Halomonas, and the thirteenth species sequenced in Halomonadaceae. We described the features of H. lutea YIM 91125 T, together with the high quality draft genome sequence and annotation of its type strain. The 4,533,090 bp long genome of strain YIMmore » 91125 T with its 4,284 protein-coding and 84 RNA genes is a part of Genomic Encyclopedia of Type Strains, Phase I: the one thousand microbial genomes (KMG-I) project. From the viewpoint of comparative genomics, H. lutea has a larger genome size and more specific genes, which indicated acquisition of function bringing better adaption to its environment. Finally, DDH analysis demonstrated that H. lutea is a distinctive species, and halophilic features and nitrogen metabolism related genes were discovered in its genome.« less

Transcriptome Sequencing and Characterization of Japanese Scallop Patinopecten yessoensis from Different Shell Color Lines

PubMed Central

Chang, Yaqing; Zhao, Wenming; Du, Zhenlin; Hao, Zhenlin

2015-01-01

Shell color is an important trait that is used in breeding the Japanese scallop Patinopecten yessoensis, the most economically important scallop species in China. We constructed four transcriptome libraries from different shell color lines of P. yessoensis: the left and right shell mantles of ordinary strains of P. yessoensis and the left shell mantles of the ‘Ivory’ and ‘Maple’ strains. These four libraries were paired-end sequenced using the Illumina HiSeq 2000 platform and contained 54,802,692 sequences, 40,798,962 sequences, 74,019,262 sequences, and 44,466,166 sequences, respectively. A total of 214,087,082 expressed sequence tags were assembled into 73,522 unigenes with an average size of 1,163 bp. When the data were compared against the public Nr and Swiss-Prot databases using BlastX, nearly 30.55% (22,458) of the unigenes were significantly matched to known unique proteins. Gene Ontology annotation and pathway mapping analysis using the Kyoto Encyclopedia of Genes and Genomes categorized unigenes according to their diverse biological functions and processes and identified candidate genes that were potentially involved in growth, pigmentation, metal transcription, and immunity. Expression profile analysis was performed on all four libraries and many differentially expressed genes were identified. In addition, 5,772 simple sequence repeats were obtained from the P. yessoensis transcriptomes, and 464,197, 395,646, and 310,649 single nucleotide polymorphisms were revealed in the ordinary strains, the ‘Ivory’ strain, and the ‘Maple’ strain, respectively. These results provide valuable information for future genomic studies on P. yessoensis and improve our understanding of the molecular mechanisms involved in the growth, immunity, shell coloring, and shell biomineralization of this species. These resources also may be used in a variety of applications, such as trait mapping, marker-assisted breeding, studies of population genetics and genomics, and work on functional genomics. PMID:25680107

Resequencing Pathogen Microarray (RPM) for prospective detection and identification of emergent pathogen strains and variants

NASA Astrophysics Data System (ADS)

Tibbetts, Clark; Lichanska, Agnieszka M.; Borsuk, Lisa A.; Weslowski, Brian; Morris, Leah M.; Lorence, Matthew C.; Schafer, Klaus O.; Campos, Joseph; Sene, Mohamadou; Myers, Christopher A.; Faix, Dennis; Blair, Patrick J.; Brown, Jason; Metzgar, David

2010-04-01

High-density resequencing microarrays support simultaneous detection and identification of multiple viral and bacterial pathogens. Because detection and identification using RPM is based upon multiple specimen-specific target pathogen gene sequences generated in the individual test, the test results enable both a differential diagnostic analysis and epidemiological tracking of detected pathogen strains and variants from one specimen to the next. The RPM assay enables detection and identification of pathogen sequences that share as little as 80% sequence similarity to prototype target gene sequences represented as detector tiles on the array. This capability enables the RPM to detect and identify previously unknown strains and variants of a detected pathogen, as in sentinel cases associated with an infectious disease outbreak. We illustrate this capability using assay results from testing influenza A virus vaccines configured with strains that were first defined years after the design of the RPM microarray. Results are also presented from RPM-Flu testing of three specimens independently confirmed to the positive for the 2009 Novel H1N1 outbreak strain of influenza virus.

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

PubMed

Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

2016-08-01

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Ideonella azotifigens sp. nov., an aerobic diazotroph of the Betaproteobacteria isolated from grass rhizosphere soil, and emended description of the genus Ideonella.

PubMed

Noar, Jesse D; Buckley, Daniel H

2009-08-01

Strain 1a22T, a nitrogen-fixing bacterium, was isolated from soil associated with the rhizosphere of a perennial grass growing in a fallow agricultural field in Ithaca, New York, USA. Analysis of the 16S rRNA gene sequence placed the strain in the Rubrivivax-Roseateles-Leptothrix-Azohydromonas-Aquincola-Ideonella branch of the Betaproteobacteria and the closest characterized relative was the type strain of Ideonella dechloratans (97.7% 16S rRNA sequence similarity). Cells of strain 1a22T were Gram-negative, motile, straight rods, which formed polyhydroxybutyrate-like granules and were positive for oxidase and weakly positive for catalase. Cells were chemo-organotrophic, unable to grow by reduction of chlorate or nitrate and grew exclusively through aerobic respiration. Growth with mannitol on N-free solid media caused the strain to produce copious amounts of slime. The G+C content of the genomic DNA was 67.4 mol%. The major cellular fatty acids were C16:1 cis-9 and C16:0 and cells contained significant amounts of the hydroxy fatty acids C10:0 3-OH, C12:0 2-OH and C12:0 3-OH. Based on DNA-DNA hybridization studies, 16S rRNA gene sequence analysis, fatty acid analysis, and morphological and physiological characteristics, strain 1a22T represents a novel species in the genus Ideonella, for which the name Ideonella azotifigens sp. nov. is proposed. The type strain of Ideonella azotifigens is 1a22T (=JCM 15503T=DSM 21438T).

Whole-genome analysis of piscine reovirus (PRV) shows PRV represents a new genus in family Reoviridae and its genome segment S1 sequences group it into two separate sub-genotypes.

PubMed

Kibenge, Molly J T; Iwamoto, Tokinori; Wang, Yingwei; Morton, Alexandra; Godoy, Marcos G; Kibenge, Frederick S B

2013-07-11

Piscine reovirus (PRV) is a newly discovered fish reovirus of anadromous and marine fish ubiquitous among fish in Norwegian salmon farms, and likely the causative agent of heart and skeletal muscle inflammation (HSMI). HSMI is an increasingly economically significant disease in Atlantic salmon (Salmo salar) farms. The nucleotide sequence data available for PRV are limited, and there is no genetic information on this virus outside of Norway and none from wild fish. RT-PCR amplification and sequencing were used to obtain the complete viral genome of PRV (10 segments) from western Canada and Chile. The genetic diversity among the PRV strains and their relationship to Norwegian PRV isolates were determined by phylogenetic analyses and sequence identity comparisons. PRV is distantly related to members of the genera Orthoreovirus and Aquareovirus and an unambiguous new genus within the family Reoviridae. The Canadian and Norwegian PRV strains are most divergent in the segment S1 and S4 encoded proteins. Phylogenetic analysis of PRV S1 sequences, for which the largest number of complete sequences from different "isolates" is available, grouped Norwegian PRV strains into a single genotype, Genotype I, with sub-genotypes, Ia and Ib. The Canadian PRV strains matched sub-genotype Ia and Chilean PRV strains matched sub-genotype Ib. PRV should be considered as a member of a new genus within the family Reoviridae with two major Norwegian sub-genotypes. The Canadian PRV diverged from Norwegian sub-genotype Ia around 2007 ± 1, whereas the Chilean PRV diverged from Norwegian sub-genotype Ib around 2008 ± 1.

Whole-genome analysis of piscine reovirus (PRV) shows PRV represents a new genus in family Reoviridae and its genome segment S1 sequences group it into two separate sub-genotypes

PubMed Central

2013-01-01

Background Piscine reovirus (PRV) is a newly discovered fish reovirus of anadromous and marine fish ubiquitous among fish in Norwegian salmon farms, and likely the causative agent of heart and skeletal muscle inflammation (HSMI). HSMI is an increasingly economically significant disease in Atlantic salmon (Salmo salar) farms. The nucleotide sequence data available for PRV are limited, and there is no genetic information on this virus outside of Norway and none from wild fish. Methods RT-PCR amplification and sequencing were used to obtain the complete viral genome of PRV (10 segments) from western Canada and Chile. The genetic diversity among the PRV strains and their relationship to Norwegian PRV isolates were determined by phylogenetic analyses and sequence identity comparisons. Results PRV is distantly related to members of the genera Orthoreovirus and Aquareovirus and an unambiguous new genus within the family Reoviridae. The Canadian and Norwegian PRV strains are most divergent in the segment S1 and S4 encoded proteins. Phylogenetic analysis of PRV S1 sequences, for which the largest number of complete sequences from different “isolates” is available, grouped Norwegian PRV strains into a single genotype, Genotype I, with sub-genotypes, Ia and Ib. The Canadian PRV strains matched sub-genotype Ia and Chilean PRV strains matched sub-genotype Ib. Conclusions PRV should be considered as a member of a new genus within the family Reoviridae with two major Norwegian sub-genotypes. The Canadian PRV diverged from Norwegian sub-genotype Ia around 2007 ± 1, whereas the Chilean PRV diverged from Norwegian sub-genotype Ib around 2008 ± 1. PMID:23844948

Improved detection of genetic markers of antimicrobial resistance by hybridization probe-based melting curve analysis using primers to mask proximal mutations: examples include the influenza H275Y substitution.

PubMed

Whiley, David M; Jacob, Kevin; Nakos, Jennifer; Bletchly, Cheryl; Nimmo, Graeme R; Nissen, Michael D; Sloots, Theo P

2012-06-01

Numerous real-time PCR assays have been described for detection of the influenza A H275Y alteration. However, the performance of these methods can be undermined by sequence variation in the regions flanking the codon of interest. This is a problem encountered more broadly in microbial diagnostics. In this study, we developed a modification of hybridization probe-based melting curve analysis, whereby primers are used to mask proximal mutations in the sequence targets of hybridization probes, so as to limit the potential for sequence variation to interfere with typing. The approach was applied to the H275Y alteration of the influenza A (H1N1) 2009 strain, as well as a Neisseria gonorrhoeae mutation associated with antimicrobial resistance. Assay performances were assessed using influenza A and N. gonorrhoeae strains characterized by DNA sequencing. The modified hybridization probe-based approach proved successful in limiting the effects of proximal mutations, with the results of melting curve analyses being 100% consistent with the results of DNA sequencing for all influenza A and N. gonorrhoeae strains tested. Notably, these included influenza A and N. gonorrhoeae strains exhibiting additional mutations in hybridization probe targets. Of particular interest was that the H275Y assay correctly typed influenza A strains harbouring a T822C nucleotide substitution, previously shown to interfere with H275Y typing methods. Overall our modified hybridization probe-based approach provides a simple means of circumventing problems caused by sequence variation, and offers improved detection of the influenza A H275Y alteration and potentially other resistance mechanisms.

Characterization of Aeromonas hydrophila wound pathotypes by comparative genomic and functional analyses of virulence genes.

PubMed

Grim, Christopher J; Kozlova, Elena V; Sha, Jian; Fitts, Eric C; van Lier, Christina J; Kirtley, Michelle L; Joseph, Sandeep J; Read, Timothy D; Burd, Eileen M; Tall, Ben D; Joseph, Sam W; Horneman, Amy J; Chopra, Ashok K; Shak, Joshua R

2013-04-23

Aeromonas hydrophila has increasingly been implicated as a virulent and antibiotic-resistant etiologic agent in various human diseases. In a previously published case report, we described a subject with a polymicrobial wound infection that included a persistent and aggressive strain of A. hydrophila (E1), as well as a more antibiotic-resistant strain of A. hydrophila (E2). To better understand the differences between pathogenic and environmental strains of A. hydrophila, we conducted comparative genomic and functional analyses of virulence-associated genes of these two wound isolates (E1 and E2), the environmental type strain A. hydrophila ATCC 7966(T), and four other isolates belonging to A. aquariorum, A. veronii, A. salmonicida, and A. caviae. Full-genome sequencing of strains E1 and E2 revealed extensive differences between the two and strain ATCC 7966(T). The more persistent wound infection strain, E1, harbored coding sequences for a cytotoxic enterotoxin (Act), a type 3 secretion system (T3SS), flagella, hemolysins, and a homolog of exotoxin A found in Pseudomonas aeruginosa. Corresponding phenotypic analyses with A. hydrophila ATCC 7966(T) and SSU as reference strains demonstrated the functionality of these virulence genes, with strain E1 displaying enhanced swimming and swarming motility, lateral flagella on electron microscopy, the presence of T3SS effector AexU, and enhanced lethality in a mouse model of Aeromonas infection. By combining sequence-based analysis and functional assays, we characterized an A. hydrophila pathotype, exemplified by strain E1, that exhibited increased virulence in a mouse model of infection, likely because of encapsulation, enhanced motility, toxin secretion, and cellular toxicity. Aeromonas hydrophila is a common aquatic bacterium that has increasingly been implicated in serious human infections. While many determinants of virulence have been identified in Aeromonas, rapid identification of pathogenic versus nonpathogenic strains remains a challenge for this genus, as it is for other opportunistic pathogens. This paper demonstrates, by using whole-genome sequencing of clinical Aeromonas strains, followed by corresponding virulence assays, that comparative genomics can be used to identify a virulent subtype of A. hydrophila that is aggressive during human infection and more lethal in a mouse model of infection. This aggressive pathotype contained genes for toxin production, toxin secretion, and bacterial motility that likely enabled its pathogenicity. Our results highlight the potential of whole-genome sequencing to transform microbial diagnostics; with further advances in rapid sequencing and annotation, genomic analysis will be able to provide timely information on the identities and virulence potential of clinically isolated microorganisms.

Paenibacillus phoenicis sp. nov., isolated from the Phoenix Lander assembly facility and a subsurface molybdenum mine.

PubMed

Benardini, James N; Vaishampayan, Parag A; Schwendner, Petra; Swanner, Elizabeth; Fukui, Youhei; Osman, Sharif; Satomi, Masakata; Venkateswaran, Kasthuri

2011-06-01

A novel Gram-positive, motile, endospore-forming, aerobic bacterium was isolated from the NASA Phoenix Lander assembly clean room that exhibits 100 % 16S rRNA gene sequence similarity to two strains isolated from a deep subsurface environment. All strains are rod-shaped, endospore-forming bacteria, whose endospores are resistant to UV radiation up to 500 J m(-2). A polyphasic taxonomic study including traditional phenotypic tests, fatty acid analysis, 16S rRNA gene sequencing and DNA-DNA hybridization analysis was performed to characterize these novel strains. The 16S rRNA gene sequencing convincingly grouped these novel strains within the genus Paenibacillus as a separate cluster from previously described species. The similarity of 16S rRNA gene sequences among the novel strains was identical but only 98.1 to 98.5 % with their nearest neighbours Paenibacillus barengoltzii ATCC BAA-1209(T) and Paenibacillus timonensis CIP 108005(T). The menaquinone MK-7 was dominant in these novel strains as shown in other species of the genus Paenibacillus. The DNA-DNA hybridization dissociation value was <45 % with the closest related species. The novel strains had DNA G+C contents of 51.9 to 52.8 mol%. Phenotypically, the novel strains can be readily differentiated from closely related species by the absence of urease and gelatinase and the production of acids from a variety of sugars including l-arabinose. The major fatty acid was anteiso-C(15 : 0) as seen in P. barengoltzii and P. timonensis whereas the proportion of C(16 : 0) was significantly different from the closely related species. Based on phylogenetic and phenotypic results, it was concluded that these strains represent a novel species of the genus Paenibacillus, for which the name Paenibacillus phoenicis sp. nov. is proposed. The type strain is 3PO2SA(T) ( = NRRL B-59348(T)  = NBRC 106274(T)).

Genome sequence and physiological analysis of Yamadazyma laniorum f.a. sp. nov. and a reevaluation of the apocryphal xylose fermentation of its sister species, Candida tenuis.

PubMed

Haase, Max A B; Kominek, Jacek; Langdon, Quinn K; Kurtzman, Cletus P; Hittinger, Chris Todd

2017-05-01

Xylose fermentation is a rare trait that is immensely important to the cellulosic biofuel industry, and Candida tenuis is one of the few yeasts that has been reported with this trait. Here we report the isolation of two strains representing a candidate sister species to C. tenuis. Integrated analysis of genome sequence and physiology suggested the genetic basis of a number of traits, including variation between the novel species and C. tenuis in lactose metabolism due to the loss of genes encoding lactose permease and β-galactosidase in the former. Surprisingly, physiological characterization revealed that neither the type strain of C. tenuis nor this novel species fermented xylose in traditional assays. We reexamined three xylose-fermenting strains previously identified as C. tenuis and found that these strains belong to the genus Scheffersomyces and are not C. tenuis. We propose Yamadazyma laniorum f.a. sp. nov. to accommodate our new strains and designate its type strain as yHMH7 (=CBS 14780 = NRRL Y-63967T). Furthermore, we propose the transfer of Candida tenuis to the genus Yamadazyma as Yamadazyma tenuis comb. nov. This approach provides a roadmap for how integrated genome sequence and physiological analysis can yield insight into the mechanisms that generate yeast biodiversity. Published by Oxford University Press on behalf of FEMS 2017. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Shewanella amazonensis sp. nov., a novel metal-reducing facultative anaerobe from Amazonian shelf muds

NASA Technical Reports Server (NTRS)

Venkateswaran, K.; Dollhopf, M. E.; Aller, R.; Stackebrandt, E.; Nealson, K. H.

1998-01-01

A new bacterial species belonging to the genus Shewanella is described on the basis of phenotypic characterization and sequence analysis of its 16S rRNA-encoding and gyrase B (gyrB) genes. This organism, isolated from shallow-water marine sediments derived from the Amazon River delta, is a Gram-negative, motile, polarly flagellated, facultatively anaerobic, rod-shaped eubacterium and has a G&C content of 51.7 mol%. Strain SB2BT is exceptionally active in the anaerobic reduction of iron, manganese and sulfur compounds. SB2BT grows optimally at 35 degrees C, with 1-3% NaCl and over a pH range of 7-8. Analysis of the 16S rDNA sequence revealed a clear affiliation between strain SB2BT and members of the gamma subclass of the class Proteobacteria. High similarity values were found with certain members of the genus Shewanella, especially with Shewanella putrefaciens, and this was supported by cellular fatty acid profiles and phenotypic characterization. DNA-DNA hybridization between strain SB2BT and its phylogenetically closest relatives revealed low similarity values (24.6-42.7%) which indicated species status for strain SB2BT. That SB2BT represents a distinct bacterial species within the genus Shewanella is also supported by gyrB sequence analysis. Considering the source of the isolate, the name Shewanella amazonensis sp. nov. is proposed and strain SB2BT (= ATCC 700329T) is designated as the type strain.

Detection and analysis of CRISPRs of Shigella.

PubMed

Guo, Xiangjiao; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Wang, Pengfei; Qiu, Shaofu; Xi, Yuanlin; Yang, Haiyan

2015-01-01

The recently discovered CRISPRs (Clustered regularly interspaced short palindromic repeats) and Cas (CRISPR-associated) proteins are a novel genetic barrier that limits horizontal gene transfer in prokaryotes and the CRISPR loci provide a historical view of the exposure of prokaryotes to a variety of foreign genetic elements. The aim of study was to investigate the occurrence and distribution of the CRISPRs in Shigella. A collection of 61 strains of Shigella were screened for the existence of CRISPRs. Three CRISPR loci were identified among 61 shigella strains. CRISPR1/cas loci are detected in 49 strains of shigella. Yet, IS elements were detected in cas gene in some strains. In the remaining 12 Shigella flexneri strains, the CRISPR1/cas locus is deleted and only a cas3' pseudo gene and a repeat sequence are present. The presence of CRISPR2 is frequently accompanied by the emergence of CRISPR1. CRISPR3 loci were present in almost all strains (52/61). The length of CRISPR arrays varied from 1 to 9 spacers. Sequence analysis of the CRISPR arrays revealed that few spacers had matches in the GenBank databases. However, one spacer in CRISPR3 loci matches the cognate cas3 genes and no cas gene was present around CRISPR3 region. Analysis of CRISPR sequences show that CRISPR have little change which makes CRISPR poor genotyping markers. The present study is the first attempt to determine and analyze CRISPRs of shigella isolated from clinical patients.

Whole-Genome-Sequencing characterization of bloodstream infection-causing hypervirulent Klebsiella pneumoniae of capsular serotype K2 and ST374.

PubMed

Wang, Xiaoli; Xie, Yingzhou; Li, Gang; Liu, Jialin; Li, Xiaobin; Tian, Lijun; Sun, Jingyong; Ou, Hong-Yu; Qu, Hongping

2018-01-01

Hypervirulent K. pneumoniae variants (hvKP) have been increasingly reported worldwide, causing metastasis of severe infections such as liver abscesses and bacteremia. The capsular serotype K2 hvKP strains show diverse multi-locus sequence types (MLSTs), but with limited genetics and virulence information. In this study, we report a hypermucoviscous K. pneumoniae strain, RJF293, isolated from a human bloodstream sample in a Chinese hospital. It caused a metastatic infection and fatal septic shock in a critical patient. The microbiological features and genetic background were investigated with multiple approaches. The Strain RJF293 was determined to be multilocis sequence type (ST) 374 and serotype K2, displayed a median lethal dose (LD50) of 1.5 × 10 2 CFU in BALB/c mice and was as virulent as the ST23 K1 serotype hvKP strain NTUH-K2044 in a mouse lethality assay. Whole genome sequencing revealed that the RJF293 genome codes for 32 putative virulence factors and exhibits a unique presence/absence pattern in comparison to the other 105 completely sequenced K. pneumoniae genomes. Whole genome SNP-based phylogenetic analysis revealed that strain RJF293 formed a single clade, distant from those containing either ST66 or ST86 hvKP. Compared to the other sequenced hvKP chromosomes, RJF293 contains several strain-variable regions, including one prophage, one ICEKp1 family integrative and conjugative element and six large genomic islands. The sequencing of the first complete genome of an ST374 K2 hvKP clinical strain should reinforce our understanding of the epidemiology and virulence mechanisms of this bloodstream infection-causing hvKP with clinical significance.

Whole-Genome-Sequencing characterization of bloodstream infection-causing hypervirulent Klebsiella pneumoniae of capsular serotype K2 and ST374

PubMed Central

Wang, Xiaoli; Xie, Yingzhou; Li, Gang; Liu, Jialin; Li, Xiaobin; Tian, Lijun; Sun, Jingyong; Qu, Hongping

2018-01-01

ABSTRACT Hypervirulent K. pneumoniae variants (hvKP) have been increasingly reported worldwide, causing metastasis of severe infections such as liver abscesses and bacteremia. The capsular serotype K2 hvKP strains show diverse multi-locus sequence types (MLSTs), but with limited genetics and virulence information. In this study, we report a hypermucoviscous K. pneumoniae strain, RJF293, isolated from a human bloodstream sample in a Chinese hospital. It caused a metastatic infection and fatal septic shock in a critical patient. The microbiological features and genetic background were investigated with multiple approaches. The Strain RJF293 was determined to be multilocis sequence type (ST) 374 and serotype K2, displayed a median lethal dose (LD50) of 1.5 × 102 CFU in BALB/c mice and was as virulent as the ST23 K1 serotype hvKP strain NTUH-K2044 in a mouse lethality assay. Whole genome sequencing revealed that the RJF293 genome codes for 32 putative virulence factors and exhibits a unique presence/absence pattern in comparison to the other 105 completely sequenced K. pneumoniae genomes. Whole genome SNP-based phylogenetic analysis revealed that strain RJF293 formed a single clade, distant from those containing either ST66 or ST86 hvKP. Compared to the other sequenced hvKP chromosomes, RJF293 contains several strain-variable regions, including one prophage, one ICEKp1 family integrative and conjugative element and six large genomic islands. The sequencing of the first complete genome of an ST374 K2 hvKP clinical strain should reinforce our understanding of the epidemiology and virulence mechanisms of this bloodstream infection-causing hvKP with clinical significance. PMID:29338592

High Genetic Diversity Revealed by Variable-Number Tandem Repeat Genotyping and Analysis of hsp65 Gene Polymorphism in a Large Collection of “Mycobacterium canettii” Strains Indicates that the M. tuberculosis Complex Is a Recently Emerged Clone of “M. canettii”

PubMed Central

Fabre, Michel; Koeck, Jean-Louis; Le Flèche, Philippe; Simon, Fabrice; Hervé, Vincent; Vergnaud, Gilles; Pourcel, Christine

2004-01-01

We have analyzed, using complementary molecular methods, the diversity of 43 strains of “Mycobacterium canettii” originating from the Republic of Djibouti, on the Horn of Africa, from 1998 to 2003. Genotyping by multiple-locus variable-number tandem repeat analysis shows that all the strains belong to a single but very distant group when compared to strains of the Mycobacterium tuberculosis complex (MTBC). Thirty-one strains cluster into one large group with little variability and five strains form another group, whereas the other seven are more diverged. In total, 14 genotypes are observed. The DR locus analysis reveals additional variability, some strains being devoid of a direct repeat locus and others having unique spacers. The hsp65 gene polymorphism was investigated by restriction enzyme analysis and sequencing of PCR amplicons. Four new single nucleotide polymorphisms were discovered. One strain was characterized by three nucleotide changes in 441 bp, creating new restriction enzyme polymorphisms. As no sequence variability was found for hsp65 in the whole MTBC, and as a single point mutation separates M. tuberculosis from the closest “M. canettii” strains, this diversity within “M. canettii” subspecies strongly suggests that it is the most probable source species of the MTBC rather than just another branch of the MTBC. PMID:15243089

Structure and Evolution of Chlorate Reduction Composite Transposons

PubMed Central

Clark, Iain C.; Melnyk, Ryan A.; Engelbrektson, Anna; Coates, John D.

2013-01-01

ABSTRACT The genes for chlorate reduction in six bacterial strains were analyzed in order to gain insight into the metabolism. A newly isolated chlorate-reducing bacterium (Shewanella algae ACDC) and three previously isolated strains (Ideonella dechloratans, Pseudomonas sp. strain PK, and Dechloromarinus chlorophilus NSS) were genome sequenced and compared to published sequences (Alicycliphilus denitrificans BC plasmid pALIDE01 and Pseudomonas chloritidismutans AW-1). De novo assembly of genomes failed to join regions adjacent to genes involved in chlorate reduction, suggesting the presence of repeat regions. Using a bioinformatics approach and finishing PCRs to connect fragmented contigs, we discovered that chlorate reduction genes are flanked by insertion sequences, forming composite transposons in all four newly sequenced strains. These insertion sequences delineate regions with the potential to move horizontally and define a set of genes that may be important for chlorate reduction. In addition to core metabolic components, we have highlighted several such genes through comparative analysis and visualization. Phylogenetic analysis places chlorate reductase within a functionally diverse clade of type II dimethyl sulfoxide (DMSO) reductases, part of a larger family of enzymes with reactivity toward chlorate. Nucleotide-level forensics of regions surrounding chlorite dismutase (cld), as well as its phylogenetic clustering in a betaproteobacterial Cld clade, indicate that cld has been mobilized at least once from a perchlorate reducer to build chlorate respiration. PMID:23919996

[Rubella virus genetic determinant of attenuation].

PubMed

Dmitriev, G V; Borisova, T K; Faizuloev, E B; Desiatskova, R G; Zverev, V V

2014-01-01

Vaccination is the most effective and available way to prevent Rubella. Presently, 9 vaccine strains were registered. Nevertheless, the molecular mechanisms of the attenuation were poorly elucidated for the rubella virus. However, the study of these mechanisms identifying genotypic and phenotypic markers of attenuation, which together with sequence analysis could be used for the genetic stability control of vaccine strains, is still of current interest. Common trends of genetic changes in the process of adaptation to cold were found due to comparison of nucleic acid and amino acid sequences of the Russian strain C-77 with corresponding positions of the known rubella virus strains and its wild type progenitors, if available.

Staphylococcus muscae, a new species isolated from flies.

PubMed

Hájek, V; Ludwig, W; Schleifer, K H; Springer, N; Zitzelsberger, W; Kroppenstedt, R M; Kocur, M

1992-01-01

A new coagulase-negative species of the genus Staphylococcus, Staphylococcus muscae, is described on the basis of the results of a study of four strains that were isolated from flies. 16S rRNA sequences of the type strains of S. muscae, Staphylococcus schleiferi, and Staphylococcus sciuri were determined and used, together with the corresponding sequences of Staphylococcus aureus and Staphylococcus epidermidis, for a comparative analysis. The new species is characterized taxonomically; this species is differentiated from the other novobiocin-susceptible staphylococci by its physiological and biochemical activities, cell wall composition, and levels of genetic relatedness. The type strain of this species is strain MB4 (= CCM 4175).

Draft Genome Sequence of Lactococcus lactis subsp. lactis bv. diacetylactis CRL264, a Citrate-Fermenting Strain.

PubMed

Zuljan, Federico; Espariz, Martín; Blancato, Victor S; Esteban, Luis; Alarcón, Sergio; Magni, Christian

2016-02-04

We report the draft genome sequence of Lactococcus lactis subsp. lactis bv. diacetylactis CRL264, a natural strain isolated from artisanal cheese from northwest Argentina. L. lactis subsp. lactis bv. diacetylactis is one of the most important microorganisms used as starter culture around the world. The CRL264 strain constitutes a model microorganism in the studies on the generation of aroma compounds (diacetyl, acetoin, and 2,3-butanediol) by lactic acid bacteria. Our genome analysis shows similar genetic organization to other available genomes of L. lactis bv. diacetylactis strains. Copyright © 2016 Zuljan et al.

Legionella saoudiensis sp. nov., isolated from a sewage water sample.

PubMed

Bajrai, Leena Hussein; Azhar, Esam Ibraheem; Yasir, Muhammad; Jardot, Priscilla; Barrassi, Lina; Raoult, Didier; La Scola, Bernard; Pagnier, Isabelle

2016-11-01

A Gram-stain-negative, bacilli-shaped bacterial strain, LS-1T, was isolated from a sewage water sample collected in Jeddah, Saudi Arabia. The taxonomic position of strain LS-1T was investigated using a polyphasic taxonomic approach. Phylogenetic analysis based on 16S rRNA gene sequences and those of four other genes indicated that strain LS-1T belongs to the genus Legionella in the family Legionellaceae. Regarding the 16S rRNA gene, the most closely related species are Legionella rowbothamii LLAP-6T (98.6 %) and Legionella lytica L2T (98.5 %). The mip gene sequence of strain LS-1T showed 94 % sequence similarity with that of L. lytica L2T and 93 % similarity with that of L. rowbothamii LLAP-6T. Strain LS-1T grew optimally at a temperature of 32 °C on a buffered charcoal yeast extract (BCYE) agar plate in a 5 % CO2 atmosphere and had a flagellum. The combined phylogenetic, phenotypic and genomic sequence data suggest that strain LS-1T represents a novel species of the genus Legionella, for which the name Legionella saoudiensis sp. nov. is proposed. The type strain is LS-1T (=DSM 101682T=CSUR P2101T).

Genotyping of Salmonella enterica serovar Typhi strains isolated from 1959 to 2006 in China and analysis of genetic diversity by genomic microarray.

PubMed

Zhang, Haifang; Zhang, Xiaolei; Yan, Meiying; Pang, Bo; Kan, Biao; Xu, Huaxi; Huang, Xinxiang

2011-12-15

To determine the genotype of Salmonella enterica serovar Typhi (S. Typhi) strains in China and analyze their genetic diversity. We collected S. Typhi strains from 1959 to 2006 in five highly endemic Chinese provinces and chose 40 representative strains. Multilocus sequence typing was used to determine the genotypes or sequence types (ST) and microarray-based comparative genomic hybridization (M-CGH) to investigate the differences in gene content among these strains. Forty representative S. Typhi strains belonged to 4 sequence types (ST1, ST2, ST890, and ST892). The predominant S. Typhi genotype (31/40) was ST2 and it had a diverse geographic distribution. We discovered two novel STs - ST890 and ST892. M-CGH showed that 69 genes in these two novel STs were divergent from S. Typhi Ty2, which belongs to ST1. In addition, 5 representative Typhi strains of ST2 isolated from Guizhou province showed differences in divergent genes. We determined two novel sequence types, ST890 and ST892, and found that ST2 was the most prevalent genotype of S. Typhi in China. Genetic diversity was present even within a highly clonal bacterial population.

Whole Genome Sequence Analysis of an Alachlor and Endosulfan Degrading Micrococcus sp. strain 2385 Isolated from Ochlockonee River, Florida

PubMed Central

Pathak, Ashish; Chauhan, Ashvini; Ewida, Ayman Y.I.; Stothard, Paul

2016-01-01

We recently isolated Micrococcus sp. strain 2385 from Ochlockonee River, Florida and demonstrated potent biodegradative activity against two commonly used pesticides- alachlor [(2-chloro-2`,6`-diethylphenyl-N (methoxymethyl)acetanilide)] and endosulfan [(6,7,8,9,10,10-hexachloro-1,5,5a,6,9,9a-hexahydro-6,9methano-2,3,4-benzo(e)di-oxathiepin-3-oxide], respectively. To further identify the repertoire of metabolic functions possessed by strain 2385, a draft genome sequence was obtained, assembled, annotated and analyzed. The genome sequence of Micrococcus sp. strain 2385 consisted of 1,460,461,440 bases which assembled into 175 contigs with an N50 contig length of 50,109 bases and a coverage of 600x. The genome size of this strain was estimated at 2,431,226 base pairs with a G+C content of 72.8 and a total number of 2,268 putative genes. RAST annotated a total of 340 subsystems in the genome of strain 2385 along with the presence of 2,177 coding sequences. A genome wide survey indicated that that strain 2385 harbors a plethora of genes to degrade other pollutants including caprolactam, PAHs (such as naphthalene), styrene, toluene and several chloroaromatic compounds. PMID:27672405

Elucidation of Echovirus 30's Origin and Transmission during the 2012 Aseptic Meningitis Outbreak in Guangdong, China, through Continuing Environmental Surveillance

PubMed Central

Lu, Jing; Guo, Xue; Zhang, Yong; Li, Hui; Liu, Leng; Zeng, Hanri; Fang, Ling; Mo, Yanling; Yoshida, Hiromu; Yi, Lina; Liu, Tao; Rutherford, Shannon; Xu, Wenbo; Ke, Changwen

2015-01-01

An aseptic meningitis outbreak occurred in Luoding City of Guangdong, China, in 2012, and echovirus type 30 (ECHO30) was identified as the major causative pathogen. Environmental surveillance indicated that ECHO30 was detected in the sewage of a neighboring city, Guangzhou, from 2010 to 2012 and also in Luoding City sewage samples (6/43, 14%) collected after the outbreak. In order to track the potential origin of the outbreak viral strains, we sequenced the VP1 genes of 29 viral strains from clinical patients and environmental samples. Sequence alignments and phylogenetic analyses based on VP1 gene sequences revealed that virus strains isolated from the sewage of Guangzhou and Luoding cities matched well the clinical strains from the outbreak, with high nucleotide sequence similarity (98.5% to 100%) and similar cluster distribution. Five ECHO30 clinical strains were clustered with the Guangdong environmental strains but diverged from strains from other regions, suggesting that this subcluster of viruses most likely originated from the circulating virus in Guangdong rather than having been more recently imported from other regions. These findings underscore the importance of long-term, continuous environmental surveillance and genetic analysis to monitor circulating enteroviruses. PMID:25616804

Whole Genome Sequence Analysis of an Alachlor and Endosulfan Degrading Micrococcus sp. strain 2385 Isolated from Ochlockonee River, Florida.

PubMed

Pathak, Ashish; Chauhan, Ashvini; Ewida, Ayman Y I; Stothard, Paul

2016-01-01

We recently isolated Micrococcus sp. strain 2385 from Ochlockonee River, Florida and demonstrated potent biodegradative activity against two commonly used pesticides- alachlor [(2-chloro-2`,6`-diethylphenyl-N (methoxymethyl)acetanilide)] and endosulfan [(6,7,8,9,10,10-hexachloro-1,5,5a,6,9,9a-hexahydro-6,9methano-2,3,4-benzo(e)di-oxathiepin-3-oxide], respectively. To further identify the repertoire of metabolic functions possessed by strain 2385, a draft genome sequence was obtained, assembled, annotated and analyzed. The genome sequence of Micrococcus sp. strain 2385 consisted of 1,460,461,440 bases which assembled into 175 contigs with an N50 contig length of 50,109 bases and a coverage of 600x. The genome size of this strain was estimated at 2,431,226 base pairs with a G+C content of 72.8 and a total number of 2,268 putative genes. RAST annotated a total of 340 subsystems in the genome of strain 2385 along with the presence of 2,177 coding sequences. A genome wide survey indicated that that strain 2385 harbors a plethora of genes to degrade other pollutants including caprolactam, PAHs (such as naphthalene), styrene, toluene and several chloroaromatic compounds.

The murine Cd48 gene: allelic polymorphism in the IgV-like region.

PubMed

Cabrero, J G; Freeman, G J; Reiser, H

1998-12-01

The murine CD48 molecule is a member of the immunoglobulin superfamily which regulates the activation of T lymphocytes. prior cloning experiments using mRNA from two different mouse strains had yielded discrepant sequences within the IgV-like domain of murine CD48. To resolve this issue, we have directly sequenced genomic DNA of 10 laboratory strains and two inbred strains of wild origin. The results of our analysis reveal an allelic polymorphism within the IgV-like domain of murine CD48.

Multilocus Sequence Analysis and rpoB Sequencing of Mycobacterium abscessus (Sensu Lato) Strains▿

PubMed Central

Macheras, Edouard; Roux, Anne-Laure; Bastian, Sylvaine; Leão, Sylvia Cardoso; Palaci, Moises; Sivadon-Tardy, Valérie; Gutierrez, Cristina; Richter, Elvira; Rüsch-Gerdes, Sabine; Pfyffer, Gaby; Bodmer, Thomas; Cambau, Emmanuelle; Gaillard, Jean-Louis; Heym, Beate

2011-01-01

Mycobacterium abscessus, Mycobacterium bolletii, and Mycobacterium massiliense (Mycobacterium abscessus sensu lato) are closely related species that currently are identified by the sequencing of the rpoB gene. However, recent studies show that rpoB sequencing alone is insufficient to discriminate between these species, and some authors have questioned their current taxonomic classification. We studied here a large collection of M. abscessus (sensu lato) strains by partial rpoB sequencing (752 bp) and multilocus sequence analysis (MLSA). The final MLSA scheme developed was based on the partial sequences of eight housekeeping genes: argH, cya, glpK, gnd, murC, pgm, pta, and purH. The strains studied included the three type strains (M. abscessus CIP 104536T, M. massiliense CIP 108297T, and M. bolletii CIP 108541T) and 120 isolates recovered between 1997 and 2007 in France, Germany, Switzerland, and Brazil. The rpoB phylogenetic tree confirmed the existence of three main clusters, each comprising the type strain of one species. However, divergence values between the M. massiliense and M. bolletii clusters all were below 3% and between the M. abscessus and M. massiliense clusters were from 2.66 to 3.59%. The tree produced using the concatenated MLSA gene sequences (4,071 bp) also showed three main clusters, each comprising the type strain of one species. The M. abscessus cluster had a bootstrap value of 100% and was mostly compact. Bootstrap values for the M. massiliense and M. bolletii branches were much lower (71 and 61%, respectively), with the M. massiliense cluster having a fuzzy aspect. Mean (range) divergence values were 2.17% (1.13 to 2.58%) between the M. abscessus and M. massiliense clusters, 2.37% (1.5 to 2.85%) between the M. abscessus and M. bolletii clusters, and 2.28% (0.86 to 2.68%) between the M. massiliense and M. bolletii clusters. Adding the rpoB sequence to the MLSA-concatenated sequence (total sequence, 4,823 bp) had little effect on the clustering of strains. We found 10/120 (8.3%) isolates for which the concatenated MLSA gene sequence and rpoB sequence were discordant (e.g., M. massiliense MLSA sequence and M. abscessus rpoB sequence), suggesting the intergroup lateral transfers of rpoB. In conclusion, our study strongly supports the recent proposal that M. abscessus, M. massiliense, and M. bolletii should constitute a single species. Our findings also indicate that there has been a horizontal transfer of rpoB sequences between these subgroups, precluding the use of rpoB sequencing alone for the accurate identification of the two proposed M. abscessus subspecies. PMID:21106786

Full-length genome characterization and genetic relatedness analysis of hepatitis A virus outbreak strains associated with acute liver failure among children.

PubMed

Vaughan, Gilberto; Forbi, Joseph C; Xia, Guo-Liang; Fonseca-Ford, Maureen; Vazquez, Roberto; Khudyakov, Yury E; Montiel, Sonia; Waterman, Steve; Alpuche, Celia; Gonçalves Rossi, Livia Maria; Luna, Norma

2014-02-01

Clinical infection by hepatitis A virus (HAV) is generally self-limited but in some cases can progress to liver failure. Here, an HAV outbreak investigation among children with acute liver failure in a highly endemic country is presented. In addition, a sensitive method for HAV whole genome amplification and sequencing suitable for analysis of clinical samples is described. In this setting, two fatal cases attributed to acute liver failure and two asymptomatic cases living in the same household were identified. In a second household, one HAV case was observed with jaundice which resolved spontaneously. Partial molecular characterization showed that both households were infected by HAV subtype IA; however, the infecting strains in the two households were different. The HAV outbreak strains recovered from all cases grouped together within cluster IA1, which contains closely related HAV strains from the United States commonly associated with international travelers. Full-genome HAV sequences obtained from the household with the acute liver failure cases were related (genetic distances ranging from 0.01% to 0.04%), indicating a common-source infection. Interestingly, the strain recovered from the asymptomatic household contact was nearly identical to the strain causing acute liver failure. The whole genome sequence from the case in the second household was distinctly different from the strains associated with acute liver failure. Thus, infection with almost identical HAV strains resulted in drastically different clinical outcomes. © 2013 Wiley Periodicals, Inc.

Mycobacterium leprae genomes from a British medieval leprosy hospital: towards understanding an ancient epidemic.

PubMed

Mendum, Tom A; Schuenemann, Verena J; Roffey, Simon; Taylor, G Michael; Wu, Huihai; Singh, Pushpendra; Tucker, Katie; Hinds, Jason; Cole, Stewart T; Kierzek, Andrzej M; Nieselt, Kay; Krause, Johannes; Stewart, Graham R

2014-04-08

Leprosy has afflicted humankind throughout history leaving evidence in both early texts and the archaeological record. In Britain, leprosy was widespread throughout the Middle Ages until its gradual and unexplained decline between the 14th and 16th centuries. The nature of this ancient endemic leprosy and its relationship to modern strains is only partly understood. Modern leprosy strains are currently divided into 5 phylogenetic groups, types 0 to 4, each with strong geographical links. Until recently, European strains, both ancient and modern, were thought to be exclusively type 3 strains. However, evidence for type 2 strains, a group normally associated with Central Asia and the Middle East, has recently been found in archaeological samples in Scandinavia and from two skeletons from the medieval leprosy hospital (or leprosarium) of St Mary Magdalen, near Winchester, England. Here we report the genotypic analysis and whole genome sequencing of two further ancient M. leprae genomes extracted from the remains of two individuals, Sk14 and Sk27, that were excavated from 10th-12th century burials at the leprosarium of St Mary Magdalen. DNA was extracted from the surfaces of bones showing osteological signs of leprosy. Known M. leprae polymorphisms were PCR amplified and Sanger sequenced, while draft genomes were generated by enriching for M. leprae DNA, and Illumina sequencing. SNP-typing and phylogenetic analysis of the draft genomes placed both of these ancient strains in the conserved type 2 group, with very few novel SNPs compared to other ancient or modern strains. The genomes of the two newly sequenced M. leprae strains group firmly with other type 2F strains. Moreover, the M. leprae strain most closely related to one of the strains, Sk14, in the worldwide phylogeny is a contemporaneous ancient St Magdalen skeleton, vividly illustrating the epidemic and clonal nature of leprosy at this site. The prevalence of these type 2 strains indicates that type 2F strains, in contrast to later European and associated North American type 3 isolates, may have been the co-dominant or even the predominant genotype at this location during the 11th century.

Comparison and Evaluation of the Molecular Typing Methods for Toxigenic Vibrio cholerae in Southwest China.

PubMed

Liao, Feng; Mo, Zhishuo; Chen, Meiling; Pang, Bo; Fu, Xiaoqing; Xu, Wen; Jing, Huaiqi; Kan, Biao; Gu, Wenpeng

2018-01-01

Vibrio cholerae O1 strains taken from the repository of Yunnan province, southwest China, were abundant and special. We selected 70 typical toxigenic V. cholerae (69 O1 and one O139 serogroup strains) isolated from Yunnan province, performed the pulsed field gel electrophoresis (PFGE), multilocus sequence typing (MLST), and MLST of virulence gene (V-MLST) methods, and evaluated the resolution abilities for typing methods. The ctxB subunit sequence analysis for all strains have shown that cholera between 1986 and 1995 was associated with mixed infections with El Tor and El Tor variants, while infections after 1996 were all caused by El Tor variant strains. Seventy V. cholerae obtained 50 PFGE patterns, with a high resolution. The strains could be divided into three groups with predominance of strains isolated during 1980s, 1990s, and 2000s, respectively, showing a good consistency with the epidemiological investigation. We also evaluated two MLST method for V. cholerae , one was used seven housekeeping genes ( adk , gyrB , metE , pntA , mdh , purM , and pyrC ), and all the isolates belonged to ST69; another was used nine housekeeping genes ( cat , chi , dnaE , gyrB , lap , pgm , recA , rstA , and gmd ). A total of seven sequence types (STs) were found by using this method for all the strains; among them, rstA gene had five alleles, recA and gmd have two alleles, and others had only one allele. The virulence gene sequence typing method ( ctxAB , tcpA , and toxR ) showed that 70 strains were divided into nine STs; among them, tcpA gene had six alleles, toxR had five alleles, while ctxAB was identical for all the strains. The latter two sequences based typing methods also had consistency with epidemiology of the strains. PFGE had a higher resolution ability compared with the sequence based typing method, and MLST used seven housekeeping genes showed the lower resolution power than nine housekeeping genes and virulence genes methods. These two sequence typing methods could distinguish some epidemiological special strains in local area.

Genetic Diversity Among Botulinum Neurotoxin Producing Clostridial Strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hill, K K; Smith, T J; Helma, C H

2006-07-06

Clostridium botulinum is a taxonomic designation for many diverse anaerobic spore forming rod-shaped bacteria which have the common property of producing botulinum neurotoxins (BoNTs). The BoNTs are exoneurotoxins that can cause severe paralysis and even death in humans and various other animal species. A collection of 174 C. botulinum strains were examined by amplified fragment length polymorphism (AFLP) analysis and by sequencing of the 16S rRNA gene and BoNT genes to examine genetic diversity within this species. This collection contained representatives of each of the seven different serotypes of botulinum neurotoxins (BoNT A-G). Analysis of the16S rRNA sequences confirmed earliermore » reports of at least four distinct genomic backgrounds (Groups I-IV) each of which has independently acquired one or more BoNT serotypes through horizontal gene transfer. AFLP analysis provided higher resolution, and can be used to further subdivide the four groups into sub-groups. Sequencing of the BoNT genes from serotypes A, B and E in multiple strains confirmed significant sequence variation within each serotype. Four distinct lineages within each of the BoNT A and B serotypes, and five distinct lineages of serotype E strains were identified. The nucleotide sequences of the seven serotypes of BoNT were compared and show varying degrees of interrelatedness and recombination as has been previously noted for the NTNH gene which is linked to BoNT. These analyses contribute to the understanding of the evolution and phylogeny within this species and assist in the development of improved diagnostics and therapeutics for treatment of botulism.« less

Genome analysis and physiological comparison of Alicycliphilus denitrificans strains BC and K601T

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oosterkamp, Margreet J.; Veuskens, Teun; Saia, Flavia Talarico

2013-01-01

The genomes of the Betaproteobacteria Alicycliphilus denitrificans strains BC and K601T have been sequenced to get insight into the physiology of the two strains. Strain BC degrades benzene with chlorate as electron acceptor. The cyclohexanol-degrading denitrifying strain K601T is not able to use chlorate as electron acceptor, while strain BC cannot degrade cyclohexanol. The 16S rRNA sequences of strains BC and K601T are identical and the fatty acid methyl ester patterns of the strains are similar. Basic Local Alignment Search Tool (BLAST) analysis of predicted open reading frames of both strains showed most hits with Acidovorax sp. JS42, a bacteriummore » that degrades nitro-aromatics. The genomes include strain-specific plasmids (pAlide201 in strain K601T and pAlide01 and pAlide02 in strain BC). Key genes of chlorate reduction in strain BC were located on a 120 kb megaplasmid (pAlide01), which was absent in strain K601T. Genes involved in cyclohexanol degradation were only found in strain K601T. Benzene and toluene are degraded via oxygenase-mediated pathways in both strains. Genes involved in the meta-cleavage pathway of catechol are present in the genomes of both strains. Strain BC also contains all genes of the ortho-cleavage pathway. The large number of mono- and dioxygenase genes in the genomes suggests that the two strains have a broader substrate range than known thus far.« less

Genome Analysis and Physiological Comparison of Alicycliphilus denitrificans Strains BC and K601T

PubMed Central

Talarico Saia, Flávia; Weelink, Sander A. B.; Goodwin, Lynne A.; Daligault, Hajnalka E.; Bruce, David C.; Detter, John C.; Tapia, Roxanne; Han, Cliff S.; Land, Miriam L.; Hauser, Loren J.; Langenhoff, Alette A. M.; Gerritse, Jan; van Berkel, Willem J. H.; Pieper, Dietmar H.; Junca, Howard; Smidt, Hauke; Schraa, Gosse; Davids, Mark; Schaap, Peter J.; Plugge, Caroline M.; Stams, Alfons J. M.

2013-01-01

The genomes of the Betaproteobacteria Alicycliphilus denitrificans strains BC and K601T have been sequenced to get insight into the physiology of the two strains. Strain BC degrades benzene with chlorate as electron acceptor. The cyclohexanol-degrading denitrifying strain K601T is not able to use chlorate as electron acceptor, while strain BC cannot degrade cyclohexanol. The 16S rRNA sequences of strains BC and K601T are identical and the fatty acid methyl ester patterns of the strains are similar. Basic Local Alignment Search Tool (BLAST) analysis of predicted open reading frames of both strains showed most hits with Acidovorax sp. JS42, a bacterium that degrades nitro-aromatics. The genomes include strain-specific plasmids (pAlide201 in strain K601T and pAlide01 and pAlide02 in strain BC). Key genes of chlorate reduction in strain BC were located on a 120 kb megaplasmid (pAlide01), which was absent in strain K601T. Genes involved in cyclohexanol degradation were only found in strain K601T. Benzene and toluene are degraded via oxygenase-mediated pathways in both strains. Genes involved in the meta-cleavage pathway of catechol are present in the genomes of both strains. Strain BC also contains all genes of the ortho-cleavage pathway. The large number of mono- and dioxygenase genes in the genomes suggests that the two strains have a broader substrate range than known thus far. PMID:23825601

Analysis of Haemophilus influenzae serotype f isolated from three Japanese children with invasive H. influenzae infection.

PubMed

Hoshino, Tadashi; Hachisu, Yushi; Kikuchi, Takashi; Tokutake, Shoko; Okui, Hideyuki; Kutsuna, Satoru; Fukasawa, Chie; Murayama, Kei; Oohara, Asami; Shimizu, Hiroyuki; Ito, Midori; Takahashi, Yoshiko; Ishiwada, Naruhiko

2015-04-01

In Japan, publicly subsidized Haemophilus influenzae serotype b vaccines became available in 2011; consequently, the incidence of invasive H. influenzae infection in paediatric patients of less than 5 years of age decreased dramatically. In 2013, the first case of H. influenzae serotype f (Hif) meningitis in a Japanese infant was reported, and another case of Hif meningitis in a Japanese infant was observed in 2013. We experienced a fatal paediatric case of Hif bacteraemia in 2004; therefore, we conducted an analysis of the three Hif strains isolated from these three Japanese children with invasive Hif infections. All three strains were β-lactamase-non-producing, ampicillin-sensitive strains, with MICs of 1 µg ml(-1) or less. However, one of the three strains showed slightly elevated MICs for ampicillin (1 µg ml(-1)), cefotaxime (0.25 µg ml(-1)) and meropenem (0.13 µg ml(-1)). A molecular analysis by multilocus sequence typing identified all three strains as sequence type (ST) 124, which is a predominant invasive Hif strain in many countries. SmaI-digested PFGE showed variable DNA fragmentation patterns among the strains, suggesting that some highly virulent strains have originated from a single ST124 clone and caused invasive Hif infections in Japan. Additional studies are needed to determine the factors that have led to the clonal expansion of virulent ST124 strains. © 2015 The Authors.

Bacillus nealsonii sp. nov., isolated from a spacecraft-assembly facility, whose spores are gamma-radiation resistant

NASA Technical Reports Server (NTRS)

Venkateswaran, Kasthuri; Kempf, Michael; Chen, Fei; Satomi, Masataka; Nicholson, Wayne; Kern, Roger

2003-01-01

One of the spore-formers isolated from a spacecraft-assembly facility, belonging to the genus Bacillus, is described on the basis of phenotypic characterization, 16S rDNA sequence analysis and DNA-DNA hybridization studies. It is a Gram-positive, facultatively anaerobic, rod-shaped eubacterium that produces endospores. The spores of this novel bacterial species exhibited resistance to UV, gamma-radiation, H2O2 and desiccation. The 18S rDNA sequence analysis revealed a clear affiliation between this strain and members of the low G+C Firmicutes. High 16S rDNA sequence similarity values were found with members of the genus Bacillus and this was supported by fatty acid profiles. The 16S rDNA sequence similarity between strain FO-92T and Bacillus benzoevorans DSM 5391T was very high. However, molecular characterizations employing small-subunit 16S rDNA sequences were at the limits of resolution for the differentiation of species in this genus, but DNA-DNA hybridization data support the proposal of FO-92T as Bacillus nealsonii sp. nov. (type strain is FO-92T =ATCC BAAM-519T =DSM 15077T).

Phylogenetic analysis of family Neisseriaceae based on genome sequences and description of Populibacter corticis gen. nov., sp. nov., a member of the family Neisseriaceae, isolated from symptomatic bark of Populus × euramericana canker.

PubMed

Li, Yong; Xue, Han; Sang, Sheng-Qi; Lin, Cai-Li; Wang, Xi-Zhuo

2017-01-01

Two Gram-stain negative aerobic bacterial strains were isolated from the bark tissue of Populus × euramericana. The novel isolates were investigated using a polyphasic approach including 16S rRNA gene sequencing, genome sequencing, average nucleotide identity (ANI) and both phenotypic and chemotaxonomic assays. The genome core gene sequence and 16S rRNA gene phylogenies suggest that the novel isolates are different from the genera Snodgrassella and Stenoxybacter. Additionally, the ANI, G+C content, main fatty acids and phospholipid profile data supported the distinctiveness of the novel strain from genus Snodgrassella. Therefore, based on the data presented, the strains constitute a novel species of a novel genus within the family Neisseriaceae, for which the name Populibacter corticis gen. nov., sp. nov. is proposed. The type strain is 15-3-5T (= CFCC 13594T = KCTC 42251T).

[Sequence-based typing of enviromental Legionella pneumophila isolates in Guangzhou].

