STRONG LENS TIME DELAY CHALLENGE. II. RESULTS OF TDC1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liao, Kai; Treu, Tommaso; Marshall, Phil

2015-02-10

We present the results of the first strong lens time delay challenge. The motivation, experimental design, and entry level challenge are described in a companion paper. This paper presents the main challenge, TDC1, which consisted of analyzing thousands of simulated light curves blindly. The observational properties of the light curves cover the range in quality obtained for current targeted efforts (e.g., COSMOGRAIL) and expected from future synoptic surveys (e.g., LSST), and include simulated systematic errors. Seven teams participated in TDC1, submitting results from 78 different method variants. After describing each method, we compute and analyze basic statistics measuring accuracy (ormore » bias) A, goodness of fit χ{sup 2}, precision P, and success rate f. For some methods we identify outliers as an important issue. Other methods show that outliers can be controlled via visual inspection or conservative quality control. Several methods are competitive, i.e., give |A| < 0.03, P < 0.03, and χ{sup 2} < 1.5, with some of the methods already reaching sub-percent accuracy. The fraction of light curves yielding a time delay measurement is typically in the range f = 20%-40%. It depends strongly on the quality of the data: COSMOGRAIL-quality cadence and light curve lengths yield significantly higher f than does sparser sampling. Taking the results of TDC1 at face value, we estimate that LSST should provide around 400 robust time-delay measurements, each with P < 0.03 and |A| < 0.01, comparable to current lens modeling uncertainties. In terms of observing strategies, we find that A and f depend mostly on season length, while P depends mostly on cadence and campaign duration.« less

Impulsive choice and pre-exposure to delays: iv. effects of delay- and immediacy-exposure training relative to maturational changes in impulsivity.

PubMed

Renee Renda, C; Rung, Jillian M; Hinnenkamp, Jay E; Lenzini, Stephanie N; Madden, Gregory J

2018-04-23

Impulsive choice describes preference for smaller, sooner rewards over larger, later rewards. Excessive delay discounting (i.e., rapid devaluation of delayed rewards) underlies some impulsive choices, and is observed in many maladaptive behaviors (e.g., substance abuse, gambling). Interventions designed to reduce delay discounting may provide therapeutic gains. One such intervention provides rats with extended training with delayed reinforcers. When compared to a group given extended training with immediate reinforcers, delay-exposed rats make significantly fewer impulsive choices. To what extent is this difference due to delay-exposure training shifting preference toward self-control or immediacy-exposure training (the putative control group) shifting preference toward impulsivity? The current study compared the effects of delay- and immediacy-exposure training to a no-training control group and evaluated within-subject changes in impulsive choice across 51 male Wistar rats. Delay-exposed rats made significantly fewer impulsive choices than immediacy-exposed and control rats. Between-group differences in impulsive choice were not observed in the latter two groups. While delay-exposed rats showed large, significant pre- to posttraining reductions in impulsive choice, immediacy-exposed and control rats showed small reductions in impulsive choice. These results suggest that extended training with delayed reinforcers reduces impulsive choice, and that extended training with immediate reinforcers does not increase impulsive choice. © 2018 Society for the Experimental Analysis of Behavior.

Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries.

PubMed

Wickersheim, Michelle L; Blumenstiel, Justin P

2013-11-01

A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.

A Classroom Collaborative Strategy Designed To Improve Oral Motor Skill Deficits in Developmentally Delayed Pre-Kindergarten Students.

ERIC Educational Resources Information Center

Hoffman, Lorri J.

This practicum report describes the design and implementation of an oral motor program to increase the verbal communication skills of seven pre-kindergarten children with developmental delays, including hypotonia in oral motor development with moderate to severe articulation difficulties. Collaborative planning by the pre-kindergarten special…

Pre-school children with and without developmental delay: behaviour problems and parenting stress over time.

PubMed

Baker, B L; McIntyre, L L; Blacher, J; Crnic, K; Edelbrock, C; Low, C

2003-01-01

Children with intellectual disability are at heightened risk for behaviour problems and diagnosed mental disorder. The present authors studied the early manifestation and continuity of problem behaviours in 205 pre-school children with and without developmental delays. Behaviour problems were quite stable over the year from age 36-48 months. Children with developmental delays were rated higher on behaviour problems than their non-delayed peers, and were three times as likely to score in the clinical range. Mothers and fathers showed high agreement in their rating of child problems, especially in the delayed group. Parenting stress was also higher in the delayed group, but was related to the extent of behaviour problems rather than to the child's developmental delay. Over time, a transactional model fit the relationship between parenting stress and behaviour problems: high parenting stress contributed to a worsening in child behaviour problems over time, and high child behaviour problems contributed to a worsening in parenting stress. Findings for mothers and fathers were quite similar.

Selectivity of Electronic Coherence and Attosecond Ionization Delays in Strong-Field Double Ionization

NASA Astrophysics Data System (ADS)

Kobayashi, Yuki; Reduzzi, Maurizio; Chang, Kristina F.; Timmers, Henry; Neumark, Daniel M.; Leone, Stephen R.

2018-06-01

Experiments are presented on real-time probing of coherent electron dynamics in xenon initiated by strong-field double ionization. Attosecond transient absorption measurements allow for characterization of electronic coherences as well as relative ionization timings in multiple electronic states of Xe+ and Xe2 + . A high degree of coherence g =0.4 is observed between P3 2 0-P3 0 0 of Xe2 + , whereas for other possible pairs of states the coherences are below the detection limits of the experiments. A comparison of the experimental results with numerical simulations based on an uncorrelated electron-emission model shows that the coherences produced by strong-field double ionization are more selective than predicted. Surprisingly short ionization time delays, 0.85 fs, 0.64 fs, and 0.75 fs relative to Xe+ formation, are also measured for the P2 3 , P0 3 , and P1 3 states of Xe2 + , respectively. Both the unpredicted selectivity in the formation of coherence and the subfemtosecond time delays of specific states provide new insight into correlated electron dynamics in strong-field double ionization.

Synchronization and bidirectional communication without delay line using strong mutually coupled semiconductor lasers

NASA Astrophysics Data System (ADS)

Li, Guang-Hui; Wang, An-Bang; Feng, Ye; Wang, Yang

2010-07-01

This paper numerically demonstrates synchronization and bidirectional communication without delay line by using two semiconductor lasers with strong mutual injection in a face-to-face configuration. These results show that both of the two lasers' outputs synchronize with their input chaotic carriers. In addition, simulations demonstrate that this kind of synchronization can be used to realize bidirectional communications without delay line. Further studies indicate that within a small deviation in message amplitudes of two sides (±6%), the message can be extracted with signal-noise-ratio more than 10 dB; and the signal-noise-ratio is extremely sensitive to the message rates mismatch of two sides, which may be used as a key of bidirectional communication.

31 CFR 560.515 - 30-day delayed effective date for pre-May 7, 1995 trade contracts involving Iran.

Code of Federal Regulations, 2012 CFR

2012-07-01

...-May 7, 1995 trade contracts involving Iran. 560.515 Section 560.515 Money and Finance: Treasury....515 30-day delayed effective date for pre-May 7, 1995 trade contracts involving Iran. (a) All... involving Iran (a pre-existing trade contract), including the exportation of goods, services (including...

Stuttering adults' lack of pre-speech auditory modulation normalizes when speaking with delayed auditory feedback.

PubMed

Daliri, Ayoub; Max, Ludo

2018-02-01

Auditory modulation during speech movement planning is limited in adults who stutter (AWS), but the functional relevance of the phenomenon itself remains unknown. We investigated for AWS and adults who do not stutter (AWNS) (a) a potential relationship between pre-speech auditory modulation and auditory feedback contributions to speech motor learning and (b) the effect on pre-speech auditory modulation of real-time versus delayed auditory feedback. Experiment I used a sensorimotor adaptation paradigm to estimate auditory-motor speech learning. Using acoustic speech recordings, we quantified subjects' formant frequency adjustments across trials when continually exposed to formant-shifted auditory feedback. In Experiment II, we used electroencephalography to determine the same subjects' extent of pre-speech auditory modulation (reductions in auditory evoked potential N1 amplitude) when probe tones were delivered prior to speaking versus not speaking. To manipulate subjects' ability to monitor real-time feedback, we included speaking conditions with non-altered auditory feedback (NAF) and delayed auditory feedback (DAF). Experiment I showed that auditory-motor learning was limited for AWS versus AWNS, and the extent of learning was negatively correlated with stuttering frequency. Experiment II yielded several key findings: (a) our prior finding of limited pre-speech auditory modulation in AWS was replicated; (b) DAF caused a decrease in auditory modulation for most AWNS but an increase for most AWS; and (c) for AWS, the amount of auditory modulation when speaking with DAF was positively correlated with stuttering frequency. Lastly, AWNS showed no correlation between pre-speech auditory modulation (Experiment II) and extent of auditory-motor learning (Experiment I) whereas AWS showed a negative correlation between these measures. Thus, findings suggest that AWS show deficits in both pre-speech auditory modulation and auditory-motor learning; however, limited pre

Precise Time Delays from Strongly Gravitationally Lensed Type Ia Supernovae with Chromatically Microlensed Images

NASA Astrophysics Data System (ADS)

Goldstein, Daniel A.; Nugent, Peter E.; Kasen, Daniel N.; Collett, Thomas E.

2018-03-01

Time delays between the multiple images of strongly gravitationally lensed Type Ia supernovae (glSNe Ia) have the potential to deliver precise cosmological constraints, but the effects of microlensing on time delay extraction have not been studied in detail. Here we quantify the effect of microlensing on the glSN Ia yield of the Large Synoptic Survey Telescope (LSST) and the effect of microlensing on the precision and accuracy of time delays that can be extracted from LSST glSNe Ia. Microlensing has a negligible effect on the LSST glSN Ia yield, but it can be increased by a factor of ∼2 over previous predictions to 930 systems using a novel photometric identification technique based on spectral template fitting. Crucially, the microlensing of glSNe Ia is achromatic until three rest-frame weeks after the explosion, making the early-time color curves microlensing-insensitive time delay indicators. By fitting simulated flux and color observations of microlensed glSNe Ia with their underlying, unlensed spectral templates, we forecast the distribution of absolute time delay error due to microlensing for LSST, which is unbiased at the sub-percent level and peaked at 1% for color curve observations in the achromatic phase, while for light-curve observations it is comparable to state-of-the-art mass modeling uncertainties (4%). About 70% of LSST glSN Ia images should be discovered during the achromatic phase, indicating that microlensing time delay uncertainties can be minimized if prompt multicolor follow-up observations are obtained. Accounting for microlensing, the 1–2 day time delay on the recently discovered glSN Ia iPTF16geu can be measured to 40% precision, limiting its cosmological utility.

Precise Time Delays from Strongly Gravitationally Lensed Type Ia Supernovae with Chromatically Microlensed Images

DOE PAGES

Goldstein, Daniel A.; Nugent, Peter E.; Kasen, Daniel N.; ...

2018-03-01

Time delays between the multiple images of strongly gravitationally lensed Type Ia supernovae (glSNe Ia) have the potential to deliver precise cosmological constraints, but the effects of microlensing on time delay extraction have not been studied in detail. Here we quantify the effect of microlensing on the glSN Ia yield of the Large Synoptic Survey Telescope (LSST) and the effect of microlensing on the precision and accuracy of time delays that can be extracted from LSST glSNe Ia. Microlensing has a negligible effect on the LSST glSN Ia yield, but it can be increased by a factor of ~2 overmore » previous predictions to 930 systems using a novel photometric identification technique based on spectral template fitting. Crucially, the microlensing of glSNe Ia is achromatic until three rest-frame weeks after the explosion, making the early-time color curves microlensing-insensitive time delay indicators. By fitting simulated flux and color observations of microlensed glSNe Ia with their underlying, unlensed spectral templates, we forecast the distribution of absolute time delay error due to microlensing for LSST, which is unbiased at the sub-percent level and peaked at 1% for color curve observations in the achromatic phase, while for light-curve observations it is comparable to state-of-the-art mass modeling uncertainties (4%). About 70% of LSST glSN Ia images should be discovered during the achromatic phase, indicating that microlensing time delay uncertainties can be minimized if prompt multicolor follow-up observations are obtained. Lastly, accounting for microlensing, the 1-2 day time delay on the recently discovered glSN Ia iPTF16geu can be measured to 40% precision, limiting its cosmological utility.« less

Precise Time Delays from Strongly Gravitationally Lensed Type Ia Supernovae with Chromatically Microlensed Images

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goldstein, Daniel A.; Nugent, Peter E.; Kasen, Daniel N.

Time delays between the multiple images of strongly gravitationally lensed Type Ia supernovae (glSNe Ia) have the potential to deliver precise cosmological constraints, but the effects of microlensing on time delay extraction have not been studied in detail. Here we quantify the effect of microlensing on the glSN Ia yield of the Large Synoptic Survey Telescope (LSST) and the effect of microlensing on the precision and accuracy of time delays that can be extracted from LSST glSNe Ia. Microlensing has a negligible effect on the LSST glSN Ia yield, but it can be increased by a factor of ~2 overmore » previous predictions to 930 systems using a novel photometric identification technique based on spectral template fitting. Crucially, the microlensing of glSNe Ia is achromatic until three rest-frame weeks after the explosion, making the early-time color curves microlensing-insensitive time delay indicators. By fitting simulated flux and color observations of microlensed glSNe Ia with their underlying, unlensed spectral templates, we forecast the distribution of absolute time delay error due to microlensing for LSST, which is unbiased at the sub-percent level and peaked at 1% for color curve observations in the achromatic phase, while for light-curve observations it is comparable to state-of-the-art mass modeling uncertainties (4%). About 70% of LSST glSN Ia images should be discovered during the achromatic phase, indicating that microlensing time delay uncertainties can be minimized if prompt multicolor follow-up observations are obtained. Lastly, accounting for microlensing, the 1-2 day time delay on the recently discovered glSN Ia iPTF16geu can be measured to 40% precision, limiting its cosmological utility.« less

An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

PubMed

Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M

2009-10-19

Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

Role of assessment tests in the stability of intelligence scoring of pre-school children with uneven/delayed cognitive profile.

PubMed

Yang, P; Jong, Y-J; Hsu, H-Y; Lung, F-W

2011-05-01

As part of an ongoing clinical service programme for pre-school children with developmental delay in an Asian developing country, we analysed the effect of three assessment tests, that is, Bayley Scale of Infant Development-II, Leiter International Performance Scale - Revised and Wechsler Preschool and Primary Scale of Intelligence - Revised - Chinese, on the stability of intelligence quotient (IQ) of children from pre-school through early childhood. The participants were 313 Taiwanese pre-school children with uneven or delayed cognitive profile and they were followed through early childhood. IQ stability was explored by different tests and among children of different clinical diagnosis: 168 children with non-autistic intellectual disability, 73 children with autism spectrum disorder, 58 children with mixed receptive-expressive language disorder and 14 children of other heterogeneous diagnoses. Stability of scores was evaluated using the r-squared for Pearson's coefficients to see the correlation between initial IQ (IQ1) and follow-up IQ (IQ2). Multiple linear regressions were also applied to see whether IQ1 had predictive ability for IQ2 and test-test difference in the total 313 children and each diagnostic subgroup. Results revealed that mean IQ1 was 65.8 ± 15.4 while mean IQ2 was 73.2 ± 17.9 for the total 313 children. The IQs were stable across an average follow-up duration of 38.6 ± 22.1 month from pre-school into early childhood. Patterns of positive correlations between IQ1 and IQ2 were noted by all the tests (r-squared = 0.43-0.5, all P < 0.001) and in the majority of diagnostic subgroups. Multiple regressions analysis also revealed that IQ1 could predict IQ2 significantly in all the tests (all P < 0.001). After careful choice of appropriate initial test, stability of IQ in children with developmental delay was noted from pre-school through early childhood. In addition, the translated version of cognitive assessment was valid for the required context of

The rRNA methyltransferase Bud23 shows functional interaction with components of the SSU processome and RNase MRP.

PubMed

Sardana, Richa; White, Joshua P; Johnson, Arlen W

2013-06-01

Bud23 is responsible for the conserved methylation of G1575 of 18S rRNA, in the P-site of the small subunit of the ribosome. bud23Δ mutants have severely reduced small subunit levels and show a general failure in cleavage at site A2 during rRNA processing. Site A2 is the primary cleavage site for separating the precursors of 18S and 25S rRNAs. Here, we have taken a genetic approach to identify the functional environment of BUD23. We found mutations in UTP2 and UTP14, encoding components of the SSU processome, as spontaneous suppressors of a bud23Δ mutant. The suppressors improved growth and subunit balance and restored cleavage at site A2. In a directed screen of 50 ribosomal trans-acting factors, we identified strong positive and negative genetic interactions with components of the SSU processome and strong negative interactions with components of RNase MRP. RNase MRP is responsible for cleavage at site A3 in pre-rRNA, an alternative cleavage site for separating the precursor rRNAs. The strong negative genetic interaction between RNase MRP mutants and bud23Δ is likely due to the combined defects in cleavage at A2 and A3. Our results suggest that Bud23 plays a role at the time of A2 cleavage, earlier than previously thought. The genetic interaction with the SSU processome suggests that Bud23 could be involved in triggering disassembly of the SSU processome, or of particular subcomplexes of the processome.

An Archaea 5S rRNA analog is stably expressed in Escherichia coli

NASA Technical Reports Server (NTRS)

Yang, Y.; Fox, G. E.

1996-01-01

Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

hUTP24 is essential for processing of the human rRNA precursor at site A1, but not at site A0

PubMed Central

Tomecki, Rafal; Labno, Anna; Drazkowska, Karolina; Cysewski, Dominik; Dziembowski, Andrzej

2015-01-01

Production of ribosomes relies on more than 200 accessory factors to ensure the proper sequence of steps and faultless assembly of ribonucleoprotein machinery. Among trans-acting factors are numerous enzymes, including ribonucleases responsible for processing the large rRNA precursor synthesized by RNA polymerase I that encompasses sequences corresponding to mature 18S, 5.8S, and 25/28S rRNA. In humans, the identity of most enzymes responsible for individual processing steps, including endoribonucleases that cleave pre-rRNA at specific sites within regions flanking and separating mature rRNA, remains largely unknown. Here, we investigated the role of hUTP24 in rRNA maturation in human cells. hUTP24 is a human homolog of the Saccharomyces cerevisiae putative PIN domain-containing endoribonuclease Utp24 (yUtp24), which was suggested to participate in the U3 snoRNA-dependent processing of yeast pre-rRNA at sites A0, A1, and A2. We demonstrate that hUTP24 interacts to some extent with proteins homologous to the components of the yeast small subunit (SSU) processome. Moreover, mutation in the putative catalytic site of hUTP24 results in slowed growth of cells and reduced metabolic activity. These effects are associated with a defect in biogenesis of the 40S ribosomal subunit, which results from decreased amounts of 18S rRNA as a consequence of inaccurate pre-rRNA processing at the 5′-end of the 18S rRNA segment (site A1). Interestingly, and in contrast to yeast, site A0 located upstream of A1 is efficiently processed upon UTP24 dysfunction. Finally, hUTP24 inactivation leads to aberrant processing of 18S rRNA 2 nucleotides downstream of the normal A1 cleavage site. PMID:26237581

The cytoplasmic mRNA degradation factor Pat1 is required for rRNA processing

PubMed Central

Muppavarapu, Mridula; Huch, Susanne; Nissan, Tracy

2016-01-01

ABSTRACT Pat1 is a key cytoplasmic mRNA degradation factor, the loss of which severely increases mRNA half-lives. Several recent studies have shown that Pat1 can enter the nucleus and can shuttle between the nucleus and the cytoplasm. As a result, many nuclear roles have been proposed for Pat1. In this study, we analyzed four previously suggested nuclear roles of Pat1 and show that Pat1 is not required for efficient pre-mRNA splicing or pre-mRNA decay in yeast. However, lack of Pat1 results in accumulation of pre-rRNA processing intermediates. Intriguingly, we identified a novel genetic relationship between Pat1 and the rRNA decay machinery, specifically the exosome and the TRAMP complex. While the pre-rRNA processing intermediates that accumulate in the pat1 deletion mutant are, at least to some extent, recognized as aberrant by the rRNA degradation machinery, it is unlikely that these accumulations are the cause of their synthetic sick relationship. Here, we show that the dysregulation of the levels of mRNAs related to ribosome biogenesis could be the cause of the accumulation of the pre-rRNA processing intermediates. Although our results support a role for Pat1 in transcription, they nevertheless suggest that the primary cause of the dysregulated mRNA levels is most likely due to Pat1's role in mRNA decapping and mRNA degradation. PMID:26918764

The cytoplasmic mRNA degradation factor Pat1 is required for rRNA processing.

PubMed

Muppavarapu, Mridula; Huch, Susanne; Nissan, Tracy

2016-01-01

Pat1 is a key cytoplasmic mRNA degradation factor, the loss of which severely increases mRNA half-lives. Several recent studies have shown that Pat1 can enter the nucleus and can shuttle between the nucleus and the cytoplasm. As a result, many nuclear roles have been proposed for Pat1. In this study, we analyzed four previously suggested nuclear roles of Pat1 and show that Pat1 is not required for efficient pre-mRNA splicing or pre-mRNA decay in yeast. However, lack of Pat1 results in accumulation of pre-rRNA processing intermediates. Intriguingly, we identified a novel genetic relationship between Pat1 and the rRNA decay machinery, specifically the exosome and the TRAMP complex. While the pre-rRNA processing intermediates that accumulate in the pat1 deletion mutant are, at least to some extent, recognized as aberrant by the rRNA degradation machinery, it is unlikely that these accumulations are the cause of their synthetic sick relationship. Here, we show that the dysregulation of the levels of mRNAs related to ribosome biogenesis could be the cause of the accumulation of the pre-rRNA processing intermediates. Although our results support a role for Pat1 in transcription, they nevertheless suggest that the primary cause of the dysregulated mRNA levels is most likely due to Pat1's role in mRNA decapping and mRNA degradation.

RNomics in Archaea reveals a further link between splicing of archaeal introns and rRNA processing

PubMed Central

Tang, Thean Hock; Rozhdestvensky, Timofey S.; d’Orval, Béatrice Clouet; Bortolin, Marie-Line; Huber, Harald; Charpentier, Bruno; Branlant, Christiane; Bachellerie, Jean-Pierre; Brosius, Jürgen; Hüttenhofer, Alexander

2002-01-01

The bulge–helix–bulge (BHB) motif recognised by the archaeal splicing endonuclease is also found in the long processing stems of archaeal rRNA precursors in which it is cleaved to generate pre-16S and pre-23S rRNAs. We show that in two species, Archaeoglobus fulgidus and Sulfolobus solfataricus, representatives from the two major archaeal kingdoms Euryarchaeota and Crenarchaeota, respectively, the pre-rRNA spacers cleaved at the BHB motifs surrounding pre-16S and pre-23S rRNAs subsequently become ligated. In addition, we present evidence that this is accompanied by circularisation of ribosomal pre-16S and pre-23S rRNAs in both species. These data reveal a further link between intron splicing and pre-rRNA processing in Archaea, which might reflect a common evolutionary origin of the two processes. One spliced RNA species designated 16S-D RNA, resulting from religation at the BHB motif of 16S pre-rRNA, is a highly abundant and stable RNA which folds into a three-stem structure interrupted by two single-stranded regions as assessed by chemical probing. It spans a region of the pre-rRNA 5′ external transcribed spacer exhibiting a highly conserved folding pattern in Archaea. Surprisingly, 16S-D RNA contains structural motifs found in archaeal C/D box small RNAs and binds to the L7Ae protein, a core component of archaeal C/D box RNPs. This supports the notion that it might have an important but still unknown role in pre-rRNA biogenesis or might even target RNA molecules other than rRNA. PMID:11842103

Ciguatoxin reduces regenerative capacity of axotomized peripheral neurons and delays functional recovery in pre-exposed mice after peripheral nerve injury.

PubMed

Au, Ngan Pan Bennett; Kumar, Gajendra; Asthana, Pallavi; Tin, Chung; Mak, Yim Ling; Chan, Leo Lai; Lam, Paul Kwan Sing; Ma, Chi Him Eddie

2016-05-27

Ciguatera fish poisoning (CFP) results from consumption of tropical reef fish containing ciguatoxins (CTXs). Pacific (P)-CTX-1 is among the most potent known CTXs and the predominant source of CFP in the endemic region responsible for the majority of neurological symptoms in patients. Chronic and persistent neurological symptoms occur in some CFP patients, which often result in incomplete functional recovery for years. However, the direct effects of exposure to CTXs remain largely unknown. In present study, we exposed mice to CTX purified from ciguatera fish sourced from the Pacific region. P-CTX-1 was detected in peripheral nerves within hours and persisted for two months after exposure. P-CTX-1 inhibited axonal regrowth from axotomized peripheral neurons in culture. P-CTX-1 exposure reduced motor function in mice within the first two weeks of exposure before returning to baseline levels. These pre-exposed animals exhibited delayed sensory and motor functional recovery, and irreversible motor deficits after peripheral nerve injury in which formation of functional synapses was impaired. These findings are consistent with reduced muscle function, as assessed by electromyography recordings. Our study provides strong evidence that the persistence of P-CTX-1 in peripheral nerves reduces the intrinsic growth capacity of peripheral neurons, resulting in delayed functional recovery after injury.

Differences in symptoms, first medical contact and pre-hospital delay times between patients with ST- and non-ST-elevation myocardial infarction.

PubMed

Ängerud, Karin H; Sederholm Lawesson, Sofia; Isaksson, Rose-Marie; Thylén, Ingela; Swahn, Eva

2017-11-01

In ST-elevation myocardial infarction, time to reperfusion is crucial for the prognosis. Symptom presentation in myocardial infarction influences pre-hospital delay times but studies about differences in symptoms between patients with ST-elevation myocardial infarction and non-ST-elevation myocardial infarction are sparse and inconclusive. The aim was to compare symptoms, first medical contact and pre-hospital delay times in patients with ST-elevation myocardial infarction and non-ST-elevation myocardial infarction. This multicentre, observational study included 694 myocardial infarction patients from five hospitals. The patients filled in a questionnaire about their pre-hospital experiences within 24 h of hospital admittance. Chest pain was the most common symptom in ST-elevation myocardial infarction and non-ST-elevation myocardial infarction (88.7 vs 87.0%, p=0.56). Patients with cold sweat (odds ratio 3.61, 95% confidence interval 2.29-5.70), jaw pain (odds ratio 2.41, 95% confidence interval 1.04-5.58), and nausea (odds ratio 1.70, 95% confidence interval 1.01-2.87) were more likely to present with ST-elevation myocardial infarction, whereas the opposite was true for symptoms that come and go (odds ratio 0.58, 95% confidence interval 0.38-0.90) or anxiety (odds ratio 0.52, 95% confidence interval 0.29-0.92). Use of emergency medical services was higher among patients admitted with ST-elevation myocardial infarction. The pre-hospital delay time from symptom onset to first medical contact was significantly longer in non-ST-elevation myocardial infarction (2:05 h vs 1:10 h, p=0.001). Patients with ST-elevation myocardial infarction differed from those with non-ST-elevation myocardial infarction regarding symptom presentation, ambulance utilisation and pre-hospital delay times. This knowledge is important to be aware of for all healthcare personnel and the general public especially in order to recognise symptoms suggestive of ST-elevation myocardial infarction and

Visual stimuli in intervention approaches for pre-schoolers diagnosed with phonological delay.

PubMed

Pedro, Cassandra Ferreira; Lousada, Marisa; Hall, Andreia; Jesus, Luis M T

2018-04-01

The aim of this study was to develop and content validate specific speech and language intervention picture cards: The Letter-Sound (L&S) cards. The present study was also focused on assessing the influence of these cards on letter-sound correspondences and speech sound production. An expert panel of six speech and language therapists analysed and discussed the L&S cards based on several criteria previously established. A Speech and Language Therapist carried out a 6-week therapeutic intervention with a group of seven Portuguese phonologically delayed pre-schoolers aged 5;3 to 6;5. The modified Bland-Altman method revealed good agreement among evaluators, that is the majority of the values was between the agreement limits. Additional outcome measures were collected before and after the therapeutic intervention process. Results indicate that the L&S cards facilitate the acquisition of letter-sound correspondences. Regarding speech sound production, some improvements were also observed at word level. The L&S cards are therefore likely to give phonetic cues, which are crucial for the correct production of therapeutic targets. These visual cues seemed to have helped children with phonological delay develop the above-mentioned skills.

5S rRNA and ribosome.

PubMed

Gongadze, G M

2011-12-01

5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania.

PubMed

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-12-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved.

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania

PubMed Central

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-01-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved. PMID:22767185

Observational selection biases in time-delay strong lensing and their impact on cosmography

NASA Astrophysics Data System (ADS)

Collett, Thomas E.; Cunnington, Steven D.

2016-11-01

Inferring cosmological parameters from time-delay strong lenses requires a significant investment of telescope time; it is therefore tempting to focus on the systems with the brightest sources, the highest image multiplicities and the widest image separations. We investigate if this selection bias can influence the properties of the lenses studied and the cosmological parameters inferred. Using an ellipsoidal power-law deflector population, we build a sample of double- and quadruple-image systems. Assuming reasonable thresholds on image separation and flux, based on current lens monitoring campaigns, we find that the typical density profile slopes of monitorable lenses are significantly shallower than the input ensemble. From a sample of quads, we find that this selection function can introduce a 3.5 per cent bias on the inferred time-delay distances if the properties of the input ensemble are (incorrectly) used as priors on the lens model. This bias remains at the 2.4 per cent level when high-resolution imaging of the quasar host is used to precisely infer the properties of individual lenses. We also investigate if the lines of sight for monitorable strong lenses are biased. The expectation value for the line-of-sight convergence is increased by 0.009 (0.004) for quads (doubles) implying a 0.9 per cent (0.4 per cent) bias on H0. We therefore conclude that whilst the properties of typical quasar lenses and their lines of sight do deviate from the global population, the total magnitude of this effect is likely to be a subdominant effect for current analyses, but has the potential to be a major systematic for samples of ˜25 or more lenses.

High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

PubMed

Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

2015-10-01

Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

The Evolutionarily Conserved Protein LAS1 Is Required for Pre-rRNA Processing at Both Ends of ITS2

PubMed Central

Schillewaert, Stéphanie; Wacheul, Ludivine; Lhomme, Frédéric

2012-01-01

Ribosome synthesis entails the formation of mature rRNAs from long precursor molecules, following a complex pre-rRNA processing pathway. Why the generation of mature rRNA ends is so complicated is unclear. Nor is it understood how pre-rRNA processing is coordinated at distant sites on pre-rRNA molecules. Here we characterized, in budding yeast and human cells, the evolutionarily conserved protein Las1. We found that, in both species, Las1 is required to process ITS2, which separates the 5.8S and 25S/28S rRNAs. In yeast, Las1 is required for pre-rRNA processing at both ends of ITS2. It is required for Rrp6-dependent formation of the 5.8S rRNA 3′ end and for Rat1-dependent formation of the 25S rRNA 5′ end. We further show that the Rat1-Rai1 5′-3′ exoribonuclease (exoRNase) complex functionally connects processing at both ends of the 5.8S rRNA. We suggest that pre-rRNA processing is coordinated at both ends of 5.8S rRNA and both ends of ITS2, which are brought together by pre-rRNA folding, by an RNA processing complex. Consistently, we note the conspicuous presence of ∼7- or 8-nucleotide extensions on both ends of 5.8S rRNA precursors and at the 5′ end of pre-25S RNAs suggestive of a protected spacer fragment of similar length. PMID:22083961

Identification of an Alternative rRNA Post-transcriptional Maturation of 26S rRNA in the Kingdom Fungi.

PubMed

Navarro-Ródenas, Alfonso; Carra, Andrea; Morte, Asunción

2018-01-01

Despite of the integrity of their RNA, some desert truffles present a non-canonical profile of rRNA where 3.3 kb is absent, 1.8 kb is clear and a band of 1.6 kb is observed. A similar rRNA profile was identified in organisms belonging to different life kingdoms, with the exception of the Kingdom Fungi, as a result of a split LSU rRNA called hidden gap . rRNA profiles of desert truffles were analyzed to verify the presence of the non-canonical profile. The RNA of desert truffles and yeast were blotted and hybridized with probes complementary to LSU extremes. RACE of LSU rRNA was carried out to determine the LSU rRNA breakage point. LSU rRNA of desert truffles presents a post-transcriptional cleavage of five nucleotides that generates a hidden gap located in domain D7. LSU splits into two molecules of 1.6 and 1.8 kb. Similar to other organisms, a UAAU tract, downstream of the breakage point, was identified. Phylogenetic comparison suggests that during fungi evolution mutations were introduced in the hypervariable D7 domain, resulting in a sequence that is specifically post-transcriptionally cleaved in some desert truffles.

Diagnosis and treatment delays among elderly breast cancer patients with pre-existing mental illness.

PubMed

Iglay, Kristy; Santorelli, Melissa L; Hirshfield, Kim M; Williams, Jill M; Rhoads, George G; Lin, Yong; Demissie, Kitaw

2017-11-01

This study aimed to compare diagnosis and treatment delays in elderly breast cancer patients with and without pre-existing mental illness. A retrospective cohort study was conducted using the Surveillance, Epidemiology and End Results-Medicare data including 16,636 women 68+ years, who were diagnosed with stage I-IIIa breast cancer in the United States from 2005 to 2007. Mental illness was identified using International Classification of Diseases, Ninth Revision, Clinical Modification codes recorded on inpatient and outpatient claims during the 3 years prior to breast cancer diagnosis. Patients were classified as having no mental illness, anxiety, depression, anxiety and depression, or severe mental illness (bipolar disorder, schizophrenia, and other psychotic disorder). Multivariable binomial regression was used to assess the association between mental illness and delays of ≥60 and ≥90 days after adjustment for confounders. Patients with comorbid anxiety and depression had an increased risk for diagnosis delay of ≥90 days from symptom recognition (RR 1.11; 95% CI 1.00, 1.23), and those with severe mental illness had an increased risk for initial treatment delay of ≥60 days from diagnosis (RR 1.36; 95% CI 1.06, 1.74). Patients with any mental illness experienced an increased risk for adjuvant chemotherapy delay of ≥90 days from last operation (RR 1.13; 95% CI 1.01, 1.26) and each category of mental illness, except depression, showed a non-significant trend for this association. Breast cancer patients with mental illness should be closely managed by a cross-functional care team, including a psychiatrist, a primary care physician, and an oncologist, to ensure adequate care is received within an appropriate timeframe.

RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility

PubMed Central

Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

2015-01-01

Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmAII enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmAII, rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmAII in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmAII activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmAII, thereby facilitating TEL binding to the ribosome. PMID:26365244

Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

PubMed

Wu, Shu; Xiong, Jie; Yu, Yuhe

2015-01-01

Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

PubMed Central

Wu, Shu; Xiong, Jie; Yu, Yuhe

2015-01-01

Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

Alternative splicing of anciently exonized 5S rRNA regulates plant transcription factor TFIIIA

PubMed Central

Fu, Yan; Bannach, Oliver; Chen, Hao; Teune, Jan-Hendrik; Schmitz, Axel; Steger, Gerhard; Xiong, Liming; Barbazuk, W. Brad

2009-01-01

Identifying conserved alternative splicing (AS) events among evolutionarily distant species can prioritize AS events for functional characterization and help uncover relevant cis- and trans-regulatory factors. A genome-wide search for conserved cassette exon AS events in higher plants revealed the exonization of 5S ribosomal RNA (5S rRNA) within the gene of its own transcription regulator, TFIIIA (transcription factor for polymerase III A). The 5S rRNA-derived exon in TFIIIA gene exists in all representative land plant species but not in green algae and nonplant species, suggesting it is specific to land plants. TFIIIA is essential for RNA polymerase III-based transcription of 5S rRNA in eukaryotes. Integrating comparative genomics and molecular biology revealed that the conserved cassette exon derived from 5S rRNA is coupled with nonsense-mediated mRNA decay. Utilizing multiple independent Arabidopsis overexpressing TFIIIA transgenic lines under osmotic and salt stress, strong accordance between phenotypic and molecular evidence reveals the biological relevance of AS of the exonized 5S rRNA in quantitative autoregulation of TFIIIA homeostasis. Most significantly, this study provides the first evidence of ancient exaptation of 5S rRNA in plants, suggesting a novel gene regulation model mediated by the AS of an anciently exonized noncoding element. PMID:19211543

Strong Delayed Interactive Effects of Metal Exposure and Warming: Latitude-Dependent Synergisms Persist Across Metamorphosis.

PubMed

Debecker, Sara; Dinh, Khuong V; Stoks, Robby

2017-02-21

As contaminants are often more toxic at higher temperatures, predicting their impact under global warming remains a key challenge for ecological risk assessment. Ignoring delayed effects, synergistic interactions between contaminants and warming, and differences in sensitivity across species' ranges could lead to an important underestimation of the risks. We addressed all three mechanisms by studying effects of larval exposure to zinc and warming before, during, and after metamorphosis in Ischnura elegans damselflies from high- and low-latitude populations. By integrating these mechanisms into a single study, we could identify two novel patterns. First, during exposure zinc did not affect survival, whereas it induced mild to moderate postexposure mortality in the larval stage and at metamorphosis, and very strongly reduced adult lifespan. This severe delayed effect across metamorphosis was especially remarkable in high-latitude animals, as they appeared almost insensitive to zinc during the larval stage. Second, the well-known synergism between metals and warming was manifested not only during the larval stage but also after metamorphosis, yet notably only in low-latitude damselflies. These results highlight that a more complete life-cycle approach that incorporates the possibility of delayed interactions between contaminants and warming in a geographical context is crucial for a more realistic risk assessment in a warming world.

31 CFR 560.515 - 30-day delayed effective date for pre-May 7, 1995 trade contracts involving Iran.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false 30-day delayed effective date for pre-May 7, 1995 trade contracts involving Iran. 560.515 Section 560.515 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY IRANIAN TRANSACTIONS REGULATIONS...

31 CFR 538.506 - 30-day delayed effective date for pre-November 4, 1997 trade contracts involving Sudan.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 31 Money and Finance:Treasury 3 2014-07-01 2014-07-01 false 30-day delayed effective date for pre-November 4, 1997 trade contracts involving Sudan. 538.506 Section 538.506 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY SUDANESE SANCTIONS REGULATIONS...

31 CFR 538.506 - 30-day delayed effective date for pre-November 4, 1997 trade contracts involving Sudan.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false 30-day delayed effective date for pre-November 4, 1997 trade contracts involving Sudan. 538.506 Section 538.506 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY SUDANESE SANCTIONS REGULATIONS...

31 CFR 538.506 - 30-day delayed effective date for pre-November 4, 1997 trade contracts involving Sudan.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 31 Money and Finance:Treasury 3 2011-07-01 2011-07-01 false 30-day delayed effective date for pre-November 4, 1997 trade contracts involving Sudan. 538.506 Section 538.506 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY SUDANESE SANCTIONS REGULATIONS...

31 CFR 560.515 - 30-day delayed effective date for pre-May 7, 1995 trade contracts involving Iran.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 31 Money and Finance:Treasury 3 2011-07-01 2011-07-01 false 30-day delayed effective date for pre-May 7, 1995 trade contracts involving Iran. 560.515 Section 560.515 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY IRANIAN TRANSACTIONS REGULATIONS...

Role of Assessment Tests in the Stability of Intelligence Scoring of Pre-School Children with Uneven/Delayed Cognitive Profile

ERIC Educational Resources Information Center

Yang, P.; Jong, Y-J.; Hsu, H-Y.; Lung, F-W.

2011-01-01

Background: As part of an ongoing clinical service programme for pre-school children with developmental delay in an Asian developing country, we analysed the effect of three assessment tests, that is, Bayley Scale of Infant Development-II, Leiter International Performance Scale-Revised and Wechsler Preschool and Primary Scale of…

Increased 5S rRNA oxidation in Alzheimer's disease.

PubMed

Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

2012-01-01

It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

Kinetic analysis of pre-ribosome structure in vivo

PubMed Central

Swiatkowska, Agata; Wlotzka, Wiebke; Tuck, Alex; Barrass, J. David; Beggs, Jean D.; Tollervey, David

2012-01-01

Pre-ribosomal particles undergo numerous structural changes during maturation, but their high complexity and short lifetimes make these changes very difficult to follow in vivo. In consequence, pre-ribosome structure and composition have largely been inferred from purified particles and analyzed in vitro. Here we describe techniques for kinetic analyses of the changes in pre-ribosome structure in living cells of Saccharomyces cerevisiae. To allow this, in vivo structure probing by DMS modification was combined with affinity purification of newly synthesized 20S pre-rRNA over a time course of metabolic labeling with 4-thiouracil. To demonstrate that this approach is generally applicable, we initially analyzed the accessibility of the region surrounding cleavage site D site at the 3′ end of the mature 18S rRNA region of the pre-rRNA. This revealed a remarkably flexible structure throughout 40S subunit biogenesis, with little stable RNA–protein interaction apparent. Analysis of folding in the region of the 18S central pseudoknot was consistent with previous data showing U3 snoRNA–18S rRNA interactions. Dynamic changes in the structure of the hinge between helix 28 (H28) and H44 of pre-18S rRNA were consistent with recently reported interactions with the 3′ guide region of U3 snoRNA. Finally, analysis of the H18 region indicates that the RNA structure matures early, but additional protection appears subsequently, presumably reflecting protein binding. The structural analyses described here were performed on total, affinity-purified, newly synthesized RNA, so many classes of RNA and RNA–protein complex are potentially amenable to this approach. PMID:23093724

RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility.

PubMed

Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

2015-10-15

Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmA(II) enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmA(II), rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmA(II) in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmA(II) activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmA(II), thereby facilitating TEL binding to the ribosome. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Exploring visual-graphic symbol acquisition by pre-school age children with developmental and language delays.

PubMed

Barton, Andrea; Sevcik, Rose A; Romski, Mary Ann

2006-03-01

The process of language acquisition requires an individual to organize the world through a system of symbols and referents. For children with severe intellectual disabilities and language delays, the ability to link a symbol to its referent may be a difficult task. In addition to the intervention strategy, issues such as the visual complexity and iconicity of a symbol arise when deciding what to select as a medium to teach language. This study explored the ability of four pre-school age children with developmental and language delays to acquire the meanings of Blissymbols and lexigrams using an observational experiential language intervention. In production, all four of the participants demonstrated symbol-referent relationships, while in comprehension, three of the four participants demonstrated at least emerging symbol-referent relationships. Although the number of symbols learned across participants varied, there were no differences between the learning of arbitrary and comparatively iconic symbols. The participants' comprehension skills appeared to influence their performance.

A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

PubMed Central

Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

2012-01-01

P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

Effect of pre-fixation delay and freezing on mink testicular endpoints for environmental research.

PubMed

Spörndly-Nees, Ellinor; Ekstedt, Elisabeth; Magnusson, Ulf; Fakhrzadeh, Azadeh; Luengo Hendriks, Cris L; Holm, Lena

2015-01-01

There is growing interest in using wild animals to monitor the real-life cocktail effect of environmental chemicals on male reproduction. However, practical difficulties, such as long distances to the laboratory, generally prolong the time between euthanisation and specimen handling. For instance, tissue fixation is often performed on frozen material or on material where deterioration has started, which may affect tissue morphology. This study examined the effect of pre-fixation delay and freezing on mink testicular endpoints in order to determine robust endpoints in suboptimally handled specimens. Sexually mature farmed mink (n=30) selected at culling were divided into six groups and subjected to different time intervals between euthanisation and fixation or freezing: 0 hours (fixed immediately post mortem), 6 hours, 18 hours, 30 hours, 42 hours, or frozen 6 hours post mortem and thawed overnight. Unaffected endpoints when pre-fixation storage was extended to 30 hours included: area and diameter of the seminiferous tubules, length and weight of the testes, and acrosomes marked with Gata-4. Epithelial height, Sertoli cells marked with Gata-4 and cell morphology were affected endpoints after 6 hours of storage. Freezing the tissue prior to fixation severely altered cell morphology and reduced testicular weight, tubular diameter and area. Morphological changes seen after 6 hours included shredded germ cells and excess cytoplasm in seminiferous tubular lumen, chromatin rearrangements and increased germ cell death. Extended delay before fixation and freezing affected many endpoints in the mink testicular tissue. Some of these endpoints may mimic chemically induced effects, which is important to consider when evaluating specimens from wild animals for environmental toxicity.

Horizontal Transfer of Segments of the 16S rRNA Genes between Species of the Streptococcus anginosus Group

PubMed Central

Schouls, Leo M.; Schot, Corrie S.; Jacobs, Jan A.

2003-01-01

The nature in variation of the 16S rRNA gene of members of the Streptococcus anginosus group was investigated by hybridization and DNA sequencing. A collection of 708 strains was analyzed by reverse line blot hybridization. This revealed the presence of distinct reaction patterns representing 11 different hybridization groups. The 16S rRNA genes of two strains of each hybridization group were sequenced to near-completion, and the sequence data confirmed the reverse line blot hybridization results. Closer inspection of the sequences revealed mosaic-like structures, strongly suggesting horizontal transfer of segments of the 16S rRNA gene between different species belonging to the Streptococcus anginosus group. Southern blot hybridization further showed that within a single strain all copies of the 16S rRNA gene had the same composition, indicating that the apparent mosaic structures were not PCR-induced artifacts. These findings indicate that the highly conserved rRNA genes are also subject to recombination and that these events may be fixed in the population. Such recombination may lead to the construction of incorrect phylogenetic trees based on the 16S rRNA genes. PMID:14645285

Delay discounting rates: a strong prognostic indicator of smoking relapse.

PubMed

Sheffer, Christine E; Christensen, Darren R; Landes, Reid; Carter, Larry P; Jackson, Lisa; Bickel, Warren K

2014-11-01

Recent evidence suggests that several dimensions of impulsivity and locus of control are likely to be significant prognostic indicators of relapse. One-hundred and thirty-one treatment seeking smokers were enrolled in six weeks of multi-component cognitive-behavioral therapy with eight weeks of nicotine replacement therapy. Cox proportional hazard regressions were used to model days to relapse with each of the following: delay discounting of $100, delay discounting of $1000, six subscales of the Barratt Impulsiveness Scale (BIS), Rotter's Locus of Control (RLOC), Fagerstrom's Test for Nicotine Dependence (FTND), and the Perceived Stress Scale (PSS). Hazard ratios for a one standard deviation increase were estimated with 95% confidence intervals for each explanatory variable. Likelihood ratios were used to examine the level of association with days to relapse for different combinations of the explanatory variables while accounting for nicotine dependence and stress level. These analyses found that the $100 delay discounting rate had the strongest association with days to relapse. Further, when discounting rates were combined with the FTND and PSS, the associations remained significant. When the other measures were combined with the FTND and PSS, their associations with relapse non-significant. These findings indicate that delay discounting is independently associated with relapse and adds to what is already accounted for by nicotine dependence and stress level. They also signify that delay discounting is a productive new target for enhancing treatment for tobacco dependence. Consequently, adding an intervention designed to decrease discounting rates to a comprehensive treatment for tobacco dependence has the potential to decrease relapse rates. Copyright © 2014 Elsevier Ltd. All rights reserved.

Test of the FLRW Metric and Curvature with Strong Lens Time Delays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liao, Kai; Li, Zhengxiang; Wang, Guo-Jian

We present a new model-independent strategy for testing the Friedmann–Lemaître–Robertson–Walker (FLRW) metric and constraining cosmic curvature, based on future time-delay measurements of strongly lensed quasar-elliptical galaxy systems from the Large Synoptic Survey Telescope and supernova observations from the Dark Energy Survey. The test only relies on geometric optics. It is independent of the energy contents of the universe and the validity of the Einstein equation on cosmological scales. The study comprises two levels: testing the FLRW metric through the distance sum rule (DSR) and determining/constraining cosmic curvature. We propose an effective and efficient (redshift) evolution model for performing the formermore » test, which allows us to concretely specify the violation criterion for the FLRW DSR. If the FLRW metric is consistent with the observations, then on the second level the cosmic curvature parameter will be constrained to ∼0.057 or ∼0.041 (1 σ ), depending on the availability of high-redshift supernovae, which is much more stringent than current model-independent techniques. We also show that the bias in the time-delay method might be well controlled, leading to robust results. The proposed method is a new independent tool for both testing the fundamental assumptions of homogeneity and isotropy in cosmology and for determining cosmic curvature. It is complementary to cosmic microwave background plus baryon acoustic oscillation analyses, which normally assume a cosmological model with dark energy domination in the late-time universe.« less

Promoting Social and Emotional Learning in Preschool Students: A Study of "Strong Start Pre-K"

ERIC Educational Resources Information Center

Gunter, Leslie; Caldarella, Paul; Korth, Byran B.; Young, K. Richard

2012-01-01

The inclusion of social and emotional learning (SEL) curricula in preschools may help prevent emotional and behavioral problems. This study evaluated the effects of a SEL curriculum, "Strong Start Pre-K," on the social and emotional competence of 52 preschool students using a quasi-experimental, non-equivalent control group design. Teachers rated…

Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

NASA Technical Reports Server (NTRS)

Gutell, R. R.; Larsen, N.; Woese, C. R.

1994-01-01

The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

PubMed

Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

2018-03-19

To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

Emergency surgery pre-operative delays - realities and economic impacts.

PubMed

O'Leary, D P; Beecher, S; McLaughlin, R

2014-12-01

A key principle of acute surgical service provision is the establishment of a distinct patient flow process and an emergency theatre. Time-to-theatre (TTT) is a key performance indicator of theatre efficiency. The combined impacts of an aging population, increasing demands and complexity associated with centralisation of emergency and oncology services has placed pressure on emergency theatre access. We examined our institution's experience with running a designated emergency theatre for acute surgical patients. A retrospective review of an electronic prospectively maintained database was performed between 1/1/12 and 31/12/13. A cost analysis was conducted to assess the economic impact of delayed TTT, with every 24hr delay incurring the cost of an additional overnight bed. Delays and the economic effects were assessed only after the first 24 h as an in-patient had elapsed. In total, 7041 procedures were performed. Overall mean TTT was 26 h, 2 min. There were significant differences between different age groups, with those aged under 16 year and over 65 having mean TTT at 6 h, 34 min (95% C.I. 0.51-2.15, p < 0.001) and 23 h, 41 min (95% C.I. 19.6-23.9, p < 0.001) respectively. 2421 (34%) waited greater than 24 h for emergency procedures. The >65 years age group had a mean TTT of 23 h, 41 min which was significantly longer than the overall mean TTT Vascular and urological emergencies are significantly disadvantaged in competition with other services for a shared emergency theatre. The economic impact of delayed TTT was calculated at €7,116,000, or €9880/day of additional costs generated from delayed TTT over a 24 month period. One third of patients waited longer than 24 h for emergency surgery, with the elderly disproportionately represented in this group. Aside from the clinical risks of delayed and out of hours surgery, such practices incur significant additional costs. New strategies must be devised to ensure efficient access to emergency theatres, investment

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

PubMed

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-12-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

PubMed Central

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-01-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387

Chromatin structure and methylation of rat rRNA genes studied by formaldehyde fixation and psoralen cross-linking.

PubMed Central

Stancheva, I; Lucchini, R; Koller, T; Sogo, J M

1997-01-01

By using formaldehyde cross-linking of histones to DNA and gel retardation assays we show that formaldehyde fixation, similar to previously established psoralen photocross-linking, discriminates between nucleosome- packed (inactive) and nucleosome-free (active) fractions of ribosomal RNA genes. By both cross-linking techniques we were able to purify fragments from agarose gels, corresponding to coding, enhancer and promoter sequences of rRNA genes, which were further investigated with respect to DNA methylation. This approach allows us to analyse independently and in detail methylation patterns of active and inactive rRNA gene copies by the combination of Hpa II and Msp I restriction enzymes. We found CpG methylation mainly present in enhancer and promoter regions of inactive rRNA gene copies. The methylation of one single Hpa II site, located in the promoter region, showed particularly strong correlation with the transcriptional activity. PMID:9108154

Analysis of the function of E. coli 23S rRNA helix-loop 69 by mutagenesis

PubMed Central

Liiv, Aivar; Karitkina, Diana; Maiväli, Ülo; Remme, Jaanus

2005-01-01

Background The ribosome is a two-subunit enzyme known to exhibit structural dynamism during protein synthesis. The intersubunit bridges have been proposed to play important roles in decoding, translocation, and the peptidyl transferase reaction; yet the physical nature of their contributions is ill understood. An intriguing intersubunit bridge, B2a, which contains 23S rRNA helix 69 as a major component, has been implicated by proximity in a number of catalytically important regions. In addition to contacting the small ribosomal subunit, helix 69 contacts both the A and P site tRNAs and several translation factors. Results We scanned the loop of helix 69 by mutagenesis and analyzed the mutant ribosomes using a plasmid-borne IPTG-inducible expression system. We assayed the effects of 23S rRNA mutations on cell growth, contribution of mutant ribosomes to cellular polysome pools and the ability of mutant ribosomes to function in cell-free translation. Mutations A1912G, and A1919G have very strong growth phenotypes, are inactive during in vitro protein synthesis, and under-represented in the polysomes. Mutation Ψ1917C has a very strong growth phenotype and leads to a general depletion of the cellular polysome pool. Mutation A1916G, having a modest growth phenotype, is apparently defective in the assembly of the 70S ribosome. Conclusion Mutations A1912G, A1919G, and Ψ1917C of 23S rRNA strongly inhibit translation. Mutation A1916G causes a defect in the 50S subunit or 70S formation. Mutations Ψ1911C, A1913G, C1914A, Ψ1915C, and A1918G lack clear phenotypes. PMID:16053518

Subcutaneous fat accumulation in early infancy is more strongly associated with motor development and delay than muscle growth.

PubMed

Kanazawa, H; Kawai, M; Niwa, F; Hasegawa, T; Iwanaga, K; Ohata, K; Tamaki, A; Heike, T

2014-06-01

Physical growth in neurologically healthy preterm infants affects motor development. This study investigated the separate relationships between muscle and fat in infancy and later motor development and physical growth. Muscle thickness and subcutaneous fat thickness of the anterior thigh were measured using ultrasound images obtained from neurologically healthy preterm infants at birth, 3, 6, 12 and 18 months' corrected age. We also obtained the Pediatric Evaluation of Disability Inventory and Alberta Infant Motor Scale scores at 18 months' corrected age to assess motor ability and motor delay. Thirty preterm infants completed the study protocol. There was a significant positive correlation between motor ability and increments in subcutaneous fat thickness during the first 3 and 6 months' corrected age (r = 0.48 and 0.40, p < 0.05, respectively), but not between motor ability and muscle thickness growth in any of the periods. A secondary, logistic regression analysis showed that increments in subcutaneous fat thickness during the first 3 months were a protective factor for motor delay. Subcutaneous fat accumulation in early infancy is more strongly associated with motor development and delay than muscle growth. ©2014 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

PubMed Central

Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

2012-01-01

Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

Choice between delayed food and immediate oxycodone in rats.

PubMed

Secci, Maria E; Factor, Julie A; Schindler, Charles W; Panlilio, Leigh V

2016-12-01

The choice to seek immediate drug effects instead of more meaningful but delayed rewards is a defining feature of addiction. To develop a rodent model of this behavior, we allowed rats to choose between immediate intravenous delivery of the prescription opioid oxycodone (50 μg/kg) and delayed delivery of palatable food pellets. Rats preferred food at delays up to 30 s, but they chose oxycodone and food equally at 60-s delay and preferred oxycodone over food at 120-s delay. Comparison of food-drug choice, food-only, and drug-only conditions indicated that food availability decreased drug intake, but drug availability increased food intake. In the food-only condition, food was effective as a reinforcer even when delayed by 120 s. Pre-session feeding with chow slowed acquisition of food and drug self-administration, but did not affect choice. To establish procedures for testing potential anti-addiction medications, noncontingent pre-treatment with oxycodone or naltrexone (analogous to substitution and antagonist therapies, respectively) were tested on a baseline in which oxycodone was preferred over delayed food. Naltrexone pre-treatment decreased drug intake and increased food intake. Oxycodone pre-treatment decreased drug intake, but also produced extended periods with no food or drug responding. These findings show that the contingencies that induce preference for drugs over more meaningful but less immediate rewards in humans can be modeled in rodents, and they suggest that the model could be useful for assessing the therapeutic potential of treatments and exploring the underlying behavioral and neural mechanisms involved in addiction.

Selective Phylogenetic Analysis Targeted at 16S rRNA Genes of Thermophiles and Hyperthermophiles in Deep-Subsurface Geothermal Environments

PubMed Central

Kimura, Hiroyuki; Sugihara, Maki; Kato, Kenji; Hanada, Satoshi

2006-01-01

Deep-subsurface samples obtained by deep drilling are likely to be contaminated with mesophilic microorganisms in the drilling fluid, and this could affect determination of the community structure of the geothermal microflora using 16S rRNA gene clone library analysis. To eliminate possible contamination by PCR-amplified 16S rRNA genes from mesophiles, a combined thermal denaturation and enzyme digestion method, based on a strong correlation between the G+C content of the 16S rRNA gene and the optimum growth temperatures of most known prokaryotic cultures, was used prior to clone library construction. To validate this technique, hot spring fluid (76°C) and river water (14°C) were used to mimic a deep-subsurface sample contaminated with drilling fluid. After DNA extraction and PCR amplification of the 16S rRNA genes from individual samples separately, the amplified products from river water were observed to be denatured at 82°C and completely digested by exonuclease I (Exo I), while the amplified products from hot spring fluid remained intact after denaturation at 84°C and enzyme digestion with Exo I. DNAs extracted from the two samples were mixed and used as a template for amplification of the 16S rRNA genes. The amplified rRNA genes were denatured at 84°C and digested with Exo I before clone library construction. The results indicated that the 16S rRNA gene sequences from the river water were almost completely eliminated, whereas those from the hot spring fluid remained. PMID:16391020

The Treacher Collins syndrome (TCOF1) gene product is involved in pre-rRNA methylation.

PubMed

Gonzales, Bianca; Henning, Dale; So, Rolando B; Dixon, Jill; Dixon, Michael J; Valdez, Benigno C

2005-07-15

Treacher Collins syndrome (TCS) is characterized by defects in craniofacial development, which results from mutations in the TCOF1 gene. TCOF1 encodes the nucleolar phosphoprotein treacle, which interacts with upstream binding factor (UBF) and affects transcription of the ribosomal DNA gene. The present study shows participation of treacle in the 2'-O-methylation of pre-rRNA. Antisense-mediated down-regulation of treacle expression in Xenopus laevis oocytes reduced 2'-O-methylation of pre-rRNA. Analysis of RNA isolated from wild-type and Tcof1+/- heterozygous mice embryos from strains that exhibit a lethal phenotype showed significant reduction in 2'-O-methylation at nucleotide C463 of 18S rRNA. The level of pseudouridylation of U1642 of 18S rRNA from the same RNA samples was not affected suggesting specificity. There is no significant difference in rRNA methylation between wild-type and heterozygous embryos of DBA x BALB/c mice, which have no obvious craniofacial phenotype. The function of treacle in pre-rRNA methylation is most likely mediated by its direct physical interaction with NOP56, a component of the ribonucleoprotein methylation complex. Although treacle co-localizes with UBF throughout mitosis, it co-localizes with NOP56 and fibrillarin, a putative methyl transferase, only during telophase when rDNA gene transcription and pre-rRNA methylation are known to commence. These observations suggest that treacle might link RNA polymerase I-catalyzed transcription and post-transcriptional modification of pre-rRNA. We hypothesize that haploinsufficiency of treacle in TCS patients results in inhibition of production of properly modified mature rRNA in addition to inhibition of rDNA gene transcription, which consequently affects proliferation and proper differentiation of specific embryonic cells during development.

Control of rRNA transcription in Escherichia coli.

PubMed Central

Condon, C; Squires, C; Squires, C L

1995-01-01

The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

USDA-ARS?s Scientific Manuscript database

This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

PubMed

Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

2012-07-13

Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

PubMed

Bai, Baoyan; Moore, Henna M; Laiho, Marikki

2013-01-01

CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

Heat shock represses rRNA synthesis by inactivation of TIF-IA and lncRNA-dependent changes in nucleosome positioning.

PubMed

Zhao, Zhongliang; Dammert, Marcel A; Hoppe, Sven; Bierhoff, Holger; Grummt, Ingrid

2016-09-30

Attenuation of ribosome biogenesis in suboptimal growth environments is crucial for cellular homeostasis and genetic integrity. Here, we show that shutdown of rRNA synthesis in response to elevated temperature is brought about by mechanisms that target both the RNA polymerase I (Pol I) transcription machinery and the epigenetic signature of the rDNA promoter. Upon heat shock, the basal transcription factor TIF-IA is inactivated by inhibition of CK2-dependent phosphorylations at Ser170/172. Attenuation of pre-rRNA synthesis in response to heat stress is accompanied by upregulation of PAPAS, a long non-coding RNA (lncRNA) that is transcribed in antisense orientation to pre-rRNA. PAPAS interacts with CHD4, the adenosine triphosphatase subunit of NuRD, leading to deacetylation of histones and movement of the promoter-bound nucleosome into a position that is refractory to transcription initiation. The results exemplify how stress-induced inactivation of TIF-IA and lncRNA-dependent changes of chromatin structure ensure repression of rRNA synthesis in response to thermo-stress. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Translational initiation in Leishmania tarentolae and Phytomonas serpens (Kinetoplastida) is strongly influenced by pre-ATG triplet and its 5' sequence context.

PubMed

Lukes, Julius; Paris, Zdenek; Regmi, Sandesh; Breitling, Reinhard; Mureev, Sergey; Kushnir, Susanna; Pyatkov, Konstantin; Jirků, Milan; Alexandrov, Kirill A

2006-08-01

To investigate the influence of sequence context of translation initiation codon on translation efficiency in Kinetoplastida, we constructed a library of expression plasmids randomized in the three nucleotides prefacing ATG of a reporter gene encoding enhanced green fluorescent protein (EGFP). All 64 possible combinations of pre-ATG triplets were individually stably integrated into the rDNA locus of Leishmania tarentolae and the resulting cell lines were assessed for EGFP expression. The expression levels were quantified directly by measuring the fluorescence of EGFP protein in living cells and confirmed by Western blotting. We observed a strong influence of the pre-ATG triplet on the level of protein expression over a 20-fold range. To understand the degree of evolutionary conservation of the observed effect, we transformed Phytomonas serpens, a trypanosomatid parasite of plants, with a subset of the constructs. The pattern of translational efficiency mediated by individual pre-ATG triplets in this species was similar to that observed in L. tarentolae. However, the pattern of translational efficiency of two other proteins (red fluorescent protein and tetracycline repressor) containing selected pre-ATG triplets did not correlate with either EGFP or each other. Thus, we conclude that a conserved mechanism of translation initiation site selection exists in kinetoplastids that is strongly influenced not only by the pre-ATG sequences but also by the coding region of the gene.

Acquisition of 16S rRNA methylase gene in Pseudomonas aeruginosa.

PubMed

Yokoyama, Keiko; Doi, Yohei; Yamane, Kunikazu; Kurokawa, Hiroshi; Shibata, Naohiro; Shibayama, Keigo; Yagi, Tetsuya; Kato, Haru; Arakawa, Yoshichika

2003-12-06

Bacteria develop resistance to aminoglycosides by producing aminoglycoside-modifying enzymes such as acetyltransferase, phosphorylase, and adenyltransferase. These enzymes, however, cannot confer consistent resistance to various aminoglycosides because of their substrate specificity. Notwithstanding, a Pseudomonas aeruginosa strain AR-2 showing high-level resistance (minimum inhibitory concentration >1024 mg/L) to various aminoglycosides was isolated clinically. We aimed to clone and characterise the genetic determinant of this resistance. We used conventional methods for DNA manipulation, susceptibility testing, and gene analyses to clone and characterise the genetic determinant of the resistance seen. PCR detection of the gene was also done on a stock of P aeruginosa strains that were isolated clinically since 1997. An aminoglycoside-resistance gene, designated rmtA, was identified in P aeruginosa AR-2. The Escherichia coli transformant and transconjugant harbouring the rmtA gene showed very high-level resistance to various aminoglycosides, including amikacin, tobramycin, isepamicin, arbekacin, kanamycin, and gentamicin. The 756-bp nucleotide rmtA gene encoded a protein, RmtA. This protein showed considerable similarity to the 16S rRNA methylases of aminoglycoside-producing actinomycetes, which protect bacterial 16S rRNA from intrinsic aminoglycosides by methylation. Incorporation of radiolabelled methyl groups into the 30S ribosome was detected in the presence of RmtA. Of 1113 clinically isolated P aeruginosa strains, nine carried the rmtA gene, as shown by PCR analyses. Our findings strongly suggest intergeneric lateral gene transfer of 16S rRNA methylase gene from some aminoglycoside-producing microorganisms to P aeruginosa. Further dissemination of the rmtA gene in nosocomial bacteria could be a matter of concern in the future.

Thrombolysis in Acute Ischemic Stroke: A Simulation Study to Improve Pre- and in-Hospital Delays in Community Hospitals

PubMed Central

Lahr, Maarten M. H.; van der Zee, Durk-Jouke; Vroomen, Patrick C. A. J.; Luijckx, Gert-Jan; Buskens, Erik

2013-01-01

Background Various studies demonstrate better patient outcome and higher thrombolysis rates achieved by centralized stroke care compared to decentralized care, i.e. community hospitals. It remains largely unclear how to improve thrombolysis rate in decentralized care. The aim of this simulation study was to assess the impact of previously identified success factors in a central model on thrombolysis rates and patient outcome when implemented for a decentral model. Methods Based on a prospectively collected dataset of 1084 ischemic stroke patients, simulation was used to replicate current practice and estimate the effect of re-organizing decentralized stroke care to resemble a centralized model. Factors simulated included symptom onset call to help, emergency medical services transportation, and in-hospital diagnostic workup delays. Primary outcome was proportion of patients treated with thrombolysis; secondary endpoints were good functional outcome at 90 days, Onset-Treatment-Time (OTT), and OTT intervals, respectively. Results Combining all factors might increase thrombolysis rate by 7.9%, of which 6.6% ascribed to pre-hospital and 1.3% to in-hospital factors. Good functional outcome increased by 11.4%, 8.7% ascribed to pre-hospital and 2.7% to in-hospital factors. The OTT decreased 17 minutes, 7 minutes ascribed to pre-hospital and 10 minutes to in-hospital factors. An increase was observed in the proportion thrombolyzed within 1.5 hours; increasing by 14.1%, of which 5.6% ascribed to pre-hospital and 8.5% to in-hospital factors. Conclusions Simulation technique may target opportunities for improving thrombolysis rates in acute stroke. Pre-hospital factors proved to be the most promising for improving thrombolysis rates in an implementation study. PMID:24260151

Comparative analysis of the 5S rRNA and its associated proteins reveals unique primitive rather than parasitic features in Giardia lamblia.

PubMed

Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan

2012-01-01

5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.

Comparative Analysis of the 5S rRNA and Its Associated Proteins Reveals Unique Primitive Rather Than Parasitic Features in Giardia lamblia

PubMed Central

Xin, De-Dong; Wen, Jian-Fan

2012-01-01

Background 5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. Methodology/Principal Findings By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. Conclusion/Significance The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features. PMID

Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

NASA Technical Reports Server (NTRS)

Fox, G. E.

1985-01-01

Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

Antibiotics for pre-term pre-labour rupture of membranes: prevention of neonatal deaths due to complications of pre-term birth and infection.

PubMed

Cousens, Simon; Blencowe, Hannah; Gravett, Michael; Lawn, Joy E

2010-04-01

In high-income countries, it is standard practice to give antibiotics to women with pre-term, pre-labour rupture of membranes (pPROM) to delay birth and reduce the risk of infection. In low and middle-income settings, where some 2 million neonatal deaths occur annually due to complications of pre-term birth or infection, many women do not receive antibiotic therapy for pPROM. To review the evidence for and estimate the effect on neonatal mortality due to pre-term birth complications or infection, of administration of antibiotics to women with pPROM, in low and middle-income countries. We performed a systematic review to update a Cochrane review. Standardized abstraction forms were used. The quality of the evidence provided by individual studies and overall was assessed using an adapted GRADE approach. Eighteen RCTs met our inclusion criteria. Most were from high-income countries and provide strong evidence that antibiotics for pPROM reduce the risk of respiratory distress syndrome [risk ratio (RR) = 0.88; confidence interval (CI) 0.80, 0.97], and early onset postnatal infection (RR = 0.61; CI 0.48, 0.77). The data are consistent with a reduction in neonatal mortality (RR = 0.90; CI 0.72, 1.12). Antibiotics for pPROM reduce complications due to pre-term delivery and post-natal infection in high-income settings. There is moderate quality evidence that, in low-income settings, where access to other interventions (antenatal steroids, surfactant therapy, ventilation, antibiotic therapy) may be low, antibiotics for pPROM could prevent 4% of neonatal deaths due to complications of prematurity and 8% of those due to infection.

Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

PubMed Central

Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

2001-01-01

rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

Selective phylogenetic analysis targeting 16S rRNA genes of hyperthermophilic archaea in the deep-subsurface hot biosphere.

PubMed

Kimura, Hiroyuki; Ishibashi, Jun-Ichiro; Masuda, Harue; Kato, Kenji; Hanada, Satoshi

2007-04-01

International drilling projects for the study of microbial communities in the deep-subsurface hot biosphere have been expanded. Core samples obtained by deep drilling are commonly contaminated with mesophilic microorganisms in the drilling fluid, making it difficult to examine the microbial community by 16S rRNA gene clone library analysis. To eliminate mesophilic organism contamination, we previously developed a new method (selective phylogenetic analysis [SePA]) based on the strong correlation between the guanine-plus-cytosine (G+C) contents of the 16S rRNA genes and the optimal growth temperatures of prokaryotes, and we verified the method's effectiveness (H. Kimura, M. Sugihara, K. Kato, and S. Hanada, Appl. Environ. Microbiol. 72:21-27, 2006). In the present study we ascertained SePA's ability to eliminate contamination by archaeal rRNA genes, using deep-sea hydrothermal fluid (117 degrees C) and surface seawater (29.9 degrees C) as substitutes for deep-subsurface geothermal samples and drilling fluid, respectively. Archaeal 16S rRNA gene fragments, PCR amplified from the surface seawater, were denatured at 82 degrees C and completely digested with exonuclease I (Exo I), while gene fragments from the deep-sea hydrothermal fluid remained intact after denaturation at 84 degrees C because of their high G+C contents. An examination using mixtures of DNAs from the two environmental samples showed that denaturation at 84 degrees C and digestion with Exo I completely eliminated archaeal 16S rRNA genes from the surface seawater. Our method was quite useful for culture-independent community analysis of hyperthermophilic archaea in core samples recovered from deep-subsurface geothermal environments.

Eukaryotic 5S rRNA biogenesis

PubMed Central

Ciganda, Martin; Williams, Noreen

2012-01-01

The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

PubMed Central

Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

2011-01-01

Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

Motor skill delays in pre-school children with leukemia one year after treatment: Hematopoietic stem cell transplantation therapy as an important risk factor.

PubMed

Taverna, Livia; Tremolada, Marta; Bonichini, Sabrina; Tosetto, Barbara; Basso, Giuseppe; Messina, Chiara; Pillon, Marta

2017-01-01

CNS-directed therapies for the treatment of leukemia can adversely affect the acquisition of new skills, such as reading/writing and math. Two years after the end of treatments, children show gross and fine motor skill delays that may persist even when patients are considered healed. The goal of the present study was to assess motor skills difficulties in pre-school children with leukemia one year after treatment. Particular attention has been paid to those patients who had undergone Hematopoietic Stem Cell Transplantation (HSCT) and to the relationship between motor delays and age bands. Participants were 60 children (median age of 5; inter quartile range: 3.07-5.76), including 31 females and 29 males, 91.7% of them were affected by acute lymphoblastic leukemia (ALL), and 8.3% by acute myeloid leukemia (AML). Five children had undergone HCST. Parents were interviewed by Vineland Adaptive Behavior Scales (VABS) on children's motor skills and filled in the Italian Temperament Questionnaire (QUIT). VABS's total scores were converted into equivalent mental age scores (EMA). A score difference of at least three months between current age and equivalent mental age was considered a developmental delay. Non-parametric analyses were run to understand if HSCT treatment and a specific age band influence children's motor skills. Significant delays were found in global motor skills (56.7%) as well as in fine and gross motor domains. Mann Whitney U tests showed that children with HSCT were reported to have lower gross motor mean ranks (U = 62; p = 0.004; Mean rank = 15.40) than peers without HSCT (Mean rank = 31.87) and lower mean rank values on motor temperament scale (U = 9; p = 0.003; HSCT Mean rank = 4.75 versus no HSCT Mean rank = 27.81). Kruskal Wallis' tests identified the high risk treatment showing that HSCT experience negatively impacted the motor skills and temperamental motor activity of pre-school children one year after the diagnosis of leukemia.

Motor skill delays in pre-school children with leukemia one year after treatment: Hematopoietic stem cell transplantation therapy as an important risk factor

PubMed Central

Bonichini, Sabrina; Tosetto, Barbara; Basso, Giuseppe; Messina, Chiara; Pillon, Marta

2017-01-01

CNS-directed therapies for the treatment of leukemia can adversely affect the acquisition of new skills, such as reading/writing and math. Two years after the end of treatments, children show gross and fine motor skill delays that may persist even when patients are considered healed. The goal of the present study was to assess motor skills difficulties in pre-school children with leukemia one year after treatment. Particular attention has been paid to those patients who had undergone Hematopoietic Stem Cell Transplantation (HSCT) and to the relationship between motor delays and age bands. Participants were 60 children (median age of 5; inter quartile range: 3.07–5.76), including 31 females and 29 males, 91.7% of them were affected by acute lymphoblastic leukemia (ALL), and 8.3% by acute myeloid leukemia (AML). Five children had undergone HCST. Parents were interviewed by Vineland Adaptive Behavior Scales (VABS) on children’s motor skills and filled in the Italian Temperament Questionnaire (QUIT). VABS’s total scores were converted into equivalent mental age scores (EMA). A score difference of at least three months between current age and equivalent mental age was considered a developmental delay. Non-parametric analyses were run to understand if HSCT treatment and a specific age band influence children’s motor skills. Significant delays were found in global motor skills (56.7%) as well as in fine and gross motor domains. Mann Whitney U tests showed that children with HSCT were reported to have lower gross motor mean ranks (U = 62; p = 0.004; Mean rank = 15.40) than peers without HSCT (Mean rank = 31.87) and lower mean rank values on motor temperament scale (U = 9; p = 0.003; HSCT Mean rank = 4.75 versus no HSCT Mean rank = 27.81). Kruskal Wallis’ tests identified the high risk treatment showing that HSCT experience negatively impacted the motor skills and temperamental motor activity of pre-school children one year after the diagnosis of leukemia. PMID

Natural-abundance stable carbon isotopes of small-subunit ribosomal RNA (SSU rRNA) from Guaymas Basin (Mexico)

NASA Astrophysics Data System (ADS)

MacGregor, B. J.; Mendlovitz, H.; Albert, D.; Teske, A. P.

2012-12-01

Small-subunit ribosomal RNA (SSU rRNA) is a phylogenetically informative molecule found in all species. Because it is poorly preserved in most environments, it is a useful marker for active microbial populations. We are using the natural-abundance stable carbon isotopic composition of specific microbial groups to help identify the carbon substrates contributing to microbial biomass in a variety of marine environments. At Guaymas Basin, hydrothermal fluids interact with abundant sedimentary organic carbon to produce natural gas and petroleum. Where this reaches the sediment surface, it can support dense patches of seafloor life, including Beggiatoa mats. We report here on the stable carbon isotopic composition of SSU rRNA from a Beggiatoa mat transect, a cold background site, a warm site with high oil concentration, and a second Beggiatoa mat. The central part of the transect mat overlay the steepest temperature gradient, and was visually dominated by orange Beggiatoa. This was fringed by white Beggiatoa mat and bare, but still warm, sediment. Methane concentrations were saturating beneath the orange and white mats and at the oily site, lower beneath bare sediment, and below detection at the background site. Our initial hypotheses were that rRNA isotopic composition would be strongly influenced by methane supply, and that archaeal rRNA might be lighter than bacterial due to contributions from methanogens and anaerobic methane oxidizers. We used biotin-labeled oligonucleotides to capture Bacterial and Archaeal SSU rRNA for isotopic determination. Background-site rRNA was isotopically heaviest, and bacterial RNA from below 2 cm at the oily site was lightest, consistent with control by methane. Within the transect mat, however, the pattern was more complicated; at some sediment depths, rRNA from the mat periphery was isotopically lightest. Part of this may be due to the spatially and temporally variable paths followed by hydrothermal fluid, which can include horizontal

Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

PubMed Central

Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

2005-01-01

5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

Different effects of the two types of spatial pre-cueing: what precisely is "attention" in Di Lollo's and Enns' substitution masking theory?

PubMed

Luiga, I; Bachmann, T

2007-11-01

Enns and Di Lollo [Psychological Science, 8 (2), 135-139, 1997] have introduced the object substitution theory of visual masking. Object substitution masking occurs when focusing attention on the target is delayed. However, Posner (Quarterly Journal of Experimental Psychology, 32, 3-25, 1980) has already shown that attention can be directed to a target at least in two ways: intentionally (endogenously) and automatically (exogenously). We conducted two experiments to explore the effects of endogenous and exogenous cues on substitution masking. The results showed that when attention was shifted to the target location automatically (using a local peripheral pre-cue), masking was attenuated. A decrease in target identification dependent on a delay of mask offset, typical to substitution masking, was not observed. However, strong substitution masking occurred when the target location was not pre-cued or when attention was directed to the target location intentionally (using a symbolic pre-cue displayed centrally). The hypothesis of two different mechanisms of attentional control in substitution masking was confirmed.

Estimation of contrast agent bolus arrival delays for improved reproducibility of liver DCE MRI

NASA Astrophysics Data System (ADS)

Chouhan, Manil D.; Bainbridge, Alan; Atkinson, David; Punwani, Shonit; Mookerjee, Rajeshwar P.; Lythgoe, Mark F.; Taylor, Stuart A.

2016-10-01

Delays between contrast agent (CA) arrival at the site of vascular input function (VIF) sampling and the tissue of interest affect dynamic contrast enhanced (DCE) MRI pharmacokinetic modelling. We investigate effects of altering VIF CA bolus arrival delays on liver DCE MRI perfusion parameters, propose an alternative approach to estimating delays and evaluate reproducibility. Thirteen healthy volunteers (28.7  ±  1.9 years, seven males) underwent liver DCE MRI using dual-input single compartment modelling, with reproducibility (n  =  9) measured at 7 days. Effects of VIF CA bolus arrival delays were assessed for arterial and portal venous input functions. Delays were pre-estimated using linear regression, with restricted free modelling around the pre-estimated delay. Perfusion parameters and 7 days reproducibility were compared using this method, freely modelled delays and no delays using one-way ANOVA. Reproducibility was assessed using Bland-Altman analysis of agreement. Maximum percent change relative to parameters obtained using zero delays, were  -31% for portal venous (PV) perfusion, +43% for total liver blood flow (TLBF), +3247% for hepatic arterial (HA) fraction, +150% for mean transit time and  -10% for distribution volume. Differences were demonstrated between the 3 methods for PV perfusion (p  =  0.0085) and HA fraction (p  <  0.0001), but not other parameters. Improved mean differences and Bland-Altman 95% Limits-of-Agreement for reproducibility of PV perfusion (9.3 ml/min/100 g, ±506.1 ml/min/100 g) and TLBF (43.8 ml/min/100 g, ±586.7 ml/min/100 g) were demonstrated using pre-estimated delays with constrained free modelling. CA bolus arrival delays cause profound differences in liver DCE MRI quantification. Pre-estimation of delays with constrained free modelling improved 7 days reproducibility of perfusion parameters in volunteers.

The Human RNA Polymerase I Transcription Terminator Complex Acts as a Replication Fork Barrier That Coordinates the Progress of Replication with rRNA Transcription Activity.

PubMed

Akamatsu, Yufuko; Kobayashi, Takehiko

2015-05-01

In S phase, the replication and transcription of genomic DNA need to accommodate each other, otherwise their machineries collide, with chromosomal instability as a possible consequence. Here, we characterized the human replication fork barrier (RFB) that is present downstream from the 47S pre-rRNA gene (ribosomal DNA [rDNA]). We found that the most proximal transcription terminator, Sal box T1, acts as a polar RFB, while the other, Sal box T4/T5, arrests replication forks bidirectionally. The fork-arresting activity at these sites depends on polymerase I (Pol I) transcription termination factor 1 (TTF-1) and a replisome component, TIMELESS (TIM). We also found that the RFB activity was linked to rDNA copies with hypomethylated CpG and coincided with the time that actively transcribed rRNA genes are replicated. Failed fork arrest at RFB sites led to a slowdown of fork progression moving in the opposite direction to rRNA transcription. Chemical inhibition of transcription counteracted this deceleration of forks, indicating that rRNA transcription impedes replication in the absence of RFB activity. Thus, our results reveal a role of RFB for coordinating the progression of replication and transcription activity in highly transcribed rRNA genes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Cryo-EM structure of a late pre-40S ribosomal subunit from Saccharomyces cerevisiae

PubMed Central

Schmidt, Christian; Berninghausen, Otto; Becker, Thomas

2017-01-01

Mechanistic understanding of eukaryotic ribosome formation requires a detailed structural knowledge of the numerous assembly intermediates, generated along a complex pathway. Here, we present the structure of a late pre-40S particle at 3.6 Å resolution, revealing in molecular detail how assembly factors regulate the timely folding of pre-18S rRNA. The structure shows that, rather than sterically blocking 40S translational active sites, the associated assembly factors Tsr1, Enp1, Rio2 and Pno1 collectively preclude their final maturation, thereby preventing untimely tRNA and mRNA binding and error prone translation. Moreover, the structure explains how Pno1 coordinates the 3’end cleavage of the 18S rRNA by Nob1 and how the late factor’s removal in the cytoplasm ensures the structural integrity of the maturing 40S subunit. PMID:29155690

Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

PubMed Central

Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

2015-01-01

RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

Spouses' conceptions of the pre-hospital phase when their partners suffered an acute myocardial infarction--a qualitative analysis.

PubMed

Johansson, Ingela; Swahn, Eva; Strömberg, Anna

2008-09-01

Delay from onset of acute myocardial infarction symptoms to the delivery of medical care is a major determinant of prognosis. Although studies have explored patient reasons for delay, there are only limited data concerning experiences of the spouse. Was to describe spouses' conceptions of the pre-hospital phase when their partners suffered an acute myocardial infarction. A phenomenographic approach was applied. Fifteen spouses were interviewed <48 h after the partner's hospital admittance. Two categories with underlying sub-categories conceptualised the spouses' experiences. The category being resourceful contained: sharing the experience, having knowledge, understanding the severity, being rational, and consulting others. The category respecting independence contained: accepting the need for control, marital roles and experiences, restraining emotions, and seeking agreement. Our findings suggest that spouses have a strong influence on the course of events. When accepting the partner's need for control through following earlier marital roles and experiences, restraining own emotions and seeking agreement, this seemed to contribute to delay. However, when the spouse was resourceful by sharing the experience, having knowledge, understanding the severity, being rational and consulting others when needed, this seemed to have a positive influence on the pre-hospital time.

Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli.

PubMed

Triman, K; Becker, E; Dammel, C; Katz, J; Mori, H; Douthwaite, S; Yapijakis, C; Yoast, S; Noller, H F

1989-10-20

Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alleles, originally identified by Morgan and co-workers, enable us to follow expression of cloned rRNA genes in vivo. Recessive mutations causing the loss of expression of the cloned 16 S rRNA gene were identified by the loss of the ability of cells to survive on media containing spectinomycin. The mutations were localized by in vitro restriction fragment replacement followed by in vivo marker rescue and were identified by DNA sequence analysis. We report here seven single-base alterations in 16 S rRNA (A146, U153, A350, A359, A538, A1292 and U1293), five of which produce temperature-sensitive spectinomycin resistance and two that produce unconditional loss of resistance. In each case, loss of ribosomal function can be accounted for by disruption of base-pairing in the secondary structure of 16 S rRNA. For the temperature-sensitive mutants, there is a lag period of about two generations between a shift to the restrictive temperature and cessation of growth, implying that the structural defects cause impairment of ribosome assembly.

U14 small nucleolar RNA makes multiple contacts with the pre-ribosomal RNA.

PubMed

Morrissey, J P; Tollervey, D

1997-06-01

The small nucleolar RNA (snoRNA) U14 has two regions of extended primary sequence complementarity to the 18S rRNA. The 3' region (domain B) shows the consensus structure for the methylation guide class of snoRNAs, whereas base-pairing between the 5' region (domain A) and the 18S rRNA sequence is required for the formation of functional ribosomes. Between domains A and B lies another essential region (domain Y). Here we report that yeast U14 can be cross-linked in vivo to the pre-rRNA; cross-linking is detected exclusively with the 35S primary transcript. Many nucleotides in U14 that lie outside of domains A and B are cross-linked to the pre-rRNA; in particular the essential domain Y region is cross-linked at several sites. U14 is, therefore, in far more extensive contact with the pre-rRNA than predicted from simple base-pairing models. Moreover, U14 can be cross-linked to other small RNA species. The functional interactions made by U14 during ribosome synthesis are likely to be very complex.

How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?

PubMed

Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T

2018-03-15

The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA

Nuclear ribosome biogenesis mediated by the DIM1A rRNA dimethylase is required for organized root growth and epidermal patterning in Arabidopsis.

PubMed

Wieckowski, Yana; Schiefelbein, John

2012-07-01

Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development.

Epigenetic regulation of TTF-I-mediated promoter–terminator interactions of rRNA genes

PubMed Central

Németh, Attila; Guibert, Sylvain; Tiwari, Vijay Kumar; Ohlsson, Rolf; Längst, Gernot

2008-01-01

Ribosomal RNA synthesis is the eukaryotic cell's main transcriptional activity, but little is known about the chromatin domain organization and epigenetics of actively transcribed rRNA genes. Here, we show epigenetic and spatial organization of mouse rRNA genes at the molecular level. TTF-I-binding sites subdivide the rRNA transcription unit into functional chromatin domains and sharply delimit transcription factor occupancy. H2A.Z-containing nucleosomes occupy the spacer promoter next to a newly characterized TTF-I-binding site. The spacer and the promoter proximal TTF-I-binding sites demarcate the enhancer. DNA from both the enhancer and the coding region is hypomethylated in actively transcribed repeats. 3C analysis revealed an interaction between promoter and terminator regions, which brings the beginning and end of active rRNA genes into close contact. Reporter assays show that TTF-I mediates this interaction, thereby linking topology and epigenetic regulation of the rRNA genes. PMID:18354495

Breast cancer patient delay in Fukushima, Japan following the 2011 triple disaster: a long-term retrospective study.

PubMed

Ozaki, Akihiko; Nomura, Shuhei; Leppold, Claire; Tsubokura, Masaharu; Tanimoto, Tetsuya; Yokota, Takeru; Saji, Shigehira; Sawano, Toyoaki; Tsukada, Manabu; Morita, Tomohiro; Ochi, Sae; Kato, Shigeaki; Kami, Masahiro; Nemoto, Tsuyoshi; Kanazawa, Yukio; Ohira, Hiromichi

2017-06-19

Little information is available concerning how patient delay may be affected by mass disasters. The main objectives of the present study are to identify whether there was a post-disaster increase in the risk of experiencing patient delay among breast cancer patients in an area affected by the 2011 triple disaster in Fukushima, Japan, and to elucidate factors associated with post-disaster patient delay. Sociodemographic factors (age, employment status, cohabitant status and evacuation status), health characteristics, and health access- and disaster-related factors were specifically considered. Records of symptomatic breast cancer patients diagnosed from 2005 to 2016 were retrospectively reviewed to calculate risk ratios (RRs) for patient delay in every year post-disaster compared with the pre-disaster baseline. Total and excessive patient delays were respectively defined as three months or more and twelve months or more from symptom recognition to first medical consultation. Logistic regression analysis was conducted for pre- and post-disaster patient delay in order to reveal any factors potentially associated with patient delay, and changes after the disaster. Two hundred nineteen breast cancer patients (122 pre-disaster and 97 post-disaster) were included. After adjustments for age, significant post-disaster increases in RRs of experiencing both total (RR: 1.66, 95% Confidence Interval (CI): 1.02-2.70, p < 0.05) and excessive patient delay (RR: 4.49, 95% CI: 1.73-11.65, p < 0.01) were observed. The RRs for total patient delay peaked in the fourth year post-disaster, and significant increases in the risk of excessive patient delay were observed in the second, fourth, and fifth years post-disaster, with more than five times the risk observed pre-disaster. A family history of any cancer was the only factor significantly associated with total patient delay post-disaster (odds ratio: 0.38, 95% CI: 0.15-0.95, p < 0.05), while there were no variables associated

rRNA fragmentation induced by a yeast killer toxin.

PubMed

Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

2014-02-01

Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. © 2013 John Wiley & Sons Ltd.

Comparison of in-situ delay monitors for use in Adaptive Voltage Scaling

NASA Astrophysics Data System (ADS)

Pour Aryan, N.; Heiß, L.; Schmitt-Landsiedel, D.; Georgakos, G.; Wirnshofer, M.

2012-09-01

In Adaptive Voltage Scaling (AVS) the supply voltage of digital circuits is tuned according to the circuit's actual operating condition, which enables dynamic compensation to PVTA variations. By exploiting the excessive safety margins added in state-of-the-art worst-case designs considerable power saving is achieved. In our approach, the operating condition of the circuit is monitored by in-situ delay monitors. This paper presents different designs to implement the in-situ delay monitors capable of detecting late but still non-erroneous transitions, called Pre-Errors. The developed Pre-Error monitors are integrated in a 16 bit multiplier test circuit and the resulting Pre-Error AVS system is modeled by a Markov chain in order to determine the power saving potential of each Pre-Error detection approach.

The DEAH-box helicase Dhr1 dissociates U3 from the pre-rRNA to promote formation of the central pseudoknot.

PubMed

Sardana, Richa; Liu, Xin; Granneman, Sander; Zhu, Jieyi; Gill, Michael; Papoulas, Ophelia; Marcotte, Edward M; Tollervey, David; Correll, Carl C; Johnson, Arlen W

2015-02-01

In eukaryotes, the highly conserved U3 small nucleolar RNA (snoRNA) base-pairs to multiple sites in the pre-ribosomal RNA (pre-rRNA) to promote early cleavage and folding events. Binding of the U3 box A region to the pre-rRNA is mutually exclusive with folding of the central pseudoknot (CPK), a universally conserved rRNA structure of the small ribosomal subunit essential for protein synthesis. Here, we report that the DEAH-box helicase Dhr1 (Ecm16) is responsible for displacing U3. An active site mutant of Dhr1 blocked release of U3 from the pre-ribosome, thereby trapping a pre-40S particle. This particle had not yet achieved its mature structure because it contained U3, pre-rRNA, and a number of early-acting ribosome synthesis factors but noticeably lacked ribosomal proteins (r-proteins) that surround the CPK. Dhr1 was cross-linked in vivo to the pre-rRNA and to U3 sequences flanking regions that base-pair to the pre-rRNA including those that form the CPK. Point mutations in the box A region of U3 suppressed a cold-sensitive mutation of Dhr1, strongly indicating that U3 is an in vivo substrate of Dhr1. To support the conclusions derived from in vivo analysis we showed that Dhr1 unwinds U3-18S duplexes in vitro by using a mechanism reminiscent of DEAD box proteins.

The DEAH-box Helicase Dhr1 Dissociates U3 from the Pre-rRNA to Promote Formation of the Central Pseudoknot

PubMed Central

Granneman, Sander; Zhu, Jieyi; Gill, Michael; Papoulas, Ophelia; Marcotte, Edward M.; Tollervey, David; Correll, Carl C.; Johnson, Arlen W.

2015-01-01

In eukaryotes, the highly conserved U3 small nucleolar RNA (snoRNA) base-pairs to multiple sites in the pre-ribosomal RNA (pre-rRNA) to promote early cleavage and folding events. Binding of the U3 box A region to the pre-rRNA is mutually exclusive with folding of the central pseudoknot (CPK), a universally conserved rRNA structure of the small ribosomal subunit essential for protein synthesis. Here, we report that the DEAH-box helicase Dhr1 (Ecm16) is responsible for displacing U3. An active site mutant of Dhr1 blocked release of U3 from the pre-ribosome, thereby trapping a pre-40S particle. This particle had not yet achieved its mature structure because it contained U3, pre-rRNA, and a number of early-acting ribosome synthesis factors but noticeably lacked ribosomal proteins (r-proteins) that surround the CPK. Dhr1 was cross-linked in vivo to the pre-rRNA and to U3 sequences flanking regions that base-pair to the pre-rRNA including those that form the CPK. Point mutations in the box A region of U3 suppressed a cold-sensitive mutation of Dhr1, strongly indicating that U3 is an in vivo substrate of Dhr1. To support the conclusions derived from in vivo analysis we showed that Dhr1 unwinds U3-18S duplexes in vitro by using a mechanism reminiscent of DEAD box proteins. PMID:25710520

Dynamic high pressure induced strong and weak hydrogen bonds enhanced by pre-resonance stimulated Raman scattering in liquid water.

PubMed

Wang, Shenghan; Fang, Wenhui; Li, Fabing; Gong, Nan; Li, Zhanlong; Li, Zuowei; Sun, Chenglin; Men, Zhiwei

2017-12-11

355 nm pulsed laser is employed to excite pre-resonance forward stimulated Raman scattering (FSRS) of liquid water at ambient temperature. Due to the shockwave induced dynamic high pressure, the obtained Raman spectra begin to exhibit double peaks distribution at 3318 and 3373 cm -1 with the input energy of 17 mJ,which correspond with OH stretching vibration with strong and weak hydrogen (H) bonds. With laser energy rising from 17 to 27 mJ, the Stokes line at 3318 cm -1 shifts to 3255 and 3230 cm -1 because of the high pressure being enlarged. When the energy is up to 32 mJ, only 3373 cm -1 peak exists. The strong and weak H bond exhibit quite different energy dependent behaviors.

Proterozoic (pre-Ediacaran) glaciation and the high obliquity, low-latitude ice, strong seasonality (HOLIST) hypothesis: Principles and tests

NASA Astrophysics Data System (ADS)

Williams, George E.

2008-03-01

Sedimentological observations and palaeomagnetic data for Cryogenian glacial deposits present the climatic paradox of grounded glaciers and in situ cold climate near sea-level, glaciomarine deposition, and accompanying large (up to 40 °C) seasonal changes of temperature, all in low to near-equatorial (< 10°) palaeolatitudes (equated with geographic latitudes). Neither the "snowball Earth" nor the "slushball Earth" hypothesis can account for such strong seasonality near the palaeoequator, which together with findings from sedimentology, chemostratigraphy, biogeochemistry, micropalaeontology, geochronology and climate modelling argue against those scenarios. An alternative explanation of glaciation and strong seasonality in low palaeolatitudes is offered by a high (> 54°) obliquity of the ecliptic, which would render the equator cooler than the poles, on average, and amplify global seasonality. A high obliquity per se would not have been a primary trigger for glaciation, but would have strongly influenced the latitudinal distribution of glaciers. The principle of low-latitude glaciation on a terrestrial planet with high obliquity is validated by theoretical studies and observations of Mars. A high obliquity for the early Earth is a likely outcome of a single giant impact at 4.5 Ga, the widely favoured mechanism for lunar origin. This implies that a high obliquity could have prevailed during most of the Precambrian, controlling the low palaeolatitude of glaciations in the early and late Palaeoproterozoic and Cryogenian. It is postulated that the obliquity changed to < 54° between the termination of the last Cryogenian low-palaeolatitude glaciation at ≤ 635 Ma and the initiation of Late Ordovician-Early Silurian circum-polar glaciation at 445 Ma. The High Obliquity, Low-latitude Ice, STrong seasonality (HOLIST) hypothesis for pre-Ediacaran glaciation emerges favourably from numerous glacial and non-glacial tests. The hypothesis is in accord with such established

A Plant 5S Ribosomal RNA Mimic Regulates Alternative Splicing of Transcription Factor IIIA Pre-mRNAs

PubMed Central

Hammond, Ming C.; Wachter, Andreas; Breaker, Ronald R.

2009-01-01

Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with striking resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs (pre-mRNAs) from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. Since the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing. PMID:19377483

Speech and language delay in two children: an unusual presentation of hyperthyroidism.

PubMed

Sohal, Aman P S; Dasarathi, Madhuri; Lodh, Rajib; Cheetham, Tim; Devlin, Anita M

2013-01-01

Hyperthyroidism is rare in pre-school children. Untreated, it can have a profound effect on normal growth and development, particularly in the first 2 years of life. Although neurological manifestations of dysthyroid states are well known, specific expressive speech and language disorder as a presentation of hyperthyroidism is rarely documented. Case reports of two children with hyperthyroidism presenting with speech and language delay. We report two pre-school children with hyperthyroidism, who presented with expressive speech and language delay, and demonstrated a significant improvement in their language skills following treatment with anti-thyroid medication. Hyperthyroidism must be considered in all children presenting with speech and language difficulties, particularly expressive speech delay. Prompt recognition and early treatment are likely to improve outcome.

MXD1 localizes in the nucleolus, binds UBF and impairs rRNA synthesis.

PubMed

Lafita-Navarro, Maria Del Carmen; Blanco, Rosa; Mata-Garrido, Jorge; Liaño-Pons, Judit; Tapia, Olga; García-Gutiérrez, Lucía; García-Alegría, Eva; Berciano, María T; Lafarga, Miguel; León, Javier

2016-10-25

MXD1 is a protein that interacts with MAX, to form a repressive transcription factor. MXD1-MAX binds E-boxes. MXD1-MAX antagonizes the transcriptional activity of the MYC oncoprotein in most models. It has been reported that MYC overexpression leads to augmented RNA synthesis and ribosome biogenesis, which is a relevant activity in MYC-mediated tumorigenesis. Here we describe that MXD1, but not MYC or MNT, localizes to the nucleolus in a wide array of cell lines derived from different tissues (carcinoma, leukemia) as well as in embryonic stem cells. MXD1 also localizes in the nucleolus of primary tissue cells as neurons and Sertoli cells. The nucleolar localization of MXD1 was confirmed by co-localization with UBF. Co-immunoprecipitation experiments showed that MXD1 interacted with UBF and proximity ligase assays revealed that this interaction takes place in the nucleolus. Furthermore, chromatin immunoprecipitation assays showed that MXD1 was bound in the transcribed rDNA chromatin, where it co-localizes with UBF, but also in the ribosomal intergenic regions. The MXD1 involvement in rRNA synthesis was also suggested by the nucleolar segregation upon rRNA synthesis inhibition by actinomycin D. Silencing of MXD1 with siRNAs resulted in increased synthesis of pre-rRNA while enforced MXD1 expression reduces it. The results suggest a new role for MXD1, which is the control of ribosome biogenesis. This new MXD1 function would be important to curb MYC activity in tumor cells.

MXD1 localizes in the nucleolus, binds UBF and impairs rRNA synthesis

PubMed Central

Lafita-Navarro, Maria del Carmen; Blanco, Rosa; Mata-Garrido, Jorge; Liaño-Pons, Judit; Tapia, Olga; García-Gutiérrez, Lucía; García-Alegría, Eva; Berciano, María T.; Lafarga, Miguel; León, Javier

2016-01-01

MXD1 is a protein that interacts with MAX, to form a repressive transcription factor. MXD1-MAX binds E-boxes. MXD1-MAX antagonizes the transcriptional activity of the MYC oncoprotein in most models. It has been reported that MYC overexpression leads to augmented RNA synthesis and ribosome biogenesis, which is a relevant activity in MYC-mediated tumorigenesis. Here we describe that MXD1, but not MYC or MNT, localizes to the nucleolus in a wide array of cell lines derived from different tissues (carcinoma, leukemia) as well as in embryonic stem cells. MXD1 also localizes in the nucleolus of primary tissue cells as neurons and Sertoli cells. The nucleolar localization of MXD1 was confirmed by co-localization with UBF. Co-immunoprecipitation experiments showed that MXD1 interacted with UBF and proximity ligase assays revealed that this interaction takes place in the nucleolus. Furthermore, chromatin immunoprecipitation assays showed that MXD1 was bound in the transcribed rDNA chromatin, where it co-localizes with UBF, but also in the ribosomal intergenic regions. The MXD1 involvement in rRNA synthesis was also suggested by the nucleolar segregation upon rRNA synthesis inhibition by actinomycin D. Silencing of MXD1 with siRNAs resulted in increased synthesis of pre-rRNA while enforced MXD1 expression reduces it. The results suggest a new role for MXD1, which is the control of ribosome biogenesis. This new MXD1 function would be important to curb MYC activity in tumor cells. PMID:27588501

rRNA Genes Are Not Fully Activated in Mouse Somatic Cell Nuclear Transfer Embryos*

PubMed Central

Zheng, Zhong; Jia, Jia-Lin; Bou, Gerelchimeg; Hu, Li-Li; Wang, Zhen-Dong; Shen, Xing-Hui; Shan, Zhi-Yan; Shen, Jing-Ling; Liu, Zhong-Hua; Lei, Lei

2012-01-01

The well known and most important function of nucleoli is ribosome biogenesis. However, the nucleolus showed delayed development and malfunction in somatic cell nuclear transfer (NT) embryos. Previous studies indicated that nearly half rRNA genes (rDNA) in somatic cells were inactive and not transcribed. We compared the rDNA methylation level, active nucleolar organizer region (NORs) numbers, nucleolar proteins (upstream binding factor (UBF), nucleophosmin (B23)) distribution, and nucleolar-related gene expression in three different donor cells and NT embryos. The results showed embryonic stem cells (ESCs) had the most active NORs and lowest rDNA methylation level (7.66 and 6.76%), whereas mouse embryonic fibroblasts (MEFs) were the opposite (4.70 and 22.57%). After the donor cells were injected into enucleated MII oocytes, cumulus cells and MEFs nuclei lost B23 and UBF signals in 20 min, whereas in ESC-NT embryos, B23 and UBF signals could still be detected at 60 min post-NT. The embryos derived from ESCs, cumulus cells, and MEFs showed the same trend in active NORs numbers (7.19 versus 6.68 versus 5.77, p < 0.05) and rDNA methylation levels (6.36 versus 9.67% versus 15.52%) at the 4-cell stage as that in donor cells. However, the MEF-NT embryos displayed low rRNA synthesis/processing potential at morula stage and had an obvious decrease in blastocyst developmental rate. The results presented clear evidences that the rDNA reprogramming efficiency in NT embryos was determined by the rDNA activity in donor cells from which they derived. PMID:22467869

A critical role for noncoding 5S rRNA in regulating Mdmx stability.

PubMed

Li, Muyang; Gu, Wei

2011-09-16

Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

Nuclear Ribosome Biogenesis Mediated by the DIM1A rRNA Dimethylase Is Required for Organized Root Growth and Epidermal Patterning in Arabidopsis[C][W

PubMed Central

Wieckowski, Yana; Schiefelbein, John

2012-01-01

Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development. PMID:22829145

Probing electron delays in above-threshold ionization

DOE PAGES

Zipp, Lucas J.; Natan, Adi; Bucksbaum, Philip H.

2014-11-21

Recent experiments have revealed attosecond delays in the emission of electrons from atoms ionized by extreme UV light, offering a glimpse into the ultrafast nature of light-induced electron dynamics. In this work, we extend these measurements to the strong-field above-threshold ionization (ATI) regime, by measuring delays in the photoemission of electrons from argon in the presence of an intense laser field. We probe the ATI process with a weak coherent reference, at half the laser frequency. The interfering ionization signal reveals the relative spectral phase of adjacent ATI channels, with an equivalent resolution of a few attoseconds. These relative delaysmore » depend on the strong field, and approach zero at higher intensity. Our phase measurements of ATI electrons show how strong fields alter ionization dynamics in atoms.« less

Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

PubMed

Douzery, E; Catzeflis, F M

1995-11-01

The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

Interpreting the Strongly Lensed Supernova iPTF16geu: Time Delay Predictions, Microlensing, and Lensing Rates

DOE Office of Scientific and Technical Information (OSTI.GOV)

More, Anupreeta; Oguri, Masamune; More, Surhud

2017-02-01

We present predictions for time delays between multiple images of the gravitationally lensed supernova, iPTF16geu, which was recently discovered from the intermediate Palomar Transient Factory (iPTF). As the supernova is of Type Ia where the intrinsic luminosity is usually well known, accurately measured time delays of the multiple images could provide tight constraints on the Hubble constant. According to our lens mass models constrained by the Hubble Space Telescope F814W image, we expect the maximum relative time delay to be less than a day, which is consistent with the maximum of 100 hr reported by Goobar et al. but placesmore » a stringent upper limit. Furthermore, the fluxes of most of the supernova images depart from expected values suggesting that they are affected by microlensing. The microlensing timescales are small enough that they may pose significant problems to measure the time delays reliably. Our lensing rate calculation indicates that the occurrence of a lensed SN in iPTF is likely. However, the observed total magnification of iPTF16geu is larger than expected, given its redshift. This may be a further indication of ongoing microlensing in this system.« less

Phylogenetic position of the enigmatic clawless eutardigrade genus Apodibius Dastych, 1983 (Tardigrada), based on 18S and 28S rRNA sequence data from its type species A. confusus.

PubMed

Dabert, Miroslawa; Dastych, Hieronymus; Hohberg, Karin; Dabert, Jacek

2014-01-01

The systematics of Eutardigrada, the largest lineage among the three classes of the phylum Tardigrada, is based mainly on the morphology of the leg claws and of the buccal apparatus. However, three members of the rarely recorded and poorly known limno-terrestrial eutardigrade genus Apodibius have no claws on their strongly reduced legs, a unique character among all tardigrades. This absence of all claws makes the systematic position of Apodibius one of the most enigmatic among the whole class. Until now all known associates of the genus Apodibius have been located in the incertae sedis species group or, quite recently, included into the Necopinatidae family. In the present study, phylogenetic analyses of 18S and 28S rRNA sequence data from 31 tardigrade species representing four parachelan superfamilies (Isohypsibioidea, Hypsibioidea, Macrobiotoidea, Eohypsibioidea), the apochelan Milnesium tardigradum, and the type species of the genus Apodibius, A. confusus, indicated close relationship of the Apodibius with tardigrade species recently included in the superfamily Isohypsibioidea. This result was well-supported and consistent across all markers (separate 18S rRNA, 28S rRNA, and combined 18S rRNA+28S rRNA datasets) and methods (MP, ML) applied. Copyright © 2013 Elsevier Inc. All rights reserved.

Behavioral effects of delayed timeouts from reinforcement.

PubMed

Byrne, Tom; Poling, Alan

2017-03-01

Timeouts are sometimes used in applied settings to reduce target responses, and in some circumstances delays are unavoidably imposed between the onset of a timeout and the offset of the response that produces it. The present study examined the effects of signaled and unsignaled timeouts in rats exposed to concurrent fixed-ratio 1 fixed-ratio 1 schedules of food delivery, where each response on one lever, the location of which changed across conditions, produced both food and a delayed 10-s timeout. Delays of 0 to 38 s were examined. Delayed timeouts often, but not always, substantially reduced the number of responses emitted on the lever that produced timeouts relative to the number emitted on the lever that did not produce timeouts. In general, greater sensitivity was observed to delayed timeouts when they were signaled. These results demonstrate that delayed timeouts, like other delayed consequences, can affect behavior, albeit less strongly than immediate consequences. © 2017 Society for the Experimental Analysis of Behavior.

Systemic delay propagation in the US airport network

PubMed Central

Fleurquin, Pablo; Ramasco, José J.; Eguiluz, Victor M.

2013-01-01

Technologically driven transport systems are characterized by a networked structure connecting operation centers and by a dynamics ruled by pre-established schedules. Schedules impose serious constraints on the timing of the operations, condition the allocation of resources and define a baseline to assess system performance. Here we study the performance of an air transportation system in terms of delays. Technical, operational or meteorological issues affecting some flights give rise to primary delays. When operations continue, such delays can propagate, magnify and eventually involve a significant part of the network. We define metrics able to quantify the level of network congestion and introduce a model that reproduces the delay propagation patterns observed in the U.S. performance data. Our results indicate that there is a non-negligible risk of systemic instability even under normal operating conditions. We also identify passenger and crew connectivity as the most relevant internal factor contributing to delay spreading. PMID:23362459

Delay-correlation landscape reveals characteristic time delays of brain rhythms and heart interactions

PubMed Central

Lin, Aijing; Liu, Kang K. L.; Bartsch, Ronny P.; Ivanov, Plamen Ch.

2016-01-01

Within the framework of ‘Network Physiology’, we ask a fundamental question of how modulations in cardiac dynamics emerge from networked brain–heart interactions. We propose a generalized time-delay approach to identify and quantify dynamical interactions between physiologically relevant brain rhythms and the heart rate. We perform empirical analysis of synchronized continuous EEG and ECG recordings from 34 healthy subjects during night-time sleep. For each pair of brain rhythm and heart interaction, we construct a delay-correlation landscape (DCL) that characterizes how individual brain rhythms are coupled to the heart rate, and how modulations in brain and cardiac dynamics are coordinated in time. We uncover characteristic time delays and an ensemble of specific profiles for the probability distribution of time delays that underly brain–heart interactions. These profiles are consistently observed in all subjects, indicating a universal pattern. Tracking the evolution of DCL across different sleep stages, we find that the ensemble of time-delay profiles changes from one physiologic state to another, indicating a strong association with physiologic state and function. The reported observations provide new insights on neurophysiological regulation of cardiac dynamics, with potential for broad clinical applications. The presented approach allows one to simultaneously capture key elements of dynamic interactions, including characteristic time delays and their time evolution, and can be applied to a range of coupled dynamical systems. PMID:27044991

Delay-correlation landscape reveals characteristic time delays of brain rhythms and heart interactions

NASA Astrophysics Data System (ADS)

Lin, Aijing; Liu, Kang K. L.; Bartsch, Ronny P.; Ivanov, Plamen Ch.

2016-05-01

Within the framework of `Network Physiology', we ask a fundamental question of how modulations in cardiac dynamics emerge from networked brain-heart interactions. We propose a generalized time-delay approach to identify and quantify dynamical interactions between physiologically relevant brain rhythms and the heart rate. We perform empirical analysis of synchronized continuous EEG and ECG recordings from 34 healthy subjects during night-time sleep. For each pair of brain rhythm and heart interaction, we construct a delay-correlation landscape (DCL) that characterizes how individual brain rhythms are coupled to the heart rate, and how modulations in brain and cardiac dynamics are coordinated in time. We uncover characteristic time delays and an ensemble of specific profiles for the probability distribution of time delays that underly brain-heart interactions. These profiles are consistently observed in all subjects, indicating a universal pattern. Tracking the evolution of DCL across different sleep stages, we find that the ensemble of time-delay profiles changes from one physiologic state to another, indicating a strong association with physiologic state and function. The reported observations provide new insights on neurophysiological regulation of cardiac dynamics, with potential for broad clinical applications. The presented approach allows one to simultaneously capture key elements of dynamic interactions, including characteristic time delays and their time evolution, and can be applied to a range of coupled dynamical systems.

Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

ERIC Educational Resources Information Center

Guan, Min-Xin

2005-01-01

The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

On Strong Anticipation

PubMed Central

Stepp, N.; Turvey, M. T.

2009-01-01

We examine Dubois's (2003) distinction between weak anticipation and strong anticipation. Anticipation is weak if it arises from a model of the system via internal simulations. Anticipation is strong if it arises from the system itself via lawful regularities embedded in the system's ordinary mode of functioning. The assumption of weak anticipation dominates cognitive science and neuroscience and in particular the study of perception and action. The assumption of strong anticipation, however, seems to be required by anticipation's ubiquity. It is, for example, characteristic of homeostatic processes at the level of the organism, organs, and cells. We develop the formal distinction between strong and weak anticipation by elaboration of anticipating synchronization, a phenomenon arising from time delays in appropriately coupled dynamical systems. The elaboration is conducted in respect to (a) strictly physical systems, (b) the defining features of circadian rhythms, often viewed as paradigmatic of biological behavior based in internal models, (c) Pavlovian learning, and (d) forward models in motor control. We identify the common thread of strongly anticipatory systems and argue for its significance in furthering understanding of notions such as “internal”, “model” and “prediction”. PMID:20191086

Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

PubMed

Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

2014-10-17

RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. Copyright © 2014 Elsevier B.V. All rights reserved.

Small RNA populations revealed by blocking rRNA fragments in Drosophila melanogaster reproductive tissues

PubMed Central

Dalmay, Tamas

2018-01-01

RNA interference (RNAi) is a complex and highly conserved regulatory mechanism mediated via small RNAs (sRNAs). Recent technical advances in high throughput sequencing have enabled an increasingly detailed analysis of sRNA abundances and profiles in specific body parts and tissues. This enables investigations of the localized roles of microRNAs (miRNAs) and small interfering RNAs (siRNAs). However, variation in the proportions of non-coding RNAs in the samples being compared can hinder these analyses. Specific tissues may vary significantly in the proportions of fragments of longer non-coding RNAs (such as ribosomal RNA or transfer RNA) present, potentially reflecting tissue-specific differences in biological functions. For example, in Drosophila, some tissues contain a highly abundant 30nt rRNA fragment (the 2S rRNA) as well as abundant 5’ and 3’ terminal rRNA fragments. These can pose difficulties for the construction of sRNA libraries as they can swamp the sequencing space and obscure sRNA abundances. Here we addressed this problem and present a modified “rRNA blocking” protocol for the construction of high-definition (HD) adapter sRNA libraries, in D. melanogaster reproductive tissues. The results showed that 2S rRNAs targeted by blocking oligos were reduced from >80% to < 0.01% total reads. In addition, the use of multiple rRNA blocking oligos to bind the most abundant rRNA fragments allowed us to reveal the underlying sRNA populations at increased resolution. Side-by-side comparisons of sequencing libraries of blocked and non-blocked samples revealed that rRNA blocking did not change the miRNA populations present, but instead enhanced their abundances. We suggest that this rRNA blocking procedure offers the potential to improve the in-depth analysis of differentially expressed sRNAs within and across different tissues. PMID:29474379

The rRNA evolution and procaryotic phylogeny

NASA Technical Reports Server (NTRS)

Fox, G. E.

1986-01-01

Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

Molecular phylogeny of mitochondrial cytochrome b and 12S rRNA sequences in the Felidae: ocelot and domestic cat lineages.

PubMed

Masuda, R; Lopez, J V; Slattery, J P; Yuhki, N; O'Brien, S J

1996-12-01

Molecular phylogeny of the cat family Felidae is derived using two mitochondrial genes, cytochrome b and 12S rRNA. Phylogenetic methods of weighted maximum parsimony and minimum evolution estimated by neighbor-joining are employed to reconstruct topologies among 20 extant felid species. Sequence analyses of 363 bp of cytochrome b and 376 bp of the 12S rRNA genes yielded average pair-wise similarity values between felids ranging from 94 to 99% and from 85 to 99%, respectively. Phylogenetic reconstruction supports more recent, intralineage associations but fails to completely resolve interlineage relationships. Both genes produce a monophyletic group of Felis species but vary in the placement of the pallas cat. The ocelot lineage represents an early divergence within the Felidae, with strong associations between ocelot and margay, Geoffroy's cat and kodkod, and pampas cat and tigrina. Implications of the relative recency of felid evolution, presence of ancestral polymorphisms, and influence of outgroups in placement of the topological root are discussed.

Temporal trends and associated factors for pre-hospital and in-hospital delays of stroke patients over a 16-year period: the Athens study.

PubMed

Papapanagiotou, Panagiotis; Iacovidou, Nicoletta; Spengos, Konstantinos; Xanthos, Theodoros; Zaganas, Ioannis; Aggelina, Afrodite; Alegakis, Athanasios; Vemmos, Konstantinos

2011-01-01

The management and outcome of acute ischemic stroke changed dramatically after the introduction of intravenous thrombolysis. However, relatively few patients have received thrombolytic treatment, mainly due to pre-hospital and/or in-hospital delays. Although the causes of these delays have been adequately studied, their change over a long period has not. All acute first-ever stroke patients (n = 2,746) presenting to our academic center from 1993 to 2008 were prospectively documented in a computerized stroke data bank. The time from symptoms onset to presentation at the emergency room and to acquisition of a brain CT was calculated. Time trends over this period as well as the factors affecting them were analyzed. The final study cohort consisted of 2,326 acute stroke patients after excluding 302 patients with an unknown time of stroke onset and 118 who suffered a stroke during hospitalization for another illness. Over the 16-year period, the median time from stroke onset to presentation at the emergency room decreased significantly from 3.15 h (interquartile range 1.30-10.30) to 2.00 h (range 1.00-4.00) (p < 0.001). The median time from emergency room presentation to CT scan completion also decreased significantly (p < 0.001) from 12.3 h (range 4.1-29.8) to 1.0 h (range 0.31-2.77). As a result, the proportion of patients having a CT scan within 4 h of stroke onset increased significantly from 8.6% in 1993-1994 to 53.6% in 2007-2008 (p < 0.001). Thrombolytic treatment was applied in 4.15% of all ischemic stroke patients in the period from 2003 to 2008. Along with other significant factors, use of an emergency medical service was associated with a 57% greater chance of presenting within 3 h after symptoms onset. These results suggest a continued improvement in pre-hospital and in-hospital delays for stroke management. Public awareness and education regarding medical and paramedical services are necessary for the best early management of acute stroke patients

CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.

PubMed

Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

2016-01-01

High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA

CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment

PubMed Central

Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

2016-01-01

High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in

Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

PubMed

Beauparlant, Marc A; Drouin, Guy

2014-02-01

Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

PubMed Central

Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

1996-01-01

Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

PubMed

Drouin, Guy; Tsang, Corey

2012-06-01

Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

Uncultivated Microbial Eukaryotic Diversity: A Method to Link ssu rRNA Gene Sequences with Morphology

PubMed Central

Hirst, Marissa B.; Kita, Kelley N.; Dawson, Scott C.

2011-01-01

Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA “phylotypes” from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

Chromosomal Organization of Rrna Operons in Bacillus Subtilis

PubMed Central

Jarvis, E. D.; Widom, R. L.; LaFauci, G.; Setoguchi, Y.; Richter, I. R.; Rudner, R.

1988-01-01

Integrative mapping with vectors containing ribosomal DNA sequences were used to complete the mapping of the 10 rRNA gene sets in the endospore forming bacterium Bacillus subtilis. Southern hybridizations allowed the assignment of nine operons to distinct BclI restriction fragments and their genetic locus identified by transductional crosses. Nine of the ten rRNA gene sets are located between 0 and 70° on the genomic map. In the region surrounding cysA14, two sets of closely spaced tandem clusters are present. The first (rrnJ and rrnW) is located between purA16 and cysA14 closely linked to the latter; the second (rrnI, rrnH and rrnG) previously mapped within this area is located between attSPO2 and glpT6. The operons at or near the origin of replication (rrnO,rrnA and rrnJ,rrnW) represent ``hot spots'' of plasmid insertion. PMID:2465199

Pre-cementation of deep shaft

NASA Astrophysics Data System (ADS)

Heinz, W. F.

1988-12-01

Pre-cementation or pre-grouting of deep shafts in South Africa is an established technique to improve safety and reduce water ingress during shaft sinking. The recent completion of several pre-cementation projects for shafts deeper than 1000m has once again highlighted the effectiveness of pre-grouting of shafts utilizing deep slimline boreholes and incorporating wireline technique for drilling and conventional deep borehole grouting techniques for pre-cementation. Pre-cementation of deep shaft will: (i) Increase the safety of shaft sinking operation (ii) Minimize water and gas inflow during shaft sinking (iii) Minimize the time lost due to additional grouting operations during sinking of the shaft and hence minimize costly delays and standing time of shaft sinking crews and equipment. (iv) Provide detailed information of the geology of the proposed shaft site. Informations on anomalies, dykes, faults as well as reef (gold bearing conglomerates) intersections can be obtained from the evaluation of cores of the pre-cementation boreholes. (v) Provide improved rock strength for excavations in the immediate vicinity of the shaft area. The paper describes pre-cementation techniques recently applied successfully from surface and some conclusions drawn for further considerations.

Student Participation under Random and Delayed Credit Contingencies

ERIC Educational Resources Information Center

Aspiranti, K. B.; McCleary, D. F.; McCleary, L. N.; Ga-lyon, C. E.; Blondin, C. A.; Yaw, J. S.; Williams, R. L.

2013-01-01

The authors examined the effects of randomized and delayed credit on the percentage of college students participating at four pre-defined levels on each class discussion day: non-participation, credit-level participation, frequent participation, and dominant participation. Although the same amount of participation credit was available to students…

[Creation and Evaluation of Educational Programs for Additional Delayed Scan of FDG-PET/CT].

PubMed

Wada, Ryota; Kamiya, Takashi; Fujino, Kouichi; Ueda, Junpei; Isohashi, Kayako; Tatsumi, Mitsuaki; Hatazawa, Jun

Generally, FDG-PET/CT image is acquired at the 60th minute after tracer administration. Depending on the clinical case, additional delayed scans may be useful. However, it is difficult to judge whether additional delayed scan is useful or not. The purposes of this study were creation and evaluation of educational programs to help radiological technologists to decide the usefulness of additional delayed scan of FDG-PET/CT. Educational programs consisted of the instructional materials and the judgment test of clinical cases. The instructional materials provided the valuable findings for differentiation between uptake in the wall of the colon and colon content, distinction between uptake in the lymph node and urinary tract, and evaluation of malignancy. The judgment test of clinical cases consisted of 10 cases selected by a nuclear medicine physician (for 5 of that cases additional delayed scan was decided to be useful). Five experienced technologists and five inexperienced technologists scored the volubility of additional delayed scan pre- and post-training using the instructional materials (the full marks of score is 5). After the educational programs using the instructional materials, the score was improved with the significant difference in both experienced (pre: 3.6±1.4, post: 4.0±1.2) and inexperienced (pre: 2.8±1.5, post: 3.7±1.5) groups (p<0.05). According to the educational programs, technologist might be able to decide whether the additional delayed scan is useful or not. The successful results of this study may improve the interpretation or reduce the total exposure dose of the PET/CT scan.

Nearly complete rRNA genes assembled from across the metazoan animals: effects of more taxa, a structure-based alignment, and paired-sites evolutionary models on phylogeny reconstruction.

PubMed

Mallatt, Jon; Craig, Catherine Waggoner; Yoder, Matthew J

2010-04-01

This study (1) uses nearly complete rRNA-gene sequences from across Metazoa (197 taxa) to reconstruct animal phylogeny; (2) presents a highly annotated, manual alignment of these sequences with special reference to rRNA features including paired sites (http://purl.oclc.org/NET/rRNA/Metazoan_alignment) and (3) tests, after eliminating as few disruptive, rogue sequences as possible, if a likelihood framework can recover the main metazoan clades. We found that systematic elimination of approximately 6% of the sequences, including the divergent or unstably placed sequences of cephalopods, arrowworm, symphylan and pauropod myriapods, and of myzostomid and nemertodermatid worms, led to a tree that supported Ecdysozoa, Lophotrochozoa, Protostomia, and Bilateria. Deuterostomia, however, was never recovered, because the rRNA of urochordates goes (nonsignificantly) near the base of the Bilateria. Counterintuitively, when we modeled the evolution of the paired sites, phylogenetic resolution was not increased over traditional tree-building models that assume all sites in rRNA evolve independently. The rRNA genes of non-bilaterians contain a higher % AT than do those of most bilaterians. The rRNA genes of Acoela and Myzostomida were found to be secondarily shortened, AT-enriched, and highly modified, throwing some doubt on the location of these worms at the base of Bilateria in the rRNA tree--especially myzostomids, which other evidence suggests are annelids instead. Other findings are marsupial-with-placental mammals, arrowworms in Ecdysozoa (well supported here but contradicted by morphology), and Placozoa as sister to Cnidaria. Finally, despite the difficulties, the rRNA-gene trees are in strong concordance with trees derived from multiple protein-coding genes in supporting the new animal phylogeny. (c) 2009 Elsevier Inc. All rights reserved.

Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

PubMed Central

Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

2011-01-01

5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

PubMed

Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

2009-07-01

RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

PubMed

Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

2017-12-05

Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

Standard cosmology delayed

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choudhury, Debajyoti; Ghoshal, Debashis; Sen, Anjan Ananda, E-mail: debajyoti.choudhury@gmail.com, E-mail: dghoshal@mail.jnu.ac.in, E-mail: anjan.ctp@jmi.ac.in

2012-02-01

The introduction of a delay in the Friedmann equation of cosmological evolution is shown to result in the very early universe undergoing the necessary accelerated expansion in the usual radiation (or matter) dominated phase. Occurring even without a violation of the strong energy condition, this expansion slows down naturally to go over to the decelerated phase, namely the standard Hubble expansion. This may obviate the need for a scalar field driven inflationary epoch.

Time delay in atomic photoionization with circularly polarized light

NASA Astrophysics Data System (ADS)

Ivanov, I. A.; Kheifets, A. S.

2013-03-01

We study time delay in atomic photoionization by circularly polarized light. By considering the Li atom in an excited 2p state, we demonstrate a strong time-delay asymmetry between the photoemission of the target electrons that are co- and counter-rotating with the electromagnetic field in the polarization plane. In addition, we observe the time-delay sensitivity to the polar angle of the photoelectron emission in the polarization plane. This modulation depends on the shape and duration of the electromagnetic pulse.

AMPK agonist AICAR delays the initial decline in lifetime-apex V̇o2 peak, while voluntary wheel running fails to delay its initial decline in female rats.

PubMed

Toedebusch, Ryan G; Ruegsegger, Gregory N; Braselton, Joshua F; Heese, Alexander J; Hofheins, John C; Childs, Tom E; Thyfault, John P; Booth, Frank W

2016-02-01

There has never been an outcome measure for human health more important than peak oxygen consumption (V̇o2 peak), yet little is known regarding the molecular triggers for its lifetime decline with aging. We examined the ability of physical activity or 5 wk of 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) administration to delay the initial aging-induced decline in lifetime-apex V̇o2 peak and potential underlying molecular mechanisms. Experiment 1 consisted of female rats with (RUN) and without (NO RUN) running wheels, while experiment 2 consisted of female nonrunning rats getting the AMPK agonist AICAR (0.5 mg/g/day) subcutaneously for 5 wk beginning at 17 wk of age. All rats underwent frequent, weekly or biweekly V̇o2 peak tests beginning at 10 wk of age. In experiment 1, lifetime-apex V̇o2 peak occurred at 19 wk of age in both RUN and NO RUN and decreased thereafter. V̇o2 peak measured across experiment 1 was ∼25% higher in RUN than in NO RUN. In experiment 2, AICAR delayed the chronological age observed in experiment 1 by 1 wk, from 19 wk to 20 wk of age. RUN and NO RUN showed different skeletal muscle transcriptomic profiles both pre- and postapex. Additionally, growth and development pathways are differentially regulated between RUN and NO RUN. Angiomotin mRNA was downregulated postapex in RUN and NO RUN. Furthermore, strong significant correlations to V̇o2 peak and trends for decreased protein concentration supports angiomotin's potential importance in our model. Contrary to our primary hypothesis, wheel running was not sufficient to delay the chronological age of lifetime-apex V̇o2 peak decline, whereas AICAR delayed it 1 wk. Copyright © 2016 the American Physiological Society.

Pre-hospital treatment of STEMI patients. A scientific statement of the Working Group Acute Cardiac Care of the European Society of Cardiology.

PubMed

Tubaro, M; Danchin, N; Goldstein, P; Filippatos, G; Hasin, Y; Heras, M; Jansky, P; Norekval, T M; Swahn, E; Thygesen, K; Vrints, C; Zahger, D; Arntz, H R; Bellou, A; De La Coussaye, J E; De Luca, L; Huber, K; Lambert, Y; Lettino, M; Lindahl, B; McLean, S; Nibbe, L; Peacock, W F; Price, S; Quinn, T; Spaulding, C; Tatu-Chitoiu, G; Van De Werf, F

2011-06-01

In ST-elevation myocardial infarction (STEMI) the pre-hospital phase is the most critical, as the administration of the most appropriate treatment in a timely manner is instrumental for mortality reduction. STEMI systems of care based on networks of medical institutions connected by an efficient emergency medical service are pivotal. The first steps are devoted to minimize the patient's delay in seeking care, rapidly dispatch a properly staffed and equipped ambulance to make the diagnosis on scene, deliver initial drug therapy and transport the patient to the most appropriate (not necessarily the closest) cardiac facility. Primary PCI is the treatment of choice, but thrombolysis followed by coronary angiography and possibly PCI is a valid alternative, according to patient's baseline risk, time from symptoms onset and primary PCI-related delay. Paramedics and nurses have an important role in pre-hospital STEMI care and their empowerment is essential to increase the effectiveness of the system. Strong cooperation between cardiologists and emergency medicine doctors is mandatory for optimal pre-hospital STEMI care. Scientific societies have an important role in guideline implementation as well as in developing quality indicators and performance measures; health care professionals must overcome existing barriers to optimal care together with political and administrative decision makers.

Hot Jet Ignition Delay Characterization of Methane and Hydrogen at Elevated Temperatures

NASA Astrophysics Data System (ADS)

Tarraf Kojok, Ali

This study contributes to a better understanding of ignition by hot combustion gases which finds application in internal combustion chambers with pre-chamber ignition as well as in wave rotor engine applications. The experimental apparatus consists of two combustion chambers: a pre chamber that generates the transient hot jet of gas and a main chamber which contains the main fuel air blend under study. Variables considered are three fuel mixtures (Hydrogen, Methane, 50% Hydrogen-Methane), initial pressure in the pre-chamber ranging from 1 to 2 atm, equivalence ratio of the fuel air mixture in the main combustion chamber ranging from 0.4 to 1.5, and initial temperature of the main combustion chamber mixture ranging from 297 K to 500 K. Experimental data makes use of 4 pressure sensors with a recorded sampling rate up to 300 kHz, as well as high speed Schlieren imaging with a recorded frame rate up to 20,833 frame per seconds. Results shows an overall increase in ignition delay with increasing equivalence ratio. High temperature of the main chamber blend was found not to affect hot jet ignition delay considerably. Physical mixing effects, and density of the main chamber mixture have a greater effect on hot jet ignition delay.

Pre-operative urinary tract infection: is it a risk factor for early surgical site infection with hip fracture surgery? A retrospective analysis.

PubMed

Yassa, Rafik Rd; Khalfaoui, Mahdi Y; Veravalli, Karunakar; Evans, D Alun

2017-03-01

The aims of the current study were to determine whether pre-operative urinary tract infections in patients presenting acutely with neck of femur fractures resulted in a delay to surgery and whether such patients were at increased risk of developing post-operative surgical site infections. A retrospective review of all patients presenting with a neck of femur fracture, at a single centre over a one-year period. The hospital hip fracture database was used as the main source of data. UK University Teaching Hospital. All patients ( n  = 460) presenting across a single year study period with a confirmed hip fracture. The presence of pre-operative urinary tract infection, the timing of surgical intervention, the occurrence of post-operative surgical site infection and the pathogens identified. A total of 367 patients were operated upon within 24 hours of admission. Urinary infections were the least common cause of delay. A total of 99 patients (21.5%) had pre-operative urinary tract infection. Post-operatively, a total of 57 (12.4%) patients developed a surgical site infection. Among the latter, 31 (54.4%) did not have a pre-operative urinary infection, 23 (40.4%) patients had a pre-operative urinary tract infection, 2 had chronic leg ulcers and one patient had a pre-operative chest infection. Statistically, there was a strong relationship between pre-operative urinary tract infection and the development of post-operative surgical site infection ( p -value: 0.0005). The results of our study indicate that pre-operative urinary tract infection has a high prevalence amongst those presenting with neck of femur fractures, and this is a risk factor for the later development of post-operative surgical site infection.

Delayed/back up antibiotic prescriptions: what do the public think?

PubMed Central

McNulty, Cliodna A M; Lecky, Donna M; Hawking, Meredith K D; Quigley, Anna; Butler, Chris C

2015-01-01

Objective To describe the general public's understanding, acceptance and use of delayed antibiotics. Design Face to face computer-assisted survey using an Ipsos MORI Capibus survey. Setting Randomly selected households in England using multistage sampling. Respondents A representative sample of 1625 adults aged over 15 years and recruited from household visits in England, using age and gender quotas for each area. Data collection and analysis The survey was undertaken in January 2014. Weights based on gender, age, ethnicity, working status, social grade, housing tenure and Government Office Region corrected for selection biases, so that results are broadly representative of the population. Main outcomes measures Proportion of respondents; understanding the meaning of the term delayed antibiotic prescription and how the strategy is used in general practice; in favour of, or opposed to clinicians offering them a delayed antibiotic; reporting receipt, use and acceptability of delayed antibiotic prescriptions in the past year. Results 17% reported fully understanding the meaning of delayed antibiotic prescription and strategy use in general practice;72% were unaware of the term or strategy; 36–39% were in favour of, and 28–30% opposed to clinicians offering them a delayed antibiotic for throat, urine, ear or chest infections. Half of those who were fully aware of the term and practice were in favour of delayed antibiotics. Women, and older respondents, were more strongly opposed to delayed prescribing. Only 4% of all respondents, and 15% of those prescribed an antibiotic, reported being offered a delayed antibiotic in the last year. Conclusions Wider understanding and acceptance of delayed prescribing may facilitate increased uptake. Further research is needed to determine why groups are so strongly in favour or opposed to delayed prescribing. PMID:26614626

The expected emotional benefits of influenza vaccination strongly affect pre-season intentions and subsequent vaccination among healthcare personnel.

PubMed

Thompson, Mark G; Gaglani, Manjusha J; Naleway, Allison; Ball, Sarah; Henkle, Emily M; Sokolow, Leslie Z; Brennan, Beth; Zhou, Hong; Foster, Lydia; Black, Carla; Kennedy, Erin D; Bozeman, Sam; Grohskopf, Lisa A; Shay, David K

2012-05-21

The relative importance of different attitudes in predicting vaccination among healthcare personnel (HCP) is unclear. We hypothesized that HCP who feel at risk without vaccination or say they would regret not getting vaccinated would be more likely to get vaccinated than HCP who do not expect these emotional benefits. A prospective cohort of 1544 HCP with direct patient care was enrolled from September 18 to December 18, 2010 at Scott & White Healthcare in Texas and Kaiser Permanente Northwest in Oregon and Washington. An Internet-based questionnaire assessed pre-season intention to be vaccinated and included 12 questions on attitudes about vaccination: single-item measures of perceived susceptibility and vaccine effectiveness, 5 items that were summed to form a concerns about vaccine scale, and 5 items summed to form an emotional benefits of vaccination scale. Influenza vaccination status for the 2010-2011 season and for 5 prior seasons was confirmed by medical record extraction. There were significant differences between vaccinated and unvaccinated HCP on all attitude items; 72% of vaccinated HCP agreed that they "worry less about getting the flu" if vaccinated, compared to only 26% of the unvaccinated (odds ratio=7.4, 95% confidence interval=5.8-9.5). In a multivariate model, the emotional benefits scale was the strongest predictor of 2010-2011 seasonal influenza vaccination, after adjusting for other attitude measures, prior vaccination history, and pre-season intention to be vaccinated. The predictive value of the emotional benefits scale was strongest for HCP with low pre-season intention to be vaccinated, where HCP vaccine receipt was 15% versus 83% for those with low versus high scores on the emotional benefits scale. The expected emotional benefits of vaccination strongly affect seasonal influenza vaccination among HCP, even after taking into account other attitudes, pre-season intentions, and prior vaccination history. These attitudes are promising

Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences

NASA Technical Reports Server (NTRS)

Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.

1995-01-01

Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.

Detection of Verrucomicrobia in a Pasture Soil by PCR-Mediated Amplification of 16S rRNA Genes

PubMed Central

O’Farrell, Katrina A.; Janssen, Peter H.

1999-01-01

Oligonucleotide primers were designed and used to amplify, by PCR, partial 16S rRNA genes of members of the bacterial division Verrucomicrobia in DNA extracted from a pasture soil. By applying most-probable-number theory to the assay, verrucomicrobia appeared to contribute some 0.2% of the soil DNA. Amplified ribosomal DNA restriction analysis of 53 cloned PCR-amplified partial 16S rRNA gene fragments and comparative sequence analysis of 21 nonchimeric partial 16S rRNA genes showed that these primers amplified only 16S rRNA genes of members of the Verrucomicrobia in DNA extracted from the soil. PMID:10473454

Study of Relationship Between Illness Perception and Delay in Seeking Help for Breast Cancer Patients Based on Leventhal's Self-Regulation Model.

PubMed

Attari, Seyedeh Maryam; Ozgoli, Giti; Solhi, Mahnaz; Alavi Majd, Hamid

2016-01-01

One of the major causes of morbidity and mortality in breast cancer patients is delay in seeking help. Leventhal's self-regulation model provides an appropriate framework to assess delay in seeking help. The aim of this study was to investigate the relationship between "illness perception" and "help seeking delay" in breast cancer patients based on Leventhal's self-regulation model. In this correlational descriptive study with convenience sampling conducted in 2013, participants were 120 women with breast cancer who were diagnosed in the last year and referred to chemotherapy and radiotherapy centers in Rasht, Iran. Data collection scales included demographic data, Revised Illness Perception Questionnaire (IPQ-R)and a researcher made questionnaire to measure the delay in seeking help. Pre-hospital delay (help seeking delay) was evaluated in 3 phases (assessment, disease, behavior). The data were analyzed using SPSS-19. The mean (SD) age calculated for the patients was 47.3±10.2. Some 43% of the patients had a high school or higher education level and 82% were married. The "pre-hospital delay" was reported ≥3 months. Logistic regression analysis showed that none of the illness perception components were correlated with appraisal and behavioral delay phases. In the illness delay phase, "time line" (p-value =0.04) and "risk factors"(p-value=0.03) had significant effects on reducing and "psychological attributions" had significant effects on increasing the delay (p-value =0.01). "Illness coherence" was correlated with decreased pre-hospital patient delay (p-value<0.01). Women's perceptions of breast cancer influences delay in seeking help. In addition to verifying the validity of Leventhal's self-regulation model in explaining delay in seeking help, the results signify the importance of the "illness delay phase" (decision to seek help) and educational interventions-counseling for women in the community.

Nucleolar sub-compartments in motion during rRNA synthesis inhibition: Contraction of nucleolar condensed chromatin and gathering of fibrillar centers are concomitant

PubMed Central

Tchelidze, Pavel; Benassarou, Aassif; Kaplan, Hervé; O’Donohue, Marie-Françoise; Lucas, Laurent; Terryn, Christine; Rusishvili, Levan; Mosidze, Giorgi; Lalun, Nathalie

2017-01-01

The nucleolus produces the large polycistronic transcript (47S precursor) containing the 18S, 5.8S and 28S rRNA sequences and hosts most of the nuclear steps of pre-rRNA processing. Among numerous components it contains condensed chromatin and active rRNA genes which adopt a more accessible conformation. For this reason, it is a paradigm of chromosome territory organization. Active rRNA genes are clustered within several fibrillar centers (FCs), in which they are maintained in an open configuration by Upstream Binding Factor (UBF) molecules. Here, we used the reproducible reorganization of nucleolar components induced by the inhibition of rRNA synthesis by Actinomycin D (AMD) to address the steps of the spatiotemporal reorganization of FCs and nucleolar condensed chromatin. To reach that goal, we used two complementary approaches: i) time-lapse confocal imaging of cells expressing one or several GFP-tagged proteins (fibrillarin, UBF, histone H2B) and ii) ultrastructural identification of nucleolar components involved in the reorganization. Data obtained by time lapse confocal microscopy were analyzed through detailed 3D imaging. This allowed us to demonstrate that AMD treatment induces no fusion and no change in the relative position of the different nucleoli contained in one nucleus. In contrast, for each nucleolus, we observed step by step gathering and fusion of both FCs and nucleolar condensed chromatin. To analyze the reorganization of FCs and condensed chromatin at a higher resolution, we performed correlative light and electron microscopy electron microscopy (CLEM) imaging of the same cells. We demonstrated that threads of intranucleolar condensed chromatin are localized in a complex 3D network of vacuoles. Upon AMD treatment, these structures coalesce before migrating toward the perinucleolar condensed chromatin, to which they finally fuse. During their migration, FCs, which are all linked to ICC, are pulled by the latter to gather as caps disposed at the

Numeracy Predicts Risk of Pre-Hospital Decision Delay: a Retrospective Study of Acute Coronary Syndrome Survival.

PubMed

Petrova, Dafina; Garcia-Retamero, Rocio; Catena, Andrés; Cokely, Edward; Heredia Carrasco, Ana; Arrebola Moreno, Antonio; Ramírez Hernández, José Antonio

2017-04-01

Many patients delay seeking medical attention during acute coronary syndromes (ACS), profoundly increasing their risk for death and major disability. Although research has identified several risk factors, efforts to improve patient decision making have generally been unsuccessful, prompting a call for more research into psychological factors. The purpose of this study is to estimate the relationship between ACS decision delay and numeracy, a factor closely related to general decision making skill and risk literacy. About 5 days after experiencing ACS, 102 survivors (mean age = 58, 32-74) completed a questionnaire including measures of numeracy, decision delay, and other relevant factors (e.g., anxiety, depression, symptom severity, knowledge, demographics). Low patient numeracy was related to longer decision delay, OR = 0.64 [95 % confidence interval (CI) 0.44, 0.92], which was in turn related to higher odds of positive troponin on arrival at the hospital, OR = 1.37 [95 % CI 1.01, 2.01]. Independent of the influence of all other assessed factors, a patient with high (vs. low) numeracy was about four times more likely to seek medical attention within the critical first hour after symptom onset (i.e., OR high-low  = 3.84 [1.127, 11.65]). Numeracy may be one of the largest decision delay risk factors identified to date. Results accord with theories emphasizing potentially pivotal roles of patient deliberation, denial, and outcome understanding during decision making. Findings suggest that brief numeracy assessments may predict which patients are at greater risk for life-threatening decision delay and may also facilitate the design of risk communications that are appropriate for diverse patients who vary in risk literacy.

Nucleation by rRNA Dictates the Precision of Nucleolus Assembly.

PubMed

Falahati, Hanieh; Pelham-Webb, Bobbie; Blythe, Shelby; Wieschaus, Eric

2016-02-08

Membrane-less organelles are intracellular compartments specialized to carry out specific cellular functions. There is growing evidence supporting the possibility that such organelles form as a new phase, separating from cytoplasm or nucleoplasm. However, a main challenge to such phase separation models is that the initial assembly, or nucleation, of the new phase is typically a highly stochastic process and does not allow for the spatiotemporal precision observed in biological systems. Here, we investigate the initial assembly of the nucleolus, a membrane-less organelle involved in different cellular functions including ribosomal biogenesis. We demonstrate that the nucleolus formation is precisely timed in D. melanogaster embryos and follows the transcription of rRNA. We provide evidence that transcription of rRNA is necessary for overcoming the highly stochastic nucleation step in the formation of the nucleolus, through a seeding mechanism. In the absence of rDNA, the nucleolar proteins studied are able to form high-concentration assemblies. However, unlike the nucleolus, these assemblies are highly variable in number, location, and time at which they form. In addition, quantitative study of the changes in the nucleoplasmic concentration and distribution of these nucleolar proteins in the wild-type embryos is consistent with the role of rRNA in seeding the nucleolus formation. Copyright © 2016 Elsevier Ltd. All rights reserved.

Delayed luminescence in a multiparameter approach to evaluation and reduction of radiobiological risks

NASA Astrophysics Data System (ADS)

Grasso, Rosaria; Cammarata, Francesco Paolo; Minafra, Luigi; Marchese, Valentina; Russo, Giorgio; Manti, Lorenzo; Musumeci, Francesco; Scordino, Agata

2017-07-01

In the framework of the research project ETHICS "Pre-clinical experimental and theoretical studies to improve treatment and protection by charged particles" funded by the National Nuclear Physics Institute, Italy, we studied the phenomenon called delayed luminescence emitted by non-tumorigenic breast epithelial MCF10A cell line after proton irradiation at different doses (0.5, 2, 6, 9 Gy). The aim is to found possible correlations between delayed luminescence and in vitro damaging induced by ion irradiation. The first results of this research show that the delayed luminescence kinetics is proton dose dependent. An interesting correlation between delayed luminescence and clonogenic potential was observed.

Neuroprotective effects of silymarin on ischemia-induced delayed neuronal cell death in rat hippocampus.

PubMed

Hirayama, Koki; Oshima, Hideki; Yamashita, Akiko; Sakatani, Kaoru; Yoshino, Atsuo; Katayama, Yoichi

2016-09-01

We examined the effects of silymarin, which was extracted from Silybum marianum, on delayed neuronal cell death in the rat hippocampus. Rats were divided into four groups: sham-operated rats (sham group), rats which underwent ischemic surgery (control group), rats which were treated with silymarin before and after ischemic surgery (pre group), and rats which were treated with silymarin after ischemic surgery only (post group). We performed the ischemic surgery by occluding the bilateral carotid arteries for 20min and sacrificed the rats one week after the surgery. Silymarin was administered orally at 200mg/kg body weight. Smaller numbers of delayed cell deaths were noted in the rat CA1 region of the pre- and post-groups, and no significant difference was observed between these groups. There were few apoptotic cell deaths in all groups. Compared to the control group, significantly fewer cell deaths by autophagy were found in the pre- and post-group. We concluded that silymarin exerts a preservation effect on delayed neuronal cell death in the rat hippocampus and this effect has nothing to do with the timing of administering of silymarin. Copyright © 2016 Elsevier B.V. All rights reserved.

Fast Mapping Word-Learning Abilities of Language-Delayed Preschoolers.

ERIC Educational Resources Information Center

Rice, Mabel L.; And Others

1990-01-01

Twenty language-delayed children (age three to six) viewed a presentation incorporating object, action, attribute, and affective state words into a narrative script. In pre- and postviewing word comprehension measurements, subjects scored lower than children matched for chronological age and children matched for mean length of utterance.…

Parents' and Speech and Language Therapists' Explanatory Models of Language Development, Language Delay and Intervention

ERIC Educational Resources Information Center

Marshall, Julie; Goldbart, Juliet; Phillips, Julie

2007-01-01

Background: Parental and speech and language therapist (SLT) explanatory models may affect engagement with speech and language therapy, but there has been dearth of research in this area. This study investigated parents' and SLTs' views about language development, delay and intervention in pre-school children with language delay. Aims: The aims…

Local Stability of AIDS Epidemic Model Through Treatment and Vertical Transmission with Time Delay

NASA Astrophysics Data System (ADS)

Novi W, Cascarilla; Lestari, Dwi

2016-02-01

This study aims to explain stability of the spread of AIDS through treatment and vertical transmission model. Human with HIV need a time to positively suffer AIDS. The existence of a time, human with HIV until positively suffer AIDS can be delayed for a time so that the model acquired is the model with time delay. The model form is a nonlinear differential equation with time delay, SIPTA (susceptible-infected-pre AIDS-treatment-AIDS). Based on SIPTA model analysis results the disease free equilibrium point and the endemic equilibrium point. The disease free equilibrium point with and without time delay are local asymptotically stable if the basic reproduction number is less than one. The endemic equilibrium point will be local asymptotically stable if the time delay is less than the critical value of delay, unstable if the time delay is more than the critical value of delay, and bifurcation occurs if the time delay is equal to the critical value of delay.

Comparative evaluation of rRNA depletion procedures for the improved analysis of bacterial biofilm and mixed pathogen culture transcriptomes

PubMed Central

Petrova, Olga E.; Garcia-Alcalde, Fernando; Zampaloni, Claudia; Sauer, Karin

2017-01-01

Global transcriptomic analysis via RNA-seq is often hampered by the high abundance of ribosomal (r)RNA in bacterial cells. To remove rRNA and enrich coding sequences, subtractive hybridization procedures have become the approach of choice prior to RNA-seq, with their efficiency varying in a manner dependent on sample type and composition. Yet, despite an increasing number of RNA-seq studies, comparative evaluation of bacterial rRNA depletion methods has remained limited. Moreover, no such study has utilized RNA derived from bacterial biofilms, which have potentially higher rRNA:mRNA ratios and higher rRNA carryover during RNA-seq analysis. Presently, we evaluated the efficiency of three subtractive hybridization-based kits in depleting rRNA from samples derived from biofilm, as well as planktonic cells of the opportunistic human pathogen Pseudomonas aeruginosa. Our results indicated different rRNA removal efficiency for the three procedures, with the Ribo-Zero kit yielding the highest degree of rRNA depletion, which translated into enhanced enrichment of non-rRNA transcripts and increased depth of RNA-seq coverage. The results indicated that, in addition to improving RNA-seq sensitivity, efficient rRNA removal enhanced detection of low abundance transcripts via qPCR. Finally, we demonstrate that the Ribo-Zero kit also exhibited the highest efficiency when P. aeruginosa/Staphylococcus aureus co-culture RNA samples were tested. PMID:28117413

Taxonomic and predicted metabolic profiles of the human gut microbiome in pre-Columbian mummies.

PubMed

Santiago-Rodriguez, Tasha M; Fornaciari, Gino; Luciani, Stefania; Dowd, Scot E; Toranzos, Gary A; Marota, Isolina; Cano, Raul J

2016-11-01

Characterization of naturally mummified human gut remains could potentially provide insights into the preservation and evolution of commensal and pathogenic microorganisms, and metabolic profiles. We characterized the gut microbiome of two pre-Columbian Andean mummies dating to the 10-15th centuries using 16S rRNA gene high-throughput sequencing and metagenomics, and compared them to a previously characterized gut microbiome of an 11th century AD pre-Columbian Andean mummy. Our previous study showed that the Clostridiales represented the majority of the bacterial communities in the mummified gut remains, but that other microbial communities were also preserved during the process of natural mummification, as shown with the metagenomics analyses. The gut microbiome of the other two mummies were mainly comprised by Clostridiales or Bacillales, as demonstrated with 16S rRNA gene amplicon sequencing, many of which are facultative anaerobes, possibly consistent with the process of natural mummification requiring low oxygen levels. Metagenome analyses showed the presence of other microbial groups that were positively or negatively correlated with specific metabolic profiles. The presence of sequences similar to both Trypanosoma cruzi and Leishmania donovani could suggest that these pathogens were prevalent in pre-Columbian individuals. Taxonomic and functional profiling of mummified human gut remains will aid in the understanding of the microbial ecology of the process of natural mummification. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Delay of Transition Using Forced Damping

NASA Technical Reports Server (NTRS)

Exton, Reginald J.

2014-01-01

Several experiments which have reported a delay of transition are analyzed in terms of the frequencies of the induced disturbances generated by different flow control elements. Two of the experiments employed passive stabilizers in the boundary layer, one leading-edge bluntness, and one employed an active spark discharge in the boundary layer. It is found that the frequencies generated by the various elements lie in the damping region of the associated stability curve. It is concluded that the creation of strong disturbances in the damping region stabilizes the boundary-layer and delays the transition from laminar to turbulent flow.

Petting away pre-exam stress: The effect of therapy dog sessions on student well-being.

PubMed

Ward-Griffin, Emma; Klaiber, Patrick; Collins, Hanne K; Owens, Rhea L; Coren, Stanley; Chen, Frances S

2018-03-12

Recently, many universities have implemented programmes in which therapy dogs and their handlers visit college campuses. Despite the immense popularity of therapy dog sessions, few randomized studies have empirically tested the efficacy of such programmes. The present study evaluates the efficacy of such a therapy dog programme in improving the well-being of university students. This research incorporates two components: (a) a pre/post within-subjects design, in which 246 participants completed a brief questionnaire immediately before and after a therapy dog session and (b) an experimental design with a delayed-treatment control group, in which all participants completed baseline measures and follow-up measures approximately 10 hr later. Only participants in the experimental condition experienced the therapy dog session in between the baseline and follow-up measures. Analyses of pre/post data revealed that the therapy dog sessions had strong immediate benefits, significantly reducing stress and increasing happiness and energy levels. In addition, participants in the experimental group reported a greater improvement in negative affect, perceived social support, and perceived stress compared with those in the delayed-treatment control group. Our results suggest that single, drop-in, therapy dog sessions have large and immediate effects on students' well-being, but also that the effects after several hours are small. Copyright © 2018 John Wiley & Sons, Ltd.

Methyltransferase That Modifies Guanine 966 of the 16 S rRNA: FUNCTIONAL IDENTIFICATION AND TERTIARY STRUCTURE*

PubMed Central

Lesnyak, Dmitry V.; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V.; Bogdanov, Alexey A.; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A.

2010-01-01

N2-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m2G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m2G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m2G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05 Å. The structure closely resembles RsmC rRNA methyltransferase, specific for m2G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m2G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed. PMID:17189261

Methyltransferase that modifies guanine 966 of the 16 S rRNA: functional identification and tertiary structure.

PubMed

Lesnyak, Dmitry V; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V; Bogdanov, Alexey A; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A

2007-02-23

N(2)-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m(2)G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m(2)G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m(2)G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05A(.) The structure closely resembles RsmC rRNA methyltransferase, specific for m(2)G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m(2)G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed.

The repeat organizer, a specialized insulator element within the intergenic spacer of the Xenopus rRNA genes.

PubMed Central

Robinett, C C; O'Connor, A; Dunaway, M

1997-01-01

We have identified a novel activity for the region of the intergenic spacer of the Xenopus laevis rRNA genes that contains the 35- and 100-bp repeats. We devised a new assay for this region by constructing DNA plasmids containing a tandem repeat of rRNA reporter genes that were separated by the 35- and 100-bp repeat region and a rRNA gene enhancer. When the 35- and 100-bp repeat region is present in its normal position and orientation at the 3' end of the rRNA reporter genes, the enhancer activates the adjacent downstream promoter but not the upstream rRNA promoter on the same plasmid. Because this element can restrict the range of an enhancer's activity in the context of tandem genes, we have named it the repeat organizer (RO). The ability to restrict enhancer action is a feature of insulator elements, but unlike previously described insulator elements the RO does not block enhancer action in a simple enhancer-blocking assay. Instead, the activity of the RO requires that it be in its normal position and orientation with respect to the other sequence elements of the rRNA genes. The enhancer-binding transcription factor xUBF also binds to the repetitive sequences of the RO in vitro, but these sequences do not activate transcription in vivo. We propose that the RO is a specialized insulator element that organizes the tandem array of rRNA genes into single-gene expression units by promoting activation of a promoter by its proximal enhancers. PMID:9111359

Pulse-parameter dependence of nuclear ``attosecond time delays''

NASA Astrophysics Data System (ADS)

Armstrong, Greg; Ursrey, D.; Hernandez, J. V.; Anis, F.; Severt, T.; Zohrabi, M.; Berry, Ben; Feizollah, Peyman; Jochim, Bethany; Kanaka Raju, P.; McKenna, J.; Gaire, B.; Carnes, K. D.; Ben-Itzhak, I.; Esry, B. D.

2017-04-01

One of the main goals of strong-field photodissociation is the control of chemical reactions. Recent experiments have successfully controlled the spatial asymmetry in D2+using two-color interferometry. These experiments achieved vibrational resolution, and so were able to determine the spatial asymmetry of a number of vibrational states as a function of two-color delay. The relative phase in the delay-dependent spatial asymmetry obtained in these experiments may be used to define a time delay in dissociation from adjacent vibrational states - a technique used previously to produce relative time delays in atomic ionization from the photoelectron spectrum. Further two-color measurements in this direction are being planned. As a guide to these experiments, we aim to determine theoretically the dependence of such delays on laser intensity, pulse length, and pulse shape. We also identify the parameters that maximize the contrast in the delay-dependent spatial asymmetry. This work is supported by the Chemical Sciences, Geosciences, and Biosciences Division, Office of Basic Energy Sciences, Office of Science, U. S. Department of Energy under Contract No. DE-FG02-86ER13191.

Variable Delay Element For Jitter Control In High Speed Data Links

DOEpatents

Livolsi, Robert R.

2002-06-11

A circuit and method for decreasing the amount of jitter present at the receiver input of high speed data links which uses a driver circuit for input from a high speed data link which comprises a logic circuit having a first section (1) which provides data latches, a second section (2) which provides a circuit generates a pre-destorted output and for compensating for level dependent jitter having an OR function element and a NOR function element each of which is coupled to two inputs and to a variable delay element as an input which provides a bi-modal delay for pulse width pre-distortion, a third section (3) which provides a muxing circuit, and a forth section (4) for clock distribution in the driver circuit. A fifth section is used for logic testing the driver circuit.

Group I introns are inherited through common ancestry in the nuclear-encoded rRNA of Zygnematales (Charophyceae).

PubMed Central

Bhattacharya, D; Surek, B; Rüsing, M; Damberger, S; Melkonian, M

1994-01-01

Group I introns are found in organellar genomes, in the genomes of eubacteria and phages, and in nuclear-encoded rRNAs. The origin and distribution of nuclear-encoded rRNA group I introns are not understood. To elucidate their evolutionary relationships, we analyzed diverse nuclear-encoded small-subunit rRNA group I introns including nine sequences from the green-algal order Zygnematales (Charophyceae). Phylogenetic analyses of group I introns and rRNA coding regions suggest that lateral transfers have occurred in the evolutionary history of group I introns and that, after transfer, some of these elements may form stable components of the host-cell nuclear genomes. The Zygnematales introns, which share a common insertion site (position 1506 relative to the Escherichia coli small-subunit rRNA), form one subfamily of group I introns that has, after its origin, been inherited through common ancestry. Since the first Zygnematales appear in the middle Devonian within the fossil record, the "1506" group I intron presumably has been a stable component of the Zygnematales small-subunit rRNA coding region for 350-400 million years. PMID:7937917

Interaction of TIF-90 and filamin A in the regulation of rRNA synthesis in leukemic cells.

PubMed

Nguyen, Le Xuan Truong; Chan, Steven M; Ngo, Tri Duc; Raval, Aparna; Kim, Kyeong Kyu; Majeti, Ravindra; Mitchell, Beverly S

2014-07-24

The transcription initiation factor I (TIF-IA) is an important regulator of the synthesis of ribosomal RNA (rRNA) through its facilitation of the recruitment of RNA polymerase I (Pol I) to the ribosomal DNA promoter. Activation of the phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) pathway, which occurs commonly in acute myelogenous leukemia, enhances rRNA synthesis through TIF-IA stabilization and phosphorylation. We have discovered that TIF-IA coexists with a splicing isoform, TIF-90, which is expressed preferentially in the nucleolus and at higher levels in proliferating and transformed hematopoietic cells. TIF-90 interacts directly with Pol I to increase rRNA synthesis as a consequence of Akt activation. Furthermore, TIF-90 binds preferentially to a 90-kDa cleavage product of the actin binding protein filamin A (FLNA) that inhibits rRNA synthesis. Increased expression of TIF-90 overcomes the inhibitory effect of this cleavage product and stimulates rRNA synthesis. Because activated Akt also reduces FLNA cleavage, these results indicate that activated Akt and TIF-90 function in parallel to increase rRNA synthesis and, as a consequence, cell proliferation in leukemic cells. These results provide evidence that the direct targeting of Akt would be an effective therapy in acute leukemias in which Akt is activated. © 2014 by The American Society of Hematology.

Time delay and magnification centroid due to gravitational lensing by black holes and naked singularities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Virbhadra, K. S.; Keeton, C. R.; Department of Physics and Astronomy, Rutgers University, 136 Frelinghuysen Road, Piscataway, NJ 08854

We model the massive dark object at the center of the Galaxy as a Schwarzschild black hole as well as Janis-Newman-Winicour naked singularities, characterized by the mass and scalar charge parameters, and study gravitational lensing (particularly time delay, magnification centroid, and total magnification) by them. We find that the lensing features are qualitatively similar (though quantitatively different) for Schwarzschild black holes, weakly naked, and marginally strongly naked singularities. However, the lensing characteristics of strongly naked singularities are qualitatively very different from those due to Schwarzschild black holes. The images produced by Schwarzschild black hole lenses and weakly naked and marginallymore » strongly naked singularity lenses always have positive time delays. On the other hand, strongly naked singularity lenses can give rise to images with positive, zero, or negative time delays. In particular, for a large angular source position the direct image (the outermost image on the same side as the source) due to strongly naked singularity lensing always has a negative time delay. We also found that the scalar field decreases the time delay and increases the total magnification of images; this result could have important implications for cosmology. As the Janis-Newman-Winicour metric also describes the exterior gravitational field of a scalar star, naked singularities as well as scalar star lenses, if these exist in nature, will serve as more efficient cosmic telescopes than regular gravitational lenses.« less

Toward an Understanding of Changes in Diversity Associated with Fecal Microbiome Transplantation Based on 16S rRNA Gene Deep Sequencing

PubMed Central

Shahinas, Dea; Silverman, Michael; Sittler, Taylor; Chiu, Charles; Kim, Peter; Allen-Vercoe, Emma; Weese, Scott; Wong, Andrew; Low, Donald E.; Pillai, Dylan R.

2012-01-01

ABSTRACT Fecal microbiome transplantation by low-volume enema is an effective, safe, and inexpensive alternative to antibiotic therapy for patients with chronic relapsing Clostridium difficile infection (CDI). We explored the microbial diversity of pre- and posttransplant stool specimens from CDI patients (n = 6) using deep sequencing of the 16S rRNA gene. While interindividual variability in microbiota change occurs with fecal transplantation and vancomycin exposure, in this pilot study we note that clinical cure of CDI is associated with an increase in diversity and richness. Genus- and species-level analysis may reveal a cocktail of microorganisms or products thereof that will ultimately be used as a probiotic to treat CDI. PMID:23093385

Influence of age on delayed surgical treatment of proximal femoral fractures

PubMed Central

Gomes, Lisiane Pinto; do Nascimento, Leandra Delfim; Campos, Tulio Vinicius de Oliveira; Paiva, Edson Barreto; de Andrade, Marco Antonio Percope; Guimarães, Henrique Cerqueira

2015-01-01

ABSTRACT OBJECTIVE : To investigate the influence of patients' age on the delay between diagnosis and surgical treatment of proximal femoral fractures METHODS : This is a retrospective study, con-ducted at a tertiary university hospital, including all patients admitted with proximal femoral fractures between March 2013 and March 2014. The participants were categorized into four groups according to age levels. The groups were compared according to demographics, comorbidities, fracture type, trau-ma circumstances, and time between diagnosis and surgical procedure RESULTS : One hundred and sixty one patients were included, 37 adults and 124 elderly. Among adults, the mean delay between diagnosis and surgical procedure was 6.4±5.3 days; among elderly the delay was 9.5±7.6 days. There was a progressive increase in the delay from the young-adults group through the elderly individuals (Kruskal-Wallis: 13.7; p=0.003) CONCLUSION : In spite of being the patients most susceptible to complications due to surgical delay, the elderly individuals pre-sented the longest delays from admission to surgical treatment. Level of Evidence III, Retrospective Study. PMID:27057145

Nucleolar TRF2 attenuated nucleolus stress-induced HCC cell-cycle arrest by altering rRNA synthesis.

PubMed

Yuan, Fuwen; Xu, Chenzhong; Li, Guodong; Tong, Tanjun

2018-05-03

The nucleolus is an important organelle that is responsible for the biogenesis of ribosome RNA (rRNA) and ribosomal subunits assembly. It is also deemed to be the center of metabolic control, considering the critical role of ribosomes in protein translation. Perturbations of rRNA synthesis are closely related to cell proliferation and tumor progression. Telomeric repeat-binding factor 2 (TRF2) is a member of shelterin complex that is responsible for telomere DNA protection. Interestingly, it was recently reported to localize in the nucleolus of human cells in a cell-cycle-dependent manner, while the underlying mechanism and its role on the nucleolus remained unclear. In this study, we found that nucleolar and coiled-body phosphoprotein 1 (NOLC1), a nucleolar protein that is responsible for the nucleolus construction and rRNA synthesis, interacted with TRF2 and mediated the shuttle of TRF2 between the nucleolus and nucleus. Abating the expression of NOLC1 decreased the nucleolar-resident TRF2. Besides, the nucleolar TRF2 could bind rDNA and promoted rRNA transcription. Furthermore, in hepatocellular carcinoma (HCC) cell lines HepG2 and SMMC7721, TRF2 overexpression participated in the nucleolus stress-induced rRNA inhibition and cell-cycle arrest.

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

Effects of delayed mating on the reproductive biology of the vine mealybug, Planococcus ficus (Hemiptera: Pseudococcidae).

PubMed

Lentini, A; Mura, A; Muscas, E; Nuvoli, M T; Cocco, A

2018-04-01

The effect of increasing mating delay on the reproductive performance and population growth rates of the vine mealybug, Planococcus ficus (Signoret) (Hemiptera: Pseudococcidae), was investigated under laboratory conditions. Virgin females were mated at 1, 3, 5, 7, 14, 21 and 28 days after emergence and reproductive and life table parameters were estimated. The pre-oviposition period (number of days between mating and the onset of oviposition) significantly decreased in females mated within 7 days, whereas females mated at older ages showed equivalent pre-oviposition periods (7 days, as shorter delays in mating did not reduce the population growth rates.

Identifying Anomalies in Gravitational Lens Time Delays

NASA Astrophysics Data System (ADS)

Congdon, Arthur B.; Keeton, C. R.; Nordgren, C. E.

2009-05-01

Gravitational lensing has become a powerful probe of cold dark matter substructure. Earlier work using anomalous flux ratios in four-image quasar lenses has shown that lensing is sensitive to substructure which raises the exciting prospect of constraining the mass function and spatial distribution of dark matter satellites in galaxies. We examine the ability of gravitational lens time delays to reveal complex structure in lens potentials. We use Monte Carlo simulations to determine the range of time delays that can be produced by realistic smooth lens models consisting of isothermal ellipsoid galaxies with tidal shear. We can then identify outliers as "time-delay anomalies." We find evidence for anomalies in close image pairs in the cusp lenses RX J1131-1231 and B1422+231. The anomalies in RX J1131-1231 provide strong evidence for substructure in the lens potential, while at this point the apparent anomalies in B1422+231 mainly indicate that the time delay measurements need to be improved. We also find evidence for time-delay anomalies in larger-separation image pairs in four additional lenses. We suggest that these anomalies are caused by some combination of substructure and a complex lens environment. Our work argues for a large sample of strong lenses with precisely-measured time delays. The first of these objectives will be readily achievable as the next generation of optical and radio telescopes come online, while the second will require a dedicated one-meter class space-based observatory. Meeting these goals will make it possible to examine the properties of dark matter on sub-galactic scales, which is essential for distinguishing among the various dark matter candidates from particle physics. Part of this work was funded by NSF grant AST-0747311. ABC is currently supported by an appointment to the NASA Postdoctoral Program at the Jet Propulsion Laboratory, administered by Oak Ridge Associated Universities through a contract with NASA.

Fast and secure handover of intra-ASN IEEE802.16 network by proposed certificate based pre-authentication

NASA Astrophysics Data System (ADS)

Sridevi, B.; Supriya, T. S.; Rajaram, S.

2013-01-01

The current generation of wireless networks has been designed predominantly to support voice and more recently data traffic. WiMAX is currently one of the hottest technologies in wireless. The main motive of the mobile technologies is to provide seamless cost effective mobility. But this is affected by Authentication cost and handover delay since on each handoff the Mobile Station (MS) has to undergo all steps of authentication. Pre-Authentication is used to reduce the handover delay and increase the speed of the Intra-ASN Handover. Proposed Pre-Authentication method is intended to reduce the authentication delay by getting pre authenticated by central authority called Pre Authentication Authority (PAA). MS requests PAA for Pre Authentication Certificate (PAC) before performing handoff. PAA verifies the identity of MS and provides PAC to MS and also to the neighboring target Base Stations (tBSs). MS having time bound PAC can skip the authentication process when recognized by target BS during handoff. It also prevents the DOS (Denial Of Service) attack and Replay attack. It has no wastage of unnecessary key exchange of the resources. The proposed work is simulated by NS2 model and by MATLAB.

The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript.

PubMed Central

Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J

1981-01-01

We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619

Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

PubMed

Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

2012-07-01

Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

PubMed

Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

2003-01-01

Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

[Delays in diagnosing and treating tuberculosis in Croatia].

PubMed

Jurčev-Savičević, Anamarija; Popović-Grle, Sanja; Mulić, Rosanda; Smoljanović, Mladen; Miše, Kornelija

2012-09-01

The aim of this study was to determine factors causing delay in tuberculosis diagnosis and treatment in Croatia. It included 240 adults with pulmonary tuberculosis, who were interviewed for demographics, socioeconomic, lifestyle, and personal health data. Total delay was defined as a number of days from the onset of symptoms to the initiation of therapy. The median and the 75th percentile of the total delay were 68 and 120 days, respectively: 16.7 % of the patients initiated treatment within the first month, 23.8 % within the second month, 23.3 % within the third month, 12.9 % within the fourth month, and 23.3 % more than four months after the symptoms appeared. Long delay (exceeding median delay) was strongly associated with drug abuse (p=0.021). Extreme delay (75th percentile of delay) was significantly associated with the lowest level of education (p=0.021), below minimal income (p=0.039), minimal to average income (p=0.020), current smoking (p=0.050), and co-morbidity (p=0.048). In the multivariate model, long delay remained associated with drug abuse, while extreme delay was associated with the lowest level of education (p=0.033) and current (p=0.017) and ex-smoking (p=0.045).In a setting with decreasing TB incidence, the reported delay can be reduced by increasing health education, not only about tuberculosis per se, but about health in general and attitudes towards prevention and early care. It is also important to increase tuberculosis knowledge among healthcare workers as well as their diagnostic skills.

Identifying Anomalies in Gravitational Lens Time Delays

NASA Astrophysics Data System (ADS)

Congdon, Arthur B.; Keeton, Charles R.; Nordgren, C. Erik

2010-02-01

We examine the ability of gravitational lens time delays to reveal complex structure in lens potentials. In a previous paper, we predicted how the time delay between the bright pair of images in a "fold" lens scales with the image separation, for smooth lens potentials. Here we show that the proportionality constant increases with the quadrupole moment of the lens potential, and depends only weakly on the position of the source along the caustic. We use Monte Carlo simulations to determine the range of time delays that can be produced by realistic smooth lens models consisting of isothermal ellipsoid galaxies with tidal shear. We can then identify outliers as "time delay anomalies." We find evidence for anomalies in close image pairs in the cusp lenses RX J1131 - 1231 and B1422+231. The anomalies in RX J1131 - 1231 provide strong evidence for substructure in the lens potential, while at this point the apparent anomalies in B1422+231 mainly indicate that the time delay measurements need to be improved. We also find evidence for time delay anomalies in larger-separation image pairs in the fold lenses, B1608+656 and WFI 2033 - 4723, and the cusp lens RX J0911+0551. We suggest that these anomalies are caused by some combination of substructure and a complex lens environment. Finally, to assist future monitoring campaigns we use our smooth models with shear to predict the time delays for all known four-image lenses.

Common 5S rRNA variants are likely to be accepted in many sequence contexts

NASA Technical Reports Server (NTRS)

Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

2003-01-01

Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

Airport Flight Departure Delay Model on Improved BN Structure Learning

NASA Astrophysics Data System (ADS)

Cao, Weidong; Fang, Xiangnong

An high score prior genetic simulated annealing Bayesian network structure learning algorithm (HSPGSA) by combining genetic algorithm(GA) with simulated annealing algorithm(SAA) is developed. The new algorithm provides not only with strong global search capability of GA, but also with strong local hill climb search capability of SAA. The structure with the highest score is prior selected. In the mean time, structures with lower score are also could be choice. It can avoid efficiently prematurity problem by higher score individual wrong direct growing population. Algorithm is applied to flight departure delays analysis in a large hub airport. Based on the flight data a BN model is created. Experiments show that parameters learning can reflect departure delay.

Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations.

PubMed

Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

2018-04-14

To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .

Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations

PubMed Central

Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

2018-01-01

AIM To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori (H. pylori) and determine their association with therapeutic failure. METHODS PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar’s test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. RESULTS 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori (κ = 0.71). CONCLUSION The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori. PMID:29662291

Novel variants of the 5S rRNA genes in Eruca sativa.

PubMed

Singh, K; Bhatia, S; Lakshmikumaran, M

1994-02-01

The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

Reducing time delays in the management of ischemic stroke patients in Northern Italy.

PubMed

Vidale, Simone; Arnaboldi, Marco; Bezzi, Giacomo; Bono, Giorgio; Grampa, Giampiero; Guidotti, Mario; Perrone, Patrizia; Salmaggi, Andrea; Zarcone, Davide; Zoli, Alberto; Agostoni, Elio

2016-07-15

Thrombolysis represents the best therapy for ischemic stroke but the main limitation of its administration is time. The avoidable delay is a concept reflecting the effectiveness of management pathway. For this reason, we projected a study concerning the detection of main delays with following introduction of corrective factors. In this paper we describe the results after these corrections. Consecutive patients admitted for ischemic stroke during a 3-months period to 35 hospitals of a macro-area of Northern Italy were enrolled. Each time of management was registered, identifying three main intervals: pre-hospital, in-hospital and total times. Previous corrective interventions were: 1.increasing of population awareness to use the Emergency Medical Service (EMS); 2.pre-notification of Emergency Department; 3.use of high urgency codes; 4.use of standardised operational algorithm. Statistical analysis was conducted using time-to-event analysis and Cox proportional hazard regression. 1084 patients were enrolled. EMS was alerted for 56.3% of subjects, mainly in females and severe strokes (p<0.001). Thrombolytic treatment was performed in 4.7% of patients. Median pre-hospital and in-hospital times were 113 and 105min, while total time was 240. High urgency codes at transport contributed to reduce pre-hospital and in-hospital time (p<0.05). EMS use and high urgency codes promoted thrombolysis. Treatment within 4.5hours from symptom onset was performed in 14% of patients more than the first phase of study. The implementation of an organizational system based on EMS and concomitant high urgency codes use was effective to reduce avoidable delay and to increase thrombolysis. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Conserved Curvature of RNA Polymerase I Core Promoter Beyond rRNA Genes: The Case of the Tritryps

PubMed Central

Smircich, Pablo; Duhagon, María Ana; Garat, Beatriz

2015-01-01

In trypanosomatids, the RNA polymerase I (RNAPI)-dependent promoters controlling the ribosomal RNA (rRNA) genes have been well identified. Although the RNAPI transcription machinery recognizes the DNA conformation instead of the DNA sequence of promoters, no conformational study has been reported for these promoters. Here we present the in silico analysis of the intrinsic DNA curvature of the rRNA gene core promoters in Trypanosoma brucei, Trypanosoma cruzi, and Leishmania major. We found that, in spite of the absence of sequence conservation, these promoters hold conformational properties similar to other eukaryotic rRNA promoters. Our results also indicated that the intrinsic DNA curvature pattern is conserved within the Leishmania genus and also among strains of T. cruzi and T. brucei. Furthermore, we analyzed the impact of point mutations on the intrinsic curvature and their impact on the promoter activity. Furthermore, we found that the core promoters of protein-coding genes transcribed by RNAPI in T. brucei show the same conserved conformational characteristics. Overall, our results indicate that DNA intrinsic curvature of the rRNA gene core promoters is conserved in these ancient eukaryotes and such conserved curvature might be a requirement of RNAPI machinery for transcription of not only rRNA genes but also protein-coding genes. PMID:26718450

Imitation of contrastive lexical stress in children with speech delay

NASA Astrophysics Data System (ADS)

Vick, Jennell C.; Moore, Christopher A.

2005-09-01

This study examined the relationship between acoustic correlates of stress in trochaic (strong-weak), spondaic (strong-strong), and iambic (weak-strong) nonword bisyllables produced by children (30-50) with normal speech acquisition and children with speech delay. Ratios comparing the acoustic measures (vowel duration, rms, and f0) of the first syllable to the second syllable were calculated to evaluate the extent to which each phonetic parameter was used to mark stress. In addition, a calculation of the variability of jaw movement in each bisyllable was made. Finally, perceptual judgments of accuracy of stress production were made. Analysis of perceptual judgments indicated a robust difference between groups: While both groups of children produced errors in imitating the contrastive lexical stress models (~40%), the children with normal speech acquisition tended to produce trochaic forms in substitution for other stress types, whereas children with speech delay showed no preference for trochees. The relationship between segmental acoustic parameters, kinematic variability, and the ratings of stress by trained listeners will be presented.

Pre-pregnancy BMI, gestational weight gain and breast-feeding: a cohort study in China.

PubMed

Tao, Xing-Yong; Huang, Kun; Yan, Shuang-Qin; Zuo, A-Zhu; Tao, Rui-Wen; Cao, Hui; Gu, Chun-Li; Tao, Fang-Biao

2017-04-01

The purpose of the present study was to examine the influence of maternal pre-pregnancy BMI and gestational weight gain (GWG) on initiation and duration of infant breast-feeding in a prospective birth cohort study. Breast-feeding information was collected at 1, 3, 6 and 12 months postpartum. The association of pre-pregnancy BMI and GWG with delayed lactogenesis II and termination of exclusive breast-feeding was assessed with logistic regression analysis. The risk of early termination of any breast-feeding during the first year postpartum was assessed with Cox proportional hazards models. Urban city in China. Women with infants from the Ma'anshan Birth Cohort Study (n 3196). The median duration of any breast-feeding in this cohort was 7·0 months. Pre-pregnancy obese women had higher risks of delayed lactogenesis II (risk ratio=1·89; 95 % CI 1·04, 3·43) and early termination of any breast-feeding (hazard ratio=1·38; 95 % CI 1·09, 1·75) adjusted for potential maternal and infant confounders, when compared with normal-weight women. No differences in breast-feeding initiation or duration of exclusive breast-feeding according to pre-pregnancy BMI were found. Moreover, GWG was not associated with any poor breast-feeding outcomes. The present study indicated that pre-pregnancy obesity increases the risks of delayed lactogenesis II and early termination of any breast-feeding in Chinese women.

Pre-colonial Ethnic Institutions and Contemporary African Development*

PubMed Central

Michalopoulos, Stelios; Papaioannou, Elias

2013-01-01

We investigate the role of deeply-rooted pre-colonial ethnic institutions in shaping comparative regional development within African countries. We combine information on the spatial distribution of ethnicities before colonization with regional variation in contemporary economic performance, as proxied by satellite images of light density at night. We document a strong association between pre-colonial ethnic political centralization and regional development. This pattern is not driven by differences in local geographic features or by other observable ethnic-specific cultural and economic variables. The strong positive association between pre-colonial political complexity and contemporary development obtains also within pairs of adjacent ethnic homelands with different legacies of pre-colonial political institutions. PMID:25089052

Downhole delay assembly for blasting with series delay

DOEpatents

Ricketts, Thomas E.

1982-01-01

A downhole delay assembly is provided which can be placed into a blasthole for initiation of explosive in the blasthole. The downhole delay assembly includes at least two detonating time delay devices in series in order to effect a time delay of longer than about 200 milliseconds in a round of explosions. The downhole delay assembly provides a protective housing to prevent detonation of explosive in the blasthole in response to the detonation of the first detonating time delay device. There is further provided a connection between the first and second time delay devices. The connection is responsive to the detonation of the first detonating time delay device and initiates the second detonating time delay device. A plurality of such downhole delay assemblies are placed downhole in unfragmented formation and are initiated simultaneously for providing a round of explosive expansions. The explosive expansions can be used to form an in situ oil shale retort containing a fragmented permeable mass of formation particles.

Prevalence of 16S rRNA methylase genes among β-lactamase-producing Enterobacteriaceae clinical isolates in Saudi Arabia

PubMed Central

Al Sheikh, Yazeed A.; Marie, Mohammed Ali M.; John, James; Krishnappa, Lakshmana Gowda; Dabwab, Khaled Homoud M.

2014-01-01

Background Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and β-Lactamase (blaTEM-1, blaSHV-12, blaCTX-M-14) genes, we screened all phenotypic positive β-Lactamase producing enterobacteriaceae by polymerase chain reaction (PCR) targeting above genes. A total of 330 enterobacteriaceae strains were collected during study period out of that 218 isolates were identified phenotypically as β-Lactamase producers, which include 50 (22.9%) Escherichia coli; 92 (42.2%) Klebsiella pneumoniae, 44 (20.2%), Citrobactor freundii and 32 (14.7%) Enterobacter spp. Results Among this 218, only 188 isolates harbored the resistant gene for β-Lactamase production. Major β-Lactamase producing isolates were bla TEM-1 type. 122 (56 %) isolates were found to produce any one of the 16S rRNA methylase genes. A total of 116 isolates co produced β-Lactamase and at least one 16S rRNA methylases gene Co production of armA gene was found in 26 isolates with rmtB and in 4 isolates with rmtC. The rmtA and rmtD genes were not detected in any of the tested isolates. Six isolates were positive for a 16S rRNA methylase gene alone. Conclusion β-Lactamase producing isolates appears to coexist with 16S rRNA methylase predominantly armA and rmtB genes in the same isolate. We conclude the major β-Lactamase and 16S rRNA methylases co-producer was K. pneumoniae followed by E. coli. We suggest further work on evaluating other β-lactamases types and novel antibiotic resistance mechanisms among Enterobacteriaceae. PMID:25005152

Effect of work intensity on time delay in mediation of ventilation by arterial carbon dioxide during recovery from impulse exercise.

PubMed

Afroundeh, R; Arimitsu, T; Yamanaka, R; Lian, C S; Shirakawa, K; Yunoki, T; Yano, T

2014-01-01

Time delay in the mediation of ventilation (V(.)E) by arterial CO(2) pressure (PaCO(2)) was studied during recovery from short impulse-like exercises with different work loads of recovery. Subjects performed two tests including 10-s impulse like exercise with work load of 200 watts and 15-min recovery with 25 watts in test one and 50 watts in test two. V(.)E, end tidal CO(2) pressure (PETCO(2)) and heart rate (HR) were measured continuously during rest, warming up, exercise and recovery. PaCO(2) was estimated from PETCO(2) and tidal volume (V(T)). Results showed that predicted arterial CO(2) pressure (PaCO(2 pre)) increased during recovery in both tests. In both tests, V(.)E increased and peaked at the end of exercise. V(.)E decreased in the first few seconds of recovery but started to increase again. The highest correlation coefficient between PaCO(2 pre) and V(.)E was obtained in the time delay of 7 s (r=0.854) in test one and in time delays of 6 s (r=0.451) and 31 s (r=0.567) in test two. HR was significantly higher in test two than in test one. These results indicate that PaCO(2 pre) drives V(.)E with a time delay and that higher work intensity induces a shorter time delay.

Bioluminescent symbionts of the Caribbean flashlight fish (Kryptophanaron alfredi) have a single rRNA operon.

PubMed

Wolfe, C J; Haygood, M G

1993-08-01

Ribosomal RNA (rRNA) operon copy number and gene order were determined for the luminous bacterial symbiont of Kryptophanaron alfredi, an anomalopid (flashlight) fish, and estimated for the luminous symbionts of 3 other fish families and of 3 luminous seawater isolates. Compared with the seawater isolates and other fish symbionts, the copy number of rRNA genes in the K. alfredi symbiont was radically reduced, although gene order appeared conserved among all the strains. The K. alfredi symbiont possesses only a single rRNA operon, whereas the other strains examined have minimum copy numbers ranging from 8 to 11. No difference in copy number was observed between light organ and seawater isolates of the same species, or between isolates of the same species from the light organs of 2 different host families. Thus, the anomalopid symbiosis appears unique among characterized light organ symbioses.

Community-based early intervention for language delay: a preliminary investigation.

PubMed

Ciccone, Natalie; Hennessey, Neville; Stokes, Stephanie F

2012-01-01

A trial parent-focused early intervention (PFEI) programme for children with delayed language development is reported in which current research evidence was translated and applied within the constraints of available of clinical resources. The programme, based at a primary school, was run by a speech-language pathologist with speech-language pathology students. To investigate the changes in child language development and parent and child interactions following attendance at the PFEI. Eighteen parents and their children attended six, weekly group sessions in which parents were provided with strategies to maximize language learning in everyday contexts. Pre- and post-programme assessments of vocabulary size and measures of parent-child interaction were collected. Parents and children significantly increased their communicative interactions from pre- to post-treatment. Children's expressive vocabulary size and language skills increased significantly. Large-effect sizes were observed. The positive outcomes of the intervention programme contribute to the evidence base of intervention strategies and forms of service delivery for children at risk of language delay. © 2012 Royal College of Speech and Language Therapists.

Shear Wave Splitting analysis of borehole microseismic reveals weak azimuthal anisotropy hidden behind strong VTI fabric of Lower Paleozoic shales in northern Poland

NASA Astrophysics Data System (ADS)

Gajek, Wojciech; Verdon, James; Malinowski, Michał; Trojanowski, Jacek

2017-04-01

Azimuthal anisotropy plays a key-role in hydraulic fracturing experiments, since it provides information on stress orientation and pre-existing fracture system presence. The Lower Paleozoic shale plays in northern Poland are characterized by a strong (15-18%) Vertical Transverse Isotropy (VTI) fabric which dominates weak azimuthal anisotropy being of order of 1-2%. A shear wave travelling in the subsurface after entering an anisotropic medium splits into two orthogonally polarized waves travelling with different velocities. Splitting parameters which can be assessed using a microseismic array are polarization of the fast shear wave and time delay between two modes. Polarization of the fast wave characterizes the anisotropic system on the wave path while the time delay is proportional to the magnitude of anisotropy. We employ Shear Wave Splitting (SWS) technique using a borehole microseismic dataset collected during a hydraulic stimulation treatment located in northern Poland, to image fracture strike masked by a strong VTI signature. During the inversion part, the VTI background parameters were kept constant using information from 3D seismic (VTI model used for pre-stack depth migration). Obtained fracture azimuths averaged over fracturing stages are consistent with the available XRMI imager logs from the nearby vertical well, however they are different from the large-scale maximum stress direction (by 40-45 degrees). Inverted Hudson's crack density (ca. 2%) are compatible with the low shear-wave anisotropy observed in the cross-dipole sonic logs (1-2%). This work has been funded by the Polish National Centre for Research and Development within the Blue Gas project (No BG2/SHALEMECH/14). Data were provided by the PGNiG SA. Collaboration with University of Bristol was supported within TIDES COST Action ES1401.

Delayed-onset PTSD among war veterans: the role of life events throughout the life cycle.

PubMed

Horesh, Danny; Solomon, Z; Zerach, G; Ein-Dor, T

2011-09-01

The underlying mechanisms of delayed-onset PTSD are yet to be understood. This study examines the role of stressful life events throughout the life cycle in delayed-onset PTSD following combat. 675 Israeli veterans from the 1982 Lebanon War, 369 with antecedent combat stress reaction (CSR) and 306 without CSR were assessed prospectively, 1, 2 and 20 years after the war. Veterans were divided into four groups, according to the time of first PTSD onset (first onset at 1983, 1984, and 2002 and no PTSD onset). They were assessed for post-, peri- and pre-traumatic life events, as well as military and socio-demographic characteristics. Our findings indicate that shorter delays in PTSD onset were associated with a higher risk for CSR, a higher number of pre- and post-war life events, more severe subjective battle exposure, greater perceived danger during combat and a more stressful military position. CSR was found to be the most powerful predictor of PTSD onset. A recency effect was also found, with more recent life events proving to be stronger predictors of PTSD onset. First, our findings validate the existence of delayed-onset PTSD, as it was found among a substantial number of participants (16.5%). Second, post-, peri- and pre-traumatic life events are associated with the time of PTSD onset. Thus, practitioners and researchers are encouraged to examine not only the original trauma, but also the stressful experiences throughout the survivors' life cycle. In particular, identification of antecedent CSR may help mental help professionals in targeting high-risk populations.

Choice between delayed food and immediate oxycodone in rats

PubMed Central

Secci, Maria E.; Factor, Julie A.; Schindler, Charles W.; Panlilio, Leigh V.

2016-01-01

Rationale The choice to seek immediate drug effects instead of more meaningful but delayed rewards is a defining feature of addiction. Objectives To develop a rodent model of this behavior, we allowed rats to choose between immediate intravenous delivery of the prescription opioid oxycodone (50 μg/kg) and delayed delivery of palatable food pellets. Results Rats preferred food at delays up to 30 s, but they chose oxycodone and food equally at 60-s delay and preferred oxycodone over food at 120-s delay. Comparison of food-drug choice, food-only, and drug-only conditions indicated that food availability decreased drug intake, but drug availability increased food intake. In the food-only condition, food was effective as a reinforcer even when delayed by 120 s. Pre-session feeding with chow slowed acquisition of food and drug self-administration, but did not affect choice. To establish procedures for testing potential anti-addiction medications, noncontingent pretreatment with oxycodone or naltrexone (analogous to substitution and antagonist therapies, respectively) were tested on a baseline in which oxycodone was preferred over delayed food. Naltrexone pretreatment decreased drug intake and increased food intake. Oxycodone pretreatment decreased drug intake, but also produced extended periods with no food or drug responding. Conclusions These findings show that the contingencies that induce preference for drugs over more meaningful but less immediate rewards in humans can be modeled in rodents, and they suggest that the model could be useful for assessing the therapeutic potential of treatments and exploring the underlying behavioral and neural mechanisms involved in addiction. PMID:27678551

Temporal-contextual processing in working memory: evidence from delayed cued recall and delayed free recall tests.

PubMed

Loaiza, Vanessa M; McCabe, David P

2012-02-01

Three experiments are reported that addressed the nature of processing in working memory by investigating patterns of delayed cued recall and free recall of items initially studied during complex and simple span tasks. In Experiment 1, items initially studied during a complex span task (i.e., operation span) were more likely to be recalled after a delay in response to temporal-contextual cues, relative to items from subspan and supraspan list lengths in a simple span task (i.e., word span). In Experiment 2, items initially studied during operation span were more likely to be recalled from neighboring serial positions during delayed free recall than were items studied during word span trials. Experiment 3 demonstrated that the number of attentional refreshing opportunities strongly predicts episodic memory performance, regardless of whether the information is presented in a spaced or massed format in a modified operation span task. The results indicate that the content-context bindings created during complex span trials reflect attentional refreshing opportunities that are used to maintain items in working memory.

IDENTIFYING ANOMALIES IN GRAVITATIONAL LENS TIME DELAYS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Congdon, Arthur B.; Keeton, Charles R.; Nordgren, C. Erik, E-mail: acongdon@jpl.nasa.go, E-mail: keeton@physics.rutgers.ed, E-mail: nordgren@sas.upenn.ed

2010-02-01

We examine the ability of gravitational lens time delays to reveal complex structure in lens potentials. In a previous paper, we predicted how the time delay between the bright pair of images in a 'fold' lens scales with the image separation, for smooth lens potentials. Here we show that the proportionality constant increases with the quadrupole moment of the lens potential, and depends only weakly on the position of the source along the caustic. We use Monte Carlo simulations to determine the range of time delays that can be produced by realistic smooth lens models consisting of isothermal ellipsoid galaxiesmore » with tidal shear. We can then identify outliers as 'time delay anomalies'. We find evidence for anomalies in close image pairs in the cusp lenses RX J1131 - 1231 and B1422+231. The anomalies in RX J1131 - 1231 provide strong evidence for substructure in the lens potential, while at this point the apparent anomalies in B1422+231 mainly indicate that the time delay measurements need to be improved. We also find evidence for time delay anomalies in larger-separation image pairs in the fold lenses, B1608+656 and WFI 2033 - 4723, and the cusp lens RX J0911+0551. We suggest that these anomalies are caused by some combination of substructure and a complex lens environment. Finally, to assist future monitoring campaigns we use our smooth models with shear to predict the time delays for all known four-image lenses.« less

The nucleotide sequence of the entire ribosomal DNA operon and the structure of the large subunit rRNA of Giardia muris.

PubMed

van Keulen, H; Gutell, R R; Campbell, S R; Erlandsen, S L; Jarroll, E L

1992-10-01

The total nucleotide sequence of the rDNA of Giardia muris, an intestinal protozoan parasite of rodents, has been determined. The repeat unit is 7668 basepairs (bp) in size and consists of a spacer of 3314 bp, a small-subunit rRNA (SSU-rRNA) gene of 1429, and a large-subunit rRNA (LSU-rRNA) gene of 2698 bp. The spacer contains long direct repeats and is heterogeneous in size. The LSU-rRNA of G. muris was compared to that of the human intestinal parasite Giardia duodenalis, to the bird parasite Giardia ardeae, and to that of Escherichia coli. The LSU-rRNA has a size comparable to the 23S rRNA of E. coli but shows structural features typical for eukaryotes. Some variable regions are typically small and account for the overall smaller size of this rRNA. The structure of the G. muris LSU-rRNA is similar to that of the other Giardia rRNA, but each rRNA has characteristic features residing in a number of variable regions.

Methanosarcina acetivorans 16S rRNA and transcription factor nucleotide fluctuation with implications in exobiology and pathology

NASA Astrophysics Data System (ADS)

Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Marchese, P.; Hiciano, O.; Yao, H.; Lieberman, D.; Cheung, T.

2008-08-01

Cultures of the methane-producing archaea Methanosarcina, have recently been isolated from Alaskan sediments. It has been proposed that methanogens are strong candidates for exobiological life in extreme conditions. The spatial environmental gradients, such as those associated with the polygons on Mars' surface, could have been produced by past methanogenesis activity. The 16S rRNA gene has been used routinely to classify phenotypes. Using the fractal dimension of nucleotide fluctuation, a comparative study of the 16S rRNA nucleotide fluctuation in Methanosarcina acetivorans C2A, Deinococcus radiodurans, and E. coli was conducted. The results suggest that Methanosarcina acetivorans has the lowest fractal dimension, consistent with its ancestral position in evolution. Variation in fluctuation complexity was also detected in the transcription factors. The transcription factor B (TFB) was found to have a higher fractal dimension as compared to transcription factor E (TFE), consistent with the fact that a single TFB in Methanosarcina acetivorans can code three different TATA box proteins. The average nucleotide pair-wise free energy of the DNA repair genes was found to be highest for Methanosarcina acetivorans, suggesting a relatively weak bonding, which is consistent with its low prevalence in pathology. Multitasking capacity comparison of type-I and type-II topoisomerases has been shown to correlate with fractal dimension using the methicillin-resistant strain MRSA 252. The analysis suggests that gene adaptation in a changing chemical environment can be measured in terms of bioinformatics. Given that the radiation resistant Deinococcus radiodurans is a strong candidate for an extraterrestrial origin and that the cold temperature Psychrobacter cryohalolentis K5 can function in Siberian permafrost, the fractal dimension comparison in this study suggests that a chemical resistant methanogen could exist in extremely cold conditions (such as that which existed on early

Rates and delay times of Type Ia supernovae in the helium-enriched main-sequence donor scenario

NASA Astrophysics Data System (ADS)

Liu, Zheng-Wei; Stancliffe, Richard J.

2018-04-01

The nature of the progenitors of Type Ia supernovae (SNe Ia) remains a mystery. Comparing theoretical rates and delay-time distributions of SNe Ia with those inferred observationally can constrain their progenitor models. In this work, taking thermohaline mixing into account in the helium-enriched main-sequence (HEMS) donor scenario, we address rates and delay times of SNe Ia in this channel by combining the results of self-consistent binary evolution calculations with population synthesis models. We find that the Galactic SN Ia rate from the HEMS donor scenario is around 0.6-1.2 × 10-3 yr-1, which is about 30 per cent of the observed rate. Delay times of SNe Ia in this scenario cover a wide range of 0.1-1.0 Gyr. We also present the pre-explosion properties of companion stars in the HEMS donor scenario, which will be helpful for placing constraints on SN Ia progenitors through analysing their pre-explosion images.

Individual development of preschool children-prevalences and determinants of delays in Germany: a cross-sectional study in Southern Bavaria.

PubMed

Stich, Heribert L; Baune, Bernhard Th; Caniato, Riccardo N; Mikolajczyk, Rafael T; Krämer, Alexander

2012-12-05

Even minor abnormalities of early child development may have dramatic long term consequences. Accurate prevalence rates for a range of developmental impairments have been difficult to establish. Since related studies have used different methodological approaches, direct comparisons of the prevalence of developmental delays are difficult. The understanding of the key factors affecting child development, especially in preschool aged children remains limited. We used data from school entry examinations in Bavaria to measure the prevalence of developmental impairments in pre-school children beginning primary school in 1997-2009. The developmental impairments of all school beginners in the district of Dingolfing-Landau, Bavaria were assessed using modified "Bavarian School Entry Model" examination from 1997 to 2009 (N=13,182). The children were assessed for motor, cognitive, language and psychosocial impairments using a standardised medical protocol. Prevalence rates of impairments in twelve domains of development were estimated. Using uni- and multivariable logistic regression models, association between selected factors and development delays were assessed. The highest prevalence existed for impairments of pronunciation (13.8%) followed by fine motor impairments (12.2%), and impairments of memory and concentration (11.3%) and the lowest for impairments of rhythm of speech (3.1%). Younger children displayed more developmental delays. Male gender was strongly associated with all developmental impairments (highest risk for fine motor impairments = OR 3.22, 95% confidence interval 2.86-3.63). Preschool children with siblings (vs. children without any siblings) were at higher risk of having impairments in pronunciation (OR 1.31, 1.14-1.50). The influence of the non-German nationality was strong, with a maximum risk increase for the subareas of grammar and psychosocial development. Although children with non-German nationality had a reduced risk of disorders for the rhythm

Primer selection impacts specific population abundances but not community dynamics in a monthly time-series 16S rRNA gene amplicon analysis of coastal marine bacterioplankton.

PubMed

Wear, Emma K; Wilbanks, Elizabeth G; Nelson, Craig E; Carlson, Craig A

2018-03-09

Primers targeting the 16S small subunit ribosomal RNA marker gene, used to characterize bacterial and archaeal communities, have recently been re-evaluated for marine planktonic habitats. To investigate whether primer selection affects the ecological interpretation of bacterioplankton populations and community dynamics, amplicon sequencing with four primer sets targeting several hypervariable regions of the 16S rRNA gene was conducted on both mock communities constructed from cloned 16S rRNA genes and a time-series of DNA samples from the temperate coastal Santa Barbara Channel. Ecological interpretations of community structure (delineation of depth and seasonality, correlations with environmental factors) were similar across primer sets, while population dynamics varied. We observed substantial differences in relative abundances of taxa known to be poorly resolved by some primer sets, such as Thaumarchaeota and SAR11, and unexpected taxa including Roseobacter clades. Though the magnitude of relative abundances of common OTUs differed between primer sets, the relative abundances of the OTUs were nonetheless strongly correlated. We do not endorse one primer set but rather enumerate strengths and weaknesses to facilitate selection appropriate to a system or experimental goal. While 16S rRNA gene primer bias suggests caution in assessing quantitative population dynamics, community dynamics appear robust across studies using different primers. © 2018 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

NASA Technical Reports Server (NTRS)

Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

1992-01-01

16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria.

PubMed

Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan

2015-04-01

Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

PubMed Central

Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

2017-01-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

PubMed Central

Ciganda, Martin; Williams, Noreen

2012-01-01

P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

Delay Choice vs. Delay Maintenance: Different Measures of Delayed Gratification in Capuchin Monkeys (Cebus apella)

PubMed Central

Addessi, Elsa; Paglieri, Fabio; Beran, Michael J.; Evans, Theodore A.; Macchitella, Luigi; De Petrillo, Francesca; Focaroli, Valentina

2013-01-01

Delaying gratification involves two components: (i) delay choice (selecting a delayed reward over an immediate one), and (ii) delay maintenance (sustaining the decision to delay gratification even if the immediate reward is available during the delay). In primates, two tasks most commonly have explored these components, the Intertemporal choice task and the Accumulation task. It is unclear whether these tasks provide equivalent measures of delay of gratification. Here, we compared the performance of the same capuchin monkeys, belonging to two study populations, between these tasks. We found only limited evidence of a significant correlation in performance. Consequently, in contrast to what is often assumed, our data provide only partial support to the hypothesis that these tasks provide equivalent measures of delay of gratification. PMID:23544770

Pre-K as School Turnaround Strategy

ERIC Educational Resources Information Center

Buenafe, Anthony Q.

2011-01-01

Both state and local school systems, recognizing the strong and growing evidence of pre-kindergarten's effectiveness in closing achievement gaps, are implementing early learning programs as part of their education reform efforts. In low-performing districts, pre-k has emerged as a promising turnaround strategy, reaching children before they become…

International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

PubMed Central

Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

2015-01-01

This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

Modeling delay in genetic networks: From delay birth-death processes to delay stochastic differential equations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gupta, Chinmaya; López, José Manuel; Azencott, Robert

Delay is an important and ubiquitous aspect of many biochemical processes. For example, delay plays a central role in the dynamics of genetic regulatory networks as it stems from the sequential assembly of first mRNA and then protein. Genetic regulatory networks are therefore frequently modeled as stochastic birth-death processes with delay. Here, we examine the relationship between delay birth-death processes and their appropriate approximating delay chemical Langevin equations. We prove a quantitative bound on the error between the pathwise realizations of these two processes. Our results hold for both fixed delay and distributed delay. Simulations demonstrate that the delay chemicalmore » Langevin approximation is accurate even at moderate system sizes. It captures dynamical features such as the oscillatory behavior in negative feedback circuits, cross-correlations between nodes in a network, and spatial and temporal information in two commonly studied motifs of metastability in biochemical systems. Overall, these results provide a foundation for using delay stochastic differential equations to approximate the dynamics of birth-death processes with delay.« less

Comparison of 16S rRNA sequencing with biochemical testing for species-level identification of clinical isolates of Neisseria spp.

PubMed

Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia

2014-08-01

We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.

Cosmological test using strong gravitational lensing systems

NASA Astrophysics Data System (ADS)

Yuan, C. C.; Wang, F. Y.

2015-09-01

As one of the probes of universe, strong gravitational lensing systems allow us to compare different cosmological models and constrain vital cosmological parameters. This purpose can be reached from the dynamic and geometry properties of strong gravitational lensing systems, for instance, time-delay Δτ of images, the velocity dispersion σ of the lensing galaxies and the combination of these two effects, Δτ/σ2. In this paper, in order to carry out one-on-one comparisons between ΛCDM universe and Rh = ct universe, we use a sample containing 36 strong lensing systems with the measurement of velocity dispersion from the Sloan Lens Advanced Camera for Surveys (SLACS) and Lens Structure and Dynamic survey (LSD) survey. Concerning the time-delay effect, 12 two-image lensing systems with Δτ are also used. In addition, Monte Carlo simulations are used to compare the efficiency of the three methods as mentioned above. From simulations, we estimate the number of lenses required to rule out one model at the 99.7 per cent confidence level. Comparing with constraints from Δτ and the velocity dispersion σ, we find that using Δτ/σ2 can improve the discrimination between cosmological models. Despite the independence tests of these methods reveal a correlation between Δτ/σ2 and σ, Δτ/σ2 could be considered as an improved method of σ if more data samples are available.

Transcriptional analysis of nucleolar dominance in polyploid plants: Biased expression/silencing of progenitor rRNA genes is developmentally regulated in Brassica

PubMed Central

Chen, Z. Jeffrey; Pikaard, Craig S.

1997-01-01

Nucleolar dominance is an epigenetic phenomenon that describes the formation of nucleoli around rRNA genes inherited from only one parent in the progeny of an interspecific hybrid. Despite numerous cytogenetic studies, little is known about nucleolar dominance at the level of rRNA gene expression in plants. We used S1 nuclease protection and primer extension assays to define nucleolar dominance at a molecular level in the plant genus Brassica. rRNA transcription start sites were mapped in three diploids and in three allotetraploids (amphidiploids) and one allohexaploid species derived from these diploid progenitors. rRNA transcripts of only one progenitor were detected in vegetative tissues of each polyploid. Dominance was independent of maternal effect, ploidy, or rRNA gene dosage. Natural and newly synthesized amphidiploids yielded the same results, arguing against substantial evolutionary effects. The hypothesis that nucleolar dominance in plants is correlated with physical characteristics of rRNA gene intergenic spacers is not supported in Brassica. Furthermore, in Brassica napus, rRNA genes silenced in vegetative tissues were found to be expressed in all floral organs, including sepals and petals, arguing against the hypothesis that passage through meiosis is needed to reactivate suppressed genes. Instead, the transition of inflorescence to floral meristem appears to be a developmental stage when silenced genes can be derepressed. PMID:9096413

LKB1 promotes cell survival by modulating TIF-IA-mediated pre-ribosomal RNA synthesis under uridine downregulated conditions

PubMed Central

Liu, Xiuju; Huang, Henry; Wilkinson, Scott C.; Zhong, Diansheng; Khuri, Fadlo R.; Fu, Haian; Marcus, Adam; He, Yulong; Zhou, Wei

2016-01-01

We analyzed the mechanism underlying 5-aminoimidazole-4-carboxamide riboside (AICAR) mediated apoptosis in LKB1-null non-small cell lung cancer (NSCLC) cells. Metabolic profile analysis revealed depletion of the intracellular pyrimidine pool after AICAR treatment, but uridine was the only nucleotide precursor capable of rescuing this apoptosis, suggesting the involvement of RNA metabolism. Because half of RNA transcription in cancer is for pre-ribosomal RNA (rRNA) synthesis, which is suppressed by over 90% after AICAR treatment, we evaluated the role of TIF-IA-mediated rRNA synthesis. While the depletion of TIF-IA by RNAi alone promoted apoptosis in LKB1-null cells, the overexpression of a wild-type or a S636A TIF-IA mutant, but not a S636D mutant, attenuated AICAR-induced apoptosis. In LKB1-null H157 cells, pre-rRNA synthesis was not suppressed by AICAR when wild-type LKB1 was present, and cellular fractionation analysis indicated that TIF-IA quickly accumulated in the nucleus in the presence of a wild-type LKB1 but not a kinase-dead mutant. Furthermore, ectopic expression of LKB1 was capable of attenuating AICAR-induced death in AMPK-null cells. Because LKB1 promotes cell survival by modulating TIF-IA-mediated pre-rRNA synthesis, this discovery suggested that targeted depletion of uridine related metabolites may be exploited in the clinic to eliminate LKB1-null cancer cells. PMID:26506235

LKB1 promotes cell survival by modulating TIF-IA-mediated pre-ribosomal RNA synthesis under uridine downregulated conditions.

PubMed

Liu, Fakeng; Jin, Rui; Liu, Xiuju; Huang, Henry; Wilkinson, Scott C; Zhong, Diansheng; Khuri, Fadlo R; Fu, Haian; Marcus, Adam; He, Yulong; Zhou, Wei

2016-01-19

We analyzed the mechanism underlying 5-aminoimidazole-4-carboxamide riboside (AICAR) mediated apoptosis in LKB1-null non-small cell lung cancer (NSCLC) cells. Metabolic profile analysis revealed depletion of the intracellular pyrimidine pool after AICAR treatment, but uridine was the only nucleotide precursor capable of rescuing this apoptosis, suggesting the involvement of RNA metabolism. Because half of RNA transcription in cancer is for pre-ribosomal RNA (rRNA) synthesis, which is suppressed by over 90% after AICAR treatment, we evaluated the role of TIF-IA-mediated rRNA synthesis. While the depletion of TIF-IA by RNAi alone promoted apoptosis in LKB1-null cells, the overexpression of a wild-type or a S636A TIF-IA mutant, but not a S636D mutant, attenuated AICAR-induced apoptosis. In LKB1-null H157 cells, pre-rRNA synthesis was not suppressed by AICAR when wild-type LKB1 was present, and cellular fractionation analysis indicated that TIF-IA quickly accumulated in the nucleus in the presence of a wild-type LKB1 but not a kinase-dead mutant. Furthermore, ectopic expression of LKB1 was capable of attenuating AICAR-induced death in AMPK-null cells. Because LKB1 promotes cell survival by modulating TIF-IA-mediated pre-rRNA synthesis, this discovery suggested that targeted depletion of uridine related metabolites may be exploited in the clinic to eliminate LKB1-null cancer cells.

Microbial community profiling of fresh basil and pitfalls in taxonomic assignment of enterobacterial pathogenic species based upon 16S rRNA amplicon sequencing.

PubMed

Ceuppens, Siele; De Coninck, Dieter; Bottledoorn, Nadine; Van Nieuwerburgh, Filip; Uyttendaele, Mieke

2017-09-18

Application of 16S rRNA (gene) amplicon sequencing on food samples is increasingly applied for assessing microbial diversity but may as unintended advantage also enable simultaneous detection of any human pathogens without a priori definition. In the present study high-throughput next-generation sequencing (NGS) of the V1-V2-V3 regions of the 16S rRNA gene was applied to identify the bacteria present on fresh basil leaves. However, results were strongly impacted by variations in the bioinformatics analysis pipelines (MEGAN, SILVAngs, QIIME and MG-RAST), including the database choice (Greengenes, RDP and M5RNA) and the annotation algorithm (best hit, representative hit and lowest common ancestor). The use of pipelines with default parameters will lead to discrepancies. The estimate of microbial diversity of fresh basil using 16S rRNA (gene) amplicon sequencing is thus indicative but subject to biases. Salmonella enterica was detected at low frequencies, between 0.1% and 0.4% of bacterial sequences, corresponding with 37 to 166 reads. However, this result was dependent upon the pipeline used: Salmonella was detected by MEGAN, SILVAngs and MG-RAST, but not by QIIME. Confirmation of Salmonella sequences by real-time PCR was unsuccessful. It was shown that taxonomic resolution obtained from the short (500bp) sequence reads of the 16S rRNA gene containing the hypervariable regions V1-V3 cannot allow distinction of Salmonella with closely related enterobacterial species. In conclusion 16S amplicon sequencing, getting the status of standard method in microbial ecology studies of foods, needs expertise on both bioinformatics and microbiology for analysis of results. It is a powerful tool to estimate bacterial diversity but amenable to biases. Limitations concerning taxonomic resolution for some bacterial species or its inability to detect sub-dominant (pathogenic) species should be acknowledged in order to avoid overinterpretation of results. Copyright © 2017 Elsevier B

Spatio-temporal phenomena in complex systems with time delays

NASA Astrophysics Data System (ADS)

Yanchuk, Serhiy; Giacomelli, Giovanni

2017-03-01

Real-world systems can be strongly influenced by time delays occurring in self-coupling interactions, due to unavoidable finite signal propagation velocities. When the delays become significantly long, complicated high-dimensional phenomena appear and a simple extension of the methods employed in low-dimensional dynamical systems is not feasible. We review the general theory developed in this case, describing the main destabilization mechanisms, the use of visualization tools, and commenting on the most important and effective dynamical indicators as well as their properties in different regimes. We show how a suitable approach, based on a comparison with spatio-temporal systems, represents a powerful instrument for disclosing the very basic mechanism of long-delay systems. Various examples from different models and a series of recent experiments are reported.

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses.

PubMed

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses

PubMed Central

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the

Dollars and Sense: A Review of Economic Analyses of Pre-K. Pre-K Now Research Series

ERIC Educational Resources Information Center

Wat, Albert

2007-01-01

The momentum behind high-quality, voluntary pre-kindergarten is growing dramatically across the country--in families, in communities, and in the halls of academia and government. Thanks to this strong wave of support, state spending on pre-k increased from $2.4 billion to $4.2 billion nationwide between 2002 and 2007. This investment is built upon…

5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

PubMed

Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

2012-07-17

In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

Engineering fluidic delays in paper-based devices using laser direct-writing.

PubMed

He, P J W; Katis, I N; Eason, R W; Sones, C L

2015-10-21

We report the use of a new laser-based direct-write technique that allows programmable and timed fluid delivery in channels within a paper substrate which enables implementation of multi-step analytical assays. The technique is based on laser-induced photo-polymerisation, and through adjustment of the laser writing parameters such as the laser power and scan speed we can control the depth and/or the porosity of hydrophobic barriers which, when fabricated in the fluid path, produce controllable fluid delay. We have patterned these flow delaying barriers at pre-defined locations in the fluidic channels using either a continuous wave laser at 405 nm, or a pulsed laser operating at 266 nm. Using this delay patterning protocol we generated flow delays spanning from a few minutes to over half an hour. Since the channels and flow delay barriers can be written via a common laser-writing process, this is a distinct improvement over other methods that require specialist operating environments, or custom-designed equipment. This technique can therefore be used for rapid fabrication of paper-based microfluidic devices that can perform single or multistep analytical assays.

Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

NASA Astrophysics Data System (ADS)

Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

2011-10-01

Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

16S rRNA beacons for bacterial monitoring during human space missions.

PubMed

Larios-Sanz, Maia; Kourentzi, Katerina D; Warmflash, David; Jones, Jeffrey; Pierson, Duane L; Willson, Richard C; Fox, George E

2007-04-01

Microorganisms are unavoidable in space environments and their presence has, at times, been a source of problems. Concerns about disease during human space missions are particularly important considering the significant changes the immune system incurs during spaceflight and the history of microbial contamination aboard the Mir space station. Additionally, these contaminants may have adverse effects on instrumentation and life-support systems. A sensitive, highly specific system to detect, characterize, and monitor these microbial populations is essential. Herein we describe a monitoring approach that uses 16S rRNA targeted molecular beacons to successfully detect several specific bacterial groupings. This methodology will greatly simplify in-flight monitoring by minimizing sample handling and processing. We also address and provide solutions to target accessibility problems encountered in hybridizations that target 16S rRNA.

Dramatic robustness of a multiple delay dispersed interferometer to spectrograph errors: how mixing delays reduces or cancels wavelength drift

NASA Astrophysics Data System (ADS)

Erskine, David J.; Linder, E.; Wishnow, E.; Edelstein, J.; Sirk, M.; Muirhead, P.; Lloyd, J.; Kim, A.

2016-08-01

We describe demonstrations of remarkable robustness to instrumental noises by using a multiple delay externally dispersed interferometer (EDI) on stellar observations at the Hale telescope. Previous observatory EDI demonstrations used a single delay. The EDI (also called "TEDI") boosted the 2,700 resolution of the native TripleSpec NIR spectrograph (950-2450 nm) by as much as 10x to 27,000, using 7 overlapping delays up to 3 cm. We observed superb rejection of fixed pattern noises due to bad pixels, since the fringing signal responds only to changes in multiple exposures synchronous to the applied delay dithering. Remarkably, we observed a 20x reduction of reaction in the output spectrum to PSF shifts of the native spectrograph along the dispersion direction, using our standard processing. This allowed high resolution observations under conditions of severe and irregular PSF drift otherwise not possible without the interferometer. Furthermore, we recently discovered an improved method of weighting and mixing data between pairs of delays that can theoretically further reduce the net reaction to PSF drift to zero. We demonstrate a 350x reduction in reaction to a native PSF shift using a simple simulation. This technique could similarly reduce radial velocity noise for future EDI's that use two delays overlapped in delay space (or a single delay overlapping the native peak). Finally, we show an extremely high dynamic range EDI measurement of our ThAr lamp compared to a literature ThAr spectrum, observing weak features ( 0.001x height of nearest strong line) that occur between the major lines. Because of individuality of each reference lamp, accurate knowledge of its spectrum between the (unfortunately) sparse major lines is important for precision radial velocimetry.

Maturation delay for the predators can enhance stable coexistence for a class of prey-predator models.

PubMed

Banerjee, Malay; Takeuchi, Yasuhiro

2017-01-07

Maturation time delay for the predators is introduced in prey-predator models to implicitly model the stage-structure of predators. Most of the prey-predator models with maturation delay are known to exhibit destabilization of coexistence steady-state. Discrete time delay induced destabilization is a common finding, however, this is due to the introduction of time delay with lack of ecological justification. The main objective of the present work is to show the stabilizing role of maturation delay for a class of delayed prey-predator model. To be specific, we consider prey-predator models with strong and weak Allee effects in prey growth and Michaelis-Menten type functional response. We provide ecological justification for the introduction of maturation delay parameter in predator's growth equation. We obtain the conditions for stable and oscillatory coexistence of prey and their specialist predator in case of strong as well as weak Allee effect for non-delayed and delayed models. Apart from the analytical results for the models under consideration, we perform extensive numerical simulations to construct the relevant bifurcation diagrams. Our analytical and supportive numerical findings reveal that delay is not always a destabilizing factor rather the stable coexistence in the presence of time delay depends upon the formulation of the delayed model. The biological implications of the current investigation are provided in the conclusion section. We also explain the validity of obtained results for other types of prey-predator models with a specialist predator. Copyright © 2016 Elsevier Ltd. All rights reserved.

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

PubMed

Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

2017-04-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

PubMed

Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

2001-05-01

Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

PubMed Central

Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

2001-01-01

Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding. PMID:11350033

Programmable Differential Delay Circuit With Fine Delay Adjustment

DOEpatents

DeRyckere, John F.; Jenkins, Philip Nord; Cornett, Frank Nolan

2002-07-09

Circuitry that provides additional delay to early arriving signals such that all data signals arrive at a receiving latch with same path delay. The delay of a forwarded clock reference is also controlled such that the capturing clock edge will be optimally positioned near quadrature (depending on latch setup/hold requirements). The circuitry continuously adapts to data and clock path delay changes and digital filtering of phase measurements reduce errors brought on by jittering data edges. The circuitry utilizes only the minimum amount of delay necessary to achieve objective thereby limiting any unintended jitter. Particularly, this programmable differential delay circuit with fine delay adjustment is designed to allow the skew between ASICS to be minimized. This includes skew between data bits, between data bits and clocks as well as minimizing the overall skew in a channel between ASICS.

Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

PubMed

Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

2014-05-04

The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

When good pigeons make bad decisions: Choice with probabilistic delays and outcomes.

PubMed

Pisklak, Jeffrey M; McDevitt, Margaret A; Dunn, Roger M; Spetch, Marcia L

2015-11-01

Pigeons chose between an (optimal) alternative that sometimes provided food after a 10-s delay and other times after a 40-s delay and another (suboptimal) alternative that sometimes provided food after 10 s but other times no food after 40 s. When outcomes were not signaled during the delays, pigeons strongly preferred the optimal alternative. When outcomes were signaled, choices of the suboptimal alternative increased and most pigeons preferred the alternative that provided no food after the long delay despite the cost in terms of obtained food. The pattern of results was similar whether the short delays occurred on 25% or 50% of the trials. Shortening the 40-s delay to food sharply reduced suboptimal choices, but shortening the delay to no food had little effect. The results suggest that a signaled delay to no food does not punish responding in probabilistic choice procedures. The findings are discussed in terms of conditioned reinforcement by signals for good news. © Society for the Experimental Analysis of Behavior.

Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

PubMed

Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

2015-11-13

To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

Beyond Presence: Epistemological and Pedagogical Implications of "Strong" Emergence

ERIC Educational Resources Information Center

Osberg, Deborah; Biesta, Gert J. J.

2007-01-01

In this paper we argue that the notion of strong emergence offers a challenge to the idea, currently dominant in schooling, that knowledge somehow relates to a pre-existing world, present in itself. We do this first by providing an account of strong emergence, showing how it brings into question the assumption of determinism. Following this we…

The Role of 16S rRNA Gene Sequencing in Identification of Microorganisms Misidentified by Conventional Methods

PubMed Central

Petti, C. A.; Polage, C. R.; Schreckenberger, P.

2005-01-01

Traditional methods for microbial identification require the recognition of differences in morphology, growth, enzymatic activity, and metabolism to define genera and species. Full and partial 16S rRNA gene sequencing methods have emerged as useful tools for identifying phenotypically aberrant microorganisms. We report on three bacterial blood isolates from three different College of American Pathologists-certified laboratories that were referred to ARUP Laboratories for definitive identification. Because phenotypic identification suggested unusual organisms not typically associated with the submitted clinical diagnosis, consultation with the Medical Director was sought and further testing was performed including partial 16S rRNA gene sequencing. All three patients had endocarditis, and conventional methods identified isolates from patients A, B, and C as a Facklamia sp., Eubacterium tenue, and a Bifidobacterium sp. 16S rRNA gene sequencing identified the isolates as Enterococcus faecalis, Cardiobacterium valvarum, and Streptococcus mutans, respectively. We conclude that the initial identifications of these three isolates were erroneous, may have misled clinicians, and potentially impacted patient care. 16S rRNA gene sequencing is a more objective identification tool, unaffected by phenotypic variation or technologist bias, and has the potential to reduce laboratory errors. PMID:16333109

Lack of WDR36 leads to preimplantation embryonic lethality in mice and delays the formation of small subunit ribosomal RNA in human cells in vitro.

PubMed

Gallenberger, Martin; Meinel, Dominik M; Kroeber, Markus; Wegner, Michael; Milkereit, Philipp; Bösl, Michael R; Tamm, Ernst R

2011-02-01

Mutations in WD repeat domain 36 gene (WDR36) play a causative role in some forms of primary open-angle glaucoma, a leading cause of blindness worldwide. WDR36 is characterized by the presence of multiple WD40 repeats and shows homology to Utp21, an essential protein component of the yeast small subunit (SSU) processome required for maturation of 18S rRNA. To clarify the functional role of WDR36 in the mammalian organism, we generated and investigated mutant mice with a targeted deletion of Wdr36. In parallel experiments, we used RNA interference to deplete WDR36 mRNA in mouse embryos and cultured human trabecular meshwork (HTM-N) cells. Deletion of Wdr36 in the mouse caused preimplantation embryonic lethality, and essentially similar effects were observed when WDR36 mRNA was depleted in mouse embryos by RNA interference. Depletion of WDR36 mRNA in HTM-N cells caused apoptotic cell death and upregulation of mRNA for BAX, TP53 and CDKN1A. By immunocytochemistry, staining for WDR36 was observed in the nucleolus of cells, which co-localized with that of nucleolar proteins such as nucleophosmin and PWP2. In addition, recombinant and epitope-tagged WDR36 localized to the nucleolus of HTM-N cells. By northern blot analysis, a substantial decrease in 21S rRNA, the precursor of 18S rRNA, was observed following knockdown of WDR36. In addition, metabolic-labeling experiments consistently showed a delay of 18S rRNA maturation in WDR36-depleted cells. Our results provide evidence that WDR36 is an essential protein in mammalian cells which is involved in the nucleolar processing of SSU 18S rRNA.

Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

PubMed

Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

2017-03-17

The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Delayed plumage maturation and delayed reproductive investment in birds.

PubMed

Hawkins, Gerard L; Hill, Geoffrey E; Mercadante, Austin

2012-05-01

Delayed plumage maturation is the delayed acquisition of a definitive colour and pattern of plumage until after the first potential breeding period in birds. Here we provide a comprehensive overview of the numerous studies of delayed plumage maturation and a revised theoretical framework for understanding the function of delayed plumage maturation in all birds. We first distinguish between hypotheses that delayed plumage maturation is attributable to a moult constraint with no adaptive function and hypotheses that propose that delayed plumage maturation is a component of an adaptive life-history strategy associated with delayed reproductive investment. We then recognize three potential benefits of delayed plumage maturation: crypsis, mimicry and status signaling. Evidence suggests that delayed plumage maturation is not a consequence of developmental constraints and instead represents a strategy to maximize reproductive success in circumstances where young adults cannot effectively compete with older adults for limited resources, particularly breeding opportunities. A multi-factorial explanation that takes into account lifespan and the degree of competition for limited breeding resources and that combines the benefits of an inconspicuous appearance with the benefits of honest signaling of reduced competitiveness provides a general explanation for the function of delayed plumage maturation in most bird species. Delayed plumage maturation should be viewed as a component of alternative reproductive strategies that can include delay in both plumage and sexual development. Such strategies are frequently facultative, with individuals breeding prior to the acquisition of definitive plumages when conditions are favourable. Presumably, the benefits of delayed plumage maturation ultimately enhance lifetime reproductive success, and studying delayed plumage maturation within the context of lifetime reproductive success should be a goal of future studies. © 2011 The Authors

Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

PubMed

Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

2004-10-15

This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

Delayed electron emission in strong-field driven tunnelling from a metallic nanotip in the multi-electron regime

PubMed Central

Yanagisawa, Hirofumi; Schnepp, Sascha; Hafner, Christian; Hengsberger, Matthias; Kim, Dong Eon; Kling, Matthias F.; Landsman, Alexandra; Gallmann, Lukas; Osterwalder, Jürg

2016-01-01

Illuminating a nano-sized metallic tip with ultrashort laser pulses leads to the emission of electrons due to multiphoton excitations. As optical fields become stronger, tunnelling emission directly from the Fermi level becomes prevalent. This can generate coherent electron waves in vacuum leading to a variety of attosecond phenomena. Working at high emission currents where multi-electron effects are significant, we were able to characterize the transition from one regime to the other. Specifically, we found that the onset of laser-driven tunnelling emission is heralded by the appearance of a peculiar delayed emission channel. In this channel, the electrons emitted via laser-driven tunnelling emission are driven back into the metal, and some of the electrons reappear in the vacuum with some delay time after undergoing inelastic scattering and cascading processes inside the metal. Our understanding of these processes gives insights on attosecond tunnelling emission from solids and should prove useful in designing new types of pulsed electron sources. PMID:27786287

Determinants of hospital-to-nursing home placement delays: a pilot study.

PubMed Central

Weissert, W G; Cready, C M

1988-01-01

Estimates of hospital-to-nursing home placement delays have always been varied, and given Medicare's new Prospective Payment System (PPS) based on diagnosis-related groups (DRGs), they are likely to have changed again. Theory and previous research suggest that four patient characteristics are the main causes of delays: Medicaid as the patient's nursing home payer source; need for heavy care due to major physical or mental problems; admission to the hospital from a nursing home; and lack of social support. A pilot study of all 1,016 elderly awaiting nursing home placement in two admission cohorts (pre- and post-PPS) from the three largest hospitals in the county surrounding Charlotte, North Carolina--where nursing home beds are in short supply--indicates that other factors are more important. While most placements were delayed, delays were short. Multiple regression results show that Medicaid patients' delays were only about a day longer than those of private-pay patients. Of the many heavy-care conditions studied, only three were associated with delay. Patients without social support and patients admitted from a nursing home, discharged to a hospital-affiliated facility, or placed after PPS had shorter delays. Long delays were found among patients who had applied for Medicaid coverage but had not yet been certified as financially eligible. Nonwhites and males were also delayed. These findings, if replicated in other areas with perceived nursing home bed shortages, appear to have important implications not only for the usefulness of nursing home case-mix reimbursement and subacute levels of nursing home care, but for nursing home bed-need estimates, too, as well as for Medicaid eligibility determination practices and civil rights law enforcement. PMID:3060449

Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

PubMed Central

Dron, M; Rahire, M; Rochaix, J D

1982-01-01

The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA.

PubMed

Röder, Christoph; König, Helmut; Fröhlich, Jürgen

2007-09-01

Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.

Reliability and synchronization in a delay-coupled neuronal network with synaptic plasticity

NASA Astrophysics Data System (ADS)

Pérez, Toni; Uchida, Atsushi

2011-06-01

We investigate the characteristics of reliability and synchronization of a neuronal network of delay-coupled integrate and fire neurons. Reliability and synchronization appear in separated regions of the phase space of the parameters considered. The effect of including synaptic plasticity and different delay values between the connections are also considered. We found that plasticity strongly changes the characteristics of reliability and synchronization in the parameter space of the coupling strength and the drive amplitude for the neuronal network. We also found that delay does not affect the reliability of the network but has a determinant influence on the synchronization of the neurons.

16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

PubMed

Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

2013-12-01

Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.

Coherent control of strong-field two-pulse ionization of Rydberg atoms.

PubMed

Fedorov, M; Poluektov, N

2000-02-28

Strong-field ionization of Rydberg atoms is investigated in its dependence on phase features of the initial coherent population of Rydberg levels. In the case of a resonance between Rydberg levels and some lower-energy atomic level (V-type transitions), this dependence is shown to be very strong: by a proper choice of the initial population an atom can be made either completely or very little ionized by a strong laser pulse. It is shown that phase features of the initial coherent population of Rydberg levels and the ionization yield can be efficiently controlled in a scheme of ionization by two strong laser pulses with a varying delay time between them.

Analytical approximate solutions for a general class of nonlinear delay differential equations.

PubMed

Căruntu, Bogdan; Bota, Constantin

2014-01-01

We use the polynomial least squares method (PLSM), which allows us to compute analytical approximate polynomial solutions for a very general class of strongly nonlinear delay differential equations. The method is tested by computing approximate solutions for several applications including the pantograph equations and a nonlinear time-delay model from biology. The accuracy of the method is illustrated by a comparison with approximate solutions previously computed using other methods.

Effective Desynchronization by Nonlinear Delayed Feedback

NASA Astrophysics Data System (ADS)

Popovych, Oleksandr V.; Hauptmann, Christian; Tass, Peter A.

2005-04-01

We show that nonlinear delayed feedback opens up novel means for the control of synchronization. In particular, we propose a demand-controlled method for powerful desynchronization, which does not require any time-consuming calibration. Our technique distinguishes itself by its robustness against variations of system parameters, even in strongly coupled ensembles of oscillators. We suggest our method for mild and effective deep brain stimulation in neurological diseases characterized by pathological cerebral synchronization.

Growth properties associated with A-U replacement of specific G-C base pairs in 16S rRNA from Escherichia coli.

PubMed Central

Triman, K L

1995-01-01

Mutations that disrupt each of seven specific G-C base pairs in 16S rRNA from Escherichia coli confer loss of expression of a plasmid-encoded 16S rRNA selectable marker (spectinomycin resistance). However, A-U replacement of G-C base pairs at nucleotides 359/52 or 1292/1245 in 16S rRNA permits normal expression of the marker. By contrast, A-U replacements at 146/176, 153/168, 350/339, or 1293/1244 are associated with loss of expression of the marker. These genetic studies are designed to determine the importance of specific base pairs by assessment of the structural and functional impairments of 16S rRNA molecules resulting from expression of base pair substitutions at these positions. PMID:7543481

Clinical research for delayed hemorrhage after endoscopic sphincterotomy

PubMed Central

Wang, Yundong; Han, Zhen; Niu, Xiaoping; Jia, Yuliang; Yuan, Heming; Zhang, Guozheng; He, Chiyi

2015-01-01

To analyze the effect of delayed hemorrhage after endoscopic sphincterotomy (EST) and compare the efficacy in improving complication between medicine treatment alone and medicine combined with endoscopic treatment. 1741 patients with EST admitted in Yijishan hospital of Wannan medical college from September 2009 to May 2014 were enrolled in this study. 32 cases suffered from delayed hemorrhage. The patients with delayed hemorrhage were evaluated through incision length of duodenal papilla, clinical manifestation, stool occult blood test and the difference of hemoglobin concentration between pre and post operation. 32 patients were divided into mild bleeding group, mild serious group and serious group through the speed and amount of bleeding. All cases in mild group accepted medicine treatment. Mild serious group were divided into medicine therapy group and medicine combined with endoscopic therapy group randomly. Serious group accepted vascular intervention therapy even traditional operation. The different treatments for delayed hemorrhage were judged by efficiency. The dates were analyzed by t-test or chi-square test. Nobody endured delayed hemorrhage who accepted small incision. Delayed hemorrhage was found in 7 patients out of 627 cases who accepted medium-large incision, 25 patients of 920 cases who accepted large incision. The patients who accepted lager EST were more dangerous than small EST (χ2=4.718, P=0.030) concerning delayed hemorrhage. 32 cases in 1741 patients suffered from delayed hemorrhage. 14 patients only have passed black stool after EST. Among 14 cases, 13 patients stop bleeding after medical therapy, and 1 case received endoscopic hemostasis. 15 cases with hematemesis or melena after EST, 7 patients who received combination therapy stop bleeding. 3 patients from 8 cases stop bleeding after single chemical treatment, 5 cases had to receive endoscopic hemostasis after ineffectual medical therapy. There are significant difference for concerning

Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

PubMed Central

Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina

2015-01-01

To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

Studies of the quenching phenomenon in delayed contact hypersensitivity reactions.

PubMed

Basketter, D A; Allenby, C F

1991-09-01

Studies in guinea pig and man have shown that eugenol can quench non-specifically contact urticarial responses, whereas limonene seems largely ineffective. In a comprehensive series of studies, there was little evidence of quenching of delayed contact hypersensitivity reactions to cinnamic aldehyde or citral, including in 'pre-quenched' material supplied by a perfume/flavour company, and in a similar mixture prepared in this laboratory, in the guinea pig model. In addition, there was no evidence of the quenching by eugenol of allergic reactions to cinnamic aldehyde in a panel of human subjects with a proven history of cinnamic-aldehyde-induced allergic contact dermatitis. Overall, the results lend little credibility to earlier literature reports of quenching phenomena in delayed contact hypersensitivity responses.

Suppression of cocaine self-administration in monkeys: effects of delayed punishment.

PubMed

Woolverton, William L; Freeman, Kevin B; Myerson, Joel; Green, Leonard

2012-04-01

Delaying presentation of a drug can decrease its effectiveness as a reinforcer, but the effect of delaying punishment of drug self-administration is unknown. This study examined whether a histamine injection could punish cocaine self-administration in a drug-drug choice, whether delaying histamine would decrease its effectiveness, and whether the effects of delay could be described within a delay discounting framework. Monkeys were implanted with double-lumen catheters to allow separate injection of cocaine and histamine. In discrete trials, subjects first chose between cocaine (50 or 100 μg/kg/inj) alone and an injection of the same dose of cocaine followed immediately by an injection of histamine (0.37-50 μg/kg). Next, they chose between cocaine followed immediately by histamine and cocaine followed by an equal but delayed dose of histamine. When choosing between cocaine alone and cocaine followed immediately by histamine, preference increased with histamine dose from indifference to >80% choice of cocaine alone. When choosing between cocaine followed by immediate histamine and cocaine followed by delayed histamine, monkeys showed strong position preferences. When delayed histamine was associated with the nonpreferred position, preference for that option increased with delay from ≤30% to >85%. The corresponding decrease in choice of the preferred position was well described by a hyperboloid discounting function. Histamine can function as a punisher in the choice between injections of cocaine and delay can decrease its effectiveness as a punisher. The effects of delaying punishment of drug self-administration can be conceptualized within the delay discounting framework.

Effects of wrapping time delays on the nutritive value of baled alfalfa silages

USDA-ARS?s Scientific Manuscript database

Baled silages are an attractive forage conservation option, especially for small and mid-sized beef and dairy producers. Our objectives were to test the effects of delayed wrapping on the nutritive value of baled alfalfa silages on a pre- and post-storage basis. A secondary objective was to evaluate...

Detection and identification of bacteria in clinical samples by 16S rRNA gene sequencing: comparison of two different approaches in clinical practice.

PubMed

Jenkins, Claire; Ling, Clare L; Ciesielczuk, Holly L; Lockwood, Julianne; Hopkins, Susan; McHugh, Timothy D; Gillespie, Stephen H; Kibbler, Christopher C

2012-04-01

Amplification and sequence analysis of the 16S rRNA gene can be applied to detect and identify bacteria in clinical samples. We examined 75 clinical samples (17 culture-positive, 58 culture-negative) prospectively by two different PCR protocols, amplifying either a single fragment (1343 bp) or two fragments (762/598 bp) of the 16S rRNA gene. The 1343 bp PCR and 762/598 bp PCRs detected and identified the bacterial 16S rRNA gene in 23 (31 %) and 38 (51 %) of the 75 samples, respectively. The 1343 bp PCR identified 19 of 23 (83 %) PCR-positive samples to species level while the 762/598 bp PCR identified 14 of 38 (37 %) bacterial 16S rRNA gene fragments to species level and 24 to the genus level only. Amplification of shorter fragments of the bacterial 16S rRNA gene (762 and 598 bp) resulted in a more sensitive assay; however, analysis of a large fragment (1343 bp) improved species discrimination. Although not statistically significant, the 762/598 bp PCR detected the bacterial 16S rRNA gene in more samples than the 1343 bp PCR, making it more likely to be a more suitable method for the primary detection of the bacterial 16S rRNA gene in the clinical setting. The 1343 bp PCR may be used in combination with the 762/598 bp PCR when identification of the bacterial rRNA gene to species level is required.

Strong seismic wave scattering beneath Kanto region derived from dense K-NET/KiK-net strong motion network and numerical simulation

NASA Astrophysics Data System (ADS)

Takemura, S.; Yoshimoto, K.

2013-12-01

Observed seismograms, which consist of the high-frequency body waves through the low-velocity (LV) region at depth of 20-40 km beneath northwestern Chiba in Kanto, show strong peak delay and spindle shape of S waves. By analyzing dense seismic records from K-NET/KiK-net, such spindle-shape S waves are clearly observed in the frequency range of 1-8 Hz. In order to investigate a specific heterogeneous structure to generate such observations, we conduct 3-D finite-difference method (FDM) simulation using realistic heterogeneous models and compare the simulation results with dense strong motion array observations. Our 3-D simulation model is covering the zone 150 km by 64 km in horizontal directions and 75 km in vertical direction, which has been discretized with uniform grid size 0.05 km. We assume a layered background velocity structure, which includes basin structure, crust, mantle and subducting oceanic plate, base on the model proposed by Koketsu et al. (2008). In order to introduce the effect of seismic wave scattering, we assume a stochastic random velocity fluctuation in each layer. Random velocity fluctuations are characterized by exponential-type auto-correlation function (ACF) with correlation distance a = 3 km and rms value of fluctuation e = 0.05 in the upper crust, a = 3 km and e = 0.07 in the lower crust, a = 10 km and e = 0.02 in the mantle. In the subducting oceanic plate, we assume an anisotropic random velocity fluctuation characterized by exponential-type ACF with aH = 10 km in horizontal direction, aZ = 0.5 km in vertical direction and e = 0.02 (e.g., Furumura and Kennett, 2005). In addition, we assume a LV zone at northeastern part of Chiba with depth of 20-40 km (e.g., Matsubara et al., 2004). In the LV zone, random velocity fluctuation characterized by Gaussian-type ACF with a = 1 km and e = 0.07 is superposed on exponential-type ACF with a = 3 km and e = 0.07, in order to modulate the S-wave propagation in the dominant frequency range of

Salinity inhibits post transcriptional processing of chloroplast 16S rRNA in shoot cultures of jojoba (Simmondsia chinesis).

PubMed

Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

2005-03-01

Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.

Adaptive Pre-FFT Equalizer with High-Precision Channel Estimator for ISI Channels

NASA Astrophysics Data System (ADS)

Yoshida, Makoto

We present an attractive approach for OFDM transmission using an adaptive pre-FFT equalizer, which can select ICI reduction mode according to channel condition, and a degenerated-inverse-matrix-based channel estimator (DIME), which uses a cyclic sinc-function matrix uniquely determined by transmitted subcarriers. In addition to simulation results, the proposed system with an adaptive pre-FFT equalizer and DIME has been laboratory tested by using a software defined radio (SDR)-based test bed. The simulation and experimental results demonstrated that the system at a rate of more than 100Mbps can provide a bit error rate of less than 10-3 for a fast multi-path fading channel that has a moving velocity of more than 200km/h with a delay spread of 1.9µs (a maximum delay path of 7.3µs) in the 5-GHz band.

Movement Exploration as a Technique for Teaching Pre-Swimming Skills to Students with Developmental Delays.

ERIC Educational Resources Information Center

Buis, Joyce M.; Schane, Catherine S.

1980-01-01

Background, rationale, and techniques for using movement exploration to teach preswimming skills to developmentally delayed persons are given. Objectives (beyond the primary one of safety) of such a program include body awareness, spatial awareness, movement, and perceptual motor functions. Guidelins for activity selection and adaptation are…

Optimisation of 16S rRNA gut microbiota profiling of extremely low birth weight infants.

PubMed

Alcon-Giner, Cristina; Caim, Shabhonam; Mitra, Suparna; Ketskemety, Jennifer; Wegmann, Udo; Wain, John; Belteki, Gusztav; Clarke, Paul; Hall, Lindsay J

2017-11-02

Infants born prematurely, particularly extremely low birth weight infants (ELBW) have altered gut microbial communities. Factors such as maternal health, gut immaturity, delivery mode, and antibiotic treatments are associated with microbiota disturbances, and are linked to an increased risk of certain diseases such as necrotising enterocolitis. Therefore, there is a requirement to optimally characterise microbial profiles in this at-risk cohort, via standardisation of methods, particularly for studying the influence of microbiota therapies (e.g. probiotic supplementation) on community profiles and health outcomes. Profiling of faecal samples using the 16S rRNA gene is a cost-efficient method for large-scale clinical studies to gain insights into the gut microbiota and additionally allows characterisation of cohorts were sample quantities are compromised (e.g. ELBW infants). However, DNA extraction method, and the 16S rRNA region targeted can significantly change bacterial community profiles obtained, and so confound comparisons between studies. Thus, we sought to optimise a 16S rRNA profiling protocol to allow standardisation for studying ELBW infant faecal samples, with or without probiotic supplementation. Using ELBW faecal samples, we compared three different DNA extraction methods, and subsequently PCR amplified and sequenced three hypervariable regions of the 16S rRNA gene (V1 + V2 + V3), (V4 + V5) and (V6 + V7 + V8), and compared two bioinformatics approaches to analyse results (OTU and paired end). Paired shotgun metagenomics was used as a 'gold-standard'. Results indicated a longer bead-beating step was required for optimal bacterial DNA extraction and that sequencing regions (V1 + V2 + V3) and (V6 + V7 + V8) provided the most representative taxonomic profiles, which was confirmed via shotgun analysis. Samples sequenced using the (V4 + V5) region were found to be underrepresented in specific taxa including Bifidobacterium, and had

Efficient rejection-based simulation of biochemical reactions with stochastic noise and delays

NASA Astrophysics Data System (ADS)

Thanh, Vo Hong; Priami, Corrado; Zunino, Roberto

2014-10-01

We propose a new exact stochastic rejection-based simulation algorithm for biochemical reactions and extend it to systems with delays. Our algorithm accelerates the simulation by pre-computing reaction propensity bounds to select the next reaction to perform. Exploiting such bounds, we are able to avoid recomputing propensities every time a (delayed) reaction is initiated or finished, as is typically necessary in standard approaches. Propensity updates in our approach are still performed, but only infrequently and limited for a small number of reactions, saving computation time and without sacrificing exactness. We evaluate the performance improvement of our algorithm by experimenting with concrete biological models.

Efficient rejection-based simulation of biochemical reactions with stochastic noise and delays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thanh, Vo Hong, E-mail: vo@cosbi.eu; Priami, Corrado, E-mail: priami@cosbi.eu; Department of Mathematics, University of Trento

2014-10-07

We propose a new exact stochastic rejection-based simulation algorithm for biochemical reactions and extend it to systems with delays. Our algorithm accelerates the simulation by pre-computing reaction propensity bounds to select the next reaction to perform. Exploiting such bounds, we are able to avoid recomputing propensities every time a (delayed) reaction is initiated or finished, as is typically necessary in standard approaches. Propensity updates in our approach are still performed, but only infrequently and limited for a small number of reactions, saving computation time and without sacrificing exactness. We evaluate the performance improvement of our algorithm by experimenting with concretemore » biological models.« less

Precise measurement of ultra-narrow laser linewidths using the strong coherent envelope

NASA Astrophysics Data System (ADS)

Huang, Shihong; Zhu, Tao; Liu, Min; Huang, Wei

2017-02-01

Laser linewidth narrowing down to kHz or even Hz is an important topic in areas like clock synchronization technology, laser radars, quantum optics, and high-precision detection. Conventional decoherence measurement methods like delayed self-heterodyne/homodyne interferometry cannot measure such narrow linewidths accurately. This is because a broadening of the Gaussian spectrum, which hides the laser’s intrinsic Lorentzian linewidth, cannot be avoided. Here, we introduce a new method using the strong coherent envelope to characterize the laser’s intrinsic linewidth through self-coherent detection. This method can eliminate the effect of the broadened Gaussian spectrum induced by the 1/f frequency noise. We analyze, in detail, the relationship between intrinsic laser linewidth, contrast difference with the second peak and the second trough (CDSPST) of the strong coherent envelope, and the length of the delaying fiber. The correct length for the delaying fiber can be chosen by combining the estimated laser linewidth (Δfest) with a specific CDSPST (ΔS) to obtain the accurate laser linewidth (Δf). Our results indicate that this method can be used as an accurate detection tool for measurements of narrow or super-narrow linewidths.

Location of rRNA transcription to the nucleolar components: disappearance of the fibrillar centers in nucleoli of regenerating rat hepatocytes.

PubMed

Montanaro, Lorenzo; Govoni, Marzia; Orrico, Catia; Treré, Davide; Derenzini, Massimo

2011-01-01

The precise location of rDNA transcription to the components of mammalian cell nucleolus is still debated. This was due to the fact that all the molecules necessary for rRNA synthesis are located in two of the three components, the fibrillar centers (FCs) and the dense fibrillar component (DFC), which together with the granular component (GC) are considered to be constantly present in mammalian cell nucleoli. In the present study we demonstrated that in nucleoli of many regenerating rat hepatocytes at 15 h after partial hepatectomy the FCs were no longer present, only the DFC and the GC being detected. At this time of regeneration the rRNA transcriptional activity was three fold that of resting hepatocytes, while the synthesis of DNA was not yet significantly increased, indicating that these nucleolar changes were due to the rRNA synthesis up-regulation. The DFC appeared to be organized in numerous, small, roundish tufts of fibrils. The silver staining procedure for AgNOR proteins, which are associated with the ribosomal genes, selectively and homogeneously stained these fibrillar tufts. Immuno-gold visualization of the Upstream Binding Factor (UBF), which is associated with the promoter region and the transcribed portion of the rRNA 45S gene, demonstrated that UBF was selectively located in the fibrillar tufts. We concluded that in proliferating rat hepatocytes the increased synthesis of rRNA induced an activation of the rRNA transcription machinery located in the fibrillar centers which, by becoming associated with the ribonucleoprotein transcripts, assumed the morphological pattern of the DFC.

Directed hydroxyl radical probing of the rRNA neighborhood of ribosomal protein S13 using tethered Fe(II).

PubMed Central

Heilek, G M; Noller, H F

1996-01-01

Directed hydroxyl radical probing was used to probe the rRNA neighborhood around protein S13 in the 30S ribosomal subunit. The unique cysteine at position 84 of S13 served as a tethering site for attachment of Fe(II)-1-(p-bromoacetamidobenzyl)-EDTA. Derivatized S13 (Fe-C84-S13) was then assembled into 30S ribosomal subunits by in vitro reconstitution with 16S rRNA and a mixture of the remaining 30S subunit proteins. Hydroxyl radicals generated from the tethered Fe(II) resulted in cleavage of the RNA backbone in two localized regions of the 3' major domain of 16S rRNA. One region spans nt 1308-1333 and is close to a site previously crosslinked to S13. A second set of cleavages is found in the 950/1230 helix. Both regions have been implicated in binding of S13 by previous chemical footprinting studies using base-specific chemical probes and solution-based hydroxyl radical probing. These results place both regions of 16S rRNA in proximity to position C84 of S13 in the three-dimensional structure of the 30S ribosomal subunit. PMID:8718688

Approximate controllability of a system of parabolic equations with delay

NASA Astrophysics Data System (ADS)

Carrasco, Alexander; Leiva, Hugo

2008-09-01

In this paper we give necessary and sufficient conditions for the approximate controllability of the following system of parabolic equations with delay: where [Omega] is a bounded domain in , D is an n×n nondiagonal matrix whose eigenvalues are semi-simple with nonnegative real part, the control and B[set membership, variant]L(U,Z) with , . The standard notation zt(x) defines a function from [-[tau],0] to (with x fixed) by zt(x)(s)=z(t+s,x), -[tau][less-than-or-equals, slant]s[less-than-or-equals, slant]0. Here [tau][greater-or-equal, slanted]0 is the maximum delay, which is supposed to be finite. We assume that the operator is linear and bounded, and [phi]0[set membership, variant]Z, [phi][set membership, variant]L2([-[tau],0];Z). To this end: First, we reformulate this system into a standard first-order delay equation. Secondly, the semigroup associated with the first-order delay equation on an appropriate product space is expressed as a series of strongly continuous semigroups and orthogonal projections related with the eigenvalues of the Laplacian operator (); this representation allows us to reduce the controllability of this partial differential equation with delay to a family of ordinary delay equations. Finally, we use the well-known result on the rank condition for the approximate controllability of delay system to derive our main result.

Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing

PubMed Central

Tourlousse, Dieter M.; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro

2017-01-01

Abstract High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. PMID:27980100

A Systematic Evaluation of Blood Serum and Plasma Pre-Analytics for Metabolomics Cohort Studies

PubMed Central

Jobard, Elodie; Trédan, Olivier; Postoly, Déborah; André, Fabrice; Martin, Anne-Laure; Elena-Herrmann, Bénédicte; Boyault, Sandrine

2016-01-01

The recent thriving development of biobanks and associated high-throughput phenotyping studies requires the elaboration of large-scale approaches for monitoring biological sample quality and compliance with standard protocols. We present a metabolomic investigation of human blood samples that delineates pitfalls and guidelines for the collection, storage and handling procedures for serum and plasma. A series of eight pre-processing technical parameters is systematically investigated along variable ranges commonly encountered across clinical studies. While metabolic fingerprints, as assessed by nuclear magnetic resonance, are not significantly affected by altered centrifugation parameters or delays between sample pre-processing (blood centrifugation) and storage, our metabolomic investigation highlights that both the delay and storage temperature between blood draw and centrifugation are the primary parameters impacting serum and plasma metabolic profiles. Storing the blood drawn at 4 °C is shown to be a reliable routine to confine variability associated with idle time prior to sample pre-processing. Based on their fine sensitivity to pre-analytical parameters and protocol variations, metabolic fingerprints could be exploited as valuable ways to determine compliance with standard procedures and quality assessment of blood samples within large multi-omic clinical and translational cohort studies. PMID:27929400

Correlation study of real delay time and imaginary delay time in 1-dimensional weak disorder optical media

NASA Astrophysics Data System (ADS)

Sahay, Peeyush; Almabadi, Huda M.; Pradhan, Prabhakar

Real delay time (τr) provides a measure of the time spent by photons inside an optical system. The measurement of τr is conducted in terms of energy (E) derivative of the Wigner phase delay (φ) , as τr = dϕ / dE dϕ / cdk k and c represents wavenumber and the speed of light, respectively. The characterization of τr requires interferometric system to measure φ of the light waves scattering from the medium [ R =√{ r} exp (- iϕ) ]. We investigated the possibility of extracting the τr information from the intensity measurement of the backscattered waves. The study was performed on a 1D model of weak disordered optical system and short sample length by numerically evaluating the backscattered light intensity. An imaginary delay time (τi) , defined as τi = dθ / cdk , where θ represents an `imaginary phase', was obtained upon expressing the backscattered intensity as RR* =| R | 2 = r = exp (- θ) . The result shows a strong correlation between r and φ with τr and τi exhibiting similar statistical distribution but with a shift. The magnitude and variation of the mean and std values of τr, and the std values of τi with sample lengths are nearly the same, which indicates about one parameter theory of delay time. This work potentially paves way for extracting phase information from the intensity distribution without using interferometric systems.

The mass-sheet degeneracy and time-delay cosmography: analysis of the strong lens RXJ1131-1231

DOE Office of Scientific and Technical Information (OSTI.GOV)

Birrer, Simon; Amara, Adam; Refregier, Alexandre, E-mail: simon.birrer@phys.ethz.ch, E-mail: adam.amara@phys.ethz.ch, E-mail: alexandre.refregier@phys.ethz.ch

We present extended modelling of the strong lens system RXJ1131-1231 with archival data in two HST bands in combination with existing line-of-sight contribution and velocity dispersion estimates. Our focus is on source size and its influence on time-delay cosmography. We therefore examine the impact of mass-sheet degeneracy and especially the degeneracy pointed out by Schneider and Sluse (2013) [1] using the source reconstruction scale. We also extend on previous work by further exploring the effects of priors on the kinematics of the lens and the external convergence in the environment of the lensing system. Our results coming from RXJ1131-1231 aremore » given in a simple analytic form so that they can be easily combined with constraints coming from other cosmological probes. We find that the choice of priors on lens model parameters and source size are subdominant for the statistical errors for H {sub 0} measurements of this systems. The choice of prior for the source is sub-dominant at present (2% uncertainty on H {sub 0}) but may be relevant for future studies. More importantly, we find that the priors on the kinematic anisotropy of the lens galaxy have a significant impact on our cosmological inference. When incorporating all the above modeling uncertainties, we find H {sub 0} = 86.6{sup +6.8}{sub -6.9} km s{sup -1} Mpc{sup -1}, when using kinematic priors similar to other studies. When we use a different kinematic prior motivated by Barnabè et al. (2012) [2] but covering the same anisotropic range, we find H {sub 0} = 74.5{sup +8.0}{sub -7.8} km s{sup -1} Mpc{sup -1}. This means that the choice of kinematic modeling and priors have a significant impact on cosmographic inferences. The way forward is either to get better velocity dispersion measures which would down weight the impact of the priors or to construct physically motivated priors for the velocity dispersion model.« less

Delayed seizures after intracerebral haemorrhage

PubMed Central

Rattani, Abbas; Anderson, Christopher D.; Ayres, Alison M.; Gurol, Edip M.; Greenberg, Steven M.; Rosand, Jonathan; Viswanathan, Anand

2016-01-01

.2%). Factors associated with delayed seizures included cortical involvement on index haemorrhage (hazard ratio 1.63, P = 0.036), pre-haemorrhage dementia (hazard ratio 1.36, P = 0.044), history of multiple prior lobar haemorrhages (hazard ratio 2.50, P = 0.038), exclusively lobar microbleeds (hazard ratio 2.22, P = 0.008) and presence of ≥ 1 APOE ε4 copies (hazard ratio 1.95, P = 0.020). Delayed seizures were associated with worse long-term functional outcome (hazard ratio 1.83, P = 0.005), but the association was removed by adjusting for neuroimaging and genetic markers of cerebral small vessel disease. Delayed seizures after intracerebral haemorrhage are associated with different risk factors, when compared to recurrent seizures. They are also associated with worse functional outcome, but this finding appears to be related to underlying small vessel disease. Further investigations into the connections between small vessel disease and delayed seizures are warranted. PMID:27497491

Angiographic delay: a viable alternative to surgical delay.

PubMed

Aboutanos, Sharline Z; Spinos, Efstathios; Blanchet, Nadia P

2012-06-01

Selective embolization of the inferior epigastric arteries can serve as a method for transverse rectus abdominis musculocutaneous (TRAM) flap delay. The purpose of this study was to determine whether delay by selective arterial embolization is comparable to traditionally surgically delayed TRAM flaps as reported in the literature, in terms of skin and fat necrosis, and to examine whether certain risk factors play a role in TRAM flap fat necrosis despite angiographic delay. Retrospective chart review was performed for 88 consecutive patients who underwent unilateral TRAM flap breast reconstruction after selective embolization of bilateral inferior epigastric arteries. Between 1997 and 2009, 88 pedicled TRAM flaps were performed for breast reconstruction in women with a mean age of 49.7 years. No patients had flap skin necrosis or total flap loss. In all, 13.6% patients had TRAM flap fat necrosis. Two patients in the TRAM fat necrosis group (16.7%) had a positive history of smoking, which was a statistically significant risk factor for necrosis (P = 0.048). Outcomes of pedicled TRAM flaps delayed by selective arterial embolization are comparable to historical controls of those delayed by traditional surgical means (ligation of artery and vein) and better than nondelayed flaps. Smoking remains a significant risk factor for TRAM flap fat necrosis despite the benefit of delay.

A comparative study of COI and 16 S rRNA genes for DNA barcoding of cultivable carps in India.

PubMed

Mohanty, Mausumee; Jayasankar, Pallipuram; Sahoo, Lakshman; Das, Paramananda

2015-02-01

The 5' region of the mitochondrial DNA gene cytochrome c oxidase subunit I (COI) is the standard marker for DNA barcoding. However, 16 S rRNA has also been advocated for DNA barcoding in many animal species. Herein, we directly compare the usefulness of COI and 16 S rRNA in discriminating six cultivable carp species: Labeo rohita, Catla catla, Cirrhinus mrigala, Labeo fimbriatus, Labeo bata and Cirrhinus reba from India. Analysis of partial sequences of these two gene fragments from 171 individuals indicated close genetic relationship between Catla catla and Labeo rohita. The results of the present study indicated COI to be more useful than 16 S rRNA for DNA barcoding of Indian carps.

Trading Later Rewards for Current Pleasure: Pornography Consumption and Delay Discounting.

PubMed

Negash, Sesen; Sheppard, Nicole Van Ness; Lambert, Nathaniel M; Fincham, Frank D

2016-01-01

Internet pornography is a multi-billion-dollar industry that has grown increasingly accessible. Delay discounting involves devaluing larger, later rewards in favor of smaller, more immediate rewards. The constant novelty and primacy of sexual stimuli as particularly strong natural rewards make Internet pornography a unique activator of the brain's reward system, thereby having implications for decision-making processes. Based on theoretical studies of evolutionary psychology and neuroeconomics, two studies tested the hypothesis that consuming Internet pornography would relate to higher rates of delay discounting. Study 1 used a longitudinal design. Participants completed a pornography use questionnaire and a delay discounting task at Time 1 and then again four weeks later. Participants reporting higher initial pornography use demonstrated a higher delay discounting rate at Time 2, controlling for initial delay discounting. Study 2 tested for causality with an experimental design. Participants were randomly assigned to abstain from either their favorite food or pornography for three weeks. Participants who abstained from pornography use demonstrated lower delay discounting than participants who abstained from their favorite food. The finding suggests that Internet pornography is a sexual reward that contributes to delay discounting differently than other natural rewards. Theoretical and clinical implications of these studies are highlighted.

Suppression of Cocaine Self-Administration in Monkeys: Effects of Delayed Punishment

PubMed Central

Woolverton, William L.; Freeman, Kevin B.; Myerson, Joel; Green, Leonard

2014-01-01

Rationale Delaying presentation of a drug can decrease its effectiveness as a reinforcer, but the effect of delaying punishment of drug self-administration is unknown. Objective This study examined whether a histamine injection could punish cocaine self-administration in a drug-drug choice, whether delaying histamine would decrease its effectiveness, and whether the effects of delay could be described within a delay discounting framework. Methods Monkeys were implanted with double-lumen catheters to allow separate injection of cocaine and histamine. In discrete trials, subjects first chose between cocaine (50 or 100 μg/kg/inj) alone and an injection of the same dose of cocaine followed immediately by an injection of histamine (0.37–50 μg/kg). Next, they chose between cocaine followed immediately by histamine and cocaine followed by an equal but delayed dose of histamine. Results When choosing between cocaine alone and cocaine followed immediately by histamine, preference increased with histamine dose from indifference to > 80% choice of cocaine alone. When choosing between cocaine followed by immediate histamine and cocaine followed by delayed histamine, monkeys showed strong position preferences. When delayed histamine was associated with the non-preferred position, preference for that option increased with delay from ≤ 30% to > 85%. The corresponding decrease in choice of the preferred position was well described by a hyperboloid discounting function. Conclusions Histamine can function as a punisher in the choice between injections of cocaine and delay can decrease its effectiveness as a punisher. The effects of delaying punishment of drug self-administration can be conceptualized within the delay discounting framework. PMID:21956240

Simulation analysis of the effect of initial delay on flight delay diffusion

NASA Astrophysics Data System (ADS)

Que, Zufu; Yao, Hongguang; Yue, Wei

2018-01-01

The initial delay of the flight is an important factor affecting the spread of flight delays, so clarifying their relationship conduces to control flight delays in the aeronautical network. Through establishing a model of the chain aviation network and making simulation analysis of the effects of initial delay on the delay longitudinal diffusion, it’s found that the number of delayed airports in the air network, the total delay time and the average delay time of the delayed airport are generally positively correlated with the initial delay. This indicates that the occurrence of the initial delay should be avoided or reduced as much as possible to improve the punctuality of the flight.

Stability and delay sensitivity of neutral fractional-delay systems.

PubMed

Xu, Qi; Shi, Min; Wang, Zaihua

2016-08-01

This paper generalizes the stability test method via integral estimation for integer-order neutral time-delay systems to neutral fractional-delay systems. The key step in stability test is the calculation of the number of unstable characteristic roots that is described by a definite integral over an interval from zero to a sufficient large upper limit. Algorithms for correctly estimating the upper limits of the integral are given in two concise ways, parameter dependent or independent. A special feature of the proposed method is that it judges the stability of fractional-delay systems simply by using rough integral estimation. Meanwhile, the paper shows that for some neutral fractional-delay systems, the stability is extremely sensitive to the change of time delays. Examples are given for demonstrating the proposed method as well as the delay sensitivity.

Modified RNA-seq method for microbial community and diversity analysis using rRNA in different types of environmental samples

PubMed Central

Yan, Yong-Wei; Zou, Bin; Zhu, Ting; Hozzein, Wael N.

2017-01-01

RNA-seq-based SSU (small subunit) rRNA (ribosomal RNA) analysis has provided a better understanding of potentially active microbial community within environments. However, for RNA-seq library construction, high quantities of purified RNA are typically required. We propose a modified RNA-seq method for SSU rRNA-based microbial community analysis that depends on the direct ligation of a 5’ adaptor to RNA before reverse-transcription. The method requires only a low-input quantity of RNA (10–100 ng) and does not require a DNA removal step. The method was initially tested on three mock communities synthesized with enriched SSU rRNA of archaeal, bacterial and fungal isolates at different ratios, and was subsequently used for environmental samples of high or low biomass. For high-biomass salt-marsh sediments, enriched SSU rRNA and total nucleic acid-derived RNA-seq datasets revealed highly consistent community compositions for all of the SSU rRNA sequences, and as much as 46.4%-59.5% of 16S rRNA sequences were suitable for OTU (operational taxonomic unit)-based community and diversity analyses with complete coverage of V1-V2 regions. OTU-based community structures for the two datasets were also highly consistent with those determined by all of the 16S rRNA reads. For low-biomass samples, total nucleic acid-derived RNA-seq datasets were analyzed, and highly active bacterial taxa were also identified by the OTU-based method, notably including members of the previously underestimated genus Nitrospira and phylum Acidobacteria in tap water, members of the phylum Actinobacteria on a shower curtain, and members of the phylum Cyanobacteria on leaf surfaces. More than half of the bacterial 16S rRNA sequences covered the complete region of primer 8F, and non-coverage rates as high as 38.7% were obtained for phylum-unclassified sequences, providing many opportunities to identify novel bacterial taxa. This modified RNA-seq method will provide a better snapshot of diverse

Delayed Hospital Presentation in Acute Decompensated Heart Failure: Clinical and Patient Reported Factors

PubMed Central

Darling, Chad; Saczynski, Jane S.; McManus, David D.; Lessard, Darleen; Spencer, Frederick A.; Goldberg, Robert J.

2013-01-01

Background Patients with acute decompensated heart failure (ADHF) often wait a considerable amount of time before going to the hospital. Prior studies have examined the reasons why such delays may occur, but additional studies are needed to identify modifiable factors contributing to these delays. Purpose To describe care-seeking delay times, factors associated with prolonged delay, and patient's thoughts and actions in adult men and women hospitalized with ADHF. Methods We surveyed 1,271 patients hospitalized with ADHF at 8 urban medical centers between 2007 and 2010. Results The average age of our study population was 73 years, 47% were female, and 72% had prior heart failure. The median duration of pre-hospital delay prior to hospital presentation was 5.3 hours. Patients who delayed longer than the median were older, more likely to have diabetes, peripheral edema, to have symptoms that began in the afternoon, and to have contacted their medical provider(s) about their symptoms. Prolonged care seekers were less likely to have attributed their symptoms to ADHF, less likely to want to have bothered their doctor or family, and were more likely to be concerned about missing work due to their illness (all p values<0.05). Conclusions Care-seeking delays are common among patients with ADHF. A variety of factors contribute to these delays which in some cases may represent efforts to manage ADHF symptoms at home. More research is needed to better understand the detrimental effects of these delays and how best to encourage timely care-seeking behavior in the setting of ADHF. PMID:23474108

Comparison of plastid 16S rRNA (rrn16) genes from Helicosporidium spp.: evidence supporting the reclassification of Helicosporidia as green algae (Chlorophyta).

PubMed

Tartar, Aurélien; Boucias, Drion G; Becnel, James J; Adams, Byron J

2003-11-01

The Helicosporidia are invertebrate pathogens that have recently been identified as non-photosynthetic green algae (Chlorophyta). In order to confirm the algal nature of the genus Helicosporidium, the presence of a retained chloroplast genome in Helicosporidia cells was investigated. Fragments homologous to plastid 16S rRNA (rrn16) genes were amplified successfully from cellular DNA extracted from two different Helicosporidium isolates. The fragment sequences are 1269 and 1266 bp long, are very AT-rich (60.7 %) and are similar to homologous genes sequenced from non-photosynthetic green algae. Maximum-parsimony, maximum-likelihood and neighbour-joining methods were used to infer phylogenetic trees from an rrn16 sequence alignment. All trees depicted the Helicosporidia as sister taxa to the non-photosynthetic, pathogenic alga Prototheca zopfii. Moreover, the trees identified Helicosporidium spp. as members of a clade that included the heterotrophic species Prototheca spp. and the mesotrophic species Chlorella protothecoides. The clade is always strongly supported by bootstrap values, suggesting that all these organisms share a most recent common ancestor. Phylogenetic analyses inferred from plastid 16S rRNA genes confirmed that the Helicosporidia are non-photosynthetic green algae, close relatives of the genus Prototheca (Chlorophyta, Trebouxiophyceae). Such phylogenetic affinities suggest that Helicosporidium spp. are likely to possess Prototheca-like organelles and organelle genomes.

Cochlear implant outcomes in children with motor developmental delay.

PubMed

Amirsalari, Susan; Yousefi, Jaleh; Radfar, Shokofeh; Saburi, Amin; Tavallaie, Seyed Abbas; Hosseini, Mohammad Javad; Noohi, Sima; Hassan Alifard, Mahdieh; Ajallouyean, Mohammad

2012-01-01

Multiple handicapped children and children with syndromes and conditions resulting additional disabilities such as cerebral palsy, global developmental delay and autistic spectrum disorder, are now not routinely precluded from receiving a cochlear implant. The primary focus of this study was to determine the effect of cochlear implants on the speech perception and intelligibility of deaf children with and without motor development delay. In a cohort study, we compared cochlear implant outcomes in two groups of deaf children with or without motor developmental delay (MDD). Among 262 children with pre-lingual profound hearing loss, 28 (10%) had a motor delay based on Gross Motor Function Classification (GMFC). Children with severe motor delays (classification scale levels 4 and 5) and cognitive delays were excluded. All children completed the Categories of Auditory Perception Scales (CAP) and Speech Intelligibility Rating (SIR) prior to surgery and 24 months after the device was activated. The mean age for the study population was 4.09 ± 1.86 years. In all 262 patients the mean CAP score after surgery (5.38 ± 0.043) had a marked difference in comparison with the mean score before surgery (0.482 ± 0.018) (P=0.001). The mean CAP score after surgery for MDD children was 5.03, and was 5.77 for normal motor development children (NMD). The mean SIR score after surgery for MDD children was 2.53, and was 2.66 for NMD children. The final results of CAP and SIR did not have significant difference between NMD children versus MDD children (P>0.05). Regarding to the result, we concluded that children with hearing loss and concomitant MDD as an additional disabilities can benefit from cochlear implantation similar to those of NMD. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Continuous and lurching traveling pulses in neuronal networks with delay and spatially decaying connectivity

PubMed Central

Golomb, David; Ermentrout, G. Bard

1999-01-01

Propagation of discharges in cortical and thalamic systems, which is used as a probe for examining network circuitry, is studied by constructing a one-dimensional model of integrate-and-fire neurons that are coupled by excitatory synapses with delay. Each neuron fires only one spike. The velocity and stability of propagating continuous pulses are calculated analytically. Above a certain critical value of the constant delay, these pulses lose stability. Instead, lurching pulses propagate with discontinuous and periodic spatio-temporal characteristics. The parameter regime for which lurching occurs is strongly affected by the footprint (connectivity) shape; bistability may occur with a square footprint shape but not with an exponential footprint shape. For strong synaptic coupling, the velocity of both continuous and lurching pulses increases logarithmically with the synaptic coupling strength gsyn for an exponential footprint shape, and it is bounded for a step footprint shape. We conclude that the differences in velocity and shape between the front of thalamic spindle waves in vitro and cortical paroxysmal discharges stem from their different effective delay; in thalamic networks, large effective delay between inhibitory neurons arises from their effective interaction via the excitatory cells which display postinhibitory rebound. PMID:10557346

Pre-treatment with antibiotics and Escherichia coli to equalize the gut microbiota in conventional mice.

PubMed

Linninge, Caroline; Ahrné, Siv; Molin, Göran

2015-01-01

The composition of the gut microbiota can vary widely between individual mice of the same batch and thereby affect the resulting outcome in experimental studies. Therefore, an efficient method is needed to equalize the gut microbiota prior to the start of critical experiments. In order to minimize variations in gut microbiota between animals and provide the animals with a Gram-negative flora exposing lipopolysaccharides in the cell-walls, C57BL/6 mice were given a mixture of ampicillin, metronidazole and clindamycin in the drinking water for 3 days and then Escherichia coli for two additional days. Treatment with antibiotics alone or with antibiotics in combination with E. coli was well tolerated by all animals. Body weight and liver weight were not affected, although higher hepatic fat content was found in treated animals (p < 0.05). The diversity of the gut microbiota was strongly reduced in animals treated with antibiotics and antibiotics in combination with E. coli (p < 0.01), without affecting the total amount of bacteria. Cloned and sequenced 16S rRNA genes showed high presence of Enterobacteriaceae and Porphymonadaceae in the treated animals. Analysis with Principal Component Analysis gave a clear separation of the composition in microbiota between different treatment groups. The described treatment efficiently equalized the gut microbiota and provided the animals with a strong abundance of Enterobacteriaceae without changing the total load of bacteria. This is a straightforward, lenient and efficient method of pre-treatment to equalize the gut microbiota of mice as a starting procedure of animal studies.

Strong field gravitational lensing by a charged Galileon black hole

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Shan-Shan; Xie, Yi, E-mail: clefairy035@163.com, E-mail: yixie@nju.edu.cn

Strong field gravitational lensings are dramatically disparate from those in the weak field by representing relativistic images due to light winds one to infinity loops around a lens before escaping. We study such a lensing caused by a charged Galileon black hole, which is expected to have possibility to evade no-hair theorem. We calculate the angular separations and time delays between different relativistic images of the charged Galileon black hole. All these observables can potentially be used to discriminate a charged Galileon black hole from others. We estimate the magnitudes of these observables for the closest supermassive black hole Sgrmore » A*. The strong field lensing observables of the charged Galileon black hole can be close to those of a tidal Reissner-Nordström black hole or those of a Reissner-Nordström black hole. It will be helpful to distinguish these black holes if we can separate the outermost relativistic images and determine their angular separation, brightness difference and time delay, although it requires techniques beyond the current limit.« less

Parents' and speech and language therapists' explanatory models of language development, language delay and intervention.

PubMed

Marshall, Julie; Goldbart, Juliet; Phillips, Julie

2007-01-01

Parental and speech and language therapist (SLT) explanatory models may affect engagement with speech and language therapy, but there has been dearth of research in this area. This study investigated parents' and SLTs' views about language development, delay and intervention in pre-school children with language delay. The aims were to describe, explore and explain the thoughts, understandings, perceptions, beliefs, knowledge and feelings held by: a group of parents from East Manchester, UK, whose pre-school children had been referred with suspected language delay; and SLTs working in the same area, in relation to language development, language delay and language intervention. A total of 24 unstructured interviews were carried out: 15 with parents whose children had been referred for speech and language therapy and nine with SLTs who worked with pre-school children. The interviews were transcribed verbatim and coded using Atlas/ti. The data were analysed, subjected to respondent validation, and grounded theories and principled descriptions developed to explain and describe parents' and SLTs' beliefs and views. Parent and SLT data are presented separately. There are commonalities and differences between the parents and the SLTs. Both groups believe that language development and delay are influenced by both external and internal factors. Parents give more weight to the role of gender, imitation and personality and value television and videos, whereas the SLTs value the 'right environment' and listening skills and consider that health/disability and socio-economic factors are important. Parents see themselves as experts on their child and have varied ideas about the role of SLTs, which do not always accord with SLTs' views. The parents and SLTs differ in their views of the roles of imitation and play in intervention. Parents typically try strategies before seeing an SLT. These data suggest that parents' ideas vary and that, although parents and SLTs may share some

Pre-Service Teachers' Efficacy Beliefs and Emotional States

ERIC Educational Resources Information Center

DeMauro, Anthony A.; Jennings, Patricia A.

2016-01-01

Teachers' efficacy beliefs play an important role in how they create quality learning environments. When pre-service teachers (also known as initial teacher trainees) develop strong efficacy beliefs, they can be confident in their abilities to be successful teachers once they enter the field. One way pre-service teachers obtain efficacy…

Collection media and delayed freezing effects on microbial composition of human stool.

PubMed

Flores, Roberto; Shi, Jianxin; Yu, Guoqin; Ma, Bing; Ravel, Jacques; Goedert, James J; Sinha, Rashmi

2015-01-01

Different bacteria in stool have markedly varied growth and survival when stored at ambient temperature. It is paramount to develop optimal biostabilization of stool samples during collection and assess long-term storage for clinical specimens and epidemiological microbiome studies. We evaluated the effect of collection media and delayed freezing up to 7 days on microbial composition. Ten participants collected triplicate stool samples each into no media as well as RNAlater® with and without kanamycin or ciprofloxacin. For each set of conditions, triplicate samples were frozen on dry ice immediately (time = 0) or frozen at -80 °C after 3-days and 7-days incubation at 25 °C. Microbiota metrics were estimated from Illumina MiSeq sequences of 16S rRNA gene fragments (V3-V4 region). Intraclass correlation coefficients (ICC) across triplicates, collection media, and incubation time were estimated for taxonomy and alpha and beta diversity metrics. RNAlater® alone yielded the highest ICCs for diversity metrics at time = 0 [ICC median 0.935 (range 0.89-0.97)], but ICCs varied greatly (range 0.44-1.0) for taxa with relative abundances <1%. The 3- and 7-day freezing delays were generally associated with stable beta diversity for all three media conditions. Freezing delay caused increased variance for Shannon index (median ICC 0.77) and especially for observed species abundance (median ICC 0.47). Variance in observed species abundance and in phylogenetic distance whole tree was similarly increased with a 7-day delay. Antibiotics did not mitigate variance. No media had inferior ICCs at time 0 and differed markedly from any media in microbiome composition (e.g., P =0.01 for relative abundance of Bacteroidetes). Bacterial community composition was stable for 7 days at room temperature in RNAlater® alone. RNAlater® provides some stability for beta diversity analyses, but analyses of rare taxa will be inaccurate if specimens are not frozen immediately. RNAlater® could be

Grape berry ripening delay induced by a pre-véraison NAA treatment is paralleled by a shift in the expression pattern of auxin- and ethylene-related genes.

PubMed

Ziliotto, Fiorenza; Corso, Massimiliano; Rizzini, Fabio Massimo; Rasori, Angela; Botton, Alessandro; Bonghi, Claudio

2012-10-09

Auxins act as repressors of ripening inception in grape (véraison), while ethylene and abscisic acid (ABA) play a positive role as inducers of the syndrome. Despite the increasing amount of information made available on this topic, the complex network of interactions among these hormones remains elusive. In order to shed light on these aspects, a holistic approach was adopted to evaluate, at the transcriptomic level, the crosstalk between hormones in grape berries, whose ripening progression was delayed by applying naphtalenacetic acid (NAA) one week before véraison. The NAA treatment caused significant changes in the transcription rate of about 1,500 genes, indicating that auxin delayed grape berry ripening also at the transcriptional level, along with the recovery of a steady state of its intracellular concentration. Hormone indices analysis carried out with the HORMONOMETER tool suggests that biologically active concentrations of auxins were achieved throughout a homeostatic recovery. This occurred within 7 days after the treatment, during which the physiological response was mainly unspecific and due to a likely pharmacological effect of NAA. This hypothesis is strongly supported by the up-regulation of genes involved in auxin conjugation (GH3-like) and action (IAA4- and IAA31-like). A strong antagonistic effect between auxin and ethylene was also observed, along with a substantial 'synergism' between auxins and ABA, although to a lesser extent. This study suggests that, in presence of altered levels of auxins, the crosstalk between hormones involves diverse mechanisms, acting at both the hormone response and biosynthesis levels, creating a complex response network.

Guanosine 3'-diphosphate 5'-diphosphate is not required for growth rate-dependent control of rRNA synthesis in Escherichia coli.

PubMed Central

Gaal, T; Gourse, R L

1990-01-01

rRNA synthesis in Escherichia coli is subject to at least two regulation systems, growth rate-dependent control and stringent control. The inverse correlation between rRNA synthesis rates and guanosine 3'-diphosphate 5'-diphosphate (ppGpp) levels under various physiological conditions has led to the supposition that ppGpp is the mediator of both control mechanisms by inhibiting transcription from rrn P1 promoters. Recently, relA- spoT- strains have been constructed in which both ppGpp synthesis pathways most likely have been removed (M. Cashel, personal communication). We have confirmed that such strains produce no detectable ppGpp and therefore offer a direct means for testing the involvement of ppGpp in the regulation of rRNA synthesis in vivo. Stringent control was determined by measurement of rRNA synthesis after amino acid starvation, while growth rate control was determined by measurement of rRNA synthesis under different nutritional conditions. As expected, the relA- spoT- strain is relaxed for stringent control. However, growth rate-dependent regulation is unimpaired. These results indicate that growth rate regulation can occur in the absence of ppGpp and imply that ppGpp is not the mediator, or at least is not the sole mediator, of growth rate-dependent control. Therefore, growth rate-dependent control and stringent control may utilize different mechanisms for regulating stable RNA synthesis. PMID:2196571

Improving operating room first start efficiency - value of both checklist and a pre-operative facilitator.

PubMed

Panni, M K; Shah, S J; Chavarro, C; Rawl, M; Wojnarwsky, P K; Panni, J K

2013-10-01

There are multiple components leading to improved operating room efficiency. We undertook a project focusing on first case starts; accounting for each delay component on a global basis. Our hypothesis was there would be a reduction in first start delays after we implemented strategies to address the issues identified through this accounting process. An orange sheet checklist was implemented, with specific items that needed to be clear prior to roll back to the operating room (OR), and an OR facilitator was employed to intervene whenever there were any missing items needed for a specific patient. We present the data from this quality improvement project over an 18-month period. Initially, 10.07 (± 0.73) delayed first starts occurred per day but declined steadily over time to a low of 4.95 (± 0.38) per day after 6 months (-49.2 %, P < 0.001). By the end of the project, the most common reasons for delay still included late surgical attending (19%), schedule changes (14%) as well as 'other reasons' (13%), but with an overall reduction per day of each. Total anaesthesia delay initially totalled 11% of the first start delays, but was negligible (< 1%) at the project's completion. While we have a challenging operating room environment based on our patient population, multiple trainees in both the surgery and anaesthesiology teams: an orange sheet - pre-operative checklist in addition to a dedicated pre-operative facilitator; allowed us to make a substantial improvement in our first start on time starts. © 2013 The Acta Anaesthesiologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing.

PubMed

Tourlousse, Dieter M; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro; Sekiguchi, Yuji

2017-02-28

High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Baryogenesis from strong CP violation and the QCD axion.

PubMed

Servant, Géraldine

2014-10-24

We show that strong CP violation from the QCD axion can be responsible for the matter antimatter asymmetry of the Universe in the context of cold electroweak baryogenesis if the electroweak phase transition is delayed below the GeV scale. This can occur naturally if the Higgs couples to a O(100)  GeV dilaton, as expected in some models where the Higgs is a pseudo-Nambu-Goldstone boson of a new strongly interacting sector at the TeV scale. The existence of such a second scalar resonance with a mass and properties similar to the Higgs boson will soon be tested at the LHC. In this context, the QCD axion would not only solve the strong CP problem, but also the matter antimatter asymmetry and dark matter.

Strong gravitational lensing probes of the particle nature of dark matter

NASA Astrophysics Data System (ADS)

Moustakas, Leonidas A.; Abazajian, Kevork; Benson, Andrew; Bolton, Adam S.; Bullock, James S.; Chen, Jacqueline; Cheng, Edward; Coe, Dan; Congdon, Arthur B.; Dalal, Neal; Diemand, Juerg; Dobke, Benjamin M.; Dobler, Greg; Dore, Olivier; Dutton, Aaron; Ellis, Richard; Fassnacht, Chris D.; Ferguson, Henry; Finkbeiner, Douglas; Gavassi, Raphael; High, Fredrick William; Jeltema, Telsa; Jullo, Eric; Kaplinghat, Manoj; Keeton, Charles R.; Kneib, Jean-Paul; Koopmans, Leon V.E.; Koishiappas, Savvas M.; Kuhlen, Michael; Kusenko, Alexander; Lawrence, Charles R.; Loeb, Avi; Madae, Piero; Marshall, Phil; Metcalf, R. Ben; Natarajan, Priya; Primack, Joel R.; Profumo, Stefano; Seiffert, Michael D.; Simon, Josh; Stern, Daniel; Strigari, Louis; Taylor, James E.; Wayth, Randall; Wambsganss, Joachim; Wechsler, Risa; Zentner, Andrew

There is a vast menagerie of plausible candidates for the constituents of dark matter, both within and beyond extensions of the Standard Model of particle physics. Each of these candidates may have scattering (and other) cross section properties that are consistent with the dark matter abundance, BBN, and the most scales in the matter power spectrum; but which may have vastly different behavior at sub-galactic "cutoff" scales, below which dark matter density fluctuations are smoothed out. The only way to quantitatively measure the power spectrum behavior at sub-galactic scales at distances beyond the local universe, and indeed over cosmic time, is through probes available in multiply imaged strong gravitational lenses. Gravitational potential perturbations by dark matter substructure encode information in the observed relative magnifications, positions, and time delays in a strong lens. Each of these is sensitive to a different moment of the substructure mass function and to different effective mass ranges of the substructure. The time delay perturbations, in particular, are proving to be largely immune to the degeneracies and systematic uncertainties that have impacted exploitation of strong lenses for such studies. There is great potential for a coordinated theoretical and observational effort to enable a sophisticated exploitation of strong gravitational lenses as direct probes of dark matter properties. This opportunity motivates this white paper, and drives the need for: a) strong support of the theoretical work necessary to understand all astrophysical consequences for different dark matter candidates; and b) tailored observational campaigns, and even a fully dedicated mission, to obtain the requisite data.

Nucleolar DEAD-Box RNA Helicase TOGR1 Regulates Thermotolerant Growth as a Pre-rRNA Chaperone in Rice

PubMed Central

Tang, Ding; Zhang, Yu’e; Cheng, Zhukuan; Xue, Yongbiao

2016-01-01

Plants have evolved a considerable number of intrinsic tolerance strategies to acclimate to ambient temperature increase. However, their molecular mechanisms remain largely obscure. Here we report a DEAD-box RNA helicase, TOGR1 (Thermotolerant Growth Required1), prerequisite for rice growth themotolerance. Regulated by both temperature and the circadian clock, its expression is tightly coupled to daily temperature fluctuations and its helicase activities directly promoted by temperature increase. Located in the nucleolus and associated with the small subunit (SSU) pre-rRNA processome, TOGR1 maintains a normal rRNA homeostasis at high temperature. Natural variation in its transcript level is positively correlated with plant height and its overexpression significantly improves rice growth under hot conditions. Our findings reveal a novel molecular mechanism of RNA helicase as a key chaperone for rRNA homeostasis required for rice thermotolerant growth and provide a potential strategy to breed heat-tolerant crops by modulating the expression of TOGR1 and its orthologs. PMID:26848586

Nuclear counterparts of the cytoplasmic mitochondrial 12S rRNA gene: a problem of ancient DNA and molecular phylogenies.

PubMed

van der Kuyl, A C; Kuiken, C L; Dekker, J T; Perizonius, W R; Goudsmit, J

1995-06-01

Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S rRNA gene. Sequences aligning with the 12S rRNA gene were recovered but were only distantly related to contemporary monkey mitochondrial 12S rRNA sequences. However, many of these sequences were identical or closely related to human nuclear DNA sequences resembling mitochondrial 12S rRNA (isolated from a cell line depleted in mitochondria) and therefore have to be considered contamination. Subsequently in a separate study we were able to recover genuine mitochondrial 12S rRNA sequences from many extant species of nonhuman Old World primates and sequences closely resembling the human nuclear integrations. Analysis of all sequences by the neighbor-joining (NJ) method indicated that mitochondrial DNA sequences and their nuclear counterparts can be divided into two distinct clusters. One cluster contained all temporary cytoplasmic mitochondrial DNA sequences and approximately half of the monkey nuclear mitochondriallike sequences. A second cluster contained most human nuclear sequences and the other half of monkey nuclear sequences with a separate branch leading to human and gorilla mitochondrial and nuclear sequences. Sequences recovered from ancient materials were equally divided between the two clusters. These results constitute a warning for when working with ancient DNA or performing phylogenetic analysis using mitochondrial DNA as a target sequence: Nuclear counterparts of mitochondrial genes may lead to faulty interpretation of results.

Bacillus nanhaiisediminis sp. nov., an alkalitolerant member of Bacillus rRNA group 6.

PubMed

Zhang, Jianli; Wang, Jiewei; Song, Fei; Fang, Caiyuan; Xin, Yuhua; Zhang, Yabo

2011-05-01

A Gram-stain-positive, rod-shaped bacterium, designated strain NH3(T), was isolated from a sediment sample from the South China Sea and was subjected to a polyphasic taxonomic study. The isolate grew optimally at 37 °C and pH 9. Strain NH3(T) had cell-wall peptidoglycan based on meso-diaminopimelic acid and MK-7 as the predominant menaquinone. The cellular fatty acid profile included significant amounts of iso-C(15 : 0) and iso-C(14 : 0). The major polar lipids were phosphatidylethanolamine, phosphatidylglycerol and diphosphatidylglycerol. The DNA G+C content of strain NH3(T) was 40.3 mol%. Phylogenetic analysis of the 16S rRNA gene sequence revealed that strain NH3(T) was a member of rRNA group 6 of the genus Bacillus, which includes alkalitolerant, alkaliphilic and halotolerant species. The closest phylogenetic relatives were Bacillus akibai 1139(T) (96.82 % 16S rRNA gene sequence similarity), B. pseudofirmus DSM 8715(T) (96.76 %), B. okhensis Kh10-101(T) (96.76 %) and B. alkalidiazotrophicus MS 6(T) (96.47 %). Strain NH3(T) could be distinguished from these phylogenetically close neighbours based on a number of phenotypic properties. On the basis of phenotypic and chemotaxonomic characteristics and phylogenetic data, we conclude that strain NH3(T) ( = CGMCC 1.10116(T)  = JCM 16507(T)) merits classification as the type strain of a novel species, for which the name Bacillus nanhaiisediminis sp. nov. is proposed.

Phylogenetic Network Analysis Revealed the Occurrence of Horizontal Gene Transfer of 16S rRNA in the Genus Enterobacter

PubMed Central

Sato, Mitsuharu; Miyazaki, Kentaro

2017-01-01

Horizontal gene transfer (HGT) is a ubiquitous genetic event in bacterial evolution, but it seldom occurs for genes involved in highly complex supramolecules (or biosystems), which consist of many gene products. The ribosome is one such supramolecule, but several bacteria harbor dissimilar and/or chimeric 16S rRNAs in their genomes, suggesting the occurrence of HGT of this gene. However, we know little about whether the genes actually experience HGT and, if so, the frequency of such a transfer. This is primarily because the methods currently employed for phylogenetic analysis (e.g., neighbor-joining, maximum likelihood, and maximum parsimony) of 16S rRNA genes assume point mutation-driven tree-shape evolution as an evolutionary model, which is intrinsically inappropriate to decipher the evolutionary history for genes driven by recombination. To address this issue, we applied a phylogenetic network analysis, which has been used previously for detection of genetic recombination in homologous alleles, to the 16S rRNA gene. We focused on the genus Enterobacter, whose phylogenetic relationships inferred by multi-locus sequence alignment analysis and 16S rRNA sequences are incompatible. All 10 complete genomic sequences were retrieved from the NCBI database, in which 71 16S rRNA genes were included. Neighbor-joining analysis demonstrated that the genes residing in the same genomes clustered, indicating the occurrence of intragenomic recombination. However, as suggested by the low bootstrap values, evolutionary relationships between the clusters were uncertain. We then applied phylogenetic network analysis to representative sequences from each cluster. We found three ancestral 16S rRNA groups; the others were likely created through recursive recombination between the ancestors and chimeric descendants. Despite the large sequence changes caused by the recombination events, the RNA secondary structures were conserved. Successive intergenomic and intragenomic recombination

Insensitivity of synchronization to network structure in chaotic pendulum systems with time-delay coupling.

PubMed

Yao, Chenggui; Zhan, Meng; Shuai, Jianwei; Ma, Jun; Kurths, Jürgen

2017-12-01

It has been generally believed that both time delay and network structure could play a crucial role in determining collective dynamical behaviors in complex systems. In this work, we study the influence of coupling strength, time delay, and network topology on synchronization behavior in delay-coupled networks of chaotic pendulums. Interestingly, we find that the threshold value of the coupling strength for complete synchronization in such networks strongly depends on the time delay in the coupling, but appears to be insensitive to the network structure. This lack of sensitivity was numerically tested in several typical regular networks, such as different locally and globally coupled ones as well as in several complex networks, such as small-world and scale-free networks. Furthermore, we find that the emergence of a synchronous periodic state induced by time delay is of key importance for the complete synchronization.

The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.

PubMed

Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R

As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.

The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science

PubMed Central

Ames, Nancy J.; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R.

2017-01-01

Background As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and health care practitioners to analyze these microbial communities and their role in health and disease.16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. Objectives The objectives of this review are to: (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Discussion Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists—individuals uniquely positioned to utilize these techniques in future studies in clinical settings. PMID:28252578

Effects of delay and noise in a negative feedback regulatory motif

NASA Astrophysics Data System (ADS)

Palassini, Matteo; Dies, Marta

2009-03-01

The small copy number of the molecules involved in gene regulation can induce nontrivial stochastic phenomena such as noise-induced oscillations. An often neglected aspect of regulation dynamics are the delays involved in transcription and translation. Delays introduce analytical and computational complications because the dynamics is non-Markovian. We study the interplay of noise and delays in a negative feedback model of the p53 core regulatory network. Recent experiments have found pronounced oscillations in the concentrations of proteins p53 and Mdm2 in individual cells subjected to DNA damage. Similar oscillations occur in the Hes-1 and NK-kB systems, and in circadian rhythms. Several mechanisms have been proposed to explain this oscillatory behaviour, such as deterministic limit cycles, with and without delay, or noise-induced excursions in excitable models. We consider a generic delayed Master Equation incorporating the activation of Mdm2 by p53 and the Mdm2-promoted degradation of p53. In the deterministic limit and for large delays, the model shows a Hopf bifurcation. Via exact stochastic simulations, we find strong noise-induced oscillations well outside the limit-cycle region. We propose that this may be a generic mechanism for oscillations in gene regulatory systems.

Skin microbiome surveys are strongly influenced by experimental design

PubMed Central

Meisel, Jacquelyn S.; Hannigan, Geoffrey D.; Tyldsley, Amanda S.; SanMiguel, Adam J.; Hodkinson, Brendan P.; Zheng, Qi; Grice, Elizabeth A.

2016-01-01

Culture-independent studies to characterize skin microbiota are increasingly common, due in part to affordable and accessible sequencing and analysis platforms. Compared to culture-based techniques, DNA sequencing of the bacterial 16S ribosomal RNA (rRNA) gene or whole metagenome shotgun (WMS) sequencing provide more precise microbial community characterizations. Most widely used protocols were developed to characterize microbiota of other habitats (i.e. gastrointestinal), and have not been systematically compared for their utility in skin microbiome surveys. Here we establish a resource for the cutaneous research community to guide experimental design in characterizing skin microbiota. We compare two widely sequenced regions of the 16S rRNA gene to WMS sequencing for recapitulating skin microbiome community composition, diversity, and genetic functional enrichment. We show that WMS sequencing most accurately recapitulates microbial communities, but sequencing of hypervariable regions 1-3 of the 16S rRNA gene provides highly similar results. Sequencing of hypervariable region 4 poorly captures skin commensal microbiota, especially Propionibacterium. WMS sequencing, which is resource- and cost-intensive, provides evidence of a community’s functional potential; however, metagenome predictions based on 16S rRNA sequence tags closely approximate WMS genetic functional profiles. This work highlights the importance of experimental design for downstream results in skin microbiome surveys. PMID:26829039

LIGHT EXPOSURE AMONG ADOLESCENTS WITH DELAYED SLEEP PHASE DISORDER: A PROSPECTIVE COHORT STUDY

PubMed Central

Auger, R. Robert; Burgess, Helen J.; Dierkhising, Ross A.; Sharma, Ruchi G.; Slocumb, Nancy L.

2012-01-01

Our study objective was to compare light exposure and sleep parameters between adolescents with delayed sleep phase disorder (n=16, 15.3 ± 1.8 years) and unaffected controls (n=22, 13.7 ± 2.4 years) using a prospective cohort design. Participants wore wrist actigraphs with photosensors for 14 days. Mean hourly lux levels from 20:00-05:00 h and 05:00-14:00 h were examined, in addition to the 9-hour intervals prior to sleep onset and after sleep offset. Sleep parameters were compared separately, and were also included as covariates within models that analyzed associations with specified light intervals. Additional covariates included group and school night status. Adolescent subjects with delayed sleep phase disorder received more evening (p<0.02, 22:00-02:00 h) and less morning light (p<0.05, 08:00-09:00 h and 10:00-12:00 h) than controls, but had less pre-sleep exposure with adjustments for the time of sleep onset (p<0.03, fifth-seventh hours prior to onset hour). No differences were identified with respect to the sleep offset interval. Increased total sleep time and later sleep offset times were associated with decreased evening (p<0.001 and p=0.02, respectively) and morning (p=0.01 and p<0.001, respectively) exposure, and later sleep onset times were associated with increased evening exposure (p<0.001). Increased total sleep time also correlated with increased exposure during the 9 hours before sleep-onset (p=0.01), and a later sleep onset time corresponded with decreased exposure during the same interval (p<0.001). Outcomes persisted regardless of school night status. In conclusion, light exposure interpretation requires adjustments for sleep timing among adolescents with delayed sleep phase disorder. Pre- and post-sleep exposure do not appear to contribute directly to phase delays. Sensitivity to morning light may be reduced among adolescents with delayed sleep phase disorder. PMID:22080736

Nutritional practices in full-day-care pre-schools.

PubMed

Jennings, A; McEvoy, S; Corish, C

2011-06-01

Full-day-care pre-schools contribute significantly to the nutritional intake and acquisition of dietary habits of the pre-school child. The present study investigated nutritional practices in full-day-care pre-schools in Dublin, Ireland, aiming to determine the nutritional support that pre-school managers deem necessary, thereby facilitating the amelioration of existing pre-school nutritional training and practices. A telephone questionnaire completed by pre-school managers (n=54) examined pre-school dietary practices, food provision and the association between these and pre-school size, nutritional training attendance, possession of the Food and Nutrition Guidelines for Pre-school Services and having a healthy eating policy. Nutritional training needs were also investigated. Twenty-five pre-schools provided all food for attending children; parents were sole providers in six. Thirty-four pre-schools had a written healthy eating policy. Attendance at nutritional training was reported by 40. Possession of the Guidelines (n=40) did not consistently result in their use. Poor parental and staff involvement in policy and menu development was cited. Although the delayed introduction of iron-containing foods and a feeding beaker in infants was clearly evident, inappropriate beverages and snacks were served to children aged 1-5 years in 43 and 37 pre-schools, respectively. Training priorities cited by managers included parental education and the provision of information regarding menu planning and healthy food choices. Nutritional training should advocate whole staff familiarity with and use of current guidelines, in addition to encouraging nutritional policy development and enforcement. Parental education is warranted. Dietary education should focus specifically on appropriate weaning practices, healthy beverage and snack provision and menu planning. © 2011 The Authors. Journal of Human Nutrition and Dietetics © 2011 The British Dietetic Association Ltd.

A data-driven search for semen-related phenotypes in conception delay

PubMed Central

Patel, C. J.; Sundaram, R.; Buck Louis, G. M.

2016-01-01

SUMMARY Sperm count, morphology, and motility have been reported to be predictive of pregnancy, although with equivocal basis prompting some authors to question the prognostic value of semen analysis. To assess the utility of including semen quality data in predicting conception delay or requiring >6 cycles to become pregnant (referred to as conception delay), we utilized novel data-driven analytic techniques in a pre-conception cohort of couples prospectively followed up for time-to-pregnancy. The study cohort comprised 402 (80%) male partners who provided semen samples and had time-to-pregnancy information. Female partners used home pregnancy tests and recorded results in daily journals. Odds ratios (OR), false discovery rates, and 95% confidence intervals (CIs) for conception delay (time-to-pregnancy > 6 cycles) were estimated for 40 semen quality phenotypes comprising 35 semen quality endpoints and 5 closely related fecundity determinants (body mass index, time of contraception, lipids, cotinine and seminal white blood cells). Both traditional and strict sperm phenotype measures were associated with lower odds of conception delay. Specifically, for an increase in percent morphologically normal spermatozoa using traditional methods, we observed a 40% decrease in conception delay (OR = 0.6, 95% CI = 0.50, 0.81; p = 0.0003). Similarly, for an increase in strict criteria, we observed a 30% decrease in odds for conception delay (OR = 0.7, 95% CI = 0.52, 0.83; p = 0.001). On the other hand, an increase in percent coiled tail spermatozoa was associated with a 40% increase in the odds for conception delay (OR = 1.4, 95% CI = 1.12, 1.75; p = 0.003). However, our findings suggest that semen phenotypes have little predictive value of conception delay (area under the curve of 73%). In a multivariate model containing significant semen factors and traditional risk factors (i.e. age, body mass index, cotinine and ever having fathered a pregnancy), there was a modest

Pre-exposure rabies prophylaxis: a systematic review.

PubMed

Kessels, Jocelyn A; Recuenco, Sergio; Navarro-Vela, Ana Maria; Deray, Raffy; Vigilato, Marco; Ertl, Hildegund; Durrheim, David; Rees, Helen; Nel, Louis H; Abela-Ridder, Bernadette; Briggs, Deborah

2017-03-01

To review the safety and immunogenicity of pre-exposure rabies prophylaxis (including accelerated schedules, co-administration with other vaccines and booster doses), its cost-effectiveness and recommendations for use, particularly in high-risk settings. We searched the PubMed, Centre for Agriculture and Biosciences International, Cochrane Library and Web of Science databases for papers on pre-exposure rabies prophylaxis published between 2007 and 29 January 2016. We reviewed field data from pre-exposure prophylaxis campaigns in Peru and the Philippines. Pre-exposure rabies prophylaxis was safe and immunogenic in children and adults, also when co-administered with routine childhood vaccinations and the Japanese encephalitis vaccine. The evidence available indicates that shorter regimens and regimens involving fewer doses are safe and immunogenic and that booster intervals could be extended up to 10 years. The few studies on cost suggest that, at current vaccine and delivery costs, pre-exposure prophylaxis campaigns would not be cost-effective in most situations. Although pre-exposure prophylaxis has been advocated for high-risk populations, only Peru and the Philippines have implemented appropriate national programmes. In the future, accelerated regimens and novel vaccines could simplify delivery and increase affordability. Pre-exposure rabies prophylaxis is safe and immunogenic and should be considered: (i) where access to postexposure prophylaxis is limited or delayed; (ii) where the risk of exposure is high and may go unrecognized; and (iii) where controlling rabies in the animal reservoir is difficult. Pre-exposure prophylaxis should not distract from canine vaccination efforts, provision of postexposure prophylaxis or education to increase rabies awareness in local communities.

Pre-exposure rabies prophylaxis: a systematic review

PubMed Central

Recuenco, Sergio; Navarro-Vela, Ana Maria; Deray, Raffy; Vigilato, Marco; Ertl, Hildegund; Durrheim, David; Rees, Helen; Nel, Louis H; Abela-Ridder, Bernadette; Briggs, Deborah

2017-01-01

Abstract Objective To review the safety and immunogenicity of pre-exposure rabies prophylaxis (including accelerated schedules, co-administration with other vaccines and booster doses), its cost–effectiveness and recommendations for use, particularly in high-risk settings. Methods We searched the PubMed, Centre for Agriculture and Biosciences International, Cochrane Library and Web of Science databases for papers on pre-exposure rabies prophylaxis published between 2007 and 29 January 2016. We reviewed field data from pre-exposure prophylaxis campaigns in Peru and the Philippines. Findings Pre-exposure rabies prophylaxis was safe and immunogenic in children and adults, also when co-administered with routine childhood vaccinations and the Japanese encephalitis vaccine. The evidence available indicates that shorter regimens and regimens involving fewer doses are safe and immunogenic and that booster intervals could be extended up to 10 years. The few studies on cost suggest that, at current vaccine and delivery costs, pre-exposure prophylaxis campaigns would not be cost-effective in most situations. Although pre-exposure prophylaxis has been advocated for high-risk populations, only Peru and the Philippines have implemented appropriate national programmes. In the future, accelerated regimens and novel vaccines could simplify delivery and increase affordability. Conclusion Pre-exposure rabies prophylaxis is safe and immunogenic and should be considered: (i) where access to postexposure prophylaxis is limited or delayed; (ii) where the risk of exposure is high and may go unrecognized; and (iii) where controlling rabies in the animal reservoir is difficult. Pre-exposure prophylaxis should not distract from canine vaccination efforts, provision of postexposure prophylaxis or education to increase rabies awareness in local communities. PMID:28250534

Terrestrial Sagnac delay constraining modified gravity models

NASA Astrophysics Data System (ADS)

Karimov, R. Kh.; Izmailov, R. N.; Potapov, A. A.; Nandi, K. K.

2018-04-01

Modified gravity theories include f(R)-gravity models that are usually constrained by the cosmological evolutionary scenario. However, it has been recently shown that they can also be constrained by the signatures of accretion disk around constant Ricci curvature Kerr-f(R0) stellar sized black holes. Our aim here is to use another experimental fact, viz., the terrestrial Sagnac delay to constrain the parameters of specific f(R)-gravity prescriptions. We shall assume that a Kerr-f(R0) solution asymptotically describes Earth's weak gravity near its surface. In this spacetime, we shall study oppositely directed light beams from source/observer moving on non-geodesic and geodesic circular trajectories and calculate the time gap, when the beams re-unite. We obtain the exact time gap called Sagnac delay in both cases and expand it to show how the flat space value is corrected by the Ricci curvature, the mass and the spin of the gravitating source. Under the assumption that the magnitude of corrections are of the order of residual uncertainties in the delay measurement, we derive the allowed intervals for Ricci curvature. We conclude that the terrestrial Sagnac delay can be used to constrain the parameters of specific f(R) prescriptions. Despite using the weak field gravity near Earth's surface, it turns out that the model parameter ranges still remain the same as those obtained from the strong field accretion disk phenomenon.

Flexible pulse delay control up to picosecond for high-intensity twin electron bunches

DOE PAGES

Zhang, Zhen; Ding, Yuantao; Emma, Paul; ...

2015-09-10

Two closely spaced electron bunches have attracted strong interest due to their applications in two color X-ray free-electron lasers as well as witness bunch acceleration in plasmas and dielectric structures. In this paper, we propose a new scheme of delay system to vary the time delay up to several picoseconds while not affecting the bunch compression. Numerical simulations based on the Linac Coherent Light Source are performed to demonstrate the feasibility of this method.

A novel femtosecond-gated, high-resolution, frequency-shifted shearing interferometry technique for probing pre-plasma expansion in ultra-intense laser experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feister, S., E-mail: feister.7@osu.edu; Orban, C.; Innovative Scientific Solutions, Inc., Dayton, Ohio 45459

Ultra-intense laser-matter interaction experiments (>10{sup 18} W/cm{sup 2}) with dense targets are highly sensitive to the effect of laser “noise” (in the form of pre-pulses) preceding the main ultra-intense pulse. These system-dependent pre-pulses in the nanosecond and/or picosecond regimes are often intense enough to modify the target significantly by ionizing and forming a plasma layer in front of the target before the arrival of the main pulse. Time resolved interferometry offers a robust way to characterize the expanding plasma during this period. We have developed a novel pump-probe interferometry system for an ultra-intense laser experiment that uses two short-pulse amplifiersmore » synchronized by one ultra-fast seed oscillator to achieve 40-fs time resolution over hundreds of nanoseconds, using a variable delay line and other techniques. The first of these amplifiers acts as the pump and delivers maximal energy to the interaction region. The second amplifier is frequency shifted and then frequency doubled to generate the femtosecond probe pulse. After passing through the laser-target interaction region, the probe pulse is split and recombined in a laterally sheared Michelson interferometer. Importantly, the frequency shift in the probe allows strong plasma self-emission at the second harmonic of the pump to be filtered out, allowing plasma expansion near the critical surface and elsewhere to be clearly visible in the interferograms. To aid in the reconstruction of phase dependent imagery from fringe shifts, three separate 120° phase-shifted (temporally sheared) interferograms are acquired for each probe delay. Three-phase reconstructions of the electron densities are then inferred by Abel inversion. This interferometric system delivers precise measurements of pre-plasma expansion that can identify the condition of the target at the moment that the ultra-intense pulse arrives. Such measurements are indispensable for correlating laser pre

Pubertal Height Velocity and Associations with Pre-pubertal and Adult Heights in Cystic Fibrosis

PubMed Central

Zhang, Zhumin; Lindstrom, Mary J.; Lai, HuiChuan J.

2013-01-01

Objectives To test the hypothesis that pubertal peak height velocity (PHV) in cystic fibrosis (CF) has improved and is influenced by pre-pubertal growth and genetic potential. Study design PHV from 1862 children born in 1984–87 and documented in the 1986–2008 US CF Foundation Registry was determined by statistical modeling and classified into normal, delayed (2-SD > average age), attenuated (magnitude < 5th percentile), or both (D&A). Genetic potential for height was estimated by parental stature. Results PHV averaged 8.4 cm/y at age 14.0 y in boys and 7.0 cm/y at age 12.1 y in girls, ~6 mo delay and ~15% reduction compared with healthy children. PHV was normal in 60%, delayed in 9%, attenuated in 21% and D&A in 5%. Patients with delayed PHV reached similar adult height percentile (boys: 34th, girls: 46th) to those with normal PHV (boys: 33rd, girls: 34th); both were significantly taller than the attenuated (boys: 11th, girls: 19th) and D&A PHV subgroups (boys: 8th, girls: 14th). Pancreatic sufficient patients had taller pre-pubertal and adult heights but similar PHV compared with pancreatic insufficient or meconium ileus patients. Adjusting for genetic potential reduced adult height percentiles more in boys (25th to 16th) than girls (28th to 24th). Height at age 7 y, PHV age and magnitude, and parental stature significantly predicted adult height. Conclusions Pubertal PHV has improved in children with CF born after mid 1980s compared with older cohorts but remains below normal. Suboptimal pre-pubertal and pubertal growth led to adult height below genetic potential in CF. PMID:23535012

The methyltransferase YfgB/RlmN is responsible for modification of adenosine 2503 in 23S rRNA

PubMed Central

Toh, Seok-Ming; Xiong, Liqun; Bae, Taeok; Mankin, Alexander S.

2008-01-01

A2503 in 23S rRNA of the Gram-negative bacterium Escherichia coli is located in a functionally important region of the ribosome, at the entrance to the nascent peptide exit tunnel. In E. coli, and likely in other species, this adenosine residue is post-transcriptionally modified to m2A. The enzyme responsible for this modification was previously unknown. We identified E. coli protein YfgB, which belongs to the radical SAM enzyme superfamily, as the methyltransferase that modifies A2503 of 23S rRNA to m2A. Inactivation of the yfgB gene in E. coli led to the loss of modification at nucleotide A2503 of 23S rRNA as revealed by primer extension analysis and thin layer chromatography. The A2503 modification was restored when YfgB protein was expressed in the yfgB knockout strain. A similar protein was shown to catalyze post-transcriptional modification of A2503 in 23S rRNA in Gram-positive Staphylococcus aureus. The yfgB knockout strain loses in competition with wild type in a co-growth experiment, indicating functional importance of A2503 modification. The location of A2503 in the exit tunnel suggests its possible involvement in interaction with the nascent peptide and raises the possibility that its post-transcriptional modification may influence such an interaction. PMID:18025251

Examining the psychosocial determinants of women's decisions to delay childbearing.

PubMed

Kearney, Allison L; White, Katherine M

2016-08-01

What are the psychosocial determinants of women's intentions to delay childbearing until after 35 years? Attitudes, pressure from important others, perceived self-confidence and anticipated regret all influence the decision-making process of women aged 18-30 years to defer their attempts to conceive their first child until 35+ years. Research has consistently demonstrated that, for many women, the decision to delay childbearing can lead to 'unintentional childlessness' due to a failure to consider the impact of age-related fertility decline. A large body of literature has also found strong links between age-related involuntary infertility and negative psychological impacts, including an increased prevalence of anxiety, depression, guilt, stigma and poor mental health. The study initially conducted focus groups designed to ascertain important beliefs informing participants' intentions to delay childbearing. A subsequent larger-scale quantitative questionnaire followed. Participants (n = 358) were female, aged between 18 and 30 years, lived in Australia, identified as being open to the idea of having children, were heterosexual, had not already had children, were not already pregnant, and had not received a diagnosis of medical infertility prior to participating. Hierarchical multiple regression analyses showed strong support for psychosocial predictors of attitude, pressure from others and perceived self-confidence as predictors of women's intentions to delay childbearing, accounting for 59% of total variance. The extended model that included anticipated regret, accounted for a significant additional 4.4% variance in intention to delay childbearing past the age of 35 years. Proportionally more participants were younger, Caucasian, and were university students, thus limiting the generalizability of results to the wider Australian community. Future research in this domain is recommended to adopt a prospective design and incorporate a measure of behaviour to

Unusual intraindividual variation of the nuclear 18S rRNA gene is widespread within the Acipenseridae.

PubMed

Krieger, Jeannette; Hett, Anne Kathrin; Fuerst, Paul A; Birstein, Vadim J; Ludwig, Arne

2006-01-01

Significant intraindividual variation in the sequence of the 18S rRNA gene is unusual in animal genomes. In a previous study, multiple 18S rRNA gene sequences were observed within individuals of eight species of sturgeon from North America but not in the North American paddlefish, Polyodon spathula, in two species of Polypterus (Polypterus delhezi and Polypterus senegalus), in other primitive fishes (Erpetoichthys calabaricus, Lepisosteus osseus, Amia calva) or in a lungfish (Protopterus sp.). These observations led to the hypothesis that this unusual genetic characteristic arose within the Acipenseriformes after the presumed divergence of the sturgeon and paddlefish families. In the present study, a survey of nearly all Eurasian acipenseriform species was conducted to examine 18S rDNA variation. Intraindividual variation was not found in the polyodontid species, the Chinese paddlefish, Psephurus gladius, but variation was detected in all Eurasian acipenserid species. The comparison of sequences from two major segments of the 18S rRNA gene and identification of sites where insertion/deletion events have occurred are placed in the context of evolutionary relationships within the Acipenseriformes and the evolution of rDNA variation in this group.

Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin

PubMed Central

Chahine, Sarah; Okafor, Darius; Ong, Ana C.; Maybank, Rosslyn; Kwak, Yoon I.; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

2015-01-01

16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

Vegetation cover of forest, shrub and pasture strongly influences soil bacterial community structure as revealed by 16S rRNA gene T-RFLP analysis.

PubMed

Chim Chan, On; Casper, Peter; Sha, Li Qing; Feng, Zhi Li; Fu, Yun; Yang, Xiao Dong; Ulrich, Andreas; Zou, Xiao Ming

2008-06-01

Bacterial community structure is influenced by vegetation, climate and soil chemical properties. To evaluate these influences, terminal restriction fragment length polymorphism (T-RFLP) and cloning of the 16S rRNA gene were used to analyze the soil bacterial communities in different ecosystems in southwestern China. We compared (1) broad-leaved forest, shrub and pastures in a high-plateau region, (2) three broad-leaved forests representing a climate gradient from high-plateau temperate to subtropical and tropical regions and (3) the humus and mineral soil layers of forests, shrub lands and pastures with open and restricted grazing activities, having varied soil carbon and nutrient contents. Principal component analysis of the T-RFLP patterns revealed that soil bacterial communities of the three vegetation types were distinct. The broad-leaved forests in different climates clustered together, and relatively minor differences were observed between the soil layers or the grazing regimes. Acidobacteria dominated the broad-leaved forests (comprising 62% of the total clone sequences), but exhibited lower relative abundances in the soils of shrub (31%) and pasture (23%). Betaproteobacteria was another dominant taxa of shrub land (31%), whereas Alpha- (19%) and Gammaproteobacteria (13%) and Bacteriodetes (16%) were major components of pasture. Vegetation exerted more pronounced influences than climate and soil chemical properties.

Pre- and post-diagnosis costs of tuberculosis to patients on Directly Observed Treatment Short course in districts of southwestern Ethiopia: a longitudinal study.

PubMed

Asres, Abyot; Jerene, Degu; Deressa, Wakgari

2018-05-21

Financial burden on tuberculosis (TB) patients results in delayed treatment and poor compliance. We assessed pre- and post-diagnosis costs to TB patients. A longitudinal study among 735 new TB cases was conducted from January 2015 through June 2016 in 10 woredas (districts) of southwestern Ethiopia. Direct out-of-pocket, payments, and lost income (indirect cost) were solicited from patients during the first 2 months and at the end of treatment. Thus, we ascertained direct medical, nonmedical, and indirect costs incurred by patients during pre- and post-diagnosis periods. We categorized costs incurred from onset of illness until TB diagnosis as pre-diagnosis and that incurred after diagnosis through treatment completion as post-diagnosis. Pre- and post-diagnosis costs constitute total cost incurred by the patients. We fitted linear regression model to identify predictors of cost. Between onset of illness and anti-TB treatment course, patients incurred a median (inter-quartile range (IQR)) of US$201.48 (136.7-318.94). Of the total cost, the indirect and direct costs respectively constituted 70.6 and 29.4%. TB patients incurred a median (IQR) of US$97.62 (6.43-184.22) and US$93.75 (56.91-141.54) during the pre- and post-diagnosis periods, respectively. Thus, patients incurred 53.6% of the total cost during the pre-diagnosis period. Direct out-of-pocket expenses during the pre- and post-diagnosis periods respectively amount to median (IQR) of US$21.64 (10.23-48.31) and US$35.02 (0-70.04). Patient delay days (p < 0.001), provider delay days (p < 0.001), number of healthcare facilities visited until TB diagnosis (p < 0.001), and TB diagnosis at private facilities (p = 0.02) independently predicted increased pre-diagnosis cost. Similarly, rural residence (p < 0.001), hospitalization during anti-TB treatment (p < 0.001), patient delay days (p < 0.001), and provider delay days (p < 0.001) predicted increased post-diagnosis costs. TB patients

Mrd1p binds to pre-rRNA early during transcription independent of U3 snoRNA and is required for compaction of the pre-rRNA into small subunit processomes.

PubMed

Segerstolpe, Asa; Lundkvist, Pär; Osheim, Yvonne N; Beyer, Ann L; Wieslander, Lars

2008-08-01

In Saccharomyces cerevisiae, synthesis of the small ribosomal subunit requires assembly of the 35S pre-rRNA into a 90S preribosomal complex. SnoRNAs, including U3 snoRNA, and many trans-acting proteins are required for the ordered assembly and function of the 90S preribosomal complex. Here, we show that the conserved protein Mrd1p binds to the pre-rRNA early during transcription and is required for compaction of the pre-18S rRNA into SSU processome particles. We have exploited the fact that an Mrd1p-GFP fusion protein is incorporated into the 90S preribosomal complex, where it acts as a partial loss-of-function mutation. When associated with the pre-rRNA, Mrd1p-GFP functionally interacts with the essential Pwp2, Mpp10 and U3 snoRNP subcomplexes that are functionally interconnected in the 90S preribosomal complex. The fusion protein can partially support 90S preribosome-mediated cleavages at the A(0)-A(2) sites. At the same time, on a substantial fraction of transcripts, the composition and/or structure of the 90S preribosomal complex is perturbed by the fusion protein in such a way that cleavage of the 35S pre-rRNA is either blocked or shifted to aberrant sites. These results show that Mrd1p is required for establishing productive structures within the 90S preribosomal complex.

Improving on-time surgical starts: the impact of implementing pre-OR timeouts and performance pay.

PubMed

Martin, Luke; Langell, John

2017-11-01

Operating room (OR) time is expensive. Underutilized OR time negatively impacts efficiency and is an unnecessary cost for hospitals. The purpose of this study was to evaluate the impact of a pre-OR timeout and performance pay incentive on the frequency of on-time, first surgical starts. At a single Veterans Affairs Medical Center, we implemented a pre-OR timeout in the form of a safety-briefing checklist and a modest performance pay incentive for on-time starts (>90% compliance) for attending surgeons. Data were collected on all first-start cases beginning before implementation in 2008 and continued through 2015. Each year, an average of 960 first starts occurred across nine surgical divisions. Before implementation of either the timeout or pay incentive, only 15% of cases started on time, and by 2015, greater than 72% were on time (P < 0.001). Over the study period, there were significant improvements in on-time starts (P = 0.01), of delays <15 min (P = 0.01), and of delays 16 to 30 min (P = 0.04). The trends for delays of 31 to 60 min or >60 min were not significant (P = 0.31; P = 0.81). Assuming a loss of 7 min per case for delays <15 min and 20 min per case for delays of 16 to 30 min, the total OR time saved from implementing these measures was 37,556 min. At an estimated cost of $20/min, gross savings from this project were $751,120. Implementation of a pre-OR timeout and performance pay for on-time starts significantly improves OR utilization and reduces unnecessary costs. Published by Elsevier Inc.

Control of rRNA and tRNA syntheses in Escherichia coli by guanosine tetraphosphate.

PubMed Central

Ryals, J; Little, R; Bremer, H

1982-01-01

The expression of stable RNA (rRNA and tRNA) genes and the concentration of guanosine tetraphosphate (ppGpp) were measured in an isogenic pair of relA+ and relA derivatives of Escherichia coli B/r. The cells were either growing exponentially at different rates or subject to amino acid starvation when they were measured. The specific stable RNA gene activity (rs/rt, the rate of rRNA and tRNA synthesis relative to the total instantaneous rate of RNA synthesis) was found to decrease from 1.0 at a ppGpp concentration of 0 (extrapolated value) to 0.24 at saturating concentrations of ppGpp (above 100 pmoles per optical density at 460 nm unit of cell mass). The same relationship between the rs/rt ratio and ppGpp concentration was obtained independent of the physiological state of the bacteria (i.e., independent of the growth rate or of amino acid starvation) and independent of the relA allele. It can be concluded that ppGpp is an effector for stable RNA gene control and that stable RNA genes are not controlled by factors other than the ppGpp-mediated system. The results were shown to be qualitatively and quantitatively consistent with data on in vitro rRNA gene control by ppGpp, and they were interpreted in the light of reported ideas derived from those in vitro experiments. PMID:6179924

Characterization of hydrocortisone biometabolites and 18S rRNA gene in Chlamydomonas reinhardtii cultures.

PubMed

Ghasemi, Younes; Rasoul-Amini, Sara; Morowvat, Mohammad Hossein; Raee, Mohammad Javad; Ghoshoon, Mohammad Bagher; Nouri, Fatemeh; Negintaji, Narges; Parvizi, Rezvan; Mosavi-Azam, Seyed Bagher

2008-10-31

A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1). This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25 degrees C for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17 beta-Dihydroxyandrost-4-en-3-one (2), 11 beta-hydroxyandrost-4-en-3,17-dione (3), 11 beta,17 alpha,20 beta,21-tetrahydroxypregn-4-en-3-one (4) and prednisolone (5) were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation.

PubMed

Wang, R F; Cao, W W; Cerniglia, C E

1996-01-01

In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).

Comparative analysis of bacteria associated with different mosses by 16S rRNA and 16S rDNA sequencing.

PubMed

Tian, Yang; Li, Yan Hong

2017-01-01

To understand the differences of the bacteria associated with different mosses, a phylogenetic study of bacterial communities in three mosses was carried out based on 16S rDNA and 16S rRNA sequencing. The mosses used were Hygroamblystegium noterophilum, Entodon compressus and Grimmia montana, representing hygrophyte, shady plant and xerophyte, respectively. In total, the operational taxonomic units (OTUs), richness and diversity were different regardless of the moss species and the library level. All the examined 1183 clones were assigned to 248 OTUs, 56 genera were assigned in rDNA libraries and 23 genera were determined at the rRNA level. Proteobacteria and Bacteroidetes were considered as the most dominant phyla in all the libraries, whereas abundant Actinobacteria and Acidobacteria were detected in the rDNA library of Entodon compressus and approximately 24.7% clones were assigned to Candidate division TM7 in Grimmia montana at rRNA level. The heatmap showed the bacterial profiles derived from rRNA and rDNA were partly overlapping. However, the principle component analysis of all the profiles derived from rDNA showed sharper differences between the different mosses than that of rRNA-based profiles. This suggests that the metabolically active bacterial compositions in different mosses were more phylogenetically similar and the differences of the bacteria associated with different mosses were mainly detected at the rDNA level. Obtained results clearly demonstrate that combination of 16S rDNA and 16S rRNA sequencing is preferred approach to have a good understanding on the constitution of the microbial communities in mosses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth.

PubMed

Hotto, Amber M; Huston, Zoe E; Stern, David B

2010-09-29

The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs) in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. AS5-overexpressing (AS5ox) plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT) and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

Comprehensive Analysis of Bacterial Flora in Postoperative Maxillary Cyst Fluid by 16S rRNA Gene and Culture Methods

PubMed Central

Sano, Naoto; Yamashita, Yoshio; Fukuda, Kazumasa; Taniguchi, Hatsumi; Goto, Masaaki; Miyamoto, Hiroshi

2012-01-01

Intracystic fluid was aseptically collected from 11 patients with postoperative maxillary cyst (POMC), and DNA was extracted from the POMC fluid. Bacterial species were identified by sequencing after cloning of approximately 580 bp of the 16S rRNA gene. Identification of pathogenic bacteria was also performed by culture methods. The phylogenetic identity was determined by sequencing 517–596 bp in each of the 1139 16S rRNA gene clones. A total of 1114 clones were classified while the remaining 25 clones were unclassified. A total of 103 bacterial species belonging to 42 genera were identified in POMC fluid samples by 16S rRNA gene analysis. Species of Prevotella (91%), Neisseria (73%), Fusobacterium (73%), Porphyromonas (73%), and Propionibacterium (73%) were found to be highly prevalent in all patients. Streptococcus mitis (64%), Fusobacterium nucleatum (55%), Propionibacterium acnes (55%), Staphylococcus capitis (55%), and Streptococcus salivarius (55%) were detected in more than 6 of the 11 patients. The results obtained by the culture method were different from those obtained by 16S rRNA gene analysis, but both approaches may be necessary for the identification of pathogens, especially of bacteria that are difficult to detect by culture methods, and the development of rational treatments for patients with POMC. PMID:22685668

Pre-admission criteria and pre-clinical achievement: Can they predict medical students performance in the clinical phase?

PubMed

Salem, Raneem O; Al-Mously, Najwa; AlFadil, Sara; Baalash, Amal

2016-01-01

Various factors affect medical students' performance during clinical phase. Identifying these factors would help in mentoring weak students and help in selection process for residency programmes. Our study objective is to evaluate the impact of pre-admission criteria, and pre-clinical grade point average (GPA) on undergraduate medical students' performance during clinical phase. This study has a cross-sectional design that includes fifth- and sixth-year female medical students (71). Data of clinical and pre-clinical GPA in medical school and pre-admission to medical school tests scores were collected. A significant correlation between clinical GPA with the pre-clinical GPA was observed (p < 0.05). Such significant correlation was not seen with other variables under study. A regression analysis was performed, and the only significant predictor of students clinical performance was the pre-clinical GPA (p < 0.001). However, no significant difference between students' clinical and pre-clinical GPA for both cohorts was observed (p > 0.05). Pre-clinical GPA is strongly correlated with and can predict medical students' performance during clinical years. Our study highlighted the importance of evaluating the academic performances of students in pre-clinical years before they move into clinical years in order to identify weak students to mentor them and monitor their progress.

Ovarian reaction and estrus manifestation in delayed puberty gilts after treatment with equine chorionic gonadotropin

USDA-ARS?s Scientific Manuscript database

Prolonged pre-insemination anestrus (estrus not detected until 8 mo of age, i.e. delayed puberty) is the major reason for culling about 30% of the total number of gilts selected for reproduction at the large breeding farm units in Vojvodina (Republic of Serbia). It is important to determine whether...

Leveraging delay discounting for health: Can time delays influence food choice?

PubMed

Appelhans, Bradley M; French, Simone A; Olinger, Tamara; Bogucki, Michael; Janssen, Imke; Avery-Mamer, Elizabeth F; Powell, Lisa M

2018-07-01

Delay discounting, the tendency to choose smaller immediate rewards over larger delayed rewards, is theorized to promote consumption of immediately rewarding but unhealthy foods at the expense of long-term weight maintenance and nutritional health. An untested implication of delay discounting models of decision-making is that selectively delaying access to less healthy foods may promote selection of healthier (immediately available) alternatives, even if they may be less desirable. The current study tested this hypothesis by measuring healthy versus regular vending machine snack purchasing before and during the implementation of a 25-s time delay on the delivery of regular snacks. Purchasing was also examined under a $0.25 discount on healthy snacks, a $0.25 tax on regular snacks, and the combination of both pricing interventions with the 25-s time delay. Across 32,019 vending sales from three separate vending locations, the 25-s time delay increased healthy snack purchasing from 40.1% to 42.5%, which was comparable to the impact of a $0.25 discount (43.0%). Combining the delay and the discount had a roughly additive effect (46.0%). However, the strongest effects were seen under the $0.25 tax on regular snacks (53.7%) and the combination of the delay and the tax (50.2%). Intervention effects varied substantially between vending locations. Importantly, time delays did not harm overall vending sales or revenue, which is relevant to the real-world feasibility of this intervention. More investigation is needed to better understand how the impact of time delays on food choice varies across populations, evaluate the effects of time delays on beverage vending choices, and extend this approach to food choices in contexts other than vending machines. ClinicalTrials.gov, NCT02359916. Copyright © 2018 Elsevier Ltd. All rights reserved.

H0LiCOW - V. New COSMOGRAIL time delays of HE 0435-1223: H0 to 3.8 per cent precision from strong lensing in a flat ΛCDM model

NASA Astrophysics Data System (ADS)

Bonvin, V.; Courbin, F.; Suyu, S. H.; Marshall, P. J.; Rusu, C. E.; Sluse, D.; Tewes, M.; Wong, K. C.; Collett, T.; Fassnacht, C. D.; Treu, T.; Auger, M. W.; Hilbert, S.; Koopmans, L. V. E.; Meylan, G.; Rumbaugh, N.; Sonnenfeld, A.; Spiniello, C.

2017-03-01

We present a new measurement of the Hubble Constant H0 and other cosmological parameters based on the joint analysis of three multiply imaged quasar systems with measured gravitational time delays. First, we measure the time delay of HE 0435-1223 from 13-yr light curves obtained as part of the COSMOGRAIL project. Companion papers detail the modelling of the main deflectors and line-of-sight effects, and how these data are combined to determine the time-delay distance of HE 0435-1223. Crucially, the measurements are carried out blindly with respect to cosmological parameters in order to avoid confirmation bias. We then combine the time-delay distance of HE 0435-1223 with previous measurements from systems B1608+656 and RXJ1131-1231 to create a Time Delay Strong Lensing probe (TDSL). In flat Λ cold dark matter (ΛCDM) with free matter and energy density, we find H0 =71.9^{+2.4}_{-3.0} {km s^{-1} Mpc^{-1}} and Ω _{Λ }=0.62^{+0.24}_{-0.35}. This measurement is completely independent of, and in agreement with, the local distance ladder measurements of H0. We explore more general cosmological models combining TDSL with other probes, illustrating its power to break degeneracies inherent to other methods. The joint constraints from TDSL and Planck are H0 = 69.2_{-2.2}^{+1.4} {km s^{-1} Mpc^{-1}}, Ω _{Λ }=0.70_{-0.01}^{+0.01} and Ω _k=0.003_{-0.006}^{+0.004} in open ΛCDM and H0 =79.0_{-4.2}^{+4.4} {km s^{-1} Mpc^{-1}}, Ω _de=0.77_{-0.03}^{+0.02} and w=-1.38_{-0.16}^{+0.14} in flat wCDM. In combination with Planck and baryon acoustic oscillation data, when relaxing the constraints on the numbers of relativistic species we find Neff = 3.34_{-0.21}^{+0.21} in NeffΛCDM and when relaxing the total mass of neutrinos we find Σmν ≤ 0.182 eV in mνΛCDM. Finally, in an open wCDM in combination with Planck and cosmic microwave background lensing, we find H0 =77.9_{-4.2}^{+5.0} {km s^{-1} Mpc^{-1}}, Ω _de=0.77_{-0.03}^{+0.03}, Ω _k=-0.003_{-0.004}^{+0.004} and w=-1.37_{-0.23}^{+0.18}.

Elucidating the 16S rRNA 3' boundaries and defining optimal SD/aSD pairing in Escherichia coli and Bacillus subtilis using RNA-Seq data.

PubMed

Wei, Yulong; Silke, Jordan R; Xia, Xuhua

2017-12-15

Bacterial translation initiation is influenced by base pairing between the Shine-Dalgarno (SD) sequence in the 5' UTR of mRNA and the anti-SD (aSD) sequence at the free 3' end of the 16S rRNA (3' TAIL) due to: 1) the SD/aSD sequence binding location and 2) SD/aSD binding affinity. In order to understand what makes an SD/aSD interaction optimal, we must define: 1) terminus of the 3' TAIL and 2) extent of the core aSD sequence within the 3' TAIL. Our approach to characterize these components in Escherichia coli and Bacillus subtilis involves 1) mapping the 3' boundary of the mature 16S rRNA using high-throughput RNA sequencing (RNA-Seq), and 2) identifying the segment within the 3' TAIL that is strongly preferred in SD/aSD pairing. Using RNA-Seq data, we resolve previous discrepancies in the reported 3' TAIL in B. subtilis and recovered the established 3' TAIL in E. coli. Furthermore, we extend previous studies to suggest that both highly and lowly expressed genes favor SD sequences with intermediate binding affinity, but this trend is exclusive to SD sequences that complement the core aSD sequences defined herein.

Representing delayed force feedback as a combination of current and delayed states.

PubMed

Avraham, Guy; Mawase, Firas; Karniel, Amir; Shmuelof, Lior; Donchin, Opher; Mussa-Ivaldi, Ferdinando A; Nisky, Ilana

2017-10-01

To adapt to deterministic force perturbations that depend on the current state of the hand, internal representations are formed to capture the relationships between forces experienced and motion. However, information from multiple modalities travels at different rates, resulting in intermodal delays that require compensation for these internal representations to develop. To understand how these delays are represented by the brain, we presented participants with delayed velocity-dependent force fields, i.e., forces that depend on hand velocity either 70 or 100 ms beforehand. We probed the internal representation of these delayed forces by examining the forces the participants applied to cope with the perturbations. The findings showed that for both delayed forces, the best model of internal representation consisted of a delayed velocity and current position and velocity. We show that participants relied initially on the current state, but with adaptation, the contribution of the delayed representation to adaptation increased. After adaptation, when the participants were asked to make movements with a higher velocity for which they had not previously experienced with the delayed force field, they applied forces that were consistent with current position and velocity as well as delayed velocity representations. This suggests that the sensorimotor system represents delayed force feedback using current and delayed state information and that it uses this representation when generalizing to faster movements. NEW & NOTEWORTHY The brain compensates for forces in the body and the environment to control movements, but it is unclear how it does so given the inherent delays in information transmission and processing. We examined how participants cope with delayed forces that depend on their arm velocity 70 or 100 ms beforehand. After adaptation, participants applied opposing forces that revealed a partially correct representation of the perturbation using the current and the

Tafamidis delays disease progression in patients with early stage transthyretin familial amyloid polyneuropathy: additional supportive analyses from the pivotal trial.

PubMed

Keohane, Denis; Schwartz, Jeffrey; Gundapaneni, Balarama; Stewart, Michelle; Amass, Leslie

2017-03-01

Tafamidis, a non-NSAID highly specific transthyretin stabilizer, delayed neurologic disease progression as measured by Neuropathy Impairment Score-Lower Limbs (NIS-LL) in an 18-month, double-blind, placebo-controlled randomized trial in 128 patients with early-stage transthyretin V30M familial amyloid polyneuropathy (ATTRV30M-FAP). The current post hoc analyses aimed to further evaluate the effects of tafamidis in delaying ATTRV30M-FAP progression in this trial. Pre-specified, repeated-measures analysis of change from baseline in NIS-LL in this trial (ClinicalTrials.gov NCT00409175) was repeated with addition of baseline as covariate and multiple imputation analysis for missing data by treatment group. Change in NIS-LL plus three small-fiber nerve tests (NIS-LL + Σ3) and NIS-LL plus seven nerve tests (NIS-LL + Σ7) were assessed without baseline as covariate. Treatment outcomes over the NIS-LL, Σ3, Σ7, modified body mass index and Norfolk Quality of Life-Diabetic Neuropathy Total Quality of Life Score were also examined using multivariate analysis techniques. Neuropathy progression based on NIS-LL change from baseline to Month 18 remained significantly reduced for tafamidis versus placebo in the baseline-adjusted and multiple imputation analyses. NIS-LL + Σ3 and NIS-LL + Σ7 captured significant treatment group differences. Multivariate analyses provided strong statistical evidence for a superior tafamidis treatment effect. These supportive analyses confirm that tafamidis delays neurologic progression in early-stage ATTRV30M-FAP. NCT00409175.

Delayed Gamma-ray Spectroscopy for Safeguards Applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mozin, Vladimir

The delayed gamma-ray assay technique utilizes an external neutron source (D-D, D-T, or electron accelerator-driven), and high-resolution gamma-ray spectrometers to perform characterization of SNM materials behind shielding and in complex configurations such as a nuclear fuel assembly. High-energy delayed gamma-rays (2.5 MeV and above) observed following the active interrogation, provide a signature for identification of specific fissionable isotopes in a mixed sample, and determine their relative content. Potential safeguards applications of this method are: 1) characterization of fresh and spent nuclear fuel assemblies in wet or dry storage; 2) analysis of uranium enrichment in shielded or non-characterized containers or inmore » the presence of a strong radioactive background and plutonium contamination; 3) characterization of bulk and waste and product streams at SNM processing plants. Extended applications can include warhead confirmation and warhead dismantlement confirmation in the arms control area, as well as SNM diagnostics for the emergency response needs. In FY16 and prior years, the project has demonstrated the delayed gamma-ray measurement technique as a robust SNM assay concept. A series of empirical and modeling studies were conducted to characterize its response sensitivity, develop analysis methodologies, and analyze applications. Extensive experimental tests involving weapons-grade Pu, HEU and depleted uranium samples were completed at the Idaho Accelerator Center and LLNL Dome facilities for various interrogation time regimes and effects of the neutron source parameters. A dedicated delayed gamma-ray response modeling technique was developed and its elements were benchmarked in representative experimental studies, including highresolution gamma-ray measurements of spent fuel at the CLAB facility in Sweden. The objective of the R&D effort in FY17 is to experimentally demonstrate the feasibility of the delayed gamma-ray interrogation of shielded

"Pre-Semantic" Cognition Revisited: Critical Differences between Semantic Aphasia and Semantic Dementia

ERIC Educational Resources Information Center

Jefferies, Elizabeth; Rogers, Timothy T.; Hopper, Samantha; Lambon Ralph, Matthew A.

2010-01-01

Patients with semantic dementia show a specific pattern of impairment on both verbal and non-verbal "pre-semantic" tasks, e.g., reading aloud, past tense generation, spelling to dictation, lexical decision, object decision, colour decision and delayed picture copying. All seven tasks are characterised by poorer performance for items that are…

Skin Microbiome Surveys Are Strongly Influenced by Experimental Design.

PubMed

Meisel, Jacquelyn S; Hannigan, Geoffrey D; Tyldsley, Amanda S; SanMiguel, Adam J; Hodkinson, Brendan P; Zheng, Qi; Grice, Elizabeth A

2016-05-01

Culture-independent studies to characterize skin microbiota are increasingly common, due in part to affordable and accessible sequencing and analysis platforms. Compared to culture-based techniques, DNA sequencing of the bacterial 16S ribosomal RNA (rRNA) gene or whole metagenome shotgun (WMS) sequencing provides more precise microbial community characterizations. Most widely used protocols were developed to characterize microbiota of other habitats (i.e., gastrointestinal) and have not been systematically compared for their utility in skin microbiome surveys. Here we establish a resource for the cutaneous research community to guide experimental design in characterizing skin microbiota. We compare two widely sequenced regions of the 16S rRNA gene to WMS sequencing for recapitulating skin microbiome community composition, diversity, and genetic functional enrichment. We show that WMS sequencing most accurately recapitulates microbial communities, but sequencing of hypervariable regions 1-3 of the 16S rRNA gene provides highly similar results. Sequencing of hypervariable region 4 poorly captures skin commensal microbiota, especially Propionibacterium. WMS sequencing, which is resource and cost intensive, provides evidence of a community's functional potential; however, metagenome predictions based on 16S rRNA sequence tags closely approximate WMS genetic functional profiles. This study highlights the importance of experimental design for downstream results in skin microbiome surveys. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Redescriptions of three trachelocercid ciliates (Protista, Ciliophora, Karyorelictea), with notes on their phylogeny based on small subunit rRNA gene sequences.

PubMed

Yan, Ying; Xu, Yuan; Yi, Zhenzhen; Warren, Alan

2013-09-01

Three trachelocercid ciliates, Kovalevaia sulcata (Kovaleva, 1966) Foissner, 1997, Trachelocerca sagitta (Müller, 1786) Ehrenberg, 1840 and Trachelocerca ditis (Wright, 1982) Foissner, 1996, isolated from two coastal habitats at Qingdao, China, were investigated using live observation and silver impregnation methods. Data on their infraciliature and morphology are supplied. The small subunit rRNA (SSU rRNA) genes of K. sulcata and Trachelocerca sagitta were sequenced for the first time. Phylogenetic analyses based on SSU rRNA gene sequence data indicate that both organisms, and the previously sequenced Trachelocerca ditis, are located within the trachelocercid assemblage and that K. sulcata is sister to an unidentified taxon forming a clade that is basal to the core trachelocercids.

Long-Range Pre-Thermal Time Crystals

NASA Astrophysics Data System (ADS)

Machado, Francisco; Else, Dominic V.; Nayak, Chetan; Yao, Norman

Driven quantum systems have recently enabled the realization of a discrete time crystal - an intrinsically out-of-equilibrium phase of matter that spontaneously breaks time translation symmetry. One strategy to prevent the drive-induced, runaway heating of the time crystal phase is the presence of strong disorder leading to many-body localization. A simpler disorder-less approach is to work in the pre-thermal regime where time crystalline order can persist to long times, before ultimately being destroyed by thermalization. In this talk, we will consider the interplay between long-range interactions, dimensionality, and pre-thermal time-translation symmetry breaking. As an example, we will consider the phase diagram of a 1D long-range pre-thermal time crystal.

Mpp10 represents a platform for the interaction of multiple factors within the 90S pre-ribosome

PubMed Central

Kharde, Satyavati; Ahmed, Yasar Luqman; Stier, Gunter; Kunze, Ruth; Sinning, Irmgard

2017-01-01

In eukaryotes, ribosome assembly is a highly complex process that involves more than 200 assembly factors that ensure the folding, modification and processing of the different rRNA species as well as the timely association of ribosomal proteins. One of these factors, Mpp10 associates with Imp3 and Imp4 to form a complex that is essential for the normal production of the 18S rRNA. Here we report the crystal structure of a complex between Imp4 and a short helical element of Mpp10 to a resolution of 1.88 Å. Furthermore, we extend the interaction network of Mpp10 and characterize two novel interactions. Mpp10 is able to bind the ribosome biogenesis factor Utp3/Sas10 through two conserved motifs in its N-terminal region. In addition, Mpp10 interacts with the ribosomal protein S5/uS7 using a short stretch within an acidic loop region. Thus, our findings reveal that Mpp10 provides a platform for the simultaneous interaction with multiple proteins in the 90S pre-ribosome. PMID:28813493

Toward heterogeneity in feedforward network with synaptic delays based on FitzHugh-Nagumo model

NASA Astrophysics Data System (ADS)

Qin, Ying-Mei; Men, Cong; Zhao, Jia; Han, Chun-Xiao; Che, Yan-Qiu

2018-01-01

We focus on the role of heterogeneity on the propagation of firing patterns in feedforward network (FFN). Effects of heterogeneities both in parameters of neuronal excitability and synaptic delays are investigated systematically. Neuronal heterogeneity is found to modulate firing rates and spiking regularity by changing the excitability of the network. Synaptic delays are strongly related with desynchronized and synchronized firing patterns of the FFN, which indicate that synaptic delays may play a significant role in bridging rate coding and temporal coding. Furthermore, quasi-coherence resonance (quasi-CR) phenomenon is observed in the parameter domain of connection probability and delay-heterogeneity. All these phenomena above enable a detailed characterization of neuronal heterogeneity in FFN, which may play an indispensable role in reproducing the important properties of in vivo experiments.

Delayed ejaculation

MedlinePlus

Ejaculatory incompetence; Sex - delayed ejaculation; Retarded ejaculation; Anejaculation; Infertility - delayed ejaculation ... include: Religious background that makes the person view sex as sinful Lack of attraction for a partner ...

Effects of channel tap spacing on delay-lock tracking

NASA Astrophysics Data System (ADS)

Dana, Roger A.; Milner, Brian R.; Bogusch, Robert L.

1995-12-01

High fidelity simulations of communication links operating through frequency selective fading channels require both accurate channel models and faithful reproduction of the received signal. In modern radio receivers, processing beyond the analog-to-digital converter (A/D) is done digitally, so a high fidelity simulation is actually an emulation of this digital signal processing. The 'simulation' occurs in constructing the output of the A/D. One approach to constructing the A/D output is to convolve the channel impulse response function with the combined impulse response of the transmitted modulation and the A/D. For both link simulations and hardware channel simulators, the channel impulse response function is then generated with a finite number of samples per chip, and the convolution is implemented in a tapped delay line. In this paper we discuss the effects of the channel model tap spacing on the performance of delay locked loops (DLLs) in both direct sequence and frequency hopped spread spectrum systems. A frequency selective fading channel is considered, and the channel impulse response function is constructed with an integer number of taps per modulation symbol or chip. The tracking loop time delay is computed theoretically for this tapped delay line channel model and is compared to the results of high fidelity simulations of actual DLLs. A surprising result is obtained. The performance of the DLL depends strongly on the number of taps per chip. As this number increases the DLL delay approaches the theoretical limit.

Relative expression of rRNA transcripts and 45S rDNA promoter methylation status are dysregulated in tumors in comparison with matched-normal tissues in breast cancer.

PubMed

Karahan, Gurbet; Sayar, Nilufer; Gozum, Gokcen; Bozkurt, Betul; Konu, Ozlen; Yulug, Isik G

2015-06-01

Ribosomal RNA (rRNA) expression, one of the most important factors regulating ribosome production, is primarily controlled by a CG-rich 45 S rDNA promoter. However, the DNA methylation state of the 45 S rDNA promoter, as well as its effect on rRNA gene expression in types of human cancers is controversial. In the present study we analyzed the methylation status of the rDNA promoter (-380 to +53 bp) as well as associated rRNA expression levels in breast cancer cell lines and breast tumor-normal tissue pairs. We found that the aforementioned regulatory region was extensively methylated (74-96%) in all cell lines and in 68% (13/19 tumor-normal pairs) of the tumors. Expression levels of rRNA transcripts 18 S, 28 S, 5.8 S and 45 S external transcribed spacer (45 S ETS) greatly varied in the breast cancer cell lines regardless of their methylation status. Analyses of rRNA transcript expression levels in the breast tumor and normal matched tissues showed no significant difference when normalized with TBP. On the other hand, using the geometric mean of the rRNA expression values (GM-rRNA) as reference enabled us to identify significant changes in the relative expression of rRNAs in the tissue samples. We propose GM-rRNA normalization as a novel strategy to analyze expression differences between rRNA transcripts. Accordingly, the 18S rRNA/GM-rRNA ratio was significantly higher whereas the 5.8S rRNA/GM-rRNA ratio was significantly lower in breast tumor samples than this ratio in the matched normal samples. Moreover, the 18S rRNA/GM-rRNA ratio was negatively correlated with the 45 S rDNA promoter methylation level in the normal breast tissue samples, yet not in the breast tumors. Significant correlations observed between the expression levels of rRNA transcripts in the normal samples were lost in the tumor samples. We showed that the expression of rRNA transcripts may not be based solely on promoter methylation. Carcinogenesis may cause dysregulation of the correlation

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

Willing to wait: Elevated reward-processing EEG activity associated with a greater preference for larger-but-delayed rewards.

PubMed

Pornpattananangkul, Narun; Nusslock, Robin

2016-10-01

While almost everyone discounts the value of future rewards over immediate rewards, people differ in their so-called delay-discounting. One of the several factors that may explain individual differences in delay-discounting is reward-processing. To study individual-differences in reward-processing, however, one needs to consider the heterogeneity of neural-activity at each reward-processing stage. Here using EEG, we separated reward-related neural activity into distinct reward-anticipation and reward-outcome stages using time-frequency characteristics. Thirty-seven individuals first completed a behavioral delay-discounting task. Then reward-processing EEG activity was assessed using a separate reward-learning task, called a reward time-estimation task. During this EEG task, participants were instructed to estimate time duration and were provided performance feedback on a trial-by-trial basis. Participants received monetary-reward for accurate-performance on Reward trials, but not on No-Reward trials. Reward trials, relative to No-Reward trials, enhanced EEG activity during both reward-anticipation (including, cued-locked delta power during cue-evaluation and pre-feedback alpha suppression during feedback-anticipation) and reward-outcome (including, feedback-locked delta, theta and beta power) stages. Moreover, all of these EEG indices correlated with behavioral performance in the time-estimation task, suggesting their essential roles in learning and adjusting performance to maximize winnings in a reward-learning situation. Importantly, enhanced EEG power during Reward trials, as reflected by stronger 1) pre-feedback alpha suppression, 2) feedback-locked theta and 3) feedback-locked beta, was associated with a greater preference for larger-but-delayed rewards in a separate, behavioral delay-discounting task. Results highlight the association between a stronger preference toward larger-but-delayed rewards and enhanced reward-processing. Moreover, our reward

rRNA and Poly-β-Hydroxybutyrate Dynamics in Bioreactors Subjected to Feast and Famine Cycles

PubMed Central

Frigon, Dominic; Muyzer, Gerard; van Loosdrecht, Mark; Raskin, Lutgarde

2006-01-01

Feast and famine cycles are common in activated sludge wastewater treatment systems, and they select for bacteria that accumulate storage compounds, such as poly-β-hydroxybutyrate (PHB). Previous studies have shown that variations in influent substrate concentrations force bacteria to accumulate high levels of rRNA compared to the levels in bacteria grown in chemostats. Therefore, it can be hypothesized that bacteria accumulate more rRNA when they are subjected to feast and famine cycles. However, PHB-accumulating bacteria can form biomass (grow) throughout a feast and famine cycle and thus have a lower peak biomass formation rate during the cycle. Consequently, PHB-accumulating bacteria may accumulate less rRNA when they are subjected to feast and famine cycles than bacteria that are not capable of PHB accumulation. These hypotheses were tested with Wautersia eutropha H16 (wild type) and W. eutropha PHB-4 (a mutant not capable of accumulating PHB) grown in chemostat and semibatch reactors. For both strains, the cellular RNA level was higher when the organism was grown in semibatch reactors than when it was grown in chemostats, and the specific biomass formation rates during the feast phase were linearly related to the cellular RNA levels for cultures. Although the two strains exhibited maximum uptake rates when they were grown in semibatch reactors, the wild-type strain responded much more rapidly to the addition of fresh medium than the mutant responded. Furthermore, the chemostat-grown mutant culture was unable to exhibit maximum substrate uptake rates when it was subjected to pulse-wise addition of fresh medium. These data show that the ability to accumulate PHB does not prevent bacteria from accumulating high levels of rRNA when they are subjected to feast and famine cycles. Our results also demonstrate that the ability to accumulate PHB makes the bacteria more responsive to sudden increases in substrate concentrations, which explains their ecological

rRNA and poly-beta-hydroxybutyrate dynamics in bioreactors subjected to feast and famine cycles.

PubMed

Frigon, Dominic; Muyzer, Gerard; van Loosdrecht, Mark; Raskin, Lutgarde

2006-04-01

Feast and famine cycles are common in activated sludge wastewater treatment systems, and they select for bacteria that accumulate storage compounds, such as poly-beta-hydroxybutyrate (PHB). Previous studies have shown that variations in influent substrate concentrations force bacteria to accumulate high levels of rRNA compared to the levels in bacteria grown in chemostats. Therefore, it can be hypothesized that bacteria accumulate more rRNA when they are subjected to feast and famine cycles. However, PHB-accumulating bacteria can form biomass (grow) throughout a feast and famine cycle and thus have a lower peak biomass formation rate during the cycle. Consequently, PHB-accumulating bacteria may accumulate less rRNA when they are subjected to feast and famine cycles than bacteria that are not capable of PHB accumulation. These hypotheses were tested with Wautersia eutropha H16 (wild type) and W. eutropha PHB-4 (a mutant not capable of accumulating PHB) grown in chemostat and semibatch reactors. For both strains, the cellular RNA level was higher when the organism was grown in semibatch reactors than when it was grown in chemostats, and the specific biomass formation rates during the feast phase were linearly related to the cellular RNA levels for cultures. Although the two strains exhibited maximum uptake rates when they were grown in semibatch reactors, the wild-type strain responded much more rapidly to the addition of fresh medium than the mutant responded. Furthermore, the chemostat-grown mutant culture was unable to exhibit maximum substrate uptake rates when it was subjected to pulse-wise addition of fresh medium. These data show that the ability to accumulate PHB does not prevent bacteria from accumulating high levels of rRNA when they are subjected to feast and famine cycles. Our results also demonstrate that the ability to accumulate PHB makes the bacteria more responsive to sudden increases in substrate concentrations, which explains their ecological

rRNA gene restriction patterns as an epidemiological marker in nosocomial outbreaks of Staphylococcus aureus infections.

PubMed

Meugnier, H; Fernandez, M P; Bes, M; Brun, Y; Bornstein, N; Freney, J; Fleurette, J

1993-01-01

rRNA gene restriction patterns (ribotyping) were compared with phage typing, serotyping, enterotoxins and exfoliatin production in the analysis of 26 Staphylococcus aureus strains isolated from two different nosocomial outbreaks. Total DNA was cleaved by EcoRI restriction endonuclease. After agarose gel electrophoresis and Southern transfer, the hybridization of the membranes was done with radiolabelled 16S rRNA gene from Bacillus subtilis inserted into a plasmid vector. Six to 13 fragments were visualized. A core of common fragments was discerned for all strains tested. A full correlation between ribotyping and conventional markers was observed in only one of the outbreaks studied. In both outbreaks, ribotyping proved helpful in characterizing otherwise untypable strains.

Digital time delay

DOEpatents

Martin, A.D.

1986-05-09

Method and apparatus are provided for generating an output pulse following a trigger pulse at a time delay interval preset with a resolution which is high relative to a low resolution available from supplied clock pulses. A first lumped constant delay provides a first output signal at predetermined interpolation intervals corresponding to the desired high resolution time interval. Latching circuits latch the high resolution data to form a first synchronizing data set. A selected time interval has been preset to internal counters and corrected for circuit propagation delay times having the same order of magnitude as the desired high resolution. Internal system clock pulses count down the counters to generate an internal pulse delayed by an internal which is functionally related to the preset time interval. A second LCD corrects the internal signal with the high resolution time delay. A second internal pulse is then applied to a third LCD to generate a second set of synchronizing data which is complementary with the first set of synchronizing data for presentation to logic circuits. The logic circuits further delay the internal output signal with the internal pulses. The final delayed output signal thereafter enables the output pulse generator to produce the desired output pulse at the preset time delay interval following input of the trigger pulse.

Regulation of Plasmodium yoelii oocyst development by strain- and stage-specific small-subunit rRNA.

PubMed

Qi, Yanwei; Zhu, Feng; Eastman, Richard T; Fu, Young; Zilversmit, Martine; Pattaradilokrat, Sittiporn; Hong, Lingxian; Liu, Shengfa; McCutchan, Thomas F; Pan, Weiqing; Xu, Wenyue; Li, Jian; Huang, Fusheng; Su, Xin-zhuan

2015-03-10

One unique feature of malaria parasites is the differential transcription of structurally distinct rRNA (rRNA) genes at different developmental stages: the A-type genes are transcribed mainly in asexual stages, whereas the S-type genes are expressed mostly in sexual or mosquito stages. Conclusive functional evidence of different rRNAs in regulating stage-specific parasite development, however, is still absent. Here we performed genetic crosses of Plasmodium yoelii parasites with one parent having an oocyst development defect (ODD) phenotype and another producing normal oocysts to identify the gene(s) contributing to the ODD. The parent with ODD--characterized as having small oocysts and lacking infective sporozoites--was obtained after introduction of a plasmid with a green fluorescent protein gene into the parasite genome and subsequent passages in mice. Quantitative trait locus analysis of genome-wide microsatellite genotypes of 48 progeny from the crosses linked an ~200-kb segment on chromosome 6 containing one of the S-type genes (D-type small subunit rRNA gene [D-ssu]) to the ODD. Fine mapping of the plasmid integration site, gene expression pattern, and gene knockout experiments demonstrated that disruption of the D-ssu gene caused the ODD phenotype. Interestingly, introduction of the D-ssu gene into the same parasite strain (self), but not into a different subspecies, significantly affected or completely ablated oocyst development, suggesting a stage- and subspecies (strain)-specific regulation of oocyst development by D-ssu. This study demonstrates that P. yoelii D-ssu is essential for normal oocyst and sporozoite development and that variation in the D-ssu sequence can have dramatic effects on parasite development. Malaria parasites are the only known organisms that express structurally distinct rRNA genes at different developmental stages. The differential expression of these genes suggests that they play unique roles during the complex life cycle of the

Nucleosome Translational Position, Not Histone Acetylation, Determines TFIIIA Binding to Nucleosomal Xenopus laevis 5S rRNA Genes

PubMed Central

Howe, LeAnn; Ausió, Juan

1998-01-01

We sought to study the binding constraints placed on the nine-zinc-finger protein transcription factor IIIA (TFIIIA) by a histone octamer. To this end, five overlapping fragments of the Xenopus laevis oocyte and somatic 5S rRNA genes were reconstituted into nucleosomes, and it was subsequently shown that nucleosome translational positioning is a major determinant of the binding of TFIIIA to the 5S rRNA genes. Furthermore, it was found that histone acetylation cannot override the TFIIIA binding constraints imposed by unfavorable translational positions. PMID:9488430

Rapid in situ hybridization technique using 16S rRNA segments for detecting and differentiating the closely related gram-positive organisms Bacillus polymyxa and Bacillus macerans

NASA Technical Reports Server (NTRS)

Jurtshuk, R. J.; Blick, M.; Bresser, J.; Fox, G. E.; Jurtshuk, P. Jr

1992-01-01

A rapid, sensitive, inexpensive in situ hybridization technique, using 30-mer 16S rRNA probes, can specifically differentiate two closely related Bacillus spp., B. polymyxa and B. macerans. The 16S rRNA probes were labeled with a rhodamine derivative (Texas Red), and quantitative fluorescence measurements were made on individual bacterial cells. The microscopic fields analyzed were selected by phase-contrast microscopy, and the fluorescence imaging analyses were performed on 16 to 67 individual cells. The labeled 16S rRNA probe, POL, whose sequence was a 100% match with B. polymyxa 16S rRNA but only a 60% match with B. macerans 16S rRNA, gave quantitative fluorescence ratio measurements that were 34.8-fold higher for B. polymyxa cells than for B. macerans cells. Conversely, the labeled probe, MAC, which matched B. polymyxa 16S rRNA in 86.6% of its positions and B. macerans 16S rRNA in 100% of its positions, gave quantitative fluorescence measurements that were 59.3-fold higher in B. macerans cells than in B. polymyxa cells. Control probes, whose 16S rRNA sequence segment (P-M) was present in both B. polymyxa and B. macerans as well as a panprokaryotic probe (16S), having a 100% match with all known bacteria, hybridized equally well with both organisms. These latter hybridizations generated very high fluorescence signals, but their comparative fluorescence ratios (the differences between two organisms) were low. The control paneukaryotic probe (28S), which had less than 30% identity for both B. macerans and B. polymyxa, did not hybridize with either organism.

Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association.

PubMed

Pulk, Arto; Maiväli, Ulo; Remme, Jaanus

2006-05-01

The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts.

Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association

PubMed Central

Pulk, Arto; Maiväli, Ülo; Remme, Jaanus

2006-01-01

The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts. PMID:16556933

Midwives in India: a delayed cord clamping intervention using simulation.

PubMed

Faucher, M A; Riley, C; Prater, L; Reddy, M P

2016-09-01

Iron deficiency is a prevalent health problem in India affecting women and newborns. Delayed umbilical cord clamping at birth is a safe and effective means for increasing serum iron levels in newborns up to 6 months of age. The study aim was to increase the utilization of delayed cord clamping in a group of midwives working in Hyderabad, India. A single group pre- and post-test design was used to evaluate knowledge, beliefs and practice before and after a delayed cord clamping intervention including follow-up at 10 months after the original intervention. The intervention included lectures and simulation. Results show significant increases in knowledge and positive beliefs about the practice of delayed cord clamping. Simulation was effective for eliciting important feedback related to learning. Results represent a small group of midwives working with a non-profit foundation in Southern India. Language discordancy and cultural norms in this group of midwives may have influenced results. Knowledge, beliefs and practice related to delayed cord clamping were all significantly improved after the intervention. The Knowledge to Action framework using simulation is an effective cross-cultural method for implementing education about evidence-based practice. Midwives are invested in learning practices that promote public health. Changing institutional policy may have limitations without first considering normative practice. Using simulation combined with institutional health policy appears to result in significant uptake of practice change. Qualitative studies exploring the interconnections between cultural norms and decision making may be informative about promoting practice change particularly in this setting. Upscaling midwifery has been recommended to improve maternal and child health in India. © 2016 International Council of Nurses.

Detection of coupling delay: A problem not yet solved

NASA Astrophysics Data System (ADS)

Coufal, David; Jakubík, Jozef; Jajcay, Nikola; Hlinka, Jaroslav; Krakovská, Anna; Paluš, Milan

2017-08-01

Nonparametric detection of coupling delay in unidirectionally and bidirectionally coupled nonlinear dynamical systems is examined. Both continuous and discrete-time systems are considered. Two methods of detection are assessed—the method based on conditional mutual information—the CMI method (also known as the transfer entropy method) and the method of convergent cross mapping—the CCM method. Computer simulations show that neither method is generally reliable in the detection of coupling delays. For continuous-time chaotic systems, the CMI method appears to be more sensitive and applicable in a broader range of coupling parameters than the CCM method. In the case of tested discrete-time dynamical systems, the CCM method has been found to be more sensitive, while the CMI method required much stronger coupling strength in order to bring correct results. However, when studied systems contain a strong oscillatory component in their dynamics, results of both methods become ambiguous. The presented study suggests that results of the tested algorithms should be interpreted with utmost care and the nonparametric detection of coupling delay, in general, is a problem not yet solved.

Effects of additional food in a delayed predator-prey model.

PubMed

Sahoo, Banshidhar; Poria, Swarup

2015-03-01

We examine the effects of supplying additional food to predator in a gestation delay induced predator-prey system with habitat complexity. Additional food works in favor of predator growth in our model. Presence of additional food reduces the predatory attack rate to prey in the model. Supplying additional food we can control predator population. Taking time delay as bifurcation parameter the stability of the coexisting equilibrium point is analyzed. Hopf bifurcation analysis is done with respect to time delay in presence of additional food. The direction of Hopf bifurcations and the stability of bifurcated periodic solutions are determined by applying the normal form theory and the center manifold theorem. The qualitative dynamical behavior of the model is simulated using experimental parameter values. It is observed that fluctuations of the population size can be controlled either by supplying additional food suitably or by increasing the degree of habitat complexity. It is pointed out that Hopf bifurcation occurs in the system when the delay crosses some critical value. This critical value of delay strongly depends on quality and quantity of supplied additional food. Therefore, the variation of predator population significantly effects the dynamics of the model. Model results are compared with experimental results and biological implications of the analytical findings are discussed in the conclusion section. Copyright © 2015 Elsevier Inc. All rights reserved.

Strong expectations cancel locality effects: evidence from Hindi.

PubMed

Husain, Samar; Vasishth, Shravan; Srinivasan, Narayanan

2014-01-01

Expectation-driven facilitation (Hale, 2001; Levy, 2008) and locality-driven retrieval difficulty (Gibson, 1998, 2000; Lewis & Vasishth, 2005) are widely recognized to be two critical factors in incremental sentence processing; there is accumulating evidence that both can influence processing difficulty. However, it is unclear whether and how expectations and memory interact. We first confirm a key prediction of the expectation account: a Hindi self-paced reading study shows that when an expectation for an upcoming part of speech is dashed, building a rarer structure consumes more processing time than building a less rare structure. This is a strong validation of the expectation-based account. In a second study, we show that when expectation is strong, i.e., when a particular verb is predicted, strong facilitation effects are seen when the appearance of the verb is delayed; however, when expectation is weak, i.e., when only the part of speech "verb" is predicted but a particular verb is not predicted, the facilitation disappears and a tendency towards a locality effect is seen. The interaction seen between expectation strength and distance shows that strong expectations cancel locality effects, and that weak expectations allow locality effects to emerge.

Strong Expectations Cancel Locality Effects: Evidence from Hindi

PubMed Central

Husain, Samar; Vasishth, Shravan; Srinivasan, Narayanan

2014-01-01

Expectation-driven facilitation (Hale, 2001; Levy, 2008) and locality-driven retrieval difficulty (Gibson, 1998, 2000; Lewis & Vasishth, 2005) are widely recognized to be two critical factors in incremental sentence processing; there is accumulating evidence that both can influence processing difficulty. However, it is unclear whether and how expectations and memory interact. We first confirm a key prediction of the expectation account: a Hindi self-paced reading study shows that when an expectation for an upcoming part of speech is dashed, building a rarer structure consumes more processing time than building a less rare structure. This is a strong validation of the expectation-based account. In a second study, we show that when expectation is strong, i.e., when a particular verb is predicted, strong facilitation effects are seen when the appearance of the verb is delayed; however, when expectation is weak, i.e., when only the part of speech “verb” is predicted but a particular verb is not predicted, the facilitation disappears and a tendency towards a locality effect is seen. The interaction seen between expectation strength and distance shows that strong expectations cancel locality effects, and that weak expectations allow locality effects to emerge. PMID:25010700

A framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates.

PubMed

Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin

2015-03-01

The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific

Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

PubMed Central

2011-01-01

Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. Methods 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. Results The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. Conclusions The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus. PMID:21702978

Detection of a mixed infection in a culture-negative brain abscess by broad-spectrum bacterial 16S rRNA gene PCR.

PubMed

Keller, Peter M; Rampini, Silvana K; Bloemberg, Guido V

2010-06-01

We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis.

Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin.

PubMed

McGann, Patrick; Chahine, Sarah; Okafor, Darius; Ong, Ana C; Maybank, Rosslyn; Kwak, Yoon I; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

2016-01-01

16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

16S rRNA gene-based phylogenetic microarray for simultaneous identification of members of the genus Burkholderia.

PubMed

Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo

2009-04-01

For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.

The Value of Clean Air: Comparing Discounting of Delayed Air Quality and Money Across Magnitudes.

PubMed

Berry, Meredith S; Friedel, Jonathan E; DeHart, William B; Mahamane, Salif; Jordan, Kerry E; Odum, Amy L

2017-06-01

The detrimental health effects of exposure to air pollution are well established. Fostering behavioral change concerning air quality may be challenging because the detrimental health effects of exposure to air pollution are delayed. Delay discounting, a measure of impulsive choice, encapsulates this process of choosing between the immediate conveniences of behaviors that increase pollution and the delayed consequences of prolonged exposure to poor air quality. In Experiment 1, participants completed a series of delay-discounting tasks for air quality and money. We found that participants discounted delayed air quality more than money. In Experiment 2, we investigated whether the common finding that large amounts of money are discounted less steeply than small amounts of money generalized to larger and smaller improvements in air quality. Participants discounted larger improvements in air quality less steeply than smaller improvements, indicating that the discounting of air quality shares a similar process as the discounting of money. Our results indicate that the discounting of delayed money is strongly related to the discounting of delayed air quality and that similar mechanisms may be involved in the discounting of these qualitatively different outcomes. These data are also the first to demonstrate the malleability of delay discounting of air quality, and provide important public health implications for decreasing delay discounting of air quality.

The influences of delay time on the stability of a market model with stochastic volatility

NASA Astrophysics Data System (ADS)

Li, Jiang-Cheng; Mei, Dong-Cheng

2013-02-01

The effects of the delay time on the stability of a market model are investigated, by using a modified Heston model with a cubic nonlinearity and cross-correlated noise sources. These results indicate that: (i) There is an optimal delay time τo which maximally enhances the stability of the stock price under strong demand elasticity of stock price, and maximally reduces the stability of the stock price under weak demand elasticity of stock price; (ii) The cross correlation coefficient of noises and the delay time play an opposite role on the stability for the case of the delay time <τo and the same role for the case of the delay time >τo. Moreover, the probability density function of the escape time of stock price returns, the probability density function of the returns and the correlation function of the returns are compared with other literatures.

Tandem repeats of the 5' non-transcribed spacer of Tetrahymena rDNA function as high copy number autonomous replicons in the macronucleus but do not prevent rRNA gene dosage regulation.

PubMed Central

Pan, W J; Blackburn, E H

1995-01-01

The rRNA genes in the somatic macronucleus of Tetrahymena thermophila are normally on 21 kb linear palindromic molecules (rDNA). We examined the effect on rRNA gene dosage of transforming T.thermophila macronuclei with plasmid constructs containing a pair of tandemly repeated rDNA replication origin regions unlinked to the rRNA gene. A significant proportion of the plasmid sequences were maintained as high copy circular molecules, eventually consisting solely of tandem arrays of origin regions. As reported previously for cells transformed by a construct in which the same tandem rDNA origins were linked to the rRNA gene [Yu, G.-L. and Blackburn, E. H. (1990) Mol. Cell. Biol., 10, 2070-2080], origin sequences recombined to form linear molecules bearing several tandem repeats of the origin region, as well as rRNA genes. The total number of rDNA origin sequences eventually exceeded rRNA gene copies by approximately 20- to 40-fold and the number of circular replicons carrying only rDNA origin sequences exceeded rRNA gene copies by 2- to 3-fold. However, the rRNA gene dosage was unchanged. Hence, simply monitoring the total number of rDNA origin regions is not sufficient to regulate rRNA gene copy number. Images PMID:7784211

Studies on transcription termination and splicing of the rRNA precursor in vivo in the presence of proflavine.

PubMed Central

Nielsen, O F; Carin, M; Westergaard, O

1984-01-01

In isolated nucleoli from Tetrahymena thermophila, low concentrations of the intercalating agent proflavine inhibit both transcription termination and splicing of the rRNA precursor. Proflavine also exerts an in vivo effect on the process of transcription termination under conditions, where the growth rate is only slightly reduced. Thus, approximately 40% of the rRNA precursor molecules, accumulated in nucleoli during 60 min of treatment with the drug, are longer than the normal 35S rRNA precursor. R-Loop mapping of these longer precursor molecules isolated after 30 and 60 min of incubation demonstrates that the RNA polymerases have a 50 fold lower elongation rate in the spacer region than in the coding region. Proflavine in the given concentration is found to have no significant effect on the splicing of properly terminated precursor molecules. In contrast, none of the longer non-terminated molecules are found to be spliced. These results indicate that proflavine primarily affects the process of transcription termination and that the splicing event is inhibited due to the improper termination of the precursor molecule. Images PMID:6694912

IMNGS: A comprehensive open resource of processed 16S rRNA microbial profiles for ecology and diversity studies.

PubMed

Lagkouvardos, Ilias; Joseph, Divya; Kapfhammer, Martin; Giritli, Sabahattin; Horn, Matthias; Haller, Dirk; Clavel, Thomas

2016-09-23

The SRA (Sequence Read Archive) serves as primary depository for massive amounts of Next Generation Sequencing data, and currently host over 100,000 16S rRNA gene amplicon-based microbial profiles from various host habitats and environments. This number is increasing rapidly and there is a dire need for approaches to utilize this pool of knowledge. Here we created IMNGS (Integrated Microbial Next Generation Sequencing), an innovative platform that uniformly and systematically screens for and processes all prokaryotic 16S rRNA gene amplicon datasets available in SRA and uses them to build sample-specific sequence databases and OTU-based profiles. Via a web interface, this integrative sequence resource can easily be queried by users. We show examples of how the approach allows testing the ecological importance of specific microorganisms in different hosts or ecosystems, and performing targeted diversity studies for selected taxonomic groups. The platform also offers a complete workflow for de novo analysis of users' own raw 16S rRNA gene amplicon datasets for the sake of comparison with existing data. IMNGS can be accessed at www.imngs.org.

Two-dimensional dissipative rogue waves due to time-delayed feedback in cavity nonlinear optics.

PubMed

Tlidi, Mustapha; Panajotov, Krassimir

2017-01-01

We demonstrate a way to generate two-dimensional rogue waves in two types of broad area nonlinear optical systems subject to time-delayed feedback: in the generic Lugiato-Lefever model and in the model of a broad-area surface-emitting laser with saturable absorber. The delayed feedback is found to induce a spontaneous formation of rogue waves. In the absence of delayed feedback, spatial pulses are stationary. The rogue waves are exited and controlled by the delay feedback. We characterize their formation by computing the probability distribution of the pulse height. The long-tailed statistical contribution, which is often considered as a signature of the presence of rogue waves, appears for sufficiently strong feedback. The generality of our analysis suggests that the feedback induced instability leading to the spontaneous formation of two-dimensional rogue waves is a universal phenomenon.

A Simple Method to Decode the Complete 18-5.8-28S rRNA Repeated Units of Green Algae by Genome Skimming.

PubMed

Lin, Geng-Ming; Lai, Yu-Heng; Audira, Gilbert; Hsiao, Chung-Der

2017-11-06

Green algae, Chlorella ellipsoidea , Haematococcus pluvialis and Aegagropila linnaei (Phylum Chlorophyta) were simultaneously decoded by a genomic skimming approach within 18-5.8-28S rRNA region. Whole genomic DNAs were isolated from green algae and directly subjected to low coverage genome skimming sequencing. After de novo assembly and mapping, the size of complete 18-5.8-28S rRNA repeated units for three green algae were ranged from 5785 to 6028 bp, which showed high nucleotide diversity (π is around 0.5-0.6) within ITS1 and ITS2 (Internal Transcribed Spacer) regions. Previously, the evolutional diversity of algae has been difficult to decode due to the inability design universal primers that amplify specific marker genes across diverse algal species. In this study, our method provided a rapid and universal approach to decode the 18-5.8-28S rRNA repeat unit in three green algal species. In addition, the completely sequenced 18-5.8-28S rRNA repeated units provided a solid nuclear marker for phylogenetic and evolutionary analysis for green algae for the first time.

Detection of bacterial 16S rRNA using a molecular beacon-based X sensor

PubMed Central

Gerasimova, Yulia V.; Kolpashchikov, Dmitry M.

2012-01-01

We demonstrate how a long structurally constrained RNA can be analyzed in homogeneous solution at ambient temperatures with high specificity using a sophisticated biosensor. The sensor consists of a molecular beacon probe as a signal reporter and two DNA adaptor strands, which have fragments complementary to the reporter and to the analyzed RNA. One adaptor strand uses its long RNA-binding arm to unwind the RNA secondary structure. Second adaptor strand with a short RNA-binding arm hybridizes only to a fully complementary site, thus providing high recognition specificity. Overall the three-component sensor and the target RNA form a four-stranded DNA crossover (X) structure. Using this sensor, E.coli 16S rRNA was detected in real time with the detection limit of ~ 0.17 nM. The high specificity of the analysis was proven by differentiating B.subtilus from E.coli 16S rRNA sequences. The sensor responds to the presence of the analyte within seconds. PMID:23021850

Benchmarking taxonomic assignments based on 16S rRNA gene profiling of the microbiota from commonly sampled environments.

PubMed

Almeida, Alexandre; Mitchell, Alex L; Tarkowska, Aleksandra; Finn, Robert D

2018-05-01

Taxonomic profiling of ribosomal RNA (rRNA) sequences has been the accepted norm for inferring the composition of complex microbial ecosystems. Quantitative Insights Into Microbial Ecology (QIIME) and mothur have been the most widely used taxonomic analysis tools for this purpose, with MAPseq and QIIME 2 being two recently released alternatives. However, no independent and direct comparison between these four main tools has been performed. Here, we compared the default classifiers of MAPseq, mothur, QIIME, and QIIME 2 using synthetic simulated datasets comprised of some of the most abundant genera found in the human gut, ocean, and soil environments. We evaluate their accuracy when paired with both different reference databases and variable sub-regions of the 16S rRNA gene. We show that QIIME 2 provided the best recall and F-scores at genus and family levels, together with the lowest distance estimates between the observed and simulated samples. However, MAPseq showed the highest precision, with miscall rates consistently <2%. Notably, QIIME 2 was the most computationally expensive tool, with CPU time and memory usage almost 2 and 30 times higher than MAPseq, respectively. Using the SILVA database generally yielded a higher recall than using Greengenes, while assignment results of different 16S rRNA variable sub-regions varied up to 40% between samples analysed with the same pipeline. Our results support the use of either QIIME 2 or MAPseq for optimal 16S rRNA gene profiling, and we suggest that the choice between the two should be based on the level of recall, precision, and/or computational performance required.

Can the attention training technique turn one marshmallow into two? Improving children's ability to delay gratification.

PubMed

Murray, Joanne; Theakston, Anna; Wells, Adrian

2016-02-01

The seminal Marshmallow Test (Mischel & Ebbesen, 1970) has reliably demonstrated that children who can delay gratification are more likely to be emotionally stable and successful later in life. However, this is not good news for those children who can't delay. Therefore, this study aimed to explore whether a metacognitive therapy technique, Attention Training (ATT: Wells, 1990) can improve young children's ability to delay gratification. One hundred children participated. Classes of 5-6 year olds were randomly allocated to either the ATT or a no-intervention condition and were tested pre and post-intervention on ability to delay gratification, verbal inhibition (executive control), and measures of mood. The ATT intervention significantly increased (2.64 times) delay of gratification compared to the no-intervention condition. After controlling for age and months in school, the ATT intervention and verbal inhibition task performance were significant independent predictors of delay of gratification. These results provide evidence that ATT can improve children's self-regulatory abilities with the implication that this might reduce psychological vulnerability later in life. The findings highlight the potential contribution that the Self-Regulatory Executive Function (S-REF) model could make to designing techniques to enhance children's self-regulatory processes. Copyright © 2015 Elsevier Ltd. All rights reserved.

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys

PubMed Central

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira, and Thalassolituus, as well as the Alphaproteobacterial genus Thalassospira. Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys. PMID:28567035

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys.

PubMed

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira , and Thalassolituus , as well as the Alphaproteobacterial genus Thalassospira . Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys.

Delay of Gratification, Delay Discounting and their Associations with Age, Episodic Future Thinking, and Future Time Perspective.

PubMed

Göllner, Lars M; Ballhausen, Nicola; Kliegel, Matthias; Forstmeier, Simon

2017-01-01

The delay of gratification (DoG) in children is widely investigated with an experimental procedure originally called the "marshmallow test," whereas the studies on self-regulation (SR) in adolescents and adults usually use self-report questionnaires. Delay discounting (DD) measures simplify the DoG procedure and focus on monetary rewards. The aim of this study was to investigate age differences in DoG and DD from childhood to old age using a test that is suitable for both children and adults. Furthermore, investigations were conducted on the association between DoG/DD and two future orientation constructs [future time perspective (FTP) and episodic future thinking (EFT)] as well as age differences in these constructs. Participants from five age groups (9-14, 18-25, 35-55, 65-80, 80+) participated in the study ( N = 96). While we found no age difference for DoG, DD was the lowest [i.e., self-control (SC) was the highest] in young/middle adults; however, it was the highest (i.e., SC was the lowest) in children and old/oldest adults. Furthermore, we found significant age differences for DD and FTP. As predicted, there were strong correlations between DoG and FTP and between DD and FTP, but not between DoG/DD and EFT. These results indicate that age differences in SR vary across the measures used. Individuals who generally think and act in a future-oriented manner have a stronger ability to delay gratification.

Complex community of nitrite-dependent anaerobic methane oxidation bacteria in coastal sediments of the Mai Po wetland by PCR amplification of both 16S rRNA and pmoA genes.

PubMed

Chen, Jing; Zhou, Zhichao; Gu, Ji-Dong

2015-02-01

In the present work, both 16S rRNA and pmoA gene-based PCR primers were employed successfully to study the diversity and distribution of n-damo bacteria in the surface and lower layer sediments at the coastal Mai Po wetland. The occurrence of n-damo bacteria in both the surface and subsurface sediments with high diversity was confirmed in this study. Unlike the two other known n-damo communities from coastal areas, the pmoA gene-amplified sequences in the present work clustered not only with some freshwater subclusters but also within three newly erected marine subclusters mostly, indicating the unique niche specificity of n-damo bacteria in this wetland. Results suggested vegetation affected the distribution and community structures of n-damo bacteria in the sediments and n-damo could coexist with sulfate-reducing methanotrophs in the coastal ecosystem. Community structures of the Mai Po n-damo bacteria based on 16S rRNA gene were different from those of either the freshwater or the marine. In contrast, structures of the Mai Po n-damo communities based on pmoA gene grouped with the marine ones and were clearly distinguished from the freshwater ones. The abundance of n-damo bacteria at this wetland was quantified using 16S rRNA gene PCR primers to be 2.65-6.71 × 10(5) copies/g dry sediment. Ammonium and nitrite strongly affected the community structures and distribution of n-damo bacteria in the coastal Mai Po wetland sediments.

COSMOGRAIL XVII: Time Delays for the Quadruply Imaged Quasar PG 1115+080

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bonvin, V.; et al.

We present time-delay estimates for the quadruply imaged quasar PG 1115+080. Our resuls are based on almost daily observations for seven months at the ESO MPIA 2.2m telescope at La Silla Observatory, reaching a signal-to-noise ratio of about 1000 per quasar image. In addition, we re-analyse existing light curves from the literature that we complete with an additional three seasons of monitoring with the Mercator telescope at La Palma Observatory. When exploring the possible source of bias we consider the so-called microlensing time delay, a potential source of systematic error so far never directly accounted for in previous time-delay publications.more » In fifteen years of data on PG 1115+080, we find no strong evidence of microlensing time delay. Therefore not accounting for this effect, our time-delay estimates on the individual data sets are in good agreement with each other and with the literature. Combining the data sets, we obtain the most precise time-delay estimates to date on PG 1115+080, with Dt(AB) = 8.3+1.5-1.6 days (18.7% precision), Dt(AC) = 9.9+1.1-1.1 days (11.1%) and Dt(BC) = 18.8+1.6-1.6 days (8.5%). Turning these time delays into cosmological constraints is done in a companion paper that makes use of ground-based Adaptive Optics (AO) with the Keck telescope.« less

Delayed Parturition and Altered Myometrial Progesterone Receptor Isoform A Expression in Mice Null for Kruppel-like Factor 9

USDA-ARS?s Scientific Manuscript database

Pre-term and delayed labor conditions are devastating health problems, with currently unknown etiologies. We previously showed that the transcription factor Krüppel-like factor 9 (KLF9) influences the expression and/or transcriptional activity of receptors for estrogen and progesterone in endometria...

Geometric pre-patterning based tuning of the period doubling onset strain during thin film wrinkling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saha, Sourabh K.

Wrinkling of supported thin films is an easy-to-implement and low-cost fabrication technique for generation of stretch-tunable periodic micro and nano-scale structures. However, the tunability of such structures is often limited by the emergence of an undesirable period doubled mode at high strains. Predictively tuning the onset strain for period doubling via existing techniques requires one to have extensive knowledge about the nonlinear pattern formation behavior. Herein, a geometric pre-patterning based technique is introduced to delay the onset of period doubling that can be implemented to predictively tune the onset strain even with limited system knowledge. The technique comprises pre-patterning themore » film/base bilayer with a sinusoidal pattern that has the same period as the natural wrinkle period of the system. The effectiveness of this technique has been verified via physical and computational experiments on the polydimethylsiloxane/glass bilayer system. It is observed that the period doubling onset strain can be increased from the typical value of 20% for flat films to greater than 30% with a modest pre-pattern aspect ratio (2∙amplitude/period) of 0.15. In addition, finite element simulations reveal that (i) the onset strain can be increased up to a limit by increasing the amplitude of the pre-patterns and (ii) the delaying effect can be captured entirely by the pre-pattern geometry. As a result, one can implement this technique even with limited system knowledge, such as material properties or film thickness, by simply replicating pre-existing wrinkled patterns to generate prepatterned bilayers. Thus, geometric pre-patterning is a practical scheme to suppress period doubling that can increase the operating range of stretch-tunable wrinkle-based devices by at least 50%.« less

Engine Operating Conditions and Fuel Properties on Pre-Spark Heat Release and SPI Promotion in SI Engines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Splitter, Derek A; Kaul, Brian C; Szybist, James P

This work explores the dependence of fuel ignition delay on stochastic pre-ignition (SPI). Findings are based on bulk gas thermodynamic state, where the effects of kinetically controlled bulk gas pre-spark heat release (PSHR) are correlated to SPI tendency and magnitude. Specifically, residual gas and low temperature PSHR chemistry effects and observations are explored, which are found to be indicative of bulk gas conditions required for strong SPI events. Analyzed events range from non-knocking SPI to knocking SPI and even detonation SPI events in excess of 325 bar peak cylinder pressure. The work illustrates that singular SPI event count and magnitudemore » are found to be proportional to PSHR of the bulk gas mixture and residual gas fraction. Cycle-to-cycle variability in trapped residual mass and temperature are found to impose variability in singular SPI event count and magnitude. However, clusters and short lived bursts of multiple SPI events are found to better correlate with fuel-wall interaction. The results highlight the interplay of bulk gas thermodynamics and SPI ignition source, on SPI event magnitude and cluster tendency. Moreover, the results highlight fundamental fuel reactivity and associated hypersensitivity to operating conditions at SPI prone operating conditions.« less

Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

PubMed

Viscogliosi, E; Edgcomb, V P; Gerbod, D; Noël, C; Delgado-Viscogliosi, P

1999-12-01

The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

NASA Technical Reports Server (NTRS)

Viscogliosi, E.; Edgcomb, V. P.; Gerbod, D.; Noel, C.; Delgado-Viscogliosi, P.; Sogin, M. L. (Principal Investigator)

1999-01-01

The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

The mechanisms of delayed fluorescence in charge-transfer crystal of tetracyanobenzene-hexamethylbenzene

NASA Astrophysics Data System (ADS)

Kozankiewicz, B.; Prochorow, J.

1989-08-01

Fluorescence, phosphorescence and delayed fluorescence emission characteristics of tetracyanobenzene-hexamethylbenzene (TCNB-HMB) charge-transfer crystal have been studied in the 1.7-340 K temperature range. Delayed fluorescence, originating from heterogeneous triplet-triplet annihilation indicates the presence of mobile charge-transfer triplet excitons at a temperature as low as 1.7 K. However, the behaviour of triplet excitons in TCNB-HMB crystal is strongly controlled by a very efficient trapping process in the whole temperature range investigated. It was found that thermally activated delayed fluorescence, which is a dominating emission of the crystal at elevated temperatures (>60 K), has a different origin (a different initial state) at different temperatures. These observations were analysed and interpreted in terms of a photokinetic model, which is considered to be typical for charge-transfer crystals with high charge-transfer character of triplet excitons.

Persistent Language Delay Versus Late Language Emergence in Children With Early Cochlear Implantation

PubMed Central

Nicholas, Johanna; Tobey, Emily; Davidson, Lisa

2016-01-01

Purpose The purpose of the present investigation is to differentiate children using cochlear implants (CIs) who did or did not achieve age-appropriate language scores by midelementary grades and to identify risk factors for persistent language delay following early cochlear implantation. Materials and Method Children receiving unilateral CIs at young ages (12–38 months) were tested longitudinally and classified with normal language emergence (n = 19), late language emergence (n = 22), or persistent language delay (n = 19) on the basis of their test scores at 4.5 and 10.5 years of age. Relative effects of demographic, audiological, linguistic, and academic characteristics on language emergence were determined. Results Age at CI was associated with normal language emergence but did not differentiate late emergence from persistent delay. Children with persistent delay were more likely to use left-ear implants and older speech processor technology. They experienced higher aided thresholds and lower speech perception scores. Persistent delay was foreshadowed by low morphosyntactic and phonological diversity in preschool. Logistic regression analysis predicted normal language emergence with 84% accuracy and persistent language delay with 74% accuracy. Conclusion CI characteristics had a strong effect on persistent versus resolving language delay, suggesting that right-ear (or bilateral) devices, technology upgrades, and improved audibility may positively influence long-term language outcomes. PMID:26501740

Speed of Gravitational Waves from Strongly Lensed Gravitational Waves and Electromagnetic Signals.

PubMed

Fan, Xi-Long; Liao, Kai; Biesiada, Marek; Piórkowska-Kurpas, Aleksandra; Zhu, Zong-Hong

2017-03-03

We propose a new model-independent measurement strategy for the propagation speed of gravitational waves (GWs) based on strongly lensed GWs and their electromagnetic (EM) counterparts. This can be done in two ways: by comparing arrival times of GWs and their EM counterparts and by comparing the time delays between images seen in GWs and their EM counterparts. The lensed GW-EM event is perhaps the best way to identify an EM counterpart. Conceptually, this method does not rely on any specific theory of massive gravitons or modified gravity. Its differential setting (i.e., measuring the difference between time delays in GW and EM domains) makes it robust against lens modeling details (photons and GWs travel in the same lensing potential) and against internal time delays between GW and EM emission acts. It requires, however, that the theory of gravity is metric and predicts gravitational lensing similar to general relativity. We expect that such a test will become possible in the era of third-generation gravitational-wave detectors, when about 10 lensed GW events would be observed each year. The power of this method is mainly limited by the timing accuracy of the EM counterpart, which for kilonovae is around 10^{4}  s. This uncertainty can be suppressed by a factor of ∼10^{10}, if strongly lensed transients of much shorter duration associated with the GW event can be identified. Candidates for such short transients include short γ-ray bursts and fast radio bursts.

A Coarse-Grained Biophysical Model of E. coli and Its Application to Perturbation of the rRNA Operon Copy Number

PubMed Central

Tadmor, Arbel D.; Tlusty, Tsvi

2008-01-01

We propose a biophysical model of Escherichia coli that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity. PMID:18437222

Rats bred for high alcohol drinking are more sensitive to delayed and probabilistic outcomes.

PubMed

Wilhelm, C J; Mitchell, S H

2008-10-01

Alcoholics and heavy drinkers score higher on measures of impulsivity than nonalcoholics and light drinkers. This may be because of factors that predate drug exposure (e.g. genetics). This study examined the role of genetics by comparing impulsivity measures in ethanol-naive rats selectively bred based on their high [high alcohol drinking (HAD)] or low [low alcohol drinking (LAD)] consumption of ethanol. Replicates 1 and 2 of the HAD and LAD rats, developed by the University of Indiana Alcohol Research Center, completed two different discounting tasks. Delay discounting examines sensitivity to rewards that are delayed in time and is commonly used to assess 'choice' impulsivity. Probability discounting examines sensitivity to the uncertain delivery of rewards and has been used to assess risk taking and risk assessment. High alcohol drinking rats discounted delayed and probabilistic rewards more steeply than LAD rats. Discount rates associated with probabilistic and delayed rewards were weakly correlated, while bias was strongly correlated with discount rate in both delay and probability discounting. The results suggest that selective breeding for high alcohol consumption selects for animals that are more sensitive to delayed and probabilistic outcomes. Sensitivity to delayed or probabilistic outcomes may be predictive of future drinking in genetically predisposed individuals.

Mapping of chloroplast mutations conferring resistance to antibiotics in Chlamydomonas: evidence for a novel site of streptomycin resistance in the small subunit rRNA.

PubMed

Gauthier, A; Turmel, M; Lemieux, C

1988-10-01

A major obstacle to our understanding of the mechanisms governing the inheritance, recombination and segregation of chloroplast genes in Chlamydomonas is that the majority of antibiotic resistance mutations that have been used to gain insights into such mechanisms have not been physically localized on the chloroplast genome. We report here the physical mapping of two chloroplast antibiotic resistance mutations: one conferring cross-resistance to erythromycin and spiramycin in Chlamydomonas moewusii (er-nM1) and the other conferring resistance to streptomycin in the interfertile species C. eugametos (sr-2). The er-nM1 mutation results from a C to G transversion at a well-known site of macrolide resistance within the peptidyl transferase loop region of the large subunit rRNA gene. This locus, designated rib-2 in yeast mitochondrial DNA, corresponds to residue C-2611 in the 23 S rRNA of Escherichia coli. The sr-2 locus maps within the small subunit (SSU) rRNA gene at a site that has not been described previously. The mutation results from an A to C transversion at a position equivalent to residue A-523 in the E. coli 16 S rRNA. Although this region of the E. coli SSU rRNA has no binding affinity for streptomycin, it binds to ribosomal protein S4, a protein that has long been associated with the response of bacterial cells to this antibiotic. We propose that the sr-2 mutation indirectly affects the nearest streptomycin binding site through an altered interaction between a ribosomal protein and the SSU rRNA.

Risk factors for delay in symptomatic presentation: a survey of cancer patients

PubMed Central

Forbes, L J L; Warburton, F; Richards, M A; Ramirez, A J

2014-01-01

Background: Delay in symptomatic presentation leading to advanced stage at diagnosis may contribute to poor cancer survival. To inform public health approaches to promoting early symptomatic presentation, we aimed to identify risk factors for delay in presentation across several cancers. Methods: We surveyed 2371 patients with 15 cancers about nature and duration of symptoms using a postal questionnaire. We calculated relative risks for delay in presentation (time from symptom onset to first presentation >3 months) by cancer, symptoms leading to diagnosis and reasons for putting off going to the doctor, controlling for age, sex and deprivation group. Results: Among 1999 cancer patients reporting symptoms, 21% delayed presentation for >3 months. Delay was associated with greater socioeconomic deprivation but not age or sex. Patients with prostate (44%) and rectal cancer (37%) were most likely to delay and patients with breast cancer least likely to delay (8%). Urinary difficulties, change of bowel habit, systemic symptoms (fatigue, weight loss and loss of appetite) and skin symptoms were all common and associated with delay. Overall, patients with bleeding symptoms were no more likely to delay presentation than patients who did not have bleeding symptoms. However, within the group of patients with bleeding symptoms, there were significant differences in risk of delay by source of bleeding: 35% of patients with rectal bleeding delayed presentation, but only 9% of patients with urinary bleeding. A lump was a common symptom but not associated with delay in presentation. Twenty-eight percent had not recognised their symptoms as serious and this was associated with a doubling in risk of delay. Embarrassment, worry about what the doctor might find, being too busy to go to the doctor and worry about wasting the doctor's time were also strong risk factors for delay, but were much less commonly reported (<6%). Interpretation: Approaches to promote early presentation should

Can Early Years Professionals Determine Which Preschoolers Have Comprehension Delays? A Comparison of Two Screening Tools

ERIC Educational Resources Information Center

Seager, Emily; Abbot-Smith, Kirsten

2017-01-01

Language comprehension delays in pre-schoolers are predictive of difficulties in a range of developmental domains. In England, early years practitioners are required to assess the language comprehension of 2-year-olds in their care. Many use a format based on the Early Years Foundation Stage Unique Child Communication Sheet (EYFS:UCCS) in which…

Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

PubMed

Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

2002-12-01

Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

Theileria sp. Infections Associated with Bovine Fatalities in the United States Confirmed by Small-Subunit rRNA Gene Analyses of Blood and Tick Samples

PubMed Central

Chae, Joon-seok; Levy, Michael; Hunt, John; Schlater, Jack; Snider, Glen; Waghela, Suryakant D.; Holman, Patricia J.; Wagner, G. Gale

1999-01-01

Theileria sp.-specific small subunit (SSU) rRNA gene amplification confirmed the presence of the organism in cattle and in Amblyomma americanum and Dermacentor variabilis ticks collected from a cattle herd in Missouri. Blood from the index animal had type A and type D Theileria SSU rRNA genes. The type D gene was also found in blood from two cohort cattle and tick tissues. The type A SSU rRNA gene was previously reported from bovine Theileria isolates from Texas and North Carolina; the type D gene was reported from a Texas cow with theileriosis. PMID:10449501

Delay-range-dependent chaos synchronization approach under varying time-lags and delayed nonlinear coupling.

PubMed

Zaheer, Muhammad Hamad; Rehan, Muhammad; Mustafa, Ghulam; Ashraf, Muhammad

2014-11-01

This paper proposes a novel state feedback delay-range-dependent control approach for chaos synchronization in coupled nonlinear time-delay systems. The coupling between two systems is esteemed to be nonlinear subject to time-lags. Time-varying nature of both the intrinsic and the coupling delays is incorporated to broad scope of the present study for a better-quality synchronization controller synthesis. Lyapunov-Krasovskii (LK) functional is employed to derive delay-range-dependent conditions that can be solved by means of the conventional linear matrix inequality (LMI)-tools. The resultant control approach for chaos synchronization of the master-slave time-delay systems considers non-zero lower bound of the intrinsic as well as the coupling time-delays. Further, the delay-dependent synchronization condition has been established as a special case of the proposed LK functional treatment. Furthermore, a delay-range-dependent condition, independent of the delay-rate, has been provided to address the situation when upper bound of the delay-derivative is unknown. A robust state feedback control methodology is formulated for synchronization of the time-delay chaotic networks against the L2 norm bounded perturbations by minimizing the L2 gain from the disturbance to the synchronization error. Numerical simulation results are provided for the time-delay chaotic networks to show effectiveness of the proposed delay-range-dependent chaos synchronization methodologies. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

Delay of Gratification and Delay Discounting: A Unifying Feedback Model of Delay-Related Impulsive Behavior

ERIC Educational Resources Information Center

Reynolds, Brady; Schiffbauer, Ryan

2005-01-01

Delay of Gratification (DG) and Delay Discounting (DD) represent two indices of impulsive behavior often treated as though they represent equivalent or the same underlying processes. However, there are key differences between DG and DD procedures, and between certain research findings with each procedure, that suggest they are not equivalent. In…

Previously unclassified bacteria dominate during thermophilic and mesophilic anaerobic pre-treatment of primary sludge.

PubMed

Pervin, Hasina M; Batstone, Damien J; Bond, Philip L

2013-06-01

Thermophilic biological pre-treatment enables enhanced anaerobic digestion for treatment of wastewater sludges but, at present, there is limited understanding of the hydrolytic-acidogenic microbial composition and its contribution to this process. In this study, the process was assessed by comparing the microbiology of thermophilic (50-65 °C) and mesophilic (35 °C) pre-treatment reactors treating primary sludge. A full-cycle approach for the 16S rRNA genes was applied in order to monitor the diversity of bacteria and their abundance in a thermophilic pre-treatment reactor treating primary sludge. For the thermophilic pre-treatment (TP), over 90% of the sequences were previously undetected and these had less than 97% sequence similarity to cultured organisms. During the first 83 days, members of the Betaproteobacteria dominated the community sequences and a newly designed probe was used to monitor a previously unknown bacterium affiliated with the genus Brachymonas. Between days 85 and 183, three phylotypes that affiliated with the genera Comamonas, Clostridium and Lysobacter were persistently dominant in the TP community, as revealed by terminal-restriction fragment length polymorphism (T-RFLP). Hydrolytic and fermentative functions have been speculated for these bacteria. Mesophilic pre-treatment (MP) and TP communities were different but they were both relatively dynamic. Statistical correlation analysis and the function of closely allied reference organisms indicated that previously unclassified bacteria dominated the TP community and may have been functionally involved in the enhanced hydrolytic performance of thermophilic anaerobic pre-treatment. This study is the first to reveal the diversity and dynamics of bacteria during anaerobic digestion of primary sludge. Copyright © 2013 Elsevier GmbH. All rights reserved.

Age and Influenza-Specific Pre-Vaccination Antibodies Strongly Affect Influenza Vaccine Responses in the Icelandic Population whereas Disease and Medication Have Small Effects

PubMed Central

Olafsdottir, Thorunn A.; Alexandersson, Kristjan F.; Sveinbjornsson, Gardar; Lapini, Giulia; Palladino, Laura; Montomoli, Emanuele; Del Giudice, Giuseppe; Gudbjartsson, Daniel F.; Jonsdottir, Ingileif

2018-01-01

Influenza vaccination remains the best strategy for the prevention of influenza virus-related disease and reduction of disease severity and mortality. However, there is large individual variation in influenza vaccine responses. In this study, we investigated the effects of gender, age, underlying diseases, and medication on vaccine responses in 1,852 Icelanders of broad age range who received trivalent inactivated influenza virus vaccination in 2012, 2013, or 2015. Hemagglutination inhibition (HAI) and microneutralization (MN) titers were measured in pre- and post-vaccination sera. Of the variables tested, the strongest association was with level of pre-vaccination titer that explained a major part of the variance observed in post-vaccination titers, ranging from 19 to 29%, and from 7 to 21% in fold change (FC), depending on the strain and serological (HAI or MN) analysis performed. Thus, increasing pre-vaccination titer associated with decreasing FC (P = 1.1 × 10−99–8.6 × 10−30) and increasing post-vaccination titer (P = 2.1 × 10−159–1.1 × 10−123). Questionnaires completed by 87% of the participants revealed that post-vaccination HAI titer showed association with repeated previous influenza vaccinations. Gender had no effect on vaccine response whereas age had a strong effect and explained 1.6–3.1% of HAI post-vaccination titer variance and 3.1% of H1N1 MN titer variance. Vaccine response, both fold increase and seroprotection rate (percentage of individuals reaching HAI ≥ 40 or MN ≥ 20), was higher in vaccinees ≤37 years of age (YoA) than all other age groups. Furthermore, a reduction was observed in the H1N1 MN titer in people ≥63 YoA, demonstrating a decreased neutralizing functionality of vaccine-induced antibodies at older age. We tested the effects of underlying autoimmune diseases, asthma and allergic diseases and did not observe significant associations with vaccine responses. Intake of immune

The Value of Clean Air: Comparing Discounting of Delayed Air Quality and Money Across Magnitudes

PubMed Central

Friedel, Jonathan E.; DeHart, William B.; Mahamane, Salif; Jordan, Kerry E.; Odum, Amy L.

2018-01-01

The detrimental health effects of exposure to air pollution are well established. Fostering behavioral change concerning air quality may be challenging because the detrimental health effects of exposure to air pollution are delayed. Delay discounting, a measure of impulsive choice, encapsulates this process of choosing between the immediate conveniences of behaviors that increase pollution and the delayed consequences of prolonged exposure to poor air quality. In Experiment 1, participants completed a series of delay-discounting tasks for air quality and money. We found that participants discounted delayed air quality more than money. In Experiment 2, we investigated whether the common finding that large amounts of money are discounted less steeply than small amounts of money generalized to larger and smaller improvements in air quality. Participants discounted larger improvements in air quality less steeply than smaller improvements, indicating that the discounting of air quality shares a similar process as the discounting of money. Our results indicate that the discounting of delayed money is strongly related to the discounting of delayed air quality and that similar mechanisms may be involved in the discounting of these qualitatively different outcomes. These data are also the first to demonstrate the malleability of delay discounting of air quality, and provide important public health implications for decreasing delay discounting of air quality. PMID:29606776

Development of an oligonucleotide probe for Aureobasidium pullulans based on the small-subunit rRNA gene.

PubMed Central

Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H

1996-01-01

Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850

The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction

NASA Technical Reports Server (NTRS)

Weisburg, W. G.; Giovannoni, S. J.; Woese, C. R.

1989-01-01

Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.

A behavioral economic analysis of texting while driving: Delay discounting processes.

PubMed

Hayashi, Yusuke; Miller, Kimberly; Foreman, Anne M; Wirth, Oliver

2016-12-01

The purpose of the present study was to examine an impulsive decision-making process underlying texting while driving from a behavioral economic perspective. A sample of 108 college students completed a novel discounting task that presented participants with a hypothetical scenario in which, after receiving a text message while driving, they rated the likelihood of replying to a text message immediately versus waiting to reply for a specific period of time. Participants also completed a delay discounting task in which they made repeated hypothetical choices between obtaining a larger amount of money available after a delay and an equal or lesser amount of money available immediately. The results show that the duration of the delay is a critical variable that strongly determines whether participants choose to wait to reply to a text message, and that the decrease in the likelihood of waiting as a function of delay is best described by a hyperbolic delay discounting function. The results also show that participants who self-reported higher frequency of texting while driving discounted the opportunity to reply to a text message at greater rates, whereas there was no relation between the rates of discounting of hypothetical monetary rewards and the frequency of texting while driving. The results support the conclusion that texting while driving is fundamentally an impulsive choice. Copyright © 2016 Elsevier Ltd. All rights reserved.

A behavioral economic analysis of texting while driving: Delay discounting processes

PubMed Central

Hayashi, Yusuke; Miller, Kimberly; Foreman, Anne M.; Wirth, Oliver

2016-01-01

The purpose of the present study was to examine an impulsive decision-making process underlying texting while driving from a behavioral economic perspective. A sample of 108 college students completed a novel discounting task that presented participants with a hypothetical scenario in which, after receiving a text message while driving, they rated the likelihood of replying to a text message immediately versus waiting to reply for a specific period of time. Participants also completed a delay discounting task in which they made repeated hypothetical choices between obtaining a larger amount of money available after a delay and an equal or lesser amount of money available immediately. The results show that the duration of the delay is a critical variable that strongly determines whether participants choose to wait to reply to a text message, and that the decrease in the likelihood of waiting as a function of delay is best described by a hyperbolic delay discounting function. The results also show that participants who self-reported higher frequency of texting while driving discounted the opportunity to reply to a text message at greater rates, whereas there was no relation between the rates of discounting of hypothetical monetary rewards and the frequency of texting while driving. The results support the conclusion that texting while driving is fundamentally an impulsive choice. PMID:27614547

Genotypic variation of Pneumocystis jirovecii isolates in India based on sequence diversity at mitochondrial large subunit rRNA.

PubMed

Gupta, Rashmi; Mirdha, Bijay Ranjan; Guleria, Randeep; Agarwal, Sanjay Kumar; Samantaray, Jyotish Chandra; Kumar, Lalit; Kabra, Sushil Kumar; Luthra, Kalpana; Sreenivas, Vishnubhatla; Iyer, Venkateswaran K

2011-03-01

Pneumocystis pneumonia (PCP), a common and serious opportunistic infection in immunocompromised patients, is caused by Pneumocystis jirovecii (formerly known as Pneumocystis carinii f. sp. hominis). The aim of the present study was to describe the prevalence and distribution of genotypes of P. jirovecii based on sequence polymorphisms at mitochondrial large subunit ribosomal RNA (mt LSU rRNA) region in both HIV and non-HIV immunocompromised individuals with a positive PCR result for PCP in a tertiary health care centre in northern India. From January 2005 to October 2008, 50 patients [22 HIV-seropositive individuals, 10 post-renal transplant (PRT) recipients, 3 cancer patients, and 15 patients with various other kinds of immunosuppression] were found to be positive for P. jirovecii using PCR at the mt LSU rRNA gene. Genotyping of the positive samples was performed at the mt LSU rRNA locus. Genotype 2 was the most common accounting for 42% of total types. This was followed by the genotypes 3 (24%), 1 (20%), and 4 (8%). Mixed infection was observed in 3 cases (6%). The rates of genotype distribution were similar in HIV-seropositive individuals, cancer patients, and in patients with other kinds of immunosuppression. In the PRT recipients, genotype 1 was the most prevalent type (80%). This is the first study describing the prevalence of genotypes in HIV-infected and HIV-uninfected, immunocompromised patients based on the mt LSU rRNA gene from the Indian subcontinent. The most prevalent genotype observed was type 2 in contrast to many studies from other parts of the world where genotype 1 was the most prevalent type, suggesting geographical variation. Copyright © 2010 Elsevier GmbH. All rights reserved.

Assessing hog lagoon waste contamination in the Cape Fear Watershed using Bacteroidetes 16S rRNA gene pyrosequencing.

PubMed

Arfken, Ann M; Song, Bongkeun; Mallin, Michael A

2015-09-01

Hog lagoons can be major sources of waste and nutrient contamination to watersheds adjacent to pig farms. Fecal source tracking methods targeting Bacteroidetes 16S rRNA genes in pig fecal matter may underestimate or fail to detect hog lagoon contamination in riverine environments. In order to detect hog lagoon wastewater contamination in the Cape Fear Watershed, where a large number of hog farms are present, we conducted pyrosequencing analyses of Bacteroidetes 16S rRNA genes in hog lagoon waste and identified new hog lagoon-specific marker sequences. Additional pyrosequencing analyses of Bacteroidetes 16S rRNA genes were conducted with surface water samples collected at 4 sites during 5 months in the Cape Fear Watershed. Using an operational taxonomic unit (OTU) identity cutoff value of 97 %, these newly identified hog lagoon markers were found in 3 of the river samples, while only 1 sample contained the pig fecal marker. In the sample containing the pig fecal marker, there was a relatively high percentage (14.1 %) of the hog lagoon markers and a low pig fecal marker relative abundance of 0.4 % in the Bacteroidetes 16S rRNA gene sequences. This suggests that hog lagoon contamination must be somewhat significant in order for pig fecal markers to be detected, and low levels of hog lagoon contamination cannot be detected targeting only pig-specific fecal markers. Thus, new hog lagoon markers have a better detection capacity for lagoon waste contamination, and in conjunction with a pig fecal marker, provide a more comprehensive and accurate detection of hog lagoon waste contamination in susceptible watersheds.

Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

DOEpatents

Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.

2007-12-04

The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

The Sexual Discounting Task: HIV Risk Behavior and the Discounting of Delayed Sexual Rewards in Cocaine Dependence

PubMed Central

Johnson, Matthew W.; Bruner, Natalie R.

2011-01-01

Background Cocaine dependence is associated with high rates of sexual risk behavior and HIV infection. However, little is known about the responsible mechanism(s). Methods Cocaine-dependent individuals (N=62) completed a novel Sexual Discounting Task assessing decisions between immediate unprotected sex and delayed sex with a condom across four hypothetical partners: most (and least) likely to have a sexually transmitted infection (STI), and most (and least) sexually desirable; a real rewards money delay-discounting task, and self-reported sexual risk behavior using the HIV Risk-Taking Behavior Scale (HRBS). Results Sexual Discounting Task results were largely systematic and showed a strong effect of delay in decreasing condom use. Sexual discounting (preference for immediate unprotected sex) was significantly greater when making responses for partners judged least (compared to most) likely to have an STI, and for partners judged most (compared to least) desirable. Differences in sexual discounting were significant after controlling for differences in condom use (with no delay) between conditions. Greater discounting in 3 or the 4 Sexual Discounting Task conditions, but not in the money discounting task, was associated with greater self-reported sexual risk behavior as measured by the HRBS Conclusions Results suggest that delay is a critical variable strongly affecting HIV sexual risk behavior, and that the Sexual Discounting Task provides a clinically sensitive measure of this phenomenon that may address a variety of questions about HIV risk in future research. The wealth of behavioral and neurobiological data on delay discounting should be brought to bear on HIV education and prevention. PMID:22055012

Advanced access: reducing waiting and delays in primary care.

PubMed

Murray, Mark; Berwick, Donald M

2003-02-26

Delay of care is a persistent and undesirable feature of current health care systems. Although delay seems to be inevitable and linked to resource limitations, it often is neither. Rather, it is usually the result of unplanned, irrational scheduling and resource allocation. Application of queuing theory and principles of industrial engineering, adapted appropriately to clinical settings, can reduce delay substantially, even in small practices, without requiring additional resources. One model, sometimes referred to as advanced access, has increasingly been shown to reduce waiting times in primary care. The core principle of advanced access is that patients calling to schedule a physician visit are offered an appointment the same day. Advanced access is not sustainable if patient demand for appointments is permanently greater than physician capacity to offer appointments. Six elements of advanced access are important in its application balancing supply and demand, reducing backlog, reducing the variety of appointment types, developing contingency plans for unusual circumstances, working to adjust demand profiles, and increasing the availability of bottleneck resources. Although these principles are powerful, they are counter to deeply held beliefs and established practices in health care organizations. Adopting these principles requires strong leadership investment and support.

Delayed surgery after acute traumatic central cord syndrome is associated with reduced mortality.

PubMed

Samuel, Andre M; Grant, Ryan A; Bohl, Daniel D; Basques, Bryce A; Webb, Matthew L; Lukasiewicz, Adam M; Diaz-Collado, Pablo J; Grauer, Jonathan N

2015-03-01

A retrospective study of surgically treated patients with acute traumatic central cord syndrome (ATCCS) from the National Trauma Data Bank Research Data Set. To determine the association of time to surgery, pre-existing comorbidities, and injury severity on mortality and adverse events in surgically treated patients with ATCCS. Although earlier surgery has been shown to be beneficial for other spinal cord injuries, the literature is mixed regarding the appropriate timing of surgery after ATCCS. Traditionally, this older population has been treated with delayed surgery because medical optimization is often indicated preoperatively. Surgically treated patients with ATCCS in the National Trauma Data Bank Research Data Set from 2011 and 2012 were identified. Time to surgery, Charlson Comorbidity Index, and injury severity scores were tested for association with mortality, serious adverse events, and minor adverse events using multivariate logistic regression. A total of 1060 patients with ATCCS met inclusion criteria. After controlling for pre-existing comorbidity and injury severity, delayed surgery was associated with a decreased odds of inpatient mortality (odds ratio = 0.81, P = 0.04), or a 19% decrease in odds of mortality with each 24-hour increase in time until surgery. The association of time to surgery with serious adverse events was not statistically significant (P = 0.09), whereas time to surgery was associated with increased odds of minor adverse events (odds ratio = 1.06, P < 0.001). Although the potential neurological effect of surgical timing for patients with ATCCS remains controversial, the decreased mortality with delayed surgery suggests that waiting to optimize general health and potentially allow for some spinal cord recovery in these patients may be advantageous. 3.

Correction of ultrasonic wave aberration with a time delay and amplitude filter.

PubMed

Måsøy, Svein-Erik; Johansen, Tonni F; Angelsen, Bjørn

2003-04-01

Two-dimensional simulations with propagation through two different heterogeneous human body wall models have been performed to analyze different correction filters for ultrasonic wave aberration due to forward wave propagation. The different models each produce most of the characteristic aberration effects such as phase aberration, relatively strong amplitude aberration, and waveform deformation. Simulations of wave propagation from a point source in the focus (60 mm) of a 20 mm transducer through the body wall models were performed. Center frequency of the pulse was 2.5 MHz. Corrections of the aberrations introduced by the two body wall models were evaluated with reference to the corrections obtained with the optimal filter: a generalized frequency-dependent phase and amplitude correction filter [Angelsen, Ultrasonic Imaging (Emantec, Norway, 2000), Vol. II]. Two correction filters were applied, a time delay filter, and a time delay and amplitude filter. Results showed that correction with a time delay filter produced substantial reduction of the aberration in both cases. A time delay and amplitude correction filter performed even better in both cases, and gave correction close to the ideal situation (no aberration). The results also indicated that the effect of the correction was very sensitive to the accuracy of the arrival time fluctuations estimate, i.e., the time delay correction filter.

Why was resistance to shorter-acting pre-emergence herbicides slower to evolve?

PubMed

Somerville, Gayle J; Powles, Stephen B; Walsh, Michael J; Renton, Michael

2017-05-01

Across several agricultural systems the evolution of herbicide resistance has occurred more rapidly to post-emergence than pre-emergence herbicides; however, the reasons for this are not clear. We used a new simulation model to investigate whether interactions between differences in order of application and weed cohorts affected could explain this historically observed difference between the herbicide groups. A 10 year delay in resistance evolution was predicted for a shorter-acting residual pre-emergence (cf. post-emergence), when all other parameters were identical. Differences in order of application between pre- and post-emergence herbicides had minimal effect on rates of resistance evolution when similar weed cohorts were affected. This modelling suggested that the historically observed lower levels of resistance to pre-emergence herbicides are most likely to be due to the smaller number of weed cohorts affected by many pre-emergence herbicides. The lower number of weed cohorts affected by pre-emergence herbicides necessitated the use of additional, effective control measures, thereby reducing resistance evolution. This study highlights the advantages of applying multiple control measures to each weed cohort. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Classic conditioning in aged rabbits: delay, trace, and long-delay conditioning.

PubMed

Solomon, P R; Groccia-Ellison, M E

1996-06-01

Young (0.5 years) and aged (2+, 3+, and 4+ years) rabbits underwent acquisition of the classically conditioned nictitating membrane response in a delay (500-ms conditioned stimulus [CS], 400-ms interstimulus interval [ISI]), long-delay (1,000-ms CS, 900-ms ISI), or trace (500-ms CS, 400-ms stimulus-free period) paradigm. Collapsing across age groups, there is a general tendency for animals to acquire trace conditioning more slowly than delay conditioning. Collapsing across conditioning paradigms, there is a general tendency for aged animals to acquire more slowly than younger animals. Of greater significance, however, are the age differences in the different conditioning paradigms. In the delay and long-delay paradigms, significant conditioning deficits first appeared in the 4(+)-year-old group. In the trace conditioning paradigm, significant conditioning deficits became apparent in the 2(+)-year-old animals.

Double Dissociation of Amygdala and Hippocampal Contributions to Trace and Delay Fear Conditioning

PubMed Central

Raybuck, Jonathan D.; Lattal, K. Matthew

2011-01-01

A key finding in studies of the neurobiology of learning memory is that the amygdala is critically involved in Pavlovian fear conditioning. This is well established in delay-cued and contextual fear conditioning; however, surprisingly little is known of the role of the amygdala in trace conditioning. Trace fear conditioning, in which the CS and US are separated in time by a trace interval, requires the hippocampus and prefrontal cortex. It is possible that recruitment of cortical structures by trace conditioning alters the role of the amygdala compared to delay fear conditioning, where the CS and US overlap. To investigate this, we inactivated the amygdala of male C57BL/6 mice with GABA A agonist muscimol prior to 2-pairing trace or delay fear conditioning. Amygdala inactivation produced deficits in contextual and delay conditioning, but had no effect on trace conditioning. As controls, we demonstrate that dorsal hippocampal inactivation produced deficits in trace and contextual, but not delay fear conditioning. Further, pre- and post-training amygdala inactivation disrupted the contextual but the not cued component of trace conditioning, as did muscimol infusion prior to 1- or 4-pairing trace conditioning. These findings demonstrate that insertion of a temporal gap between the CS and US can generate amygdala-independent fear conditioning. We discuss the implications of this surprising finding for current models of the neural circuitry involved in fear conditioning. PMID:21283812

Development and validation of the Delaying Gratification Inventory.

PubMed

Hoerger, Michael; Quirk, Stuart W; Weed, Nathan C

2011-09-01

Deficits in gratification delay are associated with a broad range of public health problems, such as obesity, risky sexual behavior, and substance abuse. However, 6 decades of research on the construct has progressed less quickly than might be hoped, largely because of measurement issues. Although past research has implicated 5 domains of delay behavior, involving food, physical pleasures, social interactions, money, and achievement, no published measure to date has tapped all 5 components of the content domain. Existing measures have been criticized for limitations related to efficiency, reliability, and construct validity. Using an innovative Internet-mediated approach to survey construction, we developed the 35-item 5-factor Delaying Gratification Inventory (DGI). Evidence from 4 studies and a large, diverse sample of respondents (N = 10,741) provided support for the psychometric properties of the measure. Specifically, scores on the DGI demonstrated strong internal consistency and test-retest reliability for the 35-item composite, each of the 5 domains, and a 10-item short form. The 5-factor structure fit the data well and had good measurement invariance across subgroups. Construct validity was supported by correlations with scores on closely related self-control measures, behavioral ratings, Big Five personality trait measures, and measures of adjustment and psychopathology, including those on the Minnesota Multiphasic Personality Inventory-2-Restructured Form. DGI scores also showed incremental validity in accounting for well-being and health-related variables. The present investigation holds implications for improving public health, accelerating future research on gratification delay, and facilitating survey construction research more generally by demonstrating the suitability of an Internet-mediated strategy.

Bipartite consensus for multi-agent systems with antagonistic interactions and communication delays

NASA Astrophysics Data System (ADS)

Guo, Xing; Lu, Jianquan; Alsaedi, Ahmed; Alsaadi, Fuad E.

2018-04-01

This paper studies the consensus problems over signed digraphs with arbitrary finite communication delays. For the considered system, the information flow is directed and only locally delayed information can be used for each node. We derive that bipartite consensus of this system can be realized when the associated signed digraph is strongly connected. Furthermore, for structurally balanced networks, this paper studies the pinning partite consensus for the considered system. we design a pinning scheme to pin any one agent in the signed network, and obtain that the network achieves pinning bipartite consensus with any initial conditions. Finally, two examples are provided to demonstrate the effectiveness of our main results.

Willing to Wait: Elevated Reward-Processing EEG Activity Associated with a Greater Preference for Larger-But-Delayed Rewards

PubMed Central

Pornpattananangkul, Narun; Nusslock, Robin

2016-01-01

While almost everyone discounts the value of future rewards over immediate rewards, people differ in their so-called delay-discounting. One of the several factors that may explain individual differences in delay-discounting is reward-processing. To study individual-differences in reward-processing, however, one needs to consider the heterogeneity of neural-activity at each reward-processing stage. Here using EEG, we separated reward-related neural activity into distinct reward-anticipation and reward-outcome stages using time-frequency characteristics. Thirty-seven individuals completed a behavioral delay-discounting task. Reward-processing EEG activity was assessed using a separate reward-learning task, called a reward time-estimation task. During this task, participants were instructed to estimate time duration and were provided performance feedback on a trial-by-trial basis. Participants received monetary-reward for accurate-performance on Reward trials, but not on No-Reward trials. Reward trials, relative to No-Reward trials, enhanced EEG activity during both reward-anticipation stage (including, cued-locked delta power during cue-evaluation and pre-feedback alpha suppression during feedback-anticipation) and at the reward-outcome stage (including, feedback-locked delta, theta and beta power). Moreover, all of these EEG indices correlated with behavioral performance in the time-estimation task, suggesting their essential roles in learning and adjusting performance to maximize winnings in a reward-learning situation. Importantly, enhanced EEG power during Reward trials for 1) pre-feedback alpha suppression, 2) feedback-locked theta and 3) feedback-locked beta was associated with a greater preference for larger-but-delayed rewards. Results highlight the association between a stronger preference toward larger-but-delayed rewards and enhanced reward-processing. Moreover, our reward-processing EEG indices detail the specific stages of reward-processing where these

Evaluation of focused ultrasound algorithms: Issues for reducing pre-focal heating and treatment time.

PubMed

Yiannakou, Marinos; Trimikliniotis, Michael; Yiallouras, Christos; Damianou, Christakis

2016-02-01

Due to the heating in the pre-focal field the delay between successive movements in high intensity focused ultrasound (HIFU) are sometimes as long as 60s, resulting to treatment time in the order of 2-3h. Because there is generally a requirement to reduce treatment time, we were motivated to explore alternative transducer motion algorithms in order to reduce pre-focal heating and treatment time. A 1 MHz single element transducer with 4 cm diameter and 10 cm focal length was used. A simulation model was developed that estimates the temperature, thermal dose and lesion development in the pre-focal field. The simulated temperature history that was combined with the motion algorithms produced thermal maps in the pre-focal region. Polyacrylimde gel phantom was used to evaluate the induced pre-focal heating for each motion algorithm used, and also was used to assess the accuracy of the simulation model. Three out of the six algorithms having successive steps close to each other, exhibited severe heating in the pre-focal field. Minimal heating was produced with the algorithms having successive steps apart from each other (square, square spiral and random). The last three algorithms were improved further (with small cost in time), thus eliminating completely the pre-focal heating and reducing substantially the treatment time as compared to traditional algorithms. Out of the six algorithms, 3 were successful in eliminating the pre-focal heating completely. Because these 3 algorithms required no delay between successive movements (except in the last part of the motion), the treatment time was reduced by 93%. Therefore, it will be possible in the future, to achieve treatment time of focused ultrasound therapies shorter than 30 min. The rate of ablated volume achieved with one of the proposed algorithms was 71 cm(3)/h. The intention of this pilot study was to demonstrate that the navigation algorithms play the most important role in reducing pre-focal heating. By evaluating in

Phytoplasma phylogenetics based on analysis of secA and 23S rRNA gene sequences for improved resolution of candidate species of 'Candidatus Phytoplasma'.

PubMed

Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Harrison, Nigel; Dickinson, Matthew

2008-08-01

Phytoplasma phylogenetics has focused primarily on sequences of the non-coding 16S rRNA gene and the 16S-23S rRNA intergenic spacer region (16-23S ISR), and primers that enable amplification of these regions from all phytoplasmas by PCR are well established. In this study, primers based on the secA gene have been developed into a semi-nested PCR assay that results in a sequence of the expected size (about 480 bp) from all 34 phytoplasmas examined, including strains representative of 12 16Sr groups. Phylogenetic analysis of secA gene sequences showed similar clustering of phytoplasmas when compared with clusters resolved by similar sequence analyses of a 16-23S ISR-23S rRNA gene contig or of the 16S rRNA gene alone. The main differences between trees were in the branch lengths, which were elongated in the 16-23S ISR-23S rRNA gene tree when compared with the 16S rRNA gene tree and elongated still further in the secA gene tree, despite this being a shorter sequence. The improved resolution in the secA gene-derived phylogenetic tree resulted in the 16SrII group splitting into two distinct clusters, while phytoplasmas associated with coconut lethal yellowing-type diseases split into three distinct groups, thereby supporting past proposals that they represent different candidate species within 'Candidatus Phytoplasma'. The ability to differentiate 16Sr groups and subgroups by virtual RFLP analysis of secA gene sequences suggests that this gene may provide an informative alternative molecular marker for pathogen identification and diagnosis of phytoplasma diseases.

Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

PubMed

Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

2016-07-01

Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

Identification of Actinomyces meyeri actinomycosis in middle ear and mastoid by 16S rRNA analysis.

PubMed

Kakuta, Risako; Hidaka, Hiroshi; Yano, Hisakazu; Miyazaki, Hiromitsu; Suzaki, Hiroshi; Nakamura, Yasuhiro; Kanamori, Hajime; Endo, Shiro; Hirakata, Yoichi; Kaku, Mitsuo; Kobayashi, Toshimitsu

2013-08-01

Actinomycosis of the middle ear and mastoid is extremely rare. Here, we report a unique case of actinomycosis of the middle ear and mastoid caused by Actinomyces meyeri diagnosed by 16S rRNA gene sequence analysis.

Signal functions in delayed reinforcement

PubMed Central

Lattal, Kennon A.

1984-01-01