The "Ofcourseness" of Functional Literacy: Ideologies in Adult Literacy

ERIC Educational Resources Information Center

Perry, Kristen H.; Shaw, Donita M.; Ivanyuk, Lyudmyla; Tham, Yuen San Sarah

2018-01-01

We used metastudy and metasynthesis techniques to conduct a discursive review of 101 recent publications on the topic of adult functional literacy (FL). Our purpose was to understand the ideologies shaping current definitions and conceptualizations of FL, as well as how and why FL is researched and assessed as it is. Using discursive review…

Changes in Functional Lung Regions During the Course of Radiation Therapy and Their Potential Impact on Lung Dosimetry for Non-Small Cell Lung Cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meng, Xue; Department of Radiation Oncology, Shandong Cancer Hospital, Shandong University, Jinan; Frey, Kirk

2014-05-01

Purpose: To study changes in functional activity on ventilation (V)/perfusion (Q) single-photon emission computed tomography (SPECT) during radiation therapy (RT) and explore the impact of such changes on lung dosimetry in patients with non-small cell lung cancer (NSCLC). Methods and Materials: Fifteen NSCLC patients with centrally located tumors were enrolled. All patients were treated with definitive RT dose of ≥60 Gy. V/Q SPECT-CT scans were performed prior to and after delivery of 45 Gy of fractionated RT. SPECT images were used to define temporarily dysfunctional regions of lung caused by tumor or other potentially reversible conditions as B3. The functional lung (FL)more » was defined on SPECT by 2 separate approaches: FL1, a threshold of 30% of the maximum uptake of the patient's lung; and FL2, FL1 plus B3 region. The impact of changes in FL between initiation of RT and delivery of 45 Gy on lung dosimetry were analyzed. Results: Fourteen patients (93%) had larger FL2 volumes than FL1 pre-RT (P<.001). Dysfunctional lung became functional in 11 patients (73%) on V SPECT and in 10 patients (67%) on Q SPECT. The dosimetric parameters generated from CT-based anatomical lung had significantly lower values in FL1 than FL2, with a median reduction in the volume of lung receiving a dose of at least 20 Gy (V{sub 20}) of 3%, 5.6%, and mean lung dose of 0.95 and 1.55 on V and Q SPECT respectively. Conclusions: Regional ventilation and perfusion function improve significantly during RT in centrally located NSCLC. Lung dosimetry values vary notably between different definitions of functional lung.« less

Using Anisotropic 3D Minkowski Functionals for Trabecular Bone Characterization and Biomechanical Strength Prediction in Proximal Femur Specimens

PubMed Central

Nagarajan, Mahesh B.; De, Titas; Lochmüller, Eva-Maria; Eckstein, Felix; Wismüller, Axel

2017-01-01

The ability of Anisotropic Minkowski Functionals (AMFs) to capture local anisotropy while evaluating topological properties of the underlying gray-level structures has been previously demonstrated. We evaluate the ability of this approach to characterize local structure properties of trabecular bone micro-architecture in ex vivo proximal femur specimens, as visualized on multi-detector CT, for purposes of biomechanical bone strength prediction. To this end, volumetric AMFs were computed locally for each voxel of volumes of interest (VOI) extracted from the femoral head of 146 specimens. The local anisotropy captured by such AMFs was quantified using a fractional anisotropy measure; the magnitude and direction of anisotropy at every pixel was stored in histograms that served as a feature vectors that characterized the VOIs. A linear multi-regression analysis algorithm was used to predict the failure load (FL) from the feature sets; the predicted FL was compared to the true FL determined through biomechanical testing. The prediction performance was measured by the root mean square error (RMSE) for each feature set. The best prediction performance was obtained from the fractional anisotropy histogram of AMF Euler Characteristic (RMSE = 1.01 ± 0.13), which was significantly better than MDCT-derived mean BMD (RMSE = 1.12 ± 0.16, p<0.05). We conclude that such anisotropic Minkowski Functionals can capture valuable information regarding regional trabecular bone quality and contribute to improved bone strength prediction, which is important for improving the clinical assessment of osteoporotic fracture risk. PMID:29170581

Targeting Sirtuin-1 prolongs murine renal allograft survival and function

PubMed Central

Levine, Matthew H.; Wang, Zhonglin; Xiao, Haiyan; Jiao, Jing; Wang, Liqing; Bhatti, Tricia R.; Hancock, Wayne W.; Beier, Ulf H.

2016-01-01

Current immunosuppressive medications used after transplantation have significant toxicities. Foxp3+ T-regulatory (Treg) cells can prevent allograft rejection without compromising protective host immunity. Interestingly, inhibiting the class III histone/protein deacetylase Sirtuin-1 can augment Foxp3+ Treg suppressive function through increasing Foxp3 acetylation. Here we determined whether Sirtuin-1 targeting can stabilize biological allograft function. BALB/c kidney allografts were transplanted into C57BL/6 recipients with a CD4-conditional deletion of Sirtuin-1 (Sirt1fl/flCD4cre) or mice treated with a Sirtuin-1 specific inhibitor (EX-527), and the native kidneys removed. Blood chemistries and hematocrit were followed weekly. Sirt1fl/flCD4cre recipients showed markedly longer survival and improved kidney function. Sirt1fl/flCD4cre recipients exhibited donor specific tolerance, accepted BALB/c, but rejected third-party C3H cardiac allografts. C57BL/6 recipients of BALB/c renal allografts that were treated with EX-527 showed improved survival and renal function at 1, but not 10 mg/kg/day. Pharmacologic inhibition of Sirtuin-1 also improved renal allograft survival and function with dosing effects having relevance to outcome. Thus, inhibiting Sirtuin-1 can be a useful asset in controlling T-cell mediated rejection. However, effects on non-T cells that could adversely affect allograft survival and function merit consideration. PMID:27083279

Defective cancellous bone structure and abnormal response to PTH in cortical bone of mice lacking Cx43 cytoplasmic C-terminus domain

PubMed Central

Pacheco-Costa, Rafael; Davis, Hannah M.; Sorenson, Chad; Hon, Mary C.; Hassan, Iraj; Reginato, Rejane D.; Allen, Matthew R.; Bellido, Teresita; Plotkin, Lilian I.

2015-01-01

Connexin43 (Cx43) forms gap junction channels and hemichannels that allow the communication among osteocytes, osteoblasts, and osteoclasts. Cx43 carboxy-terminal (CT) domain regulates channel opening and intracellular signaling by acting as a scaffold for structural and signaling proteins. To determine the role of Cx43 CT domain in bone, mice in which one allele of full length Cx43 was replaced by a mutant lacking the CT domain (Cx43ΔCT/fl) were studied. Cx43ΔCT/fl mice exhibit lower cancellous bone volume but higher cortical thickness than Cx43fl/fl controls, indicating that the CT domain is involved in normal cancellous bone gain but opposes cortical bone acquisition. Further, Cx43ΔCT is able to exert the functions of full length osteocytic Cx43 on cortical bone geometry and mechanical properties, demonstrating that domains other than the CT are responsible for Cx43 function in cortical bone. In addition, parathyroid hormone (PTH) failed to increase endocortical bone formation or energy to failure, a mechanical property that indicates resistance to fracture, in cortical bone in Cx43ΔCT mice with or without osteocytic full length Cx43. On the other hand, bone mass and bone formation markers were increased by the hormone in all mouse models, regardless of whether full length or Cx43ΔCT were or not expressed. We conclude that Cx43 CT domain is involved in proper bone acquisition; and that Cx43 expression in osteocytes is dispensable for some but not all PTH anabolic actions. PMID:26409319

Defective cancellous bone structure and abnormal response to PTH in cortical bone of mice lacking Cx43 cytoplasmic C-terminus domain.

PubMed

Pacheco-Costa, Rafael; Davis, Hannah M; Sorenson, Chad; Hon, Mary C; Hassan, Iraj; Reginato, Rejane D; Allen, Matthew R; Bellido, Teresita; Plotkin, Lilian I

2015-12-01

Connexin 43 (Cx43) forms gap junction channels and hemichannels that allow the communication among osteocytes, osteoblasts, and osteoclasts. Cx43 carboxy-terminal (CT) domain regulates channel opening and intracellular signaling by acting as a scaffold for structural and signaling proteins. To determine the role of Cx43 CT domain in bone, mice in which one allele of full length Cx43 was replaced by a mutant lacking the CT domain (Cx43(ΔCT/fl)) were studied. Cx43(ΔCT/fl) mice exhibit lower cancellous bone volume but higher cortical thickness than Cx43(fl/fl) controls, indicating that the CT domain is involved in normal cancellous bone gain but opposes cortical bone acquisition. Further, Cx43(ΔCT) is able to exert the functions of full length osteocytic Cx43 on cortical bone geometry and mechanical properties, demonstrating that domains other than the CT are responsible for Cx43 function in cortical bone. In addition, parathyroid hormone (PTH) failed to increase endocortical bone formation or energy to failure, a mechanical property that indicates resistance to fracture, in cortical bone in Cx43(ΔCT) mice with or without osteocytic full length Cx43. On the other hand, bone mass and bone formation markers were increased by the hormone in all mouse models, regardless of whether full length or Cx43(ΔCT) were or not expressed. We conclude that Cx43 CT domain is involved in proper bone acquisition; and that Cx43 expression in osteocytes is dispensable for some but not all PTH anabolic actions. Copyright © 2015 Elsevier Inc. All rights reserved.

The Relation between Order of Acquisition, Segmental Frequency and Function: The Case of Word-Initial Consonants in Dutch

ERIC Educational Resources Information Center

van Severen, Lieve; Gillis, Joris J. M.; Molemans, Inge; van den Berg, Renate; De Maeyer, Sven; Gillis, Steven

2013-01-01

The impact of input frequency (IF) and functional load (FL) of segments in the ambient language on the acquisition order of word-initial consonants is investigated. Several definitions of IF/FL are compared and implemented. The impact of IF/FL and their components are computed using a longitudinal corpus of interactions between thirty…

Comparison of clinicopathologic characteristics of gastric follicular lymphomas and duodenal follicular lymphomas.

PubMed

Maeshima, Akiko Miyagi; Taniguchi, Hirokazu; Suzuki, Tomotaka; Yuda, Sayako; Toyoda, Kosuke; Yamauchi, Nobuhiko; Makita, Shinichi; Fukuhara, Suguru; Munakata, Wataru; Maruyama, Dai; Kobayashi, Yukio; Saito, Yutaka; Tobinai, Kensei

2017-07-01

We compared the incidence, esophagogastroduodenoscopy (EGD) findings, and histopathologic characteristics of gastric and duodenal follicular lymphomas (FL). Of 626 FL cases, primary gastric FL and secondary gastric involvement of FL were observed in 1% and 5% of the cases, respectively, which were lower incidences than duodenal FL (10% and 9%, respectively). Gastric FL usually appeared as submucosal tumors (primary, 71%; secondary, 79%), whereas duodenal FL, as granular lesions (primary, 92%: secondary, 87%). In the granular duodenal lesions, the neoplastic follicles were located sparsely on the muscularis mucosa and could be found between villi, whereas in the stomach, similar lesions were hidden within the lamina propria, and only larger lesions such as submucosal tumors could be detected on the mucosal surface. The differences in the incidences and EGD findings were considered to be associated with structural differences of the lamina propria. Typical FL features: grades 1-2 histology, follicularity, and CD10 + and/or BCL6 + and BCL2 + were usually observed in all primary and secondary gastric and duodenal FL. Gastroduodenal and bone marrow involvement were found in 12% and 33% of the cases, respectively, and there was no significant correlation between them (P=.095). Twenty-nine cases (5%) were up-staged by gastroduodenal-positive results. In conclusion, the histopathology of gastric FL was similar to that of duodenal and nodal FL; the differences in the incidence and EGD findings between gastric and duodenal FL were considered to be associated with structural difference of the lamina propria, and EGD was useful as a staging procedure. Copyright © 2017 Elsevier Inc. All rights reserved.

Differential Gene Dosage Effects of Diabetes-Associated Gene GLIS3 in Pancreatic β Cell Differentiation and Function

PubMed Central

Bush, Sean P.; Wen, Xianjie; Cao, Wei; Chan, Lawrence

2017-01-01

Mutations of GLI-similar 3 (GLIS3) underlie a neonatal diabetes syndrome. Genome-wide association studies revealed that GLIS3 variants are associated with both common type 1 and type 2 diabetes. Global Glis3-deficient (Glis3−/−) mice die of severe diabetes shortly after birth. GLIS3 controls islet differentiation by transactivating neurogenin 3 (Ngn3). To unravel the function of Glis3 in adults, we generated inducible global Glis3-deficient mice (Glis3fl/fl/RosaCreERT2). Tamoxifen (TAM)-treated Glis3fl/fl/RosaCreERT2 mice developed severe diabetes, which was reproduced in TAM-treated β cell–specific Glis3fl/fl/Pdx1CreERT mice, but not in TAM-treated Glis3fl/fl/MipCreERT mice. Furthermore, we generated constitutive β cell– or pancreas-specific Glis3-deficient mice using either RipCre (Glis3fl/fl/RipCre) or Pdx1Cre (Glis3fl/fl/Pdx1Cre) coexpressing mice. We observed that, remarkably, neither type of β cell– or pancreas-specific Glis3-deficient mice phenocopied the lethal neonatal diabetes observed in Glis3−/− mice. All Glis3fl/fl/RipCre mice survived to adulthood with normal glucose tolerance. Thirty percent of Glis3fl/fl/Pdx1Cre mice developed severe diabetes at 3 to 4 weeks of age, whereas 55% of them developed mild diabetes with age. In contrast to the >90% reduction of Ngn3 and near-total absence of insulin (Ins) in the embryonic pancreas of Glis3−/− mice, we found only 75%–80% reduction of Ngn3 and Ins messenger RNA or protein expression in the fetal pancreas of Glis3fl/fl/Pdx1Cre mice. The expression levels of Ngn3 and Ins correlated negatively with the extent of Cre-mediated Glis3 deletion. These mouse models are powerful tools to decipher Glis3 gene dosage effects and the role of GLIS3 mutations/variants in a spectrum of β cell dysfunction in people. PMID:27813676

Filtered pulsed cathodic arc deposition of fullerene-like carbon and carbon nitride films

NASA Astrophysics Data System (ADS)

Tucker, Mark D.; Czigány, Zsolt; Broitman, Esteban; Näslund, Lars-Åke; Hultman, Lars; Rosen, Johanna

2014-04-01

Carbon and carbon nitride films (CNx, 0 ≤ x ≤ 0.26) were deposited by filtered pulsed cathodic arc and were investigated using transmission electron microscopy and X-ray photoelectron spectroscopy. A "fullerene-like" (FL) structure of ordered graphitic planes, similar to that of magnetron sputtered FL-CNx films, was observed in films deposited at 175 °C and above, with N2 pressures of 0 and 0.5 mTorr. Higher substrate temperatures and significant nitrogen incorporation are required to produce similar FL structure by sputtering, which may, at least in part, be explained by the high ion charge states and ion energies characteristic of arc deposition. A gradual transition from majority sp3-hybridized films to sp2 films was observed with increasing substrate temperature. High elastic recovery, an attractive characteristic mechanical property of FL-CNx films, is evident in arc-deposited films both with and without nitrogen content, and both with and without FL structure.

Position-specific incorporation of fluorescent non-natural amino acids into maltose-binding protein for detection of ligand binding by FRET and fluorescence quenching.

PubMed

Iijima, Issei; Hohsaka, Takahiro

2009-04-17

Position-specific incorporation of fluorescent groups is a useful method for analysis of the functions and structures of proteins. We have developed a method for the incorporation of visible-wavelength-fluorescent non-natural amino acids into proteins in a cell-free translation system. Using this technique, we introduced one or two BODIPY-linked amino acids into maltose-binding protein (MBP) to obtain MBP derivatives showing ligand-dependent changes in fluorescence intensity or intensity ratio. BODIPY-FL-aminophenylalanine was incorporated in place of 15 tyrosines, as well as the N-terminal Lys1, and the C-terminal Lys370 of MBP. Fluorescence measurements revealed that MBP containing a BODIPY-FL moiety in place of Tyr210 showed a 13-fold increase in fluorescence upon binding of maltose. Tryptophan-to-phenylalanine substitutions suggest that the increase in fluorescence was the result of a decrease in the quenching of BODIPY-FL by tryptophan located around the binding site. MBP containing a BODIPY-558 moiety also showed a maltose-dependent increase in fluorescence. BODIPY-FL was then additionally incorporated in place of Lys1 of the BODIPY-558-containing MBP as a response to the amber codon. Fluorescence measurements with excitation of BODIPY-FL showed a large change in fluorescence intensity ratio (0.13 to 1.25) upon binding of maltose; this change can be attributed to fluorescence resonance energy transfer (FRET) and maltose-dependent quenching of BODIPY-558. These results demonstrate the usefulness of the position-specific incorporation of fluorescent amino acids in the fluorescence-based detection of protein functions.

Evaluation of Fly Ash Quality Control Tools : Technical Summary

DOT National Transportation Integrated Search

2010-06-01

Many entities currently use fl y ash in portland cement concrete (PCC) pavements and structures. Although : the body of knowledge is great concerning the use of fl y ash, several projects per year are subject to poor : performance where fl y ash is n...

Evaluation of fly ash quality control tools : tech summary.

DOT National Transportation Integrated Search

2010-06-01

Many entities currently use fl y ash in portland cement concrete (PCC) pavements and structures. Although : the body of knowledge is great concerning the use of fl y ash, several projects per year are subject to poor : performance where fl y ash is n...

TDP-43 Inclusion Bodies Formed in Bacteria Are Structurally Amorphous, Non-Amyloid and Inherently Toxic to Neuroblastoma Cells

PubMed Central

Capitini, Claudia; Conti, Simona; Perni, Michele; Guidi, Francesca; Cascella, Roberta; De Poli, Angela; Penco, Amanda; Relini, Annalisa; Cecchi, Cristina; Chiti, Fabrizio

2014-01-01

Accumulation of ubiquitin-positive, tau- and α-synuclein-negative intracellular inclusions of TDP-43 in the central nervous system represents the major hallmark correlated to amyotrophic lateral sclerosis and frontotemporal lobar degeneration with ubiquitin-positive inclusions. Such inclusions have variably been described as amorphous aggregates or more structured deposits having an amyloid structure. Following the observations that bacterial inclusion bodies generally consist of amyloid aggregates, we have overexpressed full-length TDP-43 and C-terminal TDP-43 in E. coli, purified the resulting full-length and C-terminal TDP-43 containing inclusion bodies (FL and Ct TDP-43 IBs) and subjected them to biophysical analyses to assess their structure/morphology. We show that both FL and Ct TDP-43 aggregates contained in the bacterial IBs do not bind amyloid dyes such as thioflavin T and Congo red, possess a disordered secondary structure, as inferred using circular dichroism and infrared spectroscopies, and are susceptible to proteinase K digestion, thus possessing none of the hallmarks for amyloid. Moreover, atomic force microscopy revealed an irregular structure for both types of TDP-43 IBs and confirmed the absence of amyloid-like species after proteinase K treatment. Cell biology experiments showed that FL TDP-43 IBs were able to impair the viability of cultured neuroblastoma cells when added to their extracellular medium and, more markedly, when transfected into their cytosol, where they are at least in part ubiquitinated and phosphorylated. These data reveal an inherently high propensity of TDP-43 to form amorphous aggregates, which possess, however, an inherently high ability to cause cell dysfunction. This indicates that a gain of toxic function caused by TDP-43 deposits is effective in TDP-43 pathologies, in addition to possible loss of function mechanisms originating from the cellular mistrafficking of the protein. PMID:24497973

Anoctamin 1 contributes to inflammatory and nerve-injury induced hypersensitivity.

PubMed

Lee, Byeongjun; Cho, Hawon; Jung, Jooyoung; Yang, Young Duk; Yang, Dong-Jin; Oh, Uhtaek

2014-01-23

Various pathological conditions such as inflammation or injury can evoke pain hypersensitivity. That represents the response to innocuous stimuli or exaggerated response to noxious stimuli. The molecular mechanism based on the pain hypersensitivity is associated with changes in many of ion channels in dorsal-root ganglion (DRG) neurons. Anoctamin 1 (ANO1/TMEM16A), a Ca2+ activated chloride channel is highly visible in small DRG neurons and responds to heat. Mice with an abolished function of ANO1 in DRG neurons demonstrated attenuated pain-like behaviors when exposed to noxious heat, suggesting a role in acute thermal nociception. In this study, we further examined the function of ANO1 in mediating inflammation- or injury-induced hyperalgesia or allodynia. Using Advillin/Ano1fl/fl (Adv/Ano1fl/fl) mice that have a functional ablation of Ano1 mainly in DRG neurons, we were able to determine its role in mediating thermal hyperalgesia and mechanical allodynia induced by inflammation or nerve injury. The thermal hyperalgesia and mechanical allodynia induced by carrageenan injection and spared-nerve injury were significantly reduced in Adv/Ano1fl/fl mice. In addition, flinching or licking behavior after bradykinin or formalin injection was also significantly reduced in Adv/Ano1fl/fl mice. Since pathological conditions augment nociceptive behaviors, we expected ANO1's contribution to the excitability of DRG neurons. Indeed, the application of inflammatory mediators reduced the threshold for action potential (rheobase) or time for induction of the first action potential in DRG neurons isolated from control (Ano1fl/fl) mice. These parameters for neuronal excitability induced by inflammatory mediators were not changed in Adv/Ano1fl/fl mice, suggesting an active contribution of ANO1 in augmenting the neuronal excitability. In addition to ANO1's role in mediating acute thermal pain as a heat sensor, ANO1 is also capable of augmenting the excitability of DRG neurons under inflammatory or neuropathic conditions and thereby aggravates inflammation- or tissue injury-induced pathological pain.

Shoe inserts alter plantar loading and function in patients with midfoot arthritis.

PubMed

Rao, Smita; Baumhauer, Judith F; Becica, Laura; Nawoczenski, Deborah A

2009-07-01

Experimental laboratory study supplemented by a case series. (1) To assess the effect of a 4-week intervention with a full-length insert on functional outcomes in patients with midfoot arthritis; (2) to examine the effect of the custom molded three-quarter-length (3Q) and full-length (FL) carbon graphite insert on plantar loading in patients with midfoot arthritis. Given the coexistence of pain and lower-arched foot alignment in patients with midfoot arthritis, arch-restoring orthotic devices such as the 3Q insert are frequently recommended. However, patients continue to report foot pain despite using the 3Q insert. The FL insert has been proposed as an alternative, but objective data examining its efficacy are lacking. Twenty female patients with midfoot arthritis participated in the study. Functional outcomes were assessed using the Foot Function Index-Revised (FFI-R). Plantar loading during walking was measured in the following conditions: shoe only, shoe with 3Q insert, and shoe with FL insert. Repeated-measures analyses of variance with post hoc analyses were used for statistical analysis. FL insert use for 4 weeks resulted in a 12% improvement in total FFI-R score (mean +/- SD before, 35.6 +/- 10.9; after, 31.1 +/- 9.8 [P = .03]). FL insert use resulted in a 20% reduction in medial midfoot average pressure loading (mean +/- SD, 64.8 +/- 20.4 and 51.0 +/- 15.4 kPa, with 3Q and FL insert respectively [P = .015]) and an 8.5% reduction in medial midfoot contact time (mean +/- SD, 84.9% +/- 6.4% and 76.4% +/- 7.1% of stance, with 3Q and FL insert respectively [P<.01]), compared to the 3Q insert. No differences in plantar loading were discerned between the shoe-only and FL conditions. Symptomatic improvement in patients with midfoot arthritis treated with a FL insert was accompanied by reduced magnitude and duration of loading under the medial midfoot. These preliminary outcomes suggest that the FL insert may be a viable alternative in the conservative management of patients with midfoot arthritis. Therapy, level 4. J Orthop Sports Phys Ther 2009;39(7):522-531. doi:10.2519/jospt.2009.2900.

Muscle-specific deletion of exons 2 and 3 of the IL15RA gene in mice: effects on contractile properties of fast and slow muscles.

PubMed

O'Connell, Grant; Guo, Ge; Stricker, Janelle; Quinn, LeBris S; Ma, Averil; Pistilli, Emidio E

2015-02-15

Interleukin-15 (IL-15) is a putative myokine hypothesized to induce an oxidative skeletal muscle phenotype. The specific IL-15 receptor alpha subunit (IL-15Rα) has also been implicated in specifying this contractile phenotype. The purposes of this study were to determine the muscle-specific effects of IL-15Rα functional deficiency on skeletal muscle isometric contractile properties, fatigue characteristics, spontaneous cage activity, and circulating IL-15 levels in male and female mice. Muscle creatine kinase (MCK)-driven IL-15Rα knockout mice (mIl15ra(fl/fl)/Cre(+)) were generated using the Cre-loxP system. We tested the hypothesis that IL-15Rα functional deficiency in skeletal muscle would increase resistance to contraction-induced fatigue, cage activity, and circulating IL-15 levels. There was a significant effect of genotype on the fatigue curves obtained in extensor digitorum longus (EDL) muscles from female mIl15ra(fl/fl)/Cre(+) mice, such that force output was greater during the repeated contraction protocol compared with mIl15ra(fl/fl)/Cre(-) control mice. Muscles from female mIl15ra(fl/fl)/Cre(+) mice also had a twofold greater amount of the mitochondrial genome-specific COXII gene compared with muscles from mIl15ra(fl/fl)/Cre(-) control mice, indicating a greater mitochondrial density in these skeletal muscles. There was a significant effect of genotype on the twitch:tetanus ratio in EDL and soleus muscles from mIl15ra(fl/fl)/Cre(+) mice, such that the ratio was lower in these muscles compared with mIl15ra(fl/fl)/Cre(-) control mice, indicating a pro-oxidative shift in muscle phenotype. However, spontaneous cage activity was not different and IL-15 protein levels were lower in male and female mIl15ra(fl/fl)/Cre(+) mice compared with control. Collectively, these data support a direct effect of muscle IL-15Rα deficiency in altering contractile properties and fatigue characteristics in skeletal muscles.

The U.S. Department of Defenses Earned Value ManagementAnalyst Workforce

DTIC Science & Technology

2016-01-01

as best suits each component’s unique acquisition requirements and culture. As the functional lead for this diverse and cross- functional workforce ...EVM workforces in unique arrangements, as best suits each component’s unique acquisition requirements and culture. As the FL for this diverse and...quality of the data collected by gathering insights into the diverse organization of the acquisition workforce and unique data structure across DoD

Filtered pulsed cathodic arc deposition of fullerene-like carbon and carbon nitride films

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tucker, Mark D., E-mail: martu@ifm.liu.se; Broitman, Esteban; Näslund, Lars-Åke

Carbon and carbon nitride films (CN{sub x}, 0 ≤ x ≤ 0.26) were deposited by filtered pulsed cathodic arc and were investigated using transmission electron microscopy and X-ray photoelectron spectroscopy. A “fullerene-like” (FL) structure of ordered graphitic planes, similar to that of magnetron sputtered FL-CN{sub x} films, was observed in films deposited at 175 °C and above, with N{sub 2} pressures of 0 and 0.5 mTorr. Higher substrate temperatures and significant nitrogen incorporation are required to produce similar FL structure by sputtering, which may, at least in part, be explained by the high ion charge states and ion energies characteristic of arc deposition. A gradualmore » transition from majority sp{sup 3}-hybridized films to sp{sup 2} films was observed with increasing substrate temperature. High elastic recovery, an attractive characteristic mechanical property of FL-CN{sub x} films, is evident in arc-deposited films both with and without nitrogen content, and both with and without FL structure.« less

Molecular mechanics and structure of the fluid-solid interface in simple fluids

NASA Astrophysics Data System (ADS)

Wang, Gerald J.; Hadjiconstantinou, Nicolas G.

2017-09-01

Near a fluid-solid interface, the fluid spatial density profile is highly nonuniform at the molecular scale. This nonuniformity can have profound effects on the dynamical behavior of the fluid and has been shown to play an especially important role when modeling a wide variety of nanoscale heat and momentum transfer phenomena. We use molecular-mechanics arguments and molecular-dynamics (MD) simulations to develop a better understanding of the structure of the first fluid layer directly adjacent to the solid in the layering regime, as delineated by a nondimensional number that compares the effects of wall-fluid interaction to thermal energy. Using asymptotic analysis of the Nernst-Planck equation, we show that features of the fluid density profile close to the wall, such as the areal density of the first layer ΣFL (defined as the number of atoms in this layer per unit of fluid-solid interfacial area), can be expressed as polynomial functions of the fluid average density ρave. This is found to be in agreement with MD simulations, which also show that the width of the first layer hFL is a linear function of the average density and only a weak function of the temperature T . These results can be combined to show that, for system average densities corresponding to a dense fluid (ρave≥0.7 ), the ratio C ≡ΣFLρavehFL, representing a density enhancement with respect to the bulk fluid, depends only weakly on temperature and is essentially independent of density. Further MD simulations suggest that the above results, nominally valid for large systems (solid in contact with semi-infinite fluid), also describe fluid-solid interfaces under considerable nanoconfinement, provided ρave is appropriately defined.

SHIP-1 Deficiency in AID+ B Cells Leads to the Impaired Function of B10 Cells with Spontaneous Autoimmunity.

PubMed

Chen, Yingjia; Hu, Fanlei; Dong, Xuejiao; Zhao, Meng; Wang, Jing; Sun, Xiaolin; Kim, Tae Jin; Li, Zhanguo; Liu, Wanli

2017-11-01

Unlike conventional B cells, regulatory B cells exhibit immunosuppressive functions to downregulate inflammation via IL-10 production. However, the molecular mechanism regulating the production of IL-10 is not fully understood. In this study, we report the finding that activation-induced cytidine deaminase (AID) is highly upregulated in the IL-10-competent B cell (B10) cell from Innp5d fl/fl Aicda Cre/+ mice, whereas the 5' inositol phosphatase SHIP-1 is downregulated. Notably, SHIP-1 deficiency in AID + B cells leads to a reduction in cell count and impaired IL-10 production by B10 cells. Furthermore, the Innp5d fl/fl Aicda Cre/+ mouse model shows B cell-dependent autoimmune lupus-like phenotypes, such as elevated IgG serum Abs, formation of spontaneous germinal centers, production of anti-dsDNA and anti-nuclear Abs, and the obvious deposition of IgG immune complexes in the kidney with age. We observe that these lupus-like phenotypes can be reversed by the adoptive transfer of B10 cells from control Innp5d fl/fl mice, but not from the Innp5d fl/fl Aicda Cre/+ mice. This finding highlights the importance of defective B10 cells in Innp5d fl/fl Aicda Cre/+ mice. Whereas p-Akt is significantly upregulated, MAPK and AP-1 activation is impaired in B10 cells from Innp5d fl/fl Aicda Cre/+ mice, resulting in the reduced production of IL-10. These results show that SHIP-1 is required for the maintenance of B10 cells and production of IL-10, and collectively suggests that SHIP-1 could be a new potential therapeutic target for the treatment of autoimmune diseases. Copyright © 2017 by The American Association of Immunologists, Inc.

Speech Recognition Software for Language Learning: Toward an Evaluation of Validity and Student Perceptions

ERIC Educational Resources Information Center

Cordier, Deborah

2009-01-01

A renewed focus on foreign language (FL) learning and speech for communication has resulted in computer-assisted language learning (CALL) software developed with Automatic Speech Recognition (ASR). ASR features for FL pronunciation (Lafford, 2004) are functional components of CALL designs used for FL teaching and learning. The ASR features…

Measurements of the separated longitudinal structure function FL from hydrogen and deuterium targets at low Q2

NASA Astrophysics Data System (ADS)

Tvaskis, V.; Tvaskis, A.; Niculescu, I.; Abbott, D.; Adams, G. S.; Afanasev, A.; Ahmidouch, A.; Angelescu, T.; Arrington, J.; Asaturyan, R.; Avery, S.; Baker, O. K.; Benmouna, N.; Berman, B. L.; Biselli, A.; Blok, H. P.; Boeglin, W. U.; Bosted, P. E.; Brash, E.; Breuer, H.; Chang, G.; Chant, N.; Christy, M. E.; Connell, S. H.; Dalton, M. M.; Danagoulian, S.; Day, D.; Dodario, T.; Dunne, J. A.; Dutta, D.; El Khayari, N.; Ent, R.; Fenker, H. C.; Frolov, V. V.; Gaskell, D.; Garrow, K.; Gilman, R.; Gueye, P.; Hafidi, K.; Hinton, W.; Holt, R. J.; Horn, T.; Huber, G. M.; Jackson, H.; Jiang, X.; Jones, M. K.; Joo, K.; Kelly, J. J.; Keppel, C. E.; Kuhn, J.; Kinney, E.; Klein, A.; Kubarovsky, V.; Liang, Y.; Lolos, G.; Lung, A.; Mack, D.; Malace, S.; Markowitz, P.; Mbianda, G.; McGrath, E.; Mckee, D.; Meekins, D. G.; Mkrtchyan, H.; Napolitano, J.; Navasardyan, T.; Niculescu, G.; Nozar, M.; Ostapenko, T.; Papandreou, Z.; Potterveld, D.; Reimer, P. E.; Reinhold, J.; Roche, J.; Rock, S. E.; Schulte, E.; Segbefia, E.; Smith, C.; Smith, G. R.; Stoler, P.; Tadevosyan, V.; Tang, L.; Telfeyan, J.; Todor, L.; Ungaro, M.; Uzzle, A.; Vidakovic, S.; Villano, A.; Vulcan, W. F.; Warren, G.; Wesselmann, F.; Wojtsekhowski, B.; Wood, S. A.; Yan, C.; Zihlmann, B.

2018-04-01

Structure functions, as measured in lepton-nucleon scattering, have proven to be very useful in studying the partonic dynamics within the nucleon. However, it is experimentally difficult to separately determine the longitudinal and transverse structure functions, and consequently there are substantially less data available in particular for the longitudinal structure function. Here, we present separated structure functions for hydrogen and deuterium at low four-momentum transfer squared, Q2<1 GeV2 , and compare them with parton distribution parametrization and kT factorization approaches. While differences are found, the parametrizations generally agree with the data, even at the very low-Q2 scale of the data. The deuterium data show a smaller longitudinal structure function and a smaller ratio of longitudinal to transverse cross section, R , than the proton. This suggests either an unexpected difference in R for the proton and the neutron or a suppression of the gluonic distribution in nuclei.

Structure and biocatalytic scope of thermophilic flavin-dependent halogenase and flavin reductase enzymes.

PubMed

Menon, Binuraj R K; Latham, Jonathan; Dunstan, Mark S; Brandenburger, Eileen; Klemstein, Ulrike; Leys, David; Karthikeyan, Chinnan; Greaney, Michael F; Shepherd, Sarah A; Micklefield, Jason

2016-10-04

Flavin-dependent halogenase (Fl-Hal) enzymes have been shown to halogenate a range of synthetic as well as natural aromatic compounds. The exquisite regioselectively of Fl-Hal enzymes can provide halogenated building blocks which are inaccessible using standard halogenation chemistries. Consequently, Fl-Hal are potentially useful biocatalysts for the chemoenzymatic synthesis of pharmaceuticals and other valuable products, which are derived from haloaromatic precursors. However, the application of Fl-Hal enzymes, in vitro, has been hampered by their poor catalytic activity and lack of stability. To overcome these issues, we identified a thermophilic tryptophan halogenase (Th-Hal), which has significantly improved catalytic activity and stability, compared with other Fl-Hal characterised to date. When used in combination with a thermostable flavin reductase, Th-Hal can efficiently halogenate a number of aromatic substrates. X-ray crystal structures of Th-Hal, and the reductase partner (Th-Fre), provide insights into the factors that contribute to enzyme stability, which could guide the discovery and engineering of more robust and productive halogenase biocatalysts.

Role of N-terminal residues on folding and stability of C-phycoerythrin: simulation and urea-induced denaturation studies.