PubMed

Zhang, Ying; Qu, Pinghua; Zhang, Jian; Chen, Shouyi

2011-03-01

To characterize the genes of Legionella pneumophila isolated from different water source in Guangzhou from 2006 to 2009. To genotype the strains by using sequence-based typing (SBT) scheme. In total 44 L. pneumophila strains were identified by SBT with 7 diversifying genes of flaA, asd, mip, pilE, mompS, proA and neuA. Analysis of the amplicons sequence was taken in the European Working Group for Legionella Infections (EWGLI) international SBT database to obtain the allelic profiles and sequence types (STs). Serogroups were typed by latex agglutination test. Data from SBT revealed a high diversity among the strains and ST01 accounts for 30% (13/ 44). Fifteen new STs were discovered from 20 STs and 2 of them were newly assigned (ST887 and ST888) by EWGLI. SBT Phylogenetic tree was generated by SplitsTree and BURST programs. High diversity and specificity were observed of the L. pneumophila strains in Guangzhou. SBT is useful for L. pneumophila genomic study and epidemiological surveillance.

Outbreak of poliomyelitis in Finland in 1984-85 - Re-analysis of viral sequences using the current standard approach.

PubMed

Simonen, Marja-Leena; Roivainen, Merja; Iber, Jane; Burns, Cara; Hovi, Tapani

2010-01-01

In 1984, a wild type 3 poliovirus (PV3/FIN84) spread all over Finland causing nine cases of paralytic poliomyelitis and one case of aseptic meningitis. The outbreak was ended in 1985 with an intensive vaccination campaign. By limited sequence comparison with previously isolated PV3 strains, closest relatives of PV3/FIN84 were found among strains circulating in the Mediterranean region. Now we wanted to reanalyse the relationships using approaches currently exploited in poliovirus surveillance. Cell lysates of 22 strains isolated during the outbreak and stored frozen were subjected to RT-PCR amplification in three genomic regions without prior subculture. Sequences of the entire VP1 coding region, 150 nucleotides in the VP1-2A junction, most of the 5' non-coding region, partial sequences of the 3D RNA polymerase coding region and partial 3' non-coding region were compared within the outbreak and with sequences available in data banks. In addition, complete nucleotide sequences were obtained for 2 strains isolated from two different cases of disease during the outbreak. The results confirmed the previously described wide intraepidemic variation of the strains, including amino acid substitutions in antigenic sites, as well as the likely Mediterranean region origin of the strains. Simplot and bootscanning analyses of the complete genomes indicated complicated evolutionary history of the non-capsid coding regions of the genome suggesting several recombinations with different HEV-C viruses in the past.

Phylogenetic analysis of Austrian canine distemper virus strains from clinical samples from dogs and wild carnivores.

PubMed

Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K

2011-04-09

Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.

Strain-specific and pooled genome sequences for populations of Drosophila melanogaster from three continents.

PubMed Central

Bergman, Casey M.; Haddrill, Penelope R.

2015-01-01

To contribute to our general understanding of the evolutionary forces that shape variation in genome sequences in nature, we have sequenced genomes from 50 isofemale lines and six pooled samples from populations of Drosophila melanogaster on three continents. Analysis of raw and reference-mapped reads indicates the quality of these genomic sequence data is very high. Comparison of the predicted and experimentally-determined Wolbachia infection status of these samples suggests that strain or sample swaps are unlikely to have occurred in the generation of these data. Genome sequences are freely available in the European Nucleotide Archive under accession ERP009059. Isofemale lines can be obtained from the Drosophila Species Stock Center. PMID:25717372

Strain-specific and pooled genome sequences for populations of Drosophila melanogaster from three continents.

PubMed

Bergman, Casey M; Haddrill, Penelope R

2015-01-01

To contribute to our general understanding of the evolutionary forces that shape variation in genome sequences in nature, we have sequenced genomes from 50 isofemale lines and six pooled samples from populations of Drosophila melanogaster on three continents. Analysis of raw and reference-mapped reads indicates the quality of these genomic sequence data is very high. Comparison of the predicted and experimentally-determined Wolbachia infection status of these samples suggests that strain or sample swaps are unlikely to have occurred in the generation of these data. Genome sequences are freely available in the European Nucleotide Archive under accession ERP009059. Isofemale lines can be obtained from the Drosophila Species Stock Center.

Comparisons of Native and Chimeric Shiga Toxins Indicate that the Binding Subunit Dictates Degree of Toxicity

DTIC Science & Technology

2014-03-17

to the original BXD panel as BXD strains 43-103 (218). The genomes of both founder strains, B6 (308) and D2 (47; 307), have been sequenced and 1.8... sequencing of the DBA/2J mouse genome . BMC.Bioinformatics. 11 :07 308. Waterston RH, Lindblad-Toh K, Birney E, Rogers J, Abril JF, et al. 2002. Initial... sequencing and comparative analysis of the mouse genome . Nature 420:520-62 309. Weeratna RD, Doyle MP. 1991. Detection and production of verotoxin 1

Discrimination of probiotic Lactobacillus strains for poultry by repetitive sequenced-based PCR fingerprinting.

PubMed

Lee, Chin Mei; Sieo, Chin Chin; Cheah, Yoke-Kqueen; Abdullah, Norhani; Ho, Yin Wan

2012-02-01

Four repetitive element sequence-based polymerase chain reaction (rep-PCR) methods, namely repetitive extragenic palindromic PCR (REP-PCR), enterobacterial repetitive intergenic consensus PCR (ERIC-PCR), polytrinucleotide (GTG)₅ -PCR and BOX-PCR, were evaluated for the molecular differentiation of 12 probiotic Lactobacillus strains previously isolated from the gastrointestinal tract of chickens and used as a multistrain probiotic. This study represents the first analysis of the comparative efficacy of these four rep-PCR methods and their combination (composite rep-PCR) in the molecular typing of Lactobacillus strains based on a discriminatory index (D). Species-specific and strain-specific profiles were observed from rep-PCR. From the numerical analysis of composite rep-PCR, BOX-PCR, (GTG)₅ -PCR, REP-PCR and ERIC-PCR, D values of 0.9118, 0.9044, 0.8897, 0.8750 and 0.8529 respectively were obtained. Composite rep-PCR analysis was the most discriminative method, with eight Lactobacillus strains, namely L. brevis ATCC 14869(T) , L. reuteri C 10, L. reuteri ATCC 23272(T) , L. gallinarum ATCC 33199(T) , L. salivarius ATCC 11741(T) , L. salivarius I 24, L. panis JCM 11053(T) and L. panis C 17, being differentiated at the strain level. Composite rep-PCR analysis is potentially a useful fingerprinting method to discriminate probiotic Lactobacillus strains isolated from the gastrointestinal tract of chickens. Copyright © 2011 Society of Chemical Industry.

Starmerella reginensis f.a., sp. nov. and Starmerella kourouensis f.a., sp. nov., isolated from flowers in French Guiana.

PubMed

Amoikon, Tiemele Laurent Simon; Grondin, Cécile; Djéni, Théodore N'Dédé; Jacques, Noémie; Casaregola, Serge

2018-05-21

Analysis of yeasts isolated from various biotopes in French Guiana led to the identification of two strains isolated from flowers and designated CLIB 1634 T and CLIB 1707 T . Comparison of the D1/D2 domain of the large subunit (LSU D1/D2) rRNA gene sequences of CLIB 1634 T and CLIB 1707 T to those in the GenBank database revealed that these strains belong to the Starmerella clade. Strain CLIB 1634 T was shown to diverge from the closely related Starmerella apicola type strain CBS 2868 T with a sequence divergence of 1.34 and 1.30 %, in the LSU D1/D2 rRNA gene and internal transcribed spacer (ITS) sequences respectively. Strain CLIB 1634 T and Candida apicola CBS 2868 T diverged by 3.81 and 14.96 % at the level of the protein-coding gene partial sequences EF-1α and RPB2, respectively. CLIB 1707 T was found to have sequence divergence of 3.88 and 9.16 % in the LSU D1/D2 rRNA gene and ITS, respectively, from that of the most closely related species Starmerella ratchasimensis type strain CBS 10611 T . The species Starmerella reginensis f.a., sp. nov. and Starmerella kourouensis f.a., sp. nov. are proposed to accommodate strains CLIB 1634 T (=CBS 15247 T ) and CLIB 1707 T (=CBS 15257 T ), respectively.

Salinispirillum marinum gen. nov., sp. nov., a haloalkaliphilic bacterium in the family 'Saccharospirillaceae'.

PubMed

Shahinpei, Azadeh; Amoozegar, Mohammad Ali; Fazeli, Seyed Abolhassan Shahzadeh; Schumann, Peter; Ventosa, Antonio

2014-11-01

A novel Gram-staining-negative, motile, non-pigmented, facultatively anaerobic, spirillum-shaped, halophilic and alkaliphilic bacterium, designated strain GCWy1(T), was isolated from water of the coastal-marine wetland Gomishan in Iran. The strain was able to grow at NaCl concentrations of 1-10% (w/v) and optimal growth was achieved at 3% (w/v). The optimum pH and temperature for growth were pH 8.5 and 30 °C, while the strain was able to grow at pH 7.5-10 and 4-40 °C. Phylogenetic analysis based on the comparison of the 16S rRNA gene sequence placed the isolate within the class Gammaproteobacteria as a separate deep branch, with 92.1% or lower sequence similarity to representatives of the genera Saccharospirillum and Reinekea and less than 91.0% sequence similarity with other remotely related genera. The major cellular fatty acids of the isolate were C(18 : 1)ω7c, C(16:0) and C(17 : 0), and the major components of its polar lipid profile were diphosphatidylglycerol, phosphatidylglycerol and phosphatidylethanolamine. The cells of strain GCWy1(T) contained the isoprenoid quinones Q-9 and Q-8 (81% and 2%, respectively). The G+C content of the genomic DNA of this strain was 52.3 mol%. On the basis of 16S rRNA gene sequence analysis in combination with chemotaxonomic and phenotypic data, strain GCWy1(T) represents a novel species in a new genus in the family 'Saccharospirillaceae', order Oceanospirillales, for which the name Salinispirillum marinum gen. nov., sp. nov. is proposed. The type strain of the type species is GCWy1(T) ( = IBRC-M 10765(T) =CECT 8342(T)). © 2014 IUMS.

Complete genome sequence of Corynebacterium glutamicum CP, a Chinese l-leucine producing strain.

PubMed

Gui, Yongli; Ma, Yuechao; Xu, Qingyang; Zhang, Chenglin; Xie, Xixian; Chen, Ning

2016-02-20

Here, we report the complete genome sequence of Corynebacterium glutamicum CP, an industrial l-leucine producing strain in China. The whole genome consists of a circular chromosome and a plasmid. The comparative genomics analysis shows that there are many mutations in the key enzyme coding genes relevant to l-leucine biosynthesis compared to C. glutamicum ATCC 13032. Copyright © 2016 Elsevier B.V. All rights reserved.

Molecular Characterization of Two Lactate Dehydrogenase Genes with a Novel Structural Organization on the Genome of Lactobacillus sp. Strain MONT4

PubMed Central

Weekes, Jennifer; Yüksel, Gülhan Ü.

2004-01-01

Two lactate dehydrogenase (ldh) genes from Lactobacillus sp. strain MONT4 were cloned by complementation in Escherichia coli DC1368 (ldh pfl) and were sequenced. The sequence analysis revealed a novel genomic organization of the ldh genes. Subcloning of the individual ldh genes and their Northern blot analyses indicated that the genes are monocistronic. PMID:15466577

Transfer of Bacillus halodenitrificans Denariaz et al. 1989 to the genus Virgibacillus as Virgibacillus halodenitrificans comb. nov.

PubMed

Yoon, Jung-Hoon; Oh, Tae-Kwang; Park, Yong-Ha

2004-11-01

A Gram-variable, endospore-forming moderately halophilic rod, strain SF-121, was isolated from a marine solar saltern of the Yellow Sea in Korea. The result of 16S rRNA gene sequence analysis showed that strain SF-121 has highest sequence similarity (99.7 %) with the type strain of Bacillus halodenitrificans. Phylogenetic analyses based on 16S rRNA gene sequences revealed that B. halodenitrificans DSM 10037(T) and strain SF-121 are more closely related to the genus Virgibacillus than to the genus Bacillus. Strain SF-121 and B. halodenitrificans DSM 10037(T) exhibited 16S rRNA gene similarity levels of 95.3-97.5 % with the type strains of Virgibacillus species and 94.0 % with the type strain of Bacillus subtilis. DNA-DNA relatedness and phenotypic data indicated that B. halodenitrificans DSM 10037(T) and strain SF-121 are members of the same species. B. halodenitrificans DSM 10037(T) and strain SF-121 exhibited DNA-DNA relatedness values of 9-11 % with the type strains of Virgibacillus carmonensis and Virgibacillus marismortui. On the basis of the phenotypic, chemotaxonomic, phylogenetic and genetic data, B. halodenitrificans should be reclassified in the genus Virgibacillus as Virgibacillus halodenitrificans comb. nov.

Microvirga vignae sp. nov., a root nodule symbiotic bacterium isolated from cowpea grown in semi-arid Brazil.

PubMed

Radl, Viviane; Simões-Araújo, Jean Luiz; Leite, Jakson; Passos, Samuel Ribeiro; Martins, Lindete Míria Vieira; Xavier, Gustavo Ribeiro; Rumjanek, Norma Gouvêa; Baldani, José Ivo; Zilli, Jerri Edson

2014-03-01

16S rRNA gene sequence analysis of eight strains (BR 3299(T), BR 3296, BR 10192, BR 10193, BR 10194, BR 10195, BR 10196 and BR 10197) isolated from nodules of cowpea collected from a semi-arid region of Brazil showed 97 % similarity to sequences of recently described rhizobial species of the genus Microvirga. Phylogenetic analyses of four housekeeping genes (gyrB, recA, dnaK and rpoB), DNA-DNA relatedness and AFLP further indicated that these strains belong to a novel species within the genus Microvirga. Our data support the hypothesis that genes related to nitrogen fixation were obtained via horizontal gene transfer, as sequences of nifH genes were very similar to those found in members of the genera Rhizobium and Mesorhizobium, which are not immediate relatives of the genus Microvirga, as shown by 16S rRNA gene sequence analysis. Phenotypic traits, such as host range and carbon utilization, differentiate the novel strains from the most closely related species, Microvirga lotononidis, Microvirga zambiensis and Microvirga lupini. Therefore, these symbiotic nitrogen-fixing bacteria are proposed to be representatives of a novel species, for which the name Microvirga vignae sp. nov. is suggested. The type strain is BR3299(T) ( = HAMBI 3457(T)).

Sequence analysis of the GP, NP, VP40 and VP24 genes of Ebola virus isolated from deceased, surviving and asymptomatically infected individuals during the 1996 outbreak in Gabon: comparative studies and phylogenetic characterization.

PubMed

Leroy, Eric M; Baize, Sylvain; Mavoungou, Elie; Apetrei, Cristian

2002-01-01

The aims of this study were to determine if the clinical outcome of Ebola virus (EBOV) infection is associated with virus genetic structure and to document the genetic changes in the Gabon strains of EBOV by sequencing the GP, NP, VP40 and VP24 genes from deceased and surviving symptomatic and asymptomatic individuals. GP and NP sequences were identical in the three groups of patients and only one silent substitution occurred in the VP40 and VP24 genes in asymptomatic individuals. A strain from an asymptomatic individual had a reverse substitution to the Gabon-94 sequence, indicating that minor virus variants may cocirculate during an outbreak. These results suggest that the different clinical outcomes of EBOV infection do not result from virus mutations. Phylogenetic analysis confirmed that Gabon-96 belonged to the Zaire subtype of EBOV and revealed that synonymous substitution rates were higher than nonsynonymous substitution rates in the GP, VP40 and VP24 genes. In contrast, nonsynonymous substitutions predominated over synonymous substitutions in the NP gene of the two Gabon strains, pointing to divergent evolution of these strains and to selective pressures on this gene.

Haemophilus ducreyi Cutaneous Ulcer Strains Diverged from Both Class I and Class II Genital Ulcer Strains: Implications for Epidemiological Studies

PubMed Central

Gangaiah, Dharanesh

2016-01-01

Background Haemophilus ducreyi has emerged as a major cause of cutaneous ulcers (CU) in yaws-endemic regions of the tropics in the South Pacific, South East Asia and Africa. H. ducreyi was once thought only to cause the genital ulcer (GU) disease chancroid; GU strains belong to 2 distinct classes, class I and class II. Using whole-genome sequencing of 4 CU strains from Samoa, 1 from Vanuatu and 1 from Papua New Guinea, we showed that CU strains diverged from the class I strain 35000HP and that one CU strain expressed β-lactamase. Recently, the Center for Disease Control and Prevention released the genomes of 11 additional CU strains from Vanuatu and Ghana; however, the evolutionary relationship of these CU strains to previously-characterized CU and GU strains is unknown. Methodology/Principal Findings We performed phylogenetic analysis of 17 CU and 10 GU strains. Class I and class II GU strains formed two distinct clades. The class I strains formed two subclades, one containing 35000HP and HD183 and the other containing the remainder of the class I strains. Twelve of the CU strains formed a subclone under the class I 35000HP subclade, while 2 CU strains formed a subclone under the other class I subclade. Unexpectedly, 3 of the CU strains formed a subclone under the class II clade. Phylogenetic analysis of dsrA-hgbA-ncaA sequences yielded a tree similar to that of whole-genome phylogenetic tree. Conclusions/Significance CU strains diverged from multiple lineages within both class I and class II GU strains. Multilocus sequence typing of dsrA-hgbA-ncaA could be reliably used for epidemiological investigation of CU and GU strains. As class II strains grow relatively poorly and are relatively more susceptible to vancomycin than class I strains, these findings have implications for methods to recover CU strains. Comparison of contemporary CU and GU isolates would help clarify the relationship between these entities. PMID:28027326

Azospirillum canadense sp. nov., a nitrogen-fixing bacterium isolated from corn rhizosphere.

PubMed

Mehnaz, Samina; Weselowski, Brian; Lazarovits, George

2007-03-01

A free-living diazotrophic strain, DS2(T), was isolated from corn rhizosphere. Polyphasic taxonomy was performed including morphological characterization, Biolog analysis, and 16S rRNA, cpn60 and nifH gene sequence analyses. 16S rRNA gene sequence analysis indicated that strain DS2(T) was closely related to the genus Azospirillum (96 % similarity). Chemotaxonomic characteristics (DNA G+C content 67.9 mol%; Q-10 quinone system; major fatty acid 18 : 1omega7c) were also similar to those of the genus Azospirillum. In all the analyses, including phenotypic characterization using Biolog analysis and comparison of cellular fatty acids, this isolate was found to be different from the closely related species Azospirillum lipoferum, Azospirillum oryzae and Azospirillum brasilense. On the basis of these results, a novel species is proposed for this nitrogen-fixing strain. The name Azospirillum canadense sp. nov. is suggested with the type strain DS2(T) (=NCCB 100108(T)=LMG 23617(T)).

Emergence of a deviating genotype VI pigeon paramyxovirus type-1 isolated from India.

PubMed

Ganar, Ketan; Das, Moushumee; Raut, Ashwin Ashok; Mishra, Anamika; Kumar, Sachin

2017-07-01

Pigeon paramyxovirus type 1 (PPMV-1) is an antigenic variant of avian paramyxovirus type 1 (APMV-1), which infects pigeons. The virus causes high morbidity and mortality, creating an alarming state for the poultry industry. The present work describes the molecular and pathogenic characterization of a PPMV-1 strain isolated from pigeon in Bhopal, India. Complete genome sequence analysis revealed a genome of 15,192 nucleotides encoding six genes organized in the order 3'-N-P-M-F-HN-L-5'. The fusion gene sequence analysis showed the presence of multiple basic amino acids 112 R-R-Q-K-R-F 117 at the cleavage site corresponding to pathogenic strains. The mean death time and intracerebral pathogenicity index values indicated a mesogenic nature for the PPMV-1 isolate. On phylogenetic analysis, the strain clustered with genotype VI viruses, including isolates from pigeon and dove. The Bhopal strain showed significant intra and inter-genotype evolutionary distance, suggesting the emergence of a new sub-genotype, VIj.

[Comparative analysis of variable regions in the genomes of variola virus].

PubMed

Babkin, I V; Nepomniashchikh, T S; Maksiutov, R A; Gutorov, V V; Babkina, I N; Shchelkunov, S N

2008-01-01

Nucleotide sequences of two extended segments of the terminal variable regions in variola virus genome were determined. The size of the left segment was 13.5 kbp and of the right, 10.5 kbp. Totally, over 540 kbp were sequenced for 22 variola virus strains. The conducted phylogenetic analysis and the data published earlier allowed us to find the interrelations between 70 variola virus isolates, the character of their clustering, and the degree of intergroup and intragroup variations of the clusters of variola virus strains. The most polymorphic loci of the genome segments studied were determined. It was demonstrated that that these loci are localized to either noncoding genome regions or to the regions of destroyed open reading frames, characteristic of the ancestor virus. These loci are promising for development of the strategy for genotyping variola virus strains. Analysis of recombination using various methods demonstrated that, with the only exception, no statistically significant recombinational events in the genomes of variola virus strains studied were detectable.

Bacillus infantis sp. nov. and Bacillus idriensis sp. nov., isolated from a patient with neonatal sepsis.

PubMed

Ko, Kwan Soo; Oh, Won Sup; Lee, Mi Young; Lee, Jang Ho; Lee, Hyuck; Peck, Kyong Ran; Lee, Nam Yong; Song, Jae-Hoon

2006-11-01

Two Gram-positive bacilli, designated as strains SMC 4352-1T and SMC 4352-2T, were isolated sequentially from the blood of a newborn child with sepsis. They could not be identified by using conventional clinical microbiological methods. 16S rRNA gene sequencing and phylogenetic analysis revealed that both strains belonged to the genus Bacillus but clearly diverged from known Bacillus species. Strain SMC 4352-1T and strain SMC 4352-2T were found to be closely related to Bacillus firmus NCIMB 9366T (98.2% sequence similarity) and Bacillus cibi JG-30T (97.1% sequence similarity), respectively. They also displayed low DNA-DNA reassociation values (less than 40%) with respect to the most closely related Bacillus species. On the basis of their polyphasic characteristics, strain SMC 4352-1T and strain SMC 4352-2T represent two novel species of the genus Bacillus, for which the names Bacillus infantis sp. nov. (type strain SMC 4352-1T=KCCM 90025T=JCM 13438T) and Bacillus idriensis sp. nov. (type strain SMC 4352-2T=KCCM 90024T=JCM 13437T) are proposed.

Multilocus sequence typing reveals a novel subspeciation of Lactobacillus delbrueckii.

PubMed

Tanigawa, Kana; Watanabe, Koichi

2011-03-01

Currently, the species Lactobacillus delbrueckii is divided into four subspecies, L. delbrueckii subsp. delbrueckii, L. delbrueckii subsp. bulgaricus, L. delbrueckii subsp. indicus and L. delbrueckii subsp. lactis. These classifications were based mainly on phenotypic identification methods and few studies have used genotypic identification methods. As a result, these subspecies have not yet been reliably delineated. In this study, the four subspecies of L. delbrueckii were discriminated by phenotype and by genotypic identification [amplified-fragment length polymorphism (AFLP) and multilocus sequence typing (MLST)] methods. The MLST method developed here was based on the analysis of seven housekeeping genes (fusA, gyrB, hsp60, ileS, pyrG, recA and recG). The MLST method had good discriminatory ability: the 41 strains of L. delbrueckii examined were divided into 34 sequence types, with 29 sequence types represented by only a single strain. The sequence types were divided into eight groups. These groups could be discriminated as representing different subspecies. The results of the AFLP and MLST analyses were consistent. The type strain of L. delbrueckii subsp. delbrueckii, YIT 0080(T), was clearly discriminated from the other strains currently classified as members of this subspecies, which were located close to strains of L. delbrueckii subsp. lactis. The MLST scheme developed in this study should be a useful tool for the identification of strains of L. delbrueckii to the subspecies level.

[Characterization of the genetic variability of field strains of Brucella canis isolated in Antioquia].

PubMed

Vidal Arboleda, Juana L; Ortiz Roman, Luisa F; Olivera Angel, Martha

2017-12-22

Brucella canis is a facultative intracellular pathogen responsible for canine brucellosis, a zoonotic disease that affects canines, causing abortions and reproductive failure; and the production of non-specific symptoms in humans. In 2005 the presence of B. canis in Antioquia was demonstrated and the strains were identified as type 2. The sequencing of the genome of a field strain denoted Brucella canis str. Oliveri, showed species-specific indel events, which led us to investigate the genomic characteristics of the B. canis strain isolated and to establish the phylogenetic relationships and the divergence time of B. canis str. Oliveri. Conventional PCR sequencing was performed in 30 field strains identifying 5 indel events recognized in B. canis str. Oliveri. ADN from Brucella suis, Brucella melitensis and vaccine strains from Brucella abortus were used as control, and it was determined that all of the studied field strains shared 4 out of the 5 indels of the sequenced Oliveri strain, indicating the presence of more than one strain circulating in the region. Phylogenetic analysis was performed with 24 strains of Brucella using concatenated sequences of genetic markers for species differentiation. The molecular clock hypothesis and Tajima's relative rate test were tested, showing that the Oliveri strain, similarly to other canis species, diverged from B. suis. The molecular clock hypothesis between Brucella species was rejected and an evolution rate and a similar genetic distance between the B. canis were demonstrated. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Deduced sequences of the membrane fusion and attachment proteins of canine distemper viruses isolated from dogs and wild animals in Korea.

PubMed

Bae, Chae-Wun; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Lee, Nak-Hyung; Seo, Kun-Ho; Kang, Young-Sun; Park, Choi-Kyu; Choi, In-Soo

2013-08-01

Canine distemper virus (CDV) causes highly contagious respiratory, gastrointestinal, and neurological diseases in wild and domestic animal species. Despite a broad vaccination campaign, the disease is still a serious problem worldwide. In this study, six field CDV strains were isolated from three dogs, two raccoon dogs, and one badger in Korea. The full sequence of the genes encoding fusion (F) and hemagglutinin (H) proteins were compared with those of other CDVs including field and vaccine strains. The phylogenetic analysis for the F and H genes indicated that the two CDV strains isolated from dogs were most closely related to Chinese strains in the Asia-1 genotype. Another four strains were closely related to Japanese strains in the Asia-2 genotype. The six currently isolated strains shared 90.2-92.1% and 88.2-91.8% identities with eight commercial vaccine strains in their nucleotide and amino acid sequences of the F protein, respectively. They also showed 90.1-91.4% and 87.8-90.7% identities with the same vaccine strains in their nucleotide and deduced amino acid sequences of the H protein, respectively. Different N-linked glycosylation sites were identified in the F and H genes of the six isolates from the prototype vaccine strain Onderstepoort. Collectively, these results demonstrate that at least two different CDV genotypes currently exist in Korea. The considerable genetic differences between the vaccine strains and wild-type isolates would be a major factor of the incomplete protection of dogs from CDV infections.

Whole genome sequencing of the monomorphic pathogen Mycobacterium bovis reveals local differentiation of cattle clinical isolates.

PubMed

Lasserre, Moira; Fresia, Pablo; Greif, Gonzalo; Iraola, Gregorio; Castro-Ramos, Miguel; Juambeltz, Arturo; Nuñez, Álvaro; Naya, Hugo; Robello, Carlos; Berná, Luisa

2018-01-02

Bovine tuberculosis (bTB) poses serious risks to animal welfare and economy, as well as to public health as a zoonosis. Its etiological agent, Mycobacterium bovis, belongs to the Mycobacterium tuberculosis complex (MTBC), a group of genetically monomorphic organisms featured by a remarkably high overall nucleotide identity (99.9%). Indeed, this characteristic is of major concern for correct typing and determination of strain-specific traits based on sequence diversity. Due to its historical economic dependence on cattle production, Uruguay is deeply affected by the prevailing incidence of Mycobacterium bovis. With the world's highest number of cattle per human, and its intensive cattle production, Uruguay represents a particularly suited setting to evaluate genomic variability among isolates, and the diversity traits associated to this pathogen. We compared 186 genomes from MTBC strains isolated worldwide, and found a highly structured population in M. bovis. The analysis of 23 new M. bovis genomes, belonging to strains isolated in Uruguay evidenced three groups present in the country. Despite presenting an expected highly conserved genomic structure and sequence, these strains segregate into a clustered manner within the worldwide phylogeny. Analysis of the non-pe/ppe differential areas against a reference genome defined four main sources of variability, namely: regions of difference (RD), variable genes, duplications and novel genes. RDs and variant analysis segregated the strains into clusters that are concordant with their spoligotype identities. Due to its high homoplasy rate, spoligotyping failed to reflect the true genomic diversity among worldwide representative strains, however, it remains a good indicator for closely related populations. This study introduces a comprehensive population structure analysis of worldwide M. bovis isolates. The incorporation and analysis of 23 novel Uruguayan M. bovis genomes, sheds light onto the genomic diversity of this pathogen, evidencing the existence of greater genetic variability among strains than previously contemplated.

Whole genome sequencing analysis of Salmonella enterica serovar Weltevreden isolated from human stool and contaminated food samples collected from the Southern coastal area of China.

PubMed

Li, Baisheng; Yang, Xingfen; Tan, Hailing; Ke, Bixia; He, Dongmei; Wang, Haiyan; Chen, Qiuxia; Ke, Changwen; Zhang, Yonghui

2018-02-02

Salmonella enterica serovar Weltevreden is the most common non-typhoid Salmonella found in South and Southeast Asia. It causes zoonoses worldwide through the consumption of contaminated foods and seafood, and is considered as an important food-borne pathogen in China, especially in the Southern coastal area. We compared the whole genomes of 44 S. Weltevreden strains isolated from human stool and contaminated food samples from Southern Coastal China, in order to investigate their phylogenetic relationships and establish their genetic relatedness to known international strains. ResFinder analysis of the draft genomes of isolated strains detected antimicrobial resistance (AMR) genes in only eight isolates, equivalent to minimum inhibitory concentration assay, and only a few isolates showed resistance to tetracycline, ciprofloxacin or ampicillin. In silico MLST analysis revealed that 43 out of 44 S. Weltevreden strains belonged to sequence type 365 (CC205), the most common sequence type of the serovars. Phylogenetic analysis of the 44 domestic and 26 international isolates suggested that the population of S. Weltevreden could be segregated into six phylogenetic clusters. Cluster I included two strains from food and strains of the "Island Cluster", indicating potential inter-transmission between different countries and regions through foods. The predominant S. Weltevreden isolates obtained from the samples from Southern coastal China were found to be phylogenetically related to strains from Southern East Asia, and formed clusters II-VI. The study has demonstrated that WGS-based analysis may be used to improve our understanding of the epidemiology of this bacterium as part of a food-borne disease surveillance program. The methods used are also more widely applicable to other geographical regions and areas and could therefore be useful for improving our understanding of the international spread of S. Weltevreden on a global scale. Copyright © 2017. Published by Elsevier B.V.

Proteomic Analysis of Lyme Disease: Global Protein Comparison of Three Strains of Borrelia burgdorferi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jacobs, Jon M.; Yang, Xiaohua; Luft, Benjamin J.

2005-04-01

The Borrelia burgdorferi spirochete is the causative agent of Lyme disease, the most common tick-borne disease in the United States. It has been studied extensively to help understand its pathogenicity of infection and how it can persist in different mammalian hosts. We report the proteomic analysis of the archetype B. burgdorferi B31 strain and two other strains (ND40, and JD-1) having different Borrelia pathotypes using strong cation exchange fractionation of proteolytic peptides followed by high-resolution, reversed phase capillary liquid chromatography coupled with ion trap tandem mass spectrometric (LC-MS/MS) analysis. Protein identification was facilitated by the availability of the complete B31more » genome sequence. A total of 665 Borrelia proteins were identified representing ~38 % coverage of the theoretical B31 proteome. A significant overlap was observed between the identified proteins in direct comparisons between any two strains (>72%), but distinct differences were observed among identified hypothetical and outer membrane proteins of the three strains. Such a concurrent proteomic overview of three Borrelia strains based upon only the B31 genome sequence is shown to provide significant insights into the presence or absence of specific proteins and a broad overall comparison among strains.« less

Genetic analysis of the VP2-encoding gene of canine parvovirus strains from Africa.

PubMed

Dogonyaro, Banenat B; Bosman, Anna-Mari; Sibeko, Kgomotso P; Venter, Estelle H; van Vuuren, Moritz

2013-08-30

Since the emergence of canine parvovirus type-2 (CPV-2) in the early 1970s, it has been evolving into novel genetic and antigenic variants (CPV-2a, 2b and 2c) that are unevenly distributed throughout the world. Genetic characterization of CPV-2 has not been documented in Africa since 1998 apart from the study carried out in Tunisia 2009. A total of 139 field samples were collected from South Africa and Nigeria, detected using PCR and the full length VP2-encoding gene of 27 positive samples were sequenced and genetically analyzed. Nigerian samples (n=6), South Africa (n=19) and vaccine strains (n=2) were compared with existing sequences obtained from GenBank. The results showed the presence of both CPV-2a and 2b in South Africa and only CPV-2a in Nigeria. No CPV-2c strain was detected during this study. Phylogenetic analysis showed a clustering not strictly associated with the geographical origin of the analyzed strains, although most of the South African strains tended to cluster together and the viral strains analyzed in this study were not completely distinct from CPV-2 strains from other parts of the world. Amino acid analysis showed predicted amino acid changes. Copyright © 2013 Elsevier B.V. All rights reserved.

[Isolation and identification of the temperate bacteriophage from isolated strains of Streptococcus suis serotype 2].

PubMed

Ma, Yuling; Lu, Chengping; Fan, Hongjie

2008-04-01

A PCR assay was developed to study the distributional characteristics of phage integrase gene in Streptococcus suis serotype 2 (SS2). A 323bp distinct DNA target can be amplified in 25 strains of virulent SS2, while can not be amplified in avirulent strain T15, 5 strains of other serotypes (SS1, SS7, SS9) and strains of group C Streptococcus strains from pigs, which suggested that the phage integrase gene may be related to the pathogenicity of SS2 and can be consider as a detection factor of the virulent gene of SS2. The sequencing and restriction endonuclease analysis of the PCR products were also done. Comparisons between the sequences of phage integrase gene with that of SS2 strain, showed a high homology with SS2 China strains 98HAH33, 05ZYH33 and North American strain 89-1591. Complete cell lysis was observed with SS2 virulent strains but not with avirulent strain T15 after the induction by mitomycin C. Electron microscopy analysis of the lysate from SS2 virulent strains HA9801 and ZY05719 revealed the presence of phage particles. The induced phage, named SS2-HA and SS2-ZY, both have a small isometric nucleocapsid approximately 50 nm in diameter and have no tail and is therefore a member of the Tectiviridae family. The phage integrase gene sequence of phage SS2-HA and SS2-ZY shared high homologue identities with virulent SS2 strains, which suggested that the phage integrase gene of SS2 has high specify. The temperate phage and phage integrase gene can only detected from SS2 virulent strains but not from avirulent strain, and the detection of phage integrase gene was related to the virulence-associate factors of SS2, such as the muramidase-released protein gene (mrp), which suggested that the temperate phage of SS2 may be related to the pathogenicity of SS2.

PathoScope 2.0: a complete computational framework for strain identification in environmental or clinical sequencing samples

PubMed Central

2014-01-01

Background Recent innovations in sequencing technologies have provided researchers with the ability to rapidly characterize the microbial content of an environmental or clinical sample with unprecedented resolution. These approaches are producing a wealth of information that is providing novel insights into the microbial ecology of the environment and human health. However, these sequencing-based approaches produce large and complex datasets that require efficient and sensitive computational analysis workflows. Many recent tools for analyzing metagenomic-sequencing data have emerged, however, these approaches often suffer from issues of specificity, efficiency, and typically do not include a complete metagenomic analysis framework. Results We present PathoScope 2.0, a complete bioinformatics framework for rapidly and accurately quantifying the proportions of reads from individual microbial strains present in metagenomic sequencing data from environmental or clinical samples. The pipeline performs all necessary computational analysis steps; including reference genome library extraction and indexing, read quality control and alignment, strain identification, and summarization and annotation of results. We rigorously evaluated PathoScope 2.0 using simulated data and data from the 2011 outbreak of Shiga-toxigenic Escherichia coli O104:H4. Conclusions The results show that PathoScope 2.0 is a complete, highly sensitive, and efficient approach for metagenomic analysis that outperforms alternative approaches in scope, speed, and accuracy. The PathoScope 2.0 pipeline software is freely available for download at: http://sourceforge.net/projects/pathoscope/. PMID:25225611

Identifying Likely Transmission Pathways within a 10-Year Community Outbreak of Tuberculosis by High-Depth Whole Genome Sequencing

PubMed Central

Sadsad, Rosemarie; Martinez, Elena; Jelfs, Peter; Hill-Cawthorne, Grant A.; Gilbert, Gwendolyn L.; Marais, Ben J.; Sintchenko, Vitali

2016-01-01

Background Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways. Methods We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants. Results Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade. Conclusion Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster. PMID:26938641

Diversity Analysis of Dairy and Nondairy Lactococcus lactis Isolates, Using a Novel Multilocus Sequence Analysis Scheme and (GTG)5-PCR Fingerprinting▿

PubMed Central

Rademaker, Jan L. W.; Herbet, Hélène; Starrenburg, Marjo J. C.; Naser, Sabri M.; Gevers, Dirk; Kelly, William J.; Hugenholtz, Jeroen; Swings, Jean; van Hylckama Vlieg, Johan E. T.

2007-01-01

The diversity of a collection of 102 lactococcus isolates including 91 Lactococcus lactis isolates of dairy and nondairy origin was explored using partial small subunit rRNA gene sequence analysis and limited phenotypic analyses. A subset of 89 strains of L. lactis subsp. cremoris and L. lactis subsp. lactis isolates was further analyzed by (GTG)5-PCR fingerprinting and a novel multilocus sequence analysis (MLSA) scheme. Two major genomic lineages within L. lactis were found. The L. lactis subsp. cremoris type-strain-like genotype lineage included both L. lactis subsp. cremoris and L. lactis subsp. lactis isolates. The other major lineage, with a L. lactis subsp. lactis type-strain-like genotype, comprised L. lactis subsp. lactis isolates only. A novel third genomic lineage represented two L. lactis subsp. lactis isolates of nondairy origin. The genomic lineages deviate from the subspecific classification of L. lactis that is based on a few phenotypic traits only. MLSA of six partial genes (atpA, encoding ATP synthase alpha subunit; pheS, encoding phenylalanine tRNA synthetase; rpoA, encoding RNA polymerase alpha chain; bcaT, encoding branched chain amino acid aminotransferase; pepN, encoding aminopeptidase N; and pepX, encoding X-prolyl dipeptidyl peptidase) revealed 363 polymorphic sites (total length, 1,970 bases) among 89 L. lactis subsp. cremoris and L. lactis subsp. lactis isolates with unique sequence types for most isolates. This allowed high-resolution cluster analysis in which dairy isolates form subclusters of limited diversity within the genomic lineages. The pheS DNA sequence analysis yielded two genetic groups dissimilar to the other genotyping analysis-based lineages, indicating a disparate acquisition route for this gene. PMID:17890345

Diversity analysis of dairy and nondairy Lactococcus lactis isolates, using a novel multilocus sequence analysis scheme and (GTG)5-PCR fingerprinting.

PubMed

Rademaker, Jan L W; Herbet, Hélène; Starrenburg, Marjo J C; Naser, Sabri M; Gevers, Dirk; Kelly, William J; Hugenholtz, Jeroen; Swings, Jean; van Hylckama Vlieg, Johan E T

2007-11-01

The diversity of a collection of 102 lactococcus isolates including 91 Lactococcus lactis isolates of dairy and nondairy origin was explored using partial small subunit rRNA gene sequence analysis and limited phenotypic analyses. A subset of 89 strains of L. lactis subsp. cremoris and L. lactis subsp. lactis isolates was further analyzed by (GTG)(5)-PCR fingerprinting and a novel multilocus sequence analysis (MLSA) scheme. Two major genomic lineages within L. lactis were found. The L. lactis subsp. cremoris type-strain-like genotype lineage included both L. lactis subsp. cremoris and L. lactis subsp. lactis isolates. The other major lineage, with a L. lactis subsp. lactis type-strain-like genotype, comprised L. lactis subsp. lactis isolates only. A novel third genomic lineage represented two L. lactis subsp. lactis isolates of nondairy origin. The genomic lineages deviate from the subspecific classification of L. lactis that is based on a few phenotypic traits only. MLSA of six partial genes (atpA, encoding ATP synthase alpha subunit; pheS, encoding phenylalanine tRNA synthetase; rpoA, encoding RNA polymerase alpha chain; bcaT, encoding branched chain amino acid aminotransferase; pepN, encoding aminopeptidase N; and pepX, encoding X-prolyl dipeptidyl peptidase) revealed 363 polymorphic sites (total length, 1,970 bases) among 89 L. lactis subsp. cremoris and L. lactis subsp. lactis isolates with unique sequence types for most isolates. This allowed high-resolution cluster analysis in which dairy isolates form subclusters of limited diversity within the genomic lineages. The pheS DNA sequence analysis yielded two genetic groups dissimilar to the other genotyping analysis-based lineages, indicating a disparate acquisition route for this gene.

Evolution and Diversity of Listeria monocytogenes from Clinical and Food Samples in Shanghai, China

PubMed Central

Zhang, Jianmin; Cao, Guojie; Xu, Xuebin; Allard, Marc; Li, Peng; Brown, Eric; Yang, Xiaowei; Pan, Haijian; Meng, Jianghong

2016-01-01

Listeria monocytogenes is a significant foodborne pathogen causing severe systemic infections in humans with high mortality rates. The objectives of this work were to establish a phylogenetic framework of L. monocytogenes from China and to investigate sequence diversity among different serotypes. We selected 17 L. monocytogenes strains recovered from patients and foods in China representing serotypes 1/2a, 1/2b, and 1/2c. Draft genome sequences were determined using Illumina MiSeq technique and associated protocols. Open reading frames were assigned using prokaryotic genome annotation pipeline by NCBI. Twenty-four published genomes were included for comparative genomic and phylogenetic analysis. More than 154,000 single nucleotide polymorphisms (SNPs) were identified from multiple genome alignment and used to reconstruct maximum likelihood phylogenetic tree. The 41 genomes were differentiated into lineages I and II, which consisted of 4 and 11 subgroups, respectively. A clinical strain from China (SHL009) contained significant SNP differences compared to the rest genomes, whereas clinical strain SHL001 shared most recent common ancestor with strain SHL017 from food. Moreover, clinical strains SHL004 and SHL015 clustered together with two strains (08-5578 and 08-5923) recovered from an outbreak in Canada. Partial sequences of a plasmid found in the Canadian strain were also present in SHL004. We investigated the presence of various genes and gene clusters associated with virulence and subgroup-specific genes, including internalins, L. monocytogenes pathogenicity islands (LIPIs), L. monocytogenes genomic islands (LGIs), stress survival islet 1 (SSI-1), and clustered regularly interspaced short palindromic repeats (CRISPR)/cas system. A novel genomic island, denoted as LGI-2 was identified. Comparative sequence analysis revealed differences among the L. monocytogenes strains related to virulence, survival abilities, and attributes against foreign genetic elements. L. monocytogenes from China were genetically diverse. Strains from clinical specimens and food related closely suggesting foodborne transmission of human listeriosis. PMID:27499751

Ribosomal DNA analysis of tsetse and non-tsetse transmitted Ethiopian Trypanosoma vivax strains in view of improved molecular diagnosis.

PubMed

Fikru, Regassa; Matetovici, Irina; Rogé, Stijn; Merga, Bekana; Goddeeris, Bruno Maria; Büscher, Philippe; Van Reet, Nick

2016-04-15

Animal trypanosomosis caused by Trypanosoma vivax (T. vivax) is a devastating disease causing serious economic losses. Most molecular diagnostics for T. vivax infection target the ribosomal DNA locus (rDNA) but are challenged by the heterogeneity among T. vivax strains. In this study, we investigated the rDNA heterogeneity of Ethiopian T. vivax strains in relation to their presence in tsetse-infested and tsetse-free areas and its effect on molecular diagnosis. We sequenced the rDNA loci of six Ethiopian (three from tsetse-infested and three from tsetse-free areas) and one Nigerian T. vivax strain. We analysed the obtained sequences in silico for primer-mismatches of some commonly used diagnostic PCR assays and for GC content. With these data, we selected some rDNA diagnostic PCR assays for evaluation of their diagnostic accuracy. Furthermore we constructed two phylogenetic networks based on sequences within the smaller subunit (SSU) of 18S and within the 5.8S and internal transcribed spacer 2 (ITS2) to assess the relatedness of Ethiopian T. vivax strains to strains from other African countries and from South America. In silico analysis of the rDNA sequence showed important mismatches of some published diagnostic PCR primers and high GC content of T. vivax rDNA. The evaluation of selected diagnostic PCR assays with specimens from cattle under natural T. vivax challenge showed that this high GC content interferes with the diagnostic accuracy of PCR, especially in cases of mixed infections with T. congolense. Adding betain to the PCR reaction mixture can enhance the amplification of T. vivax rDNA but decreases the sensitivity for T. congolense and Trypanozoon. The networks illustrated that Ethiopian T. vivax strains are considerably heterogeneous and two strains (one from tsetse-infested and one from tsetse-free area) are more related to the West African and South American strains than to the East African strains. The rDNA locus sequence of six Ethiopian T. vivax strains showed important differences and higher GC content compared to other animal trypanosomes but could not be related to their origin from tsetse-infested or tsetse-free area. The high GC content of T. vivax DNA renders accurate diagnosis of all pathogenic animal trypanosomes with one single PCR problematic. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Analysis of the full genome of human group C rotaviruses reveals lineage diversification and reassortment.

PubMed

Medici, Maria Cristina; Tummolo, Fabio; Martella, Vito; Arcangeletti, Maria Cristina; De Conto, Flora; Chezzi, Carlo; Fehér, Enikő; Marton, Szilvia; Calderaro, Adriana; Bányai, Krisztián

2016-08-01

Group C rotaviruses (RVC) are enteric pathogens of humans and animals. Whole-genome sequences are available only for few RVCs, leaving gaps in our knowledge about their genetic diversity. We determined the full-length genome sequence of two human RVCs (PR2593/2004 and PR713/2012), detected in Italy from hospital-based surveillance for rotavirus infection in 2004 and 2012. In the 11 RNA genomic segments, the two Italian RVCs segregated within separate intra-genotypic lineages showed variation ranging from 1.9 % (VP6) to 15.9 % (VP3) at the nucleotide level. Comprehensive analysis of human RVC sequences available in the databases allowed us to reveal the existence of at least two major genome configurations, defined as type I and type II. Human RVCs of type I were all associated with the M3 VP3 genotype, including the Italian strain PR2593/2004. Conversely, human RVCs of type II were all associated with the M2 VP3 genotype, including the Italian strain PR713/2012. Reassortant RVC strains between these major genome configurations were identified. Although only a few full-genome sequences of human RVCs, mostly of Asian origin, are available, the analysis of human RVC sequences retrieved from the databases indicates that at least two intra-genotypic RVC lineages circulate in European countries. Gathering more sequence data is necessary to develop a standardized genotype and intra-genotypic lineage classification system useful for epidemiological investigations and avoiding confusion in the literature.

Brucella papionis sp. nov., isolated from baboons (Papio spp.).

PubMed

Whatmore, Adrian M; Davison, Nicholas; Cloeckaert, Axel; Al Dahouk, Sascha; Zygmunt, Michel S; Brew, Simon D; Perrett, Lorraine L; Koylass, Mark S; Vergnaud, Gilles; Quance, Christine; Scholz, Holger C; Dick, Edward J; Hubbard, Gene; Schlabritz-Loutsevitch, Natalia E

2014-12-01

Two Gram-negative, non-motile, non-spore-forming coccoid bacteria (strains F8/08-60(T) and F8/08-61) isolated from clinical specimens obtained from baboons (Papio spp.) that had delivered stillborn offspring were subjected to a polyphasic taxonomic study. On the basis of 16S rRNA gene sequence similarities, both strains, which possessed identical sequences, were assigned to the genus Brucella. This placement was confirmed by extended multilocus sequence analysis (MLSA), where both strains possessed identical sequences, and whole-genome sequencing of a representative isolate. All of the above analyses suggested that the two strains represent a novel lineage within the genus Brucella. The strains also possessed a unique profile when subjected to the phenotyping approach classically used to separate species of the genus Brucella, reacting only with Brucella A monospecific antiserum, being sensitive to the dyes thionin and fuchsin, being lysed by bacteriophage Wb, Bk2 and Fi phage at routine test dilution (RTD) but only partially sensitive to bacteriophage Tb, and with no requirement for CO2 and no production of H2S but strong urease activity. Biochemical profiling revealed a pattern of enzyme activity and metabolic capabilities distinct from existing species of the genus Brucella. Molecular analysis of the omp2 locus genes showed that both strains had a novel combination of two highly similar omp2b gene copies. The two strains shared a unique fingerprint profile of the multiple-copy Brucella-specific element IS711. Like MLSA, a multilocus variable number of tandem repeat analysis (MLVA) showed that the isolates clustered together very closely, but represent a distinct group within the genus Brucella. Isolates F8/08-60(T) and F8/08-61 could be distinguished clearly from all known species of the genus Brucella and their biovars by both phenotypic and molecular properties. Therefore, by applying the species concept for the genus Brucella suggested by the ICSP Subcommittee on the Taxonomy of Brucella, they represent a novel species within the genus Brucella, for which the name Brucella papionis sp. nov. is proposed, with the type strain F8/08-60(T) ( = NCTC 13660(T) = CIRMBP 0958(T)). Crown Copyright 2014. Reproduced with the permission of the Controller of Her Majesty's Stationery Office/Queen's Printer for Scotland and AHVLA.

Candida andamanensis sp. nov., Candida laemsonensis sp. nov. and Candida ranongensis sp. nov., anamorphic yeast species isolated from estuarine waters in a Thai mangrove forest.

PubMed

Am-In, Somjit; Limtong, Savitree; Yongmanitchai, Wichien; Jindamorakot, Sasitorn

2011-02-01

Five strains (RV5(T), RV140, R31(T), RS17 and RS28(T)) representing three novel anamorphic ascomycetous yeast species were isolated by membrane filtration from estuarine waters collected from a mangrove forest in Laem Son National Park, Ranong Province, Thailand, on different occasions. On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, sequence analysis of the D1/D2 domain of the large-subunit rRNA gene and the internal transcribed spacer region and phylogenetic analysis, three strains were found to represent two novel Candida species. Two strains (RV5(T) and RV140) represented a single novel species, for which the name Candida laemsonensis sp. nov. is proposed. The type strain is RV5(T) (=BCC 35154(T) =NBRC 105873(T) =CBS 11419(T)). Strain R31(T) was assigned to a novel species that was named Candida andamanensis sp. nov. (type strain R31(T) =BCC 25965(T) =NBRC 103862(T) =CBS 10859(T)). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, sequence analysis of the D1/D2 domain of the large-subunit rRNA gene and phylogenetic analysis, strains RS17 and RS28(T) represented another novel species of Candida, for which the name Candida ranongensis sp. nov. is proposed. The type strain is RS28(T) (=BCC 25964(T) =NBRC 103861(T) =CBS 10861(T)).

Differentiation of highly virulent strains of Streptococcus suis serotype 2 according to glutamate dehydrogenase electrophoretic and sequence type.

PubMed

Kutz, Russell; Okwumabua, Ogi

2008-10-01

The glutamate dehydrogenase (GDH) enzymes of 19 Streptococcus suis serotype 2 strains, consisting of 18 swine isolates and 1 human clinical isolate from a geographically varied collection, were analyzed by activity staining on a nondenaturing gel. All seven (100%) of the highly virulent strains tested produced an electrophoretic type (ET) distinct from those of moderately virulent and nonvirulent strains. By PCR and nucleotide sequence determination, the gdh genes of the 19 strains and of 2 highly virulent strains involved in recent Chinese outbreaks yielded a 1,820-bp fragment containing an open reading frame of 1,344 nucleotides, which encodes a protein of 448 amino acid residues with a calculated molecular mass of approximately 49 kDa. The nucleotide sequences contained base pair differences, but most were silent. Cluster analysis of the deduced amino acid sequences separated the isolates into three groups. Group I (ETI) consisted of the seven highly virulent isolates and the two Chinese outbreak strains, containing Ala(299)-to-Ser, Glu(305)-to-Lys, and Glu(330)-to-Lys amino acid substitutions compared with groups II and III (ETII). Groups II and III consisted of moderately virulent and nonvirulent strains, which are separated from each other by Tyr(72)-to-Asp and Thr(296)-to-Ala substitutions. Gene exchange studies resulted in the change of ETI to ETII and vice versa. A spectrophotometric activity assay for GDH did not show significant differences between the groups. These results suggest that the GDH ETs and sequence types may serve as useful markers in predicting the pathogenic behavior of strains of this serotype and that the molecular basis for the observed differences in the ETs was amino acid substitutions and not deletion, insertion, or processing uniqueness.

Comprehensive Insights in the Mycobacterium avium subsp. paratuberculosis Genome Using New WGS Data of Sheep Strain JIII-386 from Germany

PubMed Central

Möbius, Petra; Hölzer, Martin; Felder, Marius; Nordsiek, Gabriele; Groth, Marco; Köhler, Heike; Reichwald, Kathrin; Platzer, Matthias; Marz, Manja

2015-01-01

Mycobacterium avium (M. a.) subsp. paratuberculosis (MAP)—the etiologic agent of Johne’s disease—affects cattle, sheep, and other ruminants worldwide. To decipher phenotypic differences among sheep and cattle strains (belonging to MAP-S [Type-I/III], respectively, MAP-C [Type-II]), comparative genome analysis needs data from diverse isolates originating from different geographic regions of the world. This study presents the so far best assembled genome of a MAP-S-strain: Sheep isolate JIII-386 from Germany. One newly sequenced cattle isolate (JII-1961, Germany), four published MAP strains of MAP-C and MAP-S from the United States and Australia, and M. a. subsp. hominissuis (MAH) strain 104 were used for assembly improvement and comparisons. All genomes were annotated by BacProt and results compared with NCBI (National Center for Biotechnology Information) annotation. Corresponding protein-coding sequences (CDSs) were detected, but also CDSs that were exclusively determined by either NCBI or BacProt. A new Shine–Dalgarno sequence motif (5′-AGCTGG-3′) was extracted. Novel CDSs including PE-PGRS family protein genes and about 80 noncoding RNAs exhibiting high sequence conservation are presented. Previously found genetic differences between MAP-types are partially revised. Four of ten assumed MAP-S-specific large sequence polymorphism regions (LSPSs) are still present in MAP-C strains; new LSPSs were identified. Independently of the regional origin of the strains, the number of individual CDSs and single nucleotide variants confirms the strong similarity of MAP-C strains and shows higher diversity among MAP-S strains. This study gives ambiguous results regarding the hypothesis that MAP-S is the evolutionary intermediate between MAH and MAP-C, but it clearly shows a higher similarity of MAP to MAH than to Mycobacterium intracellulare. PMID:26384038

[Genetic diversity and phylogeny of rhizobia isolated from peanut (Arachis hypogaea)].

PubMed

Yang, Jiang-Ke; Xie, Fu-Li; Zhou, Jun-Chu

2002-12-01

Forty three rhizobium strains isolated from peanut (Arachis hypogaea) and 15 reference strains from other genus and species were analyzed by the method of 16S rRNA RFLP, 16S rRNA sequencing and 16S-23S IGS PCR RFLP. The results of the 16S rRNA RFLP shown that 43 strains tested were all ascribed to the genus of Bradyrhizobium phylogenetically. Strains tested were adjacent to the B. japonicum and far from B. elkanii 16S rRNA genotype. The genotypes generated by the 4 restriction endonucleases, Mbo I, Dde I, Hae III and Msp I, were same as the representatives of B. japonicum. The dendrogram generated by 16S rRNA sequence and Neighbor-joining method shown that peanut rhizobia clustered into the subcluster represented by B. japonicum and B. liaoningense, were more close to B. liaoningense genetically, and the sequence difference between them was less than 1%. High sequence similarity was also determined between B. liaoningense and B. japonicum. JZ1, representative strain of peanut rhizobia were systematically far from the B. elkanii, and the sequence divergence about 2%. The results from IGS RFLP analysis indicated that although they were phylogenetically close to B. japonicum and B. elkanii, peanut rhizobia forming an independent group at the similarity of 71% could be further divided into four subgroups, A, B, C and D. Subgroup A consisted of strains from different region, subgroup B was composed of strains from Wuchang, Qianjiang and Jingzhou, subgroup C was mainly composed of strains from Jingzhou and starins of subgroup D mainly from Neijiang. Reference strains from B. japonicum and B. elkanii were independently clustered into the subgroup E at the similarity of 71%. The geographical factor effect on genetic diversity of rhizobia was found.

The effect of different screw-tightening techniques on the strain generated on an internal-connection implant superstructure. Part 2: Models created with a splinted impression technique.

PubMed

Choi, Jung-Han

2011-01-01

This study aimed to evaluate the effect of different screw-tightening sequences, torques, and methods on the strains generated on an internal-connection implant (Astra Tech) superstructure with good fit. An edentulous mandibular master model and a metal framework directly connected to four parallel implants with a passive fit to each other were fabricated. Six stone casts were made from a dental stone master model by a splinted impression technique to represent a well-fitting situation with the metal framework. Strains generated by four screw-tightening sequences (1-2-3-4, 4-3-2-1, 2-4-3-1, and 2-3-1-4), two torques (10 and 20 Ncm), and two methods (one-step and two-step) were evaluated. In the two-step method, screws were tightened to the initial torque (10 Ncm) in a predetermined screw-tightening sequence and then to the final torque (20 Ncm) in the same sequence. Strains were recorded twice by three strain gauges attached to the framework (superior face midway between abutments). Deformation data were analyzed using multiple analysis of variance at a .05 level of statistical significance. In all stone casts, strains were produced by connection of the superstructure, regardless of screw-tightening sequence, torque, and method. No statistically significant differences in superstructure strains were found based on screw-tightening sequences (range, -409.8 to -413.8 μm/m), torques (-409.7 and -399.1 μm/m), or methods (-399.1 and -410.3 μm/m). Within the limitations of this in vitro study, screw-tightening sequence, torque, and method were not critical factors for the strain generated on a well-fitting internal-connection implant superstructure by the splinted impression technique. Further studies are needed to evaluate the effect of screw-tightening techniques on the preload stress in various different clinical situations.

Full-genome sequence and analysis of a novel human rhinovirus strain within a divergent HRV-A clade.

PubMed

Rathe, Jennifer A; Liu, Xinyue; Tallon, Luke J; Gern, James E; Liggett, Stephen B

2010-01-01

Genome sequences of human rhinoviruses (HRV) have primarily been from stocks collected in the 1960s, with genomes and phylogeny of modern HRVs remaining undefined. Here, two modern isolates (hrv-A101 and hrv-A101-v1) collected approximately 8 years apart were sequenced in their entirety. Incorporation into our full-genome HRV alignment with subsequent phylogenetic network inference indicated that these represent a unique HRV-A, localized within a distinct divergent clade. They appear to have resulted from recombination of the hrv-65 and hrv-78 lineages. These results support our contention that there are unrecognized distinct HRV-A strains, and that recombination is evident in currently circulating strains.

Genome sequencing reveals loci under artificial selection that underlie disease phenotypes in the laboratory rat.

PubMed

Atanur, Santosh S; Diaz, Ana Garcia; Maratou, Klio; Sarkis, Allison; Rotival, Maxime; Game, Laurence; Tschannen, Michael R; Kaisaki, Pamela J; Otto, Georg W; Ma, Man Chun John; Keane, Thomas M; Hummel, Oliver; Saar, Kathrin; Chen, Wei; Guryev, Victor; Gopalakrishnan, Kathirvel; Garrett, Michael R; Joe, Bina; Citterio, Lorena; Bianchi, Giuseppe; McBride, Martin; Dominiczak, Anna; Adams, David J; Serikawa, Tadao; Flicek, Paul; Cuppen, Edwin; Hubner, Norbert; Petretto, Enrico; Gauguier, Dominique; Kwitek, Anne; Jacob, Howard; Aitman, Timothy J

2013-08-01

Large numbers of inbred laboratory rat strains have been developed for a range of complex disease phenotypes. To gain insights into the evolutionary pressures underlying selection for these phenotypes, we sequenced the genomes of 27 rat strains, including 11 models of hypertension, diabetes, and insulin resistance, along with their respective control strains. Altogether, we identified more than 13 million single-nucleotide variants, indels, and structural variants across these rat strains. Analysis of strain-specific selective sweeps and gene clusters implicated genes and pathways involved in cation transport, angiotensin production, and regulators of oxidative stress in the development of cardiovascular disease phenotypes in rats. Many of the rat loci that we identified overlap with previously mapped loci for related traits in humans, indicating the presence of shared pathways underlying these phenotypes in rats and humans. These data represent a step change in resources available for evolutionary analysis of complex traits in disease models. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Genome Sequencing Reveals Loci under Artificial Selection that Underlie Disease Phenotypes in the Laboratory Rat

PubMed Central

Atanur, Santosh S.; Diaz, Ana Garcia; Maratou, Klio; Sarkis, Allison; Rotival, Maxime; Game, Laurence; Tschannen, Michael R.; Kaisaki, Pamela J.; Otto, Georg W.; Ma, Man Chun John; Keane, Thomas M.; Hummel, Oliver; Saar, Kathrin; Chen, Wei; Guryev, Victor; Gopalakrishnan, Kathirvel; Garrett, Michael R.; Joe, Bina; Citterio, Lorena; Bianchi, Giuseppe; McBride, Martin; Dominiczak, Anna; Adams, David J.; Serikawa, Tadao; Flicek, Paul; Cuppen, Edwin; Hubner, Norbert; Petretto, Enrico; Gauguier, Dominique; Kwitek, Anne; Jacob, Howard; Aitman, Timothy J.

2013-01-01

Summary Large numbers of inbred laboratory rat strains have been developed for a range of complex disease phenotypes. To gain insights into the evolutionary pressures underlying selection for these phenotypes, we sequenced the genomes of 27 rat strains, including 11 models of hypertension, diabetes, and insulin resistance, along with their respective control strains. Altogether, we identified more than 13 million single-nucleotide variants, indels, and structural variants across these rat strains. Analysis of strain-specific selective sweeps and gene clusters implicated genes and pathways involved in cation transport, angiotensin production, and regulators of oxidative stress in the development of cardiovascular disease phenotypes in rats. Many of the rat loci that we identified overlap with previously mapped loci for related traits in humans, indicating the presence of shared pathways underlying these phenotypes in rats and humans. These data represent a step change in resources available for evolutionary analysis of complex traits in disease models. PaperClip PMID:23890820

Comparative genomic analysis and phenazine production of Pseudomonas chlororaphis, a plant growth-promoting rhizobacterium

PubMed Central

Chen, Yawen; Shen, Xuemei; Peng, Huasong; Hu, Hongbo; Wang, Wei; Zhang, Xuehong

2015-01-01

Pseudomonas chlororaphis HT66, a plant growth-promoting rhizobacterium that produces phenazine-1-carboxamide with high yield, was compared with three genomic sequenced P. chlororaphis strains, GP72, 30–84 and O6. The genome sizes of four strains vary from 6.66 to 7.30 Mb. Comparisons of predicted coding sequences indicated 4833 conserved genes in 5869–6455 protein-encoding genes. Phylogenetic analysis showed that the four strains are closely related to each other. Its competitive colonization indicates that P. chlororaphis can adapt well to its environment. No virulence or virulence-related factor was found in P. chlororaphis. All of the four strains could synthesize antimicrobial metabolites including different phenazines and insecticidal protein FitD. Some genes related to the regulation of phenazine biosynthesis were detected among the four strains. It was shown that P. chlororaphis is a safe PGPR in agricultural application and could also be used to produce some phenazine antibiotics with high-yield. PMID:26484173

Tracking the Origin and Deciphering the Phylogenetic Relationship of Porcine Epidemic Diarrhea Virus in Ecuador

PubMed Central

Barrera, Maritza; Garrido-Haro, Ana; Vaca, María S.; Granda, Danilo; Acosta-Batallas, Alfredo

2017-01-01

In 2010, new Chinese strains of porcine epidemic diarrhea virus (PEDV), clinically more severe than the classical strains, emerged. These strains were spread to United States in 2013 through an intercontinental transmission from China with further spreading across the world, evidencing the emergent nature of these strains. In the present study, an analysis of PEDV field sequences from Ecuador was conducted by comparing all the PEDV S gene sequences available in the GenBank database. Phylogenetic comparisons and Bayesian phylogeographic inference based on complete S gene sequences were also conducted to track the origin and putative route of PEDV. The sequence from the PED-outbreak in Ecuador was grouped into the clade II of PEDV genogroup 2a together with other sequences of isolates from Mexico, Canada, and United States. The phylogeographic study revealed the emergence of the Chinese PEDV strains, followed by spreading to US in 2013, from US to Korea, and later the introduction of PEDV to Canada, Mexico, and Ecuador directly from the US. The sources of imports of live swine in Ecuador in 2014 were mainly from Chile and US. Thus, this movement of pigs is suggested as the main way for introducing PEDV to Ecuador. PMID:29379796

Phenotypic Heterogeneity of Genomically-Diverse Isolates of Streptococcus mutans

PubMed Central

Palmer, Sara R.; Miller, James H.; Abranches, Jacqueline; Zeng, Lin; Lefebure, Tristan; Richards, Vincent P.; Lemos, José A.; Stanhope, Michael J.; Burne, Robert A.

2013-01-01

High coverage, whole genome shotgun (WGS) sequencing of 57 geographically- and genetically-diverse isolates of Streptococcus mutans from individuals of known dental caries status was recently completed. Of the 57 sequenced strains, fifteen isolates, were selected based primarily on differences in gene content and phenotypic characteristics known to affect virulence and compared with the reference strain UA159. A high degree of variability in these properties was observed between strains, with a broad spectrum of sensitivities to low pH, oxidative stress (air and paraquat) and exposure to competence stimulating peptide (CSP). Significant differences in autolytic behavior and in biofilm development in glucose or sucrose were also observed. Natural genetic competence varied among isolates, and this was correlated to the presence or absence of competence genes, comCDE and comX, and to bacteriocins. In general strains that lacked the ability to become competent possessed fewer genes for bacteriocins and immunity proteins or contained polymorphic variants of these genes. WGS sequence analysis of the pan-genome revealed, for the first time, components of a Type VII secretion system in several S. mutans strains, as well as two putative ORFs that encode possible collagen binding proteins located upstream of the cnm gene, which is associated with host cell invasiveness. The virulence of these particular strains was assessed in a wax-worm model. This is the first study to combine a comprehensive analysis of key virulence-related phenotypes with extensive genomic analysis of a pathogen that evolved closely with humans. Our analysis highlights the phenotypic diversity of S. mutans isolates and indicates that the species has evolved a variety of adaptive strategies to persist in the human oral cavity and, when conditions are favorable, to initiate disease. PMID:23613838

Comparison of multilocus sequence typing and pulsed-field gel electrophoresis for Salmonella spp. identification in surface water

NASA Astrophysics Data System (ADS)

Kuo, Chun Wei; Hao Huang, Kuan; Hsu, Bing Mu; Tsai, Hsien Lung; Tseng, Shao Feng; Kao, Po Min; Shen, Shu Min; Chou Chiu, Yi; Chen, Jung Sheng

2013-04-01

Salmonella is one of the most important pathogens of waterborne diseases with outbreaks from contaminated water reported worldwide. In addition, Salmonella spp. can survive for long periods in aquatic environments. To realize genotypes and serovars of Salmonella in aquatic environments, we isolated the Salmonella strains by selective culture plates to identify the serovars of Salmonella by serological assay, and identify the genotypes by Multilocus sequence typing (MLST) based on the sequence data from University College Cork (UCC), respectively. The results show that 36 stream water samples (30.1%) and 18 drinking water samples (23.3%) were confirmed the existence of Salmonella using culture method combined PCR specific invA gene amplification. In this study, 24 cultured isolates of Salmonella from water samples were classified to fifteen Salmonella enterica serovars. In addition, we construct phylogenetic analysis using phylogenetic tree and Minimum spanning tree (MST) method to analyze the relationship of clinical, environmental, and geographical data. Phylogenetic tree showed that four main clusters and our strains can be distributed in all. The genotypes of isolates from stream water are more biodiversity while comparing the Salmonella strains genotypes from drinking water sources. According to MST data, we can found the positive correlation between serovars and genotypes of Salmonella. Previous studies revealed that the result of Pulsed field gel electrophoresis (PFGE) method can predict the serovars of Salmonella strain. Hence, we used the MLST data combined phylogenetic analysis to identify the serovars of Salmonella strain and achieved effectiveness. While using the geographical data combined phylogenetic analysis, the result showed that the dominant strains were existed in whole stream area in rainy season. Keywords: Salmonella spp., MLST, phylogenetic analysis, PFGE

Purification and sequence analysis of 4-methyl-5-nitrocatechol oxygenase from Burkholderia sp. strain DNT.

PubMed Central

Haigler, B E; Suen, W C; Spain, J C

1996-01-01

4-Methyl-5-nitrocatechol (MNC) is an intermediate in the degradation of 2,4-dinitrotoluene by Burkholderia sp. strain DNT. In the presence of NADPH and oxygen, MNC monooxygenase catalyzes the removal of the nitro group from MNC to form 2-hydroxy-5-methylquinone. The gene (dntB) encoding MNC monooxygenase has been previously cloned and characterized. In order to examine the properties of MNC monooxygenase and to compare it with other enzymes, we sequenced the gene encoding the MNC monooxygenase and purified the enzyme from strain DNT. dntB was localized within a 2.2-kb ApaI DNA fragment. Sequence analysis of this fragment revealed an open reading frame of 1,644 bp with an N-terminal amino acid sequence identical to that of purified MNC monooxygenase from strain DNT. Comparison of the derived amino acid sequences with those of other genes showed that DntB contains the highly conserved ADP and flavin adenine dinucleotide (FAD) binding motifs characteristic of flavoprotein hydroxylases. MNC monooxygenase was purified to homogeneity from strain DNT by anion exchange and gel filtration chromatography. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed a single protein with a molecular weight of 60,200, which is consistent with the size determined from the gene sequence. The native molecular weight determined by gel filtration was 65,000, which indicates that the native enzyme is a monomer. It used either NADH or NADPH as electron donors, and NADPH was the preferred cofactor. The purified enzyme contained 1 mol of FAD per mol of protein, which is also consistent with the detection of an FAD binding motif in the amino acid sequence of DntB. MNC monooxygenase has a narrow substrate specificity. MNC and 4-nitrocatechol are good substrates whereas 3-methyl-4-nitrophenol, 3-methyl-4-nitrocatechol, 4-nitrophenol, 3-nitrophenol, and 4-chlorocatechol were not. These studies suggest that MNC monooxygenase is a flavoprotein that shares some properties with previously studied nitrophenol oxygenases. PMID:8830701

Lactobacillus apodemi sp. nov., a tannase-producing species isolated from wild mouse faeces.

PubMed

Osawa, Ro; Fujisawa, Tomohiko; Pukall, Rüdiger

2006-07-01

A Gram-positive, rod-shaped, non-endospore-forming bacterium, strain ASB1(T), able to degrade tannin, was isolated from faeces of the Japanese large wood mouse, Apodemus speciosus. Comparative analysis of the 16S rRNA gene sequence revealed that the strain could be assigned as a member of the genus Lactobacillus. The nearest phylogenetic neighbours were determined as Lactobacillus animalis DSM 20602(T) (98.9 % 16S rRNA gene sequence similarity) and Lactobacillus murinus ASF 361 (98.9 %). Subsequent polyphasic analysis, including automated ribotyping and DNA-DNA hybridization experiments, confirmed that the isolate represents a novel species, for which the name Lactobacillus apodemi sp. nov. is proposed. The DNA G+C content of the novel strain is 38.5 mol%. The cell-wall peptidoglycan is of type A4alpha L-lys-D-asp. The type strain is ASB1(T) (=DSM 16634(T)=CIP 108913(T)).

Diversity of Pea-Associated F. proliferatum and F. verticillioides Populations Revealed by FUM1 Sequence Analysis and Fumonisin Biosynthesis

PubMed Central

Waśkiewicz, Agnieszka; Stępień, Łukasz; Wilman, Karolina; Kachlicki, Piotr

2013-01-01

Fusarium proliferatum and F. verticillioides are considered as minor pathogens of pea (Pisum sativum L.). Both species can survive in seed material without visible disease symptoms, but still contaminating it with fumonisins. Two populations of pea-derived F. proliferatum and F. verticillioides strains were subjected to FUM1 sequence divergence analysis, forming a distinct group when compared to the collection strains originating from different host species. Furthermore, the mycotoxigenic abilities of those strains were evaluated on the basis of in planta and in vitro fumonisin biosynthesis. No differences were observed in fumonisin B (FB) levels measured in pea seeds (maximum level reached 1.5 μg g−1); however, in rice cultures, the majority of F. proliferatum genotypes produced higher amounts of FB1–FB3 than F. verticillioides strains. PMID:23470545

Detection and partial molecular characterization of atypical plum pox virus isolates from naturally infected sour cherry.

PubMed

Chirkov, Sergei; Ivanov, Peter; Sheveleva, Anna

2013-06-01

Atypical isolates of plum pox virus (PPV) were discovered in naturally infected sour cherry in urban ornamental plantings in Moscow, Russia. The isolates were detected by polyclonal double antibody sandwich ELISA and RT-PCR using universal primers specific for the 3'-non-coding and coat protein (CP) regions of the genome but failed to be recognized by triple antibody sandwich ELISA with the universal monoclonal antibody 5B and by RT-PCR using primers specific to for PPV strains D, M, C and W. Sequence analysis of the CP genes of nine isolates revealed 99.2-100 % within-group identity and 62-85 % identity to conventional PPV strains. Phylogenetic analysis showed that the atypical isolates represent a group that is distinct from the known PPV strains. Alignment of the N-terminal amino acid sequences of CP demonstrated their close similarity to those of a new tentative PPV strain, CR.

Bacillus methanolicus sp. nov., a new species of thermotolerant, methanol-utilizing, endospore-forming bacteria.

PubMed

Arfman, N; Dijkhuizen, L; Kirchhof, G; Ludwig, W; Schleifer, K H; Bulygina, E S; Chumakov, K M; Govorukhina, N I; Trotsenko, Y A; White, D

1992-07-01

The generic position of 14 strains of gram-positive bacteria able to use methanol as a growth substrate was determined. All are obligately aerobic, thermotolerant organisms that are able to grow at temperatures of 35 to 60 degrees C. Nine of the strains produce oval spores at a subterminal-to-central position in slightly swollen rod-shaped cells. DNA-DNA hybridization studies, 5S rRNA sequence analysis, and physiological characteristics revealed that all 14 strains cluster as a well-defined group and form a distinct new genospecies. Analysis of the 16S and 5S rRNA sequences indicated that this new species is distinct from Bacillus brevis but closely related to B. firmus and B. azotoformans. The name proposed for this new species is B. methanolicus. The type strain, PB1, has been deposited in the National Collection of Industrial and Marine Bacteria as NCIMB 13113.

Multi-gene phylogenetic analysis reveals that shochu-fermenting Saccharomyces cerevisiae strains form a distinct sub-clade of the Japanese sake cluster.

PubMed

Futagami, Taiki; Kadooka, Chihiro; Ando, Yoshinori; Okutsu, Kayu; Yoshizaki, Yumiko; Setoguchi, Shinji; Takamine, Kazunori; Kawai, Mikihiko; Tamaki, Hisanori

2017-10-01

Shochu is a traditional Japanese distilled spirit. The formation of the distinguishing flavour of shochu produced in individual distilleries is attributed to putative indigenous yeast strains. In this study, we performed the first (to our knowledge) phylogenetic classification of shochu strains based on nucleotide gene sequences. We performed phylogenetic classification of 21 putative indigenous shochu yeast strains isolated from 11 distilleries. All of these strains were shown or confirmed to be Saccharomyces cerevisiae, sharing species identification with 34 known S. cerevisiae strains (including commonly used shochu, sake, ale, whisky, bakery, bioethanol and laboratory yeast strains and clinical isolate) that were tested in parallel. Our analysis used five genes that reflect genome-level phylogeny for the strain-level classification. In a first step, we demonstrated that partial regions of the ZAP1, THI7, PXL1, YRR1 and GLG1 genes were sufficient to reproduce previous sub-species classifications. In a second step, these five analysed regions from each of 25 strains (four commonly used shochu strains and the 21 putative indigenous shochu strains) were concatenated and used to generate a phylogenetic tree. Further analysis revealed that the putative indigenous shochu yeast strains form a monophyletic group that includes both the shochu yeasts and a subset of the sake group strains; this cluster is a sister group to other sake yeast strains, together comprising a sake-shochu group. Differences among shochu strains were small, suggesting that it may be possible to correlate subtle phenotypic differences among shochu flavours with specific differences in genome sequences. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Proposal of Vespertiliibacter pulmonis gen. nov., sp. nov. and two genomospecies as new members of the family Pasteurellaceae isolated from European bats.

PubMed

Mühldorfer, Kristin; Speck, Stephanie; Wibbelt, Gudrun

2014-07-01

Five bacterial strains isolated from bats of the family Vespertilionidae were characterized by phenotypic tests and multilocus sequence analysis (MLSA) using the 16S rRNA gene and four housekeeping genes (rpoA, rpoB, infB, recN). Phylogenetic analyses of individual and combined datasets indicated that the five strains represent a monophyletic cluster within the family Pasteurellaceae. Comparison of 16S rRNA gene sequences demonstrated a high degree of similarity (98.3-99.9%) among the group of bat-derived strains, while searches in nucleotide databases indicated less than 96% sequence similarity to known members of the Pasteurellaceae. The housekeeping genes rpoA, rpoB, infB and recN provided higher resolution compared with the 16S rRNA gene and subdivided the group according to the bat species from which the strains were isolated. Three strains derived from noctule bats shared 98.6-100% sequence similarity in all four genes investigated, whereas, based on rpoB, infB and recN gene sequences, 91.8-96% similarity was observed with and between the remaining two strains isolated from a serotine bat and a pipistrelle bat, respectively. Genome relatedness as deduced from recN gene sequences correlated well with the results of MLSA and indicated that the five strains represent a new genus. Based on these results, it is proposed to classify the five strains derived from bats within Vespertiliibacter pulmonis gen. nov., sp. nov. (the type species), Vespertiliibacter genomospecies 1 and Vespertiliibacter genomospecies 2. The genus can be distinguished phenotypically from recognized genera of the Pasteurellaceae by at least three characteristics. All strains are nutritionally fastidious and require a chemically defined supplement with NAD for growth. The DNA G+C content of strain E127/08(T) is 38.2 mol%. The type strain of Vespertiliibacter pulmonis gen. nov., sp. nov. is E127/08(T) ( = CCUG 64585(T) = DSM 27238(T)). The reference strains of Vespertiliibacter genomospecies 1 and 2 are E145/08 and E157/08, respectively. © 2014 IUMS.

Analysis of the Genome Structure of the Nonpathogenic Probiotic Escherichia coli Strain Nissle 1917

PubMed Central

Grozdanov, Lubomir; Raasch, Carsten; Schulze, Jürgen; Sonnenborn, Ulrich; Gottschalk, Gerhard; Hacker, Jörg; Dobrindt, Ulrich

2004-01-01

Nonpathogenic Escherichia coli strain Nissle 1917 (O6:K5:H1) is used as a probiotic agent in medicine, mainly for the treatment of various gastroenterological diseases. To gain insight on the genetic level into its properties of colonization and commensalism, this strain's genome structure has been analyzed by three approaches: (i) sequence context screening of tRNA genes as a potential indication of chromosomal integration of horizontally acquired DNA, (ii) sequence analysis of 280 kb of genomic islands (GEIs) coding for important fitness factors, and (iii) comparison of Nissle 1917 genome content with that of other E. coli strains by DNA-DNA hybridization. PCR-based screening of 324 nonpathogenic and pathogenic E. coli isolates of different origins revealed that some chromosomal regions are frequently detectable in nonpathogenic E. coli and also among extraintestinal and intestinal pathogenic strains. Many known fitness factor determinants of strain Nissle 1917 are localized on four GEIs which have been partially sequenced and analyzed. Comparison of these data with the available knowledge of the genome structure of E. coli K-12 strain MG1655 and of uropathogenic E. coli O6 strains CFT073 and 536 revealed structural similarities on the genomic level, especially between the E. coli O6 strains. The lack of defined virulence factors (i.e., alpha-hemolysin, P-fimbrial adhesins, and the semirough lipopolysaccharide phenotype) combined with the expression of fitness factors such as microcins, different iron uptake systems, adhesins, and proteases, which may support its survival and successful colonization of the human gut, most likely contributes to the probiotic character of E. coli strain Nissle 1917. PMID:15292145

Thalassospira indica sp. nov., isolated from deep seawater.

PubMed

Liu, Yang; Lai, Qiliang; Du, Juan; Sun, Fengqin; Shao, Zongze

2016-12-01

A taxonomic study using a polyphasic approach was carried out on strain PB8BT, which was isolated from the deep water of the Indian Ocean. Cells of the bacterium were Gram-stain-negative, oxidase- and catalase-positive, curved rods and motile. Growth was observed at salinities of 0-15 % and at temperatures of 10-41°C. The isolate could reduce nitrate to nitrite and degrade Tween 80, but not degrade gelatin. Phylogenetic analysis based on 16S rRNA gene sequences indicated that strain PB8BT belonged to the genus Thalassospira, with the highest sequence similarity to the closely related type strain Thalassospira tepidiphila 1-1BT (99.7 %), followed by Thalassospira profundimaris WP0211T (99.6 %). Multilocus sequence analysis demonstrated low similarities of 94.1 and 93.7 % between strain PB8BT and the two reference type strains. Digital DNA-DNA hybridization values between strain PB8BT and the two above-mentioned type strains were, respectively, 56.3 and 55.3 %. The principal fatty acids of strain PB8BT were C18 : 1ω6c/C18 : 1ω7c, C19 : 0 cyclo ω8c and C16 : 0. The G+C content of the chromosomal DNA was 54.9 mol%. The quinone was determined to be Q-10 (100 %). Phosphatidylglycerol, phosphatidylethanolamine, and several unidentified phospholipids and lipids were present. Based on phenotypic and genotypic characteristics, strain PB8BT represents a novel species within the genus Thalassospira, for which the name Thalassospira indica sp. nov. is proposed. The type strain of the novel species is PB8BT (=MCCC 1A01103T=LMG 29620T).

Methylobacterium trifolii sp. nov. and Methylobacterium thuringiense sp. nov., methanol-utilizing, pink-pigmented bacteria isolated from leaf surfaces.

PubMed

Wellner, S; Lodders, N; Glaeser, S P; Kämpfer, P

2013-07-01

Three pink-pigmented, aerobic, Gram-stain-negative, rod-shaped and facultatively methylotrophic strains were isolated from the phyllosphere of Trifolium repens and Cerastium holosteoides. 16S rRNA gene sequence analysis support the affiliation of all strains to the genus Methylobacterium. The closest relatives of strains C34(T) and T5 were Methylobacterium gnaphalii 23e(T) (98.0 and 98.5 % sequence similarity, respectively) and Methylobacterium organophilum JCM 2833(T) (97.0 and 97.2 %, respectively). Strain TA73(T) showed the highest sequence similarities to Methylobacterium marchantiae JT1(T) and Methylobacterium bullatum F3.2(T) (both 97.9 %), followed by Methylobacterium phyllosphaerae CBMB27(T) and Methylobacterium brachiatum DSM 19569(T) (both 97.8 %), Methylobacterium cerastii C15(T) and Methylobacterium radiotolerans JCM 2831(T) (both 97.7 %). The major components in the fatty acid profiles were C18 : 1ω7c, C16 : 0 and one unknown fatty acid for strain TA73(T) and C18 : 1ω7c, C16 : 1ω7c/iso-C15 : 0 2-OH, C18 : 0 and C16 : 0 for strains C34(T) and T5. Physiological and biochemical analysis, including DNA-DNA hybridization, revealed clear differences between the investigated strains and their closest phylogenetic neighbours. DNA-DNA hybridization studies also showed high similarities between strains C34(T) and T5 (59.6-100 %). Therefore, the isolates represent two novel species within the genus Methylobacterium, for which the names Methylobacterium trifolii sp. nov. (type strain TA73(T) = LMG 25778(T) = CCM 7786(T)) and Methylobacterium thuringiense sp. nov. (type strain C34(T) = LMG 25777(T) = CCM 7787(T)) are proposed.

Complete coding regions of the prototypes enterovirus B93 and C95: phylogenetic analyses of the P1 and P3 regions of EV-B and EV-C strains.

PubMed

Junttila, N; Lévêque, N; Magnius, L O; Kabue, J P; Muyembe-Tamfum, J J; Maslin, J; Lina, B; Norder, H

2015-03-01

Complete coding regions were sequenced for two new enterovirus genomes: EV-B93 previously identified by VP1 sequencing, derived from a child with acute flaccid paralysis in the Democratic Republic of Congo; and EV-C95 from a French soldier with acute gastroenteritis in Djibouti. The EV-B93 P1 had more than 30% nucleotide divergence from other EV-B types, with highest similarity to E-15 and EV-B80. The P1 nucleotide sequence of EV-C95 was most similar, 71%, to CV-A21. Complete coding regions for the new enteroviruses were compared with those of 135 EV-B and 176 EV-C strains representing all types available in GenBank. When strains from the same outbreak or strains isolated during the same year in the same geographical region were excluded, 27 of the 58 EV-B, and 16 of the 23 EV-C types were represented by more than one sequence. However, for EV-B the P3 sequences formed three clades mainly according to origin or time of isolation, irrespective of type, while for EV-C the P3 sequences segregated mainly according to disease manifestation, with most strains causing paralysis, including polioviruses, forming one clade, and strains causing respiratory illness forming another. There was no intermixing of types between these two clades, apart from two EV-C96 strains. The EV-B P3 sequences had lower inter-clade and higher intra-clade variability as compared to the EV-C sequences, which may explain why inter-clade recombinations are more frequent in EV-B. Further analysis of more isolates may shed light on the role of recombinations in the evolution of EV-B in geographical context. © 2014 Wiley Periodicals, Inc.

Detection of Rare G3P[19] Porcine Rotavirus Strains in Chiang Mai, Thailand, Provides Evidence for Origin of the VP4 Genes of Mc323 and Mc345 Human Rotaviruses▿

PubMed Central

Maneekarn, Niwat; Khamrin, Pattara; Chan-it, Wisoot; Peerakome, Supatra; Sukchai, Sujin; Pringprao, Kidsadagon; Ushijima, Hiroshi

2006-01-01

Among 175 fecal specimens collected from diarrheic piglets during a surveillance of porcine rotavirus (PoRV) strains in Chiang Mai, Thailand, 39 (22.3%) were positive for group A rotaviruses. Of these, 33.3% (13 of 39) belonged to G3P[19], which was a rare P genotype seldom reported. Interestingly, their VP4 nucleotide sequences were most closely related to human P[19] strains (Mc323 and Mc345) isolated in 1989 from the same geographical area where these PoRV strains were isolated. These P[19] PoRV strains were also closely related to another human P[19] strain (RMC321), isolated from India in 1990. The VP4 sequence identities with human P[19] were 95.4% to 97.4%, while those to a porcine P[19] strain (4F) were only 87.6 to 89.1%. Phylogenetic analysis of the VP4 gene revealed that PoRV P[19] strains clustered with human P[19] strains in a monophyletic branch separated from strain 4F. Analysis of the VP7 gene confirmed that these strains belonged to the G3 genotype and shared 97.7% to 98.3% nucleotide identities with other G3 PoRV strains circulating in the regions. This close genetic relationship was also reflected in the phylogenetic analysis of their VP7 genes. Altogether, the findings provided peculiar evidence that supported the porcine origin of VP4 genes of Mc323 and Mc345 human rotaviruses. PMID:16988014

Molecular characterization of infectious pancreatic necrosis virus strains isolated from the three types of salmonids farmed in Chile.

PubMed

Manríquez, René A; Vera, Tamara; Villalba, Melina V; Mancilla, Alejandra; Vakharia, Vikram N; Yañez, Alejandro J; Cárcamo, Juan G

2017-01-31

The infectious pancreatic necrosis virus (IPNV) causes significant economic losses in Chilean salmon farming. For effective sanitary management, the IPNV strains present in Chile need to be fully studied, characterized, and constantly updated at the molecular level. In this study, 36 Chilean IPNV isolates collected over 6 years (2006-2011) from Salmo salar, Oncorhynchus mykiss, and Oncorhynchus kisutch were genotypically characterized. Salmonid samples were obtained from freshwater, estuary, and seawater sources from central, southern, and the extreme-south of Chile (35° to 53°S). Sequence analysis of the VP2 gene classified 10 IPNV isolates as genogroup 1 and 26 as genogroup 5. Analyses indicated a preferential, but not obligate, relationship between genogroup 5 isolates and S. salar infection. Fifteen genogroup 5 and nine genogroup 1 isolates presented VP2 gene residues associated with high virulence (i.e. Thr, Ala, and Thr at positions 217, 221, and 247, respectively). Four genogroup 5 isolates presented an oddly long VP5 deduced amino acid sequence (29.6 kDa). Analysis of the VP2 amino acid motifs associated with clinical and subclinical infections identified the clinical fingerprint in only genogroup 5 isolates; in contrast, the genogroup 1 isolates presented sequences predominantly associated with the subclinical fingerprint. Predictive analysis of VP5 showed an absence of transmembrane domains and plasma membrane tropism signals. WebLogo analysis of the VP5 BH domains revealed high identities with the marine birnavirus Y-6 and Japanese IPNV strain E1-S. Sequence analysis for putative 25 kDa proteins, coded by the ORF between VP2 and VP4, exhibited three putative nuclear localization sequences and signals of mitochondrial tropism in two isolates. This study provides important advances in updating the characterizations of IPNV strains present in Chile. The results from this study will help in identifying epidemiological links and generating specific biotechnological tools for controlling IPNV outbreaks in Chilean salmon farming.

Diversity of lactic acid bacteria in suan-tsai and fu-tsai, traditional fermented mustard products of Taiwan.

PubMed

Chao, Shiou-Huei; Wu, Ruei-Jie; Watanabe, Koichi; Tsai, Ying-Chieh

2009-11-15

Fu-tsai and suan-tsai are spontaneously fermented mustard products traditionally prepared by the Hakka tribe of Taiwan. We chose 5 different processing stages of these products for analysis of the microbial community of lactic acid bacteria (LAB) by 16S rRNA gene sequencing. From 500 LAB isolates we identified 119 representative strains belonging to 5 genera and 18 species, including Enterococcus (1 species), Lactobacillus (11 species), Leuconostoc (3 species), Pediococcus (1 species), and Weissella (2 species). The LAB composition of mustard fermented for 3 days, known as the Mu sample, was the most diverse, with 11 different LAB species being isolated. We used sequence analysis of the 16S rRNA gene to identify the LAB strains and analysis of the dnaA, pheS, and rpoA genes to identify 13 LAB strains for which identification by 16S rRNA gene sequences was not possible. These 13 strains were found to belong to 5 validated known species: Lactobacillus farciminis, Leuconostoc mesenteroides, Leuconostoc pseudomesenteroides, Weissella cibaria, and Weissella paramesenteroides, and 5 possibly novel Lactobacillus species. These results revealed that there is a high level of diversity in LAB at the different stages of fermentation in the production of suan-tsai and fu-tsai.

Streptococcus mitis Strains Causing Severe Clinical Disease in Cancer Patients

PubMed Central

Sahasrabhojane, Pranoti; Saldana, Miguel; Yao, Hui; Su, Xiaoping; Horstmann, Nicola; Thompson, Erika; Flores, Anthony R.

2014-01-01

The genetically diverse viridans group streptococci (VGS) are increasingly recognized as the cause of a variety of human diseases. We used a recently developed multilocus sequence analysis scheme to define the species of 118 unique VGS strains causing bacteremia in patients with cancer; Streptococcus mitis (68 patients) and S. oralis (22 patients) were the most frequently identified strains. Compared with patients infected with non–S. mitis strains, patients infected with S. mitis strains were more likely to have moderate or severe clinical disease (e.g., VGS shock syndrome). Combined with the sequence data, whole-genome analyses showed that S. mitis strains may more precisely be considered as >2 species. Furthermore, we found that multiple S. mitis strains induced disease in neutropenic mice in a dose-dependent fashion. Our data define the prominent clinical effect of the group of organisms currently classified as S. mitis and lay the groundwork for increased understanding of this understudied pathogen. PMID:24750901

Genome sequence of the highly weak-acid-tolerant Zygosaccharomyces bailii IST302, amenable to genetic manipulations and physiological studies.

PubMed

Palma, Margarida; Münsterkötter, Martin; Peça, João; Güldener, Ulrich; Sá-Correia, Isabel

2017-06-01

Zygosaccharomyces bailii is one of the most problematic spoilage yeast species found in the food and beverage industry particularly in acidic products, due to its exceptional resistance to weak acid stress. This article describes the annotation of the genome sequence of Z. bailii IST302, a strain recently proven to be amenable to genetic manipulations and physiological studies. The work was based on the annotated genomes of strain ISA1307, an interspecies hybrid between Z. bailii and a closely related species, and the Z. bailii reference strain CLIB 213T. The resulting genome sequence of Z. bailii IST302 is distributed through 105 scaffolds, comprising a total of 5142 genes and a size of 10.8 Mb. Contrasting with CLIB 213T, strain IST302 does not form cell aggregates, allowing its manipulation in the laboratory for genetic and physiological studies. Comparative cell cycle analysis with the haploid and diploid Saccharomyces cerevisiae strains BY4741 and BY4743, respectively, suggests that Z. bailii IST302 is haploid. This is an additional trait that makes this strain attractive for the functional analysis of non-essential genes envisaging the elucidation of mechanisms underlying its high tolerance to weak acid food preservatives, or the investigation and exploitation of the potential of this resilient yeast species as cell factory. © FEMS 2017.

Taonella mepensis gen. nov., sp. nov., a member of the family Rhodospirillaceae isolated from activated sludge.

PubMed

Xi, Xue-dong; Dong, Wei-liang; Zhang, Jun; Huang, Yan; Cui, Zhong-li

2013-07-01

A novel Gram-negative, non-spore-forming, rod-shaped strain, H1(T), was isolated from activated sludge by micromanipulation. No close relatives among cultured bacterial isolates were found; phylogenetic analysis based on 16S rRNA gene sequences revealed that strain H1(T) forms a deep single branch in the family Rhodospirillaceae. Cells of strain H1(T) were slightly curved to straight rods (1.2-1.4 × 1.5-1.7 µm) and motile by a single polar flagellum. Strain H1(T) was able to grow in the presence of 0-4 % NaCl and grew optimally at 37 °C and pH 6.0-7.0. Chemotaxonomic analysis revealed that strain H1(T) possessed Q-10 as the predominant ubiquinone and C18 : 1ω7c, C16 : 0 and C19 : 0 cyclo ω8c as the major fatty acids. The DNA G+C content of strain H1(T) was 65.1 mol%. Comparative analysis of 16S rRNA gene sequences, and phenotypic and chemotaxonomic data, indicate that strain H1(T) should represent a novel genus and species of the family Rhodospirillaceae. The name Taonella mepensis gen. nov., sp. nov. is proposed. The type strain of Taonella mepensis is H1(T) ( = CICC 10529(T) = CCTCC AB 2012861(T) = KACC 16940(T)).

An Entamoeba sp. strain isolated from rhesus monkey is virulent but genetically different from Entamoeba histolytica.

PubMed

Tachibana, Hiroshi; Yanagi, Tetsuo; Pandey, Kishor; Cheng, Xun-Jia; Kobayashi, Seiki; Sherchand, Jeevan B; Kanbara, Hiroji

2007-06-01

An Entamoeba sp. strain, P19-061405, was isolated from a rhesus monkey in Nepal and characterized genetically. The strain was initially identified as Entamoeba histolytica using PCR amplification of peroxiredoxin genes. However, sequence analysis of the 18S rRNA gene showed a 0.8% difference when compared to the reference E. histolytica HM-1:IMSS human strain. Differences were also observed in the 5.8S rRNA gene and the internal transcribed spacer (ITS) regions 1 and 2, and analysis of the serine-rich protein gene from the monkey strain showed unique codon usages compared to E. histolytica isolated from humans. The amino acid sequences of two hexokinases and two glucose phosphate isomerases also differed from those of E. histolytica. Isoenzyme analyses of these enzymes in the monkey strain showed different electrophoretic mobility patterns compared with E. histolytica isolates. Analysis of peroxiredoxin genes indicated the presence of at least seven different types of protein, none of which were identical to proteins in E. histolytica. When the trophozoites from the monkey strain were inoculated into the livers of hamsters, formation of amebic abscesses was observed 7 days after the injection. These results demonstrate that the strain is genetically different from E. histolytica and is virulent. Revival of the name Entamoeba nuttalli is proposed for the organism.

Phylogenetic analysis of two goat-origin PCV2 isolates in China.

PubMed

Wang, Xiaomin; Li, Wenliang; Xu, Xianglan; Wang, Wei; He, Kongwang; Fan, Hongjie

2018-04-20

Complete genome characterization of non-porcine origin Porcine circovirus type 2 (PCV2) was first described in 2014 in China. In the present study, we first identified PCV2 nucleotides in goat samples and the prevalence of PCV2 in goat was 6.15%. However, only two new strains, Goat2014-4 and Goat2014-5, could be completely sequenced. The genome of the strain Goat2014-4, which collected from the goat infected with PPRV, contains 1766 nt; strain Goat2014-5, which originated from a healthy goat, is comprised of 1767 nt. The results showed that they shared the highest nucleotide identity with BDH and the lowest similarity with DK1980PMWSfree strain and they belonged only to genotype PCV2d. Meanwhile, they shared higher homology with porcine-origin PCV2 strains than others. Moreover, a detailed analysis of the capsid amino acid sequences revealed that there were distinct differences for goat2014-4 (708 bp) and goat2014-5 (705 bp); strain Goat2014-4 showed an elongation of two amino acids, and strains Goat2014-5 showed an elongation of one amino acid compared with other reference strains. This is the first report of the genetic analysis of goat-origin PCV2 isolates. It also provides an additional supported evidence for cross-species transmission of PCV2. Copyright © 2018 Elsevier B.V. All rights reserved.

Acidovorax anthurii sp. nov., a new phytopathogenic bacterium which causes bacterial leaf-spot of anthurium.

PubMed

Gardan, L; Dauga, C; Prior, P; Gillis, M; Saddler, G S

2000-01-01

The bacterial leaf-spot of anthurium emerged during the 1980s, in the French West Indies and Trinidad. This new bacterial disease is presently wide spread and constitutes a serious limiting factor for commercial anthurium production. Twenty-nine strains isolated from leaf-spots of naturally infected anthurium were characterized and compared with reference strains belonging to the Comamonadaceae family, the genera Ralstonia and Burkholderia, and representative fluorescent pseudomonads. From artificial inoculations 25 out of 29 strains were pathogenic on anthurium. Biochemical and physiological tests, fatty acid analysis, DNA-DNA hybridization, 16S rRNA gene sequence analysis, DNA-16S RNA hybridization were performed. The 25 pathogenic strains on anthurium were clustered in one phenon closely related to phytopathogenic strains of the genus Acidovorax. Anthurium strains were 79-99% (deltaTm range 0.2-1.6) related to the strain CFBP 3232 and constituted a discrete DNA homology group indicating that they belong to the same species. DNA-rRNA hybridization, 16S rRNA sequence and fatty acid analysis confirmed that this new species belongs to the beta-subclass of Proteobacteria and to rRNA superfamily III, to the family of Comamonadaceae and to the genus Acidovorax. The name Acidovorax anthurii is proposed for this new phytopathogenic bacterium. The type strain has been deposited in the Collection Française des Bactéries Phytopathogènes as CFBP 3232T.

Multilocus sequence typing and pulsed-field gel electrophoresis analysis of Oenococcus oeni from different wine-producing regions of China.

PubMed

Wang, Tao; Li, Hua; Wang, Hua; Su, Jing

2015-04-16

The present study established a typing method with NotI-based pulsed-field gel electrophoresis (PFGE) and stress response gene schemed multilocus sequence typing (MLST) for 55 Oenococcus oeni strains isolated from six individual regions in China and two model strains PSU-1 (CP000411) and ATCC BAA-1163 (AAUV00000000). Seven stress response genes, cfa, clpL, clpP, ctsR, mleA, mleP and omrA, were selected for MLST testing, and positive selective pressure was detected for these genes. Furthermore, both methods separated the strains into two clusters. The PFGE clusters are correlated with the region, whereas the sequence types (STs) formed by the MLST confirm the two clusters identified by PFGE. In addition, the population structure was a mixture of evolutionary pathways, and the strains exhibited both clonal and panmictic characteristics. Copyright © 2015 Elsevier B.V. All rights reserved.

Comparison of predicted binders in Rhipicephalus (Boophilus) microplus intestine protein variants Bm86 Campo Grande strain, Bm86 and Bm95.

PubMed

Andreotti, Renato; Pedroso, Marisela S; Caetano, Alexandre R; Martins, Natália F

2008-01-01

This paper reports the sequence analysis of Bm86 Campo Grande strain comparing it with Bm86 and Bm95 antigens from the preparations TickGardPLUS and Gavac, respectively. The PCR product was cloned into pMOSBlue and sequenced. The secondary structure prediction tool PSIPRED was used to calculate alpha helices and beta strand contents of the predicted polypeptide. The hydrophobicity profile was calculated using the algorithms from the Hopp and Woods method, in addition to identification of potential MHC class-I binding regions in the antigens. Pair-wise alignment revealed that the similarity between Bm86 Campo Grande strain and Bm86 is 0.2% higher than that between Bm86 Campo Grande strain and Bm95 antigens. The identities were 96.5% and 96.3% respectively. Major suggestive differences in hydrophobicity were predicted among the sequences in two specific regions.

Complete sequence of RNA3 of Cucumber mosaic virus isolates infecting Gerbera jamesonii suggests its grouping under IB subgroup.

PubMed

Gautum, K K; Raj, R; Kumar, S; Raj, S K; Roy, R K; Katiyar, R

2014-01-01

The complete RNA3 genome of Cucumber mosaic virus (CMV) was amplified by RT-PCR from three infected gerbera (Gerbera jamesonii) leaf samples exhibiting severe chlorotic mosaic and flower deformation symptoms. The amplicons obtained were cloned sequenced and deposited in GenBank under the accessions JN692495, JX913531 (from cv. Zingaro) and JX888093 (from cv. Silvester). These sequences shared 98-99 % identities to each other and with a strain of CMV-Banana reported from India, and 90-95 % identities with various strains of CMV reported worldwide. Phylogenetic analysis revealed their closest affinity with CMV-Banana strain, and close relationships with several other strains of CMV of subgroup IB. This study provides evidence of subgroup IB CMV causing severe chlorosis and flower deformation in two cultivars (Zingaro and Silvester) of G. jamesonii in India.

Devosia soli sp. nov., isolated from greenhouse soil in Korea.

PubMed

Yoo, Seung-Hee; Weon, Hang-Yeon; Kim, Byung-Yong; Hong, Seung-Beom; Kwon, Soon-Wo; Cho, Yang-Hee; Go, Seung-Joo; Stackebrandt, Erko

2006-11-01

A Gram-negative, obligately aerobic, rod-shaped bacterium was isolated from greenhouse soil used to cultivate lettuce. The strain, GH2-10T, was characterized on the basis of phenotypic and genotypic data. 16S rRNA gene sequence analysis revealed that the isolate belonged to the genus Devosia, with highest sequence similarity (98.5%) to Devosia riboflavina IFO 13584T. Sequence similarities with other strains tested were below 97.0%. Strain GH2-10T had Q-10 as the predominant ubiquinone and C18:1omega7c and C16:0 as the major fatty acids. The G+C content of the genomic DNA was 59.5 mol%. The results of DNA-DNA hybridization experiments (47% relatedness between D. riboflavina DSM 7230T and strain GH2-10T) and physiological and biochemical tests suggested that strain GH2-10T represents a novel species of the genus Devosia, for which the name Devosia soli sp. nov. is proposed. The type strain is GH2-10T (=KACC 11509T=DSM 17780T).

Molecular prevalence of bovine noroviruses and neboviruses in newborn calves in Iran.

PubMed

Pourasgari, Farzaneh; Kaplon, Jérôme; Sanchooli, Alireza; Fremy, Céline; Karimi-Naghlani, Shahla; Otarod, Vahid; Ambert-Balay, Katia; Mojgani, Naheed; Pothier, Pierre

2018-05-01

In this study, bovine enteric caliciviruses (BECs) were detected in 49.4% of a total of 253 stool specimens for diarrheic calves collected from 42 industrial dairy farms from March 2010 to February 2012. Genogroup III norovirus (NoVsGIII) were more prevalent (39.5%) than neboviruses (NBs) (15%), and coinfections were observed in 5.1% of the samples tested. Sequence analysis of the partial polymerase gene from 13 NoVsGIII samples indicated the circulation of both genotype 1 and genotype 2 strains. Among the six NB strains sequenced, five were related to the Bo/Nebraska/80/US strain, while one was related to the Bo/Newbury1/76/UK strain.

Whole genome sequence analysis of the arctic-lineage strain responsible for distemper in Italian wolves and dogs through a fast and robust next generation sequencing protocol.

PubMed

Marcacci, Maurilia; Ancora, Massimo; Mangone, Iolanda; Teodori, Liana; Di Sabatino, Daria; De Massis, Fabrizio; Camma', Cesare; Savini, Giovanni; Lorusso, Alessio

2014-06-01

Dynamic surveillance and characterization of canine distemper virus (CDV) circulating strains are essential against possible vaccine breakthroughs events. This study describes the setup of a fast and robust next-generation sequencing (NGS) Ion PGM™ protocol that was used to obtain the complete genome sequence of a CDV isolate (CDV2784/2013). CDV2784/2013 is the prototype of CDV strains responsible for severe clinical distemper in dogs and wolves in Italy during 2013. CDV2784/2013 was isolated on cell culture and total RNA was used for NGS sample preparation. A total of 112.3 Mb of reads were assembled de novo using MIRA version 4.0rc4, which yielded a total number of 403 contigs with 12.1% coverage. The whole genome (15,690 bp) was recovered successfully and compared to those of existing CDV whole genomes. CDV2784/2013 was shown to have 92% nt identity with the Onderstepoort vaccine strain. This study describes for the first time a fast and robust Ion PGM™ platform-based whole genome amplification protocol for non-segmented negative stranded RNA viruses starting from total cell-purified RNA. Additionally, this is the first study reporting the whole genome analysis of an Arctic lineage strain that is known to circulate widely in Europe, Asia and USA. Copyright © 2014 Elsevier B.V. All rights reserved.

A PCR technique based on the Hip1 interspersed repetitive sequence distinguishes cyanobacterial species and strains.

PubMed

Smith, J K; Parry, J D; Day, J G; Smith, R J

1998-10-01

The use of primers based on the Hip1 sequence as a typing technique for cyanobacteria has been investigated. The discovery of short repetitive sequence structures in bacterial DNA during the last decade has led to the development of PCR-based methods for typing, i.e., distinguishing and identifying, bacterial species and strains. An octameric palindromic sequence known as Hip1 has been shown to be present in the chromosomal DNA of many species of cyanobacteria as a highly repetitious interspersed sequence. PCR primers were constructed that extended the Hip1 sequence at the 3' end by two bases. Five of the 16 possible extended primers were tested. Each of the five primers produced a different set of products when used to prime PCR from cyanobacterial genomic DNA. Each primer produced a distinct set of products for each of the 15 cyanobacterial species tested. The ability of Hip1-based PCR to resolve taxonomic differences was assessed by analysis of independent isolates of Anabaena flos-aquae and Nostoc ellipsosporum obtained from the CCAP (Culture Collection of Algae and Protozoa, IFE, Cumbria, UK). A PCR-based RFLP analysis of products amplified from the 23S-16S rDNA intergenic region was used to characterize the isolates and to compare with the Hip1 typing data. The RFLP and Hip1 typing yielded similar results and both techniques were able to distinguish different strains. On the basis of these results it is suggested that the Hip1 PCR technique may assist in distinguishing cyanobacterial species and strains.

High genetic diversity of Vibrio cholerae in the European lake Neusiedler See is associated with intensive recombination in the reed habitat and the long-distance transfer of strains.

PubMed

Pretzer, Carina; Druzhinina, Irina S; Amaro, Carmen; Benediktsdóttir, Eva; Hedenström, Ingela; Hervio-Heath, Dominique; Huhulescu, Steliana; Schets, Franciska M; Farnleitner, Andreas H; Kirschner, Alexander K T

2017-01-01

Coastal marine Vibrio cholerae populations usually exhibit high genetic diversity. To assess the genetic diversity of abundant V. cholerae non-O1/non-O139 populations in the Central European lake Neusiedler See, we performed a phylogenetic analysis based on recA, toxR, gyrB and pyrH loci sequenced for 472 strains. The strains were isolated from three ecologically different habitats in a lake that is a hot-spot of migrating birds and an important bathing water. We also analyzed 76 environmental and human V. cholerae non-O1/non-O139 isolates from Austria and other European countries and added sequences of seven genome-sequenced strains. Phylogenetic analysis showed that the lake supports a unique endemic diversity of V. cholerae that is particularly rich in the reed stand. Phylogenetic trees revealed that many V. cholerae isolates from European countries were genetically related to the strains present in the lake belonging to statistically supported monophyletic clades. We hypothesize that the observed phenomena can be explained by the high degree of genetic recombination that is particularly intensive in the reed stand, acting along with the long distance transfer of strains most probably via birds and/or humans. Thus, the Neusiedler See may serve as a bioreactor for the appearance of new strains with new (pathogenic) properties. © 2016 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

Gilliamella intestini sp. nov., Gilliamella bombicola sp. nov., Gilliamella bombi sp. nov. and Gilliamella mensalis sp. nov.: Four novel Gilliamella species isolated from the bumblebee gut.

PubMed

Praet, Jessy; Cnockaert, Margo; Meeus, Ivan; Smagghe, Guy; Vandamme, Peter

2017-06-01

Spectra of five isolates (LMG 28358 T , LMG 29879 T , LMG 29880 T , LMG 28359 T and R-53705) obtained from gut samples of wild bumblebees of Bombus pascuorum, Bombus lapidarius and Bombus terrestris were grouped into four MALDI-TOF MS clusters. RAPD analysis revealed an identical DNA fingerprint for LMG 28359 T and R-53705 which also grouped in the same MALDI-TOF MS cluster, while different DNA fingerprints were obtained for the other isolates. Comparative 16S rRNA gene sequence analysis of the four different strains identified Gilliamella apicola NCIMB 14804 T as nearest neighbour species. Average nucleotide identity values of draft genome sequences of the four isolates and of G. apicola NCIMB 14804 T were below the 96% threshold value for species delineation and all four strains and G. apicola NCIMB 14804 T were phenotypically distinct. Together, the draft genome sequences and phylogenetic and phenotypic data indicate that the four strains represent four novel Gilliamella species for which we propose the names Gilliamella intestini sp. nov., with LMG 28358 T as the type strain, Gilliamella bombicola sp. nov., with LMG 28359 T as the type strain, Gilliamella bombi sp. nov., with LMG 29879 T as the type strain and Gilliamella mensalis sp. nov., with LMG 29880 T as the type strain. Copyright © 2017 Elsevier GmbH. All rights reserved.

Erwinia gerundensis sp. nov., a cosmopolitan epiphyte originally isolated from pome fruit trees.

PubMed

Rezzonico, Fabio; Smits, Theo H M; Born, Yannick; Blom, Jochen; Frey, Jürg E; Goesmann, Alexander; Cleenwerck, Ilse; de Vos, Paul; Bonaterra, Anna; Duffy, Brion; Montesinos, Emilio

2016-03-01

A survey to obtain potential antagonists of pome fruit tree diseases yielded two yellow epiphytic bacterial isolates morphologically similar to Pantoea agglomerans , but showing no biocontrol activity. Whole-cell MALDI-TOF mass spectrometry and analysis of 16S rRNA gene and gyrB sequences suggested the possibility of a novel species with a phylogenetic position in either the genus Pantoea or the genus Erwinia . Multi-locus sequence analysis (MLSA) placed the two strains in the genus Erwinia and supported their classification as a novel species. The strains showed general phenotypic characteristics typical of this genus and results of DNA-DNA hybridizations confirmed that they represent a single novel species. Both strains showed a DNA G+C content, as determined by HPLC, of 54.5 mol% and could be discriminated from phylogenetically related species of the genus Erwinia by their ability to utilize potassium gluconate, potassium 2-ketogluconate, maltose, melibiose and raffinose. Whole-genome sequencing of strain EM595 T revealed the presence of a chromosomal carotenoid biosynthesis gene cluster similar to those found in species of the genera Cronobacter and Pantoea that explains the pigmentation of the strain, which is atypical for the genus Erwinia . Additional strains belonging to the same species were recovered from different plant hosts in three different continents, revealing the cosmopolitan nature of this epiphyte. The name Erwinia gerundensis sp. nov. is proposed, with EM595 T ( = LMG 28990 T  = CCOS 903 T ) as the designated type strain.

Lentzea soli sp. nov., an actinomycete isolated from soil.

PubMed

Li, Dongmei; Zheng, Weiwei; Zhao, Junwei; Han, Liyuan; Zhao, Xueli; Jiang, Hao; Wang, Xiangjing; Xiang, Wensheng

2018-05-01

A novel actinobacterium, designated strain NEAU-LZC 7 T , was isolated from soil collected from Mount Song and characterized using a polyphasic approach. Phylogenetic analysis based on 16S rRNA gene sequence indicated that strain NEAU-LZC 7 T belonged to the genus Lentzea, with highest sequence similarity to Lentzea violacea JCM 10975 T (98.1 %). Morphological and chemotaxonomic characteristics of the strain also supported its assignment to the genus Lentzea. However, DNA-DNA relatedness, physiological and biochemical data showed that strain NEAU-LZC 7 T could be distinguished from its closest relative. Therefore, strain NEAU-LZC 7 T represents a novel species of the genus Lentzea, for which the name Lentzea soli sp. nov. is proposed, with NEAU-LZC 7 T (=CCTCC AA 2017027 T =JCM 32384 T ) as the type strain.

Genotyping-By-Sequencing (GBS) Detects Genetic Structure and Confirms Behavioral QTL in Tame and Aggressive Foxes (Vulpes vulpes)

PubMed Central

Johnson, Jennifer L.; Wittgenstein, Helena; Mitchell, Sharon E.; Hyma, Katie E.; Temnykh, Svetlana V.; Kharlamova, Anastasiya V.; Gulevich, Rimma G.; Vladimirova, Anastasiya V.; Fong, Hiu Wa Flora; Acland, Gregory M.; Trut, Lyudmila N.; Kukekova, Anna V.

2015-01-01

The silver fox (Vulpes vulpes) offers a novel model for studying the genetics of social behavior and animal domestication. Selection of foxes, separately, for tame and for aggressive behavior has yielded two strains with markedly different, genetically determined, behavioral phenotypes. Tame strain foxes are eager to establish human contact while foxes from the aggressive strain are aggressive and difficult to handle. These strains have been maintained as separate outbred lines for over 40 generations but their genetic structure has not been previously investigated. We applied a genotyping-by-sequencing (GBS) approach to provide insights into the genetic composition of these fox populations. Sequence analysis of EcoT22I genomic libraries of tame and aggressive foxes identified 48,294 high quality SNPs. Population structure analysis revealed genetic divergence between the two strains and more diversity in the aggressive strain than in the tame one. Significant differences in allele frequency between the strains were identified for 68 SNPs. Three of these SNPs were located on fox chromosome 14 within an interval of a previously identified behavioral QTL, further supporting the importance of this region for behavior. The GBS SNP data confirmed that significant genetic diversity has been preserved in both fox populations despite many years of selective breeding. Analysis of SNP allele frequencies in the two populations identified several regions of genetic divergence between the tame and aggressive foxes, some of which may represent targets of selection for behavior. The GBS protocol used in this study significantly expanded genomic resources for the fox, and can be adapted for SNP discovery and genotyping in other canid species. PMID:26061395

Genotyping-By-Sequencing (GBS) Detects Genetic Structure and Confirms Behavioral QTL in Tame and Aggressive Foxes (Vulpes vulpes).

PubMed

Johnson, Jennifer L; Wittgenstein, Helena; Mitchell, Sharon E; Hyma, Katie E; Temnykh, Svetlana V; Kharlamova, Anastasiya V; Gulevich, Rimma G; Vladimirova, Anastasiya V; Fong, Hiu Wa Flora; Acland, Gregory M; Trut, Lyudmila N; Kukekova, Anna V

2015-01-01

The silver fox (Vulpes vulpes) offers a novel model for studying the genetics of social behavior and animal domestication. Selection of foxes, separately, for tame and for aggressive behavior has yielded two strains with markedly different, genetically determined, behavioral phenotypes. Tame strain foxes are eager to establish human contact while foxes from the aggressive strain are aggressive and difficult to handle. These strains have been maintained as separate outbred lines for over 40 generations but their genetic structure has not been previously investigated. We applied a genotyping-by-sequencing (GBS) approach to provide insights into the genetic composition of these fox populations. Sequence analysis of EcoT22I genomic libraries of tame and aggressive foxes identified 48,294 high quality SNPs. Population structure analysis revealed genetic divergence between the two strains and more diversity in the aggressive strain than in the tame one. Significant differences in allele frequency between the strains were identified for 68 SNPs. Three of these SNPs were located on fox chromosome 14 within an interval of a previously identified behavioral QTL, further supporting the importance of this region for behavior. The GBS SNP data confirmed that significant genetic diversity has been preserved in both fox populations despite many years of selective breeding. Analysis of SNP allele frequencies in the two populations identified several regions of genetic divergence between the tame and aggressive foxes, some of which may represent targets of selection for behavior. The GBS protocol used in this study significantly expanded genomic resources for the fox, and can be adapted for SNP discovery and genotyping in other canid species.

Characterization of genome sequences and clinical features of coxsackievirus A6 strains collected in Hyogo, Japan in 1999-2013.

PubMed

Ogi, Miki; Yano, Yoshihiko; Chikahira, Masatsugu; Takai, Denshi; Oshibe, Tomohiro; Arashiro, Takeshi; Hanaoka, Nozomu; Fujimoto, Tsuguto; Hayashi, Yoshitake

2017-08-01

Coxsackievirus A6 (CV-A6) is an enterovirus, which is known to cause herpangina. However, since 2009 it has frequently been isolated from children with hand, foot, and mouth disease (HFMD). In Japan, CV-A6 has been linked to HFMD outbreaks in 2011 and 2013. In this study, the full-length genome sequencing of CV-A6 strains were analyzed to identify the association with clinical manifestations. Five thousand six hundred and twelve children with suspected enterovirus infection (0-17 years old) between 1999 and 2013 in Hyogo Prefecture, Japan, were enrolled. Enterovirus infection was confirmed with reverse transcriptase-PCR in 753 children (791 samples), 127 of whom (133 samples) were positive for CV-A6 based on the direct sequencing of the VP4 region. The complete genomes of CV-A6 from 22 positive patients with different clinical manifestations were investigated. A phylogenetic analysis divided these 22 strains into two clusters based on the VP1 region; cluster I contained strains collected in 1999-2009 and mostly related to herpangina, and cluster II contained strains collected in 2011-2013 and related to HFMD outbreak. Based on the full-length polyprotein analysis, the amino acid differences between the strains in cluster I and II were 97.7 ± 0.28%. Amino acid differences were detected in 17 positions within the polyprotein. Strains collected in 1999-2009 and those in 2011-2013 were separately clustered by phylogenetic analysis based on 5'UTR and 3Dpol region, as well as VP1 region. In conclusion, HFMD outbreaks by CV-A6 were recently frequent in Japan and the accumulation of genomic change might be associated with the clinical course. © 2017 Wiley Periodicals, Inc.

[Standard algorithm of molecular typing of Yersinia pestis strains].

PubMed

Eroshenko, G A; Odinokov, G N; Kukleva, L M; Pavlova, A I; Krasnov, Ia M; Shavina, N Iu; Guseva, N P; Vinogradova, N A; Kutyrev, V V

2012-01-01

Development of the standard algorithm of molecular typing of Yersinia pestis that ensures establishing of subspecies, biovar and focus membership of the studied isolate. Determination of the characteristic strain genotypes of plague infectious agent of main and nonmain subspecies from various natural foci of plague of the Russian Federation and the near abroad. Genotyping of 192 natural Y. pestis strains of main and nonmain subspecies was performed by using PCR methods, multilocus sequencing and multilocus analysis of variable tandem repeat number. A standard algorithm of molecular typing of plague infectious agent including several stages of Yersinia pestis differentiation by membership: in main and nonmain subspecies, various biovars of the main subspecies, specific subspecies; natural foci and geographic territories was developed. The algorithm is based on 3 typing methods--PCR, multilocus sequence typing and multilocus analysis of variable tandem repeat number using standard DNA targets--life support genes (terC, ilvN, inv, glpD, napA, rhaS and araC) and 7 loci of variable tandem repeats (ms01, ms04, ms06, ms07, ms46, ms62, ms70). The effectiveness of the developed algorithm is shown on the large number of natural Y. pestis strains. Characteristic sequence types of Y. pestis strains of various subspecies and biovars as well as MLVA7 genotypes of strains from natural foci of plague of the Russian Federation and the near abroad were established. The application of the developed algorithm will increase the effectiveness of epidemiologic monitoring of plague infectious agent, and analysis of epidemics and outbreaks of plague with establishing the source of origin of the strain and routes of introduction of the infection.

[Analysis on molecular epidemiology of rubella virus in Shandong province during 2000-2007].

PubMed

Wang, Chang-Yin; Zhu, Zhen; Xu, Ai-Qiang; Xiong, Ping; Song, Li-Zhi; Xu, Qing; Feng, Lei; Xu, Wen-Bo

2010-11-01

Analyze the genetic characteristics of sixteen strains of wild-type rubella viruses derived from Vero cells, Rk13 cells or Vero/slam cells, and isolated from throat samples in Shandong province during 2000-2007. The 1107 nucleotide sequence of nucleoprotein (E1) gene of these isolates were amplified by RT-PCR, and the PCR products were directly sequenced. Comparing with the gene tree that was constructed based on the 739 gene sequences of the WHO reference strains, twelve isolated strains belonged to 1E genotype, one strain belonged to 1F genotype, three strains belonged to 2A genotype. The first strain belonged to 1E genotype was isolated in Shandong province in 2001, then genotype 1E became dominant genotype of wild rubella viruses circulated. The 1E genotype circulated from 2006-2007 was different compared with that circulated from 2001 to 2002, but no significant deviation in temporal and geographic distribution was found. The strain belonged to Genotype 1F was only isolated during 2000 to 2001. The three strains of 2A genotype of rubella viruses were similar to rubella viruses vaccine strain (BRDII). The most nucleotide mutation of rubella viruses among the sixteen strains were nonsense mutation, and the amino acid sequences were highly conservative with no change in important antigen sites. Alike the previous reports, there was the same amino acid mutation in protein E1 at the site of 338 in all of the 1E genotype rubella viruses isolated during 2001- 2007 in Shandong (Leu338 --> Phe338).

Wide distribution of O157-antigen biosynthesis gene clusters in Escherichia coli.

PubMed

Iguchi, Atsushi; Shirai, Hiroki; Seto, Kazuko; Ooka, Tadasuke; Ogura, Yoshitoshi; Hayashi, Tetsuya; Osawa, Kayo; Osawa, Ro

2011-01-01

Most Escherichia coli O157-serogroup strains are classified as enterohemorrhagic E. coli (EHEC), which is known as an important food-borne pathogen for humans. They usually produce Shiga toxin (Stx) 1 and/or Stx2, and express H7-flagella antigen (or nonmotile). However, O157 strains that do not produce Stxs and express H antigens different from H7 are sometimes isolated from clinical and other sources. Multilocus sequence analysis revealed that these 21 O157:non-H7 strains tested in this study belong to multiple evolutionary lineages different from that of EHEC O157:H7 strains, suggesting a wide distribution of the gene set encoding the O157-antigen biosynthesis in multiple lineages. To gain insight into the gene organization and the sequence similarity of the O157-antigen biosynthesis gene clusters, we conducted genomic comparisons of the chromosomal regions (about 59 kb in each strain) covering the O-antigen gene cluster and its flanking regions between six O157:H7/non-H7 strains. Gene organization of the O157-antigen gene cluster was identical among O157:H7/non-H7 strains, but was divided into two distinct types at the nucleotide sequence level. Interestingly, distribution of the two types did not clearly follow the evolutionary lineages of the strains, suggesting that horizontal gene transfer of both types of O157-antigen gene clusters has occurred independently among E. coli strains. Additionally, detailed sequence comparison revealed that some positions of the repetitive extragenic palindromic (REP) sequences in the regions flanking the O-antigen gene clusters were coincident with possible recombination points. From these results, we conclude that the horizontal transfer of the O157-antigen gene clusters induced the emergence of multiple O157 lineages within E. coli and speculate that REP sequences may involve one of the driving forces for exchange and evolution of O-antigen loci.

Sequence-based genotyping clarifies conflicting historical morphometric and biological data for 5 Eimeria species infecting turkeys.

PubMed

El-Sherry, S; Ogedengbe, M E; Hafeez, M A; Sayf-Al-Din, M; Gad, N; Barta, J R

2015-02-01

Unlike with Eimeria species infecting chickens, specific identification and nomenclature of Eimeria species infecting turkeys is complicated, and in the absence of molecular data, imprecise. In an attempt to reconcile contradictory data reported on oocyst morphometrics and biological descriptions of various Eimeria species infecting turkey, we established single oocyst derived lines of 5 important Eimeria species infecting turkeys, Eimeria meleagrimitis (USMN08-01 strain), Eimeria adenoeides (Guelph strain), Eimeria gallopavonis (Weybridge strain), Eimeria meleagridis (USAR97-01 strain), and Eimeria dispersa (Briston strain). Short portions (514 bp) of mitochondrial cytochrome c oxidase subunit I gene (mt COI) from each were amplified and sequenced. Comparison of these sequences showed sufficient species-specific sequence variation to recommend these short mt COI sequences as species-specific markers. Uniformity of oocyst features (dimensions and oocyst structure) of each pure line was observed. Additional morphological features of the oocysts of these species are described as useful for the microscopic differentiation of these Eimeria species. Combined molecular and morphometric data on these single species lines compared with the original species descriptions and more recent data have helped to clarify some confusing, and sometimes conflicting, features associated with these Eimeria spp. For example, these new data suggest that the KCH and KR strains of E. adenoeides reported previously represent 2 distinct species, E. adenoeides and E. meleagridis, respectively. Likewise, analysis of the Weybridge strain of E. adenoeides, which has long been used as a reference strain in various studies conducted on the pathogenicity of E. adenoeides, indicates that this coccidium is actually a strain of E. gallopavonis. We highly recommend mt COI sequence-based genotyping be incorporated into all studies using Eimeria spp. of turkeys to confirm species identifications and so that any resulting data can be associated correctly with a single named Eimeria species. © 2015 Poultry Science Association Inc.

Genotypic diversity of oscillatoriacean strains belonging to the genera Geitlerinema and Spirulina determined by 16S rDNA restriction analysis.

PubMed

Margheri, Maria C; Piccardi, Raffaella; Ventura, Stefano; Viti, Carlo; Giovannetti, Luciana

2003-05-01

Genotypic diversity of several cyanobacterial strains mostly isolated from marine or brackish waters, belonging to the genera Geitlerinema and Spirulina, was investigated by amplified 16S ribosomal DNA restriction analysis and compared with morphological features and response to salinity. Cluster analysis was performed on amplified 16S rDNA restriction profiles of these strains along with profiles obtained from sequence data of five Spirulina-like strains, including three representatives of the new genus Halospirulina. Our strains with tightly coiled trichomes from hypersaline waters could be assigned to the Halospirulina genus. Among the uncoiled strains, the two strains of hypersaline origin clustered together and were found to be distant from their counterparts of marine and freshwater habitat. Moreover, another cluster, formed by alkali-tolerant strains with tightly coiled trichomes, was well delineated.

Genome sequence analyses of two isolates from the recent Escherichia coli outbreak in Germany reveal the emergence of a new pathotype: Entero-Aggregative-Haemorrhagic Escherichia coli (EAHEC).

PubMed

Brzuszkiewicz, Elzbieta; Thürmer, Andrea; Schuldes, Jörg; Leimbach, Andreas; Liesegang, Heiko; Meyer, Frauke-Dorothee; Boelter, Jürgen; Petersen, Heiko; Gottschalk, Gerhard; Daniel, Rolf

2011-12-01

The genome sequences of two Escherichia coli O104:H4 strains derived from two different patients of the 2011 German E. coli outbreak were determined. The two analyzed strains were designated E. coli GOS1 and GOS2 (German outbreak strain). Both isolates comprise one chromosome of approximately 5.31 Mbp and two putative plasmids. Comparisons of the 5,217 (GOS1) and 5,224 (GOS2) predicted protein-encoding genes with various E. coli strains, and a multilocus sequence typing analysis revealed that the isolates were most similar to the entero-aggregative E. coli (EAEC) strain 55989. In addition, one of the putative plasmids of the outbreak strain is similar to pAA-type plasmids of EAEC strains, which contain aggregative adhesion fimbrial operons. The second putative plasmid harbors genes for extended-spectrum β-lactamases. This type of plasmid is widely distributed in pathogenic E. coli strains. A significant difference of the E. coli GOS1 and GOS2 genomes to those of EAEC strains is the presence of a prophage encoding the Shiga toxin, which is characteristic for enterohemorrhagic E. coli (EHEC) strains. The unique combination of genomic features of the German outbreak strain, containing characteristics from pathotypes EAEC and EHEC, suggested that it represents a new pathotype Entero-Aggregative-Haemorrhagic E scherichia c oli (EAHEC).

Complete Genome Sequence of the Opitutaceae Bacterium Strain TAV5, a Potential Facultative Methylotroph of the Wood-Feeding Termite Reticulitermes flavipes

DOE PAGES

Kotak, Malini; Isanapong, Jantiya; Goodwin, Lynne A.; ...

2015-03-05

The Opitutaceae bacterium strain TAV5, a member of the phylum Verrucomicrobia, was isolated from the wood-feeding termite hindgut. Here, we report here its complete genome sequence, which contains a chromosome and a plasmid of 7,317,842 bp and 99,831 bp, respectively. In conclusion, genomic analysis reveals genes for methylotrophy, lignocellulose degradation, and ammonia and sulfate assimilation.

Complete sequence of the first chimera genome constructed by cloning the whole genome of Synechocystis strain PCC6803 into the Bacillus subtilis 168 genome.

PubMed

Watanabe, Satoru; Shiwa, Yuh; Itaya, Mitsuhiro; Yoshikawa, Hirofumi

2012-12-01

Genome synthesis of existing or designed genomes is made feasible by the first successful cloning of a cyanobacterium, Synechocystis PCC6803, in Gram-positive, endospore-forming Bacillus subtilis. Whole-genome sequence analysis of the isolate and parental B. subtilis strains provides clues for identifying single nucleotide polymorphisms (SNPs) in the 2 complete bacterial genomes in one cell.

Temporal evolution and potential recombination events in PRRSV strains of Sonora Mexico.

PubMed

Burgara-Estrella, Alexel; Reséndiz-Sandoval, Mónica; Cortey, Martí; Mateu, Enric; Hernández, Jesús

2014-12-05

The aim of this work was to examine the evolution and potential existence of intragenic recombinations of PRRSV strains in Sonora, Mexico. In this study, 142 serum samples from farms located in Hermosillo (HMO), Cd. Obregón (OBR) and Navojoa (NAV) were sequenced from 2002 to 2012. Ninety non-redundant sequences of ORF5 gene were analyzed for temporal and spatial relationships among strains and the probability of a recombination event. The phylogenetic analysis showed 30 strains grouped into eight groups; 16 strains were closely related among the farms, while 14 were un-related. The first strain in this study was observed in 2002. A number of farms were infected with one or more strains, and in the majority of the strains, the virus was replaced by a new strain. The recombination analysis suggested the presence of four viruses as products of a recombination event; in one case, a virus close related with MLV vaccine was involved as the parent virus. This work shows the evolution of PRRSV in the field, the viral dissemination between farms and the potential recombination events. Our data suggest that PRRSV in Sonora has a specific genetic nature compared with other PRRSV. Copyright © 2014 Elsevier B.V. All rights reserved.

Clavibacter michiganensis subsp. capsici subsp. nov., causing bacterial canker disease in pepper.

PubMed

Oh, Eom-Ji; Bae, Chungyun; Lee, Han-Beoyl; Hwang, In Sun; Lee, Hyok-In; Yea, Mi Chi; Yim, Kyu-Ock; Lee, Seungdon; Heu, Sunggi; Cha, Jae-Soon; Oh, Chang-Sik

2016-10-01

Clavibacter michiganensis is a Gram-stain-positive bacterium with eight subspecies. One of these subspecies is C. michiganensis subsp. michiganensis, which causes bacterial canker disease in tomato. Bacterial strains showing very similar canker disease symptoms to those of a strain originally classified as C. michiganensis have been isolated from pepper. In this paper, we reclassified strains isolated from pepper. On the basis of phylogenetic analysis with 16S rRNA gene sequences, the strains isolated from pepper were grouped in a separate clade from other subspecies of C. michiganensis. Biochemical, physiological and genetic characteristics of strain PF008T, which is the representative strain of the isolates from pepper, were examined in this study. Based on multi-locus sequence typing and other biochemical and physiological features including colony color, utilization of carbon sources and enzyme activities, strain PF008T was categorically differentiated from eight subspecies of C. michiganensis. Moreover, genome analysis showed that the DNA G+C content of strain PF008T is 73.2 %. These results indicate that PF008T is distinct from other known subspecies of C. michiganensis. Therefore, we propose a novel subspecies, C. michiganensis subsp. capsici, causing bacterial canker disease in pepper, with a type strain of PF008T (=KACC 18448T=LMG 29047T).

Genomic Analysis of Phylotype I Strain EP1 Reveals Substantial Divergence from Other Strains in the Ralstonia solanacearum Species Complex

PubMed Central

Li, Peng; Wang, Dechen; Yan, Jinli; Zhou, Jianuan; Deng, Yinyue; Jiang, Zide; Cao, Bihao; He, Zifu; Zhang, Lianhui

2016-01-01

Ralstonia solanacearum species complex is a devastating group of phytopathogens with an unusually wide host range and broad geographical distribution. R. solanacearum isolates may differ considerably in various properties including host range and pathogenicity, but the underlying genetic bases remain vague. Here, we conducted the genome sequencing of strain EP1 isolated from Guangdong Province of China, which belongs to phylotype I and is highly virulent to a range of solanaceous crops. Its complete genome contains a 3.95-Mb chromosome and a 2.05-Mb mega-plasmid, which is considerably bigger than reported genomes of other R. solanacearum strains. Both the chromosome and the mega-plasmid have essential house-keeping genes and many virulence genes. Comparative analysis of strain EP1 with other 3 phylotype I and 3 phylotype II, III, IV strains unveiled substantial genome rearrangements, insertions and deletions. Genome sequences are relatively conserved among the 4 phylotype I strains, but more divergent among strains of different phylotypes. Moreover, the strains exhibited considerable variations in their key virulence genes, including those encoding secretion systems and type III effectors. Our results provide valuable information for further elucidation of the genetic basis of diversified virulences and host range of R. solanacearum species. PMID:27833603

Identification of phylogenetic position in the Chlamydiaceae family for Chlamydia strains released from monkeys and humans with chlamydial pathology.

PubMed

Karaulov, Alexander; Aleshkin, Vladimir; Slobodenyuk, Vladimir; Grechishnikova, Olga; Afanasyev, Stanislav; Lapin, Boris; Dzhikidze, Eteri; Nesvizhsky, Yuriy; Evsegneeva, Irina; Voropayeva, Elena; Afanasyev, Maxim; Aleshkin, Andrei; Metelskaya, Valeria; Yegorova, Ekaterina; Bayrakova, Alexandra

2010-01-01

Based on the results of the comparative analysis concerning relatedness and evolutional difference of the 16S-23S nucleotide sequences of the middle ribosomal cluster and 23S rRNA I domain, and based on identification of phylogenetic position for Chlamydophila pneumoniae and Chlamydia trichomatis strains released from monkeys, relatedness of the above stated isolates with similar strains released from humans and with strains having nucleotide sequences presented in the GenBank electronic database has been detected for the first time ever. Position of these isolates in the Chlamydiaceae family phylogenetic tree has been identified. The evolutional position of the investigated original Chlamydia and Chlamydophila strains close to analogous strains from the Gen-Bank electronic database has been demonstrated. Differences in the 16S-23S nucleotide sequence of the middle ribosomal cluster and 23S rRNA I domain of plasmid and nonplasmid Chlamydia trachomatis strains released from humans and monkeys relative to different genotype groups (group B-B, Ba, D, Da, E, L1, L2, L2a; intermediate group-F, G, Ga) have been revealed for the first time ever. Abnormality in incA chromosomal gene expression resulting in Chlamydia life development cycle disorder, and decrease of Chlamydia virulence can be related to probable changes in the nucleotide sequence of the gene under consideration.

Molecular typing of Vibrio parahaemolyticus strains isolated from the Philippines by PCR-based methods.

PubMed

Maluping, R P; Ravelo, C; Lavilla-Pitogo, C R; Krovacek, K; Romalde, J L

2005-01-01

The main aim of the present study was to use three PCR-based techniques for the analysis of genetic variability among Vibrio parahaemolyticus strains isolated from the Philippines. Seventeen strains of V. parahaemolyticus isolated from shrimps (Penaeus monodon) and from the environments where these shrimps are being cultivated were analysed by random amplified polymorphic DNA PCR (RAPD-PCR), enterobacterial repetitive intergenic consensus sequence PCR (ERIC-PCR) and repetitive extragenic palindromic PCR (REP-PCR). The results of this work have demonstrated genetic variability within the V. parahaemolyticus strains that were isolated from the Philippines. In addition, RAPD, ERIC and REP-PCR are suitable rapid typing methods for V. parahaemolyticus. All three methods have good discriminative ability and can be used as a rapid means of comparing V. parahaemolyticus strains for epidemiological investigation. Based on the results of this study, we could say that REP-PCR is inferior to RAPD and ERIC-PCR owing to the fact that it is less reproducible. Moreover, the REP-PCR analysis yielded a relatively small number of products. This may suggests that the REP sequences may not be widely distributed in the V. parahaemolyticus genome. Genetic variability within V. parahaemolyticus strains isolated in the Philippines has been demonstrated. The presence of ERIC and REP sequences in the genome of this bacterial species was confirmed. The RAPD, ERIC and REP-PCR techniques are useful methods for molecular typing of V. parahaemolyticus strains. To our knowledge this is the first study of this kind carried out on V. parahaemolyticus strains isolated from the Philippines.

Genome Sequences and Phylogenetic Analysis of K88- and F18-Positive Porcine Enterotoxigenic Escherichia coli

PubMed Central

Shepard, Sara M.; Danzeisen, Jessica L.; Isaacson, Richard E.; Seemann, Torsten; Achtman, Mark

2012-01-01

Porcine enterotoxigenic Escherichia coli (ETEC) continues to result in major morbidity and mortality in the swine industry via postweaning diarrhea. The key virulence factors of ETEC strains, their serotypes, and their fimbrial components have been well studied. However, most studies to date have focused on plasmid-encoded traits related to colonization and toxin production, and the chromosomal backgrounds of these strains have been largely understudied. Here, we generated the genomic sequences of K88-positive and F18-positive porcine ETEC strains and examined the phylogenetic distribution of clinical porcine ETEC strains and their plasmid-associated genetic content. The genomes of porcine ETEC strains UMNK88 and UMNF18 were both found to contain remarkable plasmid complements containing known virulence factors, potential novel virulence factors, and antimicrobial resistance-associated elements. The chromosomes of these strains also possessed several unique genomic islands containing hypothetical genes with similarity to classical virulence factors, although phage-associated genomic islands dominated the accessory genomes of these strains. Phylogenetic analysis of 78 clinical isolates associated with neonatal and porcine diarrhea revealed that a limited subset of porcine ETEC lineages exist that generally contain common toxin and fimbrial profiles, with many of the isolates belonging to the ST10, ST23, and ST169 multilocus sequencing types. These lineages were generally distinct from existing human ETEC database isolates. Overall, most porcine ETEC strains appear to have emerged from a limited subset of E. coli lineages that either have an increased propensity to carry plasmid-encoded virulence factors or have the appropriate ETEC core genome required for virulence. PMID:22081385

Relationships between functional genes in Lactobacillus delbrueckii ssp. bulgaricus isolates and phenotypic characteristics associated with fermentation time and flavor production in yogurt elucidated using multilocus sequence typing.

PubMed

Liu, Wenjun; Yu, Jie; Sun, Zhihong; Song, Yuqin; Wang, Xueni; Wang, Hongmei; Wuren, Tuoya; Zha, Musu; Menghe, Bilige; Heping, Zhang

2016-01-01

Lactobacillus delbrueckii ssp. bulgaricus (L. bulgaricus) is well known for its worldwide application in yogurt production. Flavor production and acid producing are considered as the most important characteristics for starter culture screening. To our knowledge this is the first study applying functional gene sequence multilocus sequence typing technology to predict the fermentation and flavor-producing characteristics of yogurt-producing bacteria. In the present study, phenotypic characteristics of 35 L. bulgaricus strains were quantified during the fermentation of milk to yogurt and during its subsequent storage; these included fermentation time, acidification rate, pH, titratable acidity, and flavor characteristics (acetaldehyde concentration). Furthermore, multilocus sequence typing analysis of 7 functional genes associated with fermentation time, acid production, and flavor formation was done to elucidate the phylogeny and genetic evolution of the same L. bulgaricus isolates. The results showed that strains significantly differed in fermentation time, acidification rate, and acetaldehyde production. Combining functional gene sequence analysis with phenotypic characteristics demonstrated that groups of strains established using genotype data were consistent with groups identified based on their phenotypic traits. This study has established an efficient and rapid molecular genotyping method to identify strains with good fermentation traits; this has the potential to replace time-consuming conventional methods based on direct measurement of phenotypic traits. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Pantoea allii sp. nov., isolated from onion plants and seed.

PubMed

Brady, Carrie L; Goszczynska, Teresa; Venter, Stephanus N; Cleenwerck, Ilse; De Vos, Paul; Gitaitis, Ronald D; Coutinho, Teresa A

2011-04-01

Eight yellow-pigmented, Gram-negative, rod-shaped, oxidase-negative, motile, facultatively anaerobic bacteria were isolated from onion seed in South Africa and from an onion plant exhibiting centre rot symptoms in the USA. The isolates were assigned to the genus Pantoea on the basis of phenotypic and biochemical tests. 16S rRNA gene sequence analysis and multilocus sequence analysis (MLSA), based on gyrB, rpoB, infB and atpD sequences, confirmed the allocation of the isolates to the genus Pantoea. MLSA further indicated that the isolates represented a novel species, which was phylogenetically most closely related to Pantoea ananatis and Pantoea stewartii. Amplified fragment length polymorphism analysis also placed the isolates into a cluster separate from P. ananatis and P. stewartii. Compared with type strains of species of the genus Pantoea that showed >97 % 16S rRNA gene sequence similarity with strain BD 390(T), the isolates exhibited 11-55 % whole-genome DNA-DNA relatedness, which confirmed the classification of the isolates in a novel species. The most useful phenotypic characteristics for the differentiation of the isolates from their closest phylogenetic neighbours are production of acid from amygdalin and utilization of adonitol and sorbitol. A novel species, Pantoea allii sp. nov., is proposed, with type strain BD 390(T) ( = LMG 24248(T)).

[Chlorobaculum macestae sp. nov., a new green sulfur bacterium].

PubMed

Koppen, O I; Berg, I A; Lebedeva, N V; Taisova, A S; Kolganova, T V; Slobodova, N V; Bulygina, E S; Turova, T P; Ivanovskiĭ, R N

2008-01-01

The investigated green sulfur bacterium, strain M, was isolated from a sulfidic spring on the Black Sea Coast of the Caucasus. The cells of strain M are straight or curved rods 0.6-0.9 x 1.8-4.2 microm in size. According to the cell wall structure, the bacteria are gram-negative. Chlorosomes are located along the cell periphery. Strain M is an obligate anaerobe capable of photoautotrophic growth on sulfide, thiosulfate, and H2. It utilizes ammonium, urea, casein hydrolysate, and N2 as nitrogen sources and sulfide, thiosulfate, and elemental sulfur as sulfur sources. Bacteriochlorophyll c and the carotenoid chlorobactene are the main pigments. The optimal growth temperature is 25-28 degrees C; the optimal pH is 6.8. The strain does not require NaCl. Vitamin B12 stimulates growth. The content of the G+C base pairs in the DNA of strain M is 58.3 mol %. In the phylogenetic tree constructed on the basis of analysis of nucleotide sequences of 16S rRNA genes, strain M forms a separate branch, which occupies an intermediate position between the phylogenetic cluster containing representatives of the genus Chlorobaculum (94.9-96.8%) and the cluster containing species of the genus Chlorobium (94.1-96.5%). According to the results of analysis of the amino acid sequence corresponding to the fmo gene, strain M represents a branch which, unlike that in the "ribosomal" tree, falls into the cluster of the genus Chlorobaculum (95.8-97.2%). Phylogenetic analysis of the amino acid sequence corresponding to the nifH gene placed species of the genera Chlorobaculum and Chlorobium into a single cluster, whereas strain M formed a separate branch. The results obtained allow us to describe strain M as a new species of the genus Chlorobaculum. Chlorobaculum macestae sp. nov.

Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

PubMed

Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

2004-01-01

Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Zygosaccharomyces favi sp. nov., an obligate osmophilic yeast species from bee bread and honey.

PubMed

Čadež, Neža; Fülöp, László; Dlauchy, Dénes; Péter, Gábor

2015-03-01

Five yeast strains representing a hitherto undescribed yeast species were isolated from bee bread and honey in Hungary. They are obligate osmophilic, i.e. they are unable to grow in/on high water activity culture media. Following isogamous conjugation, they form 1-4 spheroid or subspheroid ascospores in persistent asci. The analysis of the sequences of their large subunit rRNA gene D1/D2 domain placed the new species in the Zygosaccharomyces clade. In terms of pairwise sequence similarity, Zygosaccharomyces gambellarensis is the most closely related species. Comparisons of D1/D2, internal transcribed spacer and translation elongation factor-1α (EF-1α) gene sequences of the five strains with that of the type strain of Z. gambellarensis revealed that they represent a new yeast species. The name Zygosaccharomyces favi sp. nov. (type strain: NCAIM Y.01994(T) = CBS 13653(T) = NRRL Y-63719(T) = ZIM 2551(T)) is proposed for this new yeast species, which based on phenotype can be distinguished from related Zygosaccharomyces species by its obligate osmophilic nature. Some intragenomic sequence variability, mainly indels, was detected among the ITS copies of the strains of the new species.

Complete genome sequence of Enterobacter sp. IIT-BT 08: A potential microbial strain for high rate hydrogen production.

PubMed

Khanna, Namita; Ghosh, Ananta Kumar; Huntemann, Marcel; Deshpande, Shweta; Han, James; Chen, Amy; Kyrpides, Nikos; Mavrommatis, Kostas; Szeto, Ernest; Markowitz, Victor; Ivanova, Natalia; Pagani, Ioanna; Pati, Amrita; Pitluck, Sam; Nolan, Matt; Woyke, Tanja; Teshima, Hazuki; Chertkov, Olga; Daligault, Hajnalka; Davenport, Karen; Gu, Wei; Munk, Christine; Zhang, Xiaojing; Bruce, David; Detter, Chris; Xu, Yan; Quintana, Beverly; Reitenga, Krista; Kunde, Yulia; Green, Lance; Erkkila, Tracy; Han, Cliff; Brambilla, Evelyne-Marie; Lang, Elke; Klenk, Hans-Peter; Goodwin, Lynne; Chain, Patrick; Das, Debabrata

2013-12-20

Enterobacter sp. IIT-BT 08 belongs to Phylum: Proteobacteria, Class: Gammaproteobacteria, Order: Enterobacteriales, Family: Enterobacteriaceae. The organism was isolated from the leaves of a local plant near the Kharagpur railway station, Kharagpur, West Bengal, India. It has been extensively studied for fermentative hydrogen production because of its high hydrogen yield. For further enhancement of hydrogen production by strain development, complete genome sequence analysis was carried out. Sequence analysis revealed that the genome was linear, 4.67 Mbp long and had a GC content of 56.01%. The genome properties encode 4,393 protein-coding and 179 RNA genes. Additionally, a putative pathway of hydrogen production was suggested based on the presence of formate hydrogen lyase complex and other related genes identified in the genome. Thus, in the present study we describe the specific properties of the organism and the generation, annotation and analysis of its genome sequence as well as discuss the putative pathway of hydrogen production by this organism.

Analysis of human immunodeficiency virus type 1 Vif gene sequences among men who have sex with men in Heilongjiang province of China.

PubMed

Shao, Bing; Li, Hang; Liu, Sheng-Yuan; Li, Wen-Jing; Huang, Chao-Qun; Lin, Yuan-Long; Wang, Fu-Xiang; Wang, Bin-You

2013-05-01

To identify the current prevalent subtypes and to study the genetic variation of HIV-1 strains in men who have sex with men (MSM) residing in Heilongjiang province, China. We analyzed the characteristics of the nucleotide sequences and the corresponding deduced protein of Vif of HIV-1 strains isolated from 17 drug-naive HIV-1-seropositive MSM. Subtypes B (7.65%) and B' (Thailand B) (11.76%), CRF07_BC (47.06%), and CRF01_AE (23.53%) were identified. Phylogenetic analysis showed that there was a close relationship between our strains and those from the same MSM population in Hebei province, which is geographically close to Heilongjiang. Most of the documented Vif functional motifs are well conserved in the majority of our analyzed sequences. Taken together, our results suggest that there might be multiple introductions of HIV in Heilongjiang MSM and frequent sexual communications with other geographically nearby MSM populations.

Homology analysis and cross-immunogenicity of OmpA from pathogenic Yersinia enterocolitica, Yersinia pseudotuberculosis and Yersinia pestis.

PubMed

Chen, Yuhuang; Duan, Ran; Li, Xu; Li, Kewei; Liang, Junrong; Liu, Chang; Qiu, Haiyan; Xiao, Yuchun; Jing, Huaiqi; Wang, Xin

2015-12-01

The outer membrane protein A (OmpA) is one of the intra-species conserved proteins with immunogenicity widely found in the family of Enterobacteriaceae. Here we first confirmed OmpA is conserved in the three pathogenic Yersinia: Yersinia pestis, Yersinia pseudotuberculosis and pathogenic Yersinia enterocolitica, with high homology at the nucleotide level and at the amino acid sequence level. The identity of ompA sequences for 262 Y. pestis strains, 134 Y. pseudotuberculosis strains and 219 pathogenic Y. enterocolitica strains are 100%, 98.8% and 97.7% similar. The main pattern of OmpA of pathogenic Yersinia are 86.2% and 88.8% identical at the nucleotide and amino acid sequence levels, respectively. Immunological analysis showed the immunogenicity of each OmpA and cross-immunogenicity of OmpA for pathogenic Yersinia where OmpA may be a vaccine candidate for Y. pestis and other pathogenic Yersinia. Copyright © 2015 Elsevier Ltd. All rights reserved.

Streptobacillus notomytis sp. nov., isolated from a spinifex hopping mouse (Notomys alexis Thomas, 1922), and emended description of Streptobacillus Levaditi et al. 1925, Eisenberg et al. 2015 emend.

PubMed

Eisenberg, Tobias; Glaeser, Stefanie P; Ewers, Christa; Semmler, Torsten; Nicklas, Werner; Rau, Jörg; Mauder, Norman; Hofmann, Nicola; Imaoka, Koichi; Kimura, Masanobu; Kämpfer, Peter

2015-12-01

A pleomorphic, Gram-negative, rod-shaped, indole-, oxidase- and catalase-negative, non-spore-forming, non-motile bacterium was isolated in 1979 from the heart of a spinifex hopping mouse (Notomys alexis Thomas, 1922) with septicaemia and stored as Streptobacillus moniliformis in the strain collection of the Animal Health Laboratory, South Perth, Western Australia (AHL 370-1), as well as under CCUG 12425. On the basis of 16SrRNA gene sequence analyses, the strain was assigned to the genus Streptobacillus, with 99.4 % sequence similarity to the type strain of Streptobacillus moniliformis, 95.6 %sequence similarity to the type strain of Streptobacillus hongkongensis and 99.0 %sequence similarity to the type strain of Streptobacillus felis. The clear differentiation of strain AHL 370-1T from Streptobacillus moniliformis, Streptobacillus hongkongensis and Streptobacillus felis was also supported by rpoB, groEL and recA nucleotide and amino acid sequence analysis. Average nucleotide identity was 87.16 % between strain AHL 370-1T and Streptobacillus moniliformis DSM 12112T. Physiological data confirmed the allocation of strain AHL 370-1T to the family Leptotrichiaceae, considering the very similar profiles of enzyme activities and fatty acids compared to closely related species. Within the genus Streptobacillus,isolate AHL 370-1T could also be separated unambiguously from the type strains of Streptobacillus moniliformis, Streptobacillus hongkongensis and Streptobacillus felis by MALDI-TOF mass spectrometry. Two further strains (KWG2 and KWG24) isolated from asymptomatic black rats in Japan were highly similar to AHL 370-1T. On the basis of these data, we propose the novel species Streptobacillus notomytis sp. nov., with the type strain AHL370-1T (=CCUG 12425T=DSM 100026T=CCM 8593T=EF 12425T).

[Sequencing and analysis of the complete genome of a rabies virus isolate from Sika deer].

PubMed

Zhao, Yun-Jiao; Guo, Li; Huang, Ying; Zhang, Li-Shi; Qian, Ai-Dong

2008-05-01

One DRV strain was isolated from Sika Deer brain and sequenced. Nine overlapped gene fragments were amplified by RT-PCR through 3'-RACE and 5'-RACE method, and the complete DRV genome sequence was assembled. The length of the complete genome is 11863bp. The DRV genome organization was similar to other rabies viruses which were composed of five genes and the initiation sites and termination sites were highly conservative. There were mutated amino acids in important antigen sites of nucleoprotein and glycoprotein. The nucleotide and amino acid homologies of gene N, P, M, G, L in strains with completed genomie sequencing were compared. Compared with N gene sequence of other typical rabies viruses, a phylogenetic tree was established . These results indicated that DRV belonged to gene type 1. The highest homology compared with Chinese vaccine strain 3aG was 94%, and the lowest was 71% compared with WCBV. These findings provided theoretical reference for further research in rabies virus.

Olsenella umbonata sp. nov., a microaerotolerant anaerobic lactic acid bacterium from the sheep rumen and pig jejunum, and emended descriptions of Olsenella, Olsenella uli and Olsenella profusa.

PubMed

Kraatz, Mareike; Wallace, R John; Svensson, Liselott

2011-04-01

Strain A2 is an anaerobic, variably Gram-stain-positive, non-spore-forming, small and irregularly rod-shaped bacterium from the ruminal fluid of a sheep that has been described informally as a representative of 'Olsenella (basonym Atopobium) oviles'. Three phenotypically similar bacterial strains (lac15, lac16 and lac31(T)) were isolated in concert with Veillonella magna lac18(T) from the mucosal jejunum of a pig. A phylogenetic analysis based on 16S rRNA gene sequences revealed that strains A2, lac15, lac16 and lac31(T) formed a genetically coherent group (100 % interstrain sequence similarity) within the bigeneric Olsenella-Atopobium branch of the family Coriobacteriaceae, class Actinobacteria. This group was most closely related to the type strains of the two recognized Olsenella species, namely Olsenella uli (sequence similarity of 96.85 %) and Olsenella profusa (sequence similarity of 97.20 %). The sequence similarity to the type strain of Atopobium minutum, the type species of the genus Atopobium, was 92.33 %. Unlike those of O. uli and O. profusa, outgrown colonies of strains A2, lac15, lac16 and lac31(T) were opaque and greyish-white with an umbonate elevation on solid culture media. The four novel strains were characterized as being well-adapted and presumably indigenous to the gastrointestinal tract of homoeothermic vertebrates: they were mesophilic, microaerotolerant, neutrophilic and acidotolerant, bile-resistant, mucin-utilizing and markedly peptidolytic lactic acid bacteria. The results of DNA-DNA hybridizations, cellular fatty acid analysis and other differential phenotypic (physiological and biochemical) tests confirmed that strains A2, lac15, lac16 and lac31(T) represent a novel species of the genus Olsenella. On the basis of the genotypic and phenotypic results, we therefore describe Olsenella umbonata sp. nov., with lac31(T) ( = CCUG 58604(T)  = DSM 22620(T)  = JCM 16156(T)) as the type strain and A2 ( = CCUG 58212  = DSM 22619  = JCM 16157) as an additionally available reference strain. Also, based on our data, we propose emended descriptions of the genus Olsenella and the species Olsenella uli and Olsenella profusa.

Limnobacter spp. as newly detected phenol-degraders among Baltic Sea surface water bacteria characterised by comparative analysis of catabolic genes.

PubMed

Vedler, Eve; Heinaru, Eeva; Jutkina, Jekaterina; Viggor, Signe; Koressaar, Triinu; Remm, Maido; Heinaru, Ain

2013-12-01

A set of phenol-degrading strains of a collection of bacteria isolated from Baltic Sea surface water was screened for the presence of two key catabolic genes coding for phenol hydroxylases and catechol 2,3-dioxygenases. The multicomponent phenol hydroxylase (LmPH) gene was detected in 70 out of 92 strains studied, and 41 strains among these LmPH(+) phenol-degraders were found to exhibit catechol 2,3-dioxygenase (C23O) activity. Comparative phylogenetic analyses of LmPH and C23O sequences from 56 representative strains were performed. The studied strains were mostly affiliated to the genera Pseudomonas and Acinetobacter. However, the study also widened the range of phenol-degraders by including the genus Limnobacter. Furthermore, using a next generation sequencing approach, the LmPH genes of Limnobacter strains were found to be the most prevalent ones in the microbial community of the Baltic Sea surface water. Four different Limnobacter strains having almost identical 16S rRNA gene sequences (99%) and similar physiological properties formed separate phylogenetic clusters of LmPH and C23O genes in the respective phylogenetic trees. Copyright © 2013 Elsevier GmbH. All rights reserved.

Complete sequencing and pan-genomic analysis of Lactobacillus delbrueckii subsp. bulgaricus reveal its genetic basis for industrial yogurt production.

PubMed

Hao, Pei; Zheng, Huajun; Yu, Yao; Ding, Guohui; Gu, Wenyi; Chen, Shuting; Yu, Zhonghao; Ren, Shuangxi; Oda, Munehiro; Konno, Tomonobu; Wang, Shengyue; Li, Xuan; Ji, Zai-Si; Zhao, Guoping

2011-01-17

Lactobacillus delbrueckii subsp. bulgaricus (Lb. bulgaricus) is an important species of Lactic Acid Bacteria (LAB) used for cheese and yogurt fermentation. The genome of Lb. bulgaricus 2038, an industrial strain mainly used for yogurt production, was completely sequenced and compared against the other two ATCC collection strains of the same subspecies. Specific physiological properties of strain 2038, such as lysine biosynthesis, formate production, aspartate-related carbon-skeleton intermediate metabolism, unique EPS synthesis and efficient DNA restriction/modification systems, are all different from those of the collection strains that might benefit the industrial production of yogurt. Other common features shared by Lb. bulgaricus strains, such as efficient protocooperation with Streptococcus thermophilus and lactate production as well as well-equipped stress tolerance mechanisms may account for it being selected originally for yogurt fermentation industry. Multiple lines of evidence suggested that Lb. bulgaricus 2038 was genetically closer to the common ancestor of the subspecies than the other two sequenced collection strains, probably due to a strict industrial maintenance process for strain 2038 that might have halted its genome decay and sustained a gene network suitable for large scale yogurt production.

Complete Sequencing and Pan-Genomic Analysis of Lactobacillus delbrueckii subsp. bulgaricus Reveal Its Genetic Basis for Industrial Yogurt Production

PubMed Central

Ding, Guohui; Gu, Wenyi; Chen, Shuting; Yu, Zhonghao; Ren, Shuangxi; Oda, Munehiro; Konno, Tomonobu; Wang, Shengyue; Li, Xuan; Ji, Zai-Si; Zhao, Guoping

2011-01-01

Lactobacillus delbrueckii subsp. bulgaricus (Lb. bulgaricus) is an important species of Lactic Acid Bacteria (LAB) used for cheese and yogurt fermentation. The genome of Lb. bulgaricus 2038, an industrial strain mainly used for yogurt production, was completely sequenced and compared against the other two ATCC collection strains of the same subspecies. Specific physiological properties of strain 2038, such as lysine biosynthesis, formate production, aspartate-related carbon-skeleton intermediate metabolism, unique EPS synthesis and efficient DNA restriction/modification systems, are all different from those of the collection strains that might benefit the industrial production of yogurt. Other common features shared by Lb. bulgaricus strains, such as efficient protocooperation with Streptococcus thermophilus and lactate production as well as well-equipped stress tolerance mechanisms may account for it being selected originally for yogurt fermentation industry. Multiple lines of evidence suggested that Lb. bulgaricus 2038 was genetically closer to the common ancestor of the subspecies than the other two sequenced collection strains, probably due to a strict industrial maintenance process for strain 2038 that might have halted its genome decay and sustained a gene network suitable for large scale yogurt production. PMID:21264216

Streptococcus moroccensis sp. nov. and Streptococcus rifensis sp. nov., isolated from raw camel milk.

PubMed

Kadri, Zaina; Amar, Mohamed; Ouadghiri, Mouna; Cnockaert, Margo; Aerts, Maarten; El Farricha, Omar; Vandamme, Peter

2014-07-01

Two catalase- and oxidase-negative Streptococcus-like strains, LMG 27682(T) and LMG 27684(T), were isolated from raw camel milk in Morocco. Comparative 16S rRNA gene sequencing assigned these bacteria to the genus Streptococcus with Streptococcus rupicaprae 2777-2-07(T) as their closest phylogenetic neighbour (95.9% and 95.7% similarity, respectively). 16S rRNA gene sequence similarity between the two strains was 96.7%. Although strains LMG 27682(T) and LMG 27684(T) shared a DNA-DNA hybridization value that corresponded to the threshold level for species delineation (68%), the two strains could be distinguished by multiple biochemical tests, sequence analysis of the phenylalanyl-tRNA synthase (pheS), RNA polymerase (rpoA) and ATP synthase (atpA) genes and by their MALDI-TOF MS profiles. On the basis of these considerable phenotypic and genotypic differences, we propose to classify both strains as novel species of the genus Streptococcus, for which the names Streptococcus moroccensis sp. nov. (type strain, LMG 27682(T)  = CCMM B831(T)) and Streptococcus rifensis sp. nov. (type strain, LMG 27684(T)  = CCMM B833(T)) are proposed. © 2014 IUMS.

Micrococcus lactis sp. nov., isolated from dairy industry waste.

PubMed

Chittpurna; Singh, Pradip K; Verma, Dipti; Pinnaka, Anil Kumar; Mayilraj, Shanmugam; Korpole, Suresh

2011-12-01

A Gram-positive, yellow-pigmented, actinobacterial strain, DW152(T), was isolated from a dairy industry effluent treatment plant. 16S rRNA gene sequence analysis indicated that strain DW152(T) exhibited low similarity with many species with validly published names belonging to the genera Micrococcus and Arthrobacter. However, phenotypic properties including chemotaxonomic markers affiliated strain DW152(T) to the genus Micrococcus. Strain DW152(T) had ai-C(15:0) and i-C(15:0) as major cellular fatty acids, and MK-8(H(2)) as the major menaquinone. The cell-wall peptidoglycan of strain DW152(T) had l-lysine as the diagnostic amino acid and the type was A4α. The DNA G+C content of strain DW152(T) was 68.0 mol%. In 16S rRNA gene sequence analysis, strain DW152(T) exhibited significant similarity with Micrococcus terreus NBRC 104258(T), but the mean value of DNA-DNA relatedness between these strains was only 42.3%. Moreover, strain DW152(T) differed in biochemical and chemotaxonomic characteristics from M. terreus and other species of the genus Micrococcus. Based on the above differences, we conclude that strain DW152(T) should be treated as a novel species of the genus Micrococcus, for which the name Micrococcus lactis sp. nov. is proposed. The type strain of Micrococcus lactis sp. nov. is DW152(T) (=MTCC10523(T) =DSM 23694(T)).

Pseudomonas caspiana sp. nov., a citrus pathogen in the Pseudomonas syringae phylogenetic group.

PubMed

Busquets, Antonio; Gomila, Margarita; Beiki, Farid; Mulet, Magdalena; Rahimian, Heshmat; García-Valdés, Elena; Lalucat, Jorge

2017-07-01

In a screening by multilocus sequence analysis of Pseudomonas strains isolated from diverse origins, 4 phylogenetically closely related strains (FBF58, FBF102 T , FBF103, and FBF122) formed a well-defined cluster in the Pseudomonas syringae phylogenetic group. The strains were isolated from citrus orchards in northern Iran with disease symptoms in the leaves and stems and its pathogenicity against citrus plants was demonstrated. The whole genome of the type strain of the proposed new species (FBF102 T =CECT 9164 T =CCUG 69273 T ) was sequenced and characterized. Comparative genomics with the 14 known Pseudomonas species type strains of the P. syringae phylogenetic group demonstrated that this strain belonged to a new genomic species, different from the species described thus far. Genome analysis detected genes predicted to be involved in pathogenesis, such as an atypical type 3 secretion system and two type 6 secretion systems, together with effectors and virulence factors. A polyphasic taxonomic characterization demonstrated that the 4 plant pathogenic strains represented a new species, for which the name Pseudomonas caspiana sp. nov. is proposed. Copyright © 2017 Elsevier GmbH. All rights reserved.