9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2014 CFR

2014-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2013 CFR

2013-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2012 CFR

2012-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

Modified pseudomonas oleovorans phaC1 nucleic acids encoding bispecific polyhydroxyalkanoate polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srienc, Friedrich; Jackson, John K.; Somers, David A.

A genetically engineered Pseudomonas oleovorans phaC1 polyhydroxyalkanoate (PHA) polymerase having tailored substrate specificity is provided. The modified PHA polymerase is preferably a "bispecific" PHA polymerase capable of copolymerizing a short chain length monomer and a medium chain length monomer is provided. Methods for making the modified PHA polymerase and for making nucleic acids encoding the modified PHA polymerase are also disclosed, as are methods of producing PHA using the modified PHA polymerase. The invention further includes methods to assay for altered substrate specificity.

Electrokinetic stringency control in self-assembled monolayer-based biosensors for multiplex urinary tract infection diagnosis.

PubMed

Liu, Tingting; Sin, Mandy L Y; Pyne, Jeff D; Gau, Vincent; Liao, Joseph C; Wong, Pak Kin

2014-01-01

Rapid detection of bacterial pathogens is critical toward judicious management of infectious diseases. Herein, we demonstrate an in situ electrokinetic stringency control approach for a self-assembled monolayer-based electrochemical biosensor toward urinary tract infection diagnosis. The in situ electrokinetic stringency control technique generates Joule heating induced temperature rise and electrothermal fluid motion directly on the sensor to improve its performance for detecting bacterial 16S rRNA, a phylogenetic biomarker. The dependence of the hybridization efficiency reveals that in situ electrokinetic stringency control is capable of discriminating single-base mismatches. With electrokinetic stringency control, the background noise due to the matrix effects of clinical urine samples can be reduced by 60%. The applicability of the system is demonstrated by multiplex detection of three uropathogenic clinical isolates with similar 16S rRNA sequences. The results demonstrate that electrokinetic stringency control can significantly improve the signal-to-noise ratio of the biosensor for multiplex urinary tract infection diagnosis. Urinary tract infections remain a significant cause of mortality and morbidity as secondary conditions often related to chronic diseases or to immunosuppression. Rapid and sensitive identification of the causative organisms is critical in the appropriate management of this condition. These investigators demonstrate an in situ electrokinetic stringency control approach for a self-assembled monolayer-based electrochemical biosensor toward urinary tract infection diagnosis, establishing that such an approach significantly improves the biosensor's signal-to-noise ratio. © 2013.

Problem-Solving Test: Real-Time Polymerase Chain Reaction

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

Assessing the potential additionality of certification by the Round table on Responsible Soybeans and the Roundtable on Sustainable Palm Oil

NASA Astrophysics Data System (ADS)

Garrett, Rachael D.; Carlson, Kimberly M.; Rueda, Ximena; Noojipady, Praveen

2016-04-01

Multi-stakeholder roundtables offering certification programs are promising voluntary governance mechanisms to address sustainability issues associated with international agricultural supply chains. Yet, little is known about whether roundtable certifications confer additionality, the benefits of certification beyond what would be expected from policies and practices currently in place. Here, we examine the potential additionality of the Round table on Responsible Soybeans (RTRS) and the Roundtable on Sustainable Palm Oil (RSPO) in mitigating conversion of native vegetation to cropland. We develop a metric of additionality based on business as usual land cover change dynamics and roundtable standard stringency relative to existing policies. We apply this metric to all countries with RTRS (n = 8) and RSPO (n = 12) certified production in 2013-2014, as well as countries that have no certified production but are among the top ten global producers in terms of soy (n = 2) and oil palm (n = 2). We find RSPO and RTRS both have substantially higher levels of stringency than existing national policies except in Brazil and Uruguay. In regions where these certification standards are adopted, the mean estimated rate of tree cover conversion to the target crop is similar for both standards. RTRS has higher mean relative stringency than the RSPO, yet RSPO countries have slightly higher enforcement levels. Therefore, mean potential additionality of RTRS and RSPO is similar across regions. Notably, countries with the highest levels of additionality have some adoption. However, with extremely low adoption rates (0.41% of 2014 global harvested area), RTRS likely has lower impact than RSPO (14%). Like most certification programs, neither roundtable is effectively targeting smallholder producers. To improve natural ecosystem protection, roundtables could target adoption to regions with low levels of environmental governance and high rates of forest-to-cropland conversion.

Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

PubMed

Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

2018-06-01

Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

PubMed Central

Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

2010-01-01

Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

PubMed

Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

2010-04-01

Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

A novel method for detection of H9N2 influenza viruses by an aptamer-real time-PCR.

PubMed

Hmila, Issam; Wongphatcharachai, Manoosak; Laamiri, Nacira; Aouini, Rim; Marnissi, Boutheina; Arbi, Marwa; Sreevatsan, Srinand; Ghram, Abdeljelil

2017-05-01

H9N2 Influenza subtype has emerged in Tunisia causing epidemics in poultry and resulting in major economic losses. New mutations in their hemagglutinin and neuraminidase proteins were acquired, suggesting their potential to directly infect humans. Effective surveillance tools should be implemented to help prevent potential spillover of the virus across species. We have developed a highly sensitive real time immuno-polymerase chain reaction (RT-I-PCR) method for detecting H9N2 virus. The assay applies aptamers as ligands to capture and detect the virus. First, a panel of specific ssDNA aptamers was selected via a one step high stringency protocol. Next, the panel of selected aptamers was characterized for their affinities and their specificity to H9N2 virus. The aptamer showing the highest binding affinity to the virus was used as ligand to develop a highly sensitive sandwich Aptamer I-PCR. A 3-log increase in analytical sensitivity was achieved as compared to a routinely used ELISA antigen test, highlighting the potential of this approach to detect very low levels of virus particles. The test was validated using clinical samples and constitutes a rapid and a label-free platform, opening a new venue for the development of aptamer -based viability sensing for a variety of microorganisms of economic importance in Tunisia and surrounding regions. Copyright © 2017 Elsevier B.V. All rights reserved.

Certificate of need legislation and the dissemination of robotic surgery for prostate cancer.

PubMed

Jacobs, Bruce L; Zhang, Yun; Skolarus, Ted A; Wei, John T; Montie, James E; Schroeck, Florian R; Hollenbeck, Brent K

2013-01-01

The uncertainty about the incremental benefit of robotic prostatectomy and its higher associated costs makes it an ideal target for state based certificate of need laws, which have been enacted in several states. We studied the relationship between certificate of need laws and market level adoption of robotic prostatectomy. We used SEER (Surveillance, Epidemiology, and End Results)-Medicare data from 2003 through 2007 to identify men 66 years old or older treated with prostatectomy for prostate cancer. Using data from the American Health Planning Association, we categorized Health Service Areas according to the stringency of certificate of need regulations (ie low vs high stringency) presiding over that market. We assessed our outcomes (probability of adopting robotic prostatectomy and propensity for robotic prostatectomy use in adopting Health Service Areas) using Cox proportional hazards and Poisson regression models, respectively. Compared to low stringency markets, high stringency markets were more racially diverse (54% vs 15% nonwhite, p <0.01), and had similar population densities (886 vs 861 people per square mile, p = 0.97) and median incomes ($42,344 vs $39,770, p = 0.56). In general, both market types had an increase in the adoption and utilization of robotic prostatectomy. However, the probability of robotic prostatectomy adoption (p = 0.22) did not differ based on a market's certificate of need stringency and use was lower in high stringency markets (p <0.01). State based certificate of need regulations were ineffective in constraining robotic surgery adoption. Despite decreased use in high stringency markets, similar adoption rates suggest that other factors impact the diffusion of robotic prostatectomy. Copyright © 2013 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Primer-independent RNA sequencing with bacteriophage phi6 RNA polymerase and chain terminators.

PubMed

Makeyev, E V; Bamford, D H

2001-05-01

Here we propose a new general method for directly determining RNA sequence based on the use of the RNA-dependent RNA polymerase from bacteriophage phi6 and the chain terminators (RdRP sequencing). The following properties of the polymerase render it appropriate for this application: (1) the phi6 polymerase can replicate a number of single-stranded RNA templates in vitro. (2) In contrast to the primer-dependent DNA polymerases utilized in the sequencing procedure by Sanger et al. (Proc Natl Acad Sci USA, 1977, 74:5463-5467), it initiates nascent strand synthesis without a primer, starting the polymerization on the very 3'-terminus of the template. (3) The polymerase can incorporate chain-terminating nucleotide analogs into the nascent RNA chain to produce a set of base-specific termination products. Consequently, 3' proximal or even complete sequence of many target RNA molecules can be rapidly deduced without prior sequence information. The new technique proved useful for sequencing several synthetic ssRNA templates. Furthermore, using genomic segments of the bluetongue virus we show that RdRP sequencing can also be applied to naturally occurring dsRNA templates. This suggests possible uses of the method in the RNA virus research and diagnostics.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

PubMed

Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

2006-07-01

We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

Polymerase chain reaction system

DOEpatents

Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

2004-03-02

A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

Assessment of examiner leniency and stringency ('hawk-dove effect') in the MRCP(UK) clinical examination (PACES) using multi-facet Rasch modelling

PubMed Central

McManus, IC; Thompson, M; Mollon, J

2006-01-01

Background A potential problem of clinical examinations is known as the hawk-dove problem, some examiners being more stringent and requiring a higher performance than other examiners who are more lenient. Although the problem has been known qualitatively for at least a century, we know of no previous statistical estimation of the size of the effect in a large-scale, high-stakes examination. Here we use FACETS to carry out a multi-facet Rasch modelling of the paired judgements made by examiners in the clinical examination (PACES) of MRCP(UK), where identical candidates were assessed in identical situations, allowing calculation of examiner stringency. Methods Data were analysed from the first nine diets of PACES, which were taken between June 2001 and March 2004 by 10,145 candidates. Each candidate was assessed by two examiners on each of seven separate tasks. with the candidates assessed by a total of 1,259 examiners, resulting in a total of 142,030 marks. Examiner demographics were described in terms of age, sex, ethnicity, and total number of candidates examined. Results FACETS suggested that about 87% of main effect variance was due to candidate differences, 1% due to station differences, and 12% due to differences between examiners in leniency-stringency. Multiple regression suggested that greater examiner stringency was associated with greater examiner experience and being from an ethnic minority. Male and female examiners showed no overall difference in stringency. Examination scores were adjusted for examiner stringency and it was shown that for the present pass mark, the outcome for 95.9% of candidates would be unchanged using adjusted marks, whereas 2.6% of candidates would have passed, even though they had failed on the basis of raw marks, and 1.5% of candidates would have failed, despite passing on the basis of raw marks. Conclusion Examiners do differ in their leniency or stringency, and the effect can be estimated using Rasch modelling. The reasons for differences are not clear, but there are some demographic correlates, and the effects appear to be reliable across time. Account can be taken of differences, either by adjusting marks or, perhaps more effectively and more justifiably, by pairing high and low stringency examiners, so that raw marks can be used in the determination of pass and fail. PMID:16919156

DNA Polymerase III Star Requires ATP to Start Synthesis on a Primed DNA†

PubMed Central

Wickner, William; Kornberg, Arthur

1973-01-01

DNA polymerase III star replicates a ϕX174 single-stranded, circular DNA primed with a fragment of RNA. This reaction proceeds in two stages. In stage I, a complex is formed requiring DNA polymerase III star, ATP, spermidine, copolymerase III*, and RNA-primed ϕX174 single-stranded, circular DNA. The complex, isolated by gel filtration, contains ADP and inorganic phosphate (the products of a specific ATP cleavage) as well as spermidine, polymerase III star, and copolymerase III star. In stage II, the chain grows upon addition of deoxynucleoside triphosphates; ADP and inorganic phosphate are discharged and chain elongation is resistant to antibody to copolymerase III star. Thus ATP and copolymerase III star are required to initiate chain growth but not to sustain it. Images PMID:4519657

Accurate RNA consensus sequencing for high-fidelity detection of transcriptional mutagenesis-induced epimutations.

PubMed

Reid-Bayliss, Kate S; Loeb, Lawrence A

2017-08-29

Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.

Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

PubMed

Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

2012-12-01

Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

PubMed

Chen, Y T; Mercer, G O; Chen, Y

1993-11-01

Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

PubMed

Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

2002-07-01

Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

Chagas disease reactivation in a heart transplant patient infected by domestic Trypanosoma cruzi discrete typing unit I (TcIDOM).

PubMed

Costales, Jaime A; Kotton, Camille N; Zurita-Leal, Andrea C; Garcia-Perez, Josselyn; Llewellyn, Martin S; Messenger, Louisa A; Bhattacharyya, Tapan; Burleigh, Barbara A

2015-08-25

Trypanosoma cruzi, causative agent of Chagas disease, displays high intraspecific genetic diversity: six genetic lineages or discrete typing units (DTUs) are currently recognized, termed TcI through TcVI. Each DTU presents a particular distribution pattern across the Americas, and is loosely associated with different transmission cycles and hosts. Several DTUs are known to circulate in Central America. It has been previously suggested that TcI infection is benign and does not lead to chronic chagasic cardiomyopathy (CCC). In this study, we genotyped T. cruzi parasites circulating in the blood and from explanted cardiac tissue of an El Salvadorian patient who developed reactivation Chagas disease while on immunosuppressive medications after undergoing heart transplant in the U.S. as treatment for end-stage CCC. Parasite typing was performed through molecular methods (restriction fragment length polymorphism of polymerase reaction chain amplified products, microsatellite typing, maxicircle sequence typing and low-stringency single primer PCR, [LSSP-PCR]) as well as lineage-specific serology. We show that the parasites infecting the patient belong to the TcI DTU exclusively. Our data indicate that the parasites isolated from the patient belong to a genotype frequently associated with human infection throughout the Americas (TcIDOM). Our results constitute compelling evidence in support of TcI DTU's ability to cause end-stage CCC and help dispel any residual bias that infection with this lineage is benign, pointing to the need for increased surveillance for dissemination of this genotype in endemic regions, the USA and globally.

Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

USDA-ARS?s Scientific Manuscript database

This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

Risk of breast cancer with CXCR4-using HIV defined by V3 loop sequencing.

PubMed

Goedert, James J; Swenson, Luke C; Napolitano, Laura A; Haddad, Mojgan; Anastos, Kathryn; Minkoff, Howard; Young, Mary; Levine, Alexandra; Adeyemi, Oluwatoyin; Seaberg, Eric C; Aouizerat, Bradley; Rabkin, Charles S; Harrigan, P Richard; Hessol, Nancy A

2015-01-01

Evaluate the risk of female breast cancer associated with HIV-CXCR4 (X4) tropism as determined by various genotypic measures. A breast cancer case-control study, with pairwise comparisons of tropism determination methods, was conducted. From the Women's Interagency HIV Study repository, one stored plasma specimen was selected from 25 HIV-infected cases near the breast cancer diagnosis date and 75 HIV-infected control women matched for age and calendar date. HIV-gp120 V3 sequences were derived by Sanger population sequencing (PS) and 454-pyro deep sequencing (DS). Sequencing-based HIV-X4 tropism was defined using the geno2pheno algorithm, with both high-stringency DS [false-positive rate (3.5) and 2% X4 cutoff], and lower stringency DS (false-positive rate, 5.75 and 15% X4 cutoff). Concordance of tropism results by PS, DS, and previously performed phenotyping was assessed with kappa (κ) statistics. Case-control comparisons used exact P values and conditional logistic regression. In 74 women (19 cases, 55 controls) with complete results, prevalence of HIV-X4 by PS was 5% in cases vs 29% in controls (P = 0.06; odds ratio, 0.14; confidence interval: 0.003 to 1.03). Smaller case-control prevalence differences were found with high-stringency DS (21% vs 36%, P = 0.32), lower stringency DS (16% vs 35%, P = 0.18), and phenotyping (11% vs 31%, P = 0.10). HIV-X4 tropism concordance was best between PS and lower stringency DS (93%, κ = 0.83). Other pairwise concordances were 82%-92% (κ = 0.56-0.81). Concordance was similar among cases and controls. HIV-X4 defined by population sequencing (PS) had good agreement with lower stringency DS and was significantly associated with lower odds of breast cancer.

Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

PubMed

Igarashi, T; Yamamoto, A; Goto, N

1996-10-01

Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

PubMed

Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

2017-01-01

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

EPA Science Inventory

Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

ERIC Educational Resources Information Center

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

USDA-ARS?s Scientific Manuscript database

Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

PubMed

Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

2005-03-01

We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

EPA Science Inventory

A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

EPA Science Inventory

Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

78 FR 66648 - Approval and Promulgation of Implementation Plans; Texas; Procedures for Stringency...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-11-06

... ENVIRONMENTAL PROTECTION AGENCY 40 CFR Part 52 [EPA-R06-OAR-2010-0335; FRL-9902-50-Region 6] Approval and Promulgation of Implementation Plans; Texas; Procedures for Stringency Determinations and Minor Permit Revisions for Federal Operating Permits AGENCY: Environmental Protection Agency (EPA...

78 FR 55234 - Approval and Promulgation of Implementation Plans; Texas; Procedures for Stringency...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-09-10

... ENVIRONMENTAL PROTECTION AGENCY 40 CFR Part 52 [EPA-R06-OAR-2010-0335; FRL-9900-81-Region6] Approval and Promulgation of Implementation Plans; Texas; Procedures for Stringency Determinations and Minor Permit Revisions for Federal Operating Permits AGENCY: Environmental Protection Agency (EPA...

DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

EPA Science Inventory

The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

ERIC Educational Resources Information Center

Phelps, Tara L.; And Others

1996-01-01

Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

Determining Annealing Temperatures for Polymerase Chain Reaction

ERIC Educational Resources Information Center

Porta, Angela R.; Enners, Edward

2012-01-01

The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

USDA-ARS?s Scientific Manuscript database

A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

PubMed

Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

2014-01-01

Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

PubMed Central

Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

2015-01-01

Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

Practical and Theoretical Requirements for Controlling Rater Stringency in Peer Review.

ERIC Educational Resources Information Center

Cason, Gerald J.; Cason, Carolyn L.

This study describes a computer based, performance rating information processing system, performance rating theory, and programs for the application of the theory to obtain ratings free from the effects of reviewer stringency in reviewing abstracts of conference papers. Originally, the Performance Rating (PR) System was used to evaluate the…

Are More Stringent NCLB State Accountability Systems Associated with Better Student Outcomes? An Analysis of NAEP Results across States

ERIC Educational Resources Information Center

Wei, Xin

2012-01-01

This study developed a comprehensive measure of the stringency level of NCLB states' accountability systems, including the strength of their annual measurable objectives, confidence intervals, performance indexing, retesting, minimum subgroup size, and the difficulty levels of proficiency standards. This study related accountability stringency in…

Support for PhD Students: The Impact of Institutional Dynamics on the Pedagogy of Learning Development

ERIC Educational Resources Information Center

Peelo, Moira

2013-01-01

This paper explores one practitioner's learning development work with PhD students in a changing university context in which managerialism and financial stringency have combined. It questions how learning development practitioners can maintain their professional goals while negotiating issues arising from managerialism, financial stringency,…

Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

Identification of Brucella spp. by using the polymerase chain reaction.

PubMed Central

Herman, L; De Ridder, H

1992-01-01

The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

Detection of Listeria monocytogenes by using the polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bessesen, M.T.; Luo, Q.; Blaser, M.J.

1990-09-01

A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

PubMed

Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

2012-07-09

Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

9 CFR 145.33 - Terminology and classification; flocks and products.

Code of Federal Regulations, 2010 CFR

2010-01-01

.... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

PubMed

Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

2016-08-01

On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.

Risk of Breast Cancer with CXCR4-using HIV Defined by V3-Loop Sequencing

PubMed Central

Goedert, James J.; Swenson, Luke C.; Napolitano, Laura A.; Haddad, Mojgan; Anastos, Kathryn; Minkoff, Howard; Young, Mary; Levine, Alexandra; Adeyemi, Oluwatoyin; Seaberg, Eric C.; Aouizerat, Bradley; Rabkin, Charles S.; Harrigan, P. Richard; Hessol, Nancy A.

2014-01-01

Objective Evaluate the risk of female breast cancer associated with HIV-CXCR4 (X4) tropism as determined by various genotypic measures. Methods A breast cancer case-control study, with pairwise comparisons of tropism determination methods, was conducted. From the Women's Interagency HIV Study repository, one stored plasma specimen was selected from 25 HIV-infected cases near the breast cancer diagnosis date and 75 HIV-infected control women matched for age and calendar date. HIVgp120-V3 sequences were derived by Sanger population sequencing (PS) and 454-pyro deep sequencing (DS). Sequencing-based HIV-X4 tropism was defined using the geno2pheno algorithm, with both high-stringency DS [False-Positive-Rate (FPR 3.5) and 2% X4 cutoff], and lower stringency DS (FPR 5.75, 15% X4 cut-off). Concordance of tropism results by PS, DS, and previously performed phenotyping was assessed with kappa (κ) statistics. Case-control comparisons used exact P-values and conditional logistic regression. Results In 74 women (19 cases, 55 controls) with complete results, prevalence of HIV-X4 by PS was 5% in cases vs 29% in controls (P=0.06, odds ratio 0.14, confidence interval 0.003-1.03). Smaller case-control prevalence differences were found with high-stringency DS (21% vs 36%, P=0.32), lower-stringency DS (16% vs 35%, P=0.18), and phenotyping (11% vs 31%, P=0.10). HIV-X4-tropism concordance was best between PS and lower-stringency DS (93%, κ=0.83). Other pairwise concordances were 82%-92% (κ=0.56-0.81). Concordance was similar among cases and controls. Conclusions HIV-X4 defined by population sequencing (PS) had good agreement with lower stringency deep sequencing and was significantly associated with lower odds of breast cancer. PMID:25321183

40 CFR 51.351 - Enhanced I/M performance standard.

Code of Federal Regulations, 2011 CFR

2011-07-01

... vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year vehicles. (11) Waiver... 2001 and newer vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year... which will be achieved by the I/M program design in the SIP to those of the model program described in...

40 CFR 51.351 - Enhanced I/M performance standard.

Code of Federal Regulations, 2012 CFR

2012-07-01

... vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year vehicles. (11) Waiver... 2001 and newer vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year... which will be achieved by the I/M program design in the SIP to those of the model program described in...

40 CFR 51.351 - Enhanced I/M performance standard.

Code of Federal Regulations, 2010 CFR

2010-07-01

... vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year vehicles. (11) Waiver... 2001 and newer vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year... which will be achieved by the I/M program design in the SIP to those of the model program described in...

40 CFR 51.351 - Enhanced I/M performance standard.

Code of Federal Regulations, 2014 CFR

2014-07-01

... vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year vehicles. (11) Waiver... 2001 and newer vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year... which will be achieved by the I/M program design in the SIP to those of the model program described in...

40 CFR 51.351 - Enhanced I/M performance standard.

Code of Federal Regulations, 2013 CFR

2013-07-01

... vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year vehicles. (11) Waiver... 2001 and newer vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year... which will be achieved by the I/M program design in the SIP to those of the model program described in...

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

PubMed

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

USDA-ARS?s Scientific Manuscript database

Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

EPA Science Inventory

This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

ERIC Educational Resources Information Center

Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

2006-01-01

We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

PubMed

Adewale, B; Mafe, M A; Oyerinde, J P O

2005-01-01

Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

PubMed

Ragheb, Suzan Mohammed; Jimenez, Luis

Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

[The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

PubMed

Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

2014-04-01

The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

A randomized and blinded comparison of qPCR and NGS-based detection of aneuploidy in a cell line mixture model of blastocyst biopsy mosaicism.

PubMed

Goodrich, David; Tao, Xin; Bohrer, Chelsea; Lonczak, Agnieszka; Xing, Tongji; Zimmerman, Rebekah; Zhan, Yiping; Scott, Richard T; Treff, Nathan R

2016-11-01

A subset of preimplantation stage embryos may possess mosaicism of chromosomal constitution, representing a possible limitation to the clinical predictive value of comprehensive chromosome screening (CCS) from a single biopsy. However, contemporary methods of CCS may be capable of predicting mosaicism in the blastocyst by detecting intermediate levels of aneuploidy within a trophectoderm biopsy. This study evaluates the sensitivity and specificity of aneuploidy detection by two CCS platforms using a cell line mixture model of a mosaic trophectoderm biopsy. Four cell lines with known karyotypes were obtained and mixed together at specific ratios of six total cells (0:6, 1:5, 2:4, 3:3, 4:2, 5:1, and 6:0). A female euploid and a male trisomy 18 cell line were used for one set, and a male trisomy 13 and a male trisomy 15 cell line were used for another. Replicates of each mixture were prepared, randomized, and blinded for analysis by one of two CCS platforms (quantitative polymerase chain reaction (qPCR) or VeriSeq next-generation sequencing (NGS)). Sensitivity and specificity of aneuploidy detection at each level of mosaicism was determined and compared between platforms. With the default settings for each platform, the sensitivity of qPCR and NGS were not statistically different, and 100 % specificity was observed (no false positives) at all levels of mosaicism. However, the use of previously published custom criteria for NGS increased sensitivity but also significantly decreased specificity (33 % false-positive prediction of aneuploidy). By demonstrating increased false-positive diagnoses when reducing the stringency of predicting an abnormality, these data illustrate the importance of preclinical evaluation of new testing paradigms before clinical implementation.

Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears

PubMed Central

Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

2016-01-01

This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

Treesearch

David E. Schreiber; Karen J. Garner; James M. Slavicek

1997-01-01

Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

PubMed Central

deWit, D; Wootton, M; Allan, B; Steyn, L

1993-01-01

A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

PubMed Central

Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

2005-01-01

Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159

Blood grouping based on PCR methods and agarose gel electrophoresis.

PubMed

Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

2015-01-01

The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

Exploring the limits of ultrafast polymerase chain reaction using liquid for thermal heat exchange: A proof of principle

NASA Astrophysics Data System (ADS)

Maltezos, George; Johnston, Matthew; Taganov, Konstantin; Srichantaratsamee, Chutatip; Gorman, John; Baltimore, David; Chantratita, Wasun; Scherer, Axel

2010-12-01

Thermal ramp rate is a major limiting factor in using real-time polymerase chain reaction (PCR) for routine diagnostics. We explored the limits of speed by using liquid for thermal exchange rather than metal as in traditional devices, and by testing different polymerases. In a clinical setting, our system equaled or surpassed state-of-the-art devices for accuracy in amplifying DNA/RNA of avian influenza, cytomegalovirus, and human immunodeficiency virus. Using Thermococcus kodakaraensis polymerase and optimizing both electrical and chemical systems, we obtained an accurate, 35 cycle amplification of an 85-base pair fragment of E. coli O157:H7 Shiga toxin gene in as little as 94.1 s, a significant improvement over a typical 1 h PCR amplification.

[Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

PubMed

Wang, F; Zhang, Y Q; Ding, J; Yu, L X

2017-10-18

To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

EPA Science Inventory

The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

USDA-ARS?s Scientific Manuscript database

This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

A novel gammaherpesvirus in a large flying fox (Pteropus vampyrus) with blepharitis.

PubMed

Paige Brock, A; Cortés-Hinojosa, Galaxia; Plummer, Caryn E; Conway, Julia A; Roff, Shannon R; Childress, April L; Wellehan, James F X

2013-05-01

A novel gammaherpesvirus was identified in a large flying fox (Pteropus vampyrus) with conjunctivitis, blepharitis, and meibomianitis by nested polymerase chain reaction and sequencing. Polymerase chain reaction amplification and sequencing of 472 base pairs of the DNA-dependent DNA polymerase gene were used to identify a novel herpesvirus. Bayesian and maximum likelihood phylogenetic analyses indicated that the virus is a member of the genus Percavirus in the subfamily Gammaherpesvirinae. Additional research is needed regarding the association of this virus with conjunctivitis and other ocular pathology. This virus may be useful as a biomarker of stress and may be a useful model of virus recrudescence in Pteropus spp.

The Effect of State Regulatory Stringency on Nursing Home Quality

PubMed Central

Mukamel, Dana B; Weimer, David L; Harrington, Charlene; Spector, William D; Ladd, Heather; Li, Yue

2012-01-01

Objective To test the hypothesis that more stringent quality regulations contribute to better quality nursing home care and to assess their cost-effectiveness. Data Sources/Setting Primary and secondary data from all states and U.S. nursing homes between 2005 and 2006. Study Design We estimated seven models, regressing quality measures on the Harrington Regulation Stringency Index and control variables. To account for endogeneity between regulation and quality, we used instrumental variables techniques. Quality was measured by staffing hours by type per case-mix adjusted day, hotel expenditures, and risk-adjusted decline in activities of daily living, high-risk pressure sores, and urinary incontinence. Data Collection All states' licensing and certification offices were surveyed to obtain data about deficiencies. Secondary data included the Minimum Data Set, Medicare Cost Reports, and the Economic Freedom Index. Principal Findings Regulatory stringency was significantly associated with better quality for four of the seven measures studied. The cost-effectiveness for the activities-of-daily-living measure was estimated at about 72,000 in 2011/ Quality Adjusted Life Year. Conclusions Quality regulations lead to better quality in nursing homes along some dimensions, but not all. Our estimates of cost-effectiveness suggest that increased regulatory stringency is in the ballpark of other acceptable cost-effective practices. PMID:22946859

Impact of toxigenic Clostridium difficile polymerase chain reaction testing on the clinical microbiology laboratory and inpatient epidemiology.

PubMed

Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E

2013-08-01

Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

PubMed

Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

2014-03-01

The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

Preemptive Isolation Precautions of Patients at High Risk for Methicillin-Resistant Staphylococcus aureus in Combination With Ultrarapid Polymerase Chain Reaction Screening as an Effective Tool for Infection Control.

PubMed

Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael

2016-12-01

This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.

Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

PubMed Central

Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

2006-01-01

Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

PubMed

Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

2016-01-01

This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.

Clinical Characteristics and Outcomes of Hematologic Malignancy Patients With Positive Clostridium difficile Toxin Immunoassay Versus Polymerase Chain Reaction Test Results.

PubMed

Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H

2018-04-25

In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.

Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

PubMed

Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

1997-09-01

In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

PubMed

Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

2001-03-01

A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar

An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less

Inhibition of herpes simplex virus DNA polymerase by purine ribonucleoside monophosphates.

PubMed

Frank, K B; Cheng, Y C

1986-02-05

Purine ribonucleoside monophosphates were found to inhibit chain elongation catalyzed by herpes simplex virus (HSV) DNA polymerase when DNA template-primer concentrations were rate-limiting. Inhibition was fully competitive with DNA template-primer during chain elongation; however, DNA polymerase-associated exonuclease activity was inhibited noncompetitively with respect to DNA. Combinations of 5'-GMP and phosphonoformate were kinetically mutually exclusive in dual inhibitor studies. Pyrimidine nucleoside monophosphates and deoxynucleoside monophosphates were less inhibitory than purine riboside monophosphates. The monophosphates of 9-beta-D-arabinofuranosyladenine, Virazole (1-beta-D-ribofuranosyl-1,2,4-triazole-3-carboxamide), 9-(2-hydroxyethoxymethyl)guanine, and 9-(1,3-dihydroxy-2-propoxymethyl)guanine exerted little or no inhibition. In contrast to HSV DNA polymerase, human DNA polymerase alpha was not inhibited by purine ribonucleoside monophosphates. These studies suggest the possibility of a physiological role of purine ribonucleoside monophosphates as regulators of herpesvirus DNA synthesis and a new approach to developing selective anti-herpesvirus compounds.

A novel mechanism of sugar selection utilized by a human X-family DNA polymerase.

PubMed

Brown, Jessica A; Fiala, Kevin A; Fowler, Jason D; Sherrer, Shanen M; Newmister, Sean A; Duym, Wade W; Suo, Zucai

2010-01-15

During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2'-hydroxyl group and the bulky side chain of an active-site residue. In this study, we demonstrated that human DNA polymerase lambda used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2'-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2'-position. Copyright 2009 Elsevier Ltd. All rights reserved.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

PubMed

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

2014-04-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

PubMed Central

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

2014-01-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

Lymphogranuloma venereum variant L2b-specific polymerase chain reaction: insertion used to close an epidemiological gap.

PubMed

Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D

2011-11-01

The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

USDA-ARS?s Scientific Manuscript database

The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

Problem-Solving Test: Pyrosequencing

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2013-01-01

Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…

Recombinase polymerase amplification: Emergence as a critical molecular technology for rapid, low-resource diagnostics.

PubMed

James, Ameh; Macdonald, Joanne

2015-01-01

Isothermal molecular diagnostics are bridging the technology gap between traditional diagnostics and polymerase chain reaction-based methods. These new techniques enable timely and accurate testing, especially in settings where there is a lack of infrastructure to support polymerase chain reaction facilities. Despite this, there is a significant lack of uptake of these technologies in developing countries where they are highly needed. Among these novel isothermal technologies, recombinase polymerase amplification (RPA) holds particular potential for use in developing countries. This rapid nucleic acid amplification approach is fast, highly sensitive and specific, and amenable to countries with a high burden of infectious diseases. Implementation of RPA technology in developing countries is critically required to assess limitations and potentials of the diagnosis of infectious disease, and may help identify impediments that prevent adoption of new molecular technologies in low resource- and low skill settings. This review focuses on approaching diagnosis of infectious disease with RPA.

Recombinase polymerase amplification-based assay to diagnose Giardia in stool samples.

PubMed

Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

2015-03-01

Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. © The American Society of Tropical Medicine and Hygiene.

Recombinase Polymerase Amplification-Based Assay to Diagnose Giardia in Stool Samples

PubMed Central

Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

2015-01-01

Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. PMID:25510713

The use of heteroduplex analysis of polymerase chain reaction products to support the possible transmission of Legionella pneumophila from a malfunctioning automobile air conditioner.

PubMed

Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T

2002-03-01

Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.

Identification of co-infection by rotavirus and parvovirus in dogs with gastroenteritis in Mexico.

PubMed

Ortega, Ariadna Flores; Martínez-Castañeda, José Simón; Bautista-Gómez, Linda G; Muñoz, Raúl Fajardo; Hernández, Israel Quijano

This is the first report on circulating canine rotavirus in Mexico. Fifty samples from dogs with gastroenteritis were analyzed used polymerase chain reaction and reverse transcription polymerase chain reaction in order to identify parvovirus and rotavirus, respectively; 7% of dogs were infected with rotavirus exclusively, while 14% were co-infected with both rotavirus and parvovirus; clinical signs in co-infected dogs were more severe. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

PubMed

Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

2016-01-01

American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

PubMed

Law, Dennis K S; Tsang, Raymond S W

2013-05-01

A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.

A process for the quantification of aircraft noise and emissions interdependencies

NASA Astrophysics Data System (ADS)

de Luis, Jorge

The main purpose of this dissertation is to develop a process to improve actual policy-making procedures in terms of aviation environmental effects. This research work expands current practices with physics based publicly available models. The current method uses solely information provided by industry members, and this information is usually proprietary, and not physically intuitive. The process herein proposed provides information regarding the interdependencies between the environmental effects of aircraft. These interdependencies are also tied to the actual physical parameters of the aircraft and the engine, making it more intuitive for decision-makers to understand the impacts to the vehicle due to different policy scenarios. These scenarios involve the use of fleet analysis tools in which the existing aircraft are used to predict the environmental effects of imposing new stringency levels. The aircraft used are reduced to a series of coefficients that represent their performance, in terms of flight characteristics, fuel burn, noise, and emissions. These coefficients are then utilized to model flight operations and calculate what the environmental impacts of those aircraft are. If a particular aircraft does not meet the stringency to be analyzed, a technology response is applied to it, in order to meet that stringency. Depending on the level of reduction needed, this technology response can have an effect on the fuel burn characteristic of the aircraft. Another important point of the current stringency analysis process is that it does not take into account both noise and emissions concurrently, but instead, it considers them separately, one at a time. This assumes that the interdependencies between the two do not exists, which is not realistic. The latest stringency process delineated in 2004 imposed a 2% fuel burn penalty for any required improvements on NOx, no matter the type of aircraft or engine, assuming that no company had the ability to produce a vehicle with similar characteristics. This left all the performance characteristics of the aircraft untouched, except for the fuel burn, including the noise performance. The proposed alternative is to create a fleet of replacement aircraft to the current fleet that does not meet stringency. These replacement aircraft represent the achievable physical limits for state of the art systems. In this research work, the interdependencies between NOx, noise, and fuel burn are not neglected, and it is in fact necessary to take all three into account, simultaneously, to capture the physical limits that can be attained during a stringency analysis. In addition, the replacement aircraft show the linkage between environmental effects and fundamental aircraft and engine characteristics, something that has been neglected in previous policy making procedures. Another aspect that has been ignored is the creation of the coefficients used for the fleet analyses. In current literature, a defined process for the creation of those coefficients does not exist, but this research work develops a process to do so and demonstrates that the characteristics of the aircraft can be propagated to the coefficients and to the fleet analysis tools. The implementation of the process proposed shows that, first, the environmental metrics can be linked to the physical attributes of the aircraft using non-proprietary, physics based tools, second, those interdependencies can be propagated to fleet level tools, and third, this propagation provides an improvement in the policy making process, by showing what needs to change in an aircraft to meet different stringency levels.

Geographic variation in marine turtle fibropapillomatosis

USGS Publications Warehouse

Greenblatt, R.J.; Work, Thierry M.; Dutton, P.; Sutton, C.A.; Spraker, T.R.; Casey, R.N.; Diez, C.E.; Parker, Dana C.; St. Ledger, J.; Balazs, G.H.; Casey, J.W.

2005-01-01

We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

Geographic variation in marine turtle fibropapillomatosis.

PubMed

Greenblatt, Rebecca J; Work, Thierry M; Dutton, Peter; Sutton, Claudia A; Spraker, Terry R; Casey, Rufina N; Diez, Carlos E; Parker, Denise; St Leger, Judy; Balazs, George H; Casey, James W

2005-09-01

We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

Brief ultrasonication improves detection of biofilm-formative bacteria around a metal implant.

PubMed

Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Fujishiro, Takaaki; Procop, Gary W

2007-04-01

Biofilms are complex microenvironments produced by microorganisms on surfaces. Ultrasonication disrupts biofilms and may make the microorganism or its DNA available for detection. We determined whether ultrasonication could affect our ability to detect bacteria adherent to a metal substrate. A biofilm-formative Staphylococcus aureus strain was used for an in vitro implant infection model (biofilm-formative condition). We used quantitative culture and real time-polymerase chain reaction to determine the influence of different durations of ultrasound on bacterial adherence and viability. Sonication for 1 minute increased the yield of bacteria. Sonication longer than 5 minutes led to fewer bacterial colonies by conventional culture but not by polymerase chain reaction. This suggests short periods of sonication help release bacteria from the metal substrate by disrupting the biofilm, but longer periods of sonication lyse bacteria prohibiting their detection in microbiologic cultures. A relatively short duration of sonication may be desirable for maximizing detection of biofilm-formative bacteria around implants by culture or polymerase chain reaction.

Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

PubMed

Bridge, Julia A

2017-01-01

The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

Collaborative decision-making on wind power projects based on AHP method

NASA Astrophysics Data System (ADS)

Badea, A.; Proştean, G.; Tămăşilă, M.; Vârtosu, A.

2017-01-01

The complexity of projects implementation in Renewable Energy Sources (RES) requires finding collaborative alliances between suppliers and project developers in RES. Links activities in supply chain in RES, respectively, transportation of heavy components, processing orders to purchase quality raw materials, storage and materials handling, packaging, and other complex activities requiring a logistics system collaboratively to be permanently dimensioned properly selected and monitored. Requirements imposed by stringency of wind power energy projects implementation inevitably involves constraints in infrastructure, implementation and logistics. Thus, following an extensive research in RES project, to eliminate these constraints were identified alternative collaboration to provide feasible solutions on different levels of performance. The paper presents a critical analysis of different collaboration alternatives in supply chain for RES projects, selecting the ones most suitable for particular situations by using decision-making method Analytic Hierarchy Process (AHP). The role of AHP method was to formulate a decision model by which can be establish the collaboration alternative choice through mathematical calculation to reduce the impact created by constraints encountered. The solution provided through AHP provides a framework for detecting optimal alternative collaboration between suppliers and project developers in RES and avoids some breaks in the chain by resizing safety buffers for leveling orders in RES projects.

The first successful use of a low stringency familial match in a French criminal investigation.

PubMed

Pham-Hoai, Emmanuel; Crispino, Frank; Hampikian, Greg

2014-05-01

We describe how a very simple application of familial searching resolved a decade-old, high-profile rape/murder in France. This was the first use of familial searching in a criminal case using the French STR DNA database, which contains approximately 1,800,000 profiles. When an unknown forensic profile (18 loci) was searched against the French arrestee/offender database using CODIS configured for a low stringency search, a single low stringency match was identified. This profile was attributed to the father of the man suspected to be the source of the semen recovered from the murder victim Elodie Kulik. The identification was confirmed using Y-chromosome DNA from the putative father, an STR profile from the mother, and finally a tissue sample from the exhumed body of the man who left the semen. Because of this identification, the investigators are now pursuing possible co-conspirators. © 2014 American Academy of Forensic Sciences.

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

PubMed

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

PubMed Central

Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

2010-01-01

Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

PubMed

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

2008-09-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

PubMed

Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

2015-07-01

Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Slow Joining of Newly Replicated DNA Chains in DNA Polymerase I-Deficient Escherichia coli Mutants*

PubMed Central

Okazaki, Reiji; Arisawa, Mikio; Sugino, Akio

1971-01-01

In Escherichia coli mutants deficient in DNA polymerase I, newly replicated short DNA is joined at about 10% of the rate in the wild-type strains. It is postulated that DNA polymerase I normally functions in filling gaps between the nascent short segments synthesized by the replication complex. Possible implications of the finding are discussed in relation to other abnormal properties of these mutants. PMID:4943548

Molecular diagnostics of periodontitis.

PubMed

Korona-Głowniak, Izabela; Siwiec, Radosław; Berger, Marcin; Malm, Anna; Szymańska, Jolanta

2017-01-28

The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host's health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridization) come increasingly into use. On the basis of a literature review, the following methods are presented: polymerase chain reaction (PCR), real-time polymerase chain reaction (real-time PCR), 16S rRNA-encoding gene sequencing, checkerboard and reverse-capture checkerboard hybridization, microarrays, denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), as well as terminal restriction fragment length polymorphism (TRFLP) and next generation sequencing (NGS). The advantages and drawbacks of each method in the examination of periopathogens are indicated. The techniques listed above allow fast detection of even small quantities of pathogen present in diagnostic material and prove particularly useful to detect microorganisms that are difficult or impossible to grow in a laboratory.

T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

PubMed

Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

2012-01-01

Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

Expression and mutational analysis of Cip/Kip family in early glottic cancer.

PubMed

Kim, D-K; Lee, J H; Lee, O J; Park, C H

2015-02-01

Genetic alteration of cyclin-dependent kinase inhibitors has been associated with carcinogenesis mechanisms in various organs. This study aimed to evaluate the expression and mutational analysis of Cip/Kip family cyclin-dependent kinase inhibitors (p21CIP1/WAF1, p27KIP1 and p57KIP2) in early glottic cancer. Expressions of Cip/Kip family and p53 were determined by quantitative reverse transcription polymerase chain reaction and densitometry. For the analysis of p21 inactivation, sequence alteration was assessed using single-strand conformational polymorphism polymerase chain reaction. Additionally, the inactivation mechanism of p27 and p57 were investigated using DNA methylation analysis. Reduced expression of p27 and p57 were detected in all samples, whereas the expression of p21 was incompletely down-regulated in 6 of 11 samples. Additionally, single-strand conformational polymorphism polymerase chain reaction analysis showed the p53 mutation at exon 6. Methylation of p27 and p57 was detected by DNA methylation assay. Our results suggest that the Cip/Kip family may have a role as a molecular mechanism of carcinogenesis in early glottic cancer.

Direct and quantitative detection of HIV-1 RNA in human plasma with a branched DNA signal amplification assay.

PubMed

Urdea, M S; Wilber, J C; Yeghiazarian, T; Todd, J A; Kern, D G; Fong, S J; Besemer, D; Hoo, B; Sheridan, P J; Kokka, R

1993-11-01

To determine the relative effect of sample matrix on the quantitation of HIV RNA in plasma. Two HIV-positive specimens were diluted into five and 10 different HIV-negative plasma samples, respectively. Branched DNA signal amplification technology and reverse-transcriptase polymerase chain reaction were used to measure the viral load. In one sample the viral load by polymerase chain reaction ranged from undetectable to 1.9 x 10(5) copies/ml, and the branched DNA results ranged from 2.6 x 10(4) to 4.2 x 10(4) HIV RNA equivalent/ml. In the other sample the corresponding figures were 6.3 x 10(4) to 5.5 x 10(5) copies/ml and 5.7 x 10(4) to 7.5 x 10(4) HIV RNA equivalents/ml. In contrast to reverse-transcriptase polymerase chain reaction the branched DNA signal amplification assay does not require a separate extraction step or enzymatic amplification of the target. Therefore this measurement is less affected by the sample matrix and the signal generated is directly proportional to the viral load.

Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

PubMed Central

Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter

2006-01-01

Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068

Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

PubMed

Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

2015-03-01

Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.

Underage alcohol policies across 50 California cities: an assessment of best practices

PubMed Central

2012-01-01

Background We pursue two primary goals in this article: (1) to test a methodology and develop a dataset on U.S. local-level alcohol policy ordinances, and (2) to evaluate the presence, comprehensiveness, and stringency of eight local alcohol policies in 50 diverse California cities in relationship to recommended best practices in both public health literature and governmental recommendations to reduce underage drinking. Methods Following best practice recommendations from a wide array of authoritative sources, we selected eight local alcohol policy topics (e.g., conditional use permits, responsible beverage service training, social host ordinances, window/billboard advertising ordinances), and determined the presence or absence as well as the stringency (restrictiveness) and comprehensiveness (number of provisions) of each ordinance in each of the 50 cities in 2009. Following the alcohol policy literature, we created scores for each city on each type of ordinance and its associated components. We used these data to evaluate the extent to which recommendations for best practices to reduce underage alcohol use are being followed. Results (1) Compiling datasets of local-level alcohol policy laws and their comprehensiveness and stringency is achievable, even absent comprehensive, on-line, or other legal research tools. (2) We find that, with some exceptions, most of the 50 cities do not have high scores for presence, comprehensiveness, or stringency across the eight key policies. Critical policies such as responsible beverage service and deemed approved ordinances are uncommon, and, when present, they are generally neither comprehensive nor stringent. Even within policies that have higher adoption rates, central elements are missing across many or most cities’ ordinances. Conclusion This study demonstrates the viability of original legal data collection in the U.S. pertaining to local ordinances and of creating quantitative scores for each policy type to reflect comprehensiveness and stringency. Analysis of the resulting dataset reveals that, although the 50 cities have taken important steps to improve public health with regard to underage alcohol use and abuse, there is a great deal more that needs to be done to bring these cities into compliance with best practice recommendations. PMID:22734468

Bi-parentally inherited species-specific markers identify hybridization between rainbow trout and cutthroat trout subspecies

USGS Publications Warehouse

Ostberg, C.O.; Rodriguez, R.J.

2004-01-01

Eight polymerase chain reaction primer sets amplifying bi-parentally inherited species-specific markers were developed that differentiate between rainbow trout (Oncorhynchus mykiss) and various cutthroat trout (O. clarki) subspecies. The primers were tested within known F1 and first generation hybrid backcrosses and were shown to amplify codominantly within hybrids. Heterozygous individuals also amplified a slower migrating band that was a heteroduplex, caused by the annealing of polymerase chain reaction products from both species. These primer sets have numerous advantages for native cutthroat trout conservation including statistical genetic analyses of known crosses and simple hybrid identification.

Flow-through polymerase chain reaction inside a seamless 3D helical microreactor fabricated utilizing a silicone tube and a paraffin mold.

PubMed

Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon

2015-03-07

We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).

Polymer-based microfluidic chips for isothermal amplification of nucleic acids

NASA Astrophysics Data System (ADS)

Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

2017-11-01

Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

[Identification of human pathogenic variola and monkeypox viruses by real-time polymerase chain reaction].

PubMed

Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N

2009-01-01

A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.

Identification of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) by using polymerase chain reaction amplification and restriction analysis of the mitochondrial cytochrome b gene.

PubMed

Carrera, E; García, T; Céspedes, A; González, I; Sanz, B; Hernández, P E; Martín, R

1998-04-01

Restriction site analysis of polymerase chain reaction (PCR) products from a conserved region of the cytochrome b gene has been used for the identification of fresh and smoked samples of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Digestion of the 359-bp PCR product with the endonucleases EcoRV and TaqI yielded specific banding patterns for salmon and trout. This genetic marker can be very useful for detecting fraudulent substitution of the cheaper smoked trout for the more expensive smoked salmon.

Polymerase chain reaction with phase change as intrinsic thermal control

NASA Astrophysics Data System (ADS)

Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

2013-04-01

This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

Building block synthesis using the polymerase chain assembly method.

PubMed

Marchand, Julie A; Peccoud, Jean

2012-01-01

De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).

High-stringency screening of target-binding partners using a microfluidic device

DOEpatents

Soh, Hyongsok; Lou, Xinhui; Lagally, Eric

2015-12-01

The invention provides a method of screening a library of candidate agents by contacting the library with a target in a reaction mixture under a condition of high stringency, wherein the target includes a tag that responds to a controllable force applied to the tag, and passing the members of the library through a microfluidic device in a manner that exposes the library members to the controllable force, thereby displacing members of the library that are bound to the target relative to their unbound counterparts. Kits and systems for use with the methods of the invention are also provided.

Evaluation of immunomagnetic separation for the detection of Salmonella in surface waters by polymerase chain reaction.

PubMed

Hsu, Chao-Yu; Hsu, Bing-Mu; Chang, Tien-Yu; Hsu, Tsui-Kang; Shen, Shu-Min; Chiu, Yi-Chou; Wang, Hung-Jen; Ji, Wen-Tsai; Fan, Cheng-Wei; Chen, Jyh-Larng

2014-09-19

Salmonella spp. is associated with fecal pollution and capable of surviving for long periods in aquatic environments. Instead of the traditional, time-consuming biochemical detection, polymerase chain reaction (PCR) allows rapid identification of Salmonella directly concentrated from water samples. However, prevalence of Salmonella may be underestimated because of the vulnerability of PCR to various environmental chemicals like humic acid, compounded by the fact that various DNA polymerases have different susceptibility to humic acid. Because immunomagnetic separation (IMS) theoretically could isolate Salmonella from other microbes and facilitate removal of aquatic PCR inhibitors of different sizes, this study aims to compare the efficiency of conventional PCR combined with immunomagnetic separation (IMS) for Salmonella detection within a moderately polluted watershed. In our study, the positive rate was increased from 17.6% to 47% with nearly ten-fold improvement in the detection limit. These results suggest the sensitivity of Salmonella detection could be enhanced by IMS, particularly in low quality surface waters. Due to its effects on clearance of aquatic pollutants, IMS may be suitable for most DNA polymerases for Salmonella detection.

Identification of fragile X pre-mutation carriers in the Chinese obstetric population using a robust FMR1 polymerase chain reaction assay: implications for screening and prenatal diagnosis.

PubMed

Cheng, Y Ky; Lin, C Sw; Kwok, Y Ky; Chan, Y M; Lau, T K; Leung, T Y; Choy, K W

2017-04-01

There is significant morbidity associated with fragile X syndrome. Unfortunately, most maternal carriers are clinically silent during their reproductive years. Because of this, many experts have put forward the notion of preconception or prenatal fragile X carrier screening for females. This study aimed to determine the prevalence of fragile X syndrome pre-mutation and asymptomatic full-mutation carriers in a Chinese pregnant population, and the distribution of cytosine-guanine-guanine (CGG) repeat numbers using a robust fragile X mental retardation 1 (FMR1) polymerase chain reaction assay. This was a cross-sectional survey in prospectively recruited pregnant women from a university hospital in Hong Kong. Chinese pregnant women without a family history of fragile X syndrome were recruited between April 2013 and May 2015. A specific FMR1 polymerase chain reaction assay was performed on peripheral blood to determine the CGG repeat number of the FMR1 gene. Prenatal counselling was offered to full-mutation and pre-mutation carriers. In 2650 Chinese pregnant women, two individuals with pre-mutation alleles (0.08%, one in 1325) and one asymptomatic woman with full-mutation (0.04%, one in 2650) alleles were identified. The overall prevalence of pre-mutation and full-mutation alleles was 0.11% (1 in 883). Furthermore, 30 (1.1%) individuals with intermediate alleles were detected. In the 2617 women with normal CGG repeats, the most common CGG repeat allele was 30. The overall prevalence of pre-mutation and asymptomatic full-mutation carriers in the Chinese pregnant population was one in 883, detected by a new FMR1 polymerase chain reaction assay.

A Sensitive Detection Method for MPLW515L or MPLW515K Mutation in Chronic Myeloproliferative Disorders with Locked Nucleic Acid-Modified Probes and Real-Time Polymerase Chain Reaction

PubMed Central

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.

2008-01-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880

No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

PubMed

D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

2006-10-01

Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

Polymerase chain displacement reaction.

PubMed

Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang

2013-02-01

Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.

[The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

PubMed

D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

1993-01-01

The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.

Utilizing a polymerase chain reaction method for the detection of Toxocara canis and T. cati eggs in soil.

PubMed

Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H

2007-03-01

A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.

Diagnosis of feline leukaemia virus infection by semi-quantitative real-time polymerase chain reaction.

PubMed

Pinches, Mark D G; Helps, Christopher R; Gruffydd-Jones, Tim J; Egan, Kathy; Jarrett, Oswald; Tasker, Séverine

2007-02-01

In this paper the design and use of a semi-quantitative real-time polymerase chain reaction assay (RT-PCR) for feline leukaemia virus (FeLV) provirus is described. Its performance is evaluated against established methods of FeLV diagnosis, including virus isolation and enzyme-linked immunoassay (ELISA) in a population of naturally infected cats. The RT-PCR assay is found to have both a high sensitivity (0.92) and specificity (0.99) when examined by expectation maximisation methods and is also able to detect a large number of cats with low FeLV proviral loads that were negative by other conventional test methods.

Polymerase chain reaction-based detection of myc transduction in feline leukemia virus-infected cats.

PubMed

Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo

2018-04-01

Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.

Molecular Evidence of Bartonella Infection in Domestic Dogs from Algeria, North Africa, by Polymerase Chain Reaction (PCR)

PubMed Central

Kernif, Tahar; Aissi, Meriem; Doumandji, Salah-Eddine; Chomel, Bruno B.; Raoult, Didier; Bitam, Idir

2010-01-01

Bartonella species are being recognized as important bacterial human and canine pathogens, and are associated with multiple arthropod vectors. Bartonella DNA extracted from blood samples was obtained from domestic dogs in Algiers, Algeria. Polymerase chain reaction (PCR) and DNA sequence analyses of the ftsZ gene and the 16S-23S intergenic spacer region (ITS) were performed. Three Bartonella species: Bartonella vinsonii subsp. berkhoffii, Bartonella clarridgeiae, and Bartonells elizabethae were detected infecting Algerian dogs. To our knowledge, this study is the first report of detection by PCR amplification of Bartonella in dogs in North Africa. PMID:20682871

Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.

PubMed

Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C

2012-09-27

We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.

Illegitimate transcription: transcription of any gene in any cell type.

PubMed Central

Chelly, J; Concordet, J P; Kaplan, J C; Kahn, A

1989-01-01

Using in vitro amplification of cDNA by the polymerase chain reaction, we have detected spliced transcripts of various tissue-specific genes (genes for anti-Müllerian hormone, beta-globin, aldolase A, and factor VIIIc) in human nonspecific cells, such as fibroblasts, hepatoma cells, and lymphoblasts. In rats, erythroid- and liver-type pyruvate kinase transcripts were also detected in brain, lung, and muscle. The abundance of these "illegitimate" transcripts is very low; yet, their existence and the possibility of amplifying them by the cDNA polymerase chain reaction provide a powerful tool to analyze pathological transcripts of any tissue-specific gene by using any accessible cell. Images PMID:2495532

A Novel Mechanism of Sugar Selection Utilized by a Human X-family DNA Polymerase†

PubMed Central

Brown, Jessica A.; Fiala, Kevin A.; Fowler, Jason D.; Sherrer, Shanen M.; Newmister, Sean A.; Dyum, Wade W.; Suo, Zucai

2009-01-01

During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2′-hydroxyl group and the bulky side chain of an active site residue. Here, we demonstrated that human DNA polymerase λ used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2′-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such a steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2′ position. PMID:19900463

DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

PubMed

Guthrie, J N; Moriarty, D J; Blackall, L L

2000-12-15

A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

Use of polymerase chain reaction (PCR) in the diagnosis of congenital toxoplasmosis.

PubMed

Loveridge-Easther, Cam; Yardley, Anne-Marie; Breidenstein, Brenda

2018-06-01

Congenital toxoplasmosis (CT) is a parasitic disease that causes serious fetal and neonatal harm or death. In countries that do not have antenatal screening programs, the initiation of CT treatment relies on a postnatal diagnosis. Until recently, diagnosis was based on clinical signs and immunoglobulin seropositivity, which is fraught with difficulty. In these cases, diagnosis was often delayed or treatment, which carries risk, started empirically. We highlight the use of polymerase chain reaction to diagnose a case of congenital toxoplasmosis, allowing early treatment and justifying the treatment burden. Copyright © 2018 American Association for Pediatric Ophthalmology and Strabismus. Published by Elsevier Inc. All rights reserved.

Polymerase chain reaction detection of Bartonella spp. in dogs from Spain with blood culture-negative infectious endocarditis.

PubMed

Roura, X; Santamarina, G; Tabar, M-D; Francino, O; Altet, L

2018-05-25

The presence of Bartonella spp. was detected by polymerase chain reaction (PCR) in dogs from Spain with blood culture-negative endocarditis. The aim of this study is to add information about canine infectious endocarditis in Europe. Thirty dogs with naturally occurring blood culture-negative endocarditis were examined from 2010 to 2017 at three veterinary referral hospitals, located in northwest, northeast, and southeast of Spain. It is a retrospective study. Medical records were reviewed to extract relevant data. Frozen or paraffin-embedded cardiac valve tissue and/or ethylenediamine tetraacetic acid blood samples were evaluated by PCR for the presence of Bartonella DNA. Positive results were sequenced to confirm the species. Polymerase chain reaction was positive for eight out of 30 dogs included (26.6%). Bartonella rochalimae, Bartonella vinsonii subsp. berkhoffii, and Bartonella koehlerae were detected in valve tissue or blood. Bartonella could be an important cause of blood culture-negative infectious endocarditis in dogs from Spain. The outcome for those dogs affected with Bartonella spp. was grave. Prompt empirical treatment with amoxicillin-clavulanate plus fluoroquinolones could be of value in cases of blood culture-negative endocarditis. Copyright © 2018 Elsevier B.V. All rights reserved.

[Roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis].

PubMed

Dai, Lin; Huang, Juan; Tang, Yuan; Liao, Dian-ying; Dong, Dan-dan; Xu, Gang; Li, Gan-di

2010-06-01

To study the roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis (TL). Forty-six archival cases of histologically diagnosed TL, encountered during the period from April, 1999 to September, 2009 and with the paraffin-embedded lymph node tissue blocks available, were enrolled into the study. The presence of genome fragments of Toxoplasma gondii (T. gondii) was analyzed using semi-nested polymerase chain reaction (PCR). Thirty cases of one or two histopathologic triad of TL as the controls. The positive rate of PCR in TL group was 76.1% (35/46), as compared to 10.0% (3/30) in the control group. The difference was of statistical significance. The sensitivity and specificity of the histologic triad in diagnosing TL was 92.1% (35/38) and 71.1% (27/38), respectively. The predictive value of positive and negative PCR results was 76.1% (35/46) and 90.0% (27/30). respectively. The high specificity but low sensitivity of applying the histologic triad in diagnosing TL cases may be due to the occurrence of atypical histologic pattern. The sensitivity is improved with the use of semi-nested PCR in detecting T. gondii DNA.

Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

PubMed Central

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

Real-Time Polymerase Chain Reaction for Detection of Schistosoma DNA in Small-Volume Urine Samples Reflects Focal Distribution of Urogenital Schistosomiasis in Primary School Girls in KwaZulu Natal, South Africa

PubMed Central

Pillay, Pavitra; Taylor, Myra; Zulu, Siphosenkosi G.; Gundersen, Svein G.; Verweij, Jaco J.; Hoekstra, Pytsje; Brienen, Eric A. T.; Kleppa, Elisabeth; Kjetland, Eyrun F.; van Lieshout, Lisette

2014-01-01

Schistosoma haematobium eggs and Schistosoma DNA levels were measured in urine samples from 708 girls recruited from 18 randomly sampled primary schools in South Africa. Microscopic analysis of two 10-mL urine subsamples collected on three consecutive days confirmed high day-to-day variation; 103 (14.5%) girls had positive results at all six examinations, and at least one positive sample was seen in 225 (31.8%) girls. Schistosoma-specific DNA, which was measured in a 200-μL urine subsample by using real-time polymerase chain reaction, was detected in 180 (25.4%) cases, and levels of DNA corresponded significantly with average urine egg excretion. In concordance with microscopic results, polymerase chain reaction results were significantly associated with history of gynecologic symptoms and confirmed highly focal distribution of urogenital schistosomiasis. Parasite-specific DNA detection has a sensitivity comparable to single urine microscopy and could be used as a standardized high-throughput procedure to assess distribution of urogenital schistosomiasis in relatively large study populations by using small sample volumes. PMID:24470560

Diagnosis of ocular toxoplasmosis by two polymerase chain reaction (PCR) examinations: qualitative multiplex and quantitative real-time.

PubMed

Sugita, Sunao; Ogawa, Manabu; Inoue, Shizu; Shimizu, Norio; Mochizuki, Manabu

2011-09-01

To establish a two-step polymerase chain reaction (PCR) diagnostic system for ocular toxoplasmosis. A total of 13 ocular fluid samples (11 aqueous humor and 2 vitreous fluid) were collected from 13 patients with clinically suspected ocular toxoplasmosis. Ten ocular samples from other uveitis patients and 20 samples from subjects without ocular inflammation were used as controls. Two polymerase chain reaction (PCR) methods, i.e., qualitative multiplex PCR and quantitative real-time PCR, were used to measure the toxoplasma genome (T. gondii B1 gene). Qualitative multiplex PCR detected T. gondii B1 gene in the ocular fluids of 11 out of 13 patients with clinically suspected ocular toxoplasmosis. In real-time PCR, we detected high copy numbers of T. gondii DNA (5.1 × 10(2)-2.1 × 10(6) copies/mL) in a total of 10 patients (10/13, 77%). Only ocular toxoplasmosis scar lesions were observed in the three real-time PCR-negative patients. PCR assay results for the samples from the two control groups were all negative. The two-step PCR examination to detect toxoplasma DNA is a useful tool for diagnosing ocular toxoplasmosis.

Cerebrospinal fluid PCR analysis and biochemistry in bodies with severe decomposition.

PubMed

Palmiere, Cristian; Vanhaebost, Jessica; Ventura, Francesco; Bonsignore, Alessandro; Bonetti, Luca Reggiani

2015-02-01

The aim of this study was to assess whether Neisseria meningitidis, Listeria monocytogenes, Streptococcus pneumoniae and Haemophilus influenzae can be identified using the polymerase chain reaction technique in the cerebrospinal fluid of severely decomposed bodies with known, noninfectious causes of death or whether postmortem changes can lead to false positive results and thus erroneous diagnostic information. Biochemical investigations, postmortem bacteriology and real-time polymerase chain reaction analysis in cerebrospinal fluid were performed in a series of medico-legal autopsies that included noninfectious causes of death with decomposition, bacterial meningitis without decomposition, bacterial meningitis with decomposition, low respiratory tract infections with decomposition and abdominal infections with decomposition. In noninfectious causes of death with decomposition, postmortem investigations failed to reveal results consistent with generalized inflammation or bacterial infections at the time of death. Real-time polymerase chain reaction analysis in cerebrospinal fluid did not identify the studied bacteria in any of these cases. The results of this study highlight the usefulness of molecular approaches in bacteriology as well as the use of alternative biological samples in postmortem biochemistry in order to obtain suitable information even in corpses with severe decompositional changes. Copyright © 2014 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

A Model of Risk Analysis in Analytical Methodology for Biopharmaceutical Quality Control.

PubMed

Andrade, Cleyton Lage; Herrera, Miguel Angel De La O; Lemes, Elezer Monte Blanco

2018-01-01

One key quality control parameter for biopharmaceutical products is the analysis of residual cellular DNA. To determine small amounts of DNA (around 100 pg) that may be in a biologically derived drug substance, an analytical method should be sensitive, robust, reliable, and accurate. In principle, three techniques have the ability to measure residual cellular DNA: radioactive dot-blot, a type of hybridization; threshold analysis; and quantitative polymerase chain reaction. Quality risk management is a systematic process for evaluating, controlling, and reporting of risks that may affects method capabilities and supports a scientific and practical approach to decision making. This paper evaluates, by quality risk management, an alternative approach to assessing the performance risks associated with quality control methods used with biopharmaceuticals, using the tool hazard analysis and critical control points. This tool provides the possibility to find the steps in an analytical procedure with higher impact on method performance. By applying these principles to DNA analysis methods, we conclude that the radioactive dot-blot assay has the largest number of critical control points, followed by quantitative polymerase chain reaction, and threshold analysis. From the analysis of hazards (i.e., points of method failure) and the associated method procedure critical control points, we conclude that the analytical methodology with the lowest risk for performance failure for residual cellular DNA testing is quantitative polymerase chain reaction. LAY ABSTRACT: In order to mitigate the risk of adverse events by residual cellular DNA that is not completely cleared from downstream production processes, regulatory agencies have required the industry to guarantee a very low level of DNA in biologically derived pharmaceutical products. The technique historically used was radioactive blot hybridization. However, the technique is a challenging method to implement in a quality control laboratory: It is laborious, time consuming, semi-quantitative, and requires a radioisotope. Along with dot-blot hybridization, two alternatives techniques were evaluated: threshold analysis and quantitative polymerase chain reaction. Quality risk management tools were applied to compare the techniques, taking into account the uncertainties, the possibility of circumstances or future events, and their effects upon method performance. By illustrating the application of these tools with DNA methods, we provide an example of how they can be used to support a scientific and practical approach to decision making and can assess and manage method performance risk using such tools. This paper discusses, considering the principles of quality risk management, an additional approach to the development and selection of analytical quality control methods using the risk analysis tool hazard analysis and critical control points. This tool provides the possibility to find the method procedural steps with higher impact on method reliability (called critical control points). Our model concluded that the radioactive dot-blot assay has the larger number of critical control points, followed by quantitative polymerase chain reaction and threshold analysis. Quantitative polymerase chain reaction is shown to be the better alternative analytical methodology in residual cellular DNA analysis. © PDA, Inc. 2018.

Stringency and relaxation among the halobacteria.

PubMed Central

Cimmino, C; Scoarughi, G L; Donini, P

1993-01-01

Accumulation of stable RNA and production of guanosine polyphosphates (ppGpp and pppGpp) were studied during amino acid starvation in four species of halobacteria. In two of the four species, stable RNA was under stringent control, whereas one of the remaining two species was relaxed and the other gave an intermediate phenotype. The stringent reaction was reversed by anisomycin, an effect analogous to the chloroamphenicol-induced reversal of stringency in the eubacteria. During the stringent response, neither ppGpp nor pppGpp accumulation took place during starvation. In both growing and starved cells a very low basal level of the two polyphosphates appeared to be present. In the stringent species the intracellular concentration of GTP did not diminish but actually increased during the course of the stringent response. These data demonstrate that (i) wild-type halobacteria can have either the stringent or the relaxed phenotype (all wild-type eubacteria tested have been shown to be stringent); (ii) stringency in the halobacteria is dependent on the deaminoacylation of tRNA, as in the eubacteria; and (iii) in the halobacteria, ppGpp is not an effector of stringent control over stable-RNA synthesis. Images PMID:7691798

RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

EPA Science Inventory

Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

relA-dependent RNA polymerase activity in Escherichia coli.

PubMed Central

Ryals, J; Bremer, H

1982-01-01

Parameters relating to RNA synthesis were measured after a temperature shift from 30 to 42 degrees C, in a relA+ and relA- isogenic pair of Escherichia coli strains containing a temperature-sensitive valyl tRNA synthetase. The following results were obtained: (i) the rRNA chain growth rate increased 2-fold in both strains; (ii) newly synthesized rRNA became unstable in both strains; (iii) the stable RNA gene activity (rRNA and tRNA, measured as stable RNA synthesis rate relative to the total instantaneous rate of RNA synthesis) decreased 1.7-fold in the relA+ strain and increased 1.9-fold in the relA mutant; and (iv) the RNA polymerase activity (measured by the percentage of total RNA polymerase enzyme active in transcription an any instant) decreased from 20 to 3.6% in the relA+ strain and remained unchanged (or increased at most to 22%) in the relA mutant. It is suggested that both rRNA gene activity and the RNA polymerase activity depend on the intracellular concentration of guanosine tetraphosphate, whereas the altered chain elongation rate and stability of rRNA are temperature or amino acid starvation effects, respectively, without involvement of relA function. PMID:6174501

Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

PubMed

Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

2009-01-01

A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

USGS Publications Warehouse

Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

2011-01-01

Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

Gonorrhoea of the sigmoid neovagina in a male-to-female transgender.

PubMed

van der Sluis, Wouter B; Bouman, Mark-Bram; Gijs, Luk; van Bodegraven, Adriaan A

2015-07-01

A 33-year-old male-to-female transgender consulted our outpatient clinic with perneovaginal bleeding during and following coitus. Four years before, she underwent a total laparoscopic sigmoid neovaginoplasty. Physical, histological and endoscopic examination revealed neither focus of active bleeding nor signs of active inflammation. A polymerase chain reaction test performed on a neovaginal swab showed gonococcal infection. Treatment consisted of 500 mg intramuscular ceftriaxone. Three weeks later, our patient reported resolution of symptoms, consistent with eradication of the infection demonstrated by a follow-up neovaginal swab polymerase chain reaction. To our knowledge, this is the first case report of gonococcal infection of the sigmoid neovagina. © The Author(s) 2014.

Multiple papillomas in a diamond python, Morelia spilota spilota.

PubMed

Gull, Jessica M; Lange, Christian E; Favrot, Claude; Dorrestein, Gerry M; Hatt, Jean-Michel

2012-12-01

A 4-yr-old male diamond python (Morelia spilota spilota) was evaluated for multiple black papillated exophytic skin proliferations and signs of pneumonia. The histopathologic structure of the skin biopsy specimens led to the diagnosis of a benign papilloma-like neoplasia. In this case, papillomavirus DNA could be amplified from a biopsy sample with a broad range polymerase chain reaction. Nested pan-herpes polymerase chain reaction was negative, and herpesvirus inclusion bodies were not found. Because of the histologically benign nature of the papilloma, the skin proliferations were left untreated. Ten mo after the first presentation, the skin lesions had regressed almost completely; 34 mo later, only scars from the biopsies were left.

Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest

Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required formore » PCR.« less

Detection of trypanosomatid Phytomonas parasitic in plants by polymerase chain reaction amplification of small subunit ribosomal DNA.

PubMed

Teixeira, M M; Campaner, M; Camargo, E P

1994-01-01

To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.

Diagnostic exercise: chronic vomiting in a dog.

PubMed

Ellis, A E; Brown, C A; Miller, D L

2010-09-01

An approximately one-and-a-half-year-old, neutered male, mixed-breed dog was presented for a chronic history of vomiting. Profuse diarrhea was also noted during examination. An exploratory laparotomy was performed, bone chips were removed from the stomach, and a raised, circular area of gastric mucosa was biopsied. Histologically, there was severe gastric cryptosporidiosis as well as numerous spiral bacteria, consistent with Helicobacter spp. Polymerase chain reaction revealed visible bands for the 18S ribosomal RNA gene for Cryptosporidium spp. The polymerase chain reaction product was sequenced and was found to be most similar to Cryptosporidium muris. Both the gastric location and the species of Cryptosporidium are unusual in a dog.

Vertebral Osteomyelitis Caused by Helicobacter cinaedi Identified Using Broad-range Polymerase Chain Reaction with Sequencing of the Biopsied Specimen.

PubMed

Hase, Ryota; Hirooka, Takuya; Itabashi, Takashi; Endo, Yasunobu; Otsuka, Yoshihito

2018-05-15

A 65-year-old man presented with gradually exacerbating low back pain. Magnetic resonance imaging revealed vertebral osteomyelitis in the Th11-L2 vertebral bodies and discs. The patient showed negative findings on conventional cultures. Direct broad-range polymerase chain reaction (PCR) with sequencing of the biopsied specimen had the highest similarity to the 16S rRNA gene of Helicobacter cinaedi. This case suggests that direct broad-range PCR with sequencing should be considered when conventional cultures cannot identify the causative organism of vertebral osteomyelitis, and that this method may be particularly useful when the pathogen is a fastidious organism, such as H. cinaedi.

Transformation of soybean Gy3 gene into Artemisaarenaria mediated by corona discharge

NASA Astrophysics Data System (ADS)

Chao, Lu-meng; Na, Ri; Xue, Dan; Xu, Yongze; Liu, Teng

2013-03-01

In order to improve the protein content of desert plant, a method of genetic transformation mediated by corona discharge was established. Artemisia seeds were processed in corona electric field for 120 min at 12 kV, and then soaked in 0.1 SSC media that contained Soybean Gy3 gene DNA to incubate for 12 h at 26 °C. Finally the seeds were inoculated on the differentiation medium. Polymerase Chain Reaction (PCR) and Reverse Transcription Polymerase Chain Reaction (RT-PCR) detection showed that the Soybean Gy3 gene had been successfully introduced into genomic DNA of the regenerated plants of Artemisaarenaria. The study provided a new way for corona discharge in plant genetic modification.

Cerebral Toxoplasmosis Diagnosed by Nested-polymerase Chain Reaction in a Patient with Rheumatoid Arthritis.

PubMed

Matsuura, Jun; Fujii, Akihiro; Mizuta, Ikuko; Norose, Kazumi; Mizuno, Toshiki

2018-05-15

A 65-year-old woman with rheumatoid arthritis (RA) visited our hospital because of right facial sensory hypoesthesia. Cerebral toxoplasmosis was suspected on brain magnetic resonance imaging. We discontinued methotrexate for RA and started a sulfamethoxazole/trimethoprim (ST) mixture. Although ST treatment was interrupted because of adverse reactions, her prognosis was favorable. The Toxoplasma 18S rDNA gene was detected by nested-polymerase chain reaction (PCR) from blood and cerebrospinal fluid. Detecting the Toxoplasma 18S rDNA gene by nested-PCR is useful for the diagnosis and safer than a brain biopsy. In addition, the discontinuation of immunosuppressants may be recommended in patients compromised by those immunosuppressants.

Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

PubMed Central

Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

2004-01-01

A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703

Detection of coliform bacteria and Escherichia coli by multiplex polymerase chain reaction: comparison with defined substrate and plating methods for water quality monitoring.

PubMed Central

Bej, A K; McCarty, S C; Atlas, R M

1991-01-01

Multiplex polymerase chain reaction (PCR) and gene probe detection of target lacZ and uidA genes were used to detect total coliform bacteria and Escherichia coli, respectively, for determining water quality. In tests of environmental water samples, the lacZ PCR method gave results statistically equivalent to those of the plate count and defined substrate methods accepted by the U.S. Environmental Protection Agency for water quality monitoring and the uidA PCR method was more sensitive than 4-methylumbelliferyl-beta-D-glucuronide-based defined substrate tests for specific detection of E. coli. Images PMID:1768116

Nested methylation-specific polymerase chain reaction cancer detection method

DOEpatents

Belinsky, Steven A [Albuquerque, NM; Palmisano, William A [Edgewood, NM

2007-05-08

A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

Vascular endothelial growth factor and platelet-derived growth factor are potential angiogenic and metastatic factors in human breast cancer.

PubMed

Anan, K; Morisaki, T; Katano, M; Ikubo, A; Kitsuki, H; Uchiyama, A; Kuroki, S; Tanaka, M; Torisu, M

1996-03-01

Angiogenesis is a prerequisite for tumor growth and metastasis. Tumor angiogenesis may be mediated by several angiogenic factors such as vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), transforming growth factor-alpha, and basic fibroblast growth factor. Differential mRNA expressions of VEGF, PDGF (A chain), transforming growth factor-alpha and basic fibroblast growth factor in 32 primary invasive breast tumors were examined by reverse transcriptase-polymerase chain reaction. We analyzed relationships between mRNA expressions of these angiogenic factors and the degree of angiogenesis, tumor size, and metastasis. Quantification of angiogenesis was achieved by the immunohistochemical staining of endothelial cells with antibody to CD31. VEGF and PDGF-A mRNAs were expressed more frequently in breast tumors than in nontumor breast tissues, whereas no difference was found in expression frequency of either transforming growth factor-alpha or basic fibroblast growth factor mRNA. Vascular counts in tumors correlated with each expression frequency of VEGF and PDGF-A mRNA. PDGF-A mRNA was expressed more frequently in tumors with lymph node metastasis than in those without metastasis. Expression of VEGF and PDGF mRNAs detected by reverse transcriptase-polymerase chain reaction in breast tumors correlates with tumor-related characteristics of angiogenesis and metastatic potential. Analysis of these mRNAs by reverse transcriptase-polymerase chain reaction may be useful for assessing the biologic behavior of a breast tumor before surgical treatment.

Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

PubMed

Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

2016-05-01

In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.

Infectious agent screening in canine blood donors in the United Kingdom.

PubMed

Crawford, K; Walton, J; Lewis, D; Tasker, S; Warman, S M

2013-08-01

Transfusion of blood products is an important component of veterinary emergency medicine. Donors must be carefully selected to minimise risk of transmission of blood-borne infectious agents. This study was devised to assess the prevalence of such agents in healthy, non-travelled UK dogs screened as prospective donors. Ethylenediaminetetraacetic acid blood samples from dogs donating blood between August 2007 and January 2012 were screened by polymerase chain reaction for haemotropic mycoplasmas, Bartonella, Babesia, Leishmania, Ehrlichia and Anaplasma spp. Dogs with positive or inconclusive results underwent repeat polymerase chain reaction testing. Four of 262 dogs had positive or inconclusive results at initial screening. Repeat polymerase chain reaction testing in each dog was negative, and none of the dogs developed clinical signs of disease. The positive results on initial screening may have represented false positives from sample contamination or amplification of non-target DNA. It is also possible that dogs were infected at initial sampling but successfully cleared infection before repeat testing. The low number of positive results obtained suggests that prevalence of these agents in a population of healthy UK dogs is low and that use of blood products is unlikely to represent a significant risk of transmission of these diseases. © 2013 British Small Animal Veterinary Association.

Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

PubMed

Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

2015-04-01

Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Digital PCR Quantitation of Muscle Mitochondrial DNA: Age, Fiber Type, and Mutation-Induced Changes.

PubMed

Herbst, Allen; Widjaja, Kevin; Nguy, Beatrice; Lushaj, Entela B; Moore, Timothy M; Hevener, Andrea L; McKenzie, Debbie; Aiken, Judd M; Wanagat, Jonathan

2017-10-01

Definitive quantitation of mitochondrial DNA (mtDNA) and mtDNA deletion mutation abundances would help clarify the role of mtDNA instability in aging. To more accurately quantify mtDNA, we applied the emerging technique of digital polymerase chain reaction to individual muscle fibers and muscle homogenates from aged rodents. Individual fiber mtDNA content correlated with fiber type and decreased with age. We adapted a digital polymerase chain reaction deletion assay that was accurate in mixing experiments to a mutation frequency of 0.03% and quantitated an age-induced increase in deletion frequency from rat muscle homogenates. Importantly, the deletion frequency measured in muscle homogenates strongly correlated with electron transport chain-deficient fiber abundance determined by histochemical analyses. These data clarify the temporal accumulation of mtDNA deletions that lead to electron chain-deficient fibers, a process culminating in muscle fiber loss. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter... of high-processivity polymerase with novel internal amplification controls for rapid and specific detection.

USDA-ARS?s Scientific Manuscript database

Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowl...

RNA Polymerase Structure, Function, Regulation, Dynamics, Fidelity, and Roles in GENE EXPRESSION | Center for Cancer Research

Cancer.gov

Multi-subunit RNA polymerases (RNAP) are ornate molecular machines that translocate on a DNA template as they generate a complementary RNA chain. RNAPs are highly conserved in evolution among eukarya, eubacteria, archaea, and some viruses. As such, multi-subunit RNAPs appear to be an irreplaceable advance in the evolution of complex life on earth. Because of their stepwise

Quantitation of Human Papillomavirus DNA in Plasma of Oropharyngeal Carcinoma Patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cao Hongbin; Banh, Alice; Kwok, Shirley

Purpose: To determine whether human papillomavirus (HPV) DNA can be detected in the plasma of patients with HPV-positive oropharyngeal carcinoma (OPC) and to monitor its temporal change during radiotherapy. Methods and Materials: We used polymerase chain reaction to detect HPV DNA in the culture media of HPV-positive SCC90 and VU147T cells and the plasma of SCC90 and HeLa tumor-bearing mice, non-tumor-bearing controls, and those with HPV-negative tumors. We used real-time quantitative polymerase chain reaction to quantify the plasma HPV DNA in 40 HPV-positive OPC, 24 HPV-negative head-and-neck cancer patients and 10 non-cancer volunteers. The tumor HPV status was confirmed bymore » p16{sup INK4a} staining and HPV16/18 polymerase chain reaction or HPV in situ hybridization. A total of 14 patients had serial plasma samples for HPV DNA quantification during radiotherapy. Results: HPV DNA was detectable in the plasma samples of SCC90- and HeLa-bearing mice but not in the controls. It was detected in 65% of the pretreatment plasma samples from HPV-positive OPC patients using E6/7 quantitative polymerase chain reaction. None of the HPV-negative head-and-neck cancer patients or non-cancer controls had detectable HPV DNA. The pretreatment plasma HPV DNA copy number correlated significantly with the nodal metabolic tumor volume (assessed using {sup 18}F-deoxyglucose positron emission tomography). The serial measurements in 14 patients showed a rapid decline in HPV DNA that had become undetectable at radiotherapy completion. In 3 patients, the HPV DNA level had increased to a discernable level at metastasis. Conclusions: Xenograft studies indicated that plasma HPV DNA is released from HPV-positive tumors. Circulating HPV DNA was detectable in most HPV-positive OPC patients. Thus, plasma HPV DNA might be a valuable tool for identifying relapse.« less

Temporal relationships between colds, upper respiratory viruses detected by polymerase chain reaction, and otitis media in young children followed through a typical cold season.

PubMed

Winther, Birgit; Alper, Cuneyt M; Mandel, Ellen M; Doyle, William J; Hendley, J Owen

2007-06-01

Otitis media is a frequent complication of a viral upper respiratory tract infection, and the reported co-incidence of those diseases increases with assay sensitivity and sampling density. We determined the incidence of otitis-media complications in young children when referenced to cold-like illnesses and to concurrent virus recovery from the nasopharynx. A total of 60 children from 24 families were followed from October 2003 through April 30, 2004, by daily parental recording of illness signs, weekly pneumatic otoscopic examinations, and periodic polymerase chain reaction assay of collected nasal fluids for common viruses. One hundred ninety-nine cold-like illnesses were observed, but a sample for virus assay was not collected concurrent with 71 episodes. Of the remainder, 73% of cold-like illnesses were temporally related to recovery of 1 or a combination of the assayed viruses, with rhinovirus predominating. For non-cold-like illness periods, 54 (18%) of 297 assays were positive for virus, and the virus frequency distribution was similar to that for cold-like illnesses. There were 93 diagnosed otitis-media episodes; 65 (70%) of these occurred during a cold-like illness. For the 79 otitis-media episodes with available nasal samples, 61 (77%) were associated with a positive virus result. In this population, the otitis-media complication rate for a cold-like illness was 33%. A cold-like illness was not a prerequisite for polymerase chain reaction detection of viruses in the nose and nasopharynx of young children. Viral detection by polymerase chain reaction in the absence of a cold-like illness is associated with complications in some subjects. Otitis media is a complication of viral infection both with and without concurrent cold-like illnesses, thus downwardly biasing coincidence estimates that use cold-based illnesses as the denominator.

No implication of Simian virus 40 in pathogenesis of malignant pleural mesothelioma in Slovenia.

PubMed

Hmeljak, Julija; Kern, Izidor; Cör, Andrej

2010-01-01

Malignant mesothelioma is predominantly caused by asbestos exposure, although the association of Simian virus 40 in its pathogenesis is currently still under debate. Simian virus 40, a DNA rhesus monkey virus with oncogenic properties, accidentally contaminated early batches of polio vaccine in the 1960s. In the 1990s, viral sequences and proteins were discovered in several human tumors, which triggered research to find a link between Simian virus 40 and human cancers, especially malignant mesothelioma. The aim of our study was to establish an effective laboratory procedure for Simian virus 40 detection and to investigate the presence of Simian virus 40 DNA and small t antigen in mesothelioma samples from Slovenian patients. Paraffin-embedded malignant pleural mesothelioma specimens from 103 Slovenian patients were collected and used for total DNA isolation and real-time polymerase chain reaction for Simian virus 40 small t and large T DNA analysis. Special attention was devoted to primer design, good laboratory practice and polymerase chain reaction contamination prevention. Polymerase chain reaction products were sequenced and BLAST aligned. One 5 microm thick paraffin section from each patient's tissue block was stained with hematoxylin and eosin for histological typing and one for immunohistochemical detection of Simian virus 40 small t antigen using a monoclonal antibody against Simian virus 40 (Pab280). SV40-expressing Wi-38 cells were used as positive control in both PCR and immunohistochemistry. In real-time polymerase chain reaction analyses, only 4 samples gave products with primer pairs amplifying small t antigen and were inconsistent and poorly reproducible. BLAST alignment showed no homology with any deposited SV40 sequences. No immunopositive staining for SV40 small t antigen was found in any of the samples. We found no evidence of SV40 presence in tissue samples from 103 Slovenian patients with malignant pleural mesothelioma. Asbestos exposure remains the main risk factor for malignant pleural mesothelioma in Slovenia.

DNA and RNA polymerase activity in a Moniliophthora perniciosa mitochondrial plasmid and self-defense against oxidative stress.

PubMed

Andrade, B S; Villela-Dias, C; Gomes, D S; Micheli, F; Góes-Neto, A

2013-06-13

Moniliophthora perniciosa (Stahel) Aime and Phillips-Mora is a hemibiotrophic basidiomycete (Agaricales, Tricholomataceae) that causes witches' broom disease in cocoa (Theobroma cacao L.). This pathogen carries a stable integrated invertron-type linear plasmid in its mitochondrial genome that encodes viral-like DNA and RNA polymerases related to fungal senescence and longevity. After culturing the fungus and obtaining its various stages of development in triplicate, we carried out total RNA extraction and subsequent complementary DNA synthesis. To analyze DNA and RNA polymerase expression levels, we performed real-time reverse transcriptase polymerase chain reaction for various fungal phases of development. Our results showed that DNA and RNA polymerase gene expression in the primordium phase of M. perniciosa is related to a potential defense mechanism against T. cacao oxidative attack.

Detection of a putative novel adenovirus by PCR amplification, sequencing and phylogenetic characterisation of two gene fragments from formalin-fixed paraffin-embedded tissues of a cat diagnosed with disseminated adenovirus disease.

PubMed

Lakatos, Béla; Hornyák, Ákos; Demeter, Zoltán; Forgách, Petra; Kennedy, Frances; Rusvai, Miklós

2017-12-01

Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in formalin-fixed paraffin-embedded tissue samples of a cat that had suffered from disseminated adenovirus infection. The identity of the amplified products from the hexon and DNA-dependent DNA polymerase genes was confirmed by DNA sequencing. The sequences were clearly distinguishable from corresponding hexon and polymerase sequences of other mastadenoviruses, including human adenoviruses. These results suggest the possible existence of a distinct feline adenovirus.

[Applying competitive polymerase chain reaction to the detection of hepatitis B virus DNA].

PubMed

Wang, Ling; Yang, Peng; Li, Shuang-qing; Xu, Shu-hui; Cao, Gui-qun; Zhang, Fa-qiang; Zhang, Mei-xia; Chen, Qing-ying; Xia, Qing-jie; Liu, Kai; Tang, Fang; Zhang, Yuan-zheng

2004-11-01

To reduce the rate of accidental false negative result in the HBV DNA PCR test on clinical serum samples. A competitive polymerase chain reaction (C-PCR) was used to decrease the false negative ratio. In the C-PCR, a constructed inner control DNA was added for co-amplification with the HBV target DNA. In a 20 microl C-PCR system, about 60 to 200 copies of inner control DNA could give apparent co-amplification signal band after electrophoresis on a 2% agarose gel. Five of 120 samples of clinical serum (4.2%) could not be amplified. C-PCR has the advantage of yielding information on false negative in the HBV DNA PCR assay of clinical serum samples.

Cytomegalovirus retinitis after intravitreal bevacizumab injection in an immunocompetent patient.

PubMed

Bae, So Hyun; Kim, Tae Wan; Chung, Hum; Heo, Jang Won

2013-02-01

We report a case of cytomegalovirus (CMV) retinitis after intravitreal bevacizumab injection. A 61-year-old woman with diabetic macular edema developed dense vitritis and necrotizing retinitis 3 weeks after intravitreal bevacizumab injection. A diagnostic vitrectomy was performed. The undiluted vitreous sample acquired by vitrectomy was analyzed by polymerase chain reaction and culture. Polymerase chain reaction of the vitreous was positive for CMV DNA. Other laboratory results did not show evidence of other infectious retinitis and systemic immune dysfunction. Human immunodeficiency virus antibodies were also negative. After systemic administration of ganciclovir, retinitis has resolved and there has been no recurrence of retinitis during the follow-up period of 12 months. Ophthalmologists should be aware of potential risk for CMV retinitis after intravitreal bevacizumab injection.

Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

PubMed

Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

2012-01-01

The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

Sexing chick mRNA: A protocol based on quantitative real-time polymerase chain reaction.

PubMed

Wan, Z; Lu, Y; Rui, L; Yu, X; Li, Z

2017-03-01

The accurate identification of sex in birds is important for research on avian sex determination and differentiation. Polymerase chain reaction (PCR)-based methods have been widely applied for the molecular sexing of birds. However, these methods have used genomic DNA. Here, we present the first sexing protocol for chick mRNA based on real-time quantitative PCR. We demonstrate that this method can accurately determine sex using mRNA from chick gonads and other tissues, such as heart, liver, spleen, lung, and muscle. The strategy of this protocol also may be suitable for other species in which sex is determined by the inheritance of sex chromosomes (ZZ male and ZW female). © 2016 Poultry Science Association Inc.

Plague in a Pediatric Patient: Case Report and Use of Polymerase Chain Reaction as a Diagnostic Aid.

PubMed

Drummond, Wendi K; Nelson, Christina A; Fowler, Joe; Epson, Erin E; Mead, Paul S; Lawaczeck, Elisabeth W

2014-12-01

We report a case of bubonic plaque in a 7-year-old patient who presented with a core temperature of 107°F, seizures, vomiting, altered mental status, and septic shock. This case highlights the utility of polymerase chain reaction (PCR) as a diagnostic aid for rapid presumptive identification of Yersinia pestis as well as the importance of correlating PCR results with clinical data. We discuss the various manifestations of plague as they relate to infection control, postexposure prophylaxis, antimicrobial therapy, and treatment duration. © The Author 2014. Published by Oxford University Press on behalf of the Pediatric Infectious Diseases Society. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Reverse Transcription Quantitative Polymerase Chain Reaction for Detection of and Differentiation Between RNA and DNA of HIV-1-Based Lentiviral Vectors.

PubMed

Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E

2017-08-01

The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.

[DIAGNOSTIC VALUE OF COMBINED USE OF COMBINED METHOD OF ENZYME IMMUNOASSAY AND POLYMERASE CHAIN REACTION TO DETECT OF INTRAUTERINE FETAL INFECTION BY PARVOVIRUS B19].

PubMed

Bondarenko, N P; Lakatosh, V P; Lakatosh, P V; Malanchuk, O B; Poladich, I V

2015-01-01

The combined method of diagnosis parvovirus infection during pregnancy by maternal serum enzyme immunoassay and deoxyribonucleic acid isolation parvovirus B19 polymerase chain reaction in amnniotic fluid and fetal cord blood newborns, can diagnose vertical transmission and anticipate a negative effect on the fetus parvovirus. Lack of maternal IgM antibodies in serum due to parvovirus seroconversion during pregnancy does not exclude the persistence of the virus in the fetus. To analyze the diagnostic value of the method for determining the LHP parvovirus B19 DNA in the amniotic fluid, umbilical cord blood of newborns to determine vertical transmission of parvovirus infection when infected mothers B19 during pregnancy.

Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

PubMed

Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

2008-03-01

Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

A case of Pitt-Hopkins syndrome with absence of hyperventilation.

PubMed

Inati, Adlette; Abbas, Hussein A; Korjian, Serge; Daaboul, Yazan; Harajeily, Mohamad; Saab, Raya

2013-12-01

Pitt-Hopkins syndrome is characterized by mental retardation, hyperventilation, and dysmorphic features due to TCF4 mutations. We report a case of Pitt-Hopkins syndrome in a 2½-year-old boy presenting with psychomotor retardation, recurrent respiratory tract infections, and dysmorphic features with absence of hyperventilation or other breathing abnormalities. Comparative genomic hybridization and quantitative real-time polymerase chain reaction were used to confirm TCF4 haploinsufficiency. Pitt-Hopkins syndrome is a rare debilitating disease that should be in the differential diagnosis of other neurodevelopmental disorders characterized by mental retardation and hypotonicity despite the absence of hyperapnea and seizures. Quantitative real-time polymerase chain reaction is another method to identify TCF4 and to confirm Pitt-Hopkins syndrome diagnosis.

Multiplex polymerase chain reaction assay for the detection of minute virus of mice and mouse parvovirus infections in laboratory mice.

PubMed

Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H

2013-04-01

Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.

Recombinase Polymerase Amplification Compared to Real-Time Polymerase Chain Reaction Test for the Detection of Fasciola hepatica in Human Stool

PubMed Central

Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton

2017-01-01

Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691

Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis in the rumen epithelium

USDA-ARS?s Scientific Manuscript database

The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA) metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following intro...

[THE COMPARATIVE ANALYSIS OF EFFECTIVENESS OF QUICK TESTS IN DIAGNOSTIC OF INFLUENZA AND RESPIRATORY SYNCYTIAL VIRAL INFECTION IN CHILDREN].

PubMed

Petrova, E R; Sukhovetskaia, V P; Pisareva, M M; Maiorova, V G; Sverlova, M V; Danilenko, D M; Petrova, P A; Krivitskaia, V Z; Sominina, A A

2015-11-01

The analysis was implemented concerning diagnostic parameters of commercial quick tests (immune chromatographic tests BinaxNOW Influenza A&B and BinaxNow RSV Alere, Scarborough Inc., USA) under detection of antigens of influenza virus A and respiratory syncytial virus in clinical materials. The polymerase chain reaction in real-time and isolation ofviruses in cell cultures. The analysis of naso-pharyngeal smears from 116 children demonstrated that sensitivity and specifcity of detection of influenza virus A using device mariPOC in comparison with polymerase chain reaction made up to 93.8% and 99.0% correspondingly at total concordance of results of both techniques as 98.3%. At diagnosing of respiratory syncytial virus using device mariPOC parameters made up to 77.3%, 98.9% and 862% as compared with polymerase chain reaction. The sensitivity, specificity and total concordance of results of immune chromatographic tests BinaxNOW in comparison ofpolymerase chain reaction made up to 86.7%, 100% and 96.2% correspondingly at detection of influenza virus A and 80.9%, 97.4% and 91.6% correspondingly at detection of respiratory syncytial virus. In comparison with isolation technique in cell cultures sensitivity of system mariPOC and immune chromatographic tests proved to be in 1.3-1.4 times higher at detection of influenza virus A and in 1.7-2 times higher in case of isolation of respiratory syncytial virus. There is no statistically significant differences between diagnostic parameters received for mariPOC and immune chromatographic tests at diagnosing influenza virus A and respiratory syncytial viral infection.

The uncoupling of catalysis and translocation in the viral RNA-dependent RNA polymerase

PubMed Central

Shu, Bo; Gong, Peng

2017-01-01

ABSTRACT The nucleotide addition cycle of nucleic acid polymerases includes 2 major events: the pre-chemistry active site closure leading to the addition of one nucleotide to the product chain; the post-chemistry translocation step moving the polymerase active site one position downstream on its template. In viral RNA-dependent RNA polymerases (RdRPs), structural and biochemical evidences suggest that these 2 events are not tightly coupled, unlike the situation observed in A-family polymerases such as the bacteriophage T7 RNA polymerase. Recently, an RdRP translocation intermediate crystal structure of enterovirus 71 shed light on how translocation may be controlled by elements within RdRP catalytic motifs, and a series of poliovirus apo RdRP crystal structures explicitly suggest that a motif B loop may assist the movement of the template strand in late stages of transcription. Implications of RdRP catalysis-translocation uncoupling and the remaining challenges to further elucidate RdRP translocation mechanism are also discussed. PMID:28277928

Development of polymerase chain reaction-based diagnostic tests for detection of Malsoor virus & adenovirus isolated from Rousettus species of bats in Maharashtra, India.

PubMed

Shete, Anita M; Yadav, Pragya; Kumar, Vimal; Nikam, Tushar; Mehershahi, Kurosh; Kokate, Prasad; Patil, Deepak; Mourya, Devendra T

2017-01-01

Bats are recognized as important reservoirs for emerging infectious disease and some unknown viral diseases. Two novel viruses, Malsoor virus (family Bunyaviridae, genus, Phlebovirus) and a novel adenovirus (AdV) (family, Adenoviridae genus, Mastadenovirus), were identified from Rousettus bats in the Maharashtra State of India. This study was done to develop and optimize real time reverse transcription - polymerase chain reaction (RT-PCR) assays for Malsoor virus and real time and nested PCR for adenovirus from Rousettus bats. For rapid and accurate screening of Malsoor virus and adenovirus a nested polymerase chain reaction and TaqMan-based real-time PCR were developed. Highly conserved region of nucleoprotein gene of phleboviruses and polymerase gene sequence from the Indian bat AdV isolate polyprotein gene were selected respectively for diagnostic assay development of Malsoor virus and AdV. Sensitivity and specificity of assays were calculated and optimized assays were used to screen bat samples. Molecular diagnostic assays were developed for screening of Malsoor virus and AdV and those were found to be specific. Based on the experiments performed with different parameters, nested PCR was found to be more sensitive than real-time PCR; however, for rapid screening, real-time PCR can be used and further nested PCR can be used for final confirmation or in those laboratories where real-time facility/expertise is not existing. This study reports the development and optimization of nested RT-PCR and a TaqMan-based real-time PCR for Malsoor virus and AdV. The diagnostic assays can be used for rapid detection of these novel viruses to understand their prevalence among bat population.

[Structure, organization and capacity problems in emergency medical services, emergency admission and intensive care units].

PubMed

Dick, W

1994-01-01

Emergency medicine is subjected worldwide to financial stringencies and organizational evaluations of cost-effectiveness. The various links in the chain of survival are affected differently. Bystander assistance or bystander CPR is available in only 30% of the emergencies, response intervals--if at all required by legislation--are observed to only a limited degree or are too extended for survival in cardiac arrest. A single emergency telephone number is lacking. Too many different phone numbers for emergency reporting result in confusion and delays. Organizational realities are not fully overcome and impair efficiency. The position of the emergency physician in the EMS System is inadequately defined, the qualification of too many emergency physicians are unsatisfactory. In spite of this, emergency physicians are frequently forced to answer out-of-hospital emergency calls. Conflicts between emergency physicians and EMTs may be overcome by providing both groups with comparable qualifications as well as by providing an explicit definition of emergency competence. A further source of conflict occurs at the juncture of prehospital and inhospital emergency care in the emergency department. Deficiencies on either side play a decisive role. At least in principle there are solutions to the deficiencies in the EMSS and in intensive care medicine. They are among others: Adequate financial compensation of emergency personnel, availability of sufficient numbers of highly qualified personnel, availability of a central receiving area with an adjacent emergency ward, constant information flow to the dispatch center on the number of available emergency beds, maintaining 5% of all beds as emergency beds, establishing intermediate care facilities. Efficiency of emergency physician activities can be demonstrated in polytraumatized patients or in patients with ventricular fibrillation or acute myocardial infarction, in patients with acute myocardial insufficiency and other emergency clinical pictures. Cost effectiveness is clearly in favor of emergency medicine. Future developments will be characterized by the consequences of new health care legislation and by effects of financial stringencies on the emergency medical services.

Stochastic model of template-directed elongation processes in biology.

PubMed

Schilstra, Maria J; Nehaniv, Chrystopher L

2010-10-01

We present a novel modular, stochastic model for biological template-based linear chain elongation processes. In this model, elongation complexes (ECs; DNA polymerase, RNA polymerase, or ribosomes associated with nascent chains) that span a finite number of template units step along the template, one after another, with semaphore constructs preventing overtaking. The central elongation module is readily extended with modules that represent initiation and termination processes. The model was used to explore the effect of EC span on motor velocity and dispersion, and the effect of initiation activator and repressor binding kinetics on the overall elongation dynamics. The results demonstrate that (1) motors that move smoothly are able to travel at a greater velocity and closer together than motors that move more erratically, and (2) the rate at which completed chains are released is proportional to the occupancy or vacancy of activator or repressor binding sites only when initiation or activator/repressor dissociation is slow in comparison with elongation. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain.

PubMed

Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur

2017-05-17

Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

Amplification of ST50 gene using dry-reagent-based polymerase chain reaction for the detection of Salmonella typhi.

PubMed

Aziah, Ismail; Ravichandran, Manickam; Ismail, Asma

2007-12-01

Conventional polymerase chain reaction (PCR) testing requires many pipetting steps and has to be transported and stored in cold chain. To overcome these limitations, we designed a ready-to-use PCR test for Salmonella typhi using PCR reagents, primers against the ST50 gene of S. typhi, a built-in internal amplification control (IAC), and gel loading dye mixed and freeze-dried in a single tube. The 2-step dry-reagent-based assay was used to amplify a 1238-bp target gene and an 810-bp IAC gene from 73 BACTEC blood culture broths (33 true positives for S. typhi and 40 true negatives for non-S. typhi). The sensitivity, specificity, positive predictive value, and negative predictive value of the PCR assay were 87.9%, 100%, 100%, and 90.9%, respectively. We suggest that this rapid 2-step PCR test could be used for the rapid diagnosis of typhoid fever.

Detection of epsilon class switching and IgE synthesis in human B cells.

PubMed

Pène, Jérôme; Guilhot, Florence; Cognet, Isabelle; Guglielmi, Paul; Guay-Giroux, Angélique; Bonnefoy, Jean-Yves; Elson, Greg C; Yssel, Hans; Gauchat, Jean-François

2006-01-01

We observed that mast cells, as other cells expressing the CD40 ligand CD154, can trigger IgE synthesis in B cells in the presence of interleukin (IL)-4. Numerous complementary techniques can be used to follow the succession of molecular events leading to IgE synthesis. This chapter will illustrate how human B cells (naïve or memory) can be purified, stored, and cultivated in medium that is permissive for IgE synthesis and stimulated with IL-4 or IL-13 and CD40 activation, the latter being induced by soluble CD154, anti-CD40 antibodies, or CD154-expressing cells. All these molecules are expressed by mast cells. The quantification of the epsilon-sterile transcript synthesis by polymerase chain reaction or Northern blot, the epsilon excision circles produced during immunoglobulin heavy chain locus rearrangement by polymerase chain reaction, and the IgE production by enzyme-linked immunosorbent assay will be described.

Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

DOE PAGES

McInerney, Peter; Adams, Paul; Hadi, Masood Z.

2014-01-01

As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error ratemore » measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

Development of a rapid and sensitive one-step reverse transcription-nested polymerase chain reaction in a single tube using the droplet-polymerase chain reaction machine.

PubMed

Yamaguchi, Akemi; Matsuda, Kazuyuki; Sueki, Akane; Taira, Chiaki; Uehara, Masayuki; Saito, Yasunori; Honda, Takayuki

2015-08-25

Reverse transcription (RT)-nested polymerase chain reaction (PCR) is a time-consuming procedure because it has several handling steps and is associated with the risk of cross-contamination during each step. Therefore, a rapid and sensitive one-step RT-nested PCR was developed that could be performed in a single tube using a droplet-PCR machine. The K562 BCR-ABL mRNA-positive cell line as well as bone marrow aspirates from 5 patients with chronic myelogenous leukemia (CML) and 5 controls without CML were used. We evaluated one-step RT-nested PCR using the droplet-PCR machine. One-step RT-nested PCR performed in a single tube using the droplet-PCR machine enabled the detection of BCR-ABL mRNA within 40min, which was 10(3)-fold superior to conventional RT nested PCR using three steps in separate tubes. The sensitivity of the one-step RT-nested PCR was 0.001%, with sample reactivity comparable to that of the conventional assay. One-step RT-nested PCR was developed using the droplet-PCR machine, which enabled all reactions to be performed in a single tube accurately and rapidly and with high sensitivity. This one-step RT-nested PCR may be applicable to a wide spectrum of genetic tests in clinical laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.

A screening method for the detection of the 35S promoter and the nopaline synthase terminator in genetically modified organisms in a real-time multiplex polymerase chain reaction using high-resolution melting-curve analysis.

PubMed

Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko

2009-11-01

To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.

Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

PubMed

Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

2014-09-01

The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

Epstein-Barr viral load before a liver transplant in children with chronic liver disease.

PubMed

Shakibazad, Nader; Honar, Naser; Dehghani, Seyed Mohsen; Alborzi, Abdolvahab

2014-12-01

Many children with chronic liver disease require a liver transplant. These patients are prone to various infections, including Epstein-Barr virus infection. This study sought to measure the Epstein-Barr viral load by polymerase chain reaction before a liver transplant. This cross-sectional study was done at the Shiraz University of Medical Sciences, Shiraz, Iran, in 2011. All patients were aged younger than 18 years with chronic liver disease and were candidates for a liver transplant at the Shiraz Nemazee Hospital Organ Transplant Center. They had been investigated regarding their demographic characteristics, underlying disease, laboratory findings, and Epstein-Barr viral load by real-time TaqMan polymerase chain reaction. Ninety-eight patients were studied and the mean age was 6.5 ± 5.9 years. Cryptogenic cirrhosis was the most-prevalent reason for liver transplant, and the death rate before a transplant was 15%. Among the study subjects, 6 had measurable Epstein-Barr viral load by polymerase chain reaction before the transplant, and 4 of them had considerably higher Epstein-Barr viral loads (more than 1000 copies/mL). With respect to the close prevalence of posttransplant lymphoproliferative disease (6%) and the high Epstein-Barr viral load in the patients before a transplant (4%), high pretransplant Epstein-Barr viral load can be considered a risk factor for posttransplant lymphoproliferative disorder.

Parvovirus B19 Infection in Children With Arterial Ischemic Stroke.

PubMed

Fullerton, Heather J; Luna, Jorge M; Wintermark, Max; Hills, Nancy K; Tokarz, Rafal; Li, Ying; Glaser, Carol; DeVeber, Gabrielle A; Lipkin, W Ian; Elkind, Mitchell S V

2017-10-01

Case-control studies suggest that acute infection transiently increases the risk of childhood arterial ischemic stroke. We hypothesized that an unbiased pathogen discovery approach utilizing MassTag-polymerase chain reaction would identify pathogens in the blood of childhood arterial ischemic stroke cases. The multicenter international VIPS study (Vascular Effects of Infection in Pediatric Stroke) enrolled arterial ischemic stroke cases, and stroke-free controls, aged 29 days through 18 years. Parental interview included questions on recent infections. In this pilot study, we used MassTag-polymerase chain reaction to test the plasma of the first 161 cases and 34 controls enrolled for a panel of 28 common bacterial and viral pathogens. Pathogen DNA was detected in no controls and 14 cases (8.7%): parvovirus B19 (n=10), herpesvirus 6 (n=2), adenovirus (n=1), and rhinovirus 6C (n=1). Parvovirus B19 infection was confirmed by serologies in all 10; infection was subclinical in 8. Four cases with parvovirus B19 had underlying congenital heart disease, whereas another 5 had a distinct arteriopathy involving a long-segment stenosis of the distal internal carotid and proximal middle cerebral arteries. Using MassTag-polymerase chain reaction, we detected parvovirus B19-a virus known to infect erythrocytes and endothelial cells-in some cases of childhood arterial ischemic stroke. This approach can generate new, testable hypotheses about childhood stroke pathogenesis. © 2017 American Heart Association, Inc.

Single cell digital polymerase chain reaction on self-priming compartmentalization chip

PubMed Central

Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

2017-01-01

Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267

Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

PubMed Central

Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

2015-01-01

This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

Combined subtraction hybridization and polymerase chain reaction amplification procedure for isolation of strain-specific Rhizobium DNA sequences.

PubMed Central

Bjourson, A J; Stone, C E; Cooper, J E

1992-01-01

A novel subtraction hybridization procedure, incorporating a combination of four separation strategies, was developed to isolate unique DNA sequences from a strain of Rhizobium leguminosarum bv. trifolii. Sau3A-digested DNA from this strain, i.e., the probe strain, was ligated to a linker and hybridized in solution with an excess of pooled subtracter DNA from seven other strains of the same biovar which had been restricted, ligated to a different, biotinylated, subtracter-specific linker, and amplified by polymerase chain reaction to incorporate dUTP. Subtracter DNA and subtracter-probe hybrids were removed by phenol-chloroform extraction of a streptavidin-biotin-DNA complex. NENSORB chromatography of the sequences remaining in the aqueous layer captured biotinylated subtracter DNA which may have escaped removal by phenol-chloroform treatment. Any traces of contaminating subtracter DNA were removed by digestion with uracil DNA glycosylase. Finally, remaining sequences were amplified by polymerase chain reaction with a probe strain-specific primer, labelled with 32P, and tested for specificity in dot blot hybridizations against total genomic target DNA from each strain in the subtracter pool. Two rounds of subtraction-amplification were sufficient to remove cross-hybridizing sequences and to give a probe which hybridized only with homologous target DNA. The method is applicable to the isolation of DNA and RNA sequences from both procaryotic and eucaryotic cells. Images PMID:1637166

Performance of transport and selective media for swine Bordetella bronchiseptica recovery and it comparison to polymerase chain reaction detection

PubMed Central

Coutinho, Tania Alen; Bernardi, Mari Lourdes; de Itapema Cardoso, Marisa Ribeiro; Borowski, Sandra Maria; Moreno, Andrea Micke; de Barcellos, David Emilio Santos Neves

2009-01-01

Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10°C and 27°C) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27°C and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures. PMID:24031390

Micro-droplet Digital Polymerase Chain Reaction and Real-Time Quantitative Polymerase Chain Reaction Technologies Provide Highly Sensitive and Accurate Detection of Zika Virus.

PubMed

Hui, Yuan; Wu, Zhiming; Qin, Zhiran; Zhu, Li; Liang, Junhe; Li, Xujuan; Fu, Hanmin; Feng, Shiyu; Yu, Jianhai; He, Xiaoen; Lu, Weizhi; Xiao, Weiwei; Wu, Qinghua; Zhang, Bao; Zhao, Wei

2018-06-01

The establishment of highly sensitive diagnostic methods is critical in the early diagnosis and control of Zika virus (ZIKV) and in preventing serious neurological complications of ZIKV infection. In this study, we established micro-droplet digital polymerase chain reaction (ddPCR) and real-time quantitative PCR (RT-qPCR) protocols for the detection of ZIKV based on the amplification of the NS5 gene. For the ZIKV standard plasmid, the RT-qPCR results showed that the cycle threshold (Ct) value was linear from 10 1 to 10 8  copy/μL, with a standard curve R 2 of 0.999 and amplification efficiency of 92.203%; however, a concentration as low as 1 copy/μL could not be detected. In comparison with RT-qPCR, the ddPCR method resulted in a linear range of 10 1 -10 4  copy/μL and was able to detect concentrations as low as 1 copy/μL. Thus, for detecting ZIKV from clinical samples, RT-qPCR is a better choice for high-concentration samples (above 10 1  copy/μL), while ddPCR has excellent accuracy and sensitivity for low-concentration samples. These results indicate that the ddPCR method should be of considerable use in the early diagnosis, laboratory study, and monitoring of ZIKV.

Single cell digital polymerase chain reaction on self-priming compartmentalization chip.

PubMed

Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

2017-01-01

Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.

Nuclear TRIM25 Specifically Targets Influenza Virus Ribonucleoproteins to Block the Onset of RNA Chain Elongation.

PubMed

Meyerson, Nicholas R; Zhou, Ligang; Guo, Yusong R; Zhao, Chen; Tao, Yizhi J; Krug, Robert M; Sawyer, Sara L

2017-11-08

TRIM25 is an E3 ubiquitin ligase that activates RIG-I to promote the antiviral interferon response. The NS1 protein from all strains of influenza A virus binds TRIM25, although not all virus strains block the interferon response, suggesting alternative mechanisms for TRIM25 action. Here we present a nuclear role for TRIM25 in specifically restricting influenza A virus replication. TRIM25 inhibits viral RNA synthesis through a direct mechanism that is independent of its ubiquitin ligase activity and the interferon pathway. This activity can be inhibited by the viral NS1 protein. TRIM25 inhibition of viral RNA synthesis results from its binding to viral ribonucleoproteins (vRNPs), the structures containing individual viral RNA segments, the viral polymerase, and multiple viral nucleoproteins. TRIM25 binding does not inhibit initiation of capped-RNA-primed viral mRNA synthesis by the viral polymerase. Rather, the onset of RNA chain elongation is inhibited because TRIM25 prohibits the movement of RNA into the polymerase complex. Copyright © 2017 Elsevier Inc. All rights reserved.

Sequences of heavy and light chain variable regions from four bovine immunoglobulins.

PubMed

Armour, K L; Tempest, P R; Fawcett, P H; Fernie, M L; King, S I; White, P; Taylor, G; Harris, W J

1994-12-01

Oligodeoxyribonucleotide primers based on the 5' ends of bovine IgG1/2 and lambda constant (C) region genes, together with primers encoding conserved amino acids at the N-terminus of mature variable (V) regions from other species, have been used in cDNA and polymerase chain reactions (PCRs) to amplify heavy and light chain V region cDNA from bovine heterohybridomas. The amino acid sequences of VH and V lambda from four bovine immunoglobulins of different specificities are presented.

Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

PubMed

Brzezinski, Jennifer L

2006-01-01

The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

Case Report of Focal Epithelial Hyperplasia (Heck's Disease) with Polymerase Chain Reaction Detection of Human Papillomavirus 13.

PubMed

Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna

2016-05-01

Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. © 2016 Wiley Periodicals, Inc.

Polymerase chain reaction identification of three members of the Anopheles sundaicus (Diptera: Culicidae) complex, malaria vectors in Southeast Asia.

PubMed

Dusfour, Isabelle; Blondeau, Johanna; Harbach, Ralph E; Vythilingham, Indra; Baimai, Visut; Trung, Ho D; Sochanta, Tho; Bangs, Michael J; Manguin, Sylvie

2007-09-01

Anopheles sundaicus s.l., a major malaria vector taxon, occurs primarily along coastal areas and on islands in Southeast Asia. Our previous studies using cytochrome oxidase I, cytochrome-b, and internal transcribed spacer 2 markers discriminated three allopatric species: An. sundaicus s.s. in northern Borneo, An. epiroticus in Southeast Asia, and An. sundaicus E on Sumatra and Java, Indonesia. Morphological comparisons of three developmental stages did not reveal unique diagnostic characters that could reliably distinguish the three species. Therefore, we developed a multiplex polymerase chain reaction (PCR) assay based on two mitochondrial DNA markers to unambiguously identify them. This PCR was tested on 374 specimens from 24 different geographical populations, expanding our knowledge of the distribution of these species.

Susceptibility of Culicoides variipennis sonorensis to infection by polymerase chain reaction-detectable bluetongue virus in cattle blood.

PubMed

Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F

1996-05-01

Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.

Detection of egg drop syndrome 1976 virus by polymerase chain reaction and study of its persistence in experimentally infected layer birds.

PubMed

Kumar, N S; Kataria, J M; Koti, M; Dhama, K; Toroghi, R

2003-01-01

Polymerase chain reaction (PCR) assay was developed for the detection of Egg drop syndrome 1976 (EDS-76) virus in tissues, namely in the uterus, spleen and buffy coat. It was also used to study the persistence of the virus in tissues of experimentally infected layer birds. The PCR assay could detect as little as 10 fg of purified EDS-76 viral DNA. It also amplified the DNA of Fowl adenovirus serotypes 4 (FAV-4) and 8 (FAV-8). The virus persisted in the uterus up to day 21 post infection (p.i.). Detection of EDS-76 viral DNA in the buffy coat could be useful for studying the occurrence of the respective disease in layer bird flocks.

Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique tilapia (Oreochromis mossambicus) by polymerase chain reaction

USGS Publications Warehouse

Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.

2004-01-01

We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

[Pea (Pisum sativum) genes, participating in symbiosis with nitrogen-fixing bacteria. III. Study of the structure of the ENOD12 early nodulin gene for various types of peas using the polymerase chain reaction (PCR)].

PubMed

Kozik, A V; Matvienko, M A; Men', A E; Zalenskiĭ, A O; Tikhonovich, I A

1992-01-01

We have determined the length of early noduline gene ENOD12 in various varieties and lines of pea (Pisum sativum) using the polymerase chain reaction (PCR). It was demonstrated that promoter regions of ENOD12A and ENOD12B genes in line 2150 (Afghanistan) are longer than these in variety "Feltham first". The disparity is 14 bp. When studying these genes in 7 different lines and varieties of pea it was found that ENOD12A gene is more variable in size than the ENOD12B gene. We showed the possibility to analyze the heritage of ENOD12 gene's alleles by using the PCR method.

Leishmania chagasi in Opossums (Didelphis albiventris) in an Urban Area Endemic for Visceral Leishmaniasis, Campo Grande, Mato Grosso do Sul, Brazil

PubMed Central

Humberg, Roberta M. P.; Oshiro, Elisa T.; Cruz, Maria do Socorro Pires e; Ribolla, Paulo E. M.; Alonso, Diego P.; Ferreira, Alda M. T.; Bonamigo, Raquel A.; Tasso, Norton; de Oliveira, Alessandra Gutierrez

2012-01-01

We investigated the occurrence of Leishmania infantum chagasi in Didelphis albiventris opossums at a wild animal rehabilitation center in the city of Campo Grande, Brazil. A total of 54 opossums were tested for L. i. chagasi infection in peripheral blood and bone marrow samples. The samples were analyzed by direct examination, culturing in a specific medium, and polymerase chain reaction–restriction fragment length polymorphism. Leishmania i. chagasi DNA was detected by polymerase chain reaction–restriction fragment length polymorphism in 11 (20.37%) animals. A total of 81.81% of positive opossums were captured in areas of known visceral leishmaniasis transmission. These results suggest a role for D. albiventris in the urban transmission of visceral leishmaniasis. PMID:22802435

Subacute Sclerosing Panencephalitis in an Infant: Diagnostic Role of Viral Genome Analysis

PubMed Central

Baram, Tallie Z.; Gonzalez-Gomez, Ignacio; Xie, Zong-De; Yao, Dapeng; Gilles, Floyd H.; Nelson, Marvin D.; Nguyen, Hahn T.; Peters, Julius

2013-01-01

Subacute sclerosing panencephalitis (SSPE) is related to “defective” measles virus or vaccination, though an association with parainfluenza viruses has been reported. SSPE is characterized by a slow, erratic course and elevated cerebrospinal fluid measles titers. An immunocompetent, vaccinated infant, with onset of symptoms in parainfiuenza virus season and a catastrophic course is described. Cerebrospinal fluid titers were negative, but postmortem brain had typical SSPE lesions. Patient brain-derived RNA, subjected to reverse transcription followed by polymerase chain reaction yielded polymerase chain reaction products with measles virus but not parainfluenza virus genes. The sequenced fragment revealed multiple mutations, typical for SSPE. SSPE can thus present in infants, with short latency and no cerebrospinal fluid antibodies. Viral genomic analysis may be diagnostic, permitting early therapy. PMID:8024248

Microfludic Device for Creating Ionic Strength Gradients over DNA Microarrays for Efficient DNA Melting Studies and Assay Development

PubMed Central

Petersen, Jesper; Poulsen, Lena; Birgens, Henrik; Dufva, Martin

2009-01-01

The development of DNA microarray assays is hampered by two important aspects: processing of the microarrays is done under a single stringency condition, and characteristics such as melting temperature are difficult to predict for immobilized probes. A technical solution to these limitations is to use a thermal gradient and information from melting curves, for instance to score genotypes. However, application of temperature gradients normally requires complicated equipment, and the size of the arrays that can be investigated is restricted due to heat dissipation. Here we present a simple microfluidic device that creates a gradient comprising zones of defined ionic strength over a glass slide, in which each zone corresponds to a subarray. Using this device, we demonstrated that ionic strength gradients function in a similar fashion as corresponding thermal gradients in assay development. More specifically, we noted that (i) the two stringency modulators generated melting curves that could be compared, (ii) both led to increased assay robustness, and (iii) both were associated with difficulties in genotyping the same mutation. These findings demonstrate that ionic strength stringency buffers can be used instead of thermal gradients. Given the flexibility of design of ionic gradients, these can be created over all types of arrays, and encompass an attractive alternative to temperature gradients, avoiding curtailment of the size or spacing of subarrays on slides associated with temperature gradients. PMID:19277213

Microfludic device for creating ionic strength gradients over DNA microarrays for efficient DNA melting studies and assay development.

PubMed

Petersen, Jesper; Poulsen, Lena; Birgens, Henrik; Dufva, Martin

2009-01-01

The development of DNA microarray assays is hampered by two important aspects: processing of the microarrays is done under a single stringency condition, and characteristics such as melting temperature are difficult to predict for immobilized probes. A technical solution to these limitations is to use a thermal gradient and information from melting curves, for instance to score genotypes. However, application of temperature gradients normally requires complicated equipment, and the size of the arrays that can be investigated is restricted due to heat dissipation. Here we present a simple microfluidic device that creates a gradient comprising zones of defined ionic strength over a glass slide, in which each zone corresponds to a subarray. Using this device, we demonstrated that ionic strength gradients function in a similar fashion as corresponding thermal gradients in assay development. More specifically, we noted that (i) the two stringency modulators generated melting curves that could be compared, (ii) both led to increased assay robustness, and (iii) both were associated with difficulties in genotyping the same mutation. These findings demonstrate that ionic strength stringency buffers can be used instead of thermal gradients. Given the flexibility of design of ionic gradients, these can be created over all types of arrays, and encompass an attractive alternative to temperature gradients, avoiding curtailment of the size or spacing of subarrays on slides associated with temperature gradients.

Identification of Potent Chemotypes Targeting Leishmania major Using a High-Throughput, Low-Stringency, Computationally Enhanced, Small Molecule Screen

PubMed Central

Sharlow, Elizabeth R.; Close, David; Shun, Tongying; Leimgruber, Stephanie; Reed, Robyn; Mustata, Gabriela; Wipf, Peter; Johnson, Jacob; O'Neil, Michael; Grögl, Max; Magill, Alan J.; Lazo, John S.

2009-01-01

Patients with clinical manifestations of leishmaniasis, including cutaneous leishmaniasis, have limited treatment options, and existing therapies frequently have significant untoward liabilities. Rapid expansion in the diversity of available cutaneous leishmanicidal chemotypes is the initial step in finding alternative efficacious treatments. To this end, we combined a low-stringency Leishmania major promastigote growth inhibition assay with a structural computational filtering algorithm. After a rigorous assay validation process, we interrogated ∼200,000 unique compounds for L. major promastigote growth inhibition. Using iterative computational filtering of the compounds exhibiting >50% inhibition, we identified 553 structural clusters and 640 compound singletons. Secondary confirmation assays yielded 93 compounds with EC50s ≤ 1 µM, with none of the identified chemotypes being structurally similar to known leishmanicidals and most having favorable in silico predicted bioavailability characteristics. The leishmanicidal activity of a representative subset of 15 chemotypes was confirmed in two independent assay formats, and L. major parasite specificity was demonstrated by assaying against a panel of human cell lines. Thirteen chemotypes inhibited the growth of a L. major axenic amastigote-like population. Murine in vivo efficacy studies using one of the new chemotypes document inhibition of footpad lesion development. These results authenticate that low stringency, large-scale compound screening combined with computational structure filtering can rapidly expand the chemotypes targeting in vitro and in vivo Leishmania growth and viability. PMID:19888337

Evaluation of Phage Display Discovered Peptides as Ligands for Prostate-Specific Membrane Antigen (PSMA)

PubMed Central

Edwards, W. Barry

2013-01-01

The aim of this study was to identify potential ligands of PSMA suitable for further development as novel PSMA-targeted peptides using phage display technology. The human PSMA protein was immobilized as a target followed by incubation with a 15-mer phage display random peptide library. After one round of prescreening and two rounds of screening, high-stringency screening at the third round of panning was performed to identify the highest affinity binders. Phages which had a specific binding activity to PSMA in human prostate cancer cells were isolated and the DNA corresponding to the 15-mers were sequenced to provide three consensus sequences: GDHSPFT, SHFSVGS and EVPRLSLLAVFL as well as other sequences that did not display consensus. Two of the peptide sequences deduced from DNA sequencing of binding phages, SHSFSVGSGDHSPFT and GRFLTGGTGRLLRIS were labeled with 5-carboxyfluorescein and shown to bind and co-internalize with PSMA on human prostate cancer cells by fluorescence microscopy. The high stringency requirements yielded peptides with affinities KD∼1 µM or greater which are suitable starting points for affinity maturation. While these values were less than anticipated, the high stringency did yield peptide sequences that apparently bound to different surfaces on PSMA. These peptide sequences could be the basis for further development of peptides for prostate cancer tumor imaging and therapy. PMID:23935860

Using the rate of bacterial clearance determined by real-time polymerase chain reaction as a timely surrogate marker to evaluate the appropriateness of antibiotic usage in critical patients with Acinetobacter baumannii bacteremia.

PubMed

Chuang, Yu-Chung; Chang, Shan-Chwen; Wang, Wei-Kung

2012-08-01

Bacteremia caused by Acinetobacter baumannii is becoming more frequent among critically ill patients, and has been associated with high mortality and prolonged hospital stay. Multidrug resistance and delay in blood culture have been shown to be significant barriers to appropriate antibiotic treatment. Quantitative polymerase chain reaction assays were recently used to monitor bacterial loads; we hypothesized that the rate of bacterial clearance determined by quantitative polymerase chain reaction can be used as a timely surrogate marker to evaluate the appropriateness of antibiotic usage. Prospective observational study. University hospital and research laboratory. Patients with culture-proven A. baumannii bacteremia in the intensive care units were prospectively enrolled from April 2008 to February 2009. Plasmid Oxa-51/pCRII-TOPO, which contained a 431-bp fragment of the A. baumannii-specific Oxa-51 gene in a pCRII-TOPO vector, was used as the standard. Sequential bacterial DNA loads in the blood were measured by a quantitative polymerase chain reaction assay. We enrolled 51 patients with A. baumannii bacteremia, and examined 318 sequential whole blood samples. The initial mean bacterial load was 2.15 log copies/mL, and the rate of bacterial clearance was 0.088 log copies/mL/day. Multivariate linear regression using the generalized estimation equation approach revealed that the use of immunosuppressants was an independent predictor for slower bacterial clearance (coefficient, 1.116; p<.001), and appropriate antibiotic usage was an independent predictor for more rapid bacterial clearance (coefficient, -0.995; p<.001). Patients with a slower rate of bacterial clearance experienced higher in-hospital mortality (odds ratio, 2.323; p=.04) Immunosuppression and appropriate antibiotic usage were independent factors affecting the rate of clearance of A. baumannii bacteremia in critical patients. These findings highlight the importance of appropriate antibiotic usage and development of effective antibiotics against A. baumannii in an era of emerging antibiotic resistance. The rate of bacterial clearance could serve as a timely surrogate marker for evaluating the appropriateness of antibiotics.

Expression of TGF-beta1, osteonectin, and BMP-4 in mandibular distraction osteogenesis with compression stimulation: reverse transcriptase-polymerase chain reaction study and biomechanical test.

PubMed

Kim, Uk-Kyu; Park, Seong-Jin; Seong, Wook-Jin; Heo, Jun; Hwang, Dae-Seok; Kim, Yong-Deok; Shin, Sang-Hun; Kim, Gyoo-Cheon

2010-09-01

This study compared the levels of transforming growth factor-beta1 (TGF-beta1), osteonectin, and bone morphogenetic protein-4 (BMP-4) expression in regenerated bone in a rabbit mandible that had undergone conventional distraction osteogenesis (DO) with those in regenerated bone from a modified DO technique with compression stimulation. A total of 42 rabbits were used in this reverse transcriptase-polymerase chain reaction study. In the control group, distraction was performed at 1 mm/day for 8 days. In the experimental group, overdistraction was performed for 10 days, followed by a 3-day latency period and 2 days of compression to achieve the same amount of DO. Three rabbits per subgroup were killed at 0, 5, 13, 20, 27, 34, and 41 days after the initial osteotomy. The levels of TGF-beta1, osteonectin, and BMP-4 in the bone regenerates were measured by reverse transcriptase-polymerase chain reaction. A biomechanical microhardness test was also performed in 8 rabbits as a separate experiment. Reverse transcriptase-polymerase chain reaction revealed a greater level of TGF-beta1 in the experimental group immediately after applying the compression force that continued for 2 weeks. The level then decreased to that of the control group at 3 weeks. The greater level of osteonectin in the experimental group after compression than that in the control group continued for 3 weeks. In the experimental group, the level of BMP-4 increased immediately after compression. However, the level in the control group decreased. The microhardness ratio of distracted bone to normal bone on the cortex was statistically different at 0.47 in the control group and 0.80 in the experimental group (P = .049) at 55 days after osteotomy. The effectiveness of the new DO technique with compression stimulation was confirmed by the gene expression study and the biomechanical test findings. Copyright 2010 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections.

PubMed

Siqueira, José F; Rôças, Isabela N

2003-08-01

Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and persistent endodontic infections. This strengthens the assumption that this bacterial species is an endodontic pathogen associated with different forms of periradicular diseases. In contrast, A radicidentis was only occasionally detected in the patients examined. The role played by this species in endodontic infections remains to be clarified.

Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter with application of high-processivity polymerase and novel internal amplification controls for rapid and specific detection.

PubMed

Oakley, Brian B; Line, J Eric; Berrang, Mark E; Johnson, Jessica M; Buhr, R Jeff; Cox, Nelson A; Hiett, Kelli L; Seal, Bruce S

2012-02-01

Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowledge none has been empirically tested for specificity using high-throughput sequencing. Here we demonstrate the power of next-generation sequencing to determine the specificity of a widely cited Campylobacter-specific polymerase chain reaction (PCR) assay and describe a rapid method for direct cell suspension PCR to quickly and easily screen samples for Campylobacter. We present a specific protocol which eliminates the need for time-consuming and expensive genomic DNA extractions and, using a high-processivity polymerase, demonstrate conclusive screening of samples in <1 h. Pyrosequencing results show the assay to be extremely (>99%) sensitive, and spike-back experiments demonstrated a detection threshold of <10(2) CFU mL(-1). Additionally, we present 2 newly designed broad-range bacterial primer sets targeting the 23S rRNA gene that have wide applicability as internal amplification controls. Empirical testing of putative taxon-specific assays using high-throughput sequencing is an important validation step that is now financially feasible for research, regulatory, or clinical applications. Published by Elsevier Inc.

Measurement of messenger RNA encoding the alpha-chain, polymeric immunoglobulin receptor, and J-chain in duodenal mucosa from dogs with and without chronic diarrhea by use of quantitative real-time reverse transcription-polymerase chain reaction assays.

PubMed

Peters, Iain R; Helps, Chris R; Calvert, Emma L; Hall, Edward J; Day, Michael J

2005-01-01

To examine the difference in expression of messenger RNA (mRNA) transcripts for polymeric immunoglobulin receptor (plgR), alpha-chain, and J-chain determined by use of quantitative real-time reverse transcription-polymerase chain reaction (QRT-PCR) assays in duodenal biopsy specimens obtained from dogs with and without chronic diarrhea. Biopsy specimens of the proximal portion of the duodenum were obtained endoscopically from 39 dogs evaluated because of chronic diarrhea (12 German Shepherd Dogs and 27 non-German Shepherd Dog breeds); specimens were also obtained from a control group of 7 dogs evaluated because of other gastrointestinal tract diseases and 2 dogs that were euthanatized as a result of nongastrointestinal tract disease. Dogs were anesthetized, and multiple mucosal biopsy specimens were obtained endoscopically at the level of the caudal duodenal flexure by use of biopsy forceps; in 2 control dogs, samples were obtained from the descending duodenum within 5 minutes of euthanasia. One-step QRT-PCR was used to quantify the level of expression of transcripts for the housekeeper gene glyceraldehyde-3-phosphate dehydrogenase, plgR, alpha-chain, and J-chain in duodenal mucosal tissue. There was no significant difference in the level of expression of any transcript among non-German Shepherd Dog breeds without diarrhea (control group), non-German Shepherd Dog breeds with chronic diarrhea, and German Shepherd Dogs with chronic diarrhea. Conclusions and Clinical Relevance-Results indicated that the susceptibility of German Shepherd Dogs to chronic diarrhea is not a result of simple failure of transcription of the key genes that encode molecules involved in mucosal IgA secretion.

Comprehensive characterization of glutamine synthetase-mediated selection for the establishment of recombinant CHO cells producing monoclonal antibodies.

PubMed

Noh, Soo Min; Shin, Seunghyeon; Lee, Gyun Min

2018-03-29

To characterize a glutamine synthetase (GS)-based selection system, monoclonal antibody (mAb) producing recombinant CHO cell clones were generated by a single round of selection at various methionine sulfoximine (MSX) concentrations (0, 25, and 50 μM) using two different host cell lines (CHO-K1 and GS-knockout CHO). Regardless of the host cell lines used, the clones selected at 50 μM MSX had the lowest average specific growth rate and the highest average specific production rates of toxic metabolic wastes, lactate and ammonia. Unlike CHO-K1, high producing clones could be generated in the absence of MSX using GS-knockout CHO with an improved selection stringency. Regardless of the host cell lines used, the clones selected at various MSX concentrations showed no significant difference in the GS, heavy chain, and light chain gene copies (P > 0.05). Furthermore, there was no correlation between the specific mAb productivity and these three gene copies (R 2  ≤ 0.012). Taken together, GS-mediated gene amplification does not occur in a single round of selection at a MSX concentration up to 50 μM. The use of the GS-knockout CHO host cell line facilitates the rapid generation of high producing clones with reduced production of lactate and ammonia in the absence of MSX.

Modulating the DNA polymerase β reaction equilibrium to dissect the reverse reaction

PubMed Central

Shock, David D.; Freudenthal, Bret D.; Beard, William A.; Wilson, Samuel H.

2017-01-01

DNA polymerases catalyze efficient and high fidelity DNA synthesis. While this reaction favors nucleotide incorporation, polymerases also catalyze a reverse reaction, pyrophosphorolysis, removing the DNA primer terminus and generating deoxynucleoside triphosphates. Since pyrophosphorolysis can influence polymerase fidelity and sensitivity to chain-terminating nucleosides, we analyzed pyrophosphorolysis with human DNA polymerase β and found the reaction to be inefficient. The lack of a thio-elemental effect indicated that it was limited by a non-chemical step. Utilizing a pyrophosphate analog, where the bridging oxygen is replaced with an imido-group (PNP), increased the rate of the reverse reaction and displayed a large thio-elemental effect indicating that chemistry was now rate determining. Time-lapse crystallography with PNP captured structures consistent with a chemical equilibrium that favored the reverse reaction. These results highlight the importance of the bridging atom between the β- and γ-phosphates of the incoming nucleotide in reaction chemistry, enzyme conformational changes, and overall reaction equilibrium. PMID:28759020

A movie of the RNA polymerase nucleotide addition cycle.

PubMed

Brueckner, Florian; Ortiz, Julio; Cramer, Patrick

2009-06-01

During gene transcription, RNA polymerase (Pol) passes through repetitive cycles of adding a nucleotide to the growing mRNA chain. Here we obtained a movie of the nucleotide addition cycle by combining structural information on different functional states of the Pol II elongation complex (EC). The movie illustrates the two-step loading of the nucleoside triphosphate (NTP) substrate, closure of the active site for catalytic nucleotide incorporation, and the presumed two-step translocation of DNA and RNA, which is accompanied by coordinated conformational changes in the polymerase bridge helix and trigger loop. The movie facilitates teaching and a mechanistic analysis of transcription and can be downloaded from http://www.lmb.uni-muenchen.de/cramer/pr-materials.

Space-to-Ground: Genes in Space: 04/13/2018

NASA Image and Video Library

2018-04-12

Can the Polymerase Chain Reaction be used to study DNA alterations on the International Space Station? NASA's Space to Ground is your weekly update on what's happening aboard the International Space Station.

EPA Scientists Develop Research Methods for Studying Mold Fact Sheet

EPA Pesticide Factsheets

In 2002, U.S. Environmental Protection Agency researchers developed a DNA-based Mold Specific Quantitative Polymerase Chain Reaction method (MSQPCR) for identifying and quantifying over 100 common molds and fungi.

Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland.

PubMed

Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw

2011-05-01

A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)

Biotechnical use of polymerase chain reaction for microbiological analysis of biological samples.

PubMed

Lantz, P G; Abu al-Soud, W; Knutsson, R; Hahn-Hägerdal, B; Rådström, P

2000-01-01

Since its introduction in the mid-80s, polymerase chain reaction (PCR) technology has been recognised as a rapid, sensitive and specific molecular diagnostic tool for the analysis of micro-organisms in clinical, environmental and food samples. Although this technique can be extremely effective with pure solutions of nucleic acids, it's sensitivity may be reduced dramatically when applied directly to biological samples. This review describes PCR technology as a microbial detection method, PCR inhibitors in biological samples and various sample preparation techniques that can be used to facilitate PCR detection, by either separating the micro-organisms from PCR inhibitors and/or by concentrating the micro-organisms to detectable concentrations. Parts of this review are updated and based on a doctoral thesis by Lantz [1] and on a review discussing methods to overcome PCR inhibition in foods [2].

Vanadium accelerates polymerase chain reaction and expands the applicability of forensic DNA testing.

PubMed

Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko

2013-05-01

Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Large pathogenic expansions in the SCA2 and SCA7 genes can be detected by fluorescent repeat-primed polymerase chain reaction assay.

PubMed

Cagnoli, Claudia; Stevanin, Giovanni; Michielotto, Chiara; Gerbino Promis, Giovanni; Brussino, Alessandro; Pappi, Patrizia; Durr, Alexandra; Dragone, Elisa; Viemont, Michelle; Gellera, Cinzia; Brice, Alexis; Migone, Nicola; Brusco, Alfredo

2006-02-01

Large expansions in the SCA2 and SCA7 genes (>100 CAG repeats) have been associated with juvenile and infantile forms of cerebellar ataxias that cannot be detected using standard polymerase chain reaction (PCR). Here, we describe a successful application of the fluorescent short tandem repeat-primed PCR method for accurate identification of these expanded repeats. The test is robust, reliable, and inexpensive and can be used to screen large series of patients, although it cannot give a precise evaluation of the size of the expansion. This test may be of practical value in prenatal diagnoses offered to affected or pre-symptomatic at-risk parents, in which a very large expansion inherited from one of the parents can be missed in the fetus by standard PCR.

Large Pathogenic Expansions in the SCA2 and SCA7 Genes Can Be Detected by Fluorescent Repeat-Primed Polymerase Chain Reaction Assay

PubMed Central

Cagnoli, Claudia; Stevanin, Giovanni; Michielotto, Chiara; Gerbino Promis, Giovanni; Brussino, Alessandro; Pappi, Patrizia; Durr, Alexandra; Dragone, Elisa; Viemont, Michelle; Gellera, Cinzia; Brice, Alexis; Migone, Nicola; Brusco, Alfredo

2006-01-01

Large expansions in the SCA2 and SCA7 genes (>100 CAG repeats) have been associated with juvenile and infantile forms of cerebellar ataxias that cannot be detected using standard polymerase chain reaction (PCR). Here, we describe a successful application of the fluorescent short tandem repeat-primed PCR method for accurate identification of these expanded repeats. The test is robust, reliable, and inexpensive and can be used to screen large series of patients, although it cannot give a precise evaluation of the size of the expansion. This test may be of practical value in prenatal diagnoses offered to affected or pre-symptomatic at-risk parents, in which a very large expansion inherited from one of the parents can be missed in the fetus by standard PCR. PMID:16436644

Tuberculous otitis media: a resurgence?

PubMed

Kameswaran, M; Natarajan, K; Parthiban, M; Krishnan, P V; Raghunandhan, S

2017-09-01

Tuberculosis is a global health problem that is especially prevalent in developing countries such as India. Recently, atypical presentation has become more common and a high index of suspicion is essential. This study analysed the various presenting symptoms and signs of tuberculous otitis media and the role of diagnostic tests, with the aim of formulating criteria for the diagnosis. A total of 502 patients underwent tympanomastoidectomy over a two-year period. Microbiological and histopathological examinations and polymerase chain reaction analysis of tissue taken during tympanomastoidectomy were performed. A total of 25 patients (5 per cent) were diagnosed with tuberculous otitis media. Severe mixed hearing loss, facial palsy, labyrinthine fistula, post-aural fistula, perichondritis and extradural abscess were noted. There seems to be a resurgence in tuberculous otitis media in India. Microbiological, histopathological and polymerase chain reaction tests for tuberculosis are helpful for its diagnosis.

Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

PubMed

Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

2008-12-01

One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

[Polymerase chain reaction applied for detection of Toxoplasma gondii in lymph nodes].

PubMed

Liu, C; Ouyang, K; Tan, D

1998-01-01

In order to investigate the morbidity of toxoplasmic lymphadenitis, polymerase chain reaction (PCR) was used to detect DNA of Toxoplasma gondii within lymph nodes in 3 groups of 120 patients with different diseases. After extracting the DNA of each sample, PCR was employed to amplify toxoplasma DNA. The results showed that the amplification product of 210 bp was confirmed in 7 patients: 3 cases of Hodgkin's disease (HD), 2 cases of non-Hodgkin's lymphoma (NHL) and 2 cases of chronic lymphadenitis (CL). Each PCR product was then subjected to Southern blot hybridization. Besides the 7 cases proved by PCR, 1 case of CL was found positive. The positive percentages of HD, NHL and CL were 9.38% (3/32), 4.88% (2/41), and 6.38% (3/47), respectively. The total positive rate was 6.67% (8/120).

Advances in digital polymerase chain reaction (dPCR) and its emerging biomedical applications.

PubMed

Cao, Lei; Cui, Xingye; Hu, Jie; Li, Zedong; Choi, Jane Ru; Yang, Qingzhen; Lin, Min; Ying Hui, Li; Xu, Feng

2017-04-15

Since the invention of polymerase chain reaction (PCR) in 1985, PCR has played a significant role in molecular diagnostics for genetic diseases, pathogens, oncogenes and forensic identification. In the past three decades, PCR has evolved from end-point PCR, through real-time PCR, to its current version, which is the absolute quantitive digital PCR (dPCR). In this review, we first discuss the principles of all key steps of dPCR, i.e., sample dispersion, amplification, and quantification, covering commercialized apparatuses and other devices still under lab development. We highlight the advantages and disadvantages of different technologies based on these steps, and discuss the emerging biomedical applications of dPCR. Finally, we provide a glimpse of the existing challenges and future perspectives for dPCR. Copyright © 2016 Elsevier B.V. All rights reserved.

Norrie disease in a family with a manifesting female carrier.

PubMed

Sims, K B; Irvine, A R; Good, W V

1997-04-01

To show that Norrie disease can occur in a girl and to describe her ophthalmologic and genetic features. Amplification of DNA polymerase chain reaction and sequencing of asymmetric polymerase chain reaction for exon 3 were performed on the blood specimen obtained from a girl born with bilateral retinal detachments. A female child with bilateral retinal detachment who had 2 uncles in whom Norrie disease had already been diagnosed. The child had a mutation in the third exon (T776-->A; Ile 123-->Asn) identical to the mutation found in her uncles. Norrie disease can occur in girls. The most likely explanation is nonrandom or unfavorable X inactivation, although timing of development of the peripheral retina and its blood supply could render it vulnerable to effects of the mutant allele at a critical developmental phase.

Development of the polymerase chain reaction for diagnosis of chancroid.

PubMed Central

Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

1993-01-01

The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

NASA Astrophysics Data System (ADS)

Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen S.; Skov, Julia; Sun, Yi; Duong Bang, Dang; Pedersen, Michael E.; Hansen, Mikkel F.; Wolff, Anders

2013-07-01

We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence signal from Rhodamine B. The method was validated with the PCR amplification of mecA gene (162 bp) from methicillin-resistant Staphylococcus aureus bacterium (MRSA), where the time for 30 cycles was reduced from 50 min (without over- and undershooting) to 20 min.

Absence of giant blood Marseille-like virus DNA detection by polymerase chain reaction in plasma from healthy US blood donors and serum from multiply transfused patients from Cameroon.

PubMed

Phan, Tung Gia; Desnues, Christelle; Switzer, William M; Djoko, Cyrille F; Schneider, Bradley S; Deng, Xutao; Delwart, Eric

2015-06-01

A new Marseilleviridae virus family member, giant blood Marseille-like (GBM) virus, was recently reported in persons from France in the serum of an infant with adenitis, in the blood of 4% of healthy blood donors, and in 9% of multiply transfused thalassemia patients. These results suggested the presence of a nucleocytoplasmic large DNA virus potentially transmissible by blood product transfusion. To investigate this possibility we tested the plasma from 113 US blood donors and 74 multiply transfused Cameroon patients for GBM viral DNA using highly sensitive polymerase chain reaction (PCR) assays. GBM DNA was not detected by nested PCR in any of these 187 human specimens. Further testing is required to confirm the occurrence of human GBM virus infections. © 2015 AABB.

Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

PubMed

Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

2010-06-01

Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons <150 base pairs) of the mitochondrial 12S rRNA gene, and an endogenous control primer pair that amplifies a 141-bp fragment of the nuclear 18S rRNA gene from eukaryotic DNA. Analysis of experimental raw and heat-treated binary mixtures as well as of commercial meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

DOEpatents

Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

2001-01-01

Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

A novel polymerase chain reaction (PCR) - denaturing gradient gel electrophoresis (DGGE) for the identification of Micrococcaceae strains involved in meat fermentations. Its application to naturally fermented Italian sausages.

PubMed

Cocolin, L; Manzano, M; Aggio, D; Cantoni, C; Comi, G

2001-05-01

A new molecular method consisting of polymerase chain reaction (PCR) amplification and denaturing gradient gel electrophoresis (DGGE) of a small fragment from the 16S rRNA gene identified the Micrococcaceae strains isolated from natural fermented Italian sausages. Lactic acid bacteria, total aerobic mesophilic flora, Enterobacteriaceae and faecal enterococci were also monitored. Micrococcaceaea control strains from international collections were used to optimise the method and 90 strains, isolated from fermented sausages, were identified by biochemical tests and PCR-DGGE. No differences were observed between the methods used. The results reported in this paper prove that Staphylococcus xylosus is the main bacterium involved in fermented sausage production, representing, from the tenth day of ripening, the only Micrococcaceaea species isolated.

High-throughput amplification of mature microRNAs in uncharacterized animal models using polyadenylated RNA and stem-loop reverse transcription polymerase chain reaction.

PubMed

Biggar, Kyle K; Wu, Cheng-Wei; Storey, Kenneth B

2014-10-01

This study makes a significant advancement on a microRNA amplification technique previously used for expression analysis and sequencing in animal models without annotated mature microRNA sequences. As research progresses into the post-genomic era of microRNA prediction and analysis, the need for a rapid and cost-effective method for microRNA amplification is critical to facilitate wide-scale analysis of microRNA expression. To facilitate this requirement, we have reoptimized the design of amplification primers and introduced a polyadenylation step to allow amplification of all mature microRNAs from a single RNA sample. Importantly, this method retains the ability to sequence reverse transcription polymerase chain reaction (RT-PCR) products, validating microRNA-specific amplification. Copyright © 2014 Elsevier Inc. All rights reserved.

Real-time quantitative polymerase chain reaction methods for four genetically modified maize varieties and maize DNA content in food.

PubMed

Brodmann, Peter D; Ilg, Evelyn C; Berthoud, Hélène; Herrmann, Andre

2002-01-01

Quantitative detection methods are needed for enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients. This labeling threshold, which is set to 1% in the European Union and Switzerland, must be applied to all approved GMOs. Four different varieties of maize are approved in the European Union: the insect-resistant Bt176 maize (Maximizer), Btl 1 maize, Mon810 (YieldGard) maize, and the herbicide-tolerant T25 (Liberty Link) maize. Because the labeling must be considered individually for each ingredient, a quantitation system for the endogenous maize content is needed in addition to the GMO-specific detection systems. Quantitative real-time polymerase chain reaction detection methods were developed for the 4 approved genetically modified maize varieties and for an endogenous maize (invertase) gene system.

[Development of molecular detection of food-borne pathogenic bacteria using miniaturized microfluidic devices].

PubMed

Iván, Kristóf; Maráz, Anna

2015-12-20

Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification - most frequently real-time polymerase chain reaction - methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple - often automated - use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors' research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria.

Clinical characteristics of children with viral single- and co-infections and a petechial rash.

PubMed

Schneider, Henriette; Adams, Ortwin; Weiss, Christel; Merz, Ulrich; Schroten, Horst; Tenenbaum, Tobias

2013-05-01

Children with petechial rash are more likely to undergo invasive diagnostics, to be treated with antibiotics for potential bacterial infection and to be hospitalized. However, viruses have also been associated with petechial rash. Nonetheless, a systematic analysis of viral infections with modern available techniques as quantitative real-time polymerase chain reaction in the context of petechial rash is lacking. The purpose of this pediatric study was to prospectively uncover viral pathogens that may promote the emergence of petechiae and to analyze the correlation with the clinical characteristics and course. We conducted a prospective study in children (0 to 18 years) presenting with petechiae and signs or symptoms of infection at the emergency department between November 2009 and March 2012. In nasopharyngeal aspirates the following viruses were analyzed by quantitative real-time polymerase chain reaction: cytomegalovirus, Epstein-Barr virus, parvovirus B19, influenza A and B, parainfluenza viruses, human respiratory syncytial virus A and B, human metapneumovirus, rhinovirus, enterovirus, adenovirus, human coronavirus OC43, 229E, NL63 and human bocavirus. A viral pathogen was identified in 67% of the analyzed 58 cases with petechial rash. Virus positive patients showed a significantly higher incidence of lower respiratory tract infections. Forty-one percent were viral coinfections, which were significantly younger than virus negative patients, had a higher leukocyte count and were hospitalized for a longer time. A petechial rash is frequently associated viral single- and coinfections and can rapidly be identified via quantitative real-time polymerase chain reaction.

Prevalence of Sexually Transmitted Diseases in Asymptomatic Renal Transplant Recipients.

PubMed

Sarier, Mehmet; Sepin Ozen, Nevgun; Guler, Hicran; Duman, Ibrahim; Yüksel, Yücel; Tekin, Sabri; Yavuz, Asuman Havva; Yucetin, Levent; Erdogan Yilmaz, Mine

2018-04-04

Sexually transmitted diseases, which may be asymptomatic, have the potential to cause serious health problems in renal transplant recipients. The aim of this study was to determine the prevalence of sexually transmitted diseases in sexually active asymptomatic renal transplant patients by using real-time multiplex polymerase chain reaction assays. This prospective controlled study was conducted between November 2016 and January 2017 in our hospital. Our study group included 80 consecutive, sexually active asymptomatic patients (40 men and 40 women) who had undergone renal transplant in our hospital and who presented to our outpatient clinic for routine follow-up. We also included a control group of 80 consecutive, sexually active nontransplant patients (40 men and 40 women). All patient samples were tested for Gardnerella vaginalis and obligate anaerobes (Prevotella bivia, Porphyromonas species), Candida species, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma species, Trichomonas vaginalis, Neisseria gonorrhoeae, Chlamydia trachomatis, herpes simplex virus 1 and 2, and Cytomegalovirus by real-time multiplex polymerase chain reaction. The prevalences of infection with Gardnerella vaginalis and obligate anaerobes (P = .043), Ureaplasma species (P = .02), and Cytomegalovirus (P = .016) were found to be significantly higher in the study group versus the control group. However, there was no difference between the 2 groups regarding the prevalence of Mycoplasma infection (P = .70). Sexually transmitted diseases may occur more frequently in sexually active asymptomatic renal transplant recipients than in nontransplanted individuals. Real-time multiplex polymerase chain reaction analysis may be a suitable method for determining these pathogens.

Granulomatous herpes simplex encephalitis in an infant with multicystic encephalopathy: a distinct clinicopathologic entity?

PubMed

Schutz, Peter W; Fauth, Clarissa T; Al-Rawahi, Ghada N; Pugash, Denise; White, Valerie A; Stockler, Sylvia; Dunham, Christopher P

2014-04-01

Herpes simplex virus encephalitis can manifest as a range of clinical presentations including classic adult, neonatal, and biphasic chronic-granulomatous herpes encephalitis. We report an infant with granulomatous herpes simplex virus type 2 encephalitis with a subacute course and multicystic encephalopathy. A 2-month-old girl presented with lethargy and hypothermia. Computed tomography scan of the head showed multicystic encephalopathy and calcifications. Cerebrospinal fluid analysis by polymerase chain reaction testing for herpes simplex virus 1 and 2, enterovirus, and cytomegalovirus was negative. Normal cerebrospinal fluid interferon-α levels argued against Aicardi-Goutières syndrome. The patient died 2 weeks after presentation. At autopsy, multicystic encephalopathy was confirmed with bilateral gliosis, granulomatous inflammation with multinucleated giant cells, and calcifications. Bilateral healing necrotizing retinitis suggested a viral etiology, but retina and brain were free of viral inclusions and immunohistochemically negative for herpes simplex virus-2 and cytomegalovirus. However, polymerase chain reaction analysis showed herpes simplex virus-2 DNA in four cerebral paraffin blocks. Subsequent repeat testing of the initial cerebrospinal fluid sample using a different polymerase chain reaction assay was weakly positive for herpes simplex virus-2 DNA. Granulomatous herpes simplex virus encephalitis in infants can present with subacute course and result in multicystic encephalopathy with mineralization and minimal cerebrospinal fluid herpes simplex virus DNA load. Infectious etiologies should be carefully investigated in the differential diagnosis of multicystic encephalopathy with mineralization, in particular if multinucleated giant cells are present. Copyright © 2014 Elsevier Inc. All rights reserved.

Molecular testing for familial hypercholesterolaemia-associated mutations in a UK-based cohort: development of an NGS-based method and comparison with multiplex polymerase chain reaction and oligonucleotide arrays.

PubMed

Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K

2016-11-01

Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.

Single polysaccharide assembly protein that integrates polymerization, termination, and chain-length quality control

PubMed Central

Williams, Danielle M.; Ovchinnikova, Olga G.; Koizumi, Akihiko; Mainprize, Iain L.; Kimber, Matthew S.; Lowary, Todd L.

2017-01-01

Lipopolysaccharides (LPS) are essential outer membrane glycolipids in most gram-negative bacteria. Biosynthesis of the O-antigenic polysaccharide (OPS) component of LPS follows one of three widely distributed strategies, and similar processes are used to assemble other bacterial surface glycoconjugates. This study focuses on the ATP-binding cassette (ABC) transporter-dependent pathway, where glycans are completed on undecaprenyl diphosphate carriers at the cytosol:membrane interface, before export by the ABC transporter. We describe Raoultella terrigena WbbB, a prototype for a family of proteins that, remarkably, integrates several key activities in polysaccharide biosynthesis into a single polypeptide. WbbB contains three glycosyltransferase (GT) modules. Each of the GT102 and GT103 modules characterized here represents a previously unrecognized GT family. They form a polymerase, generating a polysaccharide of [4)-α-Rhap-(1→3)-β-GlcpNAc-(1→] repeat units. The polymer chain is terminated by a β-linked Kdo (3-deoxy-d-manno-oct-2-ulosonic acid) residue added by a third GT module belonging to the recently discovered GT99 family. The polymerase GT modules are separated from the GT99 chain terminator by a coiled-coil structure that forms a molecular ruler to determine product length. Different GT modules in the polymerase domains of other family members produce diversified OPS structures. These findings offer insight into glycan assembly mechanisms and the generation of antigenic diversity as well as potential tools for glycoengineering. PMID:28137848

Studies on sex-organ development. Changes in chromatin structure during spermatogenesis in maturing rooster testis as demonstrated by the initiation pattern of ribonucleic acid synthesis in vitro.

PubMed Central

Mezquita, C; Teng, C S

1978-01-01

To probe the structural change in the genome of the differentiating germ cell of the maturing rooster testis, the chromatin from nuclei at various stages of differentiation were transcribed with prokaryotic RNA polymerase from Escherichia coli or with eukaryotic RNA polymerase II from wheat germ. The transcription was performed under conditions of blockage of RNA chain reinitiation in vitro with rifampicin or rifampicin AF/013. With the E. coli enzyme, the changes in (1) the titration curve for the enzyme-chromatin interaction, (2) the number of initiation sites, (3) the rate of elongation of RNA chains, and (4) the kinetics of the formation of stable initiation complexes revealed the unmasking of DNA in elongated spermatids and the masking of DNA in spermatozoa. In both cases the stability of the DNA duplex in the initiation region for RNA synthesis greatly increased. In contrast with the E. coli enzyme, the wheat-germ RNA polymerase II was relatively inefficient at transcribing chromatin of elongated spermatids. Such behaviour can be predicted if unmasked double-stranded DNA is present in elongated spermatids. PMID:346018

Gene 1.7 of bacteriophage T7 confers sensitivity of phage growth to dideoxythymidine.

PubMed

Tran, Ngoc Q; Rezende, Lisa F; Qimron, Udi; Richardson, Charles C; Tabor, Stanley

2008-07-08

Bacteriophage T7 DNA polymerase efficiently incorporates dideoxynucleotides into DNA, resulting in chain termination. Dideoxythymidine (ddT) present in the medium at levels not toxic to Escherichia coli inhibits phage T7. We isolated 95 T7 phage mutants that were resistant to ddT. All contained a mutation in T7 gene 1.7, a nonessential gene of unknown function. When gene 1.7 was expressed from a plasmid, T7 phage resistant to ddT still arose; analysis of 36 of these mutants revealed that all had a single mutation in gene 5, which encodes T7 DNA polymerase. This mutation changes tyrosine-526 to phenylalanine, which is known to increase dramatically the ability of T7 DNA polymerase to discriminate against dideoxynucleotides. DNA synthesis in cells infected with wild-type T7 phage was inhibited by ddT, suggesting that it resulted in chain termination of DNA synthesis in the presence of gene 1.7 protein. Overexpression of gene 1.7 from a plasmid rendered E. coli cells sensitive to ddT, indicating that no other T7 proteins are required to confer sensitivity to ddT.

Stringency of workplace air contaminant exposure limits: a case study of OSHA risk management.

PubMed

Hakes, J K

1999-12-01

Political context may play a large role in influencing the efficiency of environmental and health regulations. This case study uses data from a 1989 update of the Occupational Safety and Health Administration (OSHA) Permissible Exposure Limits (PELs) program to determine the relative effects of legislative mandates, costly acquisition of information by the agency, and pressure applied by special interest groups upon exposure standards. The empirical analysis suggests that federal agencies successfully thwart legislative attempts to limit agency discretion, and that agencies exercise bounded rationality by placing greater emphasis on more easily obtained information. The 1989 PELs were less significantly related to more costly information, contained "safety factors" for chemicals presenting relatively more ambiguous risks, and the proposed standard stringencies showed evidence of being influenced by vying industry and labor interests.

In Vitro Lesion Bypass Studies of O(4)-Alkylthymidines with Human DNA Polymerase η.

PubMed

Williams, Nicole L; Wang, Pengcheng; Wu, Jiabin; Wang, Yinsheng

2016-04-18

Environmental exposure and endogenous metabolism can give rise to DNA alkylation. Among alkylated nucleosides, O(4)-alkylthymidine (O(4)-alkyldT) lesions are poorly repaired in mammalian systems and may compromise the efficiency and fidelity of cellular DNA replication. To cope with replication-stalling DNA lesions, cells are equipped with translesion synthesis DNA polymerases that are capable of bypassing various DNA lesions. In this study, we assessed human DNA polymerase η (Pol η)-mediated bypass of various O(4)-alkyldT lesions, with the alkyl group being Me, Et, nPr, iPr, nBu, iBu, (R)-sBu, or (S)-sBu, in template DNA by conducting primer extension and steady-state kinetic assays. Our primer extension assay results revealed that human Pol η, but not human polymerases κ and ι or yeast polymerase ζ, was capable of bypassing all O(4)-alkyldT lesions and extending the primer to generate full-length replication products. Data from steady-state kinetic measurements showed that Pol η preferentially misincorporated dGMP opposite O(4)-alkyldT lesions with a straight-chain alkyl group. The nucleotide misincorporation opposite most lesions with a branched-chain alkyl group was, however, not selective, where dCMP, dGMP, and dTMP were inserted at similar efficiencies opposite O(4)-iPrdT, O(4)-iBudT, and O(4)-(R)-sBudT. These results provide important knowledge about the effects of the length and structure of the alkyl group in O(4)-alkyldT lesions on the fidelity and efficiency of DNA replication mediated by human Pol η.

NMR solution structure of poliovirus uridylyated peptide linked to the genome (VPgpU)

PubMed Central

Schein, Catherine H.; Oezguen, Numan; van der Heden van Noort, Gerbrand J.; Filippov, Dmitri V.; Paul, Aniko; Kumar, Eric; Braun, Werner

2010-01-01

Picornaviruses have a 22–24 amino acid peptide, VPg, bound covalently at the 5’ end of their RNA, that is essential for replication. VPgs are uridylylated at a conserved Tyrosine to form VPgpU, the primer of RNA synthesis by the viral polymerase. This first complete structure for any uridylylated VPg, of poliovirus type 1 (PV1)-VPgpU, shows that conserved amino acids in VPg stabilize the bound UMP, with the uridine atoms involved in base pairing and chain elongation projected outward. Comparing this structure to PV1-VPg and partial structures of VPg/VPgpU from other picornaviruses suggests that enteroviral polymerases require a more stable VPg structure than does the distantly related aphthovirus, foot and mouth disease virus (FMDV). The glutamine residue at the C-terminus of PV1-VPgpU lies in back of the uridine base and may stabilize its position during chain elongation and/or contribute to base specificity. Under in vivo-like conditions with the authentic cre(2C) hairpin RNA and Mg++, 5-methylUTP cannot compete with UTP for VPg uridylyation in an in vitro uridylyation assay, but both nucleotides are equally incorporated by PV1-polymerase with Mn++ and a poly-A RNA template. This indicates the 5 position is recognized under in vivo conditions. The compact VPgpU structure docks within the active site cavity of the PV-polymerase, close to the position seen for the fragment of FMDV-VPgpU with its polymerase. This structure could aid in design of novel enterovirus inhibitors, and stabilization upon uridylylation may also be pertinent for post-translational uridylylation reactions that underlie other biological processes. PMID:20441784

Characterization of an Avipoxvirus From a Bald Eagle ( Haliaeetus leucocephalus ) Using Novel Consensus PCR Protocols for the rpo147 and DNA-Dependent DNA Polymerase Genes.

PubMed

Stephen, Alexa A; Leone, Angelique M; Toplon, David E; Archer, Linda L; Wellehan, James F X

2016-12-01

A juvenile female bald eagle ( Haliaeetus leucocephalus ) was presented with emaciation and proliferative periocular lesions. The eagle did not respond to supportive therapy and was euthanatized. Histopathologic examination of the skin lesions revealed plaques of marked epidermal hyperplasia parakeratosis, marked acanthosis and spongiosis, and eosinophilic intracytoplasmic inclusion bodies. Novel polymerase chain reaction (PCR) assays were done to amplify and sequence DNA polymerase and rpo147 genes. The 4b gene was also analyzed by a previously developed assay. Bayesian and maximum likelihood phylogenetic analyses of the obtained sequences found it to be poxvirus of the genus Avipoxvirus and clustered with other raptor isolates. Better phylogenetic resolution was found in rpo147 rather than the commonly used DNA polymerase. The novel consensus rpo147 PCR assay will create more accurate phylogenic trees and allow better insight into poxvirus history.

Initiation, extension, and termination of RNA synthesis by a paramyxovirus polymerase.

PubMed

Jordan, Paul C; Liu, Cheng; Raynaud, Pauline; Lo, Michael K; Spiropoulou, Christina F; Symons, Julian A; Beigelman, Leo; Deval, Jerome

2018-02-01

Paramyxoviruses represent a family of RNA viruses causing significant human diseases. These include measles virus, the most infectious virus ever reported, in addition to parainfluenza virus, and other emerging viruses. Paramyxoviruses likely share common replication machinery but their mechanisms of RNA biosynthesis activities and details of their complex polymerase structures are unknown. Mechanistic and functional details of a paramyxovirus polymerase would have sweeping implications for understanding RNA virus replication and for the development of new antiviral medicines. To study paramyxovirus polymerase structure and function, we expressed an active recombinant Nipah virus (NiV) polymerase complex assembled from the multifunctional NiV L protein bound to its phosphoprotein cofactor. NiV is an emerging highly pathogenic virus that causes severe encephalitis and has been declared a global public health concern due to its high mortality rate. Using negative-stain electron microscopy, we demonstrated NiV polymerase forms ring-like particles resembling related RNA polymerases. We identified conserved sequence elements driving recognition of the 3'-terminal genomic promoter by NiV polymerase, and leading to initiation of RNA synthesis, primer extension, and transition to elongation mode. Polyadenylation resulting from NiV polymerase stuttering provides a mechanistic basis for transcription termination. It also suggests a divergent adaptation in promoter recognition between pneumo- and paramyxoviruses. The lack of available antiviral therapy for NiV prompted us to identify the triphosphate forms of R1479 and GS-5734, two clinically relevant nucleotide analogs, as substrates and inhibitors of NiV polymerase activity by delayed chain termination. Overall, these findings provide low-resolution structural details and the mechanism of an RNA polymerase from a previously uncharacterized virus family. This work illustrates important functional differences yet remarkable similarities between the polymerases of nonsegmented negative-strand RNA viruses.

Acoustic flight test of the Piper Lance

DOT National Transportation Integrated Search

1986-12-01

Research is being conducted to refine current noise regulation of propeller-driven small airplanes. Studies are examining the prospect of a substituting a takeoff procedure of equal stringency for the level flyover certification test presently requir...

Role of disulfide bridges in archaeal family-B DNA polymerases.

PubMed

Killelea, Tom; Connolly, Bernard A

2011-06-14

The family-B DNA polymerases obtained from the order Thermococcales, for example, Pyrococcus furiosus (Pfu-Pol) are commonly used in the polymerase chain reaction (PCR) because of their high thermostability and low error rates. Most of these polymerases contain four cysteines, arranged as two disulfide bridges. With Pfu-Pol C429-C443 forms one of the disulfides (DB1) and C507-C510 (DB2) the other. Although the disulfides are well conserved in the enzymes from the hyperthermophilic Thermococcales, they are less prevalent in euryarchaeal polymerases from other orders, and tend to be only found in other hyperthermophiles. Here, we report on the effects of deleting the disulfide bridges by mutating the relevant cysteines to serines. A variety of techniques, including differential scanning calorimetry and differential scanning fluorimetry, have shown that both disulfides make a contribution to thermostability, with DB1 being more important than DB2. However, even when both disulfides are removed, sufficient thermostability remains for normal (identical to the wild type) performance in PCR and quantitative (real-time) PCR. Therefore, polymerases totally lacking cysteine are fully compatible with most PCR-based applications. This observation opens the way to further engineering of polymerases by introduction of a single cysteine followed by appropriate chemical modification. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

MAMMALIAN DNA IN PCR REAGENTS

EPA Science Inventory

Ancient DNA analysis is becoming widespread. These studies use polymerase chain reaction (PCR) to amplify minute quantities of heavily damaged template. Unusual steps are taken to achieve the sensitivity necessary to detect ancient DNA, including high- cycle PCR amplification t...

Validation of a polymerase chain reaction aided transcript titration assay (PATTY) for topoisomerase II in lung cancer samples.

PubMed

Dingemans, A M; Van Ark-Otte, J; Smit, E F; Postmus, P E; Giaccone, G

This report describes the validation of a polymerase chain reaction aided transcript titration assay (PATTY) for tumor samples. The results obtained with the PATTY were compared to those of RNase protection in a set of 7 human lung cancer cell lines and in 23 non-small cell lung cancer samples derived from resected patients. Whereas between PATTY and RNase protection assay a good correlation was observed in the cell lines (r = 0.74, p = 0.057), no correlation was observed within the tumor samples (r = 0.06, p = 0.78). This was also the case when only tumors with a high percentage of tumor cells (> 90%) were selected. Although PATTY is a valuable tool to measure mRNA expression in cell lines, our results caution the use of PATTY in human tumor samples without proper validation. The possible causes of these results are discussed.

[The development and implementation of polymerase chain reaction to detect in real-time operation mode yersinia pestis in field material].

PubMed

Afanas'ev, M V; Chipanin, E V; Shestakov, V E; Denisov, A V; Fomina, L A; Ostiak, A S; Balakhonov, S V

2013-03-01

The article presents the results of development and practical implementation of system of polymerase chain reaction testing in real-time operation mode to detect agent of plague infield material. In laboratory conditions the system demonstrated good results and hence it was applied in conditions of field laboratory of epidemiologic team during planned epizootologic examination of Gorno-Altaisk hot spot of plague. The sampling consisted of more than 1400 objects. It was demonstrated that high sensitivity and specificity is immanent to proposed system. The adaptation of the system to the real time amplifier "Smart Cycler" (Cephid, USA) having some specific technical characteristics makes it possible to consider the proposed test-system as an effective sensitive and precise instrument for screening studies in the process of regular epizootologic examinations of hot spots of plague.

Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

PubMed

Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

2013-01-01

A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

Simultaneous detection of hemagglutinin and neuraminidase genes of novel influenza A (H7N9) by duplex real-time reverse transcription polymerase chain reaction.

PubMed

Li, Yan; Wu, Tao; Qi, Xian; Ge, Yiyue; Guo, Xiling; Wu, Bin; Yu, Huiyan; Zhu, Yefei; Shi, Zhiyang; Wang, Hua; Cui, Lunbiao; Zhou, Minghao

2013-12-01

A novel reassortant influenza A (H7N9) virus emerged recently in China. In this study, a duplex real-time reverse transcription polymerase chain reaction (rRT-PCR) assay was developed for the simultaneous detection of hemagglutinin (HA) and neuraminidase (NA) genes of H7N9 influenza viruses. The sensitivity of the assay was determined to be 10 RNA copies per reaction for both HA and NA genes. No cross-reactivity was observed with other influenza virus subtypes or respiratory tract viruses. One hundred and forty-six clinical and environmental specimens were tested and compared with reference methods and were found to be consistent. The assay is suitable for large-scale screening due to short turnaround times and high specificity, sensitivity, and reproducibility. Copyright © 2013 Elsevier B.V. All rights reserved.

Detection and genotyping of bovine diarrhea virus by reverse transcription-polymerase chain amplification of the 5' untranslated region.

PubMed

Letellier, C; Kerkhofs, P; Wellemans, G; Vanopdenbosch, E

1999-01-01

A reverse-transcription polymerase chain reaction (RT-PCR) was developed to differentiate the bovine diarrhea virus (BVDV) from other pestiviruses, and to determine the genotype of the BVDV isolates. For this purpose, primer pairs were selected in the 5' untranslated region (5'UTR). The primers BE and B2 were located in highly conserved regions and were pestivirus-specific. Two primer pairs named B3B4 and B5B6 were specific of BVDV genotypes I and II, respectively. With this technique, an amplification product of the expected size was obtained with either the B3B4 or the B5B6 primer pairs for the 107 BVDV isolates tested but not for BDV or CSFV. For some isolates that were grouped in the genotype II, sequence analysis of the PCR fragments confirmed their classification into this genotype.

Successful treatment of toxoplasmic encephalitis diagnosed early by polymerase chain reaction after allogeneic hematopoietic stem cell transplantation: two case reports and review of the literature.

PubMed

Miyagi, T; Itonaga, H; Aosai, F; Taguchi, J; Norose, K; Mochizuki, K; Fujii, H; Furumoto, A; Ohama, M; Karimata, K; Yamanoha, A; Taniguchi, H; Sato, S; Taira, N; Moriuchi, Y; Fukushima, T; Masuzaki, H; Miyazaki, Y

2015-08-01

Toxoplasmic encephalitis represents a rare, but often fatal infection after allogeneic hematopoietic stem cell transplantation. Polymerase chain reaction (PCR)-based preemptive therapy is considered promising for this disease, but is not routinely applied, especially in low seroprevalence countries including Japan. We encountered 2 cases of toxoplasmic encephalitis after transplantation that were successfully treated. The diagnosis of toxoplasmic encephalitis in these cases was confirmed by PCR testing when neurological symptoms were observed. Both patients received pyrimethamine and sulfadiazine treatments within 2 weeks of the development of neurological symptoms, and remained free of recurrence for 32 and 12 months. These results emphasized the importance of the PCR test and immediate treatment after diagnosis for the management of toxoplasmic encephalitis. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Polymerase chain reaction: A molecular diagnostic tool in periodontology

PubMed Central

Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

2016-01-01

This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

Removal of inhibitor(s) of the polymerase chain reaction from formalin fixed, paraffin wax embedded tissues.

PubMed

An, S F; Fleming, K A

1991-11-01

A problem associated with use of the polymerase chain reaction to amplify specific DNA fragments from formalin fixed, paraffin wax embedded tissues is the not infrequent failure of amplification. One possible reason for this could be the presence of inhibitor(s), which interfere with the activity of the reaction. It has been shown that such inhibitor(s) exist when amplifying the human beta globin gene (which exists in human genomic DNA as a single copy gene) from routine clinical samples. A variety of methods to remove such inhibitor(s) were investigated. The results indicate that inhibitor(s) are removed by proteinase K digestion, followed by purification with phenol/chloroform, and centrifugation through a Centricon-30 membrane (30,000 molecular weight cut off). Other factors, including the length and concentration of the DNA sequence to be amplified, can also affect amplification.

Detection of human papillomaviruses type 16, 18 and 33 in bronchial aspirates of lung carcinoma patients by polymerase chain reaction: a study of 84 cases in Croatia.

PubMed

Branica, Bozica Vrabec; Smojver-Jezek, Silvana; Juros, Zrinka; Grgić, Sandra; Srpak, Nives; Mitrecić, Dinko; Gajović, Srećko

2010-03-01

Besides its well-known role in cervical carcinoma, HPV is also suggested to be involved in lung cancer development. A number of authors have been investigating the presence of HPV in histological materials. We used routine bronchial aspirates from 84 patients with lung carcinoma for DNA extraction and then performed polymerase chain reaction for high-risk HPV types 16, 18 and 33. The results were compared to those obtained from buccal and eyelid mucosa. Only three patients were positive for HPV in bronchial aspirates: one for HPV 16 type, one for HPV 18 type, and one for HPV 33. Our data indicated the low prevalence of HPV in patients with lung carcinomas in Croatia, therefore it seems unlikely that HPV contributes to the development of lung carcinomas in this region.

Detection of human Pneumocystis carinii by the polymerase chain reaction.

PubMed

Becker-Hapak, M; Liberator, P; Graves, D

1991-01-01

Oligonucleotide primers were prepared from a clone (B12) which has been shown to be a repetitive sequence in the rat P. carinii genome. Polymerase chain reaction was employed to amplify both rat and human P. carinii DNA. The detection limit of the assay was approximately 600 ng of total nucleic acid. Amplification products from both the rat and human isolates (ca. 780 bp) were characterized by denaturing gradient gel electrophoresis after digestion with Sau3A. No amplification products were obtained when DNA from the following potential pulmonary pathogens were used in identical reactions: Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Mycobacterium avium-intracellulare and cytomegalovirus. In a blind study using the B12 primers, P. carinii DNA was successfully amplified in clinical samples which were positive by direct immunofluorescence assay (IFA) as well as in some specimens not identified by direct IFA.

Aspergillus vertebral osteomyelitis in chronic leukocyte leukemia patient diagnosed by a novel panfungal polymerase chain reaction method.

PubMed

Dayan, Lior; Sprecher, Hannah; Hananni, Amos; Rosenbaum, Hana; Milloul, Victor; Oren, Ilana

2007-01-01

Vertebral osteomyelitis and disciitis caused by Aspergillus spp is a rare event. Early diagnosis and early antifungal therapy are critical in improving the prognosis for these patients. The diagnosis of invasive fungal infections is, in many cases, not straightforward and requires invasive procedures so that histological examination and culture can be performed. Furthermore, current traditional microbiological tests (ie, cultures and stains) lack the sensitivity for diagnosis of invasive aspergillosis. To present a case of vertebral osteomyelitis caused by Aspergillus spp diagnosed using a novel polymerase chain reaction (PCR) assay. Case report. Aspergillus DNA was detected in DNA extracted from the necrotic bone tissue by using a "panfungal" PCR novel method. Treatment with voriconazole was started based on the diagnosis. Using this novel technique enabled us to diagnose accurately an unusual bone pathogen that requires a unique treatment.

Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

PubMed Central

Narihiro, Takashi; Sekiguchi, Yuji

2011-01-01

Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

Relationship Between Ebola Virus Real-Time Quantitative Polymerase Chain Reaction-Based Threshold Cycle Value and Virus Isolation From Human Plasma.

PubMed

Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F

2015-10-01

We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Analysis of raw meats and fats of pigs using polymerase chain reaction for Halal authentication.

PubMed

Aida, A A; Che Man, Y B; Wong, C M V L; Raha, A R; Son, R

2005-01-01

A method for species identification from pork and lard samples using polymerase chain reaction (PCR) analysis of a conserved region in the mitochondrial (mt) cytochrome b (cyt b) gene has been developed. Genomic DNA of pork and lard were extracted using Qiagen DNeasy(®) Tissue Kits and subjected to PCR amplification targeting the mt cyt b gene. The genomic DNA from lard was found to be of good quality and produced clear PCR products on the amplification of the mt cyt b gene of approximately 360 base pairs. To distinguish between species, the amplified PCR products were cut with restriction enzyme BsaJI resulting in porcine-specific restriction fragment length polymorphisms (RFLP). The cyt b PCR-RFLP species identification assay yielded excellent results for identification of pig species. It is a potentially reliable technique for detection of pig meat and fat from other animals for Halal authentication.

Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction

PubMed Central

Dong, X. Y.; Li, W. H.; Zhu, J. L.; Liu, W. J.; Zhao, M. Q.; Luo, Y. W.; Chen, J. D.

2015-01-01

Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance. PMID:27175171

Identification of the five human Plasmodium species including P. knowlesi by real-time polymerase chain reaction.

PubMed

Oddoux, O; Debourgogne, A; Kantele, A; Kocken, C H; Jokiranta, T S; Vedy, S; Puyhardy, J M; Machouart, M

2011-04-01

Recently, Plasmodium knowlesi has been recognised as the fifth Plasmodium species causing malaria in humans. Hundreds of human cases infected with this originally simian Plasmodium species have been described in Asian countries and increasing numbers are reported in Europe from travellers. The growing impact of tourism and economic development in South and Southeast Asia are expected to subsequently lead to a further increase in cases both among locals and among travellers. P. knowlesi is easily misidentified in microscopy as P. malariae or P. falciparum. We developed new primers for the rapid and specific detection of this species by low-cost real-time polymerase chain reaction (PCR) and added this method to an already existing panel of primers used for the molecular identification of the other four species in one reaction. Reference laboratories should now be able to identify undisputably and rapidly P. knowlesi, as it is a potentially fatal pathogen.

Apparent polyploidization after gamma irradiation: pitfalls in the use of quantitative polymerase chain reaction (qPCR) for the estimation of mitochondrial and nuclear DNA gene copy numbers.

PubMed

Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard

2013-05-30

Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.

Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation.

PubMed

Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum

2014-08-01

A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods. Copyright © 2014 Elsevier Ltd. All rights reserved.

Mycobacterium avium restriction fragment length polymorphism-IS IS1245 and the simple double repetitive element polymerase chain reaction typing method to screen genetic diversity in Brazilian strains.

PubMed

Sequeira, Patrícia Carvalho de; Fonseca, Leila de Souza; Silva, Marlei Gomes da; Saad, Maria Helena Féres

2005-11-01

Simple double repetitive element polymerase chain reaction (MaDRE-PCR) and Pvu II-IS1245 restriction fragment length polymorphism (RFLP) typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 AIDS inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.

Peptostreptococcus micros in primary endodontic infections as detected by 16S rDNA-based polymerase chain reaction.

PubMed

Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton

2003-02-01

A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.

Polymerase chain reaction technology as analytical tool in agricultural biotechnology.

PubMed

Lipp, Markus; Shillito, Raymond; Giroux, Randal; Spiegelhalter, Frank; Charlton, Stacy; Pinero, David; Song, Ping

2005-01-01

The agricultural biotechnology industry applies polymerase chain reaction (PCR) technology at numerous points in product development. Commodity and food companies as well as third-party diagnostic testing companies also rely on PCR technology for a number of purposes. The primary use of the technology is to verify the presence or absence of genetically modified (GM) material in a product or to quantify the amount of GM material present in a product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains. The document highlights the many areas to which attention must be paid in order to produce reliable test results. These include sample preparation, method validation, choice of appropriate reference materials, and biological and instrumental sources of error. The article also discusses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

PubMed

Ririe, K M; Rasmussen, R P; Wittwer, C T

1997-02-15

A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

Principles and applications of polymerase chain reaction in medical diagnostic fields: a review

PubMed Central

Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

2009-01-01

Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310

Bacterial Polysaccharide Co-Polymerases Share a Common Framework for Control of Polymer Length

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tocilj,A.; Munger, C.; Proteau, A.

2008-01-01

The chain length distribution of complex polysaccharides present on the bacterial surface is determined by polysaccharide co-polymerases (PCPs) anchored in the inner membrane. We report crystal structures of the periplasmic domains of three PCPs that impart substantially different chain length distributions to surface polysaccharides. Despite very low sequence similarities, they have a common protomer structure with a long central alpha-helix extending 100 Angstroms into the periplasm. The protomers self-assemble into bell-shaped oligomers of variable sizes, with a large internal cavity. Electron microscopy shows that one of the full-length PCPs has a similar organization as that observed in the crystal formore » its periplasmic domain alone. Functional studies suggest that the top of the PCP oligomers is an important region for determining polysaccharide modal length. These structures provide a detailed view of components of the bacterial polysaccharide assembly machinery.« less

Electrically controlled microvalves to integrate microchip polymerase chain reaction and capillary electrophoresis.

PubMed

Kaigala, Govind V; Hoang, Viet N; Backhouse, Christopher J

2008-07-01

Microvalves are key in realizing portable miniaturized diagnostic platforms. We present a scalable microvalve that integrates well with standard lab on a chip (LOC) implementations, yet which requires essentially no external infrastructure for its operation. This electrically controlled, phase-change microvalve is used to integrate genetic amplification and analysis via capillary electrophoresis--the basis of many diagnostics. The microvalve is actuated using a polymer (polyethylene glycol, PEG) that exhibits a large volumetric change between its solid and liquid phases. Both the phase change of the PEG and the genetic amplification via polymerase chain reaction (PCR) are thermally controlled using thin film resistive elements that are patterned using standard microfabrication methods. By contrast with many other valve technologies, these microvalves and their control interface scale down in size readily. The novelty here lies in the use of fully integrated microvalves that require only electrical connections to realize a portable and inexpensive genetic analysis platform.

Dual phase multiplex polymerase chain reaction

DOEpatents

Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

2008-10-07

Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

Polymerase chain reaction: A molecular diagnostic tool in periodontology.

PubMed

Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

2016-01-01

This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

USGS Publications Warehouse

Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

2010-01-01

A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

Effective characterization of Salmonella Enteritidis by most probable number (MPN) followed by multiplex polymerase chain reaction (PCR) methods.

PubMed

Zappelini, Lincohn; Martone-Rocha, Solange; Dropa, Milena; Matté, Maria Helena; Tiba, Monique Ribeiro; Breternitz, Bruna Suellen; Razzolini, Maria Tereza Pepe

2017-02-01

Nontyphoidal Salmonella (NTS) is a relevant pathogen involved in gastroenteritis outbreaks worldwide. In this study, we determined the capacity to combine the most probable number (MPN) and multiplex polymerase chain reaction (PCR) methods to characterize the most important Salmonella serotypes in raw sewage. A total of 499 isolates were recovered from 27 raw sewage samples and screened using two previously described multiplex PCR methods. From those, 123 isolates were selected based on PCR banding pattern-identical or similar to Salmonella Enteritidis and Salmonella Typhimurium-and submitted to conventional serotyping. Results showed that both PCR assays correctly serotyped Salmonella Enteritidis, however, they presented ambiguous results for Salmonella Typhimurium identification. These data highlight that MPN and multiplex PCR can be useful methods to describe microbial quality in raw sewage and suggest two new PCR patterns for Salmonella Enteritidis identification.

Sensitive and specific identification by polymerase chain reaction of Eimeria tenella and Eimeria maxima, important protozoan pathogens in laboratory avian facilities.

PubMed

Lee, Hyun-A; Hong, Sunhwa; Chung, Yungho; Kim, Okjin

2011-09-01

Eimeria tenella and Eimeria maxima are important pathogens causing intracellular protozoa infections in laboratory avian animals and are known to affect experimental results obtained from contaminated animals. This study aimed to find a fast, sensitive, and efficient protocol for the molecular identification of E. tenella and E. maxima in experimental samples using chickens as laboratory avian animals. DNA was extracted from fecal samples collected from chickens and polymerase chain reaction (PCR) analysis was employed to detect E. tenella and E. maxima from the extracted DNA. The target nucleic acid fragments were specifically amplified by PCR. Feces secreting E. tenella and E. maxima were detected by a positive PCR reaction. In this study, we were able to successfully detect E. tenella and E. maxima using the molecular diagnostic method of PCR. As such, we recommended PCR for monitoring E. tenella and E. maxima in laboratory avian facilities.

Allele related mutation specific-polymerase chain reaction for rapid diagnosis of Hb New York (beta 113 (G15) Val-->Glu, beta(CD113 GTG-->GAG)).

PubMed

Viprakasit, Vip; Tachavanich, Kalaya; Suwantol, Lerlugsn; Pung-Amritt, Parichat; Chinchang, Worawut; Tanphaichitr, Voravarn S

2002-08-01

Hemoglobin New York (beta 113 (G15) Val-->Glu), a beta-globin variant, was first reported in a Chinese family living in New York. Subsequently, this abnormal hemoglobin was reported in many Chinese descendants from several groups and it was also known as Hb Kaohsiung. The subtle change in alpha1beta1 contact region apart from the heme group connecting area by Val-->Glu substitution has minor changes in both the electrophoretic mobility and stability making this hemoglobin variant difficult to distinguish from Hb A using routine hemoglobin analysis. The authors described a case of heterozygosity of Hb New York diagnosed by a molecular technique and revealed a mutation in beta(CD113 GTG-->GAG). A novel Allele Related Mutation Specific-Polymerase Chain Reaction (ARMS-PCR) for rapid diagnosis of this mutation has been proposed.

Theory and applications of the polymerase chain reaction.

PubMed

Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

1990-04-01

The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

Capillary sample introduction of polymerase chain reaction (PCR) products separated in ultrathin slab gels.

PubMed

Bullard, K M; Hietpas, P B; Ewing, A G

1998-01-01

Polymerase chain reaction (PCR) amplified short tandem repeat (STR) samples from the HUMVWF locus have been analyzed using a unique sample introduction and separation technique. A single capillary is used to transfer samples onto an ultrathin slab gel (57 microm thin). This ultrathin nondenaturing polyacrylamide gel is used to separate the amplified fragments, and laser-induced fluorescence with ethidium bromide is used for detection. The feasibility of performing STR analysis using this system has been investigated by examining the reproducibility for repeated samples. Reproducibility is examined by comparing the migration of the 14 and 17 HUMVWF alleles on three consecutive separations on the ultrathin slab gel. Using one locus, separations match in migration time with the two alleles 42 s apart for each of the three consecutive separations. This technique shows potential to increase sample throughput in STR analysis techniques although separation resolution still needs to be improved.

International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method.

PubMed

Jacchia, Sara; Nardini, Elena; Bassani, Niccolò; Savini, Christian; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

2015-05-27

This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3' junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in haploid genome equivalents. We assessed trueness, precision, efficiency, and linearity of the two assays, and the results demonstrate that both the assays independently assessed and the entire method fulfill European and international requirements for methods for genetically modified organism (GMO) testing, within the dynamic range tested. The homogeneity of the results of the collaborative trial between Europe and Asia is a good indicator of the robustness of the method.

Generation of human scFv antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences.

PubMed

Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F

2011-09-01

The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human scFv (single chain antibody fragment) libraries using a short linker (GGSSRSS) or a long linker (GGSSRSSSSGGGGSGGGG). In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final scFv products that are used for cloning.

The Recent Emergence of Clostridium difficile Infection in Romanian Hospitals is Associated with a High Prevalence of Polymerase Chain Reaction Ribotype 027.

PubMed

Popescu, Gabriel Adrian; Serban, Roxana; Pistol, Adriana; Niculcea, Andreea; Preda, Andreea; Lemeni, Daniela; Macovei, Ioana Sabina; Tălăpan, Daniela; Rafila, Alexandru; Florea, Dragoş

2018-03-15

To investigate the epidemiology of Clostridium difficile infection in Romanian hospitals. A survey was conducted at nine hospitals throughout Romania between November 2013 and February 2014. The survey identified 393 patients with Clostridium difficile infection. The median age was 67 years (range: 2-94 years); 56% of patients were aged >65 years. The mean prevalence of Clostridium difficile infection was 5.2 cases per 10.000 patient-days. The highest prevalences were 24.9 and 20 per 10.000 patient-days in hospitals specializing in gastroenterology and infectious diseases, respectively. Clostridium difficile infections were health care-associated in 70.5% patients and community-acquired in 10.2%. The origin was not determined in 19.3%. Clostridium difficile infection was severe in 12.3% of patients, and the in-hospital all-cause mortality was 8.8%. Polymerase chain reaction ribotype 027 had the highest prevalence in all participating hospitals and represented 82.6% of the total ribotyped isolates. The minimum inhibitory concentration of moxifloxacin was >4 μg/mL for 59 of 80 tested isolates (73.8%). Of 59 isolates, 54 were highly resistant to moxifloxacin (minimum inhibitory concentration ≥32 μg/mL), and the majority were polymerase chain reaction ribotype 027 (p<0.0001). The ribotype 027 was the predominant cause of Clostridium difficile infections in Romania. In some specialized hospitals, the prevalence of Clostridium difficile infection was higher than the European mean prevalence, and this demonstrates the need for strict adherence to infection control programs.

Sustained high-throughput polymerase chain reaction diagnostics during the European epidemic of Bluetongue virus serotype 8.

PubMed

van Rijn, Piet A; Heutink, René G; Boonstra, Jan; Kramps, Hans A; van Gennip, René G P

2012-05-01

A real-time reverse transcription polymerase chain reaction assay (PCR test) based on genome segment 10 of Bluetongue virus (BTV) was developed. The PCR test consists of robotized viral RNA isolation from blood samples and an all-in-one method including initial denaturation of genomic double-stranded RNA, reverse transcription polymerase chain reaction (RT-PCR), and real-time detection and analysis. Reference strains of the 24 recognized BTV serotypes, isolates from different years, and geographic origins were detected. Other orbiviruses such as African horse sickness virus, Epizootic hemorrhagic disease virus, and Equine encephalosis virus were not detected. Experimentally infected animals were PCR positive from 2 days postinoculation, which was earlier than fever, other clinical signs, or seroconversion. The diagnostic sensitivity and specificity were very close to or even 100%. The PCR test played a key role in the detection of BTV serotype 8 in August 2006 in The Netherlands. The outbreak in a completely naive ruminant population allowed for further evaluation of the PCR test with field samples. In 2006, the correlation between enzyme-linked immunosorbent assay and PCR results was estimated to be 95%. In the following years, the PCR test was used for diagnosis of diseased animals, for testing of healthy animals for trade purposes, and for detection of BTV RNA in different species of the insect vector, Culicoides. In the autumn of 2008, BTV serotype 6 unexpectedly emerged in northwest Europe and was also detected with the PCR test developed in the current study. The performance in routine use over 5 years has been recorded and evaluated.

COLD-PCR Technologies in the Area of Personalized Medicine: Methodology and Applications.

PubMed

Mauger, Florence; How-Kit, Alexandre; Tost, Jörg

2017-06-01

Somatic mutations bear great promise for use as biomarkers for personalized medicine, but are often present only in low abundance in biological material and are therefore difficult to detect. Many assays for mutation analysis in cancer-related genes (hotspots) have been developed to improve diagnosis, prognosis, prediction of drug resistance, and monitoring of the response to treatment. Two major approaches have been developed: mutation-specific amplification methods and methods that enrich and detect mutations without prior knowledge on the exact location and identity of the mutation. CO-amplification at Lower Denaturation temperature Polymerase Chain Reaction (COLD-PCR) methods such as full-, fast-, ice- (improved and complete enrichment), enhanced-ice, and temperature-tolerant COLD-PCR make use of a critical temperature in the polymerase chain reaction to selectively denature wild-type-mutant heteroduplexes, allowing the enrichment of rare mutations. Mutations can subsequently be identified using a variety of laboratory technologies such as high-resolution melting, digital polymerase chain reaction, pyrosequencing, Sanger sequencing, or next-generation sequencing. COLD-PCR methods are sensitive, specific, and accurate if appropriately optimized and have a short time to results. A large variety of clinical samples (tumor DNA, circulating cell-free DNA, circulating cell-free fetal DNA, and circulating tumor cells) have been studied using COLD-PCR in many different applications including the detection of genetic changes in cancer and infectious diseases, non-invasive prenatal diagnosis, detection of microorganisms, or DNA methylation analysis. In this review, we describe in detail the different COLD-PCR approaches, highlighting their specificities, advantages, and inconveniences and demonstrating their use in different fields of biological and biomedical research.

An evaluation of microbial profile in halitosis with tongue coating using PCR (polymerase chain reaction)- a clinical and microbiological study.

PubMed

Kamaraj R, Dinesh; Bhushan, Kala S; K L, Vandana

2014-01-01

Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load.

Screening test recommendations for methicillin-resistant Staphylococcus aureus surveillance practices: A cost-minimization analysis.

PubMed

Whittington, Melanie D; Curtis, Donna J; Atherly, Adam J; Bradley, Cathy J; Lindrooth, Richard C; Campbell, Jonathan D

2017-07-01

To mitigate methicillin-resistant Staphylococcus aureus (MRSA) infections, intensive care units (ICUs) conduct surveillance through screening patients upon admission followed by adhering to isolation precautions. Two surveillance approaches commonly implemented are universal preemptive isolation and targeted isolation of only MRSA-positive patients. Decision analysis was used to calculate the total cost of universal preemptive isolation and targeted isolation. The screening test used as part of the surveillance practice was varied to identify which screening test minimized inappropriate and total costs. A probabilistic sensitivity analysis was conducted to evaluate the range of total costs resulting from variation in inputs. The total cost of the universal preemptive isolation surveillance practice was minimized when a polymerase chain reaction screening test was used ($82.51 per patient). Costs were $207.60 more per patient when a conventional culture was used due to the longer turnaround time and thus higher isolation costs. The total cost of the targeted isolation surveillance practice was minimized when chromogenic agar 24-hour testing was used ($8.54 per patient). Costs were $22.41 more per patient when polymerase chain reaction was used. For ICUs that preemptively isolate all patients, the use of a polymerase chain reaction screening test is recommended because it can minimize total costs by reducing inappropriate isolation costs. For ICUs that only isolate MRSA-positive patients, the use of chromogenic agar 24-hour testing is recommended to minimize total costs. Copyright © 2017 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Allele-Specific Polymerase Chain Reaction for the Imatinib-Resistant KIT D816V and D816F Mutations in Mastocytosis and Acute Myelogenous Leukemia

PubMed Central

Corless, Christopher L.; Harrell, Patina; Lacouture, Mario; Bainbridge, Troy; Le, Claudia; Gatter, Ken; White, Clifton; Granter, Scott; Heinrich, Michael C.

2006-01-01

Oncogenic mutations of the receptor tyrosine kinase KIT contribute to the pathogenesis of gastrointestinal stromal tumors, systemic mastocytosis (SM), and some cases of acute myelogenous leukemia (AML). The D816V substitution in the activation loop of KIT results in relative resistance to the kinase inhibitor imatinib (Gleevec). Because this mutation occurs in 80 to 95% of adult SM, its detection has diagnostic and predictive significance. Unfortunately, the fraction of mutation-positive cells in clinical SM samples is often below the 20 to 30% threshold needed for detection by direct DNA sequencing. We have developed an allele-specific polymerase chain reaction assay using a mutation-specific primer combined with a wild-type blocking oligonucleotide that amplifies D816V at the level of 1% mutant allele in DNA extracted from formalin-fixed, paraffin-embedded tissue. There were no amplifications among 64 KIT wild-type tumors and cell lines, whereas all D816V-mutant samples (eight AML and 11 mast cell disease) were positive. Other D816 substitutions associated with resistance to imatinib in vitro are rare in SM. Among these D816F was detectable with the assay whereas D816H, D816Y, and D816G did not amplify. Nine biopsies (bone marrow, skin, or colon) with suspected SM were negative by denaturing high performance liquid chromatography and/or DNA sequencing but positive by allele-specific polymerase chain reaction. Thus, the assay may be useful in confirming the diagnosis of SM. PMID:17065430

Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

NASA Astrophysics Data System (ADS)

Pérez Urquiza, M.; Acatzi Silva, A. I.

2014-02-01

Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

Molecular screening by polymerase chain reaction detects panleukopenia virus DNA in formalin-fixed hearts from cats with idiopathic cardiomyopathy and myocarditis.

PubMed

Meurs, K M; Fox, P R; Magnon, A L; Liu, S; Towbin, J A

2000-01-01

Viral myocarditis has been suggested as an etiology for cardiomyopathy in several mammalian species. Myocarditis and idiopathic cardiomyopathy have been reported in the domestic cat, although a viral etiology has not been demonstrated. Because of the continuing interest in the potential relationship between viral myocarditis and cardiomyopathy, we evaluated hearts from cats with spontaneous, idiopathic cardiomyopathy for viral genomic material within myocytes by polymerase chain reaction, and for the presence of myocarditis by light microscopy. Thirty-one (31) formalin-fixed hearts from domestic cats who died of idiopathic cardiomyopathy were randomly selected from pathology archives. Seventeen (17) formalin-fixed hearts from healthy cats were similarly selected as normal controls. The polymerase chain reaction (PCR) was used to evaluate myocardial tissue for the presence of viral genome from feline panleukopenia virus, herpes virus, calici virus, and corona virus. Hearts were examined using light microscopy for histologic evidence of myocarditis according to the Dallas criteria. Panleukopenia virus was identified by PCR in 10 of 31 cats with cardiomyopathy but in none of the controls. Neither cardiomyopathic or control cats tested positive by PCR for herpes virus, calici virus, and corona virus. Myocarditis was detected by histologic examination in 18 of 31 cardiomyopathic cats and in none of 17 control cats. Myocarditis and or feline panleukopenia virus genome was detected in felines with idiopathic hypertrophic, dilated, and restrictive cardiomyopathy, suggesting a possible role of viral infection and inflammation in the pathogenesis of cardiomyopathy in this species.

Sensitivity, specificity and comparison of three commercially available immunological tests in the diagnosis of Cryptosporidium species in animals.

PubMed

Danišová, Olga; Halánová, Monika; Valenčáková, Alexandra; Luptáková, Lenka

The study was conducted to compare the specificity of immunological diagnostic methods used for the diagnosis of Cryptosporidium species capable of causing life-threatening infection in both immunosuppressed and immunocompetent patients. For the detection of Cryptosporidium species in 79 animals with diarrhoea, we used three Copro-antigen tests: RIDASCREEN ® Cryptosporidium test, Cryptosporidium 2nd Generation (ELISA) and RIDA ® QUICK Cryptosporidium. For immunoassays we used positive and negative samples detected by means of polymerase chain reaction and validated by sequencing and nested polymerase chain reaction to confirm the presence six different species of Cryptosporidium species. Prevalence of cryptosporidiosis in the entire group determined by enzyme immunoassay, enzyme linked immunosorbent assay, immuno-chromatographic test and polymerase chain reaction was 34.17%, 27.84%, 6.33% and 27.84%, respectively. Sensitivity of animal samples with enzyme immunoassay, enzyme linked immunosorbent assay, and immuno-chromatographic test was 63.6%, 40.9% and 22.7%, resp., when questionable samples were considered positive, whereas specificity of enzyme immunoassay, enzyme linked immunosorbent assay and immuno-chromatographic test was 75.9%, 78.9% and 100%, respectively. Positive predictive values and negative predictive values were different for all the tests. These differences results are controversial and therefore reliability and reproducibility of immunoassays as the only diagnostic method is questionable. The use of various Cryptosporidium species in diagnosis based on immunological testing and different results obtained by individual tests indicate potential differences in Copro-antigens produced by individual Cryptosporidium species. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Generation of human Fab antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences.

PubMed

Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F

2011-09-01

The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human Fab (fragment antigen binding) antibody libraries. In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final Fab products that are used for cloning.

Lack of production of (p)ppGpp in Halobacterium volcanii under conditions that are effective in the eubacteria.

PubMed Central

Scoarughi, G L; Cimmino, C; Donini, P

1995-01-01

The stringent halobacterial strain Haloferax volcanii was subjected to a set of physiological conditions different from amino acid starvation that are known to cause production of guanosine polyphosphates [(p)pp Gpp] in eubacteria via the relA-independent (spoT) pathway. The conditions used were temperature upshift, treatment with cyanide, and total starvation. Under none of these conditions were detectable levels of (p)ppGpp observed. This result, in conjunction with our previous finding that (p)ppGpp synthesis does not occur under amino acid starvation, leads to the conclusion that in halobacteria both growth rate control and stringency are probably governed by mechanisms that operate in the absence of ppGpp. During exponential growth, a low level of phosphorylated compounds with electrophoretic mobilities similar, but not identical, to that of (p)ppGpp were observed. The intracellular concentration of these compounds increased considerably during the stationary phase of growth and with all of the treatments used. The compounds were identified as short-chain polyphosphates identical to those found under similar conditions in Saccharomyces cerevisiae. PMID:7798153

Presidential Green Chemistry Challenge: 2013 Greener Synthetic Pathways Award

EPA Pesticide Factsheets

Presidential Green Chemistry Challenge 2013 award winner, Life Technologies, developed a one-pot synthesis for polymerase chain reaction (PCR), which is a much more efficient process that prevents about 1.5 million pounds of hazardous waste a year.

Low-stringency selection of TEM1 for BLIP shows interface plasticity and selection for faster binders

PubMed Central

Cohen-Khait, Ruth; Schreiber, Gideon

2016-01-01

Protein–protein interactions occur via well-defined interfaces on the protein surface. Whereas the location of homologous interfaces is conserved, their composition varies, suggesting that multiple solutions may support high-affinity binding. In this study, we examined the plasticity of the interface of TEM1 β-lactamase with its protein inhibitor BLIP by low-stringency selection of a random TEM1 library using yeast surface display. Our results show that most interfacial residues could be mutated without a loss in binding affinity, protein stability, or enzymatic activity, suggesting plasticity in the interface composition supporting high-affinity binding. Interestingly, many of the selected mutations promoted faster association. Further selection for faster binders was achieved by drastically decreasing the library–ligand incubation time to 30 s. Preequilibrium selection as suggested here is a novel methodology for specifically selecting faster-associating protein complexes. PMID:27956635

A predictive analysis of CO2 emissions, environmental policy stringency, and economic growth in China.

PubMed

Ahmed, Khalid; Ahmed, Sidrah

2018-03-28

This study takes environmental policy stringency and economic activity as the controlling variables and forecasts the CO 2 emissions in China up to 2022. In doing so, an application of corrected grey model with convolution is used over the annual time series data between 1990 and 2012. The simulation results show that (1) between 2012 and 2022, CO 2 emissions in China is expected to increase at an average rate of 17.46% annually, raising the emissions intensity from 7.04 in 2012 to 25.461 metric tons per capita by 2022; (2) stringent environmental policies reduce CO 2 emissions-whereas, GDP tends to increase the emissions intensity in China; (3) stringent environmental policies are found to have a negative impact on GDP in China. Based on the empirical findings, the study also provides some policy suggestions to reduce emissions intensity in China.

A Two-State Model for the Dynamics of the Pyrophosphate Ion Release in Bacterial RNA Polymerase

PubMed Central

Da, Lin-Tai; Pardo Avila, Fátima; Wang, Dong; Huang, Xuhui

2013-01-01

The dynamics of the PPi release during the transcription elongation of bacterial RNA polymerase and its effects on the Trigger Loop (TL) opening motion are still elusive. Here, we built a Markov State Model (MSM) from extensive all-atom molecular dynamics (MD) simulations to investigate the mechanism of the PPi release. Our MSM has identified a simple two-state mechanism for the PPi release instead of a more complex four-state mechanism observed in RNA polymerase II (Pol II). We observed that the PPi release in bacterial RNA polymerase occurs at sub-microsecond timescale, which is ∼3-fold faster than that in Pol II. After escaping from the active site, the (Mg-PPi)2− group passes through a single elongated metastable region where several positively charged residues on the secondary channel provide favorable interactions. Surprisingly, we found that the PPi release is not coupled with the TL unfolding but correlates tightly with the side-chain rotation of the TL residue R1239. Our work sheds light on the dynamics underlying the transcription elongation of the bacterial RNA polymerase. PMID:23592966

Differentiation among isolates of prunus necrotic ringspot virus by transcript conformation polymorphism.

PubMed

Rosner, A; Maslenin, L; Spiegel, S

1998-09-01

A method based on differences in electrophoretic mobility of RNA transcripts made from polymerase chain reaction (PCR) products was used for differentiation among virus isolates. A T7 RNA polymerase promoter was attached to amplified prunus necrotic ringspot virus (PNRSV) sequences by PCR. The PCR products then served as a template for transcription. Single-stranded transcripts originated from different PNRSV isolates varied in electrophoretic mobility in polyacrylamide gels, presumably because of transcript conformation polymorphism (TCP). This procedure was applied for the differentiation of PNRSV isolates.

DNA polymerase preference determines PCR priming efficiency.

PubMed

Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

2014-01-30

Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.

Distribution of endogenous type B and type D sheep retrovirus sequences in ungulates and other mammals.

PubMed Central

Hecht, S J; Stedman, K E; Carlson, J O; DeMartini, J C

1996-01-01

The jaagsiekte sheep retrovirus (JSRV), which appears to be a type B/D retrovirus chimera, has been incriminated as the cause of ovine pulmonary carcinoma. Recent studies suggest that the sequences related to this virus are found in the genomes of normal sheep and goats. To learn whether there are breeds of sheep that lack the endogenous viral sequences and to study their distribution among other groups of mammals, we surveyed several domestic sheep and goat breeds, other ungulates, and various mammal groups for sequences related to JSRV. Probes prepared from the envelope (SU) region of JSRV and the capsid (CA) region of a Peruvian type D virus related to JSRV were used in Southern blot hybridization with genomic DNA followed by low- and high-stringency washes. Fifteen to 20 CA and SU bands were found in all members of the 13 breeds of domestic sheep and 6 breeds of goats tested. There were similar findings in 6 wild Ovis and Capra genera. Within 22 other genera of Bovidae including domestic cattle, and 7 other families of Artiodactyla including Cervidae, there were usually a few CA or SU bands at low stringency and rare bands at high stringency. Among 16 phylogenetically distant genera, there were generally fewer bands hybridizing with either probe. These results reveal wide-spread phylogenetic distribution of endogenous type B and type D retroviral sequences related to JSRV among mammals and argue for further investigation of their potential role in disease. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8622932

Oligonucleotide probes to the 16S ribosomal RNA: implications of sequence homology and secondary structure with particular reference to the oral species Prevotella intermedia and Prevotella nigrescens.

PubMed

Shah, H N; Gharbia, S E; Scully, C; Finegold, S M

1995-03-01

Eight oligonucleotides based upon regions of the small subunit 16S ribosomal RNA gene sequences were analysed against a background of their position within the molecule and their two-dimensional structure to rationalise their use in recognising Prevotella intermedia and Prevotella nigrescens. The 41 clinical isolates from both oral and respiratory sites and two reference strains were subjected to DNA-DNA hybridisation and multilocus enzyme electrophoresis to confirm their identity. Alignment of oligonucleotide probes designated I Bi-2 to I Bi-6 (for P. intermedia) and 2Bi-2 (for P. nigrescens) with the 16S rRNA suggested that these probes lacked specificity or were constructed from hypervariable regions. A 52-mer oligonucleotide (designated Bi) reliably detected both species. Because of the high degree of concordance between the 16S rRNAs of both species, it was necessary to vary the stringency of hybridisation conditions for detection of both species. Thus probe I Bi-I recognised P. intermedia while I Bi-I detected both P. intermedia and P. nigrescens at low stringency. However, under conditions of high stringency only P. nigrescens was recognised by probe 2Bi-I. These probes were highly specific and did not hybridise with DNA from the closely related P. corporis, nor other periodontal pathogens such as Fusobacterium nucleatum, Actinobacillus actinomycetemcomitans, Treponema denticola and several pigmented species such as Prevotella melaninogenica, P. denticola, P. loescheii, Porphyromonas asaccharolytica, Py. endodontalis, Py. gingivalis, Py. levii, and Py. macacae.

Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

PubMed

Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

2013-09-15

We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

DIFFERENTIATING HUMAN FROM ANIMAL ISOLATES OF CRYPTOSPORIDIUM PARVUM

EPA Science Inventory

We analyzed 9s Cryptosporidium parvum isolates from humans and animals by a polymerase chain reaction/restriction fragment length polymorphism method based on the thrombospondin-related anonymous protein 2 gene sequence. Used as a molecular marker, this method can differentiate ...

QUALITY ASSURANCE FOR PCR

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) held a workshop in January 2003 on the detection of viruses in water using polymerase chain reaction (PCR)-based methods. Speakers were asked to address a series of specific questions, including whether a single standard method coul...

Convectively driven PCR thermal-cycling

DOEpatents

Benett, William J.; Richards, James B.; Milanovich, Fred P.

2003-07-01

A polymerase chain reaction system provides an upper temperature zone and a lower temperature zone in a fluid sample. Channels set up convection cells in the fluid sample and move the fluid sample repeatedly through the upper and lower temperature zone creating thermal cycling.

A Technical Approach to Marking Explosives, Propellants, and Precursor Chemicals

DTIC Science & Technology

1998-08-01

polymerase chain reaction (PCR) methods whereby small strands are cut and analyzed under specified temperature mediated enzymatic /molecular reactions (4...such as these are often overlooked. Several other companies have been investigating other methods including immunoassay techniques, microencapsulated

Evaluation of Four RNA Extraction Methods for Gene Expression Analyses of Cryptosporidium parvum and Toxoplasma gondii Oocys

EPA Science Inventory

Cryptosporidium spp. and Toxoplasma gondii are important coccidian parasites that have caused waterborne and foodborne disease outbreaks worldwide. Techniques like subtractive hybridization, microarrays, and quantitative reverse transcriptase real-time polymerase chain reaction (...

ANIMAL DNA IN PCR REAGENTS PLAGUES ANCIENT DNA RESEARCH

EPA Science Inventory

Ancient DNA analysis is becoming widespread. These studies use polymerase chain reaction (PCR) to amplify minute quantities of heavily damaged template. Unusual steps are taken to achieve the sensitivity necessary to detect ancient DNA, including high-cycle PCR amplification targ...

DETECTION OF PATHOGENS IN DRINKING WATER (SEER 2)

EPA Science Inventory

Project investigators developed a polymerase chain reaction (PCR)-based technique to detect E. coli 0157:H7 cells in environmental samples using previously reported PCR primers for the specific detection of genes involved in biosynthesis of 0157 polysacchari...

Of Publishers and Pirates: License Agreements Promote Unethical Behavior, But That's Only the Beginning.

ERIC Educational Resources Information Center

Pournelle, Jerry

1984-01-01

Discussion of software license agreements implies that they actually contribute to software piracy because of their stringency and indicates that competition in the software publishing field will eventually eliminate the piracy problem. (MBR)

The Political Economy of Part-Time Academic Work in Canada.

ERIC Educational Resources Information Center

Rajagopal, Indhu; Farr, William D.

1989-01-01

Under continuing financial stringency, the university administration negotiates concessions with full-time faculty to satisfy their interests and maintain the stability of the system. Part-timers, excluded from the collegium, remain peripheral to these arrangements. (Author/MLW)

Enhancing the specificity of polymerase chain reaction by graphene oxide through surface modification: zwitterionic polymer is superior to other polymers with different charges.

PubMed

Zhong, Yong; Huang, Lihong; Zhang, Zhisen; Xiong, Yunjing; Sun, Liping; Weng, Jian

Graphene oxides (GOs) with different surface characteristics, such as size, reduction degree and charge, are prepared, and their effects on the specificity of polymerase chain reaction (PCR) are investigated. In this study, we demonstrate that GO with a large size and high reduction degree is superior to small and nonreduced GO in enhancing the specificity of PCR. Negatively charged polyacrylic acid (PAA), positively charged polyacrylamide (PAM), neutral polyethylene glycol (PEG) and zwitterionic polymer poly(sulfobetaine) (pSB) are used to modify GO. The PCR specificity-enhancing ability increases in the following order: GO-PAA < GO-PAM < GO-PEG < GO-pSB. Thus, zwitterionic polymer-modified GO is superior to other GO derivatives with different charges in enhancing the specificity of PCR. GO derivatives are also successfully used to enhance the specificity of PCR for the amplification of human mitochondrial DNA using blood genomic DNA as template. Molecular dynamics simulations and molecular docking are performed to elucidate the interaction between the polymers and Pfu DNA polymerase. Our data demonstrate that the size, reduction degree and surface charge of GO affect the specificity of PCR. Based on our results, zwitterionic polymer-modified GO may be used as an efficient additive for enhancing the specificity of PCR.

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

PubMed Central

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-01-01

To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions.

PubMed

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-04-01

To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.

The cellular level of O-antigen polymerase Wzy determines chain length regulation by WzzB and WzzpHS-2 in Shigella flexneri 2a.

PubMed

Carter, Javier A; Jiménez, Juan C; Zaldívar, Mercedes; Alvarez, Sergio A; Marolda, Cristina L; Valvano, Miguel A; Contreras, Inés

2009-10-01

The lipopolysaccharide O antigen of Shigella flexneri 2a has two preferred chain lengths, a short (S-OAg) composed of an average of 17 repeated units and a very long (VL-OAg) of about 90 repeated units. These chain length distributions are controlled by the chromosomally encoded WzzB and the plasmid-encoded Wzz(pHS-2) proteins, respectively. In this study, genes wzzB, wzz(pHS-2) and wzy (encoding the O-antigen polymerase) were cloned under the control of arabinose- and rhamnose-inducible promoters to investigate the effect of varying their relative expression levels on O antigen polysaccharide chain length distribution. Controlled expression of the chain length regulators wzzB and wzz(pHS-2) revealed a dose-dependent production of each modal length. Increase in one mode resulted in a parallel decrease in the other, indicating that chain length regulators compete to control the degree of O antigen polymerization. Also, when expression of the wzy gene is low, S-OAg but not VL-OAg is produced. Production of VL-OAg requires high induction levels of wzy. Thus, the level of expression of wzy is critical in determining O antigen modal distribution. Western blot analyses of membrane proteins showed comparable high levels of the WzzB and Wzz(pHS-2) proteins, but very low levels of Wzy. In vivo cross-linking experiments and immunoprecipitation of membrane proteins did not detect any direct interaction between Wzy and WzzB, suggesting the possibility that these two proteins may not interact physically but rather by other means such as via translocated O antigen precursors.

Cellular RNA-dependent RNA polymerase involved in posttranscriptional gene silencing has two distinct activity modes.

PubMed

Makeyev, Eugene V; Bamford, Dennis H

2002-12-01

Recent genetic data suggest that proteins homologous to a plant RNA-dependent RNA polymerase (RdRP) play a central role in posttranscriptional gene silencing (PTGS) in many organisms. We show here that purified recombinant protein QDE-1, a genetic component of PTGS ("quelling") in the fungus Neurospora crassa, possesses RNA polymerase activity in vitro. The full-length enzyme and its enzymatically active C-terminal fragment perform two different reactions on single-stranded RNA templates, synthesizing either extensive RNA chains that form template-length duplexes or approximately 9-21-mer complementary RNA oligonucleotides scattered along the entire template. QDE-1 supports both de novo and primer-dependent initiation mechanisms. These results suggest that several distinct activities of cell-encoded RdRPs can be employed for efficient PTGS in vivo.

Detection of Entamoeba histolytica by Recombinase Polymerase Amplification

PubMed Central

Nair, Gayatri; Rebolledo, Mauricio; White, A. Clinton; Crannell, Zachary; Richards-Kortum, R. Rebecca; Pinilla, A. Elizabeth; Ramírez, Juan David; López, M. Consuelo; Castellanos-Gonzalez, Alejandro

2015-01-01

Amebiasis is an important cause of diarrheal disease worldwide and has been associated with childhood malnutrition. Traditional microscopy approaches are neither sensitive nor specific for Entamoeba histolytica. Antigen assays are more specific, but many cases are missed unless tested by molecular methods. Although polymerase chain reaction (PCR) is effective, the need for sophisticated, expensive equipment, infrastructure, and trained personnel limits its usefulness, especially in the resource-limited, endemic areas. Here, we report development of a recombinase polymerase amplification (RPA) method to detect E. histolytica specifically. Using visual detection by lateral flow (LF), the test was highly sensitive and specific and could be performed without additional equipment. The availability of this inexpensive, sensitive, and field-applicable diagnostic test could facilitate rapid diagnosis and treatment of amebiasis in endemic regions. PMID:26123960

Bacillus subtilis DNA polymerases, PolC and DnaE, are required for both leading and lagging strand synthesis in SPP1 origin-dependent DNA replication

PubMed Central

Seco, Elena M.

2017-01-01

Abstract Firmicutes have two distinct replicative DNA polymerases, the PolC leading strand polymerase, and PolC and DnaE synthesizing the lagging strand. We have reconstituted in vitro Bacillus subtilis bacteriophage SPP1 θ-type DNA replication, which initiates unidirectionally at oriL. With this system we show that DnaE is not only restricted to lagging strand synthesis as previously suggested. DnaG primase and DnaE polymerase are required for initiation of DNA replication on both strands. DnaE and DnaG synthesize in concert a hybrid RNA/DNA ‘initiation primer’ on both leading and lagging strands at the SPP1 oriL region, as it does the eukaryotic Pol α complex. DnaE, as a RNA-primed DNA polymerase, extends this initial primer in a reaction modulated by DnaG and one single-strand binding protein (SSB, SsbA or G36P), and hands off the initiation primer to PolC, a DNA-primed DNA polymerase. Then, PolC, stimulated by DnaG and the SSBs, performs the bulk of DNA chain elongation at both leading and lagging strands. Overall, these modulations by the SSBs and DnaG may contribute to the mechanism of polymerase switch at Firmicutes replisomes. PMID:28575448

An Atlas of Soybean Small RNAs Identifies Phased siRNAs from Hundreds of Coding Genes[W

PubMed Central

Kakrana, Atul; Huang, Kun; Zhai, Jixian; Yan, Zhe; Valdés-López, Oswaldo; Prince, Silvas; Musket, Theresa A.; Stacey, Gary

2014-01-01

Small RNAs are ubiquitous, versatile repressors and include (1) microRNAs (miRNAs), processed from mRNA forming stem-loops; and (2) small interfering RNAs (siRNAs), the latter derived in plants by a process typically requiring an RNA-dependent RNA polymerase. We constructed and analyzed an expression atlas of soybean (Glycine max) small RNAs, identifying over 500 loci generating 21-nucleotide phased siRNAs (phasiRNAs; from PHAS loci), of which 483 overlapped annotated protein-coding genes. Via the integration of miRNAs with parallel analysis of RNA end (PARE) data, 20 miRNA triggers of 127 PHAS loci were detected. The primary class of PHAS loci (208 or 41% of the total) corresponded to NB-LRR genes; some of these small RNAs preferentially accumulate in nodules. Among the PHAS loci, novel representatives of TAS3 and noncanonical phasing patterns were also observed. A noncoding PHAS locus, triggered by miR4392, accumulated preferentially in anthers; the phasiRNAs are predicted to target transposable elements, with their peak abundance during soybean reproductive development. Thus, phasiRNAs show tremendous diversity in dicots. We identified novel miRNAs and assessed the veracity of soybean miRNAs registered in miRBase, substantially improving the soybean miRNA annotation, facilitating an improvement of miRBase annotations and identifying at high stringency novel miRNAs and their targets. PMID:25465409

Detection of Genetically Modified Food: Has Your Food Been Genetically Modified?

ERIC Educational Resources Information Center

Brandner, Diana L.

2002-01-01

Explains the benefits and risks of genetically-modified foods and describes methods for genetically modifying food. Presents a laboratory experiment using a polymerase chain reaction (PCR) test to detect foreign DNA in genetically-modified food. (Contains 18 references.) (YDS)

Microsatellite primers for red drum (Sciaenops ocellatus)

USDA-ARS?s Scientific Manuscript database

In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...

A SIMPLE MULTIPLEX POLYMERASE CHAIN REACTION ASSAY FOR THE IDENTIFICATION OF FOUR ENVIRONMENTALLY RELEVANT FUNGAL CONTAMINANTS

EPA Science Inventory

Historically, identification of filamentous fungal (mold) species has been based on morphological characteristics, both macroscopic and microscopic. These methods have proven to be time consuming and inaccurate, necessitating the development of identification protocols that are ...

Comparison of EPA Method 1615 RT-qPCR Assays in Standard and Kit Format

EPA Science Inventory

EPA Method 1615 contains protocols for measuring enterovirus and norovirus by reverse transcription quantitative polymerase chain reaction. A commercial kit based upon these protocols was designed and compared to the method's standard approach. Reagent grade, secondary effluent, ...

Detection of Strawberry Viruses in Egypt

USDA-ARS?s Scientific Manuscript database

As part of a USAID-MERC funded project, ‘Disease-indexing and mass propagation of superior strawberry cultivars’, an effort was made to evaluate the virus status of strawberries in Egypt. Diagnostic reverse transcription-polymerase chain reaction (RT-PCR) tests for Strawberry mottle, Strawberry cri...

USE OF TAQMAN TO ENUMERATE ENTEROCOCCUS FAECALIS IN WATER

EPA Science Inventory

The Polymerase Chain Reaction (PCR) has become a useful tool in the detection of microorganisms. However, conventional PCR is somewhat time-consuming considering that additional steps (e.g., gel electrophoresis and gene sequencing) are required to confirm the presence of the tar...

MATERIALS SUPPORTING THE NEW RECREATIONAL WATER QUALITY CRITERIA FOR PATHOGENS

EPA Science Inventory

EPA is developing new, rapid methods for monitoring water quality at beaches to determine adequacy of water quality for swimming. The methods being developed rely upon quantitive polymerase chain reaction technology. They will permit real time decisions regarding beach closures...

77 FR 71191 - 2012 Recreational Water Quality Criteria

Federal Register 2010, 2011, 2012, 2013, 2014

2012-11-29

... Criteria AGENCY: Environmental Protection Agency (EPA). ACTION: Notice of availability of the 2012... for beach monitoring, quantitative polymerase chain reaction (qPCR), for the detection of enterococci... managing recreational waters, such as predictive modeling; the EPA is providing a beach action value for...

78 FR 25274 - Findings of Research Misconduct

Federal Register 2010, 2011, 2012, 2013, 2014

2013-04-30

... AGENCY: Office of the Secretary, HHS. ACTION: Notice. SUMMARY: Notice is hereby given that the Office of Research Integrity (ORI) has taken final action in the following case: Matthew Poore, Advanced Liquid Logic... that Respondent knowingly and intentionally falsified reverse transcription-polymerase chain reaction...

Thermodynamics of Oligonucleotide Duplex Melting

ERIC Educational Resources Information Center

Schreiber-Gosche, Sherrie; Edwards, Robert A.

2009-01-01

Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…

Towards Flexibility in Academic Labour Markets?

ERIC Educational Resources Information Center

Nieuwenhuysen, John

1985-01-01

It is argued that Australia's relatively uniform and consistent academic salary structure and personnel policies should be more flexible and competitive in order to alleviate current problems of academic labor market stagnation, uneven faculty distribution, and other results of financial stringency. (MSE)

Genetic traits of avascular necrosis of the femoral head analyzed by array comparative genomic hybridization and real-time polymerase chain reaction.

PubMed

Hwang, Jung-Taek; Baik, Seung-Ho; Choi, Jin-Soo; Lee, Kweon-Haeng; Rhee, Seung-Koo

2011-01-03

In an attempt to observe the genetic traits of avascular necrosis of the femoral head, we analyzed the genomic alterations in blood samples of 18 patients with avascular necrosis of the femoral head (9 idiopathic and 9 alcoholic cases) using the array comparative genomic hybridization method and real-time polymerase chain reaction. Several candidate genes were identified that may induce avascular necrosis of the femoral head, and we investigated their role in the pathomechanism of osteonecrosis of bone. The frequency of each candidate gene over all the categories of avascular necrosis of the femoral head was also calculated by real-time polymerase chain reaction. The highest frequency specific genes in each category were FLJ40296, CYP27C1, and CTDP1. FLJ40296 and CYP27C1 had the highest frequency (55.6%) in the idiopathic category. FLJ40296 had a high frequency (44.4%) in the alcoholic category, but CYP27C1 had a relatively low frequency (33.3%) in the alcoholic category. However, CTDP1 showed a significantly high frequency (55.6%) in the alcoholic category and a low frequency (22.2%) in the idiopathic category. Although we statistically analyzed the frequency of each gene with Fisher's exact test, we could not prove statistical significance due to the small number of samples. Further studies are needed with larger sample numbers. If the causal genes of avascular necrosis of the femoral head are found, they may be used for early detection, prognosis prediction, and genomic treatment of avascular necrosis of the femoral head in the future. Copyright 2011, SLACK Incorporated.

Implications of Measurement Assay Type in Design of HIV Experiments.

PubMed

Cannon, LaMont; Jagarapu, Aditya; Vargas-Garcia, Cesar A; Piovoso, Michael J; Zurakowski, Ryan

2017-12-01

Time series measurements of circular viral episome (2-LTR) concentrations enable indirect quantification of persistent low-level Human Immunodeficiency Virus (HIV) replication in patients on Integrase-Inhibitor intensified Combined Antiretroviral Therapy (cART). In order to determine the magnitude of these low level infection events, blood has to be drawn from a patients at a frequency and volume that is strictly regulated by the Institutional Review Board (IRB). Once the blood is drawn, the 2-LTR concentration is determined by quantifying the amount of HIV DNA present in the sample via a PCR (Polymerase Chain Reaction) assay. Real time quantitative Polymerase Chain Reaction (qPCR) is a widely used method of performing PCR; however, a newer droplet digital Polymerase Chain Reaction (ddPCR) method has been shown to provide more accurate quantification of DNA. Using a validated model of HIV viral replication, this paper demonstrates the importance of considering DNA quantification assay type when optimizing experiment design conditions. Experiments are optimized using a Genetic Algorithm (GA) to locate a family of suboptimal sample schedules which yield the highest fitness. Fitness is defined as the expected information gained in the experiment, measured by the Kullback-Leibler Divergence (KLD) between the prior and posterior distributions of the model parameters. We compare the information content of the optimized schedules to uniform schedules as well as two clinical schedules implemented by researchers at UCSF and the University of Melbourne. This work shows that there is a significantly greater gain information in experiments using a ddPCR assay vs. a qPCR assay and that certain experiment design considerations should be taken when using either assay.

Mutations blocking side chain assembly, polymerization, or transport of a Wzy-dependent Streptococcus pneumoniae capsule are lethal in the absence of suppressor mutations and can affect polymer transfer to the cell wall.

PubMed

Xayarath, Bobbi; Yother, Janet

2007-05-01

Extracellular polysaccharides of many bacteria are synthesized by the Wzy polymerase-dependent mechanism, where long-chain polymers are assembled from undecaprenyl-phosphate-linked repeat units on the outer face of the cytoplasmic membrane. In gram-positive bacteria, Wzy-dependent capsules remain largely cell associated via membrane and peptidoglycan linkages. Like many Wzy-dependent capsules, the Streptococcus pneumoniae serotype 2 capsule is branched. In this study, we found that deletions of cps2K, cps2J, or cps2H, which encode a UDP-glucose dehydrogenase necessary for side chain synthesis, the putative Wzx transporter (flippase), and the putative Wzy polymerase, respectively, were obtained only in the presence of suppressor mutations. Most of the suppressor mutations were in cps2E, which encodes the initiating glycosyltransferase for capsule synthesis. The cps2K mutants containing the suppressor mutations produced low levels of high-molecular-weight polymer that was detected only in membrane fractions. cps2K-repaired mutants exhibited only modest increases in capsule production due to the effect of the secondary mutation, but capsule was detectable in both membrane and cell wall fractions. Lethality of the cps2K, cps2J, and cps2H mutations was likely due to sequestration of undecaprenyl-phosphate in the capsule pathway and either preclusion of its turnover for utilization in essential pathways or destabilization of the membrane due to an accumulation of lipid-linked intermediates. The results demonstrate that proper polymer assembly requires not only a functional transporter and polymerase but also complete repeat units. A central role for the initiating glycosyltransferase in controlling capsule synthesis is also suggested.

Diagnosing leprosy: revisiting the role of the slit-skin smear with critical analysis of the applicability of polymerase chain reaction in diagnosis.

PubMed

Banerjee, Surajita; Biswas, Nibir; Kanti Das, Nilay; Sil, Amrita; Ghosh, Pramit; Hasanoor Raja, Abu Hena; Dasgupta, Sarbani; Kanti Datta, Pijush; Bhattacharya, Basudev

2011-12-01

Diagnosing leprosy is challenging, especially in early-stage cases, and the need for a sensitive diagnostic tool is urgent. Polymerase chain reaction (PCR) holds promise as a simple and sensitive diagnostic tool, but its usefulness in the Indian context requires further evaluation. Slit-skin smear (SSS) remains the conventional method of leprosy detection. Hence, this study was undertaken to evaluate and compare the diagnostic efficacy of PCR versus that of SSS. Punch biopsy of skin and SSS were obtained from the active margins of lesions. Cases were clinically grouped according to whether they were multibacillary (MB) or paucibacillary (PB) and classified into tuberculoid (TT), borderline tuberculoid (BT), borderline lepromatous (BL), lepromatous (LL), histoid, and indeterminate groups after clinicopathological correlation. DNA was extracted from biopsy specimens, and multiplex PCR was carried out incorporating primers intended for the amplification of a specific 372-bp fragment of a repetitive sequence of Mycobacterium leprae DNA. Among 164 patients, PCR was positive in 82.3%. The sensitivity of PCR was significantly greater (P < 0.0001) than that of SSS in both the MB (85.9% vs. 59.8%) and PB (75.4% vs. 1.8%) subgroups; the difference in sensitivity in the PB subgroup is remarkable. Positivity by PCR and SSS was found in 100% of LL and histoid leprosy, but PCR had significantly greater (P < 0.0001) positivity in BT leprosy and was of definite increased value in indeterminate and TT leprosy. Polymerase chain reaction had higher sensitivity compared with SSS, especially in diagnostically challenging and PB cases. Thus, the use of this costly but sensitive tool should be restricted to this subgroup, because SSS is sufficiently sensitive in the diagnosis of LL and histoid leprosy. © 2011 The International Society of Dermatology.

Differentiation of human-induced pluripotent stem cells into insulin-producing clusters.

PubMed

Shaer, Anahita; Azarpira, Negar; Vahdati, Akbar; Karimi, Mohammad Hosein; Shariati, Mehrdad

2015-02-01

In diabetes mellitus type 1, beta cells are mostly destroyed; while in diabetes mellitus type 2, beta cells are reduced by 40% to 60%. We hope that soon, stem cells can be used in diabetes therapy via pancreatic beta cell replacement. Induced pluripotent stem cells are a kind of stem cell taken from an adult somatic cell by "stimulating" certain genes. These induced pluripotent stem cells may be a promising source of cell therapy. This study sought to produce isletlike clusters of insulin-producing cells taken from induced pluripotent stem cells. A human-induced pluripotent stem cell line was induced into isletlike clusters via a 4-step protocol, by adding insulin, transferrin, and selenium (ITS), N2, B27, fibroblast growth factor, and nicotinamide. During differentiation, expression of pancreatic β-cell genes was evaluated by reverse transcriptase-polymerase chain reaction; the morphologic changes of induced pluripotent stem cells toward isletlike clusters were observed by a light microscope. Dithizone staining was used to stain these isletlike clusters. Insulin produced by these clusters was evaluated by radio immunosorbent assay, and the secretion capacity was analyzed with a glucose challenge test. Differentiation was evaluated by analyzing the morphology, dithizone staining, real-time quantitative polymerase chain reaction, and immunocytochemistry. Gene expression of insulin, glucagon, PDX1, NGN3, PAX4, PAX6, NKX6.1, KIR6.2, and GLUT2 were documented by analyzing real-time quantitative polymerase chain reaction. Dithizone-stained cellular clusters were observed after 23 days. The isletlike clusters significantly produced insulin. The isletlike clusters could increase insulin secretion after a glucose challenge test. This work provides a model for studying the differentiation of human-induced pluripotent stem cells to insulin-producing cells.

An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

PubMed Central

Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

2015-01-01

Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features. PMID:26579116

Antibiotic resistance and molecular typing among cockle (Anadara granosa) strains of Vibrio parahaemolyticus by polymerase chain reaction (PCR)-based analysis.

PubMed

Sahilah, A M; Laila, R A S; Sallehuddin, H Mohd; Osman, H; Aminah, A; Ahmad Azuhairi, A

2014-02-01

Genomic DNA of Vibrio parahaemolyticus were characterized by antibiotic resistance, enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) and random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) analysis. These isolates originated from 3 distantly locations of Selangor, Negeri Sembilan and Melaka (East coastal areas), Malaysia. A total of 44 (n = 44) of tentatively V. parahaemolyticus were also examined for the presence of toxR, tdh and trh gene. Of 44 isolates, 37 were positive towards toxR gene; while, none were positive to tdh and trh gene. Antibiotic resistance analysis showed the V. parahaemolyticus isolates were highly resistant to bacitracin (92%, 34/37) and penicillin (89%, 33/37) followed by resistance towards ampicillin (68%, 25/37), cefuroxime (38%, 14/37), amikacin (6%, 2/37) and ceftazidime (14%, 5/37). None of the V. parahaemolyticus isolates were resistant towards chloramphenicol, ciprofloxacin, ceftriaxone, enrofloxacin, norfloxacin, streptomycin and vancomycin. Antibiogram patterns exhibited, 9 patterns and phenotypically less heterogenous when compared to PCR-based techniques using ERIC- and RAPD-PCR. The results of the ERIC- and RAPD-PCR were analyzed using GelCompare software. ERIC-PCR with primers ERIC1R and ERIC2 discriminated the V. parahaemolyticus isolates into 6 clusters and 21 single isolates at a similarity level of 80%. While, RAPD-PCR with primer Gen8 discriminated the V. parahaemolyticus isolates into 11 clusters and 10 single isolates and Gen9 into 8 clusters and 16 single isolates at the same similarity level examined. Results in the presence study demonstrated combination of phenotypically and genotypically methods show a wide heterogeneity among cockle isolates of V. parahaemolyticus.

Fatal hemorrhagic fever caused by West Nile virus in the United States.

PubMed

Paddock, Christopher D; Nicholson, William L; Bhatnagar, Julu; Goldsmith, Cynthia S; Greer, Patricia W; Hayes, Edward B; Risko, Joseph A; Henderson, Corey; Blackmore, Carina G; Lanciotti, Robert S; Campbell, Grant L; Zaki, Sherif R

2006-06-01

Most West Nile virus (WNV) infections in humans are asymptomatic; severe disease occurs in relatively few patients and typically manifests as encephalitis, meningitis, or acute flaccid paralysis. A few cases of life-threatening disease with diffuse hemorrhagic manifestations have been reported in Africa; however, this clinical presentation has not been documented for any of the >16,700 cases of WNV disease reported in the United States during 1999-2004. We describe a case of fulminant WNV infection in a 59-year-old Florida man who died following a brief illness that resembled hemorrhagic disease caused by Rickettsia reckettsii, dengue virus or yellow fever virus. Traditional and contemporary diagnostic assays, including culture isolation, electron microscopic examination, reverse-transcriptase polymerase chain reaction amplification, and immunohistochemical stains, were used to confirm systemic WNV infection in the patient. WNV was isolated in a cell culture from a skin biopsy specimen obtained from the patient shortly prior to death. Electron microscopic examination identified the isolate as a flavivirus, and reverse-transcriptase polymerase chain reaction amplified specific WNV sequences from the isolate and patient tissue. Quantitative polymerase chain reaction identified approximately 1x10(7) viral copies/mL in the patient's serum. WNV antigens were detected by immunohistochemical stains in intravascular mononuclear cells and endothelium in skin, lung, liver, kidney, spleen, bone marrow, and central nervous system; no viral antigens were identified in neurons or glial cells of the central nervous system. Although hemorrhagic disease is a rare manifestation of WNV infection, the findings provided by this report may offer new insights regarding the clinical spectrum and pathogenesis of WNV disease in humans.

A Degradome-Based Polymerase Chain Reaction to Resolve the Potential of Environmental Samples for 2,4-Dichlorophenol Biodegradation.

PubMed

Ibrahim, Eslam S; Kashef, Mona T; Essam, Tamer M; Ramadan, Mohammed A

2017-12-01

A clean way to overcome environmental pollution is biodegradation. In this perspective, at the intersection of biodegradation and metagenomics, the degradome is defined as the totality of genes related to the biodegradation of a certain compound. It includes the genetic elements from both culturable and uncultured microorganisms. The possibility of assessing the biodegradation potential of an environmental samples, using a degradome-based polymerase chain reaction, was explored. 2,4-Dichlorophenol (2,4-DCP) was chosen as a model and the use of tfdB gene as a biodegradation marker was confirmed by bioinformatics study of TfdB protein. Five primer pairs were designed for the detection of different tfdB gene families. A total of 16 environmental samples were collected from Egyptian agricultural soils and wastewaters and tested for the presence of 2,4-DCP. The biodegradation capacity of 2,4-DCP was determined, for all isolated consortia, to reach up to 350 mg/l. Metagenomic DNA was extracted directly from the soil samples while successive 2,4-DCP-degrading microbial communities were enriched, with increasing concentrations of 2,4-DCP, then their DNA was extracted. The extracted DNA was tested for the distribution of the tfdB gene using a degradome-based polymerase chain reaction. tfdB-1 and tfdB-2 were detected in 5 and 9 samples, respectively. However, the co-existence of both genes was detected only in five samples. All tfdB positive samples were capable of 2,4-DCP degradation. The developed approach of assessing the potential of different environments for degrading 2,4-DCP was successfully measured in terms of accuracy (81.25%) and specificity (100%).

Expression of Connexin 43 in Synovial Tissue of Patients With Rheumatoid Arthritis

PubMed Central

MATSUKI, Tomohiro; TSUCHIDA, Shinji; TERAUCHI, Ryu; ODA, Ryo; FUJIWARA, Hiroyoshi; MAZDA, Osam; KUBO, Toshikazu

2016-01-01

Objectives This study aims to identify the distribution and expression level of connexin 43 (Cx43) in synovial tissue in patients with rheumatoid arthritis (RA). Patients and methods The expression of Cx43 in synovial tissue from eight patients with RA (2 males, 6 females; mean age 59.5±2.7 years; range 52 to 71 years), five patients with osteoarthritis (2 males, 3 females; mean age 68.4±2.7 years; range 61 to 81 years), and one normal female subject (mean age 61 year) was analyzed by quantitative reverse transcriptase polymerase chain reaction and immunohistochemistry of tissue sections. Induction of Cx43 following stimulation of human RA synovial fibroblasts with tumor necrosis factor-alpha (TNF-a) cultures was examined by quantitative reverse transcriptase polymerase chain reaction. The effect of small interfering ribonucleic acid targeting Cx43 (siCx43) on the expression of TNF-a and interleukin-6 was examined using quantitative reverse transcriptase polymerase chain reaction and enzyme-linked immunosorbent assays. Results Connexin 43 was highly expressed in RA synovial tissue, which also expressed TNF-a, but was expressed lower in osteoarthritis and normal synovial tissue. Expression of Cx43 was markedly up-regulated in RA synovial fibroblasts after stimulation with TNF-a. The over-expression of pro- inflammatory cytokines was suppressed by transfection of siCx43. Conclusion This study shows that Cx43 is expressed in RA synovial tissue and that its expression is induced by stimulation with TNF-a. The expression of the pro-inflammatory cytokines was inhibited by transfection of siCx43. Cx43 may be a novel marker of inflammation in RA synovial tissue. PMID:29900991

Molecular analysis and association with clinical and laboratory manifestations in children with sickle cell anemia

PubMed Central

Camilo-Araújo, Roberta Faria; Amancio, Olga Maria Silverio; Figueiredo, Maria Stella; Cabanãs-Pedro, Ana Carolina; Braga, Josefina Aparecida Pellegrini

2014-01-01

Objectives To analyze the frequency of βS-globin haplotypes and alpha-thalassemia, and their influence on clinical manifestations and the hematological profile of children with sickle cell anemia. Method The frequency of βS-globin haplotypes and alpha-thalassemia and any association with clinical and laboratorial manifestations were determined in 117 sickle cell anemia children aged 3–71 months. The confirmation of hemoglobin SS and determination of the haplotypes were achieved by polymerase chain reaction-restriction fragment length polymorphism, and alpha-thalassemia genotyping was by multiplex polymerase chain reaction (single-tube multiplex-polymerase chain reaction). Results The genotype distribution of haplotypes was 43 (36.7%) Central African Republic/Benin, 41 (35.0%) Central African Republic/Central African Republic, 20 (17.0%) Rare/atypical, and 13 (11.1%) Benin/Benin. The frequency of the α3.7 deletion was 1.71% as homozygous (−α3.7/−α3.7) and 11.9% as heterozygous (−α3.7/αα). The only significant association in respect to haplotypes was related to the mean corpuscular volume. The presence of alpha-thalassemia was significantly associated to decreases in mean corpuscular volume, mean corpuscular hemoglobin and reticulocyte count and to an increase in the red blood cell count. There were no significant associations of βS-globin haplotypes and alpha-thalassemia with clinical manifestations. Conclusions In the study population, the frequency of alpha-thalassemia was similar to published data in Brazil with the Central African Republic haplotype being the most common, followed by the Benin haplotype. βS-globin haplotypes and interaction between alpha-thalassemia and sickle cell anemia did not influence fetal hemoglobin concentrations or the number of clinical manifestations. PMID:25305165

An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study

PubMed Central

Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana

2014-01-01

Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. Materials and Methods: The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. Result: The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. Conclusion: The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load. PMID:24596791

An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food.

PubMed

Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

2015-01-01

Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

Development of a Novel, Rapid Multiplex Polymerase Chain Reaction Assay for the Detection and Differentiation of Salmonella enterica Serovars Enteritidis and Typhimurium Using Ultra-Fast Convection Polymerase Chain Reaction.

PubMed

Kim, Tae-Hoon; Hwang, Hyun Jin; Kim, Jeong Hee

2017-10-01

Salmonella enterica serovars Enteritidis and Typhimurium are the most common causative agents of human nontyphoidal salmonellosis. The rapid detection and timely treatment of salmonellosis are important to increase the curative ratio and prevent spreading of the disease. In this study, we developed a rapid multiplex convection polymerase chain reaction (PCR) method to detect Salmonella spp. and differentiate Salmonella Enteritidis and Salmonella Typhimurium. We used the invA gene for Salmonella spp. detection. Salmonella Enteritidis-specific primers and Salmonella Typhimurium-specific primers were designed using the insertion element (IE) and spy genes, respectively. The primer set for Salmonella spp. detection clearly detected both Salmonella Enteritidis and Salmonella Typhimurium after a 21-min amplification reaction. Serovar-specific primer sets for Salmonella Enteritidis and Salmonella Typhimurium specifically detected each target species in a 21-min amplification reaction. We were able to detect Salmonella spp. at a single copy level in the singleplex mode. The limits of detection for Salmonella Enteritidis and Salmonella Typhimurium were 30 copies in both the singleplex and multiplex modes. The PCR run time could be reduced to 10.5 min/15 cycles. The multiplex convection PCR method developed in this study could detect the Salmonella spp. Salmonella Enteritidis and Salmonella Typhimurium in artificially contaminated milk with as few as 10 0 colony-forming unit/mL after 4-h enrichment. The PCR assay developed in this study provides a rapid, specific, and sensitive method for the detection of Salmonella spp. and the differentiation of Salmonella Enteritidis and Salmonella Typhimurium.

First report of Toxoplasma gondii sporulated oocysts and Giardia duodenalis in commercial green-lipped mussels (Perna canaliculus) in New Zealand.

PubMed

Coupe, Alicia; Howe, Laryssa; Burrows, Elizabeth; Sine, Abigail; Pita, Anthony; Velathanthiri, Niluka; Vallée, Emilie; Hayman, David; Shapiro, Karen; Roe, Wendi D

2018-05-01

Pollution of marine ecosystems with the protozoan parasites Toxoplasma gondii, Cryptosporidium spp. and Giardia duodenalis can be studied using bivalve shellfish as biosentinels. Although evidence suggests that these parasites are present in New Zealand coastal waters, the extent of protozoal pollution has not been investigated. This study used optimised molecular methods to detect the presence of Cryptosporidium spp., G. duodenalis and T. gondii in commercially sourced green-lipped mussel (Perna canaliculus), an endemic species found throughout coastal New Zealand. A nested polymerase chain reaction was validated for detection of T. gondii DNA and applied to 104 commercially sourced mussels. Thirteen mussels were positive for T. gondii DNA with an estimated true prevalence of 16.4% using Bayesian statistics, and the presence of T. gondii in mussels was significantly associated with collection during the summer compared with that in the winter (P = 0.003). Consumption of contaminated shellfish may also pose a health risk for humans and marine wildlife. As only sporulated T. gondii oocysts can be infectious, a reverse transcriptase-polymerase chain reaction was used to confirm presence of a sporozoite-specific marker (SporoSAG), detected in four mussels. G. duodenalis assemblage B, known to be pathogenic in humans, was also discovered in 1% mussels, tested by polymerase chain reaction (n = 90). Cryptosporidium spp. was not detected in the sampled mussel haemolymph. Results suggest that New Zealand may have high levels of coastal contamination with T. gondii, particularly in summer months, and that naturally exposed mussels can ingest and retain sporulated oocysts, further establishing shellfish consumption as a health concern.

QUANTIFICATION OF TRANSGENIC PLANT MARKER GENE PERSISTENCE IN THE FIELD

EPA Science Inventory

Methods were developed to monitor persistence of genomic DNA in decaying plants in the field. As a model, we used recombinant neomycin phosphotransferase II (rNPT-II) marker genes present in genetically engineered plants. Polymerase chain reaction (PCR) primers were designed, com...

CHARACTERIZATION OF SEVEN POLYMORPHIC MICROSATELLITE LOCI IN THE COMMON LOON (GAVIA IMMER)

EPA Science Inventory

We describe polymerase chain reaction (PCR) primers and conditions to amplify seven microsatellite DNA loci isolated from the Common Loon (Gavia immer). The PCR primers were tested on 83 individuals from ten locations in North America, including breeding, migration stopover, and...

New single-copy nuclear genes for scale insect systematics

USDA-ARS?s Scientific Manuscript database

Despite the advent of next-generation sequencing, the polymerase chain reaction (PCR) and Sanger sequencing remain useful tools for molecular identification and systematics. To date, molecular systematics of scale insects has been constrained by the paucity of loci that researchers have been able to...

Gene Polymorphism Studies in a Teaching Laboratory

ERIC Educational Resources Information Center

Shultz, Jeffry

2009-01-01

I present a laboratory procedure for illustrating transcription, post-transcriptional modification, gene conservation, and comparative genetics for use in undergraduate biology education. Students are individually assigned genes in a targeted biochemical pathway, for which they design and test polymerase chain reaction (PCR) primers. In this…

*A FASTER METHOD OF MEASURING RECREATIONAL WATER QUALITY FOR BETTER PROTECTION OF SWIMMER'S HEALTH

EPA Science Inventory

We previously reported that a faster method (< 2 hours) of measuring fecal indicator bacteria (FIB), based on Quantitative Polymerase Chain Reaction (QPCR), was predictive of swimming associated gastrointestinal illness. Using data from two additional beaches, we examined the re...

Molecular Diagnostic Analysis of Outbreak Scenarios

ERIC Educational Resources Information Center

Morsink, M. C.; Dekter, H. E.; Dirks-Mulder, A.; van Leeuwen, W. B.

2012-01-01

In the current laboratory assignment, technical aspects of the polymerase chain reaction (PCR) are integrated in the context of six different bacterial outbreak scenarios. The "Enterobacterial Repetitive Intergenic Consensus Sequence" (ERIC) PCR was used to analyze different outbreak scenarios. First, groups of 2-4 students determined optimal…

DEVELOPMENT OF HOMOLOGOUS VIRAL INTERNAL CONTROLS FOR USE IN RT-PCR ASSAYS OF WATERBORNE ENTERIC VIRUSES

EPA Science Inventory

Enteric viruses often contaminate water sources causing frequent outbreaks of gastroenteritis. Reverse transcription-polymerase chain reaction (RT-PCR) assays are commonly used for detection of human enteric viruses in environmental and drinking water samples. RT-PCR provides ...

75 FR 5035 - Notice of Intent To Grant Exclusive License

Federal Register 2010, 2011, 2012, 2013, 2014

2010-02-01

... DEPARTMENT OF AGRICULTURE Agricultural Research Service Notice of Intent To Grant Exclusive License AGENCY: Agricultural Research Service, USDA. ACTION: Notice of intent. SUMMARY: Notice is hereby..., ``Direct Polymerase Chain Reaction Assay, or Bio-PCR'', issued on June 25, 2002. DATES: Comments must be...

Bio-barcode gel assay for microRNA

NASA Astrophysics Data System (ADS)

Lee, Hyojin; Park, Jeong-Eun; Nam, Jwa-Min

2014-02-01

MicroRNA has been identified as a potential biomarker because expression level of microRNA is correlated with various cancers. Its detection at low concentrations would be highly beneficial for cancer diagnosis. Here, we develop a new type of a DNA-modified gold nanoparticle-based bio-barcode assay that uses a conventional gel electrophoresis platform and potassium cyanide chemistry and show this assay can detect microRNA at aM levels without enzymatic amplification. It is also shown that single-base-mismatched microRNA can be differentiated from perfectly matched microRNA and the multiplexed detection of various combinations of microRNA sequences is possible with this approach. Finally, differently expressed microRNA levels are selectively detected from cancer cells using the bio-barcode gel assay, and the results are compared with conventional polymerase chain reaction-based results. The method and results shown herein pave the way for practical use of a conventional gel electrophoresis for detecting biomolecules of interest even at aM level without polymerase chain reaction amplification.

Usage of DNA Fingerprinting Technology for Quality Control in Molecular Lab Bench Work.

PubMed

McIntosh, Linda Y; Lal, Janella E; Qin, Dahui

2018-01-01

One of the major quality assurance (QA) goals in many molecular laboratories is to avoid sample pipetting errors on the lab bench; especially when pipetting into multiwell plates. A pipetting error can cause a switch in patient samples, which can lead to recording the wrong results for the patient samples involved. Such pipetting errors are difficult to identify when it happens in lab bench work. DNA fingerprinting is a powerful tool in determining sample identities. Our laboratory has explored the usage of this technology in our QA process and successfully established that DNA fingerprinting can be used to monitor possible sample switch in gene rearrangement lab bench work. We use florescent light to quench the florescence in the gene rearrangement polymerase chain reaction products. After that, DNA fingerprinting technology is used to identify the sample DNA in the gene rearrangement polymerase chain reaction plate. The result is compared with the corresponding patient's blood sample DNA to determine whether there is a sample switch during the lab bench work.

Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction.

PubMed

Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

2008-07-23

A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

Diagnosis of Gestational, Congenital, and Placental Malaria in Colombia: Comparison of the Efficacy of Microscopy, Nested Polymerase Chain Reaction, and Histopathology

PubMed Central

Campos, Ivón M.; Uribe, Mary L.; Cuesta, Carolina; Franco-Gallego, Alexander; Carmona-Fonseca, Jaime; Maestre, Amanda

2011-01-01

The technical capability of different methods to diagnose Plasmodium in maternal peripheral blood, placenta, and umbilical cord blood has not been assessed in Colombia and seldom explored in other malaria-endemic regions. We designed a study to compare the technical and the operational-economical performances of light microscopy (LM), nested polymerase chain reaction (nPCR), and histopathology (HP). In maternal blood, LM had 41% sensitivity and 100% specificity and in placental blood, 35% and 100%, respectively, compared with nPCR. In placental tissue, LM had 33% sensitivity and 95% specificity; and nPCR 47% and 77%, respectively; compared with HP. Light microscopy had the best operational-economical qualification. We concluded that nPCR and HP performed better compared with LM, but field implementation of these two techniques remains a problem. Therefore, LM is recommended as the gold standard for diagnosis of gestational malaria and placental blood infection in the field. PMID:21633030

Detection of Zaire Ebola virus by real-time reverse transcription-polymerase chain reaction, Sierra Leone, 2014.

PubMed

Liu, Licheng; Sun, Yang; Kargbo, Brima; Zhang, Chuntao; Feng, Huahua; Lu, Huijun; Liu, Wenseng; Wang, Chengyu; Hu, Yi; Deng, Yongqiang; Jiang, Jiafu; Kang, Xiaoping; Yang, Honglei; Jiang, Yongqiang; Yang, Yinhui; Kargbo, David; Qian, Jun; Chen, Weijun

2015-09-15

During the 2014 Ebola virus disease (EVD) outbreak, a real-time quantitative polymerase chain reaction was established to detect and identify the Zaire Ebola virus. We describe the use of this assay to screen 315 clinical samples from EVD suspected person in Sierra Leone. The detection rate in blood samples was 77.81% (207/266), and there were relatively higher detection rate (79.32% and 81.42%, respectively) during the first two weeks after onset of symptoms. In the two weeks that followed, the detection rate declined to 66.67% and 25.00%, respectively. There was the highest virus load at the first week and then decreased. The detection rate in swab samples was 89.79% (44/49). This may be benefit from the included patients. 46 of 49 swab samples were collected from died patients. Taken together, the results presented here indicate that the assay specifically and sensitively detects Zaire Ebola virus. Copyright © 2015 Elsevier B.V. All rights reserved.

Multiplex polymerase chain reaction detection of black-pigmented bacteria in infections of endodontic origin.

PubMed

Seol, Jung-Hwan; Cho, Byung-Hoon; Chung, Chong-Pyoung; Bae, Kwang-Shik

2006-02-01

The purpose of this study was to detect the presence of Porphyromonas endodontalis, P. gingivalis, Prevotella intermedia, P. nigrescens, and P. tannerae from clinical samples using multiplex polymerase chain reactions (PCR). Two different multiplex PCR protocols were used (one for the two Porphyromonas species and the other for the three Prevotella species), each one using a primer pair specific for each target species. The results were compared to those of the conventional culture procedures. Microbial samples were taken aseptically from 40 infected root canals and abscesses from patients. Samples were cultured in an anaerobic condition for conventional identification using a Rapid ID 32 A kit. Multiplex PCR was processed using the DNA extracted from each sample. At least one of the five species of black-pigmented bacteria (BPB) were detected in 65% (26 of 40) of the samples using multiplex PCR, and in 15% (6 of 40) using the conventional culture procedures. Multiplex PCR was more rapid, sensitive, specific, and effective in detecting BPB than the conventional culture procedures.

Detection of Porphyromonas endodontalis in infected root canals by 16S rRNA gene-directed polymerase chain reaction.

PubMed

Machado de Oliveira, J C; Siqueira, J F; Alves, G B; Hirata, R; Andrade, A F

2000-12-01

Porphyromonas endodontalis has been isolated from the endodontic infections mainly in symptomatic teeth. This study evaluated the occurrence of P. endodontalis in both symptomatic and asymptomatic endodontic infections using 16S rRNA gene-directed polymerase chain reaction. P. endodontalis was detected in 39.5% of the cases (17 of 43 teeth). It was present in 4 of the 6 cases with acute periradicular abscess (66.7%) and in 13 of the 37 other cases (35.1%). The presence of P. endodontalis was associated with an asymptomatic periradicular lesion in 6 cases (25%) and in 10 teeth with tenderness to percussion (52.6%). P. endodontalis was also found in one asymptomatic case without evidence of periradicular pathosis. Our results indicated that, although P. endodontalis is commonly detected in symptomatic cases, it can be present in asymptomatic root canal infections. Further studies should determine if this bacterial species is really an important endodontopathogen.

Enhanced detection of intracellular organism of swine proliferative enteritis, ileal symbiont intracellularis, in feces by polymerase chain reaction.

PubMed Central

Jones, G F; Ward, G E; Murtaugh, M P; Lin, G; Gebhart, C J

1993-01-01

A sensitive assay based on amplification of a 319-bp DNA fragment of the intracellular bacterium of swine proliferative enteritis was developed for the detection of the organism in the feces of swine. A vernacular name, ileal symbiont intracellularis (IS-intracellularis), has recently been published for the intracellular bacterium, which was formerly known as a Campylobacter-like organism (C.J. Gebhart, S.M. Barnes, S. McOrist, G.F. Lin, and G.H.K. Larson, Int. J. Syst. Bacteriol. 43:533-538, 1993). As few as 10(1) IS-intracellularis organisms purified from intestinal mucosa, or 10(3) IS-intracellularis per g of feces, were detected. No amplification product was produced from a polymerase chain reaction performed on DNA extracted from the feces of healthy pigs. A 319-bp DNA fragment specific for IS-intracellularis was produced on amplification of DNA from the feces of pigs with experimental and naturally occurring proliferative enteritis. Images PMID:8253956

Four-hour quantitative real-time polymerase chain reaction-based comprehensive chromosome screening and accumulating evidence of accuracy, safety, predictive value, and clinical efficacy.

PubMed

Treff, Nathan R; Scott, Richard T

2013-03-15

Embryonic comprehensive chromosomal euploidy may represent a powerful biomarker to improve the success of IVF. However, there are a number of aneuploidy screening strategies to consider, including different technologic platforms with which to interrogate the embryonic DNA, and different embryonic developmental stages from which DNA can be analyzed. Although there are advantages and disadvantages associated with each strategy, a series of experiments producing evidence of accuracy, safety, clinical predictive value, and clinical efficacy indicate that trophectoderm biopsy and quantitative real-time polymerase chain reaction (qPCR)-based comprehensive chromosome screening (CCS) may represent a useful strategy to improve the success of IVF. This Biomarkers in Reproductive Medicine special issue review summarizes the accumulated experience with the development and clinical application of a 4-hour blastocyst qPCR-based CCS technology. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frank F. Roberto

2008-08-01

Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means ofmore » rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.« less

Actinomyces israelii in radicular cysts: a molecular study.

PubMed

Gomes, Nathália Rodrigues; Diniz, Marina Gonçalves; Pereira, Thais Dos Santos Fontes; Estrela, Carlos; de Macedo Farias, Luiz; de Andrade, Bruno Augusto Benevenuto; Gomes, Carolina Cavaliéri; Gomez, Ricardo Santiago

2017-05-01

To investigate whether the microscopic filamentous aggregates observed in radicular cysts are associated with the molecular identification of Actinomyces israelii. Moreover, to verify whether this bacterium can be detected in radicular cyst specimens not presenting aggregates. Microscopic colonies suggestive of Actinomyces were found in 8 out of 279 radicular cyst samples (case group). The case and control groups (n = 12; samples without filamentous colonies) were submitted to the semi-nested polymerase chain reaction to test the presence of A israelii. DNA sequencing was performed to validate polymerase chain reaction results. Two and 3 samples in the case and control groups, respectively, did not present a functional genomic DNA template and were excluded from the study. A israelii was identified in all samples of the case group and in 3 out of 9 samples of the control group. Although A israelii is more commonly identified in radicular cysts presenting filamentous aggregates, it also appears to be detected in radicular cysts without this microscopic finding. Copyright © 2017 Elsevier Inc. All rights reserved.

Identification of the people from whom engorged Aedes aegypti took blood meals in Florida, Puerto Rico, using polymerase chain reaction-based DNA profiling.

PubMed

De Benedictis, John; Chow-Shaffer, Esther; Costero, Adriana; Clark, Gary G; Edman, John D; Scott, Thomas W

2003-04-01

We used polymerase chain reaction-based DNA profiling to construct allelic profiles for residents and visitors of 22 houses in Florida, Puerto Rico, and human DNA from blood meals in Aedes aegypti that were collected in those homes. Complete profiles were obtained for < or = 2 days after blood ingestion. Eighteen percent of the meals came from two different people. There was no evidence of meals from > or = 2 people. Eighty percent of the meal sources were identified, > 70% were taken from residents of the collection house, and > 90% were from residents of the study community. Across the community, feeding was non-random with a bias towards young adults and males. Three people accounted for 56% of the meals. Our results confirm that multiple feeding on different people is an important component in the role of Ae. aegypti in dengue virus transmission and help explain the spatial distribution of dengue cases in a previous epidemic in Florida, Puerto Rico.

Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis

PubMed Central

Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y.; Whelen, A. Christian; Calimlim, Precilia S.; Sciulli, Rebecca H.; Honda, Stacey A. A.; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M.; da Silva, Alexandre J.

2016-01-01

Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. PMID:26526920

Genetic diversity of Chlamydia among captive birds from central Argentina.

PubMed

Frutos, María C; Monetti, Marina S; Vaulet, Lucia Gallo; Cadario, María E; Fermepin, Marcelo Rodríguez; Ré, Viviana E; Cuffini, Cecilia G

2015-01-01

To study the occurrence of Chlamydia spp. and their genetic diversity, we analysed 793 cloacal swabs from 12 avian orders, including 76 genera, obtained from 80 species of asymptomatic wild and captive birds that were examined with conventional nested polymerase chain reaction and quantitative polymerase chain reaction. Chlamydia spp. were not detected in wild birds; however, four species (Chlamydia psittaci, Chlamydia pecorum, Chlamydia pneumoniae and Chlamydia gallinacea) were identified among captive birds (Passeriformes, n = 20; Psittaciformes, n = 15; Rheiformes, n = 8; Falconiformes n = 2; Piciformes n = 2; Anseriformes n = 1; Galliformes n = 1; Strigiformes n = 1). Two pathogens (C. pneumoniae and C. pecorum) were identified simultaneously in samples obtained from captive birds. Based on nucleotide-sequence variations of the ompA gene, three C. psittaci-positive samples detected were grouped into a cluster with the genotype WC derived from mammalian hosts. A single positive sample was phylogenetically related to a new strain of C. gallinacea. This report contributes to our increasing understanding of the abundance of Chlamydia in the animal kingdom.

Rectal Lymphogranuloma Venereum in HIV-infected Patients Can Mimic Lymphoma.

PubMed

Crickx, Etienne; Meignin, Véronique; Gérard, Laurence; Plantier-Colcher, Isabelle; Walker-Combrouze, Francine; Boutboul, David; Galicier, Lionel; Fieschi, Claire; Oksenhendler, Eric

2016-01-01

An outbreak of rectal lymphogranuloma venereum (LGV) has been reported since 2003 in men who have sex with men, most of them being infected with human immunodeficiency virus. In these patients, unusual clinical presentations such as rectal tumor or intense lymphoproliferation on rectal biopsies may lead to an erroneous diagnosis of aggressive non-Hodgkin lymphoma. Three patients were referred to our center for the management of rectal B-cell non-Hodgkin lymphoma on the basis of a rectal pathologic specimen showing intense lymphoproliferation, the very suspect of lymphoma. Because of anamnesis of anal intercourses and venereal diseases, additional study revealed that all 3 had a positive Chlamydia trachomatis polymerase chain reaction on the rectal biopsy specimen. Rectal LGV was therefore considered and successfully treated with antibiotics. We propose that all patients presenting with a suspected rectal lymphoma should have a careful anamnesis of sexual behavior and a specific detection of C. trachomatis using polymerase chain reaction analysis on biopsy specimen to rule out the possibility of rectal LGV.

Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP).

PubMed

Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis

2016-06-01

Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters. Copyright © 2016 Elsevier B.V. All rights reserved.

Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

NASA Astrophysics Data System (ADS)

Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

1989-04-01

The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

Transfusion-transmitted babesiosis in an immunocompromised patient: a case report and review.

PubMed

Wudhikarn, Kitsada; Perry, Elizabeth H; Kemperman, Melissa; Jensen, Kathy A; Kline, Susan E

2011-09-01

Babesiosis is a tick- and transfusion-borne disease caused by intraerythrocytic Babesia parasites. In 2009, a 61-year-old Minnesota woman with chronic lymphocytic leukemia and a history of recent chemotherapy and numerous blood transfusions for gastrointestinal bleeding became febrile and anemic 12 days postsplenectomy. Babesia were visualized on blood smears, confirmed by polymerase chain reaction as B. microti. She developed respiratory failure despite initiation of clindamycin and quinine, and required 12 weeks of azithromycin and atovaquone before blood smear and polymerase chain reaction findings were negative. Serologic evidence of B. microti infection was identified in 1 associated blood donor and 1 other recipient of that donor's blood. Babesia infection can be asymptomatic or cause mild to fulminant disease resulting in multiorgan failure or death. Patients with advanced age, asplenia, or other immune compromise are at risk for severe babesiosis and may require prolonged treatment to eradicate parasitemia. Incidence of transfusion-transmitted babesiosis has increased over the past decade. Copyright © 2011 Elsevier Inc. All rights reserved.

Evidence of simian retrovirus type D by polymerase chain reaction.

PubMed

Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A

2017-06-01

Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

DD genotype of ace gene I/D polymorphism is associated in a Turkish study population with osteoarthritis.

PubMed

Bayram, Banu; Sayın, Emrah; Güneş, Hasan Veysi; Değirmenci, Irfan; Türkoğlu, Züleyha; Doganer, Fulya; Coşan, Didem Turgut

2011-03-01

This study was conducted in Turkish osteoarthritis patients to determine the frequency of I/D polymorphism genotypes of angiotensin converting enzyme gene, and to examine the role of this polymorphism in osteoarthritis development. Genomic DNA obtained from 200 persons (135 patients with osteoarthritis and 65 healthy controls) was used in the study. DNA was multiplied by polymerase chain reaction using I and D allele-specific primers. Polymerase chain reaction products were assessed with CCD camera by being exposed to 2% agarose gel electrophoresis. There was statistically significant difference between the groups with respect to genotype distribution (P < 0.001). The D allele frequency was indicated as 69% and I allele was as 31% in the patients, whereas it was 55-45% in the control group. Consequently, in this study, we may assert that ACE gene I/D polymorphism DD genotype determination is significant criteria for identifying patients who are likely to develop osteoarthritis in east population of Turkey.

[The implementation of polymerase chain reaction technique: the real time to reveal and differentiate the viruses of human papilloma of high carcinogenic risk].

PubMed

Andosova, L D; Kontorshchikova, K N; Blatova, O L; Kudel'kina, S Iu; Kuznetsova, I A; Belov, A V; Baĭkova, R A

2011-07-01

The polymerase chain reaction technique was applied in "real time" format to evaluate the occurrence rate and infection ratio of various genotypes of human papilloma of high carcinogenic risk in virus-positive women and contact persons. The examination sampling consisted of 738 women aged of 17-50 years. The examination results permitted to establish high percentage of infection of 546 patients (74%) by carcinogenic papilloma viruses. The analysis of detection rate of various genotypes of human papilloma of high carcinogenic risk established that the 56th and 16th types of high carcinogenic risk are revealed more often than others--in 33% and 15.4% correspondingly. In males, first place in occurrence rate is for those types of virus of human papilloma: the 56th n = 10 (33.3%), 16th n = 3 (10%), 45th n = 3 (10%), 51th n = 3 (10%). The rest of genotypes are detected in 3-7% cases.

Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

PubMed

Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

2009-10-01

Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.

Detection and identification of cutaneous leishmaniasis isolates by culture, Polymerase chain reaction and sequence analyses in Syrian and Central Anatolia patients.

PubMed

Beyhan, Yunus E; Karakus, Mehmet; Karagoz, Alper; Mungan, Mesut; Ozkan, Aysegul T; Hokelek, Murat

2017-09-01

To characterize the cutaneous leishmaniasis (CL) isolates of Syrian and Central Anatolia patients at species levels. Methods: Skin scrapings of 3 patients (2 Syrian, 1 Turkish) were taken and examined by direct examination, culture in Novy-MacNeal-Nicole (NNN) medium, internal transcribed spacer polymerase chain reaction and sequence analysis (PCR). Results:According to microscopic examination, culture and PCR methods, 3 samples were detected positive. The sequencing results of all isolates in the study were identified as Leishmania tropica. The same genotypes were detected in the 3 isolates and nucleotide sequence submitted into GenBank with the accession number: KP689599. Conclusion: This finding could give information about the transmission of CL between Turkey and Syria. Because of the Syrian civil war, most of the Syrian citizens circulating in Turkey and different part of Europe, this can be increase the risk of spreading the disease. So, prevention measurements must be taken urgently.

HSV2 acute retinal necrosis: diagnosis and monitoring with quantitative polymerase chain reaction.

PubMed

Cottet, L; Kaiser, L; Hirsch, H H; Baglivo, E

2009-06-01

To describe a case of HSV2 acute retinal necrosis (ARN) diagnosed and monitored with quantitative polymerase chain reaction (PCR) in ocular fluids. Case report. Quantitative PCR was performed in the aqueous humor (AH) and vitreous using primers specific for herpes virus. A positive PCR was found for HSV2 in the AH (>100,000,000 viral copies - 8.00 log/ml). After therapy, another anterior chamber tap showed a reduction of the viral load at 4.28 log/ml (19205 copies), confirming the efficacy of the treatment. After six months, PCR on the vitreous still showed the presence of HSV2 viral particles in the eye (3.14 log DNA copies/ml, 1379 copies) although the lesion was healed. This case demonstrates that PCR is useful to detect viral DNA in AH and vitreous and to monitor viral activity and therapeutic response. Viral DNA persists in ocular fluids for months in the presence of a healed infection.

Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum.

PubMed

Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

2014-01-01

A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.

[Usefulness of conventional polymerase chain reaction for the detection of Mycoplasma hominis, Ureaplasma spp. and Trichomonas vaginalis in female outpatient's genital samples].

PubMed

Alarcón, Gonzalo; Barraza, Gabriela; Vera, Andrea; Wozniak, Aniela; García, Patricia

2016-02-01

Trichomonas vaginalis, Mycoplasma hominis and Ureaplasma spp. are microorganisms responsible for genitourinary and pregnancy pathologies. Nucleic acid amplification methods have shown several advantages, but have not been widely studied for the detection of these microorganisms. To implement a conventional polymerase chain reaction (PCR) for the detection of the microorganisms and to compare its results versus the methods currently used at our laboratory. 91 available samples were processed by PCR, culture (M. hominis y Ureaplasma spp.) and wet mount (T vaginalis). Results were compared and statistically analyzed by kappa agreement test. 85, 80 and 87 samples resulted in agreement for the detection of M. hominis, Ureaplasma spp. y T. vaginalis, respectively. For M. hominis and Ureaplasma spp., agreement was substantial, whereas for T. vaginalis it was moderate, however, for the latter, PCR detected more cases than wet mount. We recommend the implementation of PCR for detection of T. vaginalis whereas culture kit is still a useful method for the other microorganisms.

The actin multigene family and livestock speciation using the polymerase chain reaction.

PubMed

Fairbrother, K S; Hopwood, A J; Lockley, A K; Bardsley, R G

1998-01-01

Actins constitute a family of highly-conserved multifunctional intracellular proteins, best known as myofibrillar components in striated muscle fibres. Most vertebrate genomes contain numerous actin genes with high sequence homology in protein coding regions but considerable variability in intron number and sizes. This genetic diversity can be utilised for livestock speciation purposes. The high sequence conservation has enabled a single pair of oligonucleotides to be used to prime the polymerase chain reaction (PCR) with DNA extracted from all animals so far studied. Multiple amplification products were obtained which on gel electrophoresis constituted characteristic species-specific 'fingerprints'. The patterns were reproducible, did not vary between individuals of the same breed or between different breeds within a species, and could be generated even from heat-processed muscle held at 120 degrees C for one hour. Given the capacity of PCR to amplify relatively short sequences in highly-degraded DNA, this approach may be suitable for authentication of processed meat products.

Polymerase chain reaction for detection of Leptospira spp. in clinical samples.

PubMed Central

Mérien, F; Amouriaux, P; Perolat, P; Baranton, G; Saint Girons, I

1992-01-01

A sensitive assay for Leptospira spp., the causative agent of leptospirosis, was developed on the basis of the polymerase chain reaction (PCR). A 331-bp sequence from the Leptospira interrogans serovar canicola rrs (16S) gene was amplified, and the PCR products were analyzed by DNA-DNA hybridization by using a 289-bp fragment internal to the amplified DNA. Specific PCR products also were obtained with DNA from the closely related nonpathogenic Leptospira biflexa but not with DNA from other spirochetes, such as Borrelia burgdorferi, Borrelia hermsii, Treponema denticola, Treponema pallidum, Spirochaeta aurantia, or more distant organisms such as Escherichia coli, Staphylococcus aureus, Mycobacterium tuberculosis, and Proteus mirabilis. The assay was able to detect as few as 10 bacteria. Leptospira DNA was detected in urine from experimentally infected mice. In addition, the test was found to be suitable for diagnosing leptospirosis in humans. Cerebrospinal fluid and urine from patients with leptospirosis were positive, whereas samples from control uninfected patients were negative. Images PMID:1400983

Development of a polymerase chain reaction-based assay for the detection of Alternaria fungal contamination in food products.

PubMed

Zur, G; Hallerman, E M; Sharf, R; Kashi, Y

1999-10-01

Alternaria sp. are important fungal contaminants of vegetable, fruit, and grain products, including Alternaria alternata, a contaminant of tomato products. To date, the Howard method, based on microscopic observation of fungal filaments, has been the standard examination for inspection of tomato products. We report development of a polymerase chain reaction (PCR)-based method for detection of Alternaria DNA. PCR primers were designed to anneal to the internal transcribed regions ITS1 and ITS2 of the 5.8S rRNA gene of Alternaria but not to other microbial or tomato DNA. We demonstrate use of the PCR assay to detect Alternaria DNA in experimentally infested and commercially obtained tomato sauce and tomato powder. Use of the PCR method offers a rapid and sensitive assay for the presence of Alternaria DNA in tomato products. The apparent breakdown of DNA in tomato sauce may limit the utility of the assay to freshly prepared products. The assay for tomato powder is not affected by storage time.

A real-time TaqMan polymerase chain reaction for the identification of Culex vectors of West Nile and Saint Louis encephalitis viruses in North America.

PubMed

Sanogo, Yibayiri O; Kim, Chang-Hyun; Lampman, Richard; Novak, Robert J

2007-07-01

In North America, West Nile and St. Louis encephalitis viruses have been detected in a wide range of vector species, but the majority of isolations continue to be from pools of mixed mosquitoes in the Culex subgenus Culex. Unfortunately, the morphologic identification of these important disease vectors is often difficult, particularly in regions of sympatry. We developed a sensitive real-time TaqMan polymerase chain reaction assay that allows reliable identification of Culex mosquitoes including Culex pipiens pipiens, Cx. p. quinquefasciatus, Cx. restuans, Cx. salinarius, Cx. nigripalpus, and Cx. tarsalis. Primers and fluorogenic probes specific to each species were designed based on sequences of the acetylcholinesterase gene (Ace2). Both immature and adult mosquitoes were successfully identified as individuals and as mixed species pools. This identification technique provides the basis for a rapid, sensitive, and high-throughput method for expounding the species-specific contribution of vectors to various phases of arbovirus transmission.

A Comparative Analysis of Polymerase Chain Reaction and Direct Fluorescent Antibody Test for Diagnosis of Genital Herpes.

PubMed

Patwardhan, Vrushali; Bhalla, Preena; Rawat, Deepti; Garg, Vijay Kumar; Sardana, Kabir; Sethi, Sumit

2017-01-01

To compare laboratory tests that can simultaneously detect and type herpes simplex virus (HSV) directly from the genital ulcer specimens in clinically suspected cases of genital herpes. A study was conducted over 10 months and 44 adult male and female patients clinically suspected with genital herpes were recruited. Genital ulcer swab specimens were subjected to glycoprotein-G gene-based conventional polymerase chain reaction (PCR) and commercially available direct fluorescent antibody (DFA) test and the results were compared. PCR for HSV was positive in 82% (36/44) cases. DFA was positive in 68.2% (30/44) cases. There was 100% agreement between HSV types detected by DFA and PCR. The strength of agreement between the results was better in primary genital herpes than recurrent cases. PCR was found to be better in the detection of HSV in recurrent genital herpes patients. It is a better modality, especially when genital herpes clinically presents with ulcerative or crusted lesions, and is also a cheaper alternative as compared to DFA.

Identification of 29 Rat Genetic Markers by Arbitrarily Primed Polymerase Chain Reaction

PubMed Central

Canzian, Federico; Toyota, Minoru; Hosoya, Yoko; Sugimura, Takashi; Nagao, Minako

1996-01-01

The number of genetic markers for the rat is still limited, in spite of its wide use in cancer research. To facilitate accurate mapping of both established and novel rat genetic markers, we constructed a linkage map by genotyping 105 F2 rats from ACI/N (ACI) and BUF/Nac (BUF) crosses. This map consists of 120 genetic markers that had been previously reported, mainly by two research groups, but had not been integrated. To find new genetic markers, the arbitrarily primed polymerase chain reaction (AP‐PCR) was applied to detect polymorphic bands between ACI and BUF rats. After testing 56 single primers and 12 combinations of primers, we found 36 bands produced by 16 single primers and two combinations to be reliably polymorphic between ACI and BUF rats. The 36 bands were typed in the 105 F2 rats, and 29 of them could be linkage‐mapped. AP‐PCR is thus useful to detect new genetic markers in laboratory strains of rats. PMID:8698613

Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo

PubMed Central

Yang, Jin-Long; Cheng, An-Chun; Wang, Ming-Shu; Pan, Kang-Cheng; Li, Min; Guo, Yu-Fei; Li, Chuan-Feng; Zhu, De-Kang; Chen, Xiao-Yue

2009-01-01

Background Goose parvovirus (GPV) is a Dependovirus associated with latent infection and mortality in geese. Currently, it severely affects geese production worldwide. The objective of this study was to develop a fluorescent quantitative real-time polymerase chain reaction (PCR) (FQ-PCR) assay for fast and accurate quantification of GPV DNA in infected goslings, which can aid in the understanding of the regular distribution pattern and the nosogenesis of GPV in vivo. Results The detection limit of the assay was 2.8 × 101 standard DNA copies, with a sensitivity of 3 logs higher than that of the conventional gel-based PCR assay targeting the same gene. The real-time PCR was reproducible, as shown by satisfactory low intraassay and interassay coefficients of variation. Conclusion The high sensitivity, specificity, simplicity, and reproducibility of the GPV fluorogenic PCR assay, combined with a high throughput, make this method suitable for a broad spectrum of GPV etiology-related applications. PMID:19754946

Detection of the reemerging agent Burkholderia mallei in a recent outbreak of glanders in the United Arab Emirates by a newly developed fliP-based polymerase chain reaction assay.

PubMed

Scholz, Holger C; Joseph, Marina; Tomaso, Herbert; Al Dahouk, Sascha; Witte, Angela; Kinne, Joerg; Hagen, Ralph M; Wernery, Renate; Wernery, Ulrich; Neubauer, Heinrich

2006-04-01

A polymerase chain reaction (PCR) assay targeting the flagellin P (fliP)-I S407A genomic region of Burkholderia mallei was developed for the specific detection of this organism in pure cultures and clinical samples from a recent outbreak of equine glanders. Primers deduced from the known fliP-IS407A sequence of B. mallei American Type Culture Collection (ATCC) 23344(T) allowed the specific amplification of a 989-bp fragment from each of the 20 B. mallei strains investigated, whereas other closely related organisms tested negative. The detection limit of the assay was 10 fg for purified DNA of B. mallei ATCC 23344(T). B. mallei DNA was also amplified from various tissues of horses with a generalized B. mallei infection. The developed PCR assay can be used as a simple and rapid tool for the specific and sensitive detection of B. mallei in clinical samples.

Development of a polymerase chain reaction assay for the specific identification of Burkholderia mallei and differentiation from Burkholderia pseudomallei and other closely related Burkholderiaceae.

PubMed

Ulrich, Ricky L; Ulrich, Melanie P; Schell, Mark A; Kim, H Stanley; DeShazer, David

2006-05-01

Burkholderia mallei and Burkholderia pseudomallei, the etiologic agents responsible for glanders and melioidosis, respectively, are genetically and phenotypically similar and are category B biothreat agents. We used an in silico approach to compare the B. mallei ATCC 23344 and B. pseudomallei K96243 genomes to identify nucleotide sequences unique to B. mallei. Five distinct B. mallei DNA sequences and/or genes were identified and evaluated for polymerase chain reaction (PCR) assay development. Genomic DNAs from a collection of 31 B. mallei and 34 B. pseudomallei isolates, obtained from various geographic, clinical, and environmental sources over a 70-year period, were tested with PCR primers targeted for each of the B. mallei ATCC 23344-specific nucleotide sequences. Of the 5 chromosomal targets analyzed, only PCR primers designed to bimA(Bm) were specific for B. mallei. These primers were used to develop a rapid PCR assay for the definitive identification of B. mallei and differentiation from all other bacteria.

Detection of Dichelobacter nodosus in wild ungulates (Capra ibex ibex and Ovis aries musimon) and domestic sheep suffering from foot rot using a two-step polymerase chain reaction.

PubMed

Belloy, Luc; Giacometti, Marco; Boujon, Patrick; Waldvogel, Andreas

2007-01-01

Severe keratinous hoof afflictions have been recorded in ibex (Capra ibex ibex) since 1995 and more recently in mouflon (Ovis aries musimon) in Switzerland. Based on clinical observations and comparison with diseases known to affect domestic ungulates, it was hypothesized these wild ungulates were affected by foot rot associated with infection with Dichelobacter nodosus. Dichelobacter nodosus has been shown to be the essential pathogen for initiation and establishment of foot rot, a highly contagious foot disease of sheep and goats. Because these bacteria could not be cultivated from affected ibex, we developed a nested polymerase chain reaction that allowed detection of D. nodosus without culture. Using this assay, we were able to diagnose D. nodosus infections of ibex, mouflon, and domestic sheep in natural outbreaks. From these results we conclude that D. nodosus plays an etiological role in foot rot not only in domestic but also in wild Caprinae.

Novel cytochrome P450 genes, CYP6EB1 and CYP6EC1, are over-expressed in acrinathrin-resistant Frankliniella occidentalis (Thysanoptera: Thripidae).

PubMed

Cifuentes, D; Chynoweth, R; Guillén, J; De la Rúa, P; Bielza, P

2012-06-01

Control of Frankliniella occidentalis (Pergande) is a serious problem for agriculture all over the world because of the limited range of insecticides that are available. Insecticide resistance in F. occidentalis has been reported for all major insecticide groups. Our previous studies showed that cytochrome P450-mediated detoxification is a major mechanism responsible for insecticide resistance in this pest. Degenerate polymerase chain reaction was used to identify P450 genes that might be involved in acrinathrin resistance, in a laboratory population of F. occidentalis. Associated sequences were classified as belonging to the CYP4 and CYP6 families. Real-time quantitative polymerase chain reaction analyses revealed that two genes, CYP6EB1 and CYP6EC1, were over-expressed in adults and L2 larvae of the resistant population, when compared with the susceptible population, suggesting their possible involvement in resistance to acrinathrin.

Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.

PubMed

Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry

2012-11-16

The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.

Polymerase Chain Reaction Pool Screening Used To Compare Prevalence of Infective Black Flies in Two Onchocerciasis Foci in Northern Sudan

PubMed Central

Higazi, Tarig B.; Zarroug, Isam M. A.; Mohamed, Hanan A.; Mohamed, Wigdan A.; Deran, Tong Chor M.; Aziz, Nabil; Katabarwa, Moses; Hassan, Hassan K.; Unnasch, Thomas R.; Mackenzie, Charles D.; Richards, Frank

2011-01-01

Onchocerciasis remains an important debilitating disease in many areas of Africa, including Sudan. The status of infection transmission in 2007 was assessed in the vectors of two disease foci in Sudan: Abu Hamed in northern Sudan, which has received at least 10 years of annual treatment and Galabat focus in eastern Sudan, where only minor, largely undocumented treatment activity has occurred. Assessment of more than 30,000 black flies for Onchocerca volvulus infectious stage L3 larvae by using an O-150 polymerase chain reaction protocol showed that black fly infectivity rates were 0.84 (95% confidence interval = 0.0497–1.88) per 10,000 flies for Abu Hamed and 6.9 (95% confidence interval = 1.1–16.4) infective flies per 10,000 for Galabat. These results provide entomologic evidence for suppressed Onchocerca volvulus transmission in the Abu Hamed focus and a moderate transmission rate of the parasite in the Galabat focus. PMID:21540385

Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

PubMed

Rathinam, T; Gadde, U; Chapman, H D

2015-07-01

Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.

Interobserver variability and feasibility of polymerase chain reaction-based assay in distinguishing ischemic colitis from Clostridium difficile colitis in endoscopic mucosal biopsies.

PubMed

Wiland, Homer O; Procop, Gary W; Goldblum, John R; Tuohy, Marion; Rybicki, Lisa; Patil, Deepa T

2013-06-01

Polymerase chain reaction (PCR)-based assays using stool samples are currently the most effective method of detecting Clostridium difficile. This study examines the feasibility of this assay using mucosal biopsy samples and evaluates the interobserver reproducibility in diagnosing and distinguishing ischemic colitis from C difficile colitis. Thirty-eight biopsy specimens were reviewed and classified by 3 observers into C difficile and ischemic colitis. The findings were correlated with clinical data. PCR was performed on 34 cases using BD GeneOhm C difficile assay. The histologic interobserver agreement was excellent (κ= 0.86) and the agreement between histologic and clinical diagnosis was good (κ = 0.84). All 19 ischemic colitis cases tested negative (100% specificity) and 3 of 15 cases of C difficile colitis tested positive (20% sensitivity). C difficile colitis can be reliably distinguished from ischemic colitis using histologic criteria. The C difficile PCR test on endoscopic biopsy specimens has excellent specificity but limited sensitivity.

Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources.

PubMed

Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

2017-01-01

Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli . PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources.

Electrochemical product detection of an asymmetric convective polymerase chain reaction.

PubMed

Duwensee, Heiko; Mix, Maren; Stubbe, Marco; Gimsa, Jan; Adler, Marcel; Flechsig, Gerd-Uwe

2009-10-15

For the first time, we describe the application of heated microwires for an asymmetric convective polymerase chain reaction (PCR) in a modified PCR tube in a small volume. The partly single-stranded product was labeled with the electrochemically active compound osmium tetroxide bipyridine using a partially complementary protective strand with five mismatches compared to the single-stranded product. The labeled product could be successfully detected at a gold electrode modified with a complementary single-stranded capture probe immobilized via a thiol-linker. Our simple thermo-convective PCR yielded electrochemically detectable products after only 5-10 min. A significant discrimination between complementary and non-complementary target was possible using different immobilized capture probes. The total product yield was approx. half the amount of the classical thermocycler PCR. Numerical simulations describing the thermally driven convective PCR explain the received data. Discrimination between complementary capture probes and non-complementary capture probes was performed using square-wave voltammetry. The coupling of asymmetric thermo-convective PCR with electrochemical detection is very promising for future compact DNA sensor devices.

Allele and genotype frequencies of polymorphisms in cytokine genes in ethnic Russian individuals from Moscow, Russia.

PubMed

Shadrina, Alexandra; Voronina, Elena; Zolotukhin, Igor; Filipenko, Maxim

2017-02-01

Two hundred and twenty eight ethnic Russian individuals from Moscow, Russia, were genotyped at 14 single nucleotide polymorphisms CCL2 A-2578G; VEGFA C-2578A, G-634C, and C+936T; TNF G+419A and G-308A; IL1A G-889A; IL1RN T+1018C; IL6G-174C and G-572C; IFNG T+874A; IL1B C-511T; IL10 A+1082G; TGFB1 C-509T. Genotypes were determined using real-time polymerase chain reaction with TaqMan probes and polymerase chain reaction followed by melting analysis of dual-labeled probe. Genotype distribution was in accordance with Hardy-Weinberg equilibrium for all studied polymorphisms. Genotype data are available in the Allele Frequencies Net Database under identifier AFND 3367 and the population name "Russia Moscow Cytokine". Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

Review of Detection of Brucella sp. by Polymerase Chain Reaction

PubMed Central

Yu, Wei Ling; Nielsen, Klaus

2010-01-01

Here we present a review of most of the currently used polymerase chain reaction (PCR)-based methods for identification of Brucella bacteria in biological samples. We focused in particular on methods using single-pair primers, multiplex primers, real-time PCRs, PCRs for marine Brucella, and PCRs for molecular biotyping. These methods are becoming very important tools for the identification of Brucella, at the species level and recently also at the biovar level. These techniques require minimum biological containment and can provide results in a very short time. In addition, genetic fingerprinting of isolates aid in epidemiological studies of the disease and its control. PCR-based methods are more useful and practical than conventional methods used to identify Brucella spp., and new methods for Brucella spp identification and typing are still being developed. However, the sensitivity, specificity, and issues of quality control and quality assurance using these methods must be fully validated on clinical samples before PCR can be used in routine laboratory testing for brucellosis. PMID:20718083

DNA typing by microbead arrays and PCR-SSP: apparent false-negative or -positive hybridization or amplification signals disclose new HLA-B and -DRB1 alleles.

PubMed

Rahal, M; Kervaire, B; Villard, J; Tiercy, J-M

2008-03-01

Human leukocyte antigen (HLA) typing by polymerase chain reaction-sequence-specific oligonucleotide (PCR-SSO) hybridization on solid phase (microbead assay) or polymerase chain reaction-sequence-specific primers (PCR-SSP) requires interpretation softwares to detect all possible allele combinations. These programs propose allele calls by taking into account false-positive or false-negative signal(s). The laboratory has the option to validate typing results in the presence of strongly cross-reacting or apparent false-negative signals. Alternatively, these seemingly aberrant signals may disclose novel variants. We report here four new HLA-B (B*5620 and B*5716) and HLA-DRB1 alleles (DRB1*110107 and DRB1*1474) that were detected by apparent false-negative or -positive hybridization or amplification patterns, and ultimately resolved by sequencing. To avoid allele misassignments, a comprehensive evaluation of acquired data as documented in a quality assurance system is therefore required to confirm unambiguous typing interpretation.

Amebic Liver Abscess Diagnosed by Polymerase Chain Reaction in 14 Returning Travelers

PubMed Central

Vallois, Dorothée; Epelboin, Loïc; Touafek, Feriel; Magne, Denis; Thellier, Marc; Bricaire, François; Caumes, Eric

2012-01-01

Amebic liver abscesses (ALA) are not commonly described in travelers. The ALA diagnosis is usually based on serology and Entamoeba histolytica polymerase chain reaction (PCR) is a new tool. We retrospectively reviewed all ALA cases diagnosed by PCR on the liver abscess pus aspirate of patients admitted in French hospitals between 2007 and 2011. Fourteen cases (10 male, median age 48 years) were included. The median lag time between return and onset of symptoms was 23 days (interquartile range [IQ] 18–24). All patients had an elevated cardiopulmonary resuscitation level, and 11 had leukocytosis. The ALA was multiple in five patients, localized in the right lobe in 12, and higher than 5 cm in 11. Serology was initially negative in one patient, whereas PCR was positive. There was bacterial co-infection in one patient. The outcome was good. Liver puncture allows a rapid diagnosis of ALA with PCR and helps identify the association with a bacterial dual infection. PMID:23033402

The Collaborative Ocular Tuberculosis Study (COTS)-1 Report 3: Polymerase Chain Reaction in the Diagnosis and Management of Tubercular Uveitis: Global Trends.

PubMed

Agarwal, Aniruddha; Agrawal, Rupesh; Gunasekaran, Dinesh Visva; Raje, Dhananjay; Gupta, Bhaskar; Aggarwal, Kanika; Murthy, Somasheila L; Westcott, Mark; Chee, Soon Phaik; Mccluskey, Peter; Su Ling, Ho; Teoh, Stephen; Cimino, Luca; Biswas, Jyotirmay; Narain, Shishir; Agarwal, Manisha; Mahendradas, Padmamalini; Khairallah, Moncef; Jones, Nicholas; Tugal-Tutkun, Ilknur; Babu, Kalpana; Basu, Soumayava; Carreño, Ester; Lee, Richard; Al-Dhibi, Hassan; Bodaghi, Bahram; Invernizzi, Alessandro; Goldstein, Debra A; Herbort, Carl P; Barisani-Asenbauer, Talin; González-López, Julio J; Androudi, Sofia; Bansal, Reema; Moharana, Bruttendu; Mahajan, Sarakshi; Esposti, Simona; Tasiopoulou, Anastasia; Nadarajah, Sengal; Agarwal, Mamta; Abraham, Sharanya; Vala, Ruchi; Singh, Ramandeep; Sharma, Aman; Sharma, Kusum; Zierhut, Manfred; Kon, Onn Min; Cunningham, Emmett; Nguyen, Quan Dong; Pavesio, Carlos; Gupta, Vishali

2017-12-20

To analyze the role of polymerase chain reaction (PCR) of ocular fluids in management of tubercular (TB) anterior, intermediate, posterior, and panuveitis. In Collaborative Ocular Tuberculosis Study (COTS)-1 (25 centers, n = 962), patients with TB-related uveitis were included. 59 patients undergoing PCR of intraocular fluids (18 females; 53 Asian Indians) were included. 59 (6.13%) of COTS-1 underwent PCR analysis. PCR was positive for Mycobacterium TB in 33 patients (23 males; all Asian Indians). 26 patients were PCR negative (18 males). Eight patients with negative PCR had systemic TB. Anti-TB therapy was given in 18 negative and 31 PCR cases. At 1-year follow-up, five patients with positive PCR (15.15%) and three with negative PCR (11.54%) had persistence/worsening of inflammation. Data from COTS-1 suggest that PCR is not commonly done for diagnosing intraocular TB and positive/negative results may not influence management or treatment outcomes in the real world scenario.

Presence of Legionellaceae in warm water supplies and typing of strains by polymerase chain reaction.

PubMed Central

Zietz, B.; Wiese, J.; Brengelmann, F.; Dunkelberg, H.

2001-01-01

Outbreaks of Legionnaire's disease present a public health challenge especially because fatal outcomes still remain frequent. The aim of this study was to describe the abundance and epidemiology of Legionellaceae in the human-made environment. Water was sampled from hot-water taps in private and public buildings across the area of Göttingen, Germany, including distant suburbs. Following isolation, we used polymerase chain reaction in order to generate strain specific banding profiles of legionella isolates. In total, 70 buildings were examined. Of these 18 (26%) had the bacterium in at least one water sample. Legionella pneumophila serogroups 1, 4, 5 and 6 could be identified in the water samples. Most of the buildings were colonized solely by one distinct strain, as proven by PCR. In three cases equal patterns were found in separate buildings. There were two buildings in this study where isolates with different serogroups were found at the same time. PMID:11293675

Inkjet Printing Based Droplet Generation for Integrated Online Digital Polymerase Chain Reaction.

PubMed

Zhang, Weifei; Li, Nan; Koga, Daisuke; Zhang, Yong; Zeng, Hulie; Nakajima, Hizuru; Lin, Jin-Ming; Uchiyama, Katsumi

2018-04-17

We report on the development of a novel and flexible online digital polymerase chain reaction (dPCR) system. The system was composed of three parts: an inkjet for generating the droplets, a coiled fused-silica capillary for thermal cycling, and a laser-induced fluorescence detector (LIFD) for positive droplet counting. Upon inkjet printing, monodisperse droplets were continuously generated in the oil phase and then introduced into the capillary in the form of a stable dispersion. The droplets containing one or zero molecules of target DNA passed through the helical capillary that was attached to a cylindrical thermal cycler for PCR amplification, resulting in the generation of fluorescence for the DNA-positive droplet. After 36 PCR cycles, the fluorescence signal intensity was detected by laser-induced fluorescence located at the downstream of the capillary, followed by a positive/negative counting. The present system was successfully applied to the absolute quantification of the HPV sequence in Caski cells with dynamic ranges spanning 4 orders of magnitude.

Differentiation of closely related but biologically distinct cherry isolates of Prunus necrotic ringspot virus by polymerase chain reaction.

PubMed

Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I

1999-07-01

Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.

Demise of Polymerase Chain Reaction/Electrospray Ionization-Mass Spectrometry as an Infectious Diseases Diagnostic Tool.

PubMed

Özenci, Volkan; Patel, Robin; Ullberg, Måns; Strålin, Kristoffer

2018-01-18

Although there are several US Food and Drug Administration (FDA)-approved/cleared molecular microbiology diagnostics for direct analysis of patient samples, all are single target or panel-based tests. There is no FDA-approved/cleared diagnostic for broad microbial detection. Polymerase chain reaction (PCR)/electrospray ionization-mass spectrometry (PCR/ESI-MS), commercialized as the IRIDICA system (Abbott) and formerly PLEX-ID, had been under development for over a decade and had become CE-marked and commercially available in Europe in 2014. Capable of detecting a large number of microorganisms, it was under review at the FDA when, in April 2017, Abbott discontinued it. This turn of events represents not only the loss of a potential diagnostic tool for infectious diseases but may be a harbinger of similar situations with other emerging and expensive microbial diagnostics, especially genomic tests. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Detection of eastern equine encephalomyelitis virus RNA in North American snakes.

PubMed

Bingham, Andrea M; Graham, Sean P; Burkett-Cadena, Nathan D; White, Gregory S; Hassan, Hassan K; Unnasch, Thomas R

2012-12-01

The role of non-avian vertebrates in the ecology of eastern equine encephalomyelitis virus (EEEV) is unresolved, but mounting evidence supports a potential role for snakes in the EEEV transmission cycle, especially as over-wintering hosts. To determine rates of exposure and infection, we examined serum samples from wild snakes at a focus of EEEV in Alabama for viral RNA using quantitative reverse transcription polymerase chain reaction. Two species of vipers, the copperhead (Agkistrodon contortrix) and the cottonmouth (Agkistrodon piscivorus), were found to be positive for EEEV RNA using this assay. Prevalence of EEEV RNA was more frequent in seropositive snakes than seronegative snakes. Positivity for the quantitative reverse transcription polymerase chain reaction in cottonmouths peaked in April and September. Body size and sex ratios were not significantly different between infected and uninfected snakes. These results support the hypothesis that snakes are involved in the ecology of EEEV in North America, possibly as over-wintering hosts for the virus.

[First attempts of detecting fetal cells in the maternal circulation].

PubMed

Nagy, Gyula Richárd; Bán, Zoltán; Sipos, Ferenc; Fent, János; Oroszné Nagy, Judit; Beke, Artúr; Furész, József; Papp, Zoltán

2004-10-31

In prenatal diagnosis there is great interest for noninvasive diagnostic methods. Authors report their first results in detecting fetal cells in the maternal circulation during pregnancy. The aim of the study was to detect fetal gender from maternal peripheral blood samples during pregnancy. Authors have analysed fetal nucleated red blood cells. In 12 cases after a double density Percoll gradient separation they labelled the surface antigens of the cells with anti-glycophorin-A and anti-CD45 fluorescent antibodies, did an intracellular staining of the epsilon haemoglobin chain, and analysed the cells with flow cytometry. The CD45 negative/glycophorin-A positive/epsilon-haemoglobin chain positive cells were considered as fetal cells. Having the results, in another 13 cases magnetic activated cell sorting with CD71 antibody were used as an enrichment step. Authors made an intracellular staining of the epsilon haemoglobin chain, the positive cells were isolated by micromanipulation, and analysed by single cell fluorescent polymerase chain reaction. Primers for the amelogenin gene were used to detect fetal gender. Only the Percoll enrichment step itself is not enough for using the samples for diagnostic molecular-biologic examinations, a following enrichment step is needed. For this the authors used magnetic activated cell sorting with CD71 antibody. With the help of this enrichment step, after the intracellular staining of the epsilon haemoglobin chain the direct micromanipulator isolation of the epsilon haemoglobin chain positive cells could be done. After analysing single cells by fluorescent polymerase chain reaction, in 8 out of the 11 comparable cases the results were similar to those, what was found during the genetic amniocentesis. In 2 cases from this 8, genetic amniocentesis proved Klinefelter syndrome, which they could also confirm with the examination of fetal cells in the maternal circulation. The results of the study suggest that the method described above can be useful in prenatal genetic diagnosis, and improving it could be useful to detect other genetic abnormalities (chromosomal abnormalities, single gene disorders) as well.

Partial characterization of new adenoviruses found in lizards.

PubMed

Ball, Inna; Behncke, Helge; Schmidt, Volker; Geflügel, F T A; Papp, Tibor; Stöhr, Anke C; Marschang, Rachel E

2014-06-01

In the years 2011-2012, a consensus nested polymerase chain reaction was used for the detection of adenovirus (AdV) infection in reptiles. During this screening, three new AdVs were detected. One of these viruses was detected in three lizards from a group of green striped tree dragons (Japalura splendida). Another was detected in a green anole (Anolis carolinensis). A third virus was detected in a Jackson's chameleon (Chamaeleo jacksonii). Analysis of a portion of the DNA-dependent DNA polymerase genes of each of these viruses revealed that they all were different from one another and from all previously described reptilian AdVs. Phylogenetic analysis of the partial DNA polymerase gene sequence showed that all newly detected viruses clustered within the genus Atadenovirus. This is the first description of AdVs in these lizard species.

Detection of Entamoeba histolytica by Recombinase Polymerase Amplification.

PubMed

Nair, Gayatri; Rebolledo, Mauricio; White, A Clinton; Crannell, Zachary; Richards-Kortum, R Rebecca; Pinilla, A Elizabeth; Ramírez, Juan David; López, M Consuelo; Castellanos-Gonzalez, Alejandro

2015-09-01

Amebiasis is an important cause of diarrheal disease worldwide and has been associated with childhood malnutrition. Traditional microscopy approaches are neither sensitive nor specific for Entamoeba histolytica. Antigen assays are more specific, but many cases are missed unless tested by molecular methods. Although polymerase chain reaction (PCR) is effective, the need for sophisticated, expensive equipment, infrastructure, and trained personnel limits its usefulness, especially in the resource-limited, endemic areas. Here, we report development of a recombinase polymerase amplification (RPA) method to detect E. histolytica specifically. Using visual detection by lateral flow (LF), the test was highly sensitive and specific and could be performed without additional equipment. The availability of this inexpensive, sensitive, and field-applicable diagnostic test could facilitate rapid diagnosis and treatment of amebiasis in endemic regions. © The American Society of Tropical Medicine and Hygiene.

Undesired variance due to examiner stringency/leniency effect in communication skill scores assessed in OSCEs.

PubMed

Harasym, Peter H; Woloschuk, Wayne; Cunning, Leslie

2008-12-01

Physician-patient communication is a clinical skill that can be learned and has a positive impact on patient satisfaction and health outcomes. A concerted effort at all medical schools is now directed at teaching and evaluating this core skill. Student communication skills are often assessed by an Objective Structure Clinical Examination (OSCE). However, it is unknown what sources of error variance are introduced into examinee communication scores by various OSCE components. This study primarily examined the effect different examiners had on the evaluation of students' communication skills assessed at the end of a family medicine clerkship rotation. The communication performance of clinical clerks from Classes 2005 and 2006 were assessed using six OSCE stations. Performance was rated at each station using the 28-item Calgary-Cambridge guide. Item Response Theory analysis using a Multifaceted Rasch model was used to partition the various sources of error variance and generate a "true" communication score where the effects of examiner, case, and items are removed. Variance and reliability of scores were as follows: communication scores (.20 and .87), examiner stringency/leniency (.86 and .91), case (.03 and .96), and item (.86 and .99), respectively. All facet scores were reliable (.87-.99). Examiner variance (.86) was more than four times the examinee variance (.20). About 11% of the clerks' outcome status shifted using "true" rather than observed/raw scores. There was large variability in examinee scores due to variation in examiner stringency/leniency behaviors that may impact pass-fail decisions. Exploring the benefits of examiner training and employing "true" scores generated using Item Response Theory analyses prior to making pass/fail decisions are recommended.

Pre-Steady State Kinetic Investigation of the Incorporation of Anti-Hepatitis B Nucleotide Analogs Catalyzed by Non-Canonical Human DNA Polymerases

PubMed Central

Brown, Jessica A.; Pack, Lindsey R.; Fowler, Jason D.; Suo, Zucai

2011-01-01

Antiviral nucleoside analogs have been developed to inhibit the enzymatic activities of the hepatitis B virus (HBV) polymerase, thereby preventing the replication and production of HBV. However, the usage of these analogs can be limited by drug toxicity because the 5′-triphosphates of these nucleoside analogs (nucleotide analogs) are potential substrates for human DNA polymerases to incorporate into host DNA. Although they are poor substrates for human replicative DNA polymerases, it remains to be established whether these nucleotide analogs are substrates for the recently discovered human X- and Y-family DNA polymerases. Using pre-steady state kinetic techniques, we have measured the substrate specificity values for human DNA polymerases β, λ, η, ι, κ, and Rev1 incorporating the active forms of the following anti-HBV nucleoside analogs approved for clinical use: adefovir, tenofovir, lamivudine, telbivudine, and entecavir. Compared to the incorporation of a natural nucleotide, most of the nucleotide analogs were incorporated less efficiently (2 to >122,000) by the six human DNA polymerases. In addition, the potential for entecavir and telbivudine, two drugs which possess a 3′-hydroxyl, to become embedded into human DNA was examined by primer extension and DNA ligation assays. These results suggested that telbivudine functions as a chain terminator while entecavir was efficiently extended by the six enzymes and was a substrate for human DNA ligase I. Our findings suggested that incorporation of anti-HBV nucleotide analogs catalyzed by human X- and Y-family polymerases may contribute to clinical toxicity. PMID:22132702

SWIMMING ASSOCIATED ILLNESS AND RAPID MEASURES OF WATER QUALITY AT A GULF BEACH

EPA Science Inventory

Studies at Great Lakes beaches have provided evidence that faster ways of measuring the fecal indicator bacteria (FIB) Enterococcus using quantitative polymerase chain reaction (qPCR) are predictive of swimming associated illness. In 2005 we conducted an epidemiology study to eva...

SIMULTANEOUS ONE-TUBE QUANTIFICATION OF HOST AND PATHOGEN DNA WITH REAL-TIME POLYMERASE CHAIN REACTION

EPA Science Inventory

Phaeocryptopus gaeumannii is a widespread foliar parasite of Douglas-fir. Although normally innocuous, the fungus also causes the defoliating disease Swiss needle cast in heavily infected needles. The extent of P. gaeumannii colonization in Douglas-fir foliage was estimated wit...

RAPID MONITORING BY QPCR FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

EPA Science Inventory

Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polymerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventi...

A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

EPA Science Inventory

Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

DEVELOPMENT AND EVALUATION OF A MICROARRAY APPROACH TO DETECT AND GENOTYPE NOROVIRUSES IN WATER

EPA Science Inventory

Noroviruses are the leading cause of nonbacterial gastroenteritis outbreaks in the United States, some of which are caused by the ingestion of contaminated water. These viruses are usually detected and genotyped using reverse transcription-polymerase chain reaction (RT-PCR) base...

POLYMERASE CHAIN REACTION (PCR) TECHNOLOGY IN VISUAL BEACH

EPA Science Inventory

In 2000, the US Congress passed the Beaches Environmental Assessment and Coastal Health Act under which the EPA has the mandate to manage all significant public beaches by 2008. As a result, EPA, USGS and NOAA are developing the Visual Beach program which consists of software eq...

BIALLELIC POLYMORPHISM IN THE INTRON REGION OF B-TUBULIN GENE OF CRYPTOSPORIDIUM PARASITES

EPA Science Inventory

Nucleotide sequencing of polymerase chain reaction-amplified intron region of the Cryptosporidium parvum B-tubulin gene in 26 human and 15 animal isolates revealed distinct genetic polymorphism between the human and bovine genotypes. The separation of 2 genotypes of C. parvum is...

New Performance Metrics for Quantitative Polymerase Chain Reaction-Based Microbial Source Tracking Methods

EPA Science Inventory

Binary sensitivity and specificity metrics are not adequate to describe the performance of quantitative microbial source tracking methods because the estimates depend on the amount of material tested and limit of detection. We introduce a new framework to compare the performance ...

Clusters of antibiotic resistance genes enriched together stay together in swine agriculture

USDA-ARS?s Scientific Manuscript database

Antibiotic resistance has developed into a worldwide health risk. The nature and extent of the contribution of animal agriculture to the evolution of antibiotic resistance in bacterial communities remains unclear. Using quantitative polymerase chain reaction (PCR) in tandem with next-generation sequ...

RECREATIONAL BEACH WATER QUALITY MONITORING WITH QUANTITATIVE POLYMERASE CHAIN

EPA Science Inventory

Recreational beaches are an important economic and aesthetic asset to communities, states and the nation as a whole. Considerable resources are expended each year in monitoring the water at these beaches for fecal indicator bacteria as a means of determining if it is safe for pu...

Detection and quantification limits of the EPA Enterococcus qPCR method

EPA Science Inventory

The U.S. EPA will be recommending a quantitative polymerase chain reaction (qPCR) method targeting Enterococcus spp. as an option for monitoring recreational beach water quality in 2013 and has published preliminary proposed water quality criteria guidelines for the method. An im...

DEVELOPMENT OF A MOLECULAR METHOD TO IDENTIFY HEPATITIS E VIRUS IN WATER

EPA Science Inventory

Hepatitis E virus (HEV) causes an infectious form of hepatitis associated with contaminated water. By analyzing the sequence of several HEV isolates, a reverse transciption-polymerase chain reaction method was developed and optimized that should be able to identify all of the kn...

DEVELOPMENT OF MOLECULAR METHODS TO DETECT EMERGING VIRUSES

EPA Science Inventory

A large number of human enteric viruses are known to cause gastrointestinal illness and waterborne outbreaks. Many of these are emerging viruses that do not grow or grow poorly in cell culture and so molecular detectoin methods based on the polymerase chain reaction (PCR) are be...

Detection of foodborne pathogens using microarray technology

USDA-ARS?s Scientific Manuscript database

Assays based on the polymerase chain reaction (PCR) are now accepted methods for rapidly confirming the presence or absence of specific pathogens in foods and other types of samples. Conventional PCR requires the use of agarose gel electrophoresis to detect the PCR product; whereas, real-time PCR c...

FUEL ECONOMY AND CO2 EMISSIONS STANDARDS, MANUFACTURER PRICING STRATEGIES, AND FEEBATES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Changzheng; Greene, David L; Bunch, Dr David S.

2012-01-01

Corporate Average Fuel Economy (CAFE) standards and CO2 emissions standards for 2012 to 2016 have significantly increased the stringency of requirements for new light-duty vehicle fuel efficiency. This study investigates the role of technology adoption and pricing strategies in meeting new standards, as well as the impact of feebate policies. The analysis is carried out by means of a dynamic optimization model that simulates manufacturer decisions with the objective of maximizing social surplus while simultaneously considering consumer response and meeting CAFE and emissions standards. The results indicate that technology adoption plays the major role and that the provision of compliancemore » flexibility and the availability of cost-effective advanced technologies help manufacturers reduce the need for pricing to induce changes in the mix of vehicles sold. Feebates, when implemented along with fuel economy and emissions standards, can bring additional fuel economy improvement and emissions reduction, but the benefit diminishes with the increasing stringency of the standards.« less

Identification and validation of biomarkers of IgV(H) mutation status in chronic lymphocytic leukemia using microfluidics quantitative real-time polymerase chain reaction technology.

PubMed

Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R

2007-09-01

To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.

Repriming by PrimPol is critical for DNA replication restart downstream of lesions and chain-terminating nucleosides.

PubMed

Kobayashi, Kaori; Guilliam, Thomas A; Tsuda, Masataka; Yamamoto, Junpei; Bailey, Laura J; Iwai, Shigenori; Takeda, Shunichi; Doherty, Aidan J; Hirota, Kouji

2016-08-02

PrimPol is a DNA damage tolerance enzyme possessing both translesion synthesis (TLS) and primase activities. To uncover its potential role in TLS-mediated IgVλ hypermutation and define its interplay with other TLS polymerases, PrimPol(-/-) and PrimPol(-/-)/Polη(-/-)/Polζ (-/-) gene knockouts were generated in avian cells. Loss of PrimPol had no significant impact on the rate of hypermutation or the mutation spectrum of IgVλ. However, PrimPol(-/-) cells were sensitive to methylmethane sulfonate, suggesting that it may bypass abasic sites at the IgVλ segment by repriming DNA synthesis downstream of these sites. PrimPol(-/-) cells were also sensitive to cisplatin and hydroxyurea, indicating that it assists in maintaining / restarting replication at a variety of lesions. To accurately measure the relative contribution of the TLS and primase activities, we examined DNA damage sensitivity in PrimPol(-/-) cells complemented with polymerase or primase-deficient PrimPol. Polymerase-defective, but not primase-deficient, PrimPol suppresses the hypersensitivity of PrimPol(-/-) cells. This indicates that its primase, rather than TLS activity, is pivotal for DNA damage tolerance. Loss of TLS polymerases, Polη and Polζ has an additive effect on the sensitivity of PrimPol(-/-) cells. Moreover, we found that PrimPol and Polη-Polζ redundantly prevented cell death and facilitated unperturbed cell cycle progression. PrimPol(-/-) cells also exhibited increased sensitivity to a wide variety of chain-terminating nucleoside analogs (CTNAs). PrimPol could perform close-coupled repriming downstream of CTNAs and oxidative damage in vitro. Together, these results indicate that PrimPol's repriming activity plays a central role in reinitiating replication downstream from CTNAs and other specific DNA lesions.

Posttranslational Regulation of Human DNA Polymerase ι.

PubMed

McIntyre, Justyna; McLenigan, Mary P; Frank, Ekaterina G; Dai, Xiaoxia; Yang, Wei; Wang, Yinsheng; Woodgate, Roger

2015-11-06

Human DNA polymerases (pols) η and ι are Y-family DNA polymerase paralogs that facilitate translesion synthesis past damaged DNA. Both polη and polι can be monoubiquitinated in vivo. Polη has been shown to be ubiquitinated at one primary site. When this site is unavailable, three nearby lysines may become ubiquitinated. In contrast, mass spectrometry analysis of monoubiquitinated polι revealed that it is ubiquitinated at over 27 unique sites. Many of these sites are localized in different functional domains of the protein, including the catalytic polymerase domain, the proliferating cell nuclear antigen-interacting region, the Rev1-interacting region, and its ubiquitin binding motifs UBM1 and UBM2. Polι monoubiquitination remains unchanged after cells are exposed to DNA-damaging agents such as UV light (generating UV photoproducts), ethyl methanesulfonate (generating alkylation damage), mitomycin C (generating interstrand cross-links), or potassium bromate (generating direct oxidative DNA damage). However, when exposed to naphthoquinones, such as menadione and plumbagin, which cause indirect oxidative damage through mitochondrial dysfunction, polι becomes transiently polyubiquitinated via Lys(11)- and Lys(48)-linked chains of ubiquitin and subsequently targeted for degradation. Polyubiquitination does not occur as a direct result of the perturbation of the redox cycle as no polyubiquitination was observed after treatment with rotenone or antimycin A, which both inhibit mitochondrial electron transport. Interestingly, polyubiquitination was observed after the inhibition of the lysine acetyltransferase KATB3/p300. We hypothesize that the formation of polyubiquitination chains attached to polι occurs via the interplay between lysine acetylation and ubiquitination of ubiquitin itself at Lys(11) and Lys(48) rather than oxidative damage per se. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

A polymerase chain reaction strategy for the diagnosis of camelpox.

PubMed

Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar

2009-03-01

Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.

One-Step Reverse Transcription-Polymerase Chain Reaction for Ebola and Marburg Viruses.

PubMed

Park, Sun-Whan; Lee, Ye-Ji; Lee, Won-Ja; Jee, Youngmee; Choi, WooYoung

2016-06-01

Ebola and Marburg viruses (EBOVs and MARVs, respectively) are causative agents of severe hemorrhagic fever with high mortality rates in humans and nonhuman primates. In 2014, there was a major Ebola outbreak in various countries in West Africa, including Guinea, Liberia, Republic of Sierra Leone, and Nigeria. EBOV and MARV are clinically difficult to diagnose and distinguish from other African epidemic diseases. Therefore, in this study, we aimed to develop a method for rapid identification of the virus to prevent the spread of infection. We established a conventional one-step reverse transcription-polymerase chain reaction (RT-PCR) assay for these pathogens based on the Superscript Reverse Transcriptase-Platinum Taq polymerase enzyme mixture. All assays were thoroughly optimized using in vitro-transcribed RNA. We designed seven primer sets of nucleocapsid protein (NP) genes based on sequences from seven filoviruses, including five EBOVs and two MARVs. To evaluate the sensitivity of the RT-PCR assay for each filovirus, 10-fold serial dilutions of synthetic viral RNA transcripts of EBOV or MARV NP genes were used to assess detection limits of viral RNA copies. The potential for these primers to cross react with other filoviruses was also examined. The results showed that the primers were specific for individual genotype detection in the examined filoviruses. The assay established in this study may facilitate rapid, reliable laboratory diagnosis in suspected cases of Ebola and Marburg hemorrhagic fevers.

An A-T linker adapter polymerase chain reaction method for chromosome walking without restriction site cloning bias.

PubMed

Trinh, Quoclinh; Xu, Wentao; Shi, Hui; Luo, Yunbo; Huang, Kunlun

2012-06-01

A-T linker adapter polymerase chain reaction (PCR) was modified and employed for the isolation of genomic fragments adjacent to a known DNA sequence. The improvements in the method focus on two points. The first is the modification of the PO(4) and NH(2) groups in the adapter to inhibit the self-ligation of the adapter or the generation of nonspecific products. The second improvement is the use of the capacity of rTaq DNA polymerase to add an adenosine overhang at the 3' ends of digested DNA to suppress self-ligation in the digested DNA and simultaneously resolve restriction site clone bias. The combination of modifications in the adapter and in the digested DNA leads to T/A-specific ligation, which enhances the flexibility of this method and makes it feasible to use many different restriction enzymes with a single adapter. This novel A-T linker adapter PCR overcomes the inherent limitations of the original ligation-mediated PCR method such as low specificity and a lack of restriction enzyme choice. Moreover, this method also offers higher amplification efficiency, greater flexibility, and easier manipulation compared with other PCR methods for chromosome walking. Experimental results from 143 Arabidopsis mutants illustrate that this method is reliable and efficient in high-throughput experiments. Copyright © 2012 Elsevier Inc. All rights reserved.

Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).

PubMed

Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli

2018-02-26

Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.

Genomic DNA-based absolute quantification of gene expression in Vitis

USDA-ARS?s Scientific Manuscript database

Many studies in which gene expression is quantified by polymerase chain reaction represent the expression of a gene of interest (GOI) relative to that of a reference gene (RG). Relative expression is founded on the assumptions that RG expression is stable across samples, treatments, organs, etc., an...

Comparison of Enterococcus qPCR analysis results from fresh and marine waters on two real-tme instruments

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) will be recommending a quantitativ e polymerase chain reaction (qPCR) method targeting Enterococcus spp. as an option for monitoring recreational beach water quality. A practical consideration for widespread implementation of this o...

A SIMPLE POLYMERASE CHAIN REACTION-SEQUENCING ANALYSIS CAPABLE OF IDENTIFYING MULTIPLE MEDICALLY RELEVANT FILAMENTOUS FUNGAL SPECIES

EPA Science Inventory

Due to the accumulating evidence that suggests that numerous unhealthy conditions in the indoor environment are the result of abnormal growth of the filamentous fungi (mold) in and on building surfaces, it is necessary to accurately determine the organisms responsible for these m...

Reactivation of chickenpox contracted in infancy.

PubMed Central

Terada, K; Kawano, S; Hiraga, Y; Morita, T

1995-01-01

Varicella zoster virus DNA in mononuclear cells was studied by the polymerase chain reaction to obtain virological evidence of reactivation in the children who had contracted chickenpox in infancy. The results appear to explain why chickenpox in infancy is a risk factor for herpes zoster in immunocompetent children. PMID:7574864

Relationship and Variation of qPCR and Culturable Enterococci Estimates in Ambient Surface Waters Are Predictable

EPA Science Inventory

The quantitative polymerase chain reaction (qPCR) method provides rapid estimates of fecal indicator bacteria densities that have been indicated to be useful in the assessment of water quality. Primarily because this method provides faster results than standard culture-based meth...

First report of Cocksfoot mottle virus infecting wheat (Triticum aestivum) in Ohio

USDA-ARS?s Scientific Manuscript database

Cocksfoot mottle virus (CfMV) was discovered in Ohio wheat during a 2016 field survey utilizing RNA-Seq to identify virus-like sequences. Virus sequences were confirmed by reverse transcriptase-polymerase chain reaction (RT-PCR) and Sanger sequencing, and CfMV was transmitted to orchardgrass and pas...

I See Your Smart Phone and Raise You Smart Bacteria

Science.gov Websites

understanding how bacteria sense their nearest neighbors (including pathogens), a DTRA CB/JSTO-funded research ;wild type" E. coli was tested via reverse transcription quantitative polymerase chain reactions Director of Research, Dale Ormond, kicks off #MATHCOUNTS #NationalCompetition2018 Countdown Round

DU Fragment Carcinogenicity: Extrapolation of Findings in Rodents to Man

DTIC Science & Technology

2004-03-01

changes in intrahepatic cholangiocarcinoma induced by thorotrast. Radiat. Res. 152: S 118-S 124. Khan, J., R. Simon, M. Bittner, Y. Chen, S. B. Leighton, T... cholangiocarcinomas demonstrated with a sensitive polymerase chain reaction technique. Cancer Res. 51: 3497-3502. MacDonald, J. S. and H. H. Scribner (1999

Use of DNA markers in forest tree improvement research

Treesearch

D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall

1992-01-01

DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...

NEW TARGET AND CONTROL ASSAYS FOR QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) ANALYSIS OF ENTEROCOCCI IN WATER

EPA Science Inventory

Enterococci are frequently monitored in water samples as indicators of fecal pollution. Attention is now shifting from culture based methods for enumerating these organisms to more rapid molecular methods such as QPCR. Accurate quantitative analyses by this method requires highly...

USING TODAY'S DATA TO CLOSE THE BEACH TODAY. QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) RAPID BEACH CLOSING TOOL

EPA Science Inventory

Recreational beaches are an important economic and aesthetic asset to communities, states and the nation as a whole. Considerable resources are expended each year in the measurement of fecal indicator bacteria concentrations in the water at these beaches to determine whether thes...

USING TODAY'S DATA TO CLOSE THE BEACH TODAY. QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) RAPID BEACH CLOSINGS TOOL

EPA Science Inventory

Recreational beaches are an important economic and aesthetic asset to communities, states and the nation as a whole. Considerable resources are expended each year in the measurement of fecal indicator bacteria concentrations in the water at these beaches to determine whether thes...

Modeling enterococcus densities measured by quantitative polymerase chain reaction and membrane filtration using environmental conditions at four Great Lakes beaches

EPA Science Inventory

Data collected by the US Environmental Protection Agency (EPA) during the summer months of 2003 and 2004 at four US Great Lakes beaches were analyzed using regression analysis to identify relationships between meteorological, physical water characteristics, and beach characterist...

Evaluation of Microbial Diversity in Wetland through Polymerase Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP)

DTIC Science & Technology

2006-06-01

51 Appendix C. Promega Restriction Digest Protocol ....................................................53...Rsa1 Restriction Digest Results............................................................................180 9. DNA Base Pair Comparison...particular restriction endonuclease, the length of the fragments produced will differ when the DNA is digested with a restriction enzyme (Edwards

Inter- and Intraspecific Identification of the New World Screwworm Using Random Amplified Polymorphic DNA-Polymerase Chain Reaction

USDA-ARS?s Scientific Manuscript database

New World screwworms (NWS), Cochliomyia hominivorax (Coquerel), are one of the most important arthropod pests of livestock in the Western Hemisphere. Early instars are very difficult to distinguish morphologically from several closely related blow fly species. Random amplified polymorphic DNA polyme...

UW Team Reaches Out to Grade- and High-School Students.

ERIC Educational Resources Information Center

Hood, Leroy

1994-01-01

Describes an outreach program designed to expose high school students to cutting-edge science. High school students are provided with hands-on experience in molecular biology (polymerase chain reaction, restriction mapping, chromatography, gel electrophoresis, human DNA sequencing, etc.) and may have an opportunity to participate in the Human…

REAL TIME PCR ANALYSIS OF INDOOR MOLDS: PRINCIPLES, PROCEDURES AND APPLICATIONS

EPA Science Inventory

This presentation will endeavor to present an overview of the real time polymerase chain reaction method developed for indoor mold detection and quantification by the EPA. It will begin with a brief discussion of the PCR technology that provides the basis for this method and how ...

Groundwater sampling methods using glass wool filtration to trace human enteric viruses in Madison, Wisconsin

USDA-ARS?s Scientific Manuscript database

Human enteric viruses have been detected in the Madison, Wisconsin deep municipal well system. Earlier projects by the Wisconsin Geological and Natural History Survey (WGNHS) have used glass wool filters to sample groundwater for these viruses directly from the deep municipal wells. Polymerase chain...

QUANTIFICATION AND ASSOCIATED VARIABILITY OF INDUCED VITELLOGENIN GENE TRANSCRIPTS IN FATHEAD MINNOW (PIMEPHALES PROMELAS) BY QUANTITATIVE REAL-TIME POLYMERASE CHAIN REACTION ASSAY

EPA Science Inventory

Ecological risk assessors have a growing need for sensitive and rapid indicators of environmental exposure in aquatic ecosystems resulting from natural and synthetic estrogen-like compounds. Investigators developing subcellular exposure markers in traditional sentinel organisms m...

Introduction of Molecular Methods into a Food Microbiology Curriculum

ERIC Educational Resources Information Center

Pleitner, Aaron M.; Hammons, Susan R.; McKenzie, Emily; Cho, Young-Hee; Oliver, Haley F.

2014-01-01

Maintaining current, relevant curriculum in undergraduate Food Microbiology courses is essential for training future experts in food quality and safety. Having an understanding of the fundamental techniques (for example, polymerase chain reaction [PCR]) that are used in the food industry and regulatory agencies is critical for students entering…

9 CFR 145.14 - Testing.

Code of Federal Regulations, 2014 CFR

2014-01-01

... immunosorbent assay test (ELISA), or the rapid serum test for all poultry; and the stained antigen, rapid whole... test or enzyme-labeled immunosorbent assay test (ELISA), or blood from birds that react on the stained... enzyme-linked immunosorbent assay (ELISA) test,3 a polymerase chain reaction (PCR)-based test, or a...

76 FR 15791 - National Poultry Improvement Plan and Auxiliary Provisions

Federal Register 2010, 2011, 2012, 2013, 2014

2011-03-22

... microhemagglutination inhibition test, the enzyme-linked immunosorbent assay (ELISA) test,\\3\\ a polymerase chain [[Page... samplings and/or culture of reactors. \\3\\ Procedures for the enzyme-linked immunosorbent assay (ELISA) test... Immunosorbent Assay (ELISA),'' Proceedings, 30th Western Poultry Disease Conference, pp. 63-66, March 1981...

9 CFR 145.14 - Testing.

Code of Federal Regulations, 2012 CFR

2012-01-01

... immunosorbent assay test (ELISA), or the rapid serum test for all poultry; and the stained antigen, rapid whole... test or enzyme-labeled immunosorbent assay test (ELISA), or blood from birds that react on the stained... enzyme-linked immunosorbent assay (ELISA) test,3 a polymerase chain reaction (PCR)-based test, or a...

9 CFR 145.14 - Testing.

Code of Federal Regulations, 2013 CFR

2013-01-01

... immunosorbent assay test (ELISA), or the rapid serum test for all poultry; and the stained antigen, rapid whole... test or enzyme-labeled immunosorbent assay test (ELISA), or blood from birds that react on the stained... enzyme-linked immunosorbent assay (ELISA) test,3 a polymerase chain reaction (PCR)-based test, or a...

DISTRIBUTION OF SIX VIRULENCE FACTORS IN AEROMONAS SPECIES ISOLATED FROM US DRINKING WATER UTILITIES: A PCR IDENTIFICATION

EPA Science Inventory

Surveys of finished drinking water conducted by the U.S. EPA during 2000-2001, revealed 7 out of 16 water utilities encompassing four states, were contaminated with Aeromonas species. A Polymerase Chain reaction (PCR) based genetic characterization determined the presence of six...

Importance of Flagella and Enterotoxins for Aeromonas Virulence in a Mouse Model

EPA Science Inventory

A genetic characterization of eight virulence factor genes, elastase, lipase, polar flagella (flaA/flaB, flaG), lateral flagella (lafA), and the enterotoxins alt, act, and ast, was performed using polymerase chain reaction with 55 drinking water and nine clinical isolates. When 1...