PubMed

Anwer, Khalid; Sonani, Ravi; Madamwar, Datta; Singh, Parvesh; Khan, Faez; Bisetty, Krishna; Ahmad, Faizan; Hassan, Md Imtaiyaz

2015-01-01

The conformational state of biliproteins can be determined by optical properties of the covalently linked chromophores. Recently determined crystal structure of truncated form of α-subunit of cyanobacterial phycoerythrin (αC-PE) from Phormidium tenue provides a new insight into the structure-function relationship of αC-PE. To compare their stabilities, we have measured urea-induced denaturation transitions of the full length αC-PE (FL-αC-PE) and truncated αC-PE (Tr-αC-PE) followed by observing changes in absorbance at 565 nm, fluorescence at 350 and 573 nm, and circular dichroism at 222 nm as a function of [urea], the molar concentration of urea. The transition curve of each protein was analyzed for ΔG(D)(0), the value of Gibbs free energy change on denaturation (ΔG(D)) in the absence of urea; m, the slope (=∂∆G(D)/∂[urea]), and C(m), the midpoint of the denaturation curve, i.e. [urea] at which ΔG(D) = 0. A difference of about 10% in ΔG(D)(0) observed between FL-αC-PE and Tr-αC-PE, suggests that the two proteins are almost equally stable, and the natural deletion of 31 residues from the N-terminal side of the full length protein does not alter its stability. Furthermore, normalization of probes shows that the urea-induced denaturation of both the proteins is a two-state process. Folding of both structural variants (Tr-αC-PE and FL-αC-PE) of P. tenue were also studied using molecular dynamics simulations at 300 K. The results show clearly that the stability of the proteins is evenly distributed over the whole structure indicating no significant role of N-terminal residues in the stability of both proteins.

Funktionale Satzperspektive und kommunikative Gliederung im Englischen (Functional Sentence Perspective and Communicative Classification in English)

ERIC Educational Resources Information Center

Lipka, Leonhard

1977-01-01

Sentence perspective is determined by communicative function. In English this especially involves word order and the subject, the passive voice, and intonation. Intonation in particular needs more attention in FL teaching and in the training of FL teachers. (Text is in German.) (IFS/WGA)

Integrin beta1-mediated matrix assembly and signaling are critical for the normal development and function of the kidney glomerulus.

PubMed

Kanasaki, Keizo; Kanda, Yoshiko; Palmsten, Kristin; Tanjore, Harikrishna; Lee, Soo Bong; Lebleu, Valerie S; Gattone, Vincent H; Kalluri, Raghu

2008-01-15

The human kidneys filter 180 l of blood every day via about 2.5 million glomeruli. The three layers of the glomerular filtration apparatus consist of fenestrated endothelium, specialized extracellular matrix known as the glomerular basement membrane (GBM) and the podocyte foot processes with their modified adherens junctions known as the slit diaphragm (SD). In this study we explored the contribution of podocyte beta1 integrin signaling for normal glomerular function. Mice with podocyte specific deletion of integrin beta1 (podocin-Cre beta1-fl/fl mice) are born normal but cannot complete postnatal renal development. They exhibit detectable proteinuria on day 1 and die within a week. The kidneys of podocin-Cre beta1-fl/fl mice exhibit normal glomerular endothelium but show severe GBM defects with multilaminations and splitting including podocyte foot process effacement. The integrin linked kinase (ILK) is a downstream mediator of integrin beta1 activity in epithelial cells. To further explore whether integrin beta1-mediated signaling facilitates proper glomerular filtration, we generated mice deficient of ILK in the podocytes (podocin-Cre ILK-fl/fl mice). These mice develop normally but exhibit postnatal proteinuria at birth and die within 15 weeks of age due to renal failure. Collectively, our studies demonstrate that podocyte beta1 integrin and ILK signaling is critical for postnatal development and function of the glomerular filtration apparatus.

Sphingosine 1-phosphate lyase ablation disrupts presynaptic architecture and function via an ubiquitin- proteasome mediated mechanism.

PubMed

Mitroi, Daniel N; Deutschmann, André U; Raucamp, Maren; Karunakaran, Indulekha; Glebov, Konstantine; Hans, Michael; Walter, Jochen; Saba, Julie; Gräler, Markus; Ehninger, Dan; Sopova, Elena; Shupliakov, Oleg; Swandulla, Dieter; van Echten-Deckert, Gerhild

2016-11-24

The bioactive lipid sphingosine 1-phosphate (S1P) is a degradation product of sphingolipids that are particularly abundant in neurons. We have shown previously that neuronal S1P accumulation is toxic leading to ER-stress and an increase in intracellular calcium. To clarify the neuronal function of S1P, we generated brain-specific knockout mouse models in which S1P-lyase (SPL), the enzyme responsible for irreversible S1P cleavage was inactivated. Constitutive ablation of SPL in the brain (SPL fl/fl/Nes ) but not postnatal neuronal forebrain-restricted SPL deletion (SPL fl/fl/CaMK ) caused marked accumulation of S1P. Hence, altered presynaptic architecture including a significant decrease in number and density of synaptic vesicles, decreased expression of several presynaptic proteins, and impaired synaptic short term plasticity were observed in hippocampal neurons from SPL fl/fl/Nes mice. Accordingly, these mice displayed cognitive deficits. At the molecular level, an activation of the ubiquitin-proteasome system (UPS) was detected which resulted in a decreased expression of the deubiquitinating enzyme USP14 and several presynaptic proteins. Upon inhibition of proteasomal activity, USP14 levels, expression of presynaptic proteins and synaptic function were restored. These findings identify S1P metabolism as a novel player in modulating synaptic architecture and plasticity.

Distinct Molecular Signature of Murine Fetal Liver and Adult Hematopoietic Stem Cells Identify Novel Regulators of Hematopoietic Stem Cell Function

PubMed Central

Manesia, Javed K.; Franch, Monica; Tabas-Madrid, Daniel; Nogales-Cadenas, Ruben; Vanwelden, Thomas; Van Den Bosch, Elisa; Xu, Zhuofei; Pascual-Montano, Alberto; Khurana, Satish; Verfaillie, Catherine M.

2018-01-01

During ontogeny, fetal liver (FL) acts as a major site for hematopoietic stem cell (HSC) maturation and expansion, whereas HSCs in the adult bone marrow (ABM) are largely quiescent. HSCs in the FL possess faster repopulation capacity as compared with ABM HSCs. However, the molecular mechanism regulating the greater self-renewal potential of FL HSCs has not yet extensively been assessed. Recently, we published RNA sequencing-based gene expression analysis on FL HSCs from 14.5-day mouse embryo (E14.5) in comparison to the ABM HSCs. We reanalyzed these data to identify key transcriptional regulators that play important roles in the expansion of HSCs during development. The comparison of FL E14.5 with ABM HSCs identified more than 1,400 differentially expressed genes. More than 200 genes were shortlisted based on the gene ontology (GO) annotation term “transcription.” By morpholino-based knockdown studies in zebrafish, we assessed the function of 18 of these regulators, previously not associated with HSC proliferation. Our studies identified a previously unknown role for tdg, uhrf1, uchl5, and ncoa1 in the emergence of definitive hematopoiesis in zebrafish. In conclusion, we demonstrate that identification of genes involved in transcriptional regulation differentially expressed between expanding FL HSCs and quiescent ABM HSCs, uncovers novel regulators of HSC function. PMID:27958775

Krüppel-like factor 5 is essential for maintenance of barrier function in mouse colon.

PubMed

Liu, Yang; Chidgey, Martyn; Yang, Vincent W; Bialkowska, Agnieszka B

2017-11-01

Krüppel-like factor 5 (KLF5) is a member of the zinc finger family of transcription factors that regulates homeostasis of the intestinal epithelium. Previous studies suggested an indispensable role of KLF5 in maintaining intestinal barrier function. In the current study, we investigated the mechanisms by which KLF5 regulates colonic barrier function in vivo and in vitro. We used an inducible and a constitutive intestine-specific Klf5 knockout mouse models ( Villin-CreER T2 ;Klf5 fl/fl designated as Klf5 ΔIND and Villin-Cre;Klf5 fl/fl as Klf5 ΔIS ) and studied an inducible KLF5 knockdown in Caco-2 BBe cells using a lentiviral Tet-on system (Caco-2 BBe KLF5ΔIND ). Specific knockout of Klf5 in colonic tissues, either inducible or constitutive, resulted in increased intestinal permeability. The phenotype was accompanied by a significant reduction in Dsg2 , which encodes desmoglein-2, a desmosomal cadherin, at both mRNA and protein levels. Transmission electron microscopy showed alterations of desmosomal morphology in both KLF5 knockdown Caco-2 BBe cells and Klf5 knockout mouse colonic tissues. Inducible knockdown of KLF5 in Caco-2BBe cells grown on Transwell plates led to impaired barrier function as evidenced by decreased transepithelial electrical resistance and increased paracellular permeability to fluorescein isothiocyanate-4 kDa dextran. Furthermore, DSG2 was significantly decreased in KLF5 knockdown cells, and DSG2 overexpression partially rescued the impaired barrier function caused by KLF5 knockdown. Electron microscopy studies demonstrated altered desmosomal morphology after KLF5 knockdown. In combination with chromatin immunoprecipitation analysis and promoter study, our data show that KLF5 regulates intestinal barrier function by mediating the transcription of DSG2 , a gene encoding a major component of desmosome structures. NEW & NOTEWORTHY The study is original research on the direct function of a Krüppel-like factor on intestinal barrier function, which is commonly exerted by cell junctions, including tight junctions, adherens junctions, and desmosomes. Numerous previous studies were focused on tight junctions and adherens junctions. However, this study provided a new perspective on how the intestinal barrier function is regulated by KLF5 through DSG2, a component of desmosome complexes. Copyright © 2017 the American Physiological Society.

Protective dendritic cell responses against listeriosis induced by the short form of the deubiquitinating enzyme CYLD are inhibited by full-length CYLD.

PubMed

Wurm, Rebecca; Just, Sissy; Wang, Xu; Wex, Katharina; Schmid, Ursula; Blanchard, Nicolas; Waisman, Ari; Schild, Hans-Jörg; Deckert, Martina; Naumann, Michael; Schlüter, Dirk; Nishanth, Gopala

2015-05-01

The deubiquitinating enzyme CYLD is an important tumor suppressor and inhibitor of immune responses. In contrast to full-length CYLD, the immunological function of the naturally occurring short splice variant of CYLD (sCYLD) is insufficiently described. Previously, we showed that DCs, which lack full-length CYLD but express sCYLD, exhibit augmented NF-κB and DC activation. To explore the function of sCYLD in infection, we investigated whether DC-specific sCYLD regulates the pathogenesis of listeriosis. Upon Listeria monocytogenes infection of CD11c-Cre Cyld(ex7/8 fl/fl) mice, infection of CD8α(+) DCs, which are crucial for the establishment of listeriosis in the spleen, was not affected. However, NF-κB activity of CD11c-Cre Cyld(ex7/8 fl/fl) DCs was increased, while activation of ERK and p38 was normal. In addition, CD11c-Cre Cyld(ex7/8 fl/fl) DCs produced more TNF, IL-10, and IL-12 upon infection, which led to enhanced stimulation of IFN-γ-producing NK cells. In addition CD11c-Cre Cyld(ex7/8 fl/fl) DCs presented Listeria Ag more efficiently to CD8(+) T cells resulting in a stronger pathogen-specific CD8(+) T-cell proliferation and more IFN-γ production. Collectively, the improved innate and adaptive immunity and survival during listeriosis identify the DC-specific FL-CYLD/sCYLD balance as a potential target to modulate NK-cell and Ag-specific CD8(+) T-cell responses. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Epithelial-mesenchymal transition and nuclear β-catenin induced by conditional intestinal disruption of Cdh1 with Apc is E-cadherin EC1 domain dependent

PubMed Central

Carter, Emma J.; Barnes, David; Hoppe, Hans-Jürgen; Hughes, Jennifer; Cobbold, Stephen; Harper, James; Morreau, Hans; Surakhy, Mirvat; Hassan, A. Bassim

2016-01-01

Two important protein-protein interactions establish E-cadherin (Cdh1) in the adhesion complex; homophilic binding via the extra-cellular (EC1) domain and cytoplasmic tail binding to β-catenin. Here, we evaluate whether E-cadherin binding can inhibit β-catenin when there is loss of Adenomatous polyposis coli (APC) from the β-catenin destruction complex. Combined conditional loss of Cdh1 and Apc were generated in the intestine, intestinal adenoma and adenoma organoids. Combined intestinal disruption (Cdh1fl/flApcfl/flVil-CreERT2) resulted in lethality, breakdown of the intestinal barrier, increased Wnt target gene expression and increased nuclear β-catenin localization, suggesting that E-cadherin inhibits β-catenin. Combination with an intestinal stem cell Cre (Lgr5CreERT2) resulted in ApcΔ/Δ recombination and adenoma, but intact Cdh1fl/fl alleles. Cultured ApcΔ/ΔCdh1fl/fl adenoma cells infected with adenovirus-Cre induced Cdh1fl/fl recombination (Cdh1Δ/Δ), disruption of organoid morphology, nuclear β-catenin localization, and cells with an epithelial-mesenchymal phenotype. Complementation with adenovirus expressing wild-type Cdh1 (Cdh1-WT) rescued adhesion and β-catenin membrane localization, yet an EC1 specific double mutant defective in homophilic adhesion (Cdh1-MutW2A, S78W) did not. These data suggest that E-cadherin inhibits β-catenin in the context of disruption of the APC-destruction complex, and that this function is also EC1 domain dependent. Both binding functions of E-cadherin may be required for its tumour suppressor activity. PMID:27566565

Importance of inoculum properties on the structure and growth of bacterial communities during Recolonisation of humus soil with different pH.

PubMed

Pettersson, Marie; Bååth, Erland

2013-08-01

The relationship between community structure and growth and pH tolerance of a soil bacterial community was studied after liming in a reciprocal inoculum study. An unlimed (UL) humus soil with a pH of 4.0 was fumigated with chloroform for 4 h, after which < 1 % of the initial bacterial activity remained. Half of the fumigated soil was experimentally limed (EL) to a pH of 7.6. Both the UL and the EL soil were then reciprocally inoculated with UL soil or field limed (FL) soil with a pH of 6.2. The FL soil was from a 15-year-old experiment. The structural changes were measured on both bacteria in soil and on bacteria able to grow on agar plates using phospholipids fatty acid (PLFA) and denaturing gradient gel electrophoresis (DGGE) analysis. The developing community pH tolerance and bacterial growth were also monitored over time using thymidine incorporation. The inoculum source had a significant impact on both growth and pH tolerance of the bacterial community in the EL soil. These differences between the EL soil inoculated with UL soil and FL soil were correlated to structural changes, as evidenced by both PLFA and DGGE analyses on the soil. Similar correlations were seen to the fraction of the community growing on agar plates. There were, however, no differences between the soil bacterial communities in the unlimed soils with different inocula. This study showed the connection between the development of function (growth), community properties (pH tolerance) and the structure of the bacterial community. It also highlighted the importance of both the initial properties of the community and the selection pressure after environmental changes in shaping the resulting microbial community.

The proton FL dipole approximation in the KMR and the MRW unintegrated parton distribution functions frameworks

NASA Astrophysics Data System (ADS)

Modarres, M.; Masouminia, M. R.; Hosseinkhani, H.; Olanj, N.

2016-01-01

In the spirit of performing a complete phenomenological investigation of the merits of Kimber-Martin-Ryskin (KMR) and Martin-Ryskin-Watt (MRW) unintegrated parton distribution functions (UPDF), we have computed the longitudinal structure function of the proton, FL (x ,Q2), from the so-called dipole approximation, using the LO and the NLO-UPDF, prepared in the respective frameworks. The preparation process utilizes the PDF of Martin et al., MSTW2008-LO and MSTW2008-NLO, as the inputs. Afterwards, the numerical results are undergone a series of comparisons against the exact kt-factorization and the kt-approximate results, derived from the work of Golec-Biernat and Stasto, against each other and the experimental data from ZEUS and H1 Collaborations at HERA. Interestingly, our results show a much better agreement with the exact kt-factorization, compared to the kt-approximate outcome. In addition, our results are completely consistent with those prepared from embedding the KMR and MRW UPDF directly into the kt-factorization framework. One may point out that the FL, prepared from the KMR UPDF shows a better agreement with the exact kt-factorization. This is despite the fact that the MRW formalism employs a better theoretical description of the DGLAP evolution equation and has an NLO expansion. Such unexpected consequence appears, due to the different implementation of the angular ordering constraint in the KMR approach, which automatically includes the resummation of ln ⁡ (1 / x), BFKL logarithms, in the LO-DGLAP evolution equation.

Auto-aggregation properties of a novel aerobic denitrifier Enterobacter sp. strain FL.

PubMed

Wang, Xia; An, Qiang; Zhao, Bin; Guo, Jin Song; Huang, Yuan Sheng; Tian, Meng

2018-02-01

Enterobacter sp. strain FL was newly isolated from activated sludge and exhibited significant capability of auto-aggregation as well as aerobic denitrification. The removal efficiencies of NO 3 - -N, total nitrogen (TN), and TOC by strain FL in batch culture reached 94.6, 63.9, and 72.5% in 24 h, respectively. The production of N 2 O and N 2 in the presence of oxygen demonstrated the occurrence of aerobic denitrification. The auto-aggregation index of strain FL reached 54.3%, suggesting a high tendency that the cells would agglomerate into aggregates. The production of extracellular polymeric substances (EPSs), which were mainly composed of proteins followed by polysaccharides, was considered to be related to the cell aggregation according to Fourier transform infrared (FT-IR) and confocal laser scanning microscopy (CLSM). The proteins in EPS were evenly and tightly combined to cells and altered the protein secondary structures of cell surface from random coils to β-sheets and three-turn helices. The alteration of protein secondary structures of cell surface caused by the proteins in EPS might play a dominant role in the auto-aggregation of strain FL. To further assess the feasibility of strain FL for synthetic wastewater treatment, a sequencing batch reactor (SBR), solely inoculated with strain FL, was conducted. During the 16 running cycles, the removal efficiency of NO 3 - -N was 90.2-99.7% and the auto-aggregation index was stabilized at 35.0-41.5%. The EPS promoted the biomass of strain FL to aggregate in the SBR.

Towards an understanding of the relationship of functional literacy and numeracy to geographical health inequalities.

PubMed

Moon, Graham; Aitken, Grant; Roderick, Paul; Fraser, Simon; Rowlands, Gill

2015-10-01

The relative contributions of functional literacy and functional numeracy to health disparities remain poorly understood in developed world contexts. We seek to unpack their distinctive contributions and to examine how these contributions are framed by place-based deprivation and rurality. We present a multilevel logistic analysis of the 2011 Skills for Life Survey (SfLS), a representative governmental survey of adults aged 16-65 in England. Outcome measures were self-assessed health status and the presence of self-reported long-term health conditions. Exposure variables were functional literacy (FL) and functional numeracy (FN). Age, sex, individual socio-economic status, ethnicity, whether English was a first language, non-UK birthplaces, housing tenure and geography were included as potential confounders and mediators. Geography was measured as area-based deprivation and urban/rural status. FL and FN were both independently associated with self-assessed health status, though the association attenuated after taking account of confounders and mediators. For long-term conditions, the association with FN remained significant following inclusion of confounders and mediators whilst FL attenuated to non-significance. Rurality did not influence these associations. Area deprivation was a significant factor in attenuating the association between FL and self-assessed health status. Policy makers and health professionals will need to be aware of the distinctive impact of FN as well as FL when combating health inequalities, promoting health and managing long-term conditions. Copyright © 2015 Elsevier Ltd. All rights reserved.

Formulae Based on Biomathematics to Estimate the Standard Value of Fetal Growth of Japanese.

PubMed

Miyagi, Yasunari; Tada, Katsuhiko; Takayoshi, Riko; Oguni, Nobutsugu; Sato, Yasushi; Shibata, Maki; Kiyokawa, Machiko; Hashimoto, Tadashi; Takada, Tomoyoshi; Oda, Takashi; Miyake, Takahito

2018-04-01

We devised biomathematics-based formulae to estimate the standard values of fetal growth of Japanese after 22 weeks' gestation. The growth rates of bi-parietal diameter (BPD), abdominal circumference (AC), femur length (FL), and estimated fetal body weight (EFBW) at the time of gestation were assumed to be proportional to the product of the value at the time and the rest value of an unknown maximum value, respectively. The EFBW was also assumed to follow a multiple logistic function of BPD, AC and FL to fit the standard values of Japanese fetuses published by the Japan Society of Ultrasonics in Medicine. The Mann-Whitney test was used for statistical analysis. The values as a function of gestational day, t, were as follows: BPD(t)=99.6/(1+exp (2.725-0.01837＊t)) (mm); AC(t)=39.7/(1+exp (2.454-0.01379＊t)) (cm); FL(t)=79.6/(1+exp (2.851-0.01710＊t)) (mm); EFBW(t)=8045.1/(1+exp (6.028-0.06582＊BPD(t)-0.1469＊AC(t)+ 0.07377＊FL(t))) (g). EFBW as a function of BPD, AC and FL was as follows: EFBW=8045.1/(1+exp (4.747+ 0.02584＊BPD+0.1010＊AC-0.1416＊FL)) (g). When the BPD, AC and FL were at -2 standard deviation (SD), -1SD, mean and + 2SD, the EFBW values calculated by the formula were statistically closer to the standard values than conventional formulas with p-values of 4.871×10-7, 4.228×10-7, 9.777×10-7 and 0.028, respectively. The formulae based on biomathematics might be useful to estimate the fetal growth standard values.

The antibiotic resistome of free-living and particle-attached bacteria under a reservoir cyanobacterial bloom.

PubMed

Guo, Yunyan; Liu, Min; Liu, Lemian; Liu, Xuan; Chen, Huihuang; Yang, Jun

2018-05-04

In freshwater systems, both antibiotic resistance genes (ARGs) and cyanobacterial blooms attract global public health concern. Cyanobacterial blooms can greatly impact bacterial taxonomic communities, but very little is known about the influence of the blooms on antibiotic resistance functional community. In this study, the ARGs in both free-living (FL) and particle-attached (PA) bacteria under bloom and non-bloom conditions were simultaneously investigated in a subtropical reservoir using high-throughput approaches. In total, 145 ARGs and 9 mobile genetic elements (MGEs) were detected. The most diverse and dominant of which (68.93%) were multidrug resistance genes and efflux pump mechanism. The richness of ARGs in both FL and PA bacteria was significantly lower during the bloom period compared with non-bloom period. The abundance of ARGs in FL bacteria was significantly lower under bloom condition than in the non-bloom period, but the abundance of ARGs in PA bacteria stayed constant. More importantly, the resistant functional community in PA bacteria was more strongly influenced by the cyanobacterial bloom than in the FL bacteria, although >96% ARGs were shared in both FL and PA bacteria or both bloom and non-bloom periods. We also compared the community compositions between taxonomy and function, and found antibiotic resistant communities were highly variable and exhibited lower similarity between bloom and non-bloom periods than seen in the taxonomic composition, with an exception of FL bacteria. Altogether, cyanobacterial blooms appear to have stronger inhibitory effect on ARG abundance in FL bacteria, and stronger influence on antibiotic resistant community composition in PA bacteria. Our results further suggested that both neutral and selective processes interactively affected the ARG composition dynamics of the FL and PA bacteria. However, the antibiotic resistant community of FL bacteria exhibited a higher level of temporal stochasticity following the bloom event than PA bacteria. Therefore, we emphasized the bacterial lifestyles as an important mechanism, giving rise to different responses of antibiotic resistant community to the cyanobacterial bloom. Copyright © 2018 Elsevier Ltd. All rights reserved.

Comparative study of four interleukin 17 cytokines of tongue sole Cynoglossus semilaevis: Genomic structure, expression pattern, and promoter activity.

PubMed

Chi, Heng; Sun, Li

2015-11-01

The interleukin (IL)-17 cytokine family participates in the regulation of many cellular functions. In the present study, we analyzed the genomic structure, expression, and promoter activity of four IL-17 members from the teleost fish tongue sole (Cynoglossus semilaevis), i.e. CsIL-17C CsIL-17D, CsIL-17F, and IL-17F like (IL-17Fl). We found that CsIL-17C, CsIL-17D, CsIL-17F, and CsIL-17Fl share 21.2%-28.6% overall sequence identities among themselves and 31.5%-71.2% overall sequence identities with their counterparts in other teleost. All four CsIL-17 members possess an IL-17 domain and four conserved cysteine residues. Phylogenetic analysis classified the four CsIL-17 members into three clusters. Under normal physiological conditions, the four CsIL-17 expressed in multiple tissues, especially non-immune tissues. Bacterial infection upregulated the expression of all four CsIL-17, while viral infection upregulated the expression of CsIL-17D and CsIL-17Fl but downregulated the expression of CsIL-17C and CsIL-17F. The 1.2 kb 5'-flanking regions of the four CsIL-17 exhibited apparent promoter activity and contain a number of putative transcription factor-binding sites. Furthermore, the promoter activities of CsIL-17C, CsIL-17D, and CsIL-17F, but not CsIL-17Fl, were modulated to significant extents by lipopolysaccharide, PolyI:C, and PMA. This study provides the first evidence that in teleost, different IL-17 members differ in expression pattern and promoter activity. Copyright © 2015 Elsevier Ltd. All rights reserved.

Strategies of molecular imprinting-based fluorescence sensors for chemical and biological analysis.

PubMed

Yang, Qian; Li, Jinhua; Wang, Xiaoyan; Peng, Hailong; Xiong, Hua; Chen, Lingxin

2018-07-30

One pressing concern today is to construct sensors that can withstand various disturbances for highly selective and sensitive detecting trace analytes in complicated samples. Molecularly imprinted polymers (MIPs) with tailor-made binding sites are preferred to be recognition elements in sensors for effective targets detection, and fluorescence measurement assists in highly sensitive detection and user-friendly control. Accordingly, molecular imprinting-based fluorescence sensors (MI-FL sensors) have attracted great research interest in many fields such as chemical and biological analysis. Herein, we comprehensively review the recent advances in MI-FL sensors construction and applications, giving insights on sensing principles and signal transduction mechanisms, focusing on general construction strategies for intrinsically fluorescent or nonfluorescent analytes and improvement strategies in sensing performance, particularly in sensitivity. Construction strategies are well overviewed, mainly including the traditional indirect methods of competitive binding against pre-bound fluorescent indicators, employment of fluorescent functional monomers and embedding of fluorescence substances, and novel rational designs of hierarchical architecture (core-shell/hollow and mesoporous structures), post-imprinting modification, and ratiometric fluorescence detection. Furthermore, MI-FL sensor based microdevices are discussed, involving micromotors, test strips and microfluidics, which are more portable for rapid point-of-care detection and in-field diagnosing. Finally, the current challenges and future perspectives of MI-FL sensors are proposed. Copyright © 2018 Elsevier B.V. All rights reserved.

Expression and evolution of delta9 and delta11 desaturase genes in the moth Spodoptera littoralis.

PubMed

Rodríguez, Sergio; Hao, Guixia; Liu, Weitian; Piña, Benjamín; Rooney, Alejandro P; Camps, Francisco; Roelofs, Wendell L; Fabriàs, Gemma

2004-12-01

Desaturation of fatty acids is a key reaction in the biosynthesis of moth sex pheromones. The main component of Spodoptera littoralis sex pheromone blend is produced by the action of Delta11 and Delta9 desaturases. In this article, we report on the cloning of four desaturase-like genes in this species: one from the fat body (Sls-FL1) and three (Sls-FL2, Sls-FL3 and Sls-FL4) from the pheromone gland. By means of a computational/phylogenetic method, as well as functional assays, the desaturase gene products have been characterized. The fat body gene expressed a Delta9 desaturase that produced (Z)-9-hexadecenoic and (Z)-9-octadecenoic acids in a (1:4.5) ratio, whereas the pheromone gland Sls-FL2 expressed a Delta9 desaturase that produced (Z)-9-hexadecenoic and (Z)-9-octadecenoic acids in a (1.5:1) ratio. Although both Delta9 desaturases produced (Z)-9-tetradecenoic acid from myristic acid, transformed yeast grown in the presence of a mixture of myristic and (E)-11-tetradecenoic acids produced (Z,E)-9,11-tetradecadienoic acid, but not (Z)-9-tetradecenoic acid. The Sls-FL3 gene expressed a protein that produced a mixture of (E)-11-tetradecenoic, (Z)-11-tetradecenoic, (Z)-11-hexadecenoic and (Z)-11-octadecenoic acids in a 5:4:60:31 ratio. Despite having all the characteristics of a desaturase gene, no function could be found for Sls-FL4.

[Variability in the relative abundance, size structure and sex ratio of the dolphinfish Coryphaena hippurus (Pisces: Coryphaenidae) in the Gulf of Tehuantepec, México].

PubMed

Alejo-Plata, Carmen; Gómez, José Luis; Serrano-Guzmán, Saúl J

2014-06-01

Variability in the relative abundance, size structure and sex ratio of the dolphinfish Coryphaena hippurus (Pisces: Coryphaenidae) in the Gulf of Tehuantepec, México. The dolphinfish (Coryphaena hippurus), is an oceanic epipelagic fish found worldwide in tropical and subtropical waters, with a high dispersal capability via large-scale migrations. This fast-swimming top-level predator is abundant in the Gulf of Tehuantepec, where it is caught incidentally by artisanal fisheries, and represents a target species for both recreational and commercial fisheries in Mexico, Ecuador, Peru and Central America. Nowadays, local fishery information on this species is scarce, thus our objective was to analyze the size structure by sex and the catch-per-unit-effort (CPUE) tendency of dolphinfish caught in the Gulf of Tehuantepec, from 2000 to 2007. For this, fishery catches information was obtained from the artisanal fleet, at six landing sites in the Gulf, and the sex ratio, fork length (FL) and the catch per unit effort (CPUE) were estimated. From all sampling sites, a total of 3 494 females, and 3 877 males were obtained, and dolphinfish size as fork length (FL) ranged from 20.5 to 152cm. Fish size ranged from 25.5 to 148cm furcal length (FL) in males, and 20.5 to 129cm FL in females. The sex ratio (males:females) was 1:1, except in April-May (1:1.5, p < 0.05) and November (1:0.5, p < 0.05). The sex ratio at different size classes showed a significant bias towards females at smaller sizes (< 75cm FL), whereas the males were predominant in larger size classes (> 100cm FL). The size structure was bimodal, with a variation in the size average; the modes were defined as the small group (FL = 50-55cm) and the large size group (FL = 100-110cm). The CPUE showed seasonal changes: values were high for the November-December period, and values were lower for July-August. The seasonal and inter annual variation in the abundance of dolphinfish is probably related to a pre-spawning migration in close relation to the rain-drought regime characteristic of the region, and the associated wind upwelling season of "Tehuanos" in the Gulf of Tehuantepec.

The Maize Imprinted Gene Floury3 Encodes a PLATZ Protein Required for tRNA and 5S rRNA Transcription through Interaction with RNA Polymerase III[OPEN

PubMed Central

Wang, Jiechen; Ye, Jianwei; Zheng, Xixi; Xiang, Xiaoli; Li, Changsheng; Fu, Miaomiao; Wang, Qiong; Zhang, Zhiyong; Wu, Yongrui

2017-01-01

Maize (Zea mays) floury3 (fl3) is a classic semidominant negative mutant that exhibits severe defects in the endosperm but fl3 plants otherwise appear normal. We cloned the fl3 gene and determined that it encodes a PLATZ (plant AT-rich sequence and zinc binding) protein. The mutation in fl3 resulted in an Asn-to-His replacement in the conserved PLATZ domain, creating a dominant allele. Fl3 is specifically expressed in starchy endosperm cells and regulated by genomic imprinting, which leads to the suppressed expression of fl3 when transmitted through the male, perhaps as a consequence the semidominant behavior. Yeast two-hybrid screening and bimolecular luciferase complementation experiments revealed that FL3 interacts with the RNA polymerase III subunit 53 (RPC53) and transcription factor class C 1 (TFC1), two critical factors of the RNA polymerase III (RNAPIII) transcription complex. In the fl3 endosperm, the levels of many tRNAs and 5S rRNA that are transcribed by RNAPIII are significantly reduced, suggesting that the incorrectly folded fl3 protein may impair the function of RNAPIII. The transcriptome is dramatically altered in fl3 mutants, in which the downregulated genes are primarily enriched in pathways related to translation, ribosome, misfolded protein responses, and nutrient reservoir activity. Collectively, these changes may lead to defects in endosperm development and storage reserve filling in fl3 seeds. PMID:28874509

Adsorption of Polycyclic aromatic hydrocarbons (fluoranthene and anthracenemethanol) by functional graphene oxide and removal by pH and temperature-sensitive coagulation.

PubMed

Zhang, Caili; Wu, Lin; Cai, Dongqing; Zhang, Caiyun; Wang, Ning; Zhang, Jing; Wu, Zhengyan

2013-06-12

A new kind of functional graphene oxide with fine stability in water was fabricated by mixing graphene oxide (GO) and brilliant blue (BB) with a certain weight ratio. The adsorption performance of this mixture of BB and GO (BBGO) to polycyclic aromatic hydrocarbons (anthracenemethanol (AC) and fluoranthene (FL)) was investigated, and the results indicated BBGO possessed adsorption capacity of 1.676 mmol/g and removal efficiency of 72.7% as to AC and adsorption capacity of 2.212 mmol/g and removal efficiency of 93.2% as to FL. After adsorption, pH and temperature-sensitive coagulation (PTC) method was used to remove the AC/BBGO or FL/BBGO complex and proved to be an effective approach to flocculate the AC/BBGO or FL/BBGO complex into large flocs, which tended to be removed from the aqueous solution.

RiceFOX: a database of Arabidopsis mutant lines overexpressing rice full-length cDNA that contains a wide range of trait information to facilitate analysis of gene function.

PubMed

Sakurai, Tetsuya; Kondou, Youichi; Akiyama, Kenji; Kurotani, Atsushi; Higuchi, Mieko; Ichikawa, Takanari; Kuroda, Hirofumi; Kusano, Miyako; Mori, Masaki; Saitou, Tsutomu; Sakakibara, Hitoshi; Sugano, Shoji; Suzuki, Makoto; Takahashi, Hideki; Takahashi, Shinya; Takatsuji, Hiroshi; Yokotani, Naoki; Yoshizumi, Takeshi; Saito, Kazuki; Shinozaki, Kazuo; Oda, Kenji; Hirochika, Hirohiko; Matsui, Minami

2011-02-01

Identification of gene function is important not only for basic research but also for applied science, especially with regard to improvements in crop production. For rapid and efficient elucidation of useful traits, we developed a system named FOX hunting (Full-length cDNA Over-eXpressor gene hunting) using full-length cDNAs (fl-cDNAs). A heterologous expression approach provides a solution for the high-throughput characterization of gene functions in agricultural plant species. Since fl-cDNAs contain all the information of functional mRNAs and proteins, we introduced rice fl-cDNAs into Arabidopsis plants for systematic gain-of-function mutation. We generated >30,000 independent Arabidopsis transgenic lines expressing rice fl-cDNAs (rice FOX Arabidopsis mutant lines). These rice FOX Arabidopsis lines were screened systematically for various criteria such as morphology, photosynthesis, UV resistance, element composition, plant hormone profile, metabolite profile/fingerprinting, bacterial resistance, and heat and salt tolerance. The information obtained from these screenings was compiled into a database named 'RiceFOX'. This database contains around 18,000 records of rice FOX Arabidopsis lines and allows users to search against all the observed results, ranging from morphological to invisible traits. The number of searchable items is approximately 100; moreover, the rice FOX Arabidopsis lines can be searched by rice and Arabidopsis gene/protein identifiers, sequence similarity to the introduced rice fl-cDNA and traits. The RiceFOX database is available at http://ricefox.psc.riken.jp/.

RiceFOX: A Database of Arabidopsis Mutant Lines Overexpressing Rice Full-Length cDNA that Contains a Wide Range of Trait Information to Facilitate Analysis of Gene Function

PubMed Central

Sakurai, Tetsuya; Kondou, Youichi; Akiyama, Kenji; Kurotani, Atsushi; Higuchi, Mieko; Ichikawa, Takanari; Kuroda, Hirofumi; Kusano, Miyako; Mori, Masaki; Saitou, Tsutomu; Sakakibara, Hitoshi; Sugano, Shoji; Suzuki, Makoto; Takahashi, Hideki; Takahashi, Shinya; Takatsuji, Hiroshi; Yokotani, Naoki; Yoshizumi, Takeshi; Saito, Kazuki; Shinozaki, Kazuo; Oda, Kenji; Hirochika, Hirohiko; Matsui, Minami

2011-01-01

Identification of gene function is important not only for basic research but also for applied science, especially with regard to improvements in crop production. For rapid and efficient elucidation of useful traits, we developed a system named FOX hunting (Full-length cDNA Over-eXpressor gene hunting) using full-length cDNAs (fl-cDNAs). A heterologous expression approach provides a solution for the high-throughput characterization of gene functions in agricultural plant species. Since fl-cDNAs contain all the information of functional mRNAs and proteins, we introduced rice fl-cDNAs into Arabidopsis plants for systematic gain-of-function mutation. We generated >30,000 independent Arabidopsis transgenic lines expressing rice fl-cDNAs (rice FOX Arabidopsis mutant lines). These rice FOX Arabidopsis lines were screened systematically for various criteria such as morphology, photosynthesis, UV resistance, element composition, plant hormone profile, metabolite profile/fingerprinting, bacterial resistance, and heat and salt tolerance. The information obtained from these screenings was compiled into a database named ‘RiceFOX’. This database contains around 18,000 records of rice FOX Arabidopsis lines and allows users to search against all the observed results, ranging from morphological to invisible traits. The number of searchable items is approximately 100; moreover, the rice FOX Arabidopsis lines can be searched by rice and Arabidopsis gene/protein identifiers, sequence similarity to the introduced rice fl-cDNA and traits. The RiceFOX database is available at http://ricefox.psc.riken.jp/. PMID:21186176

Mu-opioid receptors in nociceptive afferents produce a sustained suppression of hyperalgesia in chronic pain.

PubMed

Severino, Amie; Chen, Wenling; Hakimian, Joshua K; Kieffer, Brigitte L; Gaveriaux-Ruff, Claire; Walwyn, Wendy; Marvizon, Juan Carlos

2018-04-17

The latent sensitization model of chronic pain reveals that recovery from some types of long-term hyperalgesia is an altered state in which nociceptive sensitization persists but is suppressed by the ongoing activity of analgesic receptors such as µ-opioid receptors (MORs). To determine whether these MORs are the ones present in nociceptive afferents, we bred mice expressing Cre-recombinase under the Nav1.8 channel promoter (Nav1.8cre) with MOR-floxed mice (flMOR). These Nav1.8cre/flMOR mice had reduced MOR expression in primary afferents, as revealed by quantitative PCR, in situ hybridization and immunofluorescence colocalization with the neuropeptide CGRP. We then studied the recovery from chronic pain of these mice and their flMOR littermates. When Nav1.8cre/flMOR mice were injected in the paw with complete Freund's adjuvant they developed mechanical hyperalgesia that persisted for over two months, whereas the responses of flMOR mice returned to baseline after three weeks. We then used the inverse agonist naltrexone to assess ongoing MOR activity. Naltrexone produced a robust reinstatement of hyperalgesia in control flMOR mice, but produced no effect in the Nav1.8/flMOR males and a weak reinstatement of hyperalgesia in Nav1.8/flMOR females. Naltrexone also reinstated swelling of the hind paw in flMOR mice and female Nav1.8cre/flMOR mice, but not male Nav1.8cre/flMOR mice. The MOR agonist DAMGO inhibited substance P release in flMOR mice but not Nav1.8cre/flMOR mice, demonstrating a loss of MOR function at the central terminals of primary afferents. We conclude that MORs in nociceptive afferents mediate an ongoing suppression of hyperalgesia to produce remission from chronic pain.

Structural and biochemical studies of a fluoroacetyl-CoA-specific thioesterase reveal a molecular basis for fluorine selectivity.

PubMed

Weeks, Amy M; Coyle, Scott M; Jinek, Martin; Doudna, Jennifer A; Chang, Michelle C Y

2010-11-02

We have initiated a broad-based program aimed at understanding the molecular basis of fluorine specificity in enzymatic systems, and in this context, we report crystallographic and biochemical studies on a fluoroacetyl-coenzyme A (CoA) specific thioesterase (FlK) from Streptomyces cattleya. Our data establish that FlK is competent to protect its host from fluoroacetate toxicity in vivo and demonstrate a 10(6)-fold discrimination between fluoroacetyl-CoA (k(cat)/K(M) = 5 × 10⁷ M⁻¹ s⁻¹) and acetyl-CoA (k(cat)/K(M) = 30 M⁻¹ s⁻¹) based on a single fluorine substitution that originates from differences in both substrate reactivity and binding. We show that Thr 42, Glu 50, and His 76 are key catalytic residues and identify several factors that influence substrate selectivity. We propose that FlK minimizes interaction with the thioester carbonyl, leading to selection against acetyl-CoA binding that can be recovered in part by new C═O interactions in the T42S and T42C mutants. We hypothesize that the loss of these interactions is compensated by the entropic driving force for fluorinated substrate binding in a hydrophobic binding pocket created by a lid structure, containing Val 23, Leu 26, Phe 33, and Phe 36, that is not found in other structurally characterized members of this superfamily. We further suggest that water plays a critical role in fluorine specificity based on biochemical and structural studies focused on the unique Phe 36 "gate" residue, which functions to exclude water from the active site. Taken together, the findings from these studies offer molecular insights into organofluorine recognition and design of fluorine-specific enzymes.

Defining a Role for the Oncogene Beta-Catenin in Prostate Epithelial Growth and Invasion

DTIC Science & Technology

2011-07-01

receptor function. To determine in increased or decreased Wnt signaling can affect androgen receptor function, we harvested E15.5 UGSs from Esr1 -Cre x...beta-cateninfl/fl and Esr1 -Cre APCfl/fl embryos and treated them with 2 uM tamoxifen and zero, low, normal, or high androgen to determine if high

Spatial variability of particle-attached and free-living bacterial diversity in surface waters from the Mackenzie River to the Beaufort Sea (Canadian Arctic)

NASA Astrophysics Data System (ADS)

Ortega-Retuerta, E.; Joux, F.; Jeffrey, W. H.; Ghiglione, J. F.

2013-04-01

We explored the patterns of total and active bacterial community structure in a gradient covering surface waters from the Mackenzie River to the coastal Beaufort Sea in the Canadian Arctic Ocean, with a particular focus on free-living (FL) vs. particle-attached (PA) communities. Capillary electrophoresis-single-strand conformation polymorphism (CE-SSCP) showed significant differences when comparing river, coast and open sea bacterial community structures. In contrast to the river and coastal waters, total (16S rDNA-based) and active (16S rRNA-based) communities in the open sea samples were not significantly different, suggesting that most present bacterial groups were equally active in this area. Additionally, we observed significant differences between PA and FL bacterial community structure in the open sea, but similar structure in the two fractions for coastal and river samples. Direct multivariate statistical analyses showed that total community structure was mainly driven by salinity (a proxy of dissolved organic carbon and chromophoric dissolved organic matter), suspended particles, amino acids and chlorophyll a. Pyrosequencing of 16S rRNA genes from selected samples confirmed significant differences between river, coastal and sea samples. The PA fraction was only different (15.7% similarity) from the FL one in the open sea sample. Furthermore, PA samples generally showed higher diversity (Shannon, Simpson and Chao indices) than FL samples. At the class level, Opitutae was most abundant in the PA fraction of the sea sample, followed by Flavobacteria and Gammaproteobacteria, while the FL sea sample was dominated by Alphaproteobacteria. Finally, for the coast and river samples and both PA and FL fractions, Betaproteobacteria, Alphaproteobacteria and Actinobacteria were dominant. These results highlight the coexistence of particle specialists and generalists and the role of particle quality in structuring bacterial communities in the area. These results may also serve as a basis to predict further changes in bacterial communities should climate change lead to further increases in river discharge and related particle loads.

Nuclear medium effects in structure functions of nucleon at moderate Q2

NASA Astrophysics Data System (ADS)

Haider, H.; Zaidi, F.; Sajjad Athar, M.; Singh, S. K.; Ruiz Simo, I.

2015-11-01

Recent experiments performed on inclusive electron scattering from nuclear targets have measured the nucleon electromagnetic structure functions F1 (x ,Q2), F2 (x ,Q2) and FL (x ,Q2) in 12C, 27Al, 56Fe and 64Cu nuclei. The measurements have been done in the energy region of 1 GeV2

Deciphering the groove binding modes of tau-fluvalinate and flumethrin with calf thymus DNA

NASA Astrophysics Data System (ADS)

Tao, Mo; Zhang, Guowen; Pan, Junhui; Xiong, Chunhong

2016-02-01

Tau-fluvalinate (TFL) and flumethrin (FL), widely used in agriculture and a class of synthetic pyrethroid pesticides with a similar structure, may cause a potential security risk. Herein, the modes of binding in vitro of TFL and FL with calf thymus DNA (ctDNA) were characterized by fluorescence, UV-vis absorption, circular dichroism (CD) and Fourier transform infrared (FT-IR) spectroscopy with the aid of viscosity measurements, melting analyses and molecular docking studies. The fluorescence titration indicated that both TFL and FL bound to ctDNA forming complexes through hydrogen bonding and van der Waals forces. The binding constants of TFL and FL with ctDNA were in the range of 104 L mol- 1, and FL exhibited a higher binding propensity than TFL. The iodide quenching effect, single/double-stranded DNA effects, and ctDNA melting and viscosity measurements demonstrated that the binding of both TFL and FL to ctDNA was groove mode. The FT-IR analyses suggested the A-T region of the minor groove of ctDNA as the preferential binding for TFL and FL, which was confirmed by the displacement assays with Hoechst 33258 probe, and the molecular docking visualized the specific binding. The changes in CD spectra indicated that both FL and TFL induced the perturbation on the base stacking and helicity of B-DNA, but the disturbance caused by FL was more obvious. Gel electrophoresis analyses indicated that both TFL and FL did not cause significant DNA cleavage. This study provides novel insights into the binding properties of TFL/FL with ctDNA and its toxic mechanisms.

TGFβ regulates epithelial-mesenchymal interactions through WNT signaling activity to control muscle development in the soft palate.

PubMed

Iwata, Jun-ichi; Suzuki, Akiko; Yokota, Toshiaki; Ho, Thach-Vu; Pelikan, Richard; Urata, Mark; Sanchez-Lara, Pedro A; Chai, Yang

2014-02-01

Clefting of the soft palate occurs as a congenital defect in humans and adversely affects the physiological function of the palate. However, the molecular and cellular mechanism of clefting of the soft palate remains unclear because few animal models exhibit an isolated cleft in the soft palate. Using three-dimensional microCT images and histological reconstruction, we found that loss of TGFβ signaling in the palatal epithelium led to soft palate muscle defects in Tgfbr2(fl/fl);K14-Cre mice. Specifically, muscle mass was decreased in the soft palates of Tgfbr2 mutant mice, following defects in cell proliferation and differentiation. Gene expression of Dickkopf (Dkk1 and Dkk4), negative regulators of WNT-β-catenin signaling, is upregulated in the soft palate of Tgfbr2(fl/fl);K14-Cre mice, and WNT-β-catenin signaling is disrupted in the palatal mesenchyme. Importantly, blocking the function of DKK1 and DKK4 rescued the cell proliferation and differentiation defects in the soft palate of Tgfbr2(fl/fl);K14-Cre mice. Thus, our findings indicate that loss of TGFβ signaling in epithelial cells compromises activation of WNT signaling and proper muscle development in the soft palate through tissue-tissue interactions, resulting in a cleft soft palate. This information has important implications for prevention and non-surgical correction of cleft soft palate.

The Paradoxical Signals of Two TrkC Receptor Isoforms Supports a Rationale for Novel Therapeutic Strategies in ALS

PubMed Central

Barcelona, Pablo F.; Galan, Alba; Aboulkassim, Tahar; Teske, Katrina; Rogers, Mary-Louise; Bertram, Lisa; Wang, Jing; Yousefi, Masoud; Rush, Robert; Fabian, Marc; Cashman, Neil

2016-01-01

Full length TrkC (TrkC-FL) is a receptor tyrosine kinase whose mRNA can be spliced to a truncated TrkC.T1 isoform lacking the kinase domain. Neurotrophin-3 (NT-3) activates TrkC-FL to maintain motor neuron health and function and TrkC.T1 to produce neurotoxic TNF-α; hence resulting in opposing pathways. In mouse and human ALS spinal cord, the reduction of miR-128 that destabilizes TrkC.T1 mRNA results in up-regulated TrkC.T1 and TNF-α in astrocytes. We exploited conformational differences to develop an agonistic mAb 2B7 that selectively activates TrkC-FL, to circumvent TrkC.T1 activation. In mouse ALS, 2B7 activates spinal cord TrkC-FL signals, improves spinal cord motor neuron phenotype and function, and significantly prolongs life-span. Our results elucidate biological paradoxes of receptor isoforms and their role in disease progression, validate the concept of selectively targeting conformational epitopes in naturally occurring isoforms, and may guide the development of pro-neuroprotective (TrkC-FL) and anti-neurotoxic (TrkC.T1) therapeutic strategies. PMID:27695040

Presence of Functional Neurotrophin TrkB Receptors in the Rat Superior Cervical Ganglion

PubMed Central

Valle-Leija, Pablo; Cancino-Rodezno, Angeles; Sánchez-Tafolla, Berardo M.; Arias, Erwin; Elinos, Diana; Feria, Jessica; Zetina, María E.; Morales, Miguel A.; Cifuentes, Fredy

2017-01-01

Sympathetic neurons express the neurotrophin receptors TrkA, p75NTR, and a non-functional truncated TrkB isoform (TrkB-Tc), but are not thought to express a functional full-length TrkB receptor (TrkB-Fl). We, and others, have demonstrated that nerve growth factor (NGF) and brain derived neurotrophic factor (BDNF) modulate synaptic transmission and synaptic plasticity in neurons of the superior cervical ganglion (SCG) of the rat. To clarify whether TrkB is expressed in sympathetic ganglia and contributes to the effects of BDNF upon sympathetic function, we characterized the presence and activity of the neurotrophin receptors expressed in the adult SCG compared with their presence in neonatal and cultured sympathetic neurons. Here, we expand our previous study regarding the immunodetection of neurotrophin receptors. Immunohistochemical analysis revealed that 19% of adult ganglionic neurons expressed TrkB-Fl immunoreactivity (IR), 82% expressed TrkA-IR, and 51% expressed p75NTR-IR; TrkB-Tc would be expressed in 36% of neurons. In addition, using Western-blotting and reverse transcriptase polymerase chain reaction (RT-PCR) analyses, we confirmed the expression of TrkB-Fl and TrkB-Tc protein and mRNA transcripts in adult SCG. Neonatal neurons expressed significantly more TrkA-IR and TrkB-Fl-IR than p75NTR-IR. Finally, the application of neurotrophin, and high frequency stimulation, induced the activation of Trk receptors and the downstream PI3-kinase (phosphatidyl inositol-3-kinase) signaling pathway, thus evoking the phosphorylation of Trk and Akt. These results demonstrate that SCG neurons express functional TrkA and TrkB-Fl receptors, which may contribute to the differential modulation of synaptic transmission and long-term synaptic plasticity. PMID:28744222

Presence of Functional Neurotrophin TrkB Receptors in the Rat Superior Cervical Ganglion.

PubMed

Valle-Leija, Pablo; Cancino-Rodezno, Angeles; Sánchez-Tafolla, Berardo M; Arias, Erwin; Elinos, Diana; Feria, Jessica; Zetina, María E; Morales, Miguel A; Cifuentes, Fredy

2017-01-01

Sympathetic neurons express the neurotrophin receptors TrkA, p75NTR, and a non-functional truncated TrkB isoform (TrkB-Tc), but are not thought to express a functional full-length TrkB receptor (TrkB-Fl). We, and others, have demonstrated that nerve growth factor (NGF) and brain derived neurotrophic factor (BDNF) modulate synaptic transmission and synaptic plasticity in neurons of the superior cervical ganglion (SCG) of the rat. To clarify whether TrkB is expressed in sympathetic ganglia and contributes to the effects of BDNF upon sympathetic function, we characterized the presence and activity of the neurotrophin receptors expressed in the adult SCG compared with their presence in neonatal and cultured sympathetic neurons. Here, we expand our previous study regarding the immunodetection of neurotrophin receptors. Immunohistochemical analysis revealed that 19% of adult ganglionic neurons expressed TrkB-Fl immunoreactivity (IR), 82% expressed TrkA-IR, and 51% expressed p75NTR-IR; TrkB-Tc would be expressed in 36% of neurons. In addition, using Western-blotting and reverse transcriptase polymerase chain reaction (RT-PCR) analyses, we confirmed the expression of TrkB-Fl and TrkB-Tc protein and mRNA transcripts in adult SCG. Neonatal neurons expressed significantly more TrkA-IR and TrkB-Fl-IR than p75NTR-IR. Finally, the application of neurotrophin, and high frequency stimulation, induced the activation of Trk receptors and the downstream PI3-kinase (phosphatidyl inositol-3-kinase) signaling pathway, thus evoking the phosphorylation of Trk and Akt. These results demonstrate that SCG neurons express functional TrkA and TrkB-Fl receptors, which may contribute to the differential modulation of synaptic transmission and long-term synaptic plasticity.

BCL6 antagonizes NOTCH2 to maintain survival of human follicular lymphoma cells

PubMed Central

Valls, Ester; Lobry, Camille; Geng, Huimin; Wang, Ling; Cardenas, Mariano; Rivas, Martín; Cerchietti, Leandro; Oh, Philmo; Yang, Shao Ning; Oswald, Erin; Graham, Camille W.; Jiang, Yanwen; Hatzi, Katerina; Agirre, Xabier; Perkey, Eric; Li, Zhuoning; Tam, Wayne; Bhatt, Kamala; Leonard, John P.; Zweidler-McKay, Patrick A.; Maillard, Ivan; Elemento, Olivier; Ci, Weimin; Aifantis, Iannis; Melnick, Ari

2017-01-01

Summary Although the BCL6 transcriptional repressor is frequently expressed in human follicular lymphomas (FL), its biological role in this disease remains unknown. Herein we comprehensively identify the set of gene promoters directly targeted by BCL6 in primary human FLs. We noted that BCL6 binds and represses NOTCH2 and Notch pathway genes. Moreover, BCL6 and NOTCH2 pathway gene expression is inversely correlated in FL. Notably BCL6 up-regulation is associated with repression of Notch2 and its target genes in primary human and murine germinal center cells. Repression of Notch2 is an essential function of BCL6 in FL and GC B-cells since inducible expression of Notch2 abrogated GC formation in mice and kills FL cells. Indeed BCL6-targeting compounds or gene silencing leads to the induction of NOTCH2 activity and compromises survival of FL cells whereas NOTCH2 depletion or pathway antagonists rescue FL cells from such effects. Moreover, BCL6 inhibitors induced NOTCH2 expression and suppressed growth of human FL xenografts in vivo and primary human FL specimens ex vivo. These studies suggest that established FLs are thus dependent on BCL6 through its suppression of NOTCH2. PMID:28232365

The Coiled-Coil and Nucleotide Binding Domains of BROWN PLANTHOPPER RESISTANCE14 Function in Signaling and Resistance against Planthopper in Rice[OPEN

PubMed Central

Hu, Liang; Wu, Yan; Wu, Di; Rao, Weiwei; Guo, Jianping; Ma, Yinhua; Wang, Zhizheng; Shangguan, Xinxin; Wang, Huiying; Xu, Chunxue; Huang, Jin; Shi, Shaojie; Chen, Rongzhi; Du, Bo; Zhu, Lili

2017-01-01

BROWN PLANTHOPPER RESISTANCE14 (BPH14), the first planthopper resistance gene isolated via map-based cloning in rice (Oryza sativa), encodes a coiled-coil, nucleotide binding site, leucine-rich repeat (CC-NB-LRR) protein. Several planthopper and aphid resistance genes encoding proteins with similar structures have recently been identified. Here, we analyzed the functions of the domains of BPH14 to identify molecular mechanisms underpinning BPH14-mediated planthopper resistance. The CC or NB domains alone or in combination (CC-NB [CN]) conferred a similar level of brown planthopper resistance to that of full-length (FL) BPH14. Both domains activated the salicylic acid signaling pathway and defense gene expression. In rice protoplasts and Nicotiana benthamiana leaves, these domains increased reactive oxygen species levels without triggering cell death. Additionally, the resistance domains and FL BPH14 protein formed homocomplexes that interacted with transcription factors WRKY46 and WRKY72. In rice protoplasts, the expression of FL BPH14 or its CC, NB, and CN domains increased the accumulation of WRKY46 and WRKY72 as well as WRKY46- and WRKY72-dependent transactivation activity. WRKY46 and WRKY72 bind to the promoters of the receptor-like cytoplasmic kinase gene RLCK281 and the callose synthase gene LOC_Os01g67364.1, whose transactivation activity is dependent on WRKY46 or WRKY72. These findings shed light on this important insect resistance mechanism. PMID:29093216

A FIVE YEAR RECORD OF PHYTOPLANKTON PIGMENT PATTERNS IN ESCAMBIA/PENSACOLA BAY, FL

EPA Science Inventory

Phytoplankton pigments were monitored quarterly at over 50 stations in Escambia/Pensacola Bay System (Pensacola, FL) from spring of 1996 to fall 2000. HPLC accessory pigments were used to analyze the phytoplankton community structure. HPLC data suggest a dominance of blue-green a...

Notch-ligand expression by NALT dendritic cells regulates mucosal Th1- and Th2-type responses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fukuyama, Yoshiko; Tokuhara, Daisuke; Division of Mucosal Immunology, Institute of Medical Science, University of Tokyo, Tokyo 108-8639

Highlights: Black-Right-Pointing-Pointer Nasal Ad-FL effectively up-regulates APC function by CD11c{sup +} DCs in mucosal tissues. Black-Right-Pointing-Pointer Nasal Ad-FL induces Notch ligand (L)-expressing CD11c{sup +} DCs. Black-Right-Pointing-Pointer Notch L-expressing DCs support the induction of Th1- and Th2-type cytokine responses. -- Abstract: Our previous studies showed that an adenovirus (Ad) serotype 5 vector expressing Flt3 ligand (Ad-FL) as nasal adjuvant activates CD11c{sup +} dendritic cells (DCs) for the enhancement of antigen (Ag)-specific IgA antibody (Ab) responses. In this study, we examined the molecular mechanism for activation of CD11c{sup +} DCs and their roles in induction of Ag-specific Th1- and Th2-cell responses. Ad-FLmore » activated CD11c{sup +} DCs expressed increased levels of the Notch ligand (L)-expression and specific mRNA. When CD11c{sup +} DCs from various mucosal and systemic lymphoid tissues of mice given nasal OVA plus Ad-FL were cultured with CD4{sup +} T cells isolated from non-immunized OVA TCR-transgenic (OT II) mice, significantly increased levels of T cell proliferative responses were noted. Furthermore, Ad-FL activated DCs induced IFN-{gamma}, IL-2 and IL-4 producing CD4{sup +} T cells. Of importance, these APC functions by Ad-FL activated DCs were down-regulated by blocking Notch-Notch-L pathway. These results show that Ad-FL induces CD11c{sup +} DCs to the express Notch-ligands and these activated DCs regulate the induction of Ag-specific Th1- and Th2-type cytokine responses.« less

Monodisperse Multidimensional Nanostructures via Centrifugal Separation

NASA Astrophysics Data System (ADS)

Shin, Yu Jin

Anisotropic nanomaterials, including zero-dimensional metallic nanoparticles (MNPs), one-dimensional single-walled carbon nanotubes (SWCNTs), and two-dimensional few-layer black phosphorous (FL-P) exhibit interesting structure-dependent properties that could be exploited in biomedicine, plasmonics, and optoelectronics. In this thesis, centrifugation sorting of these nanomaterials is utilized for structure refinement, investigation of structure-dependent optical response, and applications in biomedical imaging and plasmonics. Nobel NMPs show unique shape- and size-dependent optical properties. Controlled synthetic methods are developed to manipulate the structure of these NMPs, but intrinsically produce dispersions of polydisperse NPs with various shape and size, and synthetic byproducts. Here, we describe a facile strategy for separating small (edge length <100 nm) faceted gold NPs: rhombic dodecahedra (RD) and obtuse triangular bipyramids (BPs), which form simultaneously during synthesis but are hard to separate via commercial filters. By utilizing centrifugation of the as-synthesized mixture in a shallow density gradient centrifugation (DGC), we are able to isolate a high purity of BPs (>80%) and subsequently achieve a 2.5 fold enhancement in refractive index sensitivity, comparable to the unsorted mixture. This shallow DGC approach is robust and reliable, and therefore can be applied to other metal nanostructures for concomitant improvements in plasmonic properties and applications. Using the identical separation strategy in the previous study, we are able to enrich gold nanostars as a function of branch number. In particular, we explore different variants of density gradient media to ensure compatibility with the star shape and colloid stability. We determine that sucrose is compatible with nanostars stability and surface functionalizaton. The refined population of gold stars are functionalized with Gd(III)-DNA to act as MRI contrast agents, and thus enables us to investigate how populations of nanostars with different branch numbers contribute to the relaxivity of surface bound Gd(III)-DNA. It is shown that the increased relaxivity of DNA-Gd star is correlated with increased number of star branches, not with increased size of the stars. Therefore, shape is a new parameter which can be tuned in the design of NP-based MRI contrast agent. These findings can also improve the performance of functionalized anisotropic nanoconjugates which have potential for applications such as lowering detection limits for sensors and diagnostics, or enabling new modes of self-assembly. Finally, we have broadened the scope of DGC to other dimensional nanomaterials: 1D-SWCNTs and 2D-FL-P. Despite their tunable and structure-dependent optical properties, intrinsic structural heterogeneity and poor quantum efficiency limit their potential applications. Therefore, DGC is employed to separate the SWCNTs and FL-P by length and the number of layers, respectively, thereby incorporating them into optical cavity structures for enhancing their luminescence properties. These fundamental studies of low-dimensional nanomaterials assist in the design process for optoelectronic device fabrication.

Investigation of Episodic Flow from Unsaturated Porous Media into a Macropore

DOE Office of Scientific and Technical Information (OSTI.GOV)

R. K. Podgorney; J. P. Fairley

Th e recent literature contains numerous observations of episodic or intermittent fl ow in unsaturated flow systems under both constant fl ux and ponded boundary conditions. Flow systems composed of a heterogeneous porous media, as well as discrete fracture networks, have been cited as examples of systems that can exhibit episodic fl ow. Episodic outfl ow events are significant because relatively large volumes of water can move rapidly through an unsaturated system, carrying water and contaminants to depth greatly ahead of a wetting front predicted by a one-dimensional, gravity-driven diff usive infiltration model. In this study, we model the behaviormore » of water flow through a sand column underlain by an impermeable-walled macropore. Relative permeability and capillary pressure relationships were developed that capture the complex interrelationships between the macropore and the overlying porous media that control fl ow out of the system. The potential for episodic flow is assessed and compared to results of conventional modeling approaches and experimental data from the literature. Model results using coupled matrix–macropore relative permeability and capillary pressure relationships capture the behavior observed in laboratory experiments remarkably well, while simulations using conventional relative permeability and capillary pressure functions fail to capture some of the observed fl ow dynamics. Capturing the rapid downward movement of water suggests that the matrix-macropore capillary pressure and relative permeability functions developed have the potential to improve descriptions of fl ow and transport processes in heterogeneous, variably saturated media.« less

Role of Parafacial Nuclei in Control of Breathing in Adult Rats

PubMed Central

Huckstepp, Robert T.R.; Cardoza, Kathryn P.; Henderson, Lauren E.

2015-01-01

Contiguous brain regions associated with a given behavior are increasingly being divided into subregions associated with distinct aspects of that behavior. Using recently developed neuronal hyperpolarizing technologies, we functionally dissect the parafacial region in the medulla, which contains key elements of the central pattern generator for breathing that are important in central CO2-chemoreception and for gating active expiration. By transfecting different populations of neighboring neurons with allatostatin or HM4D Gi/o-coupled receptors, we analyzed the effect of their hyperpolarization on respiration in spontaneously breathing vagotomized urethane-anesthetized rats. We identify two functionally separate parafacial nuclei: ventral (pFV) and lateral (pFL). Disinhibition of the pFL with bicuculline and strychnine led to active expiration. Hyperpolarizing pFL neurons had no effect on breathing at rest, or changes in inspiratory activity induced by hypoxia and hypercapnia; however, hyperpolarizing pFL neurons attenuated active expiration when it was induced by hypercapnia, hypoxia, or disinhibition of the pFL. In contrast, hyperpolarizing pFV neurons affected breathing at rest by decreasing inspiratory-related activity, attenuating the hypoxia- and hypercapnia-induced increase in inspiratory activity, and when present, reducing expiratory-related abdominal activity. Together with previous observations, we conclude that the pFV provides a generic excitatory drive to breathe, even at rest, whereas the pFL is a conditional oscillator quiet at rest that, when activated, e.g., during exercise, drives active expiration. PMID:25609622

CTGF Mediates Smad-Dependent Transforming Growth Factor β Signaling To Regulate Mesenchymal Cell Proliferation during Palate Development

PubMed Central

Parada, Carolina; Li, Jingyuan; Iwata, Junichi; Suzuki, Akiko

2013-01-01

Transforming growth factor β (TGF-β) signaling plays crucial functions in the regulation of craniofacial development, including palatogenesis. Here, we have identified connective tissue growth factor (Ctgf) as a downstream target of the TGF-β signaling pathway in palatogenesis. The pattern of Ctgf expression in wild-type embryos suggests that it may be involved in key processes during palate development. We found that Ctgf expression is downregulated in both Wnt1-Cre; Tgfbr2fl/fl and Osr2-Cre; Smad4fl/fl palates. In Tgfbr2 mutant embryos, downregulation of Ctgf expression is associated with p38 mitogen-activated protein kinase (MAPK) overactivation, whereas loss of function of Smad4 itself leads to downregulation of Ctgf expression. We also found that CTGF regulates its own expression via TGF-β signaling. Osr2-Cre; Smad4fl/fl mice exhibit a defect in cell proliferation similar to that of Tgfbr2 mutant mice, as well as cleft palate. We detected no alteration in bone morphogenetic protein (BMP) downstream targets in Smad4 mutant palates, suggesting that the reduction in cell proliferation is due to defective transduction of TGF-β signaling via decreased Ctgf expression. Significantly, an exogenous source of CTGF was able to rescue the cell proliferation defect in both Tgfbr2 and Smad4 mutant palates. Collectively, our data suggest that CTGF regulates proliferation as a mediator of the canonical pathway of TGF-β signaling during palatogenesis. PMID:23816882

Regulation of iNOS function and cellular redox state by macrophage Gch1 reveals specific requirements for tetrahydrobiopterin in NRF2 activation

PubMed Central

McNeill, Eileen; Crabtree, Mark J.; Sahgal, Natasha; Patel, Jyoti; Chuaiphichai, Surawee; Iqbal, Asif J.; Hale, Ashley B.; Greaves, David R.; Channon, Keith M.

2015-01-01

Inducible nitric oxide synthase (iNOS) is a key enzyme in the macrophage inflammatory response, which is the source of nitric oxide (NO) that is potently induced in response to proinflammatory stimuli. However, the specific role of NO production, as distinct from iNOS induction, in macrophage inflammatory responses remains unproven. We have generated a novel mouse model with conditional deletion of Gch1, encoding GTP cyclohydrolase 1 (GTPCH), an essential enzyme in the biosynthesis of tetrahydrobiopterin (BH4) that is a required cofactor for iNOS NO production. Mice with a floxed Gch1 allele (Gch1fl/fl) were crossed with Tie2cre transgenic mice, causing Gch1 deletion in leukocytes (Gch1fl/flTie2cre). Macrophages from Gch1fl/flTie2cre mice lacked GTPCH protein and de novo biopterin biosynthesis. When activated with LPS and IFNγ, macrophages from Gch1fl/flTie2cre mice induced iNOS protein in a manner indistinguishable from wild-type controls, but produced no detectable NO, as judged by L-citrulline production, EPR spin trapping of NO, and by nitrite accumulation. Incubation of Gch1fl/flTie2cre macrophages with dihydroethidium revealed significantly increased production of superoxide in the presence of iNOS expression, and an iNOS-independent, BH4-dependent increase in other ROS species. Normal BH4 levels, nitric oxide production, and cellular redox state were restored by sepiapterin, a precursor of BH4 production by the salvage pathway, demonstrating that the effects of BH4 deficiency were reversible. Gch1fl/flTie2cre macrophages showed only minor alterations in cytokine production and normal cell migration, and minimal changes in basal gene expression. However, gene expression analysis after iNOS induction identified 78 genes that were altered between wild-type and Gch1fl/flTie2cre macrophages. Pathway analysis identified decreased NRF2 activation, with reduced induction of archetypal NRF2 genes (gclm, prdx1, gsta3, nqo1, and catalase) in BH4-deficient Gch1fl/flTie2cre macrophages. These findings identify BH4-dependent iNOS regulation and NO generation as specific requirements for NRF2-dependent responses in macrophage inflammatory activation. PMID:25451639

Political Economy, the Internet and FL/OSS Development

NASA Astrophysics Data System (ADS)

Mansell, Robin; Berdou, Evangelia

Despite the growing amount of research on Free/Libre/Open Source Software (FL/OSS) development, there is little insight into how structural factors associated with institutions influence the patterns of software developer activity in this area. This article examines some of the dynamics of the development of this type of software and the extent to which these dynamics are associated with features of the gift economy as is frequently suggested in the literature. Drawing on an empirical analysis of contributors to the GNOME FL/OSS project, we suggest that greater attention should be given to the emergence of a mixed economy in which features of the exchange economy come to the fore with implications for the power relationships among those contributing to FL/OSS.

Mice lacking microRNAs in Pax8-expressing cells develop hypothyroidism and end-stage renal failure.

PubMed

Bartram, Malte P; Amendola, Elena; Benzing, Thomas; Schermer, Bernhard; de Vita, Gabriella; Müller, Roman-Ulrich

2016-04-18

Non-coding RNAs have gained increasing attention during the last decade. The first large group of non-coding RNAs to be characterized systematically starting at the beginning of the 21st century were small oligonucleotides--the so-called microRNAs (miRNAs). By now we have learnt that microRNAs are indispensable for most biological processes including organogenesis and maintenance of organ structure and function. The role of microRNAs has been studied extensively in the development of a number of organs, so far most studies focussed on e.g. the heart or the brain whilst the role of microRNAs in the development and maintenance of complex epithelial organs is less well understood. Furthermore most analyses regarding microRNA function in epithelial organs employed conditional knockout mouse models of the RNAse III Dicer to abrogate microRNA biogenesis. However, there is increasing evidence for Dicer to have multiple functions independent from microRNA maturation. Therefore Dicer independent models are needed to gain further insight into the complex biology of miRNA dependent processes. Here we analyze the contribution of microRNA-dependent transcriptional control in Pax8-expressing epithelial cells. Pax8 is a transcription factor that is crucial to the development of epithelial organs. The miRNA machinery was disrupted by crossing conditional DiGeorge syndrome critical region 8 (Dgcr8) fl/fl mice to Pax8Cre mice. The Dgcr8/Drosha complex processes pri-miRNAs in the nucleus before they are exported as pre-miRNAs for further maturation by Dicer in the cytoplasm. Dgcr8 fl/fl; Pax8Cre+ knockout mice died prematurely, developed massive hypothyroidism and end stage renal disease due to a loss of miRNAs in Pax8 expressing tissue. Pax8Cre-mediated conditional loss of DiGeorge syndrome critical region 8 (Dgcr8), an essential component of the nuclear machinery that is required for microRNA biogenesis, resulted in severe hypothyroidism, massively reduced body weight and ultimately led to renal failure and death of the animals. These data provide further insight into the importance of miRNAs in organ homeostasis using a Dicer independent model.

Fullerene-like CS x: A first-principles study of synthetic growth

NASA Astrophysics Data System (ADS)

Goyenola, C.; Gueorguiev, G. K.; Stafström, S.; Hultman, L.

2011-04-01

Fullerene-Like (FL) Sulpho-Carbide (CSx) compounds have been addressed by first principles calculations. Geometry optimization and cohesive energy results are presented for the relative stability of precursor species such as C2S, CS2, and C2S2 in isolated form. The energy cost for structural defects, arising from the substitution of C by S is also reported. Similar to previously synthesized FL-CNx and FL-CPx compounds, the pentagon, the double pentagon defects as well as the Stone-Wales defects are confirmed as energetically feasible in CSx compounds.

Conformational detection of p53's oligomeric state by FlAsH Fluorescence.

PubMed

Webber, Tawnya M; Allen, Andrew C; Ma, Wai Kit; Molloy, Rhett G; Kettelkamp, Charisse N; Dow, Caitlin A; Gage, Matthew J

2009-06-19

The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo.

Conformational detection of p53's oligomeric state by FlAsH Fluorescence

PubMed Central

Webber, Tawnya M.; Allen, Andrew C.; Ma, Wai Kit; Molloy, Rhett G.; Kettelkamp, Charisse N.; Dow, Caitlin A.; Gage, Matthew J.

2009-01-01

The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo. PMID:19393630

Bim suppresses the development of SLE by limiting myeloid inflammatory responses.

PubMed

Tsai, FuNien; Homan, Philip J; Agrawal, Hemant; Misharin, Alexander V; Abdala-Valencia, Hiam; Haines, G Kenneth; Dominguez, Salina; Bloomfield, Christina L; Saber, Rana; Chang, Anthony; Mohan, Chandra; Hutcheson, Jack; Davidson, Anne; Budinger, G R Scott; Bouillet, Philippe; Dorfleutner, Andrea; Stehlik, Christian; Winter, Deborah R; Cuda, Carla M; Perlman, Harris

2017-12-04

The Bcl-2 family is considered the guardian of the mitochondrial apoptotic pathway. We demonstrate that Bim acts as a molecular rheostat by controlling macrophage function not only in lymphoid organs but also in end organs, thereby preventing the break in tolerance. Mice lacking Bim in myeloid cells (LysM Cre Bim fl/fl ) develop a systemic lupus erythematosus (SLE)-like disease that mirrors aged Bim -/- mice, including loss of marginal zone macrophages, splenomegaly, lymphadenopathy, autoantibodies (including anti-DNA IgG), and a type I interferon signature. LysM Cre Bim fl/fl mice exhibit increased mortality attributed to glomerulonephritis (GN). Moreover, the toll-like receptor signaling adaptor protein TRIF (TIR-domain-containing adapter-inducing interferon-β) is essential for GN, but not systemic autoimmunity in LysM Cre Bim fl/fl mice. Bim-deleted kidney macrophages exhibit a novel transcriptional lupus signature that is conserved within the gene expression profiles from whole kidney biopsies of patients with SLE. Collectively, these data suggest that the Bim may be a novel therapeutic target in the treatment of SLE. © 2017 Tsai et al.

Structure and activity of full-length formin mDia1

PubMed Central

Maiti, Sankar; Michelot, Alphee; Gould, Christopher; Blanchoin, Laurent; Sokolova, Olga; Goode, Bruce L.

2012-01-01

Formins are a conserved family of actin assembly-promoting factors with essential and diverse biological roles. Most of our biochemical understanding of formin effects on actin dynamics is derived from studies using formin fragments. In addition, all structural information on formins has been limited to fragments. This has left open key questions about the structure, activity and regulation of intact formin proteins. Here, we isolated full-length mouse mDia1 (mDia1-FL) and found that it forms tightly autoinhibited dimers that can only be partially activated by RhoA. We solved the structure of autoinhibited mDia1-FL using electron microscopy and single particle analysis. Docking of crystal structures into the 3D reconstruction revealed that the fork-shaped N-terminal DID-CC region hangs over the ring-shaped FH2 domain, suggesting that autoinhibition results from steric obstruction of actin binding. Deletion of the C-terminal DAD domain extended mDia1 structure and activated it for actin assembly. Using TIRF microscopy, we observed that RhoA-activated mDia1-FL persistently accelerated filament elongation in the presence of profilin similar to mDia1 FH1-FH2 fragment. These observations validate the known activities of FH1-FH2 fragments as reflecting those of the intact molecule. Our results further suggest that mDia1-FL does not readily snap back into the autoinhibited conformation and dissociate from growing filament ends, and thus additional factors may be required to displace formins and restrict filament length. PMID:22605659

Elucidation and pharmacological targeting of novel molecular drivers of follicular lymphoma progression | Office of Cancer Genomics

Cancer.gov

Follicular lymphoma (FL), the most common indolent subtype of non-Hodgkin's lymphoma, is associated with a relatively long overall survival rate ranging from 6 to 10 years from time of diagnosis. However, in 20-60% of FL patients, transformation to aggressive diffuse large B-cell lymphoma (DLBCL) reduces median survival to only 1.2 years. The specific functional and genetic determinants of FL transformation remain elusive, and genomic alterations underlying disease advancement have only been identified for a subset of cases.

GP3 is a structural component of the PRRSV type II (US) virion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lima, M. de; Departamento de Microbiologia e Parasitologia, Universidade Federal Fluminense, Niteroi, RJ; Ansari, I.H.

2009-07-20

Glycoprotein 3 (GP3) is a highly glycosylated PRRSV envelope protein which has been reported as being present in the virions of PRRSV type I, while missing in the type II PRRSV (US) virions. We herein present evidence that GP3 is indeed incorporated in the virus particles of a North American strain of PRRSV (FL12), at a density that is consistent with the minor structural role assigned to GP3 in members of the Arterivirus genus. Two 15aa peptides corresponding to two different immunodominant linear epitopes of GP3 derived from the North American strain of PRRSV (FL12) were used as antigen tomore » generate a rabbit monospecific antiserum to this protein. The specificity of this anti-GP3 antiserum was confirmed by radioimmunoprecipitation (RIP) assay using BHK-21 cells transfected with GP3 expressing plasmid, MARC-145 cells infected with FL12 PRRSV, as well as by confocal microscopy on PRRSV-infected MARC-145 cells. To test if GP3 is a structural component of the virion, {sup 35}S-labelled PRRSV virions were pelleted through a 30% sucrose cushion, followed by a second round of purification on a sucrose gradient (20-60%). Virions were detected in specific gradient fractions by radioactive counts and further confirmed by viral infectivity assay in MARC 145 cells. The GP3 was detected in gradient fractions containing purified virions by RIP using anti-GP3 antiserum. Predictably, the GP3 was less abundant in purified virions than other major structural envelope proteins such as GP5 and M. Further evidence of the presence of GP3 at the level of PRRSV FL12 envelope was obtained by immunogold staining of purified virions from the supernatant of infected cells with anti-GP3 antiserum. Taken together, these results indicate that GP3 is a minor structural component of the PRRSV type II (FL12 strain) virion, as had been previously described for PRRSV type I.« less

Spatial variability of particle-attached and free-living bacterial diversity in surface waters from the Mackenzie River to the Beaufort Sea (Canadian Arctic)

NASA Astrophysics Data System (ADS)

Ortega-Retuerta, E.; Joux, F.; Jeffrey, W. H.; Ghiglione, J.-F.

2012-12-01

We explored the patterns of total and active bacterial community structure in a gradient covering surface waters from the Mackenzie River to the coastal Beaufort Sea, Canadian Arctic Ocean, with a particular focus on free-living vs. particle-attached communities. Capillary electrophoresis-single strand conformation polymorphism (CE-SSCP) showed significant differences when comparing river, coast and open sea bacterial community structures. In contrast to the river and coastal waters, total (16S rDNA-based) and active (16S rRNA-based) communities in the open sea samples were not significantly different, suggesting that most present bacterial groups were equally active in this area. Additionally, we observed significant differences between particle-attached (PA) and free-living (FL) bacterial communities in the open sea, but similar structure in the two fractions for coastal and river samples. Direct multivariate statistical analyses showed that total community structure was mainly driven by salinity (proxy of DOC and CDOM), suspended particles, amino acids and chlorophyll a. 16S rRNA genes pyrosequencing of selected samples confirmed these significant differences from river to sea and also between PA and FL fractions only in open sea samples, and PA samples generally showed higher diversity (Shannon, Simpson and Chao indices) than FL samples. At the class level, Opitutae was most abundant in the PA fraction of the sea sample, followed by Flavobacteria and Gammaproteobacteria, while the FL sea sample was dominated by Alphaproteobacteria. Finally, the coast and river samples, both PA and FL fractions, were dominated by Betaproteobacteria, Alphaproteobacteria and Actinobacteria. These results highlight the coexistence of particle specialists and generalists and the role of particle quality in structuring bacterial communities in the area. These results may also serve as a~basis to predict further changes in bacterial communities should climate change lead to further increases in river discharge and related particles load.

Ego Boundaries and Attainments in FL Pronunciation

ERIC Educational Resources Information Center

Baran-Lucarz, Malgorzata

2012-01-01

The paper reports on a study designed to examine the relationship between the thickness of ego boundaries and attainments in FL pronunciation after a clearly structured form-focused practical course of phonetics. The research involved 45 first-year students of the Institute of English Studies in Wroclaw, Poland, who had attended around thirty…

Hydrogenated amorphous carbon films on steel balls and Si substrates: Nanostructural evolutions and their trigging tribological behaviors

NASA Astrophysics Data System (ADS)

Wang, Yongfu; Wang, Yan; Zhang, Xingkai; Shi, Jing; Gao, Kaixiong; Zhang, Bin; Zhang, Junyan

2017-10-01

In this study, we prepared hydrogenated amorphous carbon films on steel balls and Si substrates (steel ball- and Si substrate-films) with different deposition time, and discussed their carbon nanostructural evolutions and tribological behaviors. The steel ball-film structure started to be graphite-like structure and then gradually transformed into fullerene-like (FL) structure. The Si substrate-film structure began in FL structure and kept it through the thickness. The difference may be result from the competition between high starting substrate temperature after additional nitriding applied on the steel balls (its supply power is higher than that in the film deposition), and relaxation of compressive stress from energized ion bombardment in film deposition process. The FL structural film friction couples could achieve ultra-low friction in open air. In particular, the Si substrate-film with 3 h, against the steel ball-film with 2 h and 3 h, exhibited super-low friction (∼0.009) and superlong wear life (∼5.5 × 105 cycles). Our result could widen the superlubricity scope from previously high load and velocity, to middle load and velocity.

[Renaturation with simultaneous purification of the recombinant human Flt3 ligand from inclusion bodies by high performance hydrophobic interaction chromatography].

PubMed

Jia, Jia; Wang, Lili; Gao, Dong; Geng, Xindu

2010-06-01

Flt3 ligand (FL) is a class of cytokines with the functions of promoting early hematopoiesis. It has important clinical value in promoting growth and development of hematopoietic cells and hematopoietic mobilization. In order to obtain large quantities of recombinant human FL (rhFL) by genetic engineering methods for clinic and research, in this work, rhFL was expressed in E. coli as inclusion bodies. The inclusion bodies were recovered, cleaned and solubilized in 8 mol/L urea, the solubilized rhFL was renatured by high performance hydrophobic interaction chromatography (HPHIC) with simultaneous purification, the retention feature and renaturation regularity were studied. The results showed that when the denatured protein concentration was 8.51 g/L, and the end group of stationary phase was PEG800, under the conditions of mobile phase of pH 7.0 and with the addition of 4 mol/L urea, 1.8 mmol/L glutathione (GSH) and 0.3 mmol/L oxidative glutathione (GSSG), a mass recovery of 36.9% and a purity of 94.5% were obtained after refolding with simultaneous purification. The obtained rhFL was successfully renatured with simultaneous purification in only one step of HPHIC, and it provided a foundation for the manufacturing of high quality rhFL.

Oligofluorenes as polymeric model compounds for providing insight into the triplets of ketone and ketylimine derivatives.

PubMed

Robert, Patricia; Bolduc, Andréanne; Skene, W G

2012-09-20

A series of oligofluorenes ranging between one and three repeating units were prepared as structurally well-defined representative models of polyfluorenes. The photophysics of the oligofluorene models were investigated both by laser flash photolysis and steady-state fluorescence. The effects of the ketone and ketylimine functional groups in the 9-position on the photophysical properties, notably the triplet quantum yield (Φ(TT)) by intersystem crossing and the absolute fluorescence quantum yields (Φ(fl)), were investigated. The singlet depletion method was used to determine both the Φ(TT) and molar absorption coefficients of the observed triplets (ε(TT)). Meanwhile, the absolute Φ(fl) were determined using an integrating sphere. It was found that both the ketone and ketylimine substituents and the degree of oligomerization contributed to quenching the oligofluorene fluorescence. For example, the Φ(fl) was quenched 5-fold with the ketylimine and ketone substituents for the bifluorenyl derivatives compared to their corresponding 9,9-dihexyl bifluorenyl counterparts. Meanwhile, the Φ(fl) quenching increased 14 times with the trifluorenyl ketone and ketylimine derivatives. Measured Φ(TT) values ranged between 22 and 43% for the difluorenyl derivatives with ε(TT) on the order of 13 000 cm(-1) M(-1). The Φ(TT) decreased to <10% concomitant with doubling of the ε(TT) when the degree of oligomerization was increased to 3. A new fluorescence emission at 545 nm formed at low temperatures for the ketone and ketylimine oligofluorene derivatives. The emission intensity was dependent on the temperature, and it disappeared at room temperature.

Postnatal Ablation of Foxm1 from Cardiomyocytes Causes Late Onset Cardiac Hypertrophy and Fibrosis without Exacerbating Pressure Overload-Induced Cardiac Remodeling

PubMed Central

Bolte, Craig; Zhang, Yufang; York, Allen; Kalin, Tanya V.; Schultz, Jo El J.; Molkentin, Jeffery D.; Kalinichenko, Vladimir V.

2012-01-01

Heart disease remains a leading cause of morbidity and mortality in the industrialized world. Hypertrophic cardiomyopathy is the most common genetic cardiovascular disorder and the most common cause of sudden cardiac death. Foxm1 transcription factor (also known as HFH-11B, Trident, Win or MPP2) plays an important role in the pathogenesis of various cancers and is a critical mediator of post-injury repair in multiple organs. Foxm1 has been previously shown to be essential for heart development and proliferation of embryonic cardiomyocytes. However, the role of Foxm1 in postnatal heart development and in cardiac injury has not been evaluated. To delete Foxm1 in postnatal cardiomyocytes, αMHC-Cre/Foxm1fl/fl mice were generated. Surprisingly, αMHC-Cre/Foxm1fl/fl mice exhibited normal cardiomyocyte proliferation at postnatal day seven and had no defects in cardiac structure or function but developed cardiac hypertrophy and fibrosis late in life. The development of cardiomyocyte hypertrophy and cardiac fibrosis in aged Foxm1-deficient mice was associated with reduced expression of Hey2, an important regulator of cardiac homeostasis, and increased expression of genes critical for cardiac remodeling, including MMP9, αSMA, fibronectin and vimentin. We also found that following aortic constriction Foxm1 mRNA and protein were induced in cardiomyocytes. However, Foxm1 deletion did not exacerbate cardiac hypertrophy or fibrosis following chronic pressure overload. Our results demonstrate that Foxm1 regulates genes critical for age-induced cardiomyocyte hypertrophy and cardiac fibrosis. PMID:23144938

The E3 ligase Mule protects the heart against oxidative stress and mitochondrial dysfunction through Myc-dependent inactivation of Pgc-1α and Pink1.

PubMed

Dadson, Keith; Hauck, Ludger; Hao, Zhenyue; Grothe, Daniela; Rao, Vivek; Mak, Tak W; Billia, Filio

2017-02-02

Cardiac homeostasis requires proper control of protein turnover. Protein degradation is principally controlled by the Ubiquitin-Proteasome System. Mule is an E3 ubiquitin ligase that regulates cellular growth, DNA repair and apoptosis to maintain normal tissue architecture. However, Mule's function in the heart has yet to be described. In a screen, we found reduced Mule expression in left ventricular samples from end-stage heart failure patients. Consequently, we generated conditional cardiac-specific Mule knockout (Mule  fl/fl(y) ;mcm) mice. Mule ablation in adult Mule  fl/fl(y) ;mcm mice prevented myocardial c-Myc polyubiquitination, leading to c-Myc accumulation and subsequent reduced expression of Pgc-1α, Pink1, and mitochondrial complex proteins. Furthermore, these mice developed spontaneous cardiac hypertrophy, left ventricular dysfunction, and early mortality. Co-deletion of Mule and c-Myc rescued this phenotype. Our data supports an indispensable role for Mule in cardiac homeostasis through the regulation of mitochondrial function via maintenance of Pgc-1α and Pink1 expression and persistent negative regulation of c-Myc.

Chronic tinnitus and unipolar brush cell alterations in the cerebellum and dorsal cochlear nucleus.

PubMed

Brozoski, Thomas; Brozoski, Daniel; Wisner, Kurt; Bauer, Carol

2017-07-01

Animal model research has shown that the central features of tinnitus, the perception of sound without an acoustic correlate, include elevated spontaneous and stimulus-driven activity, enhanced burst-mode firing, decreased variance of inter-spike intervals, and distortion of tonotopic frequency representation. Less well documented are cell-specific correlates of tinnitus. Unipolar brush cell (UBC) alterations in animals with psychophysical evidence of tinnitus has recently been reported. UBCs are glutamatergic interneurons that appear to function as local-circuit signal amplifiers. UBCs are abundant in the dorsal cochlear nucleus (DCN) and very abundant in the flocculus (FL) and paraflocculus (PFL) of the cerebellum. In the present research, two indicators of UBC structure and function were examined: Doublecortin (DCX) and epidermal growth factor receptor substrate 8 (Eps8). DCX is a protein that binds to microtubules where it can modify their assembly and growth. Eps8 is a cell-surface tyrosine kinase receptor mediating the response to epidermal growth factor; it appears to have a role in actin polymerization as well as cytoskeletal protein interactions. Both functions could contribute to synaptic remodeling. In the present research UBC Eps8 and DCX immunoreactivity (IR) were determined in 4 groups of rats distinguished by their exposure to high-level sound and psychophysical performance: Unexposed, exposed to high-level sound with behavioral evidence of tinnitus, and two exposed groups without behavioral evidence of tinnitus. Compared to unexposed controls, exposed animals with tinnitus had Eps8 IR elevated in their PFL; other structures were not affected, nor was DCX IR affected. This was interpreted as UBC upregulation in animals with tinnitus. Exposure that failed to produce tinnitus did not increase either Eps8 or DCX IR. Rather Eps8 IR was decreased in the FL and DCN of one subgroup (Least-Tinnitus), while DCX IR decreased in the FL of the other subgroup (No-Tinnitus). Neuron degeneration was also documented in the cochlear nucleus and PFL of exposed animals, both with and without tinnitus. Degeneration was not found in unexposed animals. Implications for tinnitus neuropathy are discussed in the context of synaptic remodeling and cerebellar sensory modulation. Copyright © 2017 Elsevier B.V. All rights reserved.

The Absence of Sensory Axon Bifurcation Affects Nociception and Termination Fields of Afferents in the Spinal Cord

PubMed Central

Tröster, Philip; Haseleu, Julia; Petersen, Jonas; Drees, Oliver; Schmidtko, Achim; Schwaller, Frederick; Lewin, Gary R.; Ter-Avetisyan, Gohar; Winter, York; Peters, Stefanie; Feil, Susanne; Feil, Robert; Rathjen, Fritz G.; Schmidt, Hannes

2018-01-01

A cGMP signaling cascade composed of C-type natriuretic peptide, the guanylyl cyclase receptor Npr2 and cGMP-dependent protein kinase I (cGKI) controls the bifurcation of sensory axons upon entering the spinal cord during embryonic development. However, the impact of axon bifurcation on sensory processing in adulthood remains poorly understood. To investigate the functional consequences of impaired axon bifurcation during adult stages we generated conditional mouse mutants of Npr2 and cGKI (Npr2fl/fl;Wnt1Cre and cGKIKO/fl;Wnt1Cre) that lack sensory axon bifurcation in the absence of additional phenotypes observed in the global knockout mice. Cholera toxin labeling in digits of the hind paw demonstrated an altered shape of sensory neuron termination fields in the spinal cord of conditional Npr2 mouse mutants. Behavioral testing of both sexes indicated that noxious heat sensation and nociception induced by chemical irritants are impaired in the mutants, whereas responses to cold sensation, mechanical stimulation, and motor coordination are not affected. Recordings from C-fiber nociceptors in the hind limb skin showed that Npr2 function was not required to maintain normal heat sensitivity of peripheral nociceptors. Thus, the altered behavioral responses to noxious heat found in Npr2fl/fl;Wnt1Cre mice is not due to an impaired C-fiber function. Overall, these data point to a critical role of axonal bifurcation for the processing of pain induced by heat or chemical stimuli. PMID:29472841

Improved facial nerve identification during parotidectomy with fluorescently labeled peptide.

PubMed

Hussain, Timon; Nguyen, Linda T; Whitney, Michael; Hasselmann, Jonathan; Nguyen, Quyen T

2016-12-01

Additional intraoperative guidance could reduce the risk of iatrogenic injury during parotid gland cancer surgery. We evaluated the intraoperative use of fluorescently labeled nerve binding peptide NP41 to aid facial nerve identification and preservation during parotidectomy in an orthotopic model of murine parotid gland cancer. We also quantified the accuracy of intraoperative nerve detection for surface and buried nerves in the head and neck with NP41 versus white light (WL) alone. Twenty-eight mice underwent parotid gland cancer surgeries with additional fluorescence (FL) guidance versus WL reflectance (WLR) alone. Eight mice were used for additional nerve-imaging experiments. Twenty-eight parotid tumor-bearing mice underwent parotidectomy. Eight mice underwent imaging of both sides of the face after skin removal. Postoperative assessment of facial nerve function measured by automated whisker tracking were compared between FL guidance (n = 13) versus WL alone (n=15). In eight mice, nerve to surrounding tissue contrast was measured under FL versus WLR for all nerve branches detectable in the field of view. Postoperative facial nerve function after parotid gland cancer surgery tended to be better with additional FL guidance. Fluorescent labeling significantly improved nerve to surrounding tissue contrast for both large and smaller buried nerve branches compared to WLR visualization and improved detection sensitivity and specificity. NP41 FL imaging significantly aids the intraoperative identification of nerve braches otherwise nearly invisible to the naked eye. Its application in a murine model of parotid gland cancer surgery tended to improve functional preservation of the facial nerve. NA Laryngoscope, 126:2711-2717, 2016. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.

Improved Facial Nerve Identification During Parotidectomy With Fluorescently Labeled Peptide

PubMed Central

Hussain, Timon; Nguyen, Linda T.; Whitney, Michael; Hasselmann, Jonathan; Nguyen, Quyen T.

2016-01-01

Objectives/Hypothesis Additional intraoperative guidance could reduce the risk of iatrogenic injury during parotid gland cancer surgery. We evaluated the intraoperative use of fluorescently labeled nerve binding peptide NP41 to aid facial nerve identification and preservation during parotidectomy in an orthotopic model of murine parotid gland cancer. We also quantified the accuracy of intraoperative nerve detection for surface and buried nerves in the head and neck with NP41 versus white light (WL) alone. Study Design Twenty-eight mice underwent parotid gland cancer surgeries with additional fluorescence (FL) guidance versus WL reflectance (WLR) alone. Eight mice were used for additional nerve-imaging experiments. Methods Twenty-eight parotid tumor-bearing mice underwent parotidectomy. Eight mice underwent imaging of both sides of the face after skin removal. Postoperative assessment of facial nerve function measured by automated whisker tracking were compared between FL guidance (n = 13) versus WL alone (n = 15). In eight mice, nerve to surrounding tissue contrast was measured under FL versus WLR for all nerve branches detectable in the field of view. Results Postoperative facial nerve function after parotid gland cancer surgery tended to be better with additional FL guidance. Fluorescent labeling significantly improved nerve to surrounding tissue contrast for both large and smaller buried nerve branches compared to WLR visualization and improved detection sensitivity and specificity. Conclusions NP41 FL imaging significantly aids the intraoperative identification of nerve braches otherwise nearly invisible to the naked eye. Its application in a murine model of parotid gland cancer surgery tended to improve functional preservation of the facial nerve. PMID:27171862

Alk5-Mediated Transforming Growth Factor β Signaling Acts Upstream of Fibroblast Growth Factor 10 To Regulate the Proliferation and Maintenance of Dental Epithelial Stem Cells▿

PubMed Central

Zhao, Hu; Li, Sha; Han, Dong; Kaartinen, Vesa; Chai, Yang

2011-01-01

Mouse incisors grow continuously throughout life. This growth is supported by the division of dental epithelial stem cells that reside in the cervical loop region. Little is known about the maintenance and regulatory mechanisms of dental epithelial stem cells. In the present study, we investigated how transforming growth factor β (TGF-β) signaling-mediated mesenchymal-epithelial cell interactions control dental epithelial stem cells. We designed two approaches using incisor organ culture and bromodeoxyuridine (BrdU) pulse-chase experiments to identify and evaluate stem cell functions. We show that the loss of the TGF-β type I receptor (Alk5) in the cranial neural crest-derived dental mesenchyme severely affects the proliferation of TA (transit-amplifying) cells and the maintenance of dental epithelial stem cells. Incisors of Wnt1-Cre; Alk5fl/fl mice lost their ability to continue to grow in vitro. The number of BrdU label-retaining cells (LRCs) was dramatically reduced in Alk5 mutant mice. Fgf10, Fgf3, and Fgf9 signals in the dental mesenchyme were downregulated in Wnt1-Cre; Alk5fl/fl incisors. Strikingly, the addition of exogenous fibroblast growth factor 10 (FGF10) into cultured incisors rescued dental epithelial stem cells in Wnt1-Cre; Alk5fl/fl mice. Therefore, we propose that Alk5 functions upstream of Fgf10 to regulate TA cell proliferation and stem cell maintenance and that this signaling mechanism is crucial for stem cell-mediated tooth regeneration. PMID:21402782

Unusually high fluorescence quantum yield of a homopolyfluorenylazomethine--towards a universal fluorophore.

PubMed

Mallet, Charlotte; Bolduc, Andréanne; Bishop, Sophie; Gautier, Yohan; Skene, W G

2014-11-28

The absolute fluorescence quantum yield (Φfl) of a polyfluorenyl azomethine homopolymer was measured as a function of solvent polarity. The solvent induced and temperature dependent fluorescence of the homopolymer were also investigated and they were compared to the corresponding monomer and copolymer. The Φfl of the homopolymer was consistent (45-70%), regardless of solvent polarity with Stokes shifts up to 7460 cm(-1) in ethanol. In contrast, the Φfl of its corresponding monomer decreased from 60% in ethanol to 1% in toluene, whereas a Φfl < 5% for its analogous copolymer was measured. Moderate fluorescence yields (Φfl ≈ 25%) were also possible in thin film when co-depositing the homopolymer with PMMA. Cryofluorescence was used to probe the excited state deactivation modes. Deactivation by internal conversion was found to compete with fluorescence. The fluorescence deactivation pathways of the homopolymer and its corresponding monomer could be suppressed at 77 K, resulting in fluorescence turn-on. Both fluorophores were found to detect nitroaromatics.

Fluorescent light exposure incites acute and prolonged immune responses in zebrafish (Danio rerio) skin.

PubMed

Gonzalez, Trevor J; Lu, Yuan; Boswell, Mikki; Boswell, William; Medrano, Geraldo; Walter, Sean; Ellis, Samuel; Savage, Markita; Varga, Zoltan M; Lawrence, Christian; Sanders, George; Walter, Ronald B

2018-06-01

Artificial light produces an emission spectrum that is considerably different than the solar spectrum. Artificial light has been shown to affect various behavior and physiological processes in vertebrates. However, there exists a paucity of data regarding the molecular genetic effects of artificial light exposure. Previous studies showed that one of the commonly used fluorescent light source (FL; 4100K or "cool white") can affect signaling pathways related to maintenance of circadian rhythm, cell cycle progression, chromosome segregation, and DNA repair/recombination in the skin of male Xiphophorus maculatus. These observations raise questions concerning the kinetics of the FL induced gene expression response, and which biological functions become modulated at various times after light exposure. To address these questions, we exposed zebrafish to 4100K FL and utilized RNA-Seq to assess gene expression changes in skin at various times (1 to 12h) after FL exposure. We found 4100K FL incites a robust early (1-2h) transcriptional response, followed by a more protracted late response (i.e., 4-12h). The early transcriptional response involves genes associated with cell migration/infiltration and cell proliferation as part of an overall increase in immune function and inflammation. The protracted late transcriptional response occurs within gene sets predicted to maintain and perpetuate the inflammatory response, as well as suppression of lipid, xenobiotic, and melatonin metabolism. Copyright © 2017 Elsevier Inc. All rights reserved.

Targeted Delivery of TrkB Receptor to Phrenic Motoneurons Enhances Functional Recovery of Rhythmic Phrenic Activity after Cervical Spinal Hemisection

PubMed Central

Gransee, Heather M.; Zhan, Wen-Zhi; Sieck, Gary C.; Mantilla, Carlos B.

2013-01-01

Progressive recovery of rhythmic phrenic activity occurs over time after a spinal cord hemisection involving unilateral transection of anterolateral funiculi at C2 (SH). Brain-derived neurotrophic factor (BDNF) acting through its full-length tropomyosin related kinase receptor subtype B (TrkB.FL) contributes to neuroplasticity after spinal cord injury, but the specific cellular substrates remain unclear. We hypothesized that selectively targeting increased TrkB.FL expression to phrenic motoneurons would be sufficient to enhance recovery of rhythmic phrenic activity after SH. Several adeno-associated virus (AAV) serotypes expressing GFP were screened to determine specificity for phrenic motoneuron transduction via intrapleural injection in adult rats. GFP expression was present in the cervical spinal cord 3 weeks after treatment with AAV serotypes 7, 8, and 9, but not with AAV2, 6, or rhesus-10. Overall, AAV7 produced the most consistent GFP expression in phrenic motoneurons. SH was performed 3 weeks after intrapleural injection of AAV7 expressing human TrkB.FL-FLAG or saline. Delivery of TrkB.FL-FLAG to phrenic motoneurons was confirmed by FLAG protein expression in the phrenic motor nucleus and human TrkB.FL mRNA expression in microdissected phrenic motoneurons. In all SH rats, absence of ipsilateral diaphragm EMG activity was confirmed at 3 days post-SH, verifying complete interruption of ipsilateral descending drive to phrenic motoneurons. At 14 days post-SH, all AAV7-TrkB.FL treated rats (n = 11) displayed recovery of ipsilateral diaphragm EMG activity compared to 3 out of 8 untreated SH rats (p<0.01). During eupnea, AAV7-TrkB.FL treated rats exhibited 73±7% of pre-SH root mean squared EMG vs. only 31±11% in untreated SH rats displaying recovery (p<0.01). This study provides direct evidence that increased TrkB.FL expression in phrenic motoneurons is sufficient to enhance recovery of ipsilateral rhythmic phrenic activity after SH, indicating that selectively targeting gene expression in spared motoneurons below the level of spinal cord injury may promote functional recovery. PMID:23724091

Conditional deletion of caspase-8 in macrophages alters macrophage activation in a RIPK-dependent manner.

PubMed

Cuda, Carla M; Misharin, Alexander V; Khare, Sonal; Saber, Rana; Tsai, FuNien; Archer, Amy M; Homan, Philip J; Haines, G Kenneth; Hutcheson, Jack; Dorfleutner, Andrea; Budinger, G R Scott; Stehlik, Christian; Perlman, Harris

2015-10-16

Although caspase-8 is a well-established initiator of apoptosis and suppressor of necroptosis, recent evidence suggests that this enzyme maintains functions beyond its role in cell death. As cells of the innate immune system, and in particular macrophages, are now at the forefront of autoimmune disease pathogenesis, we examined the potential involvement of caspase-8 within this population. Cre (LysM) Casp8 (fl/fl) mice were bred via a cross between Casp8 (fl/fl) mice and Cre (LysM) mice, and RIPK3 (-/-) Cre (LysM) Casp8 (fl/fl) mice were generated to assess the contribution of receptor-interacting serine-threonine kinase (RIPK)3. Immunohistochemical and immunofluorescence analyses were used to examine renal damage. Flow cytometric analysis was employed to characterize splenocyte distribution and activation. Cre (LysM) Casp8 (fl/fl) mice were treated with either Toll-like receptor (TLR) agonists or oral antibiotics to assess their response to TLR activation or TLR agonist removal. Luminex-based assays and enzyme-linked immunosorbent assays were used to measure cytokine/chemokine and immunoglobulin levels in serum and cytokine levels in cell culture studies. In vitro cell culture was used to assess macrophage response to cell death stimuli, TLR activation, and M1/M2 polarization. Data were compared using the Mann-Whitney U test. Loss of caspase-8 expression in macrophages promotes onset of a mild systemic inflammatory disease, which is preventable by the deletion of RIPK3. In vitro cell culture studies reveal that caspase-8-deficient macrophages are prone to a caspase-independent death in response to death receptor ligation; yet, caspase-8-deficient macrophages are not predisposed to unchecked survival, as analysis of mixed bone marrow chimeric mice demonstrates that caspase-8 deficiency does not confer preferential expansion of myeloid populations. Loss of caspase-8 in macrophages dictates the response to TLR activation, as injection of TLR ligands upregulates expression of costimulatory CD86 on the Ly6C(high)CD11b(+)F4/80(+) splenic cells, and oral antibiotic treatment to remove microbiota prevents splenomegaly and lymphadenopathy in Cre (LysM) Casp8 (fl/fl) mice. Further, caspase-8-deficient macrophages are hyperresponsive to TLR activation and exhibit aberrant M1 macrophage polarization due to RIPK activity. These data demonstrate that caspase-8 functions uniquely in macrophages by controlling the response to TLR activation and macrophage polarization in an RIPK-dependent manner.

Important Functional Roles of Basigin in Thymocyte Development and T cell Activation

PubMed Central

Yao, Hui; Teng, Yan; Sun, Qian; Xu, Jing; Chen, Ya-Tong; Hou, Ning; Cheng, Xuan; Yang, Xiao; Chen, Zhi-Nan

2014-01-01

Basigin is a highly glycosylated transmembrane protein that is expressed in a broad range of tissues and is involved in a number of physiological and pathological processes. However, the in vivo role of basigin remains unknown. To better understand the physiological and pathological functions of basigin in vivo, we generated a conditional null allele by introducing two loxP sites flanking exons 2 and 7 of the basigin gene (Bsg). Bsgfl/fl mice were born at the expected Mendelian ratio and showed a similar growth rate compared with wildtype mice. After crossing these mice with Lck-Cre transgenic mice, basigin expression was specifically inactivated in T cells in the resulting Lck-Cre; Bsgfl/fl mice. Although the birth and growth rate of Lck-Cre; Bsgfl/fl mice were similar to control mice, thymus development was partially arrested in Lck-Cre; Bsgfl/fl mice, specifically at the CD4+CD8+ double-positive (DP) and CD4 single-positive (CD4+CD8-, CD4SP) stages. In addition, CD4+ T cell activation was enhanced upon Concanavalin A (Con A) or anti-CD3/anti-CD28 stimulation but not upon PMA/Ionomycin stimulation in the absence of basigin. Overall, this study provided the first in vivo evidence for the function of basigin in thymus development. Moreover, the successful generation of the conditional null basigin allele provides a useful tool for the study of distinct physiological or pathological functions of basigin in different tissues at different development stages. PMID:24391450

Strength and Structure of Ga1-xInx as Alloys

DTIC Science & Technology

1986-04-01

fixtures were ordered and received. An existing furnace and retort will be used to surround the compression fixture. The sample will be positioned in a B203...oncerns the experimental measurement of the flow stress and hardness as a function of temperature and In content:. High mprare hardns testing is used ...approximately 1/3 of the hardness 4 value9 so the latter indicates expected trends for yield stress. flWI1AL WORK The hardess tester used in this study was

Acculturation into the Creek Traditions: Growing in Depth and Breadth of Understanding within the Environment

ERIC Educational Resources Information Center

Bogan, Margaret B.

2011-01-01

This paper is in part, a reflective analysis of 15 years living with the state-recognized Florida Creek Indians of the Central Florida Muskogee Creek Tribe and the Pasco Band of Creek Indians, formally of Lacoochee, FL and currently in Brooksville, FL, respectively. It addresses the power structures within tribal organizations. Selected Creek…

Kinetic and Structural Characterization of a Heterohexamer 4-Oxalocrotonate Tautomerase from Chloroflexus aurantiacus J-10-fl: Implications for Functional and Structural Diversity in the Tautomerase Superfamily

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burks, Elizabeth A.; Fleming, Christopher D.; Mesecar, Andrew D.

2010-09-30

4-Oxalocrotonate tautomerase (4-OT) isozymes play prominent roles in the bacterial utilization of aromatic hydrocarbons as sole carbon sources. These enzymes catalyze the conversion of 2-hydroxy-2,4-hexadienedioate (or 2-hydroxymuconate) to 2-oxo-3-hexenedioate, where Pro-1 functions as a general base and shuttles a proton from the 2-hydroxyl group of the substrate to the C-5 position of the product. 4-OT, a homohexamer from Pseudomonas putida mt-2, is the most extensively studied 4-OT isozyme and the founding member of the tautomerase superfamily. A search of five thermophilic bacterial genomes identified a coded amino acid sequence in each that had been annotated as a tautomerase-like protein butmore » lacked Pro-1. However, a nearby sequence has Pro-1, but the sequence is not annotated as a tautomerase-like protein. To characterize this group of proteins, two genes from Chloroflexus aurantiacus J-10-fl were cloned, and the corresponding proteins were expressed. Kinetic, biochemical, and X-ray structural analyses show that the two expressed proteins form a functional heterohexamer 4-OT (hh4-OT), composed of three {alpha}{beta} dimers. Like the P. putida enzyme, hh4-OT requires the amino-terminal proline and two arginines for the conversion of 2-hydroxymuconate to the product, implicating an analogous mechanism. In contrast to 4-OT, hh4-OT does not exhibit the low-level activity of another tautomerase superfamily member, the heterohexamer trans-3-chloroacrylic acid dehalogenase (CaaD). Characterization of hh4-OT enables functional assignment of the related enzymes, highlights the diverse ways the {beta}-{alpha}-{beta} building block can be assembled into an active enzyme, and provides further insight into the molecular basis of the low-level CaaD activity in 4-OT.« less

Ultrasound-guided versus fluoroscopy-guided sacroiliac joint intra-articular injections in the noninflammatory sacroiliac joint dysfunction: a prospective, randomized, single-blinded study.

PubMed

Jee, Haemi; Lee, Ji-Hae; Park, Ki Deok; Ahn, Jaeki; Park, Yongbum

2014-02-01

To compare the short-term effects and safety of ultrasound (US)-guided sacroiliac joint (SIJ) injections with fluoroscopy (FL)-guided SIJ injections in patients with noninflammatory SIJ dysfunction. Prospective, randomized controlled trial. University hospital. Patients (N=120) with noninflammatory sacroiliac arthritis were enrolled. All procedures were performed using an FL or US apparatus. Subjects were randomly assigned to either the FL or US group. Immediately after the SIJ injections, fluoroscopy was applied to verify the correct placement of the injected medication and intravascular injections. Treatment effects and functional improvement were compared at 2 and 12 weeks after the procedures. The verbal numeric pain scale and Oswestry Disability Index improved at 2 and 12 weeks after the injections without statistical significances between groups. Of 55 US-guided injections, 48 (87.3%) were successful and 7 (12.7%) were missed. The FL-guided SIJ approach exhibited a greater accuracy (98.2%) than the US-guided approach. Vascularization around the SIJ was seen in 34 of 55 patients. Among the 34 patients, 7 had vascularization inside the joint, 23 had vascularization around the joint, and 4 had vascularization both inside and around the joint. Three cases of intravascular injections occurred in the FL group. The US-guided approach may facilitate the identification and avoidance of the critical vessels around or within the SIJ. Function and pain relief significantly improved in both groups without significant differences between groups. The US-guided approach was shown to be as effective as the FL-guided approach in treatment effects. However, diagnostic application in the SIJ may be limited because of the significantly lower accuracy rate (87.3%). Copyright © 2014 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

Skeletal Muscle-specific G Protein-coupled Receptor Kinase 2 Ablation Alters Isolated Skeletal Muscle Mechanics and Enhances Clenbuterol-stimulated Hypertrophy*

PubMed Central

Woodall, Benjamin P.; Woodall, Meryl C.; Luongo, Timothy S.; Grisanti, Laurel A.; Tilley, Douglas G.; Elrod, John W.; Koch, Walter J.

2016-01-01

GRK2, a G protein-coupled receptor kinase, plays a critical role in cardiac physiology. Adrenergic receptors are the primary target for GRK2 activity in the heart; phosphorylation by GRK2 leads to desensitization of these receptors. As such, levels of GRK2 activity in the heart directly correlate with cardiac contractile function. Furthermore, increased expression of GRK2 after cardiac insult exacerbates injury and speeds progression to heart failure. Despite the importance of this kinase in both the physiology and pathophysiology of the heart, relatively little is known about the role of GRK2 in skeletal muscle function and disease. In this study we generated a novel skeletal muscle-specific GRK2 knock-out (KO) mouse (MLC-Cre:GRK2fl/fl) to gain a better understanding of the role of GRK2 in skeletal muscle physiology. In isolated muscle mechanics testing, GRK2 ablation caused a significant decrease in the specific force of contraction of the fast-twitch extensor digitorum longus muscle yet had no effect on the slow-twitch soleus muscle. Despite these effects in isolated muscle, exercise capacity was not altered in MLC-Cre:GRK2fl/fl mice compared with wild-type controls. Skeletal muscle hypertrophy stimulated by clenbuterol, a β2-adrenergic receptor (β2AR) agonist, was significantly enhanced in MLC-Cre:GRK2fl/fl mice; mechanistically, this seems to be due to increased clenbuterol-stimulated pro-hypertrophic Akt signaling in the GRK2 KO skeletal muscle. In summary, our study provides the first insights into the role of GRK2 in skeletal muscle physiology and points to a role for GRK2 as a modulator of contractile properties in skeletal muscle as well as β2AR-induced hypertrophy. PMID:27566547

SMN transcript levels in leukocytes of SMA patients determined by absolute real-time PCR

PubMed Central

Tiziano, Francesco Danilo; Pinto, Anna Maria; Fiori, Stefania; Lomastro, Rosa; Messina, Sonia; Bruno, Claudio; Pini, Antonella; Pane, Marika; D'Amico, Adele; Ghezzo, Alessandro; Bertini, Enrico; Mercuri, Eugenio; Neri, Giovanni; Brahe, Christina

2010-01-01

Spinal muscular atrophy (SMA) is an autosomal recessive neuromuscular disorder caused by homozygous mutations of the SMN1 gene. Three forms of SMA are recognized (type I–III) on the basis of clinical severity. All patients have at least one or more (usually 2–4) copies of a highly homologous gene (SMN2), which produces insufficient levels of functional SMN protein, because of alternative splicing of exon 7. Recently, evidence has been provided that SMN2 expression can be enhanced by pharmacological treatment. However, no reliable biomarkers are available to test the molecular efficacy of the treatments. At present, the only potential biomarker is the dosage of SMN products in peripheral blood. However, the demonstration that SMN full-length (SMN-fl) transcript levels are reduced in leukocytes of patients compared with controls remains elusive (except for type I). We have developed a novel assay based on absolute real-time PCR, which allows the quantification of SMN1-fl/SMN2-fl transcripts. For the first time, we have shown that SMN-fl levels are reduced in leukocytes of type II–III patients compared with controls. We also found that transcript levels are related to clinical severity as in type III patients SMN2-fl levels are significantly higher compared with type II and directly correlated with functional ability in type II patients and with age of onset in type III patients. Moreover, in haploidentical siblings with discordant phenotype, the less severely affected individuals showed significantly higher transcript levels. Our study shows that SMN2-fl dosage in leukocytes can be considered a reliable biomarker and can provide the rationale for SMN dosage in clinical trials. PMID:19603064

Assessing duplication and loss of APETALA1/FRUITFULL homologs in Ranunculales

PubMed Central

Pabón-Mora, Natalia; Hidalgo, Oriane; Gleissberg, Stefan; Litt, Amy

2013-01-01

Gene duplication and loss provide raw material for evolutionary change within organismal lineages as functional diversification of gene copies provide a mechanism for phenotypic variation. Here we focus on the APETALA1/FRUITFULL MADS-box gene lineage evolution. AP1/FUL genes are angiosperm-specific and have undergone several duplications. By far the most significant one is the core-eudicot duplication resulting in the euAP1 and euFUL clades. Functional characterization of several euAP1 and euFUL genes has shown that both function in proper floral meristem identity, and axillary meristem repression. Independently, euAP1 genes function in floral meristem and sepal identity, whereas euFUL genes control phase transition, cauline leaf growth, compound leaf morphogenesis and fruit development. Significant functional variation has been detected in the function of pre-duplication basal-eudicot FUL-like genes, but the underlying mechanisms for change have not been identified. FUL-like genes in the Papaveraceae encode all functions reported for euAP1 and euFUL genes, whereas FUL-like genes in Aquilegia (Ranunculaceae) function in inflorescence development and leaf complexity, but not in flower or fruit development. Here we isolated FUL-like genes across the Ranunculales and used phylogenetic approaches to analyze their evolutionary history. We identified an early duplication resulting in the RanFL1 and RanFL2 clades. RanFL1 genes were present in all the families sampled and are mostly under strong negative selection in the MADS, I and K domains. RanFL2 genes were only identified from Eupteleaceae, Papaveraceae s.l., Menispermaceae and Ranunculaceae and show relaxed purifying selection at the I and K domains. We discuss how asymmetric sequence diversification, new motifs, differences in codon substitutions and likely protein-protein interactions resulting from this Ranunculiid-specific duplication can help explain the functional differences among basal-eudicot FUL-like genes. PMID:24062757

Bond topography and nanostructure of hydrogenated fullerene-like carbon films: A comparative study

NASA Astrophysics Data System (ADS)

Wang, Yongfu; Gao, Kaixiong; Shi, Jing; Zhang, Junyan

2016-09-01

Fullerene-like nanostructural hydrogenated amorphous carbon (FL-C:H) films were prepared by dc- and pulse- plasma enhanced chemical vapor deposition technique (PECVD). Both the films exhibit relatively stresses (0.63 GPa) in spite of their FL features and nanostructural bonding configurations, especially the pentagonal carbon rings. The creation of pentagonal rings is not fully driven by thermodynamics, but is closely related to compressive stress determined by the ion bombardment at the discharged state of the pulse- and dc- discharged plasmas methods. The dc method leads to FL's basal planes which contain less cross-linkages, and causes amorphous strongly hydrogenated structures.

A hybrid neural networks-fuzzy logic-genetic algorithm for grade estimation

NASA Astrophysics Data System (ADS)

Tahmasebi, Pejman; Hezarkhani, Ardeshir

2012-05-01

The grade estimation is a quite important and money/time-consuming stage in a mine project, which is considered as a challenge for the geologists and mining engineers due to the structural complexities in mineral ore deposits. To overcome this problem, several artificial intelligence techniques such as Artificial Neural Networks (ANN) and Fuzzy Logic (FL) have recently been employed with various architectures and properties. However, due to the constraints of both methods, they yield the desired results only under the specific circumstances. As an example, one major problem in FL is the difficulty of constructing the membership functions (MFs).Other problems such as architecture and local minima could also be located in ANN designing. Therefore, a new methodology is presented in this paper for grade estimation. This method which is based on ANN and FL is called "Coactive Neuro-Fuzzy Inference System" (CANFIS) which combines two approaches, ANN and FL. The combination of these two artificial intelligence approaches is achieved via the verbal and numerical power of intelligent systems. To improve the performance of this system, a Genetic Algorithm (GA) - as a well-known technique to solve the complex optimization problems - is also employed to optimize the network parameters including learning rate, momentum of the network and the number of MFs for each input. A comparison of these techniques (ANN, Adaptive Neuro-Fuzzy Inference System or ANFIS) with this new method (CANFIS-GA) is also carried out through a case study in Sungun copper deposit, located in East-Azerbaijan, Iran. The results show that CANFIS-GA could be a faster and more accurate alternative to the existing time-consuming methodologies for ore grade estimation and that is, therefore, suggested to be applied for grade estimation in similar problems.

A hybrid neural networks-fuzzy logic-genetic algorithm for grade estimation

PubMed Central

Tahmasebi, Pejman; Hezarkhani, Ardeshir

2012-01-01

The grade estimation is a quite important and money/time-consuming stage in a mine project, which is considered as a challenge for the geologists and mining engineers due to the structural complexities in mineral ore deposits. To overcome this problem, several artificial intelligence techniques such as Artificial Neural Networks (ANN) and Fuzzy Logic (FL) have recently been employed with various architectures and properties. However, due to the constraints of both methods, they yield the desired results only under the specific circumstances. As an example, one major problem in FL is the difficulty of constructing the membership functions (MFs).Other problems such as architecture and local minima could also be located in ANN designing. Therefore, a new methodology is presented in this paper for grade estimation. This method which is based on ANN and FL is called “Coactive Neuro-Fuzzy Inference System” (CANFIS) which combines two approaches, ANN and FL. The combination of these two artificial intelligence approaches is achieved via the verbal and numerical power of intelligent systems. To improve the performance of this system, a Genetic Algorithm (GA) – as a well-known technique to solve the complex optimization problems – is also employed to optimize the network parameters including learning rate, momentum of the network and the number of MFs for each input. A comparison of these techniques (ANN, Adaptive Neuro-Fuzzy Inference System or ANFIS) with this new method (CANFIS–GA) is also carried out through a case study in Sungun copper deposit, located in East-Azerbaijan, Iran. The results show that CANFIS–GA could be a faster and more accurate alternative to the existing time-consuming methodologies for ore grade estimation and that is, therefore, suggested to be applied for grade estimation in similar problems. PMID:25540468

Structure, mechanical, and frictional properties of hydrogenated fullerene-like amorphous carbon film prepared by direct current plasma enhanced chemical vapor deposition

NASA Astrophysics Data System (ADS)

Wang, Yongfu; Gao, Kaixiong; Zhang, Junyan

2016-07-01

In this study, fullerene like carbon (FL-C) is introduced in hydrogenated amorphous carbon (a-C:H) film by employing a direct current plasma enhanced chemical vapor deposition. The film has a low friction and wear, such as 0.011 and 2.3 × 10-9mm3/N m in the N2, and 0.014 and 8.4 × 10-8mm3/N m in the humid air, and high hardness and elasticity (25.8 GPa and 83.1%), to make further engineering applications in practice. It has several nanometers ordered domains consisting of less frequently cross-linked graphitic sheet stacks. We provide new evidences for understanding the reported Raman fit model involving four vibrational frequencies from five, six, and seven C-atom rings of FL-C structures, and discuss the structure evolution before or after friction according to the change in the 1200 cm-1 Raman band intensity caused by five- and seven-carbon rings. Friction inevitably facilitates the transformation of carbon into FL-C nanostructures, namely, the ultra low friction comes from both such structures within the carbon film and the sliding induced at friction interface.

An Ada/SQL (Structured Query Language) Application Scanner.

DTIC Science & Technology

1988-03-01

Digital ...8217 (" DIGITS "), 46 new STRING’ ("DO"), new STRING’ ("ELSE"), new STRING’ ("ELSIF"), new STRING’ ("END"), new STRING’ ("ENTRY"), new STRING’ ("EXCEPTION...INTEGERPRINT; generic type NUM is digits <>; package FLOATPRINT is package txtprts.ada 18 prcdr PR (FL inFL %YE LINE n LINTYPE UNCLASSIFIED procedure

Characteristics of multi-organ lymphangiectasia resulting from temporal deletion of calcitonin receptor-like receptor in adult mice.

PubMed

Hoopes, Samantha L; Willcockson, Helen H; Caron, Kathleen M

2012-01-01

Adrenomedullin (AM) and its receptor complexes, calcitonin receptor-like receptor (Calcrl) and receptor activity modifying protein 2/3, are highly expressed in lymphatic endothelial cells and are required for embryonic lymphatic development. To determine the role of Calcrl in adulthood, we used an inducible Cre-loxP system to temporally and ubiquitously delete Calcrl in adult mice. Following tamoxifen injection, Calcrl(fl/fl)/CAGGCre-ER™ mice rapidly developed corneal edema and inflammation that was preceded by and persistently associated with dilated corneoscleral lymphatics. Lacteals and submucosal lymphatic capillaries of the intestine were also dilated, while mesenteric collecting lymphatics failed to properly transport chyle after an acute Western Diet, culminating in chronic failure of Calcrl(fl/fl)/CAGGCre-ER™ mice to gain weight. Dermal lymphatic capillaries were also dilated and chronic edema challenge confirmed significant and prolonged dermal lymphatic insufficiency. In vivo and in vitro imaging of lymphatics with either genetic or pharmacologic inhibition of AM signaling revealed markedly disorganized lymphatic junctional proteins ZO-1 and VE-cadherin. The maintenance of AM signaling during adulthood is required for preserving normal lymphatic permeability and function. Collectively, these studies reveal a spectrum of lymphatic defects in adult Calcrl(fl/fl)/CAGGCre-ER™ mice that closely recapitulate the clinical symptoms of patients with corneal, intestinal and peripheral lymphangiectasia.

Bioengineered 2'-fucosyllactose and 3-fucosyllactose inhibit the adhesion of Pseudomonas aeruginosa and enteric pathogens to human intestinal and respiratory cell lines.

PubMed

Weichert, Stefan; Jennewein, Stefan; Hüfner, Eric; Weiss, Christel; Borkowski, Julia; Putze, Johannes; Schroten, Horst

2013-10-01

Human milk oligosaccharides help to prevent infectious diseases in breastfed infants. Larger scale testing, particularly in animal models and human clinical studies, is still limited due to shortened availability of more complex oligosaccharides. The purpose of this study was to evaluate 2'-fucosyllactose (2'-FL) and 3-fucosyllactose (3-FL) synthesized by whole-cell biocatalysis for their biological activity in vitro. Therefore, we have tested these oligosaccharides for their inhibitory potential of pathogen adhesion in two different human epithelial cell lines. 2'-FL could inhibit adhesion of Campylobacter jejuni, enteropathogenic Escherichia coli, Salmonella enterica serovar fyris, and Pseudomonas aeruginosa to the intestinal human cell line Caco-2 (reduction of 26%, 18%, 12%, and 17%, respectively), as could be shown for 3-FL (enteropathogenic E coli 29%, P aeruginosa 26%). Furthermore, adherence of P aeruginosa to the human respiratory epithelial cell line A549 was significantly inhibited by 2'-FL and 3-FL (reduction of 24% and 23%, respectively). These results confirm the biological and functional activity of biotechnologically synthesized human milk oligosaccharides. Mass-tailored human milk oligosaccharides could be used in the future to supplement infant formula ingredients or as preventatives to reduce the impact of infectious diseases. © 2013 Elsevier Inc. All rights reserved.

Detection of specific protein-protein interactions in nanocages by engineering bipartite FlAsH binding sites.

PubMed

Cornell, Thomas A; Fu, Jing; Newland, Stephanie H; Orner, Brendan P

2013-11-06

Proteins that form cage-like structures have been of much recent cross-disciplinary interest due to their application to bioconjugate and materials chemistry, their biological functions spanning multiple essential cellular processes, and their complex structure, often defined by highly symmetric protein–protein interactions. Thus, establishing the fundamentals of their formation, through detecting and quantifying important protein–protein interactions, could be crucial to understanding essential cellular machinery, and for further development of protein-based technologies. Herein we describe a method to monitor the assembly of protein cages by detecting specific, oligomerization state dependent, protein–protein interactions. Our strategy relies on engineering protein monomers to include cysteine pairs that are presented proximally if the cage state assembles. These assembled pairs of cysteines act as binding sites for the fluorescent reagent FlAsH, which, once bound, provides a readout for successful oligomerization. As a proof of principle, we applied this technique to the iron storage protein, DNA-binding protein from starved cells from E. coli. Several linker lengths and conformations for the presentation of the cysteine pairs were screened to optimize the engineered binding sites. We confirmed that our designs were successful in both lysates and with purified proteins, and that FlAsH binding was dependent upon cage assembly. Following successful characterization of the assay, its throughput was expanded. A two-dimension matrix of pH and denaturing buffer conditions was screened to optimize nanocage stability. We intend to use this method for the high throughput screening of protein cage libraries and of conditions for the generation of inorganic nanoparticles within the cavity of these and other cage proteins.

Expression of LAG-3 defines exhaustion of intratumoral PD-1+ T cells and correlates with poor outcome in follicular lymphoma

PubMed Central

Yang, Zhi-Zhang; Kim, Hyo Jin; Villasboas, Jose C.; Chen, Ya-Ping; Price-Troska, Tammy; Jalali, Shahrzad; Wilson, Mara; Novak, Anne J.; Ansell, Stephen M.

2017-01-01

Exhausted T-cells in follicular lymphoma (FL) typically express PD-1, but expression of PD-1 is not limited to exhausted cells. Although expected to be functionally suppressed, we found that the population of intratumoral PD-1+ T cells were predominantly responsible for production of cytokines and granules. This surprising finding prompted us to explore the involvement of LAG-3 to specifically identify functionally exhausted T cells. We found that LAG-3 was expressed on a subset of intratumoral T cells from FL and LAG-3+ T cells almost exclusively came from PD-1+ population. CyTOF analysis revealed that intratumoral LAG-3+ T cells were phenotypically heterogeneous as LAG-3 was expressed on a variety of T cell subsets. In contrast to PD-1+LAG-3- cells, intratumoral PD-1+LAG-3+ T cells exhibited reduced capacity to produce cytokines and granules. LAG-3 expression could be substantially upregulated on CD4+ or CD8+ T cells by IL-12, a cytokine that has been shown to induce T-cell exhaustion and be increased in the serum of lymphoma patients. Furthermore, we found that blockade of both PD-1 and LAG-3 signaling enhanced the function of intratumoral CD8+ T cells resulting in increased IFN-γ and IL-2 production. Clinically, LAG-3 expression on intratumoral T cells correlated with a poor outcome in FL patients. Taken together, we find that LAG-3 expression is necessary to identify the population of intratumoral PD-1+ T cells that are functionally exhausted and, in contrast, find that PD-1+LAG-3- T cells are simply activated cells that are immunologically functional. These findings may have important implications for immune checkpoint therapy in FL. PMID:28977875

Scaling of Primate Forearm Muscle Architecture as It Relates to Locomotion and Posture.

PubMed

Leischner, Carissa L; Crouch, Michael; Allen, Kari L; Marchi, Damiano; Pastor, Francisco; Hartstone-Rose, Adam

2018-03-01

It has been previously proposed that distal humerus morphology may reflect the locomotor pattern and substrate preferred by different primates. However, relationships between these behaviors and the morphological capabilities of muscles originating on these osteological structures have not been fully explored. Here, we present data about forearm muscle architecture in a sample of 44 primate species (N = 55 specimens): 9 strepsirrhines, 15 platyrrhines, and 20 catarrhines. The sample includes all major locomotor and substrate use groups. We isolated each antebrachial muscle and categorized them into functional groups: wrist and digital extensors and flexors, antebrachial mm. that do not cross the wrist, and functional combinations thereof. Muscle mass, physiological cross-sectional area (PCSA), reduced PCSA (RPCSA), and fiber length (FL) are examined in the context of higher taxonomic group, as well as locomotor/postural and substrate preferences. Results show that muscle masses, PCSA, and RPCSA scale with positive allometry while FL scales with isometry indicating that larger primates have relatively stronger, but neither faster nor more flexible, forearms across the sample. When accounting for variation in body size, we found no statistically significant difference in architecture among higher taxonomic groups or locomotor/postural groups. However, we found that arboreal primates have significantly greater FL than terrestrial ones, suggesting that these species are adapted for greater speed and/or flexibility in the trees. These data may affect our interpretation of the mechanisms for variation in humeral morphology and provide information for refining biomechanical models of joint stress and movement in extant and fossil primates. Anat Rec, 301:484-495, 2018. © 2018 Wiley Periodicals, Inc. © 2018 Wiley Periodicals, Inc.

A general approach for chemical labeling and rapid, spatially controlled protein inactivation

PubMed Central

Marks, Kevin M.; Braun, Patrick D.; Nolan, Garry P.

2004-01-01

Chemical labeling of proteins inside of living cells can enable studies of the location, movement, and function of proteins in vivo. Here we demonstrate an approach for chemical labeling of proteins that uses the high-affinity interaction between an FKBP12 mutant (F36V) and a synthetic, engineered ligand (SLF′). A fluorescein conjugate to the engineered ligand (FL-SLF′) retained binding to FKBP12(F36V) and possessed similar fluorescence properties as parental fluorescein. FL-SLF′ labeled FKBP12(F36V) fusion proteins in live mammalian cells, and was used to monitor the subcellular localization of a membrane targeted FKBP12(F36V) construct. Chemical labeling of FKBP12(F36V) fusion proteins with FL-SLF′ was readily detectable at low expression levels of the FKBP12(F36V) fusion, and the level of fluorescent staining with FL-SLF′ was proportional to the FKBP12(F36V) expression level. This FL-SLF′-FKBP12(F36V) labeling technique was tested in fluorophore assisted laser inactivation (FALI), a light-mediated technique to rapidly inactivate fluorophore-labeled target proteins. FL-SLF′ mediated FALI of a β-galactosidase-FKBP12(F36V) fusion protein, causing rapid inactivation of >90% of enzyme activity upon irradiation in vitro. FL-SLF′ also mediated FALI of a β-galactosidase fusion expressed in living NIH 3T3 cells, where β-galactosidase activity was reduced in 15 s. Thus, FL-SLF′ can be used to monitor proteins in vivo and to target rapid, spatially and temporally defined inactivation of target proteins in living cells in a process that we call FK-FALI. PMID:15218100

In vitro and in silico assessment of the structure-dependent binding of bisphenol analogues to glucocorticoid receptor.

PubMed

Zhang, Jie; Zhang, Tiehua; Guan, Tianzhu; Yu, Hansong; Li, Tiezhu

2017-03-01

Widespread use of bisphenol A (BPA) and other bisphenol analogues has attracted increasing attention for their potential adverse effects. As environmental endocrine-disrupting compounds (EDCs), bisphenols (BPs) may activate a variety of nuclear receptors, including glucocorticoid receptor (GR). In this work, the binding of 11 BPs to GR was investigated by fluorescence polarization (FP) assay in combination with molecular dynamics simulations. The human glucocorticoid receptor was prepared as a soluble recombinant protein. A fluorescein-labeled dexamethasone derivative (Dex-fl) was employed as tracer. Competitive displacement of Dex-fl from GR by BPs showed that the binding affinities of bisphenol analogues were largely dependent on their characteristic functional groups. In order to further understand the relationship between BPs structures and their GR-mediated activities, molecular docking was utilized to explore the binding modes at the atomic level. The results confirmed that structural variations of bisphenol analogues contributed to different interactions of BPs with GR, potentially causing distinct toxic effects. Comparison of the calculated binding energies vs. experimental binding affinities yielded a good correlation (R 2  = 0.8266), which might be helpful for the design of environmentally benign materials with reduced toxicities. In addition, the established FP assay based on GR exhibited the potential to offer an alternative to traditional methods for the detection of bisphenols.

Fascicles from energy-storing tendons show an age-specific response to cyclic fatigue loading

PubMed Central

Thorpe, Chavaunne T.; Riley, Graham P.; Birch, Helen L.; Clegg, Peter D.; Screen, Hazel R. C.

2014-01-01

Some tendons, such as the human Achilles and equine superficial digital flexor tendon (SDFT), act as energy stores, stretching and recoiling to increase efficiency during locomotion. Our previous observations of rotation in response to applied strain in SDFT fascicles suggest a helical structure, which may provide energy-storing tendons with a greater ability to extend and recoil efficiently. Despite this specialization, energy-storing tendons are prone to age-related tendinopathy. The aim of this study was to assess the effect of cyclic fatigue loading (FL) on the microstructural strain response of SDFT fascicles from young and old horses. The data demonstrate two independent age-related mechanisms of fatigue failure; in young horses, FL caused low levels of matrix damage and decreased rotation. This suggests that loading causes alterations to the helix substructure, which may reduce their ability to recoil and recover. By contrast, fascicles from old horses, in which the helix is already compromised, showed greater evidence of matrix damage and suffer increased fibre sliding after FL, which may partially explain the age-related increase in tendinopathy. Elucidation of helix structure and the precise alterations occurring owing to both ageing and FL will help to develop appropriate preventative and repair strategies for tendinopathy. PMID:24402919

Semantic Domains and Denotational Semantics

DTIC Science & Technology

1989-02-14

are continuous functions PL N -* PN FL :PN -PN such that IL 0 %FL = id and T1/L o IL -- id. Then the function RL (r,s) = TLo 4L represents the constant...would actually reduce the abstractness of denotations. The popularity of continuations seems to be partly due to the accompanying notational convenience...R.L ’ES.(~’ , r) s’)] ( rl (s))) (ext~ rl , _L R ,S’ E S). (g(r’, r2), ’]r( )) (S[Sile)(SIS1Je) S[ < S > =Ae E Env. fix(Ah R -, R. Ar E R. ext[As E S

Pretreatment Circulating Serum Cytokines Associated with Follicular and Diffuse Large B-Cell Lymphoma: A Clinic-Based Case-Control Study

PubMed Central

Charbonneau, Bridget; Maurer, Matthew J; Ansell, Stephen M; Slager, Susan L; Fredericksen, Zachary S; Ziesmer, Steven C; Macon, William R; Habermann, Thomas M; Witzig, Thomas E; Link, Brian K; Cerhan, James R; Novak, Anne J

2012-01-01

Background Abnormal immune function is a key factor in predisposition to non-Hodgkin lymphoma (NHL). We evaluated the association of 30 cytokines individually and as a profile with diffuse large B-cell (DLBCL) and follicular (FL) lymphomas. Methods We used a multiplexed assay to measure 30 cytokine concentrations in pre-treatment serum in a case-control study of 234 FL, 188 DLBCL, and 400 control participants. Unconditional logistic regression was used to estimate odds ratios (ORs) and 95% confidence intervals (CI) adjusted for age and sex, and polytomous regression was used to evaluate heterogeneity between FL and DLBCL. Principal components analysis (PCA) was used to assess cytokine profiles associated with FL and DLBCL. Results In single cytokine modeling, we found that 12 of the 30 circulating serum cytokines were significantly (P<0.05) associated with FL and/or DLBCL after accounting for multiple testing (q<0.05). Soluble IL-2R (sIL-2R) had the strongest association with both FL (OR=6.0 for highest versus lowest tertile, 95% CI 3.8–9.5; p-trend=1.8 × 10−21) and DLBCL (OR=7.6, 95% CI 4.5–13.1; p-trend=7.2 × 10−20). IL1RA and IL-12p40 also showed similar associations for DLBCL and FL. In contrast, HGF, MIG, and MIP-1α had a stronger association with DLBCL compared to FL, and IL-6, IL-8, IL-10, IFN-γ, IP-10, and VEGF were only statistically significantly associated with DLBCL after accounting for multiple testing. However, in PCA modeling, a cytokine profile based on sIL-2R, IL-1RA, MIG, IP-10, IL-8, and IL-12p40 explained most of the variability between controls and both FL and DLBCL. Conclusions We identified some single cytokines unique to DLBCL, but overall cytokine associations were more similar than distinct for DLBCL and FL. While these data are limited by concerns of reverse causality, they do suggest cytokines and cytokine profiles that can be prioritized in future studies. PMID:23010502

Morphological tuned preparation of zinc oxide: reduced graphene oxide composites for non-enzymatic fluorescence glucose sensing and enhanced photocatalysis

NASA Astrophysics Data System (ADS)

Sivalingam, Muthu Mariappan; Balasubramanian, Karthikeyan

2016-07-01

Zinc oxide: reduced graphene oxide (ZnO:rgo) composites with varying ZnO morphologies have been synthesized towards the application of non-enzymatic fluorescence (FL) glucose sensor and photocatalysis for methylene blue (MB) degradation. The phase structure of ZnO has confirmed by X-ray diffraction studies, and the band gap calculations were done by UV absorption spectra. Scanning electron microscope and Raman spectra revealed the morphological change and the vibrational studies of the prepared samples, respectively. The quenching of the FL emission band of ZnO:rgo composite sample confirmed the transfer of electrons from ZnO to rgo which inhibit the exciton recombination process. The non-enzymatic FL glucose sensing was carried out by the addition of dextrose glucose ( d-glucose) into the ZnO:rgo composite solution, which shows strong relationship between glucose concentration and the FL intensity. The photocatalytic studies showed that composite with high surface to volume ratio exhibits a maximum degradation of MB over 93 %. Our combined results ensured that the ZnO:rgo composites with varying morphologies could be an effective system for applications such as FL-based glucose sensing and photocatalytic degradation.

Base Structure Annex to Manpower Requirements Report for FY 1980

DTIC Science & Technology

1979-01-01

Printing and Reproduction Installation Safety Installation Engineering Service Related Investment"* Support Groups/Units assigned to these functions...c 04 o1 fn n a K~~~2 W U4u~ S -Ct ’- .dc w u .S . . . ...... - . ..l .. .AF) . ... .. . z -, IVf ’ N 1 j C0 ---- -K dl fl~ t. I . .Wz x A jt vd idz "oz...actions must beanalyzed to determine if any of the activities associated with the action will cause a significuant impact on the human environ-ment or

Toward a New Chemotherapy for Breast Cancer: Structural and Functional Mechanism of the Retinoid Receptors Addressed by a Novel Computer Approach

DTIC Science & Technology

2002-01-01

the surface of the receptor. This pocket is the target for several known and unknown coactivator proteins, which bind the LBD through a conserved LxxLL...was and to Not se FLKAILN) and the LBDs of several receptors (TRo was used as an example in prisingly, the LBD of TR13 was also found to interact with...receptors. 541 ATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCA The LBDs of several nuclear receptors were examined for FL. K. A • 1,...N

ReAsH/FlAsH labeling and image analysis of tetracysteine sensor proteins in cells.

PubMed

Irtegun, Sevgi; Ramdzan, Yasmin M; Mulhern, Terrence D; Hatters, Danny M

2011-08-31

Fluorescent proteins and dyes are essential tools for the study of protein trafficking, localization and function in cells. While fluorescent proteins such as green fluorescence protein (GFP) have been extensively used as fusion partners to proteins to track the properties of a protein of interest, recent developments with smaller tags enable new functionalities of proteins to be examined in cells such as conformational change and protein-association. One small tag system involves a tetracysteine motif (CCXXCC) genetically inserted into a target protein, which binds to biarsenical dyes, ReAsH (red fluorescent) and FlAsH (green fluorescent), with high specificity even in live cells. The TC/biarsenical dye system offers far less steric constraints to the host protein than fluorescent proteins which has enabled several new approaches to measure conformational change and protein-protein interactions. We recently developed a novel application of TC tags as sensors of oligomerization in cells expressing mutant huntingtin, which when mutated aggregates in neurons in Huntington disease. Huntingtin was tagged with two fluorescent dyes, one a fluorescent protein to track protein location, and the second a TC tag which only binds biarsenical dyes in monomers. Hence, changes in colocalization between protein and biarsenical dye reactivity enabled submicroscopic oligomer content to be spatially mapped within cells. Here, we describe how to label TC-tagged proteins fused to a fluorescent protein (Cherry, GFP or CFP) with FlAsH or ReAsH in live mammalian cells and how to quantify the two color fluorescence (Cherry/FlAsH, CFP/FlAsH or GFP/ReAsH combinations).

A randomized clinical trial of theory-based activities for the behavioral symptoms of dementia in nursing home residents.

PubMed

Kolanowski, Ann; Litaker, Mark; Buettner, Lin; Moeller, Joyel; Costa, Paul T

2011-06-01

To test the main and interactive effects of activities derived from the Need-Driven Dementia-Compromised Behavior model for responding to behavioral symptoms in nursing home residents. Randomized double-blind clinical trial. Nine community-based nursing homes. One hundred twenty-eight cognitively impaired residents randomly assigned to activities adjusted to functional level (FL) (n=32), personality style of interest (PSI) (n=33), functional level and personality style of interest (FL+PSI) (n=31), or active control (AC) (n=32). Three weeks of activities provided twice daily. Agitation, passivity, engagement, affect, and mood assessed from video recordings and real-time observations during baseline, intervention, random times outside of intervention, and 1 week after intervention. All treatments improved outcomes during intervention except mood, which worsened under AC. During intervention the PSI group demonstrated greater engagement, alertness, and attention than the other groups; the FL+PSI group demonstrated greater pleasure. During random times, engagement returned to baseline levels except in the FL group in which it decreased. There was also less agitation and passivity in groups with a component adjusted to PSI. One week after the intervention, mood, anxiety, and passivity improved over baseline; significantly less pleasure was displayed after withdrawal of treatment. The hypothesis that activities adjusted to FL+PSI would improve behavioral outcomes to a greater extent than partially adjusted or nonadjusted activities was partially supported. PSI is a critical component of individualized activity prescription. © 2011, Copyright the Authors. Journal compilation © 2011, The American Geriatrics Society.

Metabolic demands of neural-hemodynamic associated and disassociated areas in brain.

PubMed

Sanganahalli, Basavaraju G; Herman, Peter; Rothman, Douglas L; Blumenfeld, Hal; Hyder, Fahmeed

2016-10-01

Interpretation of regional blood oxygenation level-dependent (BOLD) responses in functional magnetic resonance imaging (fMRI) is contingent on whether local field potential (LFP) and multi-unit activity (MUA) is either dissociated or associated. To examine whether neural-hemodynamic associated and dissociated areas have different metabolic demands, we recorded sensory-evoked responses of BOLD signal, blood flow (CBF), and blood volume (CBV), which with calibrated fMRI provided oxidative metabolism (CMR O2 ) from rat's ventral posterolateral thalamic nucleus (VPL) and somatosensory forelimb cortex (S1 FL ) and compared these neuroimaging signals to neurophysiological recordings. MUA faithfully recorded evoked latency differences between VPL and S1 FL because evoked MUA in these regions were similar in magnitude. Since evoked LFP was significantly attenuated in VPL, we extracted the time courses of the weaker thalamic LFP to compare with the stronger cortical LFP using wavelet transform. BOLD and CBV responses were greater in S1 FL than in VPL, similar to LFP regional differences. CBF and CMR O2 responses were both comparably larger in S1 FL and VPL. Despite different levels of CBF-CMR O2 and LFP-MUA couplings in VPL and S1 FL , the CMR O2 was well matched with MUA in both regions. These results suggest that neural-hemodynamic associated and dissociated areas in VPL and S1 FL can have similar metabolic demands. © The Author(s) 2016.

E2fl1 is a meiosis-specific transcription factor in the protist Tetrahymena thermophila

PubMed Central

Zhang, Jing; Tian, Miao; Miao, Wei

2017-01-01

ABSTRACT Members of the E2F family of transcription factors have been reported to regulate the expression of genes involved in cell cycle control, DNA replication, and DNA repair in multicellular eukaryotes. Here, E2FL1, a meiosis-specific E2F transcription factor gene, was identified in the model ciliate Tetrahymena thermophila. Loss of this gene resulted in meiotic arrest prior to anaphase I. The cytological experiments revealed that the meiotic homologous pairing was not affected in the absence of E2FL1, but the paired homologous chromosomes did not separate and assumed a peculiar tandem arrangement. This is the first time that an E2F family member has been shown to regulate meiotic events. Moreover, BrdU incorporation showed that DSB processing during meiosis was abnormal upon the deletion of E2FL1. Transcriptome sequencing analysis revealed that E2FL1 knockout decreased the expression of genes involved in DNA replication and DNA repair in T. thermophila, suggesting that the function of E2F is highly conserved in eukaryotes. In addition, E2FL1 deletion inhibited the expression of related homologous chromosome segregation genes in T. thermophila. The result may explain the meiotic arrest phenotype at anaphase I. Finally, by searching for E2F DNA-binding motifs in the entire T. thermophila genome, we identified 714 genes containing at least one E2F DNA-binding motif; of these, 235 downregulated represent putative E2FL1 target genes. PMID:27892792

An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

PubMed

Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

2011-01-01

cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

Skeletal Muscle-specific G Protein-coupled Receptor Kinase 2 Ablation Alters Isolated Skeletal Muscle Mechanics and Enhances Clenbuterol-stimulated Hypertrophy.

PubMed

Woodall, Benjamin P; Woodall, Meryl C; Luongo, Timothy S; Grisanti, Laurel A; Tilley, Douglas G; Elrod, John W; Koch, Walter J

2016-10-14

GRK2, a G protein-coupled receptor kinase, plays a critical role in cardiac physiology. Adrenergic receptors are the primary target for GRK2 activity in the heart; phosphorylation by GRK2 leads to desensitization of these receptors. As such, levels of GRK2 activity in the heart directly correlate with cardiac contractile function. Furthermore, increased expression of GRK2 after cardiac insult exacerbates injury and speeds progression to heart failure. Despite the importance of this kinase in both the physiology and pathophysiology of the heart, relatively little is known about the role of GRK2 in skeletal muscle function and disease. In this study we generated a novel skeletal muscle-specific GRK2 knock-out (KO) mouse (MLC-Cre:GRK2 fl/fl ) to gain a better understanding of the role of GRK2 in skeletal muscle physiology. In isolated muscle mechanics testing, GRK2 ablation caused a significant decrease in the specific force of contraction of the fast-twitch extensor digitorum longus muscle yet had no effect on the slow-twitch soleus muscle. Despite these effects in isolated muscle, exercise capacity was not altered in MLC-Cre:GRK2 fl/fl mice compared with wild-type controls. Skeletal muscle hypertrophy stimulated by clenbuterol, a β 2 -adrenergic receptor (β 2 AR) agonist, was significantly enhanced in MLC-Cre:GRK2 fl/fl mice; mechanistically, this seems to be due to increased clenbuterol-stimulated pro-hypertrophic Akt signaling in the GRK2 KO skeletal muscle. In summary, our study provides the first insights into the role of GRK2 in skeletal muscle physiology and points to a role for GRK2 as a modulator of contractile properties in skeletal muscle as well as β 2 AR-induced hypertrophy. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Proteome profiling reveals regional protein alteration in cerebrum of common marmoset (Callithrix jacchus) exposed to methylmercury.

PubMed

Shao, Yueting; Yamamoto, Megumi; Figeys, Daniel; Ning, Zhibin; Chan, Hing Man

2016-03-10

Methylmercury (MeHg) is known to selectively damage the calcarine and precentral cortices along deep sulci and fissures in adult cases, but the detailed mechanism is still unclear. This study aims to identify and analyze the differential proteome expression in two regions of the cerebrum (the frontal lobe and the occipital lobe including the calcarine sulcus) of the common marmoset exposed to MeHg using a shot-gun proteomic approach. A total of 1045 and 1062 proteins were identified in the frontal lobe (FL) and occipital lobe (OL), of which, 62 and 89 proteins were found significantly changed with MeHg exposure. Functional enrichment/depletion analysis showed that the lipid metabolic process and proteolysis were affected in both two lobes. Functional changes in FL were characterized in cell cycle and cell division, sulfur compound metabolic process, microtubule-based process and glycerolipid metabolic process. In comparison, proteins were enriched in the functions of transport, carbohydrate metabolic process, chemical caused homeostasis and regulation of body fluid levels in OL. Pathway analysis predicted that vasopressin-regulated water reabsorption was disturbed in MeHg-treated FL. Our results showed that MeHg induced regional specific protein changes in FL and OL but with similar endpoint effects such as energy diminish and disruption of water transport. APOE and GPX1 were shown to be possible key proteins targeted by MeHg leading to multiple functional changes in OL. This is the first report of the whole proteome changes of primate cerebrum for MeHg neurotoxicity, and the results will contribute to the understanding of molecular basis of MeHg intoxication in humans. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Fractionalized Fermi liquids and exotic superconductivity in the Kitaev-Kondo lattice

NASA Astrophysics Data System (ADS)

Seifert, Urban F. P.; Meng, Tobias; Vojta, Matthias

2018-02-01

Fractionalized Fermi liquids (FL*) have been introduced as non-Fermi-liquid metallic phases, characterized by coexisting electron-like charge carriers and local moments which form a fractionalized spin liquid. Here we investigate a Kondo lattice model on the honeycomb lattice with Kitaev interactions among the local moments, a concrete model hosting FL* phases based on Kitaev's Z2 spin liquid. We characterize the FL* phases via perturbation theory, and we employ a Majorana-fermion mean-field theory to map out the full phase diagram. Most remarkably we find nematic triplet superconducting phases which mask the quantum phase transition between fractionalized and conventional Fermi liquid phases. Their pairing structure is inherited from the Kitaev spin liquid; i.e., superconductivity is driven by Majorana glue.

Quantitative fluorescence loss in photobleaching for analysis of protein transport and aggregation

PubMed Central

2012-01-01

Background Fluorescence loss in photobleaching (FLIP) is a widely used imaging technique, which provides information about protein dynamics in various cellular regions. In FLIP, a small cellular region is repeatedly illuminated by an intense laser pulse, while images are taken with reduced laser power with a time lag between the bleaches. Despite its popularity, tools are lacking for quantitative analysis of FLIP experiments. Typically, the user defines regions of interest (ROIs) for further analysis which is subjective and does not allow for comparing different cells and experimental settings. Results We present two complementary methods to detect and quantify protein transport and aggregation in living cells from FLIP image series. In the first approach, a stretched exponential (StrExp) function is fitted to fluorescence loss (FL) inside and outside the bleached region. We show by reaction–diffusion simulations, that the StrExp function can describe both, binding/barrier–limited and diffusion-limited FL kinetics. By pixel-wise regression of that function to FL kinetics of enhanced green fluorescent protein (eGFP), we determined in a user-unbiased manner from which cellular regions eGFP can be replenished in the bleached area. Spatial variation in the parameters calculated from the StrExp function allow for detecting diffusion barriers for eGFP in the nucleus and cytoplasm of living cells. Polyglutamine (polyQ) disease proteins like mutant huntingtin (mtHtt) can form large aggregates called inclusion bodies (IB’s). The second method combines single particle tracking with multi-compartment modelling of FL kinetics in moving IB’s to determine exchange rates of eGFP-tagged mtHtt protein (eGFP-mtHtt) between aggregates and the cytoplasm. This method is self-calibrating since it relates the FL inside and outside the bleached regions. It makes it therefore possible to compare release kinetics of eGFP-mtHtt between different cells and experiments. Conclusions We present two complementary methods for quantitative analysis of FLIP experiments in living cells. They provide spatial maps of exchange dynamics and absolute binding parameters of fluorescent molecules to moving intracellular entities, respectively. Our methods should be of great value for quantitative studies of intracellular transport. PMID:23148417

F-16 Instructional System Design Alternatives.

DTIC Science & Technology

1981-03-01

inservice training 1-15 Subsystem: Supply maintenance Function: FL 4.8 Perform supply maintenance FL...000 0 F-16 AIRCREW TRAINING DEVELOPMENT PROJECT Contract No. F02604-79-C8875 DTIC ELECTE:, .JUNO 8 1981 K2>)F-i6 JSTRUCTIONAL_.YSTEM" P§ __SIGN AL ER TI...8217’’’ ’ " -... . .... . .. ..-- , .. , ... 4:-... <" ’’’’- " - . . . .. -,-: - PREFACE This report was created for the F-16 Aircrew Training De- velopment Project contract

Expanded explorations into the optimization of an energy function for protein design

PubMed Central

Huang, Yao-ming; Bystroff, Christopher

2014-01-01

Nature possesses a secret formula for the energy as a function of the structure of a protein. In protein design, approximations are made to both the structural representation of the molecule and to the form of the energy equation, such that the existence of a general energy function for proteins is by no means guaranteed. Here we present new insights towards the application of machine learning to the problem of finding a general energy function for protein design. Machine learning requires the definition of an objective function, which carries with it the implied definition of success in protein design. We explored four functions, consisting of two functional forms, each with two criteria for success. Optimization was carried out by a Monte Carlo search through the space of all variable parameters. Cross-validation of the optimized energy function against a test set gave significantly different results depending on the choice of objective function, pointing to relative correctness of the built-in assumptions. Novel energy cross-terms correct for the observed non-additivity of energy terms and an imbalance in the distribution of predicted amino acids. This paper expands on the work presented at ACM-BCB, Orlando FL , October 2012. PMID:24384706

77 FR 42425 - Amendment of Air Traffic Service (ATS) Routes in the Vicinity of Vero Beach, FL

Federal Register 2010, 2011, 2012, 2013, 2014

2012-07-19

... Orlando, FL, 140[deg] radials; Orlando; Ocala, FL; Cross City, FL; Greenville, FL; Pecan, GA; Eufaula, AL... Virginia Key 014[deg] and Treasure, FL, 143[deg] radials; Treasure; INT Treasure 296[deg] and Orlando, FL, 162[deg] radials; Orlando; Ocala, FL; Cross City, FL; to Seminole, FL. The portion outside the United...

Scaling relations and the fundamental line of the local group dwarf galaxies

NASA Astrophysics Data System (ADS)

Woo, Joanna; Courteau, Stéphane; Dekel, Avishai

2008-11-01

We study the scaling relations between global properties of dwarf galaxies in the local group. In addition to quantifying the correlations between pairs of variables, we explore the `shape' of the distribution of galaxies in log parameter space using standardized principal component analysis, the analysis is performed first in the 3D structural parameter space of stellar mass M*, internal velocity V and characteristic radius R* (or surface brightness μ*). It is then extended to a 4D space that includes a stellar population parameter such as metallicity Z or star formation rate . We find that the local group dwarfs basically define a one-parameter `fundamental line' (FL), primarily driven by stellar mass, M*. A more detailed inspection reveals differences between the star formation properties of dwarf irregulars (dI's) and dwarf ellipticals (dE's), beyond the tendency of the latter to be more massive. In particular, the metallicities of dI's are typically lower by a factor of 3 at a given M* and they grow faster with increasing M*, showing a tighter FL in the 4D space for the dE's. The structural scaling relations of dI's resemble those of the more massive spirals, but the dI's have lower star formation rates for a given M* which also grow faster with increasing M*. On the other hand, the FL of the dE's departs from the fundamental plane of bigger ellipticals. While the one-parameter nature of the FL and the associated slopes of the scaling relations are consistent with the general predictions of supernova feedback from Dekel & Woo, the differences between the FL's of the dE's and the dI's remain a challenge and should serve as a guide for the secondary physical processes responsible for these two types.

New cardioprotective agent flokalin and its supramolecular complexes with target amino acids: An integrated mass-spectrometry and quantum-chemical study

NASA Astrophysics Data System (ADS)

Pashynska, Vlada; Stepanian, Stepan; Gömöry, Ágnes; Vékey, Károly; Adamowicz, Ludwik

2017-10-01

This study is devoted to examining the molecular structure and molecular mechanisms of action of the recently developed cardioprotective agent flokalin (Fl), a fluorine containing analogue of pinacidil, which is known as an activator of ATP sensitive potassium membrane channels. A combined experimental and computational investigation of flokalin and its biologically relevant supramolecular complexes with selected amino acids involved in KATP-channels proteins is performed by electrospray ionization mass spectrometry (ESI MS) and by B3LYP/aug-cc-pVDZ quantum-mechanical calculations. First Fl solution is probed by ESI MS and a characteristic mass spectrum of the agent is obtained. Next the intermolecular interactions of Fl with the potentially targeted aminoacids (AA), Lys and Thr, are experimentally investigated. The spectra of the model Fl:AA systems (in 1:1 M ratio) contain information on the ions characteristic to the individual components of the mixtures; though the most interesting spectral results from the biophysical view point are related to the ions of stable molecular clusters formed by flokalin with AA. The peaks of such ions are quite prominent in the spectrum for the Fl:Lys system and less prominent for Fl:Thr. The equilibrium geometries and the corresponding interaction energies of the noncovalent supramolecular complexes registered in the mass spectra are determined in the quantum chemical calculations. The formation of the stable noncovalent complexes of Fl with Lyz and Thr revealed by the ESI MS probing and by the theoretical modelling testify to a possibility of interaction of flokalin with the KATP-channel domains enriched with the two amino acids in biological systems.

Biological properties of purified recombinant HCV particles with an epitope-tagged envelope

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takahashi, Hitoshi; Akazawa, Daisuke; Toray Industries, Inc., Kanagawa

2010-05-14

To establish a simple system for purification of recombinant infectious hepatitis C virus (HCV) particles, we designed a chimeric J6/JFH-1 virus with a FLAG (FL)-epitope-tagged sequence at the N-terminal region of the E2 hypervariable region-1 (HVR1) gene (J6/JFH-1/1FL). We found that introduction of an adaptive mutation at the potential N-glycosylation site (E2N151K) leads to efficient production of the chimeric virus. This finding suggests the involvement of glycosylation at Asn within the envelope protein(s) in HCV morphogenesis. To further analyze the biological properties of the purified recombinant HCV particles, we developed a strategy for large-scale production and purification of recombinant J6/JFH-1/1FL/E2N151K.more » Infectious particles were purified from the culture medium of J6/JFH-1/1FL/E2N151K-infected Huh-7 cells using anti-FLAG affinity chromatography in combination with ultrafiltration. Electron microscopy of the purified particles using negative staining showed spherical particle structures with a diameter of 40-60 nm and spike-like projections. Purified HCV particle-immunization induced both an anti-E2 and an anti-FLAG antibody response in immunized mice. This strategy may contribute to future detailed analysis of HCV particle structure and to HCV vaccine development.« less

Functional characterization of the NhaA Na+/H+ antiporter from the green picoalga Ostreococcus tauri.

PubMed

Dawut, Keatisuda; Sirisattha, Sophon; Hibino, Takashi; Kageyama, Hakuto; Waditee-Sirisattha, Rungaroon

2018-07-01

Transmembrane ion transport is a critical process in the cellular response to salt stress. Among the known functional membrane transporters that are involved in the salt stress response, Na + /H + antiporters have been extensively studied. These ubiquitous membrane proteins are crucial for salt tolerance and are associated with the regulation of internal pH, cell volume, morphogenesis, and vesicular trafficking. Molecular and functional analyses of Na + /H + antiporters have been characterized among taxa but little is known about algal Na + /H + antiporters. Here, we analyzed putative Na + /H + antiporters from the complete genome sequence of the marine picoalga Ostreococcus tauri. At least 10 putative Na + /H + antiporters belonging to the SOS1, NHX, and KEA/Kef families were found. Surprisingly, a bacterial type NhaA sequence (OtNhaA) was also found. Topological modeling of OtNhaA predicted 12 possible transmembrane segments with a long N-terminus. The full-length (FL_OtNhaA) and N-terminal truncated (ΔN112_OtNhaA) versions of OtNhaA were constructed, expressed in the salt-sensitive mutant Escherichia coli TO114, and functionally characterized. Complementation analysis revealed that FL_OtNhaA- and ΔN112_OtNhaA-expressing cells exhibited increased tolerance to high NaCl concentrations up to 700 mM. Antiporter activity assays showed that both FL_OtNhaA and ΔN112_OtNhaA proteins predominantly exhibited Na + /H + and Ca 2+ /H + antiporter activities at alkaline pH conditions. Intriguingly, the ΔN112_OtNhaA exhibited higher Na + /H + and Ca 2+ /H + antiporter activities compared to FL_OtNhaA. Kinetic analysis revealed that FL_OtNhaA has a high affinity for Na + and Ca 2+ ions with a K m of 1.1 ± 0.23 mM for Na + (at pH 8.5) and a K m of 0.3 ± 0.07 mM for Ca 2+ (at pH 8.5). Since NhaA has shown striking diversity among taxa, our results provide insight into the functional properties of the algal NhaA Na + /H + antiporter. These results will contribute to the understanding of Na + /H + antiporters that have various implications in all kingdoms of life. Copyright © 2018 Elsevier Inc. All rights reserved.

Chronic Ankle Instability and Corticomotor Excitability of the Fibularis Longus Muscle

PubMed Central

Pietrosimone, Brian G.; Gribble, Phillip A.

2012-01-01

Context Neuromuscular deficits are common in people with chronic ankle instability (CAI). Corticomotor pathways are very influential in the production of voluntary muscle function, yet these pathways have not been evaluated in people with CAI. Objective To determine if corticomotor excitability of the fibularis longus (FL) differs between individuals with unilateral CAI and matched control participants without CAI. Design Case-control study. Setting Laboratory. Patients or Other Participants Ten people with CAI (4 men, 6 women; age = 21.2 ± 1.23 years, height = 175.13 ± 9.7 cm, mass = 77.1 ± 13.58 kg) and 10 people without CAI (4 men, 6 women; age = 21.2 ± 2.3 years; height = 172.34 ± 8.86 cm, mass = 73.4 ± 7.15 kg) volunteered for this study. Main Outcome Measure(s) Transcranial magnetic stimulation was performed over the motor cortex on neurons corresponding with the FL. All testing was performed with the participant in a seated position with a slightly flexed knee joint and the ankle secured in 10° of plantar flexion. The resting motor threshold (RMT), which was expressed as a percentage of 2 T, was considered the lowest amount of magnetic energy that would induce an FL motor evoked potential equal to or greater than 20 μV, as measured with surface electromyography, on 7 consecutive stimuli. In addition, the Functional Ankle Disability Index (FADI) and FADI Sport were used to assess self-reported function. Results Higher RMTs were found in the injured and uninjured FL of the CAI group (60.8% ± 8.4% and 59.1% ± 8.99%, respectively) than the healthy group (52.8% ± 8.56% and 52% ± 7.0%, respectively; F1,18 = 4.92, P = .04). No leg × group interactions (F1,18 = 0.1, P = .76) or between-legs differences (F1,18 = 0.74, P = .40) were found. A moderate negative correlation was found between RMT and FADI (r = −0.4, P = .04) and FADI Sport (r = −0.44, P = .03), suggesting that higher RMT is related to lower self-reported function. Conclusions Higher bilateral RMTs may indicate deficits in FL corticomotor excitability in people with CAI. In addition, a moderate correlation between RMT and FADI suggests that cortical excitability deficits may be influential in altering function. PMID:23182009

Chronic ankle instability and corticomotor excitability of the fibularis longus muscle.

PubMed

Pietrosimone, Brian G; Gribble, Phillip A

2012-01-01

Neuromuscular deficits are common in people with chronic ankle instability (CAI). Corticomotor pathways are very influential in the production of voluntary muscle function, yet these pathways have not been evaluated in people with CAI. To determine if corticomotor excitability of the fibularis longus (FL) differs between individuals with unilateral CAI and matched control participants without CAI. Case-control study. Laboratory. Patients or Other Participants: Ten people with CAI (4 men, 6 women; age = 21.2 ± 1.23 years, height = 175.13 ± 9.7 cm, mass = 77.1 ± 13.58 kg) and 10 people without CAI (4 men, ± women; age = 21.2 ± 2.3 years; height = 172.34 ± 8.86 cm, mass = 73.4 ± 7.15 kg) volunteered for this study. Transcranial magnetic stimulation was performed over the motor cortex on neurons corresponding with the FL. All testing was performed with the participant in a seated position with a slightly flexed knee joint and the ankle secured in 10 8 of plantar flexion. The resting motor threshold (RMT), which was expressed as a percentage of 2 T, was considered the lowest amount of magnetic energy that would induce an FL motor evoked potential equal to or greater than 20 l V, as measured with surface electromyography, on 7 consecutive stimuli. In addition, the Functional Ankle Disability Index (FADI) and FADI Sport were used to assess self-reported function. Higher RMTs were found in the injured and uninjured FL of the CAI group (60.8% ± 8.4% and 59.1% ± 8.99%, respectively) than the healthy group (52.8% ± 8.56% and 52% ± 7.0%, respectively; F(1,18) = 4.92, P = .04). No leg x group interactions (F(1,18) = 0.1, P = .76) or between-legs differences (F(1,18) = 0.74, P = .40) were found. A moderate negative correlation was found between RMT and FADI (r = 0.4, P = .04) and FADI Sport (r = 0.44, P = .03), suggesting that higher RMT is related to lower self-reported function. Higher bilateral RMTs may indicate deficits in FL corticomotor excitability in people with CAI. In addition, a moderate correlation between RMT and FADI suggests that cortical excitability deficits may be influential in altering function.

Damage evaluation in graphene underlying atomic layer deposition dielectrics

PubMed Central

Tang, Xiaohui; Reckinger, Nicolas; Poncelet, Olivier; Louette, Pierre; Ureña, Ferran; Idrissi, Hosni; Turner, Stuart; Cabosart, Damien; Colomer, Jean-François; Raskin, Jean-Pierre; Hackens, Benoit; Francis, Laurent A.

2015-01-01

Based on micro-Raman spectroscopy (μRS) and X-ray photoelectron spectroscopy (XPS), we study the structural damage incurred in monolayer (1L) and few-layer (FL) graphene subjected to atomic-layer deposition of HfO2 and Al2O3 upon different oxygen plasma power levels. We evaluate the damage level and the influence of the HfO2 thickness on graphene. The results indicate that in the case of Al2O3/graphene, whether 1L or FL graphene is strongly damaged under our process conditions. For the case of HfO2/graphene, μRS analysis clearly shows that FL graphene is less disordered than 1L graphene. In addition, the damage levels in FL graphene decrease with the number of layers. Moreover, the FL graphene damage is inversely proportional to the thickness of HfO2 film. Particularly, the bottom layer of twisted bilayer (t-2L) has the salient features of 1L graphene. Therefore, FL graphene allows for controlling/limiting the degree of defect during the PE-ALD HfO2 of dielectrics and could be a good starting material for building field effect transistors, sensors, touch screens and solar cells. Besides, the formation of Hf-C bonds may favor growing high-quality and uniform-coverage dielectric. HfO2 could be a suitable high-K gate dielectric with a scaling capability down to sub-5-nm for graphene-based transistors. PMID:26311131

Acquired platelet function defect

MedlinePlus

... Some cases cannot be prevented. Alternative Names Acquired qualitative platelet disorders; Acquired disorders of platelet function Images ... Todd Gersten, MD, Hematology/Oncology, Florida Cancer Specialists & Research Institute, Wellington, FL. Review provided by VeriMed Healthcare ...

Hepatic Adaptation Compensates Inactivation of Intestinal Arginine Biosynthesis in Suckling Mice

PubMed Central

Marion, Vincent; Sankaranarayanan, Selvakumari; de Theije, Chiel; van Dijk, Paul; Hakvoort, Theo B. M.; Lamers, Wouter H.; Köhler, Eleonore S.

2013-01-01

Suckling mammals, including mice, differ from adults in the abundant expression of enzymes that synthesize arginine from citrulline in their enterocytes. To investigate the importance of the small-intestinal arginine synthesis for whole-body arginine production in suckling mice, we floxed exon 13 of the argininosuccinate synthetase (Ass) gene, which codes for a key enzyme in arginine biosynthesis, and specifically and completely ablated Ass in enterocytes by crossing Ass fl and Villin-Cre mice. Unexpectedly, Ass fl/fl /VilCre tg/- mice showed no developmental impairments. Amino-acid fluxes across the intestine, liver, and kidneys were calculated after determining the blood flow in the portal vein, and hepatic and renal arteries (86%, 14%, and 33%, respectively, of the transhepatic blood flow in 14-day-old mice). Relative to control mice, citrulline production in the splanchnic region of Ass fl/fl /VilCre tg/- mice doubled, while arginine production was abolished. Furthermore, the net production of arginine and most other amino acids in the liver of suckling control mice declined to naught or even changed to consumption in Ass fl/fl /VilCre tg/- mice, and had, thus, become remarkably similar to that of post-weaning wild-type mice, which no longer express arginine-biosynthesizing enzymes in their small intestine. The adaptive changes in liver function were accompanied by an increased expression of genes involved in arginine metabolism (Asl, Got1, Gpt2, Glud1, Arg1, and Arg2) and transport (Slc25a13, Slc25a15, and Slc3a2), whereas no such changes were found in the intestine. Our findings suggest that the genetic premature deletion of arginine synthesis in enterocytes causes a premature induction of the post-weaning pattern of amino-acid metabolism in the liver. PMID:23785515

p53 Enables metabolic fitness and self-renewal of nephron progenitor cells.

PubMed

Li, Yuwen; Liu, Jiao; Li, Wencheng; Brown, Aaron; Baddoo, Melody; Li, Marilyn; Carroll, Thomas; Oxburgh, Leif; Feng, Yumei; Saifudeen, Zubaida

2015-04-01

Contrary to its classic role in restraining cell proliferation, we demonstrate here a divergent function of p53 in the maintenance of self-renewal of the nephron progenitor pool in the embryonic mouse kidney. Nephron endowment is regulated by progenitor availability and differentiation potential. Conditional deletion of p53 in nephron progenitor cells (Six2Cre(+);p53(fl/fl)) induces progressive depletion of Cited1(+)/Six2(+) self-renewing progenitors and loss of cap mesenchyme (CM) integrity. The Six2(p53-null) CM is disorganized, with interspersed stromal cells and an absence of a distinct CM-epithelia and CM-stroma interface. Impaired cell adhesion and epithelialization are indicated by decreased E-cadherin and NCAM expression and by ineffective differentiation in response to Wnt induction. The Six2Cre(+);p53(fl/fl) cap has 30% fewer Six2(GFP(+)) cells. Apoptotic index is unchanged, whereas proliferation index is significantly reduced in accordance with cell cycle analysis showing disproportionately fewer Six2Cre(+);p53(fl/fl) cells in the S and G2/M phases compared with Six2Cre(+);p53(+/+) cells. Mutant kidneys are hypoplastic with fewer generations of nascent nephrons. A significant increase in mean arterial pressure is observed in early adulthood in both germline and conditional Six2(p53-null) mice, linking p53-mediated defects in kidney development to hypertension. RNA-Seq analyses of FACS-isolated wild-type and Six2(GFP(+)) CM cells revealed that the top downregulated genes in Six2Cre(+);p53(fl/fl) CM belong to glucose metabolism and adhesion and/or migration pathways. Mutant cells exhibit a ∼ 50% decrease in ATP levels and a 30% decrease in levels of reactive oxygen species, indicating energy metabolism dysfunction. In summary, our data indicate a novel role for p53 in enabling the metabolic fitness and self-renewal of nephron progenitors. © 2015. Published by The Company of Biologists Ltd.

Rapid Estimation of Astaxanthin and the Carotenoid-to-Chlorophyll Ratio in the Green Microalga Chromochloris zofingiensis Using Flow Cytometry.

PubMed

Chen, Junhui; Wei, Dong; Pohnert, Georg

2017-07-19

The green microalga Chromochloris zofingiensis can accumulate significant amounts of valuable carotenoids, mainly natural astaxanthin, a product with applications in functional food, cosmetics, nutraceuticals, and with potential therapeutic value in cardiovascular and neurological diseases. To optimize the production of astaxanthin, it is essential to monitor the content of astaxanthin in algal cells during cultivation. The widely used HPLC (high-performance liquid chromatography) method for quantitative astaxanthin determination is time-consuming and laborious. In the present work, we present a method using flow cytometry (FCM) for in vivo determination of the astaxanthin content and the carotenoid-to-chlorophyll ratio (Car/Chl) in mixotrophic C. zofingiensis . The method is based on the assessment of fluorescent characteristics of cellular pigments. The mean fluorescence intensity (MFI) of living cells was determined by FCM to monitor pigment formation based on the correlation between MFI detected in particular channels (FL1: 533 ± 15 nm; FL2: 585 ± 20 nm; FL3: >670 nm) and pigment content in algal cells. Through correlation and regression analysis, a linear relationship was observed between MFI in FL2 (band-pass filter, emission at 585 nm in FCM) and astaxanthin content (in HPLC) and applied for predicting astaxanthin content. With similar procedures, the relationships between MFI in different channels and Car/Chl ratio in mixotrophic C. zofingiensis were also determined. Car/Chl ratios could be estimated by the ratios of MFI (FL1/FL3, FL2/FL3). FCM is thus a highly efficient and feasible method for rapid estimation of astaxanthin content in the green microalga C. zofingiensis . The rapid FCM method is complementary to the current HPLC method, especially for rapid evaluation and prediction of astaxanthin formation as it is required during the high-throughput culture in the laboratory and mass cultivation in industry.

Rapid Estimation of Astaxanthin and the Carotenoid-to-Chlorophyll Ratio in the Green Microalga Chromochloris zofingiensis Using Flow Cytometry

PubMed Central

Chen, Junhui; Pohnert, Georg

2017-01-01

The green microalga Chromochloris zofingiensis can accumulate significant amounts of valuable carotenoids, mainly natural astaxanthin, a product with applications in functional food, cosmetics, nutraceuticals, and with potential therapeutic value in cardiovascular and neurological diseases. To optimize the production of astaxanthin, it is essential to monitor the content of astaxanthin in algal cells during cultivation. The widely used HPLC (high-performance liquid chromatography) method for quantitative astaxanthin determination is time-consuming and laborious. In the present work, we present a method using flow cytometry (FCM) for in vivo determination of the astaxanthin content and the carotenoid-to-chlorophyll ratio (Car/Chl) in mixotrophic C. zofingiensis. The method is based on the assessment of fluorescent characteristics of cellular pigments. The mean fluorescence intensity (MFI) of living cells was determined by FCM to monitor pigment formation based on the correlation between MFI detected in particular channels (FL1: 533 ± 15 nm; FL2: 585 ± 20 nm; FL3: >670 nm) and pigment content in algal cells. Through correlation and regression analysis, a linear relationship was observed between MFI in FL2 (band-pass filter, emission at 585 nm in FCM) and astaxanthin content (in HPLC) and applied for predicting astaxanthin content. With similar procedures, the relationships between MFI in different channels and Car/Chl ratio in mixotrophic C. zofingiensis were also determined. Car/Chl ratios could be estimated by the ratios of MFI (FL1/FL3, FL2/FL3). FCM is thus a highly efficient and feasible method for rapid estimation of astaxanthin content in the green microalga C. zofingiensis. The rapid FCM method is complementary to the current HPLC method, especially for rapid evaluation and prediction of astaxanthin formation as it is required during the high-throughput culture in the laboratory and mass cultivation in industry. PMID:28753934

ReAsH/FlAsH Labeling and Image Analysis of Tetracysteine Sensor Proteins in Cells

PubMed Central

Irtegun, Sevgi; Ramdzan, Yasmin M.; Mulhern, Terrence D.; Hatters, Danny M.

2011-01-01

Fluorescent proteins and dyes are essential tools for the study of protein trafficking, localization and function in cells. While fluorescent proteins such as green fluorescence protein (GFP) have been extensively used as fusion partners to proteins to track the properties of a protein of interest1, recent developments with smaller tags enable new functionalities of proteins to be examined in cells such as conformational change and protein-association 2, 3. One small tag system involves a tetracysteine motif (CCXXCC) genetically inserted into a target protein, which binds to biarsenical dyes, ReAsH (red fluorescent) and FlAsH (green fluorescent), with high specificity even in live cells 2. The TC/biarsenical dye system offers far less steric constraints to the host protein than fluorescent proteins which has enabled several new approaches to measure conformational change and protein-protein interactions 4-7. We recently developed a novel application of TC tags as sensors of oligomerization in cells expressing mutant huntingtin, which when mutated aggregates in neurons in Huntington disease 7. Huntingtin was tagged with two fluorescent dyes, one a fluorescent protein to track protein location, and the second a TC tag which only binds biarsenical dyes in monomers. Hence, changes in colocalization between protein and biarsenical dye reactivity enabled submicroscopic oligomer content to be spatially mapped within cells. Here, we describe how to label TC-tagged proteins fused to a fluorescent protein (Cherry, GFP or CFP) with FlAsH or ReAsH in live mammalian cells and how to quantify the two color fluorescence (Cherry/FlAsH, CFP/FlAsH or GFP/ReAsH combinations). PMID:21897361

Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

PubMed

Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

2017-06-01

The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

Dendritic cell modification of neutrophil responses to infection after burn injury.

PubMed

Bohannon, Julia; Cui, Weihua; Sherwood, Edward; Toliver-Kinsky, Tracy

2010-09-01

Burn patients are highly susceptible to infections due to increased exposure through wounds and impairments in a number of immune functions. Dendritic cells (DCs) are important in activation of numerous immune responses that are essential for the clearance of infections. We have found that prophylactic treatment of burn-injured mice with the DC growth factor FLT3 ligand (FL) significantly increases resistance to burn wound infections in a DC-dependent manner that is correlated closely with enhanced bacterial clearance. However, as DCs are not typically microbicidal, the mechanisms by which DC modulation enhances bacterial clearance are not known. Due to the rapid response of neutrophils to cutaneous wounds, and the reported interactions between DCs and neutrophils, we investigated the role of neutrophils in FL-mediated resistance to burn wound infection. This was examined both in vivo and in vitro through neutrophil depletion, supplementation of neutrophils, and assessment of neutrophil chemotaxis following FL treatment. To test the involvement of DCs, CD11c-diphtheria toxin receptor transgenic mice were used to deplete DCs during FL treatment. Studies revealed that neutrophils do play a critical role in FL-mediated resistance to a burn wound infection. Additionally, treatment with FL after a burn injury enhances neutrophil-mediated control of bacterial spread, neutrophil migratory capacity, and myeloperoxidase production in a DC-dependent manner. The results of this study provide new insight into immunological mechanisms that can offer protection against infection after burn injury.

Targeted Reduction of Vascular Msx1 and Msx2 Mitigates Arteriosclerotic Calcification and Aortic Stiffness in LDLR-Deficient Mice Fed Diabetogenic Diets

PubMed Central

Cheng, Su-Li; Behrmann, Abraham; Shao, Jian-Su; Ramachandran, Bindu; Krchma, Karen; Bello Arredondo, Yoanna; Kovacs, Attila; Mead, Megan; Maxson, Robert

2014-01-01

When fed high-fat diets, male LDLR−/− mice develop obesity, hyperlipidemia, hyperglycemia, and arteriosclerotic calcification. An osteogenic Msx-Wnt regulatory program is concomitantly upregulated in the vasculature. To better understand the mechanisms of diabetic arteriosclerosis, we generated SM22-Cre;Msx1(fl/fl);Msx2(fl/fl);LDLR−/− mice, assessing the impact of Msx1+Msx2 gene deletion in vascular myofibroblast and smooth muscle cells. Aortic Msx2 and Msx1 were decreased by 95% and 34% in SM22-Cre;Msx1(fl/fl);Msx2(fl/fl);LDLR−/− animals versus Msx1(fl/fl);Msx2(fl/fl);LDLR−/− controls, respectively. Aortic calcium was reduced by 31%, and pulse wave velocity, an index of stiffness, was decreased in SM22-Cre;Msx1(fl/fl);Msx2(fl/fl);LDLR−/− mice vs. controls. Fasting blood glucose and lipids did not differ, yet SM22-Cre;Msx1(fl/fl);Msx2(fl/fl);LDLR−/− siblings became more obese. Aortic adventitial myofibroblasts from SM22-Cre;Msx1(fl/fl);Msx2(fl/fl);LDLR−/− mice exhibited reduced osteogenic gene expression and mineralizing potential with concomitant reduction in multiple Wnt genes. Sonic hedgehog (Shh) and Sca1, markers of aortic osteogenic progenitors, were also reduced, paralleling a 78% reduction in alkaline phosphatase (TNAP)–positive adventitial myofibroblasts. RNA interference revealed that although Msx1+Msx2 supports TNAP and Wnt7b expression, Msx1 selectively maintains Shh and Msx2 sustains Wnt2, Wnt5a, and Sca1 expression in aortic adventitial myofibroblast cultures. Thus, Msx1 and Msx2 support vascular mineralization by directing the osteogenic programming of aortic progenitors in diabetic arteriosclerosis. PMID:25056439

Lock No. 1 St. Lucie Canal. Upper gate structure, masonry ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Lock No. 1- St. Lucie Canal. Upper gate structure, masonry plan- masonry elevations. - St. Lucie Canal, St. Lucie Lock No. 1, St. Lucie, Cross State Canal, Okeechobee Intracoastal Waterway, Stuart, Martin County, FL

Magainin 2a - Induced Permeabilization of Phospholipid Vesicles

DTIC Science & Technology

1991-01-02

flJ ə) fl) C rH -H 0) E M D e t e 1 0 0 % • 43 • fl) J3 0 C3...fl) +) ft-H to U4 EH RJ OP 43 o 4J H -H IS *M 0 0 fl) c to 0 • H O 4J O -H in 73 TJ h RJ 0 MH >t 43 fl) to TJ flj fl) fl) C...r H - H F r e t e r m O fl) VD TJ tp to G rt •rH r% f o l l o w : f 6 C F 1 O 43 0) to T J flJ fl) fl) C rH •H fl) E Ul

Structure of a seismogenic fault zone in dolostones: the Foiana Line (Italian Southern Alps)

NASA Astrophysics Data System (ADS)

Di Toro, G.; Fondriest, M.; Smith, S. A.; Aretusini, S.

2012-12-01

Fault zones in carbonate rocks (limestones and dolostones) represent significant upper crustal seismogenic sources in several areas worldwide (e.g. L'Aquila 2009 Mw = 6.3 in central Italy). Here we describe an exhumed example of a regionally-significant fault zone cutting dolostones. The Foiana Line (FL) is a major NNE-SSW-trending sinistral transpressive fault cutting sedimentary Triassic dolostones in the Italian Southern Alps. The FL has a cumulative vertical throw of 1.5-2 km that reduces toward its southern termination. The fault zone is 50-300 m wide and is exposed for ~ 10 km along strike within several outcrops exhumed from increasing depths from the south (1 km) to the north (2.5 km). The southern portion of the FL consists of heavily fractured (shattered) dolostones, with particles of a few millimeters in size (exposed in badlands topography over an area of 6 km2), cut by a dense network of 1-20 m long mirror-like fault surfaces with dispersed attitudes. The mirror-like faults have mainly dip-slip reverse kinematics and displacements ranging between 0.04 m and 0.5 m. The northern portion of the FL consists of sub-parallel fault strands spaced 2-5 m apart, surrounded by 2-3 m thick bands of shattered dolostones. The fault strands are characterized by smooth to mirror-like sub-vertical slip surfaces with dominant strike-slip kinematics. Overall, deformation is more localized moving from South to North along the FL. Mirror-like fault surfaces similar to those found in the FL were produced in friction experiments at the deformation conditions expected during seismic slip along the FL (Fondriest et al., this meeting). Scanning Electron Microscope investigations of the natural shattered dolostones beneath the mirror-like fault surfaces show: 1) lack of significant shear strain (even at a few micrometers from the slip surface), 2) pervasive extensional fracturing down to the micrometer scale, 3) exploded clasts with radial fractures, and 4) chains of split clasts (resulting from force chains) oriented at 60-80 degrees to the slip surfaces. Similar features have been reported in natural and experimental pulverized rocks, the latter produced under dynamic stress wave loading conditions. 3-Dimensional rupture simulations along strike-slip faults predict (1) off-fault damage distributions with "flower-like" shapes (broad damage zone near the surface that rapidly narrows with increasing confining pressure, e.g., Ma and Andrews, 2010) and (2) formation of secondary faults/fractures with disperse attitudes and kinematics near the surface, with horizontal slip at depth. Qualitatively, these theoretical results compare favorably with increasing strain localization and a switch in fault kinematics recognized along the FL moving from the southern, shallower portion of the fault zone to the northern, deeper portion. Observations along the FL suggest that the association of shattered dolostones and mirror-like slip surfaces might be a potential indicator of seismic rupture propagation. Further detailed structural mapping along the FL coupled with experimental work on rock pulverization will be necessary to understand rupture dynamics in dolostones.

Structure, mechanical, and frictional properties of hydrogenated fullerene-like amorphous carbon film prepared by direct current plasma enhanced chemical vapor deposition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Yongfu; University of Chinese Academy of Sciences, Beijing 100049; Gao, Kaixiong

In this study, fullerene like carbon (FL-C) is introduced in hydrogenated amorphous carbon (a-C:H) film by employing a direct current plasma enhanced chemical vapor deposition. The film has a low friction and wear, such as 0.011 and 2.3 × 10{sup −9}mm{sup 3}/N m in the N{sub 2}, and 0.014 and 8.4 × 10{sup −8}mm{sup 3}/N m in the humid air, and high hardness and elasticity (25.8 GPa and 83.1%), to make further engineering applications in practice. It has several nanometers ordered domains consisting of less frequently cross-linked graphitic sheet stacks. We provide new evidences for understanding the reported Raman fit model involving four vibrational frequenciesmore » from five, six, and seven C-atom rings of FL-C structures, and discuss the structure evolution before or after friction according to the change in the 1200 cm{sup −1} Raman band intensity caused by five- and seven-carbon rings. Friction inevitably facilitates the transformation of carbon into FL-C nanostructures, namely, the ultra low friction comes from both such structures within the carbon film and the sliding induced at friction interface.« less

Protein oxidative changes in whole and skim milk after ultraviolet or fluorescent light exposure.

PubMed

Scheidegger, D; Pecora, R P; Radici, P M; Kivatinitz, S C

2010-11-01

We investigated how protein changes occur, at the primary or higher structural levels, when proteins are exposed to UV or fluorescent (FL) light while in the complex matrix, milk. Whole milk (WM) or skim milk (SM) samples were exposed to FL or UV light from 0 to 24h at 4°C. Protein oxidation was evaluated by the formation of protein carbonyls (PC), dityrosine bond (DiTyr), and changes in molecular weight (protein fragmentation and polymerization). Oxidative changes in AA residues were measured by PC. Dityrosine and N'-formylkynurenine (NFK), a carbonylation derivative of Trp, were measured by fluorometry. Protein carbonyls increased as a function of irradiation time for both WM and SM. The initial rate for PC formation by exposure to FL light (0.25 or 0.27 nmol/h for WM and SM, respectively) was slower than that following exposure to UV light (1.95 or 1.20 nmol/h, respectively). The time course of NFK formation resembled that of PC. After 24h of UV exposure, SM had significantly higher levels of NFK than did WM. In contrast, WM samples irradiated with UV had higher levels of DiTyr than did SM samples, indicating different molecular pathways. The formation of intra- or intermolecular DiTyr bonds could be indicative of changes in the tertiary structure or oligomerization of proteins. The existence of NFK suggests the occurrence of protein fragmentation. Thus, proteolysis and oligomerization were analyzed by sodium dodecyl sulfate-PAGE. After 24h of exposing WM to UV or FL light, all the proteins were affected by both types of light, as evidenced by loss of material in most of the bands. Aggregates were produced only by UV irradiation. Hydrolysis by pepsin and enzyme-induced coagulation by rennet were performed to evaluate altered biological properties of the oxidized proteins. No effect on pepsin digestion or rennet coagulation was found in irradiated SM or WM. The oxidative status of proteins in milk and dairy products is of interest to the dairy industry and consumers. These findings provide knowledge that could be useful in determining the optimal lighting conditions in the dairy industry in general and in cheese making in particular. Copyright © 2010 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Targeted reduction of vascular Msx1 and Msx2 mitigates arteriosclerotic calcification and aortic stiffness in LDLR-deficient mice fed diabetogenic diets.

PubMed

Cheng, Su-Li; Behrmann, Abraham; Shao, Jian-Su; Ramachandran, Bindu; Krchma, Karen; Bello Arredondo, Yoanna; Kovacs, Attila; Mead, Megan; Maxson, Robert; Towler, Dwight A

2014-12-01

When fed high-fat diets, male LDLR(-/-) mice develop obesity, hyperlipidemia, hyperglycemia, and arteriosclerotic calcification. An osteogenic Msx-Wnt regulatory program is concomitantly upregulated in the vasculature. To better understand the mechanisms of diabetic arteriosclerosis, we generated SM22-Cre;Msx1(fl/fl);Msx2(fl/fl);LDLR(-/-) mice, assessing the impact of Msx1+Msx2 gene deletion in vascular myofibroblast and smooth muscle cells. Aortic Msx2 and Msx1 were decreased by 95% and 34% in SM22-Cre;Msx1(fl/fl);Msx2(fl/fl);LDLR(-/-) animals versus Msx1(fl/fl);Msx2(fl/fl);LDLR(-/-) controls, respectively. Aortic calcium was reduced by 31%, and pulse wave velocity, an index of stiffness, was decreased in SM22-Cre;Msx1(fl/fl);Msx2(fl/fl);LDLR(-/-) mice vs. controls. Fasting blood glucose and lipids did not differ, yet SM22-Cre;Msx1(fl/fl);Msx2(fl/fl);LDLR(-/-) siblings became more obese. Aortic adventitial myofibroblasts from SM22-Cre;Msx1(fl/fl);Msx2(fl/fl);LDLR(-/-) mice exhibited reduced osteogenic gene expression and mineralizing potential with concomitant reduction in multiple Wnt genes. Sonic hedgehog (Shh) and Sca1, markers of aortic osteogenic progenitors, were also reduced, paralleling a 78% reduction in alkaline phosphatase (TNAP)-positive adventitial myofibroblasts. RNA interference revealed that although Msx1+Msx2 supports TNAP and Wnt7b expression, Msx1 selectively maintains Shh and Msx2 sustains Wnt2, Wnt5a, and Sca1 expression in aortic adventitial myofibroblast cultures. Thus, Msx1 and Msx2 support vascular mineralization by directing the osteogenic programming of aortic progenitors in diabetic arteriosclerosis. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

Three-dimensional model of an ultramafic feeder system to the Nikolai Greenstone mafic large igneous province, central Alaska Range

USGS Publications Warehouse

Glen, J.M.G.; Schmidt, J.M.; Connard, G.G.

2011-01-01

The Amphitheater Mountains and southern central Alaska Range expose a thick sequence of Triassic Nikolai basalts that is underlain by several mafic-ultramafic complexes, the largest and best exposed being the Fish Lake and Tangle (FL-T) mafic-ultramafic sills that flank the Amphitheater Mountains synform. Three-dimensional (3-D) modeling of gravity and magnetic data reveals details of the structure of the Amphitheater Mountains, such as the orientation and thickness of Nikolai basalts, and the geometry of the FL-T intrusions. The 3-D model (50 ?? 70 km) includes the full geographic extent of the FL-T complexes and consists of 11 layers. Layer surfaces and properties (density and magnetic susceptibility) were modified by forward and inverse methods to reduce differences between the observed and calculated gravity and magnetic grids. The model suggests that the outcropping FL-T sills are apparently connected and traceable at depth and reveals variations in thickness, shape, and orientation of the ultramafic bodies that may identify paths of magma flow. The model shows that a significant volume (2000 km3) of ultramafic material occurs in the subsurface, gradually thickening and plunging westward to depths exceeding 4 km. This deep ultramafic material is interpreted as the top of a keel or root system that supplied magma to the Nikolai lavas and controlled emplacement of related magmatic intrusions. The presence of this deep, keel-like structure, and asymmetry of the synform, supports a sag basin model for development of the Amphitheater Mountains structure and reveals that the feeders to the Nikolai are much more extensive than previously known. Copyright 2011 by the American Geophysical Union.

Association of fat to lean mass ratio with metabolic dysfunction in women with polycystic ovary syndrome.

PubMed

Ezeh, Uche; Pall, Marita; Mathur, Ruchi; Azziz, Ricardo

2014-07-01

Are differences in metabolic dysfunction between polycystic ovary syndrome (PCOS) and control women related to differences in their fat to lean mass (F/L) ratio? Compared with controls of similar body mass index (BMI), women with PCOS demonstrate adverse body composition characterized by increased whole body fat relative to lean mass (i.e. a higher F/L ratio), which is associated with differences in metabolic dysfunction between the two groups. Previous studies examining body composition and insulin resistance (IR) in PCOS have yielded conflicting results. Excess total fat mass (i.e. fat mass index [fat BMI]) correlates with IR, whereas increased total lean mass (i.e. lean BMI) has been associated with higher insulin sensitivity. However, the role of the F/L ratio, which integrates the antagonistic effects of both fat and lean mass depots, on IR in PCOS, has not been investigated. We conducted a prospective cross-sectional study of 120 women between the ages of 22-44 years to study the relation of the F/L ratio with measures of insulin action and secretion in both steady and dynamic states. Sixty PCOS (by NIH, 1990 criteria) and 60 control (age, race and BMI-matched) women were prospectively studied for body composition (by bioelectrical impedance analysis [BIA]) and basal IR and insulin secretion by the homeostasis model assessment (HOMA-IR and HOMA-%β-cell function, respectively) in a tertiary care academic referral center. A subset of 12 PCOS and 12 matched control women also underwent a modified frequently sampled intravenous glucose tolerance test (FSIVGTT) to determine glucose uptake and insulin secretion in dynamic state. Our results indicate that women with PCOS demonstrated greater degrees of hyperandrogenism, and higher waist-to-hip ratio (WHR), %body fat, fat BMI, F/L, fasting insulin levels, and HOMA-IR and HOMA-%β-cell values, than controls. In models adjusted for WHR and free testosterone and diagnostic groups, fasting insulin levels, HOMA-IR, and HOMA-%beta cell function were positively related to the F/L ratio. A positive relationship was also found in both study groups between F/L and the FSIVGTT measures insulin sensitivity (Si) and acute insulin response to glucose (AIRg). The F/L tended to negatively correlate with glucose effectiveness or non-insulin-mediated glucose transport (Sg) only in PCOS women. Regional tissue sub-compartments, which have been shown to have potential independent associations with metabolic variables, cannot be determined by bioelectrical impedance analysis (BIA). The current results suggest that BIA could be used to assess F/L in place of dual energy X-ray absorptiometry (DXA) in research protocols, and that F/L could possibly be used as an alternative to WHR as a surrogate marker of metabolic dysfunction in clinical practice. This work was supported by grants R01-DK073632 and R01-HD29364 from the NIH and an endowment of the Helping Hand of Los Angeles, Inc. (to R.A.). The authors have no competing interests to declare. Not applicable.

Phenotypic, genetic, and single nucleotide polymorphism marker associations between calf diseases and subsequent performance and disease occurrences of first-lactation German Holstein cows.

PubMed

Mahmoud, M; Yin, T; Brügemann, K; König, S

2017-03-01

A total of 31,396 females born from 2010 to 2013 in 43 large-scale Holstein-Friesian herds were phenotyped for calf and cow disease traits using a veterinarian diagnosis key. Calf diseases were general disease status (cGDS), calf diarrhea (cDIA), and calf respiratory disease (cRD) recorded from birth to 2 mo of age. Incidences were 0.48 for cGDS, 0.28 for cRD, and 0.21 for cDIA. Cow disease trait recording focused on the early period directly after calving in first parity, including the interval from 10 d before calving to 200 d in lactation. For cows, at least one entry for the respective disease implied a score = 1 (sick); otherwise, score = 0 (healthy). Corresponding cow diseases were first-lactation general disease status (flGDS), first-lactation diarrhea (flDIA), and first-lactation respiratory disease (flRD). Additional cow disease categories included mastitis (flMAST), claw disorders (flCLAW), female fertility disorders (flFF), and metabolic disorders (flMET). A further cow trait category considered first-lactation test-day production traits from official test-days 1 and 2 after calving. The genotype data set included 41,256 single nucleotide polymorphisms (SNP) from 9,388 females with phenotypes. Linear and generalized linear mixed models with a logit link-function were applied to Gaussian and categorical cow traits, respectively, considering the calf disease as a fixed effect. Most of the calf diseases were not significantly associated with the occurrence of any cow disease. By trend, increasing risks for the occurrence of cow diseases were observed for healthy calves, indicating mechanisms of disease resistance with aging. Also by trend, occurrence of calf diseases was associated with decreasing milk, protein, and fat yields. Univariate linear and threshold animal models were used to estimate heritabilities and breeding values (EBV) for all calf and cow traits. Heritabilities for cGDS and cRD were 0.06 and 0.07 for cDIA. Genetic correlations among all traits were estimated using linear-linear animal models in a series of bivariate runs. The genetic correlation between cDIA and cRD was 0.29. Apart from the genetic correlation between flRD with cGDS (-0.38), EBV correlations and genetic correlations between calf diseases with all cow traits were close to zero. Genome-wide association studies were applied to estimate SNP effects for cRD and cDIA, and for the corresponding traits observed in cows (flRD and flDIA). Different significant SNP markers contributed to cDIA and flDIA, or to cRD and flRD. The average correlation coefficient between cRD and flRD considering SNP effects from all chromosomes was 0.01, and between cDIA and flDIA was -0.04. In conclusion, calf diseases are not appropriate early predictors for cow traits during the early lactation stage in parity 1. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Facile synthesis of 3D few-layered MoS2 coated TiO2 nanosheet core-shell nanostructures for stable and high-performance lithium-ion batteries

NASA Astrophysics Data System (ADS)

Chen, Biao; Zhao, Naiqin; Guo, Lichao; He, Fang; Shi, Chunsheng; He, Chunnian; Li, Jiajun; Liu, Enzuo

2015-07-01

Uniform transition metal sulfide deposition on a smooth TiO2 surface to form a coating structure is a well-known challenge, caused mainly due to their poor affinities. Herein, we report a facile strategy for fabricating mesoporous 3D few-layered (<4 layers) MoS2 coated TiO2 nanosheet core-shell nanocomposites (denoted as 3D FL-MoS2@TiO2) by a novel two-step method using a smooth TiO2 nanosheet as a template and glucose as a binder. The core-shell structure has been systematically examined and corroborated by transmission electron microscopy, scanning transmission electron microscopy, and X-ray photoelectron spectroscopy analyses. It is found that the resultant 3D FL-MoS2@TiO2 as a lithium-ion battery anode delivers an outstanding high-rate capability with an excellent cycling performance, relating to the unique structure of 3D FL-MoS2@TiO2. The 3D uniform coverage of few-layered (<4 layers) MoS2 onto the TiO2 can remarkably enhance the structure stability and effectively shortens the transfer paths of both lithium ions and electrons, while the strong synergistic effect between MoS2 and TiO2 can significantly facilitate the transport of ions and electrons across the interfaces, especially in the high-rate charge-discharge process. Moreover, the facile fabrication strategy can be easily extended to design other oxide/carbon-sulfide/oxide core-shell materials for extensive applications.Uniform transition metal sulfide deposition on a smooth TiO2 surface to form a coating structure is a well-known challenge, caused mainly due to their poor affinities. Herein, we report a facile strategy for fabricating mesoporous 3D few-layered (<4 layers) MoS2 coated TiO2 nanosheet core-shell nanocomposites (denoted as 3D FL-MoS2@TiO2) by a novel two-step method using a smooth TiO2 nanosheet as a template and glucose as a binder. The core-shell structure has been systematically examined and corroborated by transmission electron microscopy, scanning transmission electron microscopy, and X-ray photoelectron spectroscopy analyses. It is found that the resultant 3D FL-MoS2@TiO2 as a lithium-ion battery anode delivers an outstanding high-rate capability with an excellent cycling performance, relating to the unique structure of 3D FL-MoS2@TiO2. The 3D uniform coverage of few-layered (<4 layers) MoS2 onto the TiO2 can remarkably enhance the structure stability and effectively shortens the transfer paths of both lithium ions and electrons, while the strong synergistic effect between MoS2 and TiO2 can significantly facilitate the transport of ions and electrons across the interfaces, especially in the high-rate charge-discharge process. Moreover, the facile fabrication strategy can be easily extended to design other oxide/carbon-sulfide/oxide core-shell materials for extensive applications. Electronic supplementary information (ESI) available: Supplementary SEM, TEM, XPS and EIS analyses. See DOI: 10.1039/c5nr03334a

Healthy Dietary Patterns and Oxidative Stress as Measured by Fluorescent Oxidation Products in Nurses' Health Study.

PubMed

Jung, Seungyoun; Smith-Warner, Stephanie A; Willett, Walter C; Wang, Molin; Wu, Tianying; Jensen, Majken; Hankinson, Susan E; Eliassen, A Heather

2016-09-21

Healthy diets may lower oxidative stress and risk of chronic diseases. However, no previous studies examined associations between diet and fluorescent oxidation products (FlOP), a global marker of oxidative stress. We evaluated associations between healthy eating patterns (Alternative Healthy Eating Index (AHEI), Dietary Approach to Stop Hypertension (DASH), and Alternate Mediterranean Diet (aMED)) and FlOP, measured at three excitation/emission wavelengths (FlOP_360, FlOP_320, FlOP_400) from 2021 blood samples collected from 1688 women within the Nurses' Health Study. AHEI, DASH, and aMED scores were significantly positively associated with FlOP_360 and FlOP_320 concentrations ( p -trend ≤ 0.04), but not associated with FlOP_400. Among specific food groups that contribute to these diet scores, significantly positive associations were observed with legumes and vegetables for FlOP_360, vegetables and fruits for FlOP_320, and legumes and alcohol for FlOP_400. Inverse associations were observed with nuts, sweets or desserts, and olive oil for FlOP_360, nuts for FlOP_320 and sweets or desserts for FlOP_400 (all p -trend ≤ 0.05). However, FlOP variation due to diet was small compared to overall FlOP variation. In conclusion, AHEI, DASH, and aMED scores were unexpectedly positively, but weakly, associated with FlOP_360 and FlOP_320. However, these findings should be interpreted cautiously as the determinants of FlOP concentrations are not fully understood.

Native lignin structure of Miscanthus x giganteus and its changes during acetic and formic acid fractionation.

PubMed

Villaverde, Juan José; Li, Jiebing; Ek, Monica; Ligero, Pablo; de Vega, Alberto

2009-07-22

Milled wood lignin (MWL) and acetic and formic acid lignin (AL and FL) from Miscanthus x giganteus bark were produced, respectively, before and after organosolv fractionations under optimal conditions, in terms of organic and hydrochloric acid concentrations, liquid/wood ratio, and reaction time. In order to study the M. x giganteus native lignin structure and its modifications during the fractionation process, the lignins were studied by two-dimensional heteronuclear single quantum coherence (2D-(HSQC)), (13)C- and (31)P nuclear magnetic resonance (NMR) spectroscopy, Fourier transform infrared (FTIR), size-exclusion chromatography (SEC) both before and after thioacidolysis, and elemental analysis. In addition, chemical composition analysis was performed on ash, Klason lignin, and carbohydrate content. The analyses demonstrated that M. x giganteus native lignin (MWL) is highly acylated at the C(gamma) of the lignin side chain (46%), possibly with p-coumarate and/or acetate groups. This is newsworthy since several earlier studies showed that acylation at the gamma-carbon commonly occurs in C(3) and CAM grasses, whereas M. x giganteus is a C(4) grass. Furthermore, M. x giganteus showed a low S/G ratio (0.7) and a predominance of beta-O-4' linkages (up to 93% of all linkages). AL and FL lose part of these linkages during organosolv fractionation (up to 21 and 32%, respectively). The p-coumarate groups resist fractionation processes and are still present in high quantities in AL and FL. During the fractionation process, lignin is acetylated (acetic acid process) and condensed, with the G units condensing more than S units. M. x giganteus MWL contains a high content of carbohydrates (22.8%), suggesting that it is a lignin-carbohydrate complex (LCC). AL and FL showed low carbohydrate contents because of the breaking down of the LCC structures. AL and FL have high molecular weights and low polydispersities, and are high in phenolic content, qualities that make these suitable for different applications. These results suggest that refinement of M. x giganteus via organosolv processes could potentially turn this grass into a valuable source of both fiber and lignin.

Application of Mahler measure theory to the face-centred cubic lattice Green function at the origin and its associated logarithmic integral

NASA Astrophysics Data System (ADS)

Joyce, G. S.

2012-07-01

The mathematical properties of the face-centred cubic lattice Green function \\begin{equation*} \\fl G(w) \\equiv {1\\over {\\pi ^3}}\\int _{0}^{\\pi }\\int _{0}^{\\pi }\\int _{0}^{\\pi } {{d\\theta _1\\,d\\theta _2\\,d\\theta _3}\\over {w-c(\\theta _1)\\,c(\\theta _2)- c(\\theta _2)\\,c(\\theta _3)-c(\\theta _3)\\,c(\\theta _1)}} \\end{equation*} and the associated logarithmic integral \\begin{eqnarray*} \\fl S(w) \\equiv {1\\over {\\pi ^3}}\\int _{0}^{\\pi }\\int _{0}^{\\pi }\\int _{0}^{\\pi } \\ln [ w-c(\\theta _1)\\,c(\\theta _2)-c(\\theta _2)\\,c(\\theta _3)\

Predation by Northern Pikeminnow and tiger muskellunge on juvenile salmonids in a high–head reservoir: Implications for anadromous fish reintroductions

USGS Publications Warehouse

Sorel, Mark H.; Hansen, Adam G.; Connelly, Kristin A.; Wilson, Andrew C.; Lowery, Erin D.; Beauchamp, David A.

2016-01-01

The feasibility of reintroducing anadromous salmonids into reservoirs above high-head dams is affected by the suitability of the reservoir habitat for rearing and the interactions of the resident fish with introduced fish. We evaluated the predation risk to anadromous salmonids considered for reintroduction in Merwin Reservoir on the North Fork Lewis River in Washington State for two reservoir use-scenarios: year-round rearing and smolt migration. We characterized the role of the primary predators, Northern Pikeminnow Ptychocheilus oregonensis and tiger muskellunge (Northern Pike Esox lucius × Muskellunge E. masquinongy), by using stable isotopes and stomach content analysis, quantified seasonal, per capita predation using bioenergetics modeling, and evaluated the size and age structures of the populations. We then combined these inputs to estimate predation rates of size-structured population units. Northern Pikeminnow of FL ≥ 300 mm were highly cannibalistic and exhibited modest, seasonal, per capita predation on salmonids, but they were disproportionately much less abundant than smaller, less piscivorous, conspecifics. The annual predation on kokanee Oncorhynchus nerka (in biomass) by a size-structured unit of 1,000 Northern Pikeminnow having a FL ≥ 300 mm was analogous to 16,000–40,000 age-0 spring Chinook Salmon O. tshawytscha rearing year-round, or 400–1,000 age-1 smolts migrating April–June. The per capita consumption of salmonids by Northern Pikeminnow having a FL ≥ 200 mm was relatively low, due in large part to spatial segregation during the summer and the skewed size distribution of the predator population. Tiger muskellunge fed heavily on Northern Pikeminnow, other nonsalmonids, and minimally on salmonids. In addition to cannibalism within the Northern Pikeminnow population, predation by tiger muskellunge likely contributed to the low recruitment of larger (more piscivorous) Northern Pikeminnow, thereby decreasing the risk of predation to salmonids. This study highlights the importance of evaluating trophic interactions within reservoirs slated for reintroduction with anadromous salmonids, as they can be functional migration corridors and may offer profitable juvenile-rearing habitats despite hosting abundant predator populations.

Modeling of Anopheles minimus Mosquito NADPH-Cytochrome P450 Oxidoreductase (CYPOR) and Mutagenesis Analysis

PubMed Central

Sarapusit, Songklod; Lertkiatmongkol, Panida; Duangkaew, Panida; Rongnoparut, Pornpimol

2013-01-01

Malaria is one of the most dangerous mosquito-borne diseases in many tropical countries, including Thailand. Studies in a deltamethrin resistant strain of Anopheles minimus mosquito, suggest cytochrome P450 enzymes contribute to the detoxification of pyrethroid insecticides. Purified A. minimus CYPOR enzyme (AnCYPOR), which is the redox partner of cytochrome P450s, loses flavin-adenosine di-nucleotide (FAD) and FLAVIN mono-nucleotide (FMN) cofactors that affect its enzyme activity. Replacement of leucine residues at positions 86 and 219 with phenylalanines in FMN binding domain increases FMN binding, enzyme stability, and cytochrome c reduction activity. Membrane-Bound L86F/L219F-AnCYPOR increases A. minimus P450-mediated pyrethroid metabolism in vitro. In this study, we constructed a comparative model structure of AnCYPOR using a rat CYPOR structure as a template. Overall model structure is similar to rat CYPOR, with some prominent differences. Based on primary sequence and structural analysis of rat and A. minimus CYPOR, C427R, W678A, and W678H mutations were generated together with L86F/L219F resulting in three soluble Δ55 triple mutants. The C427R triple AnCYPOR mutant retained a higher amount of FAD binding and increased cytochrome c reduction activity compared to wild-type and L86F/L219F-Δ55AnCYPOR double mutant. However W678A and W678H mutations did not increase FAD and NAD(P)H bindings. The L86F/L219F double and C427R triple membrane-bound AnCYPOR mutants supported benzyloxyresorufin O-deakylation (BROD) mediated by mosquito CYP6AA3 with a two-to three-fold increase in efficiency over wild-type AnCYPOR. The use of rat CYPOR in place of AnCYPOR most efficiently supported CYP6AA3-mediated BROD compared to all AnCYPORs. PMID:23325047

Fate of Lu(III) sorbed on 2-line ferrihydrite at pH 5.7 and aged for 12 years at room temperature. I: insights from ICP-OES, XRD, ESEM, AsFlFFF/ICP-MS, and EXAFS spectroscopy.

PubMed

Finck, Nicolas; Bouby, Muriel; Dardenne, Kathy

2018-01-31

Two-line ferrihydrite (2LFh) was aged for 12 years under ambient conditions and sheltered from light in the presence of Lu(III) used as surrogate for trivalent actinides. 2LFh aging produced hematite rhombohedra with overgrown acicular goethite particles. Analysis of the homogeneous suspension by asymmetrical flow field-flow fractionation (AsFlFFF) coupled to ICP-MS indicated that particles have a mean hydrodynamic diameter of about 140 nm and the strong correlation of the Fe and Lu fractograms hinted at a structural association of the lanthanide with the solid phase(s). Unfortunately, recoveries were low and thus results cannot be considered representative of the whole sample. The suspension was centrifuged and X-ray absorption spectroscopy (XAS) at the Lu L 3 -edge on the settled particles indicated that Lu(III) is sixfold coordinated by oxygen atoms, pointing to a retention by structural incorporation within particles. This result is consistent with AsFlFFF results on the same suspension without centrifugation. The detection of next nearest Fe and O atoms were consistent with the structure of goethite, ruling out incorporation within hematite. After centrifugation of the suspension, only nanoparticulate needle-like particles, very likely goethite, could be detected in the supernatant by ESEM. AsFlFFF data of the supernatant were comparable to that obtained for the homogeneous suspension, whereas XAS indicated that Lu(III) is predominantly present as dissolved species in the supernatant. Results from both techniques can be interpreted as a major fraction of Lu present as aqueous ions and a minor fraction as structurally incorporated. Findings from this study are corroborated by STEM-HAADF data and results from DFT calculations in a companion paper.

Interactions of Histone Acetyltransferase p300 with the Nuclear Proteins Histone and HMGB1, As Revealed by Single Molecule Atomic Force Spectroscopy.

PubMed

Banerjee, S; Rakshit, T; Sett, S; Mukhopadhyay, R

2015-10-22

One of the important properties of the transcriptional coactivator p300 is histone acetyltransferase (HAT) activity that enables p300 to influence chromatin action via histone modulation. p300 can exert its HAT action upon the other nuclear proteins too--one notable example being the transcription-factor-like protein HMGB1, which functions also as a cytokine, and whose accumulation in the cytoplasm, as a response to tissue damage, is triggered by its acetylation. Hitherto, no information on the structure and stability of the complexes between full-length p300 (p300FL) (300 kDa) and the histone/HMGB1 proteins are available, probably due to the presence of unstructured regions within p300FL that makes it difficult to be crystallized. Herein, we have adopted the high-resolution atomic force microscopy (AFM) approach, which allows molecularly resolved three-dimensional contour mapping of a protein molecule of any size and structure. From the off-rate and activation barrier values, obtained using single molecule dynamic force spectroscopy, the biochemical proposition of preferential binding of p300FL to histone H3, compared to the octameric histone, can be validated. Importantly, from the energy landscape of the dissociation events, a model for the p300-histone and the p300-HMGB1 dynamic complexes that HAT forms, can be proposed. The lower unbinding forces of the complexes observed in acetylating conditions, compared to those observed in non-acetylating conditions, indicate that upon acetylation, p300 tends to weakly associate, probably as an outcome of charge alterations on the histone/HMGB1 surface and/or acetylation-induced conformational changes. To our knowledge, for the first time, a single molecule level treatment of the interactions of HAT, where the full-length protein is considered, is being reported.

4. GENERAL VIEW SHOWING EARTHEN BERM AROUND STRUCTURE. NOTE INSTRUMENTATION ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

4. GENERAL VIEW SHOWING EARTHEN BERM AROUND STRUCTURE. NOTE INSTRUMENTATION TRENCH IN FOREGROUND RIGHT; VIEW TO WEST. - Cape Canaveral Air Station, Launch Complex 17, Facility 28401, East end of Lighthouse Road, Cape Canaveral, Brevard County, FL

Thermodynamic and electron paramagnetic resonance characterization of flavin in succinate dehydrogenase.

PubMed

Ohnishi, T; King, T E; Salerno, J C; Blum, H; Bowyer, J R; Maida, T

1981-06-10

Thermodynamic parameters of succinate dehydrogenase flavin were determined potentiometrically from the analysis of free radical signal levels as a function of the oxidation-reduction potential. Midpoint redox potentials of consecutive 1-electron transfer steps are -127 and -31 mV at pH 7.0. This corresponds to a stability constant of intermediate stability, 2.5 x 10(-2), which suggests flavin itself may be a converter from n = 2 to n = 1 electron transfer steps. The pK values of the free radical (FlH . in equilibrium Fl . -) and the fully reduced form (FlH2 in equilibrium FlH-) were estimated as 8.0 +/- 0.2 and 7.7 +/- 0.2, respectively. Succinate dehydrogenase flavosemiquinone elicits an EPR spectrum at g = 2.00 with a peak to peak width of 1.2 mT even in the protonated form, suggesting the delocalization in the unpaired electron density. A close proximity of succinate dehydrogenase flavin and iron-sulfur cluster S-1 was demonstrated based on the enhancement of flavin spin relaxation by Center S-1.

Investigation of arterial bloodgases at altitude using constant-flow oxygen masks.

PubMed

Hodgson, W R; Wright, R C; Nelson, G C; Letchford, T

1978-06-01

Arterial blood oxygen tensions up to 6700 m altitude (FL220) were measured polarographically while subjects breathed from various masks with constant-flow oxygen. The Sierra and Aro masks used for emergency decompression descent in commercial passenger aircraft, gave mean PaO2's of 130 +/- 7.6 and 130 +/- 12.1 torr at 6700 m (FL220) and 90 +/- 3.8 and 77 +/- 3.35 torr at 4260 m (FL140), respectively, when supplied with oxygen flows corresponding to those available in the Boeing 747. These oxygen tensions during descent are acceptable for normal physiological function in a heterogeneous population of air travellers whereas breathing ambient air during return to base at 4260 m (FL 140) (PaO2 of 48 or less) is not acceptable. The valveless Hudson 1007 and Puritan 114011 masks, used for air ambulance service, gave mean PaO2's of 110 +/- 2.7 and 98 +/- 4.5 torr at 6700 m and 80 +/- 3.0 and 77 +/- 2.5 torr at 4260 m under the same condition--significantly less than the Sierra mask.

Intraflagellar transport 88 (IFT88) is crucial for craniofacial development in mice and is a candidate gene for human cleft lip and palate.

PubMed

Tian, Hua; Feng, Jifan; Li, Jingyuan; Ho, Thach-Vu; Yuan, Yuan; Liu, Yang; Brindopke, Frederick; Figueiredo, Jane C; Magee, William; Sanchez-Lara, Pedro A; Chai, Yang

2017-03-01

Ciliopathies are pleiotropic human diseases resulting from defects of the primary cilium, and these patients often have cleft lip and palate. IFT88 is required for the assembly and function of the primary cilia, which mediate the activity of key developmental signaling pathways. Through whole exome sequencing of a family of three affected siblings with isolated cleft lip and palate, we discovered that they share a novel missense mutation in IFT88 (c.915G > C, p.E305D), suggesting this gene should be considered a candidate for isolated orofacial clefting. In order to evaluate the function of IFT88 in regulating craniofacial development, we generated Wnt1-Cre;Ift88fl/fl mice to eliminate Ift88 specifically in cranial neural crest (CNC) cells. Wnt1-Cre;Ift88fl/flpups died at birth due to severe craniofacial defects including bilateral cleft lip and palate and tongue agenesis, following the loss of the primary cilia in the CNC-derived palatal mesenchyme. Loss of Ift88 also resulted in a decrease in neural crest cell proliferation during early stages of palatogenesis as well as a downregulation of the Shh signaling pathway in the palatal mesenchyme. Importantly, Osr2KI-Cre;Ift88fl/flmice, in which Ift88 is lost specifically in the palatal mesenchyme, exhibit isolated cleft palate. Taken together, our results demonstrate that IFT88 has a highly conserved function within the primary cilia of the CNC-derived mesenchyme in the lip and palate region in mice and is a strong candidate as an orofacial clefting gene in humans. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Transcriptional coactivator NT-PGC-1α promotes gluconeogenic gene expression and enhances hepatic gluconeogenesis.

PubMed

Chang, Ji Suk; Jun, Hee-Jin; Park, Minsung

2016-10-01

The transcriptional coactivator PGC-1α plays a central role in hepatic gluconeogenesis. We previously reported that alternative splicing of the PGC-1α gene produces an additional transcript encoding the truncated protein NT-PGC-1α NT-PGC-1α is co-expressed with PGC-1α and highly induced by fasting in the liver. NT-PGC-1α regulates tissue-specific metabolism, but its role in the liver has not been investigated. Thus, the objective of this study was to determine the role of hepatic NT-PGC-1α in the regulation of gluconeogenesis. Adenovirus-mediated expression of NT-PGC-1α in primary hepatocytes strongly stimulated the expression of key gluconeogenic enzyme genes (PEPCK and G6Pase), leading to increased glucose production. To further understand NT-PGC-1α function in hepatic gluconeogenesis in vivo, we took advantage of a previously reported FL-PGC-1α -/- mouse line that lacks full-length PGC-1α (FL-PGC-1α) but retains a slightly shorter and functionally equivalent form of NT-PGC-1α (NT-PGC-1α 254 ). In FL-PGC-1α -/- mice, NT-PGC-1α 254 was induced by fasting in the liver and recruited to the promoters of PEPCK and G6Pase genes. The enrichment of NT-PGC-1α 254 at the promoters was closely associated with fasting-induced increase in PEPCK and G6Pase gene expression and efficient production of glucose from pyruvate during a pyruvate tolerance test in FL-PGC-1α -/- mice. Moreover, FL-PGC-1α -/- primary hepatocytes showed a significant increase in gluconeogenic gene expression and glucose production after treatment with dexamethasone and forskolin, suggesting that NT-PGC-1α 254 is sufficient to stimulate the gluconeogenic program in the absence of FL-PGC-1α Collectively, our findings highlight the role of hepatic NT-PGC-1α in stimulating gluconeogenic gene expression and glucose production. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Spatial interpolation and radiological mapping of ambient gamma dose rate by using artificial neural networks and fuzzy logic methods.

PubMed

Yeşilkanat, Cafer Mert; Kobya, Yaşar; Taşkın, Halim; Çevik, Uğur

2017-09-01

The aim of this study was to determine spatial risk dispersion of ambient gamma dose rate (AGDR) by using both artificial neural network (ANN) and fuzzy logic (FL) methods, compare the performances of methods, make dose estimations for intermediate stations with no previous measurements and create dose rate risk maps of the study area. In order to determine the dose distribution by using artificial neural networks, two main networks and five different network structures were used; feed forward ANN; Multi-layer perceptron (MLP), Radial basis functional neural network (RBFNN), Quantile regression neural network (QRNN) and recurrent ANN; Jordan networks (JN), Elman networks (EN). In the evaluation of estimation performance obtained for the test data, all models appear to give similar results. According to the cross-validation results obtained for explaining AGDR distribution, Pearson's r coefficients were calculated as 0.94, 0.91, 0.89, 0.91, 0.91 and 0.92 and RMSE values were calculated as 34.78, 43.28, 63.92, 44.86, 46.77 and 37.92 for MLP, RBFNN, QRNN, JN, EN and FL, respectively. In addition, spatial risk maps showing distributions of AGDR of the study area were created by all models and results were compared with geological, topological and soil structure. Copyright © 2017 Elsevier Ltd. All rights reserved.

Respiration and carbon dynamics of free-living and particle-attached bacteria in coastal waters of NE Pacific

NASA Astrophysics Data System (ADS)

Guo, C.; Ke, Y.; Liu, H.

2016-02-01

Bacterial respiration (BR) rates are fundamental to understand the role of bacteria in carbon flow in aquatic ecosystem, and therefore it is critical to obtain reliable measurements. Prefiltration- (mostly 1-3μm) and dark-incubation- (mostly 24 h) based direct measurements of oxygen consumption have been the most commonly used method for BR. However, the prefiltration procedure and long incubation time may cause change of the bacterial abundance and structure, leading to inaccurate measurements. In this study, by measuring bacterial abundance, production and respiration of both particle-attached (PA) and free-living (FL) bacteria at two contrasting site in coastal NE Pacific from Nov 2014 to Mar 2015, we found that the 24 h growth rate of FL bacteria in the traditional BR incubations were significantly higher for 30% and 54% than those obtained for FL and total (FL+PA) bacteria in unfiltered incubations respectively, suggesting removal of protist grazers could cause a significant biomass accumulation during 24 h incubation than the in situ condition. This biomass overestimation resulted in 40% (±12%) overestimation of measured FL BR rates compared with the corrected in situ FL BR. Nevertheless, for the corrected in situ total BR, the rates were overestimated by traditional method in three measurements over nine for 6-46%, and were underestimated in the rest six measurements for 7-67%. Interestingly, those underestimations were attributed to the ignorance of PA bacteria due to prefiltration, which had larger cell size than the FL bacteria, accounted for 19% (±16%) in total bacterial abundance, and contributed to 50% (±19%) of total bacterial production. The average bacterial growth efficiency calculated by comparable 24 h integrated bacterial production and respiration was 0.42 (±0.24). Our results confirmed two major flaws in the current BR methodology, i.e., 1) it only measures the respiration of FL bacteria, and 2) the removal of grazers causing dramatic increase of bacteria abundance during the 24 h incubation, and attempted to provide a solution for correction. Although the problems causes magnificent overestimate of the respiration of the FL bacteria, it could either overestimate or underestimate the total BR due to the proportion of PA bacteria that was not measured in the standard BR methodology.

Von Willebrand disease

MedlinePlus

... platelet and vascular function. In: Goldman L, Schafer AI, eds. Goldman's Cecil Medicine . 25th ed. Philadelphia, ... Florida Cancer Specialists & Research Institute, Wellington, FL. Review provided by ...

Glanzmann disease

MedlinePlus

... platelet and vascular function. In: Goldman L, Schafer AI, eds. Goldman-Cecil Medicine . 25th ed. Philadelphia, PA: ... Florida Cancer Specialists & Research Institute, Wellington, FL. Review provided by ...

Full-scale investigation of wind-induced vibrations of mast-arm traffic signal structures.

DOT National Transportation Integrated Search

2014-08-01

Because of their inherent : fl : exibility and low damping ratios, cantilevered mast : - : arm : tra : ffi : c signal structures are suscepti : b : le to : wind : - : induced vibrations. : These vibrations : cause stru : ctural stresses and strains t...

Maillard reaction products and their relation to complications in insulin-dependent diabetes mellitus.

PubMed Central

McCance, D R; Dyer, D G; Dunn, J A; Bailie, K E; Thorpe, S R; Baynes, J W; Lyons, T J

1993-01-01

Glycation, oxidation, and browning of proteins have all been implicated in the development of diabetic complications. We measured the initial Amadori adduct, fructoselysine (FL); two Maillard products, N epsilon-(carboxymethyl) lysine (CML) and pentosidine; and fluorescence (excitation = 328 nm, emission = 378 nm) in skin collagen from 39 type 1 diabetic patients (aged 41.5 +/- 15.3 [17-73] yr; duration of diabetes 17.9 +/- 11.5 [0-46] yr, [mean +/- SD, range]). The measurements were related to the presence of background (n = 9) or proliferative (n = 16) retinopathy; early nephropathy (24-h albumin excretion rate [AER24] > or = 20 micrograms/min; n = 9); and limited joint mobility (LJM; n = 20). FL, CML, pentosidine, and fluorescence increased progressively across diabetic retinopathy (P < 0.05, P < 0.001, P < 0.05, P < 0.01, respectively). FL, CML, pentosidine, and fluorescence were also elevated in patients with early nephropathy (P < 0.05, P < 0.001, P < 0.01, P < 0.01, respectively). There was no association with LJM. Controlling for age, sex, and duration of diabetes using logistic regression, FL and CML were independently associated with retinopathy (FL odds ratio (OR) = 1.06, 95% confidence interval (CI) = 1.01-1.12, P < 0.05; CML OR = 6.77, 95% CI = 1.33-34.56, P < 0.05) and with early nephropathy (FL OR = 1.05, 95% CI = 1.01-1.10, P < 0.05; CML OR = 13.44, 95% CI = 2.00-93.30, P < 0.01). The associations between fluorescence and retinopathy and between pentosidine and nephropathy approached significance (P = 0.05). These data show that FL and Maillard products in skin correlate with functional abnormalities in other tissues and suggest that protein glycation and oxidation (glycoxidation) may be implicated in the development of diabetic retinopathy and early nephropathy. PMID:8514859

Advances in optical structure systems; Proceedings of the Meeting, Orlando, FL, Apr. 16-19, 1990

NASA Astrophysics Data System (ADS)

Breakwell, John; Genberg, Victor L.; Krumweide, Gary C.

Various papers on advances in optical structure systems are presented. Individual topics addressed include: beam pathlength optimization, thermal stress in glass/metal bond with PR 1578 adhesive, structural and optical properties for typical solid mirror shapes, parametric study of spinning polygon mirror deformations, simulation of small structures-optics-controls system, spatial PSDs of optical structures due to random vibration, mountings for a four-meter glass mirror, fast-steering mirrors in optical control systems, adaptive state estimation for control of flexible structures, surface control techniques for large segmented mirrors, two-time-scale control designs for large flexible structures, closed-loop dynamic shape control of a flexible beam. Also discussed are: inertially referenced pointing for body-fixed payloads, sensor blending line-of-sight stabilization, controls/optics/structures simulation development, transfer functions for piezoelectric control of a flexible beam, active control experiments for large-optics vibration alleviation, composite structures for a large-optical test bed, graphite/epoxy composite mirror for beam-steering applications, composite structures for optical-mirror applications, thin carbon-fiber prepregs for dimensionally critical structures.

Association of fat to lean mass ratio with metabolic dysfunction in women with polycystic ovary syndrome

PubMed Central

Ezeh, Uche; Pall, Marita; Mathur, Ruchi; Azziz, Ricardo

2014-01-01

STUDY QUESTION Are differences in metabolic dysfunction between polycystic ovary syndrome (PCOS) and control women related to differences in their fat to lean mass (F/L) ratio? SUMMARY ANSWER Compared with controls of similar body mass index (BMI), women with PCOS demonstrate adverse body composition characterized by increased whole body fat relative to lean mass (i.e. a higher F/L ratio), which is associated with differences in metabolic dysfunction between the two groups. WHAT IS KNOWN ALREADY Previous studies examining body composition and insulin resistance (IR) in PCOS have yielded conflicting results. Excess total fat mass (i.e. fat mass index [fat BMI]) correlates with IR, whereas increased total lean mass (i.e. lean BMI) has been associated with higher insulin sensitivity. However, the role of the F/L ratio, which integrates the antagonistic effects of both fat and lean mass depots, on IR in PCOS, has not been investigated. STUDY DESIGN, SIZE, DURATION We conducted a prospective cross-sectional study of 120 women between the ages of 22–44 years to study the relation of the F/L ratio with measures of insulin action and secretion in both steady and dynamic states. PARTICIPANTS/MATERIALS, SETTING, METHODS Sixty PCOS (by NIH, 1990 criteria) and 60 control (age, race and BMI-matched) women were prospectively studied for body composition (by bioelectrical impedance analysis [BIA]) and basal IR and insulin secretion by the homeostasis model assessment (HOMA-IR and HOMA-%β-cell function, respectively) in a tertiary care academic referral center. A subset of 12 PCOS and 12 matched control women also underwent a modified frequently sampled intravenous glucose tolerance test (FSIVGTT) to determine glucose uptake and insulin secretion in dynamic state. MAIN RESULTS AND THE ROLE OF CHANCE Our results indicate that women with PCOS demonstrated greater degrees of hyperandrogenism, and higher waist-to-hip ratio (WHR), %body fat, fat BMI, F/L, fasting insulin levels, and HOMA-IR and HOMA-%β-cell values, than controls. In models adjusted for WHR and free testosterone and diagnostic groups, fasting insulin levels, HOMA-IR, and HOMA-%beta cell function were positively related to the F/L ratio. A positive relationship was also found in both study groups between F/L and the FSIVGTT measures insulin sensitivity (Si) and acute insulin response to glucose (AIRg). The F/L tended to negatively correlate with glucose effectiveness or non-insulin-mediated glucose transport (Sg) only in PCOS women. LIMITATIONS, REASONS FOR CAUTION Regional tissue sub-compartments, which have been shown to have potential independent associations with metabolic variables, cannot be determined by bioelectrical impedance analysis (BIA). WIDER IMPLICATIONS OF THE FINDINGS The current results suggest that BIA could be used to assess F/L in place of dual energy X-ray absorptiometry (DXA) in research protocols, and that F/L could possibly be used as an alternative to WHR as a surrogate marker of metabolic dysfunction in clinical practice. STUDY FUNDING/COMPETING INTEREST(S) This work was supported by grants R01-DK073632 and R01-HD29364 from the NIH and an endowment of the Helping Hand of Los Angeles, Inc. (to R.A.). The authors have no competing interests to declare. TRIAL REGISTRATION NUMBER Not applicable. PMID:24813197

Human Systems Integration: Requirements and Functional Decomposition

NASA Technical Reports Server (NTRS)

Berson, Barry; Gershzohn, Gary; Boltz, Laura; Wolf, Russ; Schultz, Mike

2005-01-01

This deliverable was intended as an input to the Access 5 Policy and Simulation Integrated Product Teams. This document contains high-level pilot functionality for operations in the National Airspace System above FL430. Based on the derived pilot functions the associated pilot information and control requirements are given.

The arrestin-1 finger loop interacts with two distinct conformations of active rhodopsin.

PubMed

Elgeti, Matthias; Kazmin, Roman; Rose, Alexander S; Szczepek, Michal; Hildebrand, Peter W; Bartl, Franz J; Scheerer, Patrick; Hofmann, Klaus Peter

2018-03-23

Signaling of the prototypical G protein-coupled receptor (GPCR) rhodopsin through its cognate G protein transducin (G t ) is quenched when arrestin binds to the activated receptor. Although the overall architecture of the rhodopsin/arrestin complex is known, many questions regarding its specificity remain unresolved. Here, using FTIR difference spectroscopy and a dual pH/peptide titration assay, we show that rhodopsin maintains certain flexibility upon binding the "finger loop" of visual arrestin (prepared as synthetic peptide ArrFL-1). We found that two distinct complexes can be stabilized depending on the protonation state of E3.49 in the conserved (D)ERY motif. Both complexes exhibit different interaction modes and affinities of ArrFL-1 binding. The plasticity of the receptor within the rhodopsin/ArrFL-1 complex stands in contrast to the complex with the C terminus of the G t α-subunit (GαCT), which stabilizes only one specific substate out of the conformational ensemble. However, G t α-subunit binding and both ArrFL-1-binding modes involve a direct interaction to conserved R3.50, as determined by site-directed mutagenesis. Our findings highlight the importance of receptor conformational flexibility and cytoplasmic proton uptake for modulation of rhodopsin signaling and thereby extend the picture provided by crystal structures of the rhodopsin/arrestin and rhodopsin/ArrFL-1 complexes. Furthermore, the two binding modes of ArrFL-1 identified here involve motifs of conserved amino acids, which indicates that our results may have elucidated a common modulation mechanism of class A GPCR-G protein/-arrestin signaling. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Syntopic frogs reveal different patterns of interaction with the landscape: A comparative landscape genetic study of Pelophylax nigromaculatus and Fejervarya limnocharis from central China.

PubMed

Garcia, Vhon Oliver S; Ivy, Catherine; Fu, Jinzhong

2017-11-01

Amphibians are often considered excellent environmental indicator species. Natural and man-made landscape features are known to form effective genetic barriers to amphibian populations; however, amphibians with different characteristics may have different species-landscape interaction patterns. We conducted a comparative landscape genetic analysis of two closely related syntopic frog species from central China, Pelophylax nigromaculatus ( PN ) and Fejervarya limnocharis ( FL ). These two species differ in several key life history traits; PN has a larger body size and larger clutch size, and reaches sexual maturity later than FL . Microsatellite DNA data were collected and analyzed using conventional ( F ST , isolation by distance (IBD), AMOVA) and recently developed (Bayesian assignment test, isolation by resistance) landscape genetic methods. As predicted, a higher level of population structure in FL ( F ST ' = 0.401) than in PN ( F ST ' = 0.354) was detected, in addition to FL displaying strong IBD patterns ( r  =   .861) unlike PN ( r  =   .073). A general north-south break in FL populations was detected, consistent with the IBD pattern, while PN exhibited clustering of northern- and southern-most populations, suggestive of altered dispersal patterns. Species-specific resistant landscape features were also identified, with roads and land cover the main cause of resistance to FL , and elevation the main influence on PN . These different species-landscape interactions can be explained mostly by their life history traits, revealing that closely related and ecologically similar species have different responses to the same landscape features. Comparative landscape genetic studies are important in detecting such differences and refining generalizations about amphibians in monitoring environmental changes.

Folklore: A Foundation for Literary Study.

ERIC Educational Resources Information Center

Galda, S. L.; Pellegrini, A. D.

1981-01-01

Discusses folklore as the basis for literary study. Discusses two major theoretical positions on folklore universals--behaviorism and structuralism--and applies the two theories to literary analysis. (FL)

A Unique Blend of 2-Fluorenyl-2-anthracene and 2-Anthryl-2-anthracence Showing White Emission and High Charge Mobility.

PubMed

Chen, Mengyun; Zhao, Yang; Yan, Lijia; Yang, Shuai; Zhu, Yanan; Murtaza, Imran; He, Gufeng; Meng, Hong; Huang, Wei

2017-01-16

White-light-emitting materials with high mobility are necessary for organic white-light-emitting transistors, which can be used for self-driven OLED displays or OLED lighting. In this study, we combined two materials with similar structures-2-fluorenyl-2-anthracene (FlAnt) with blue emission and 2-anthryl-2-anthracence (2A) with greenish-yellow emission-to fabricate OLED devices, which showed unusual solid-state white-light emission with the CIE coordinates (0.33, 0.34) at 10 V. The similar crystal structures ensured that the OTFTs based on mixed FlAnt and 2A showed high mobility of 1.56 cm 2  V -1  s -1 . This simple method provides new insight into the design of high-performance white-emitting transistor materials and structures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

30 CFR 7.86 - Test equipment and specifications.

Code of Federal Regulations, 2012 CFR

2012-07-01

...) Filters—F1, F2, F3, and F4; (ii) Flowmeters—FL1, FL2, FL3, FL4, FL5, FL6, and FL7; (iii) Upstream Gauges... equivalent results. The components are designated as follows— (i) Filters—F1, F2, F3, and F4; (ii) Flowmeters... exhaust pipe up to the filter holder, which are in contact with raw and diluted exhaust gas, shall be...

Boolean and fuzzy logic implemented at the molecular level

NASA Astrophysics Data System (ADS)

Gentili, Pier Luigi

2007-07-01

In this work, it is shown how to implement both hard and soft computing by means of two structurally related heterocyclic compounds: flindersine (FL) and 6(5H)-phenanthridinone (PH). Since FL and PH have a carbonyl group in their molecular skeletons, they exhibit Proximity Effects in their photophysics. In other words, they have an emission power that can be modulated through external inputs such as temperature ( T) and hydrogen-bonding donation (HBD) ability of solvents. This phenomenology can be exploited to implement both crisp and fuzzy logic. Fuzzy Logic Systems (FLSs) wherein the antecedents of the rules are connected through the AND operator, are built by both the Mamdani's and Sugeno's models. Finally, they are adopted as approximators of the proximity effect phenomenon and tested for their prediction capabilities. Moreover, FL as photochromic compound is also a multiply configurable crisp logic molecular element.

Effect of Actual and Simulated Microgravity on Cardiac Mass and Function in the Rat

NASA Technical Reports Server (NTRS)

Ray, Chester H.; Vasques, Marilyn; Miller, Todd H.; Wilkerson, M. Keith; Delp, Michael D.; Dalton, Bonnie (Technical Monitor)

2001-01-01

The purpose of this study was to test the hypothesis that exposure to actual or simulated microgravity induces cardiac atrophy in male Sprague-Dawley rats. For the microgravity study, rats were subdivided into four groups: Preflight (PF, n = 12); Flight (FL, n = 7); Flight Cage Simulation (SIM, n = 6), and Vivarium Control (VIV, n = 7). Animals in the FL group were exposed to 7 days of microgravity during the Spacelab 3 mission. Animals in the simulated microgravity study were subdivided into three groups: Control (CON, n = 20); 7 day hindlimb unloaded (7HU, n = 10); and 28 day unloaded (28HU, n = 19). In a subset of CON (n = 7) and 28HU (n = 6) rats, a catheter was advanced into the left ventricle to measure the rate of rise in ventricular pressure (+dP/dt) during standing as an estimate of cardiac contractility. After completion of their respective treatments, hearts were removed and weighed. Animals in the PF group were sacrificed 24 hr prior to launch while the FL group was sacrificed 11- 17 hr after landing. The SM and VIV groups were sacrificed 48 and 96 hr after the FL group, respectively. Heart mass was unchanged in adult animals exposed to 7 days of actual microgravity (PF 1.33 +/- .03 g; FL 1.32 +/- 0.02 g; SIM 1.28 +/- 0.04 g; VIV 1.35 +/- 0.04 g). Similarly, heart mass was unaltered with hinlimb unloading (CON 1.40 +/- 0.04 g; 7HU 1.35 +/- 0.06 g; 28HU 1.42 +/- 0.03 g). Hindlimb unloading also had no effect on myocardial contractility (CON 8055 +/- 385 mmHg/sec; 28HU 8545 +/- 755 mmHg/sec). These data suggest that cardiac atrophy does not occur following short-term exposure to microgravity, and that neither short- nor long-term simulated microgravity alter cardiac mass or function.

Brain ischaemia induces shedding of a BDNF-scavenger ectodomain from TrkB receptors by excitotoxicity activation of metalloproteinases and γ-secretases.

PubMed

Tejeda, Gonzalo S; Ayuso-Dolado, Sara; Arbeteta, Raquel; Esteban-Ortega, Gema M; Vidaurre, Oscar G; Díaz-Guerra, Margarita

2016-04-01

Stroke remains a leading cause of death and disability in the world with limited therapies available to restrict brain damage or improve functional recovery after cerebral ischaemia. A promising strategy currently under investigation is the promotion of brain-derived neurotrophic factor (BDNF) signalling through tropomyosin-related kinase B (TrkB) receptors, a pathway essential for neuronal survival and function. However, TrkB and BDNF-signalling are impaired by excitotoxicity, a primary pathological process in stroke also associated with neurodegenerative diseases. Pathological imbalance of TrkB isoforms is critical in neurodegeneration and is caused by calpain processing of BDNF high affinity full-length receptor (TrkB-FL) and an inversion of the transcriptional pattern of the Ntrk2 gene, to favour expression of the truncated isoform TrkB-T1 over TrkB-FL. We report here that both TrkB-FL and neuronal TrkB-T1 also undergo ectodomain shedding by metalloproteinases activated after ischaemic injury or excitotoxic damage of cortical neurons. Subsequently, the remaining membrane-bound C-terminal fragments (CTFs) are cleaved by γ-secretases within the transmembrane region, releasing their intracellular domains (ICDs) into the cytosol. Therefore, we identify TrkB-FL and TrkB-T1 as new substrates of regulated intramembrane proteolysis (RIP), a mechanism that highly contributes to TrkB-T1 regulation in ischaemia but is minor for TrkB-FL which is mainly processed by calpain. However, since the secreted TrkB ectodomain acts as a BDNF scavenger and significantly alters BDNF/TrkB signalling, the mechanism of RIP could contribute to neuronal death in excitotoxicity. These results are highly relevant since they reveal new targets for the rational design of therapies to treat stroke and other pathologies with an excitotoxic component. Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Satb2 Ablation Impairs Hippocampus-Based Long-Term Spatial Memory and Short-Term Working Memory and Immediate Early Genes (IEGs)-Mediated Hippocampal Synaptic Plasticity.

PubMed

Li, Ying; You, Qiang-Long; Zhang, Sheng-Rong; Huang, Wei-Yuan; Zou, Wen-Jun; Jie, Wei; Li, Shu-Ji; Liu, Ji-Hong; Lv, Chuang-Ye; Cong, Jin; Hu, Yu-Ying; Gao, Tian-Ming; Li, Jian-Ming

2017-04-18

Special AT-rich sequence-binding protein 2 (Satb2) is a protein binding to the matrix attachment regions of DNA and important for gene regulation. Patients with SATB2 mutation usually suffer moderate to severe mental retardation. However, the mechanisms for the defects of intellectual activities in patients with SATB2 mutation are largely unclear. Here we established the heterozygous Satb2 mutant mice and Satb2 conditional knockout mice to mimic the patients with SATB2 mutation and figured out the role of Satb2 in mental activities. We found that the spatial memory and working memory were significantly damaged in the heterozygous Satb2 mutant mice, early postnatal Satb2-deficient mice (CaMKIIα-Cre + Satb2 fl/fl mice), and adult Satb2 ablation mice (Satb2 fl/fl mice injected with CaMKIIα-Cre virus). Functionally, late phase long-term potentiation (L-LTP) in these Satb2 mutant mice was greatly impaired. Morphologically, in CA1 neurons of CaMKIIα-Cre + Satb2 fl/fl mice, we found decreased spine density of the basal dendrites and less branches of apical dendrites that extended into lacunar molecular layer. Mechanistically, expression levels of immediate early genes (IEGs) including Fos, FosB, and Egr1 were significantly decreased after Satb2 deletion. And, Satb2 could regulate expression of FosB by binding to the promoter of FosB directly. In general, our study uncovers that Satb2 plays an important role in spatial memory and working memory by regulating IEGs-mediated hippocampal synaptic plasticity.

Spectroscopic characterization of the binding mechanism of fluorescein and carboxyfluorescein in human serum albumin

NASA Astrophysics Data System (ADS)

Sulaiman, Saba A. J.; Kulathunga, H. Udani; Abou-Zied, Osama K.

2015-03-01

Fluorescein (FL) and some of its precursors have proven to be effective fluorescent tracers in pharmaceutical and medical applications owing to their high quantum yield of fluorescence in physiological conditions and their high membrane permeability. In order to protect FL from metabolic effects during the process of its delivery, human serum albumin (HSA) has been used as a carrier because of its compatibility with the human body. In the present work, we used spectroscopic methods to characterize the binding mechanisms of FL and one of its derivatives, 5(6)- carboxyfluorescein (CFL), in the HSA protein. The absorbance change of the two ligands (FL and CFL) was quantified as a function of the HSA concentration and the results indicate a moderate binding strength for the two ligands inside HSA (1.00 +/- 0.12 x 104 M-1). The quenching effect of FL(CFL) on the fluorescence intensity of W214 (the sole tryptophan in HSA) indicates that FL and CFL occupy Site I in the protein which is known to bind several hydrophobic drugs. By performing site-competitive experiments, the location of the ligands is determined to be similar to that of the anticoagulant drug warfarin. At higher ratios of [ligand]/[HSA], we observed an upward curvature in the Stern-Volmer plots which indicates that the ligands occupy more pockets in Site I, close to W214. Our results indicate that both ligands bind in HSA with a moderate strength that should not affect their release when used as fluorescent reporters. The chemical and physical identities of the two ligands are also preserved inside the HSA binding sites.

The possible role of liver kinase B1 in hydroquinone-induced toxicity of murine fetal liver and bone marrow hematopoietic stem cells.

PubMed

Li, Zhen; Wang, Chunhong; Zhu, Jie; Bai, YuE; Wang, Wei; Zhou, Yanfeng; Zhang, Shaozun; Liu, Xiangxiang; Zhou, Sheng; Huang, Wenting; Bi, Yongyi; Wang, Hong

2016-07-01

Epidemiological studies suggest that the increasing incidence of childhood leukemia may be due to maternal exposure to benzene, which is a known human carcinogen; however, the mechanisms involved remain unknown. Liver Kinase B1 (LKB1) acts as a regulator of cellular energy metabolism and functions to regulate hematopoietic stem cell (HSC) homeostasis. We hypothesize that LKB1 contributes to the deregulation of fetal or bone hematopoiesis caused by the benzene metabolite hydroquinone (HQ). To evaluate this hypothesis, we compared the effects of HQ on murine fetal liver hematopoietic stem cells (FL-HSCs) and bone marrow hematopoietic stem cells (BM-HSCs). FL-HSCs and BM-HSCs were isolated and enriched by a magnetic cell sorting system and exposed to various concentrations of HQ (0, 1.25, 2.5, 5, 10, 20, and 40 μM) for 24 h. We found that the inhibition of differentiation and growth, as well as the apoptosis rate of FL-HSCs, induced by HQ were consistent with the changes in BM-HSCs. Furthermore, G1 cell cycle arrest was observed in BM-HSCs and FL-HSCs in response to HQ. Importantly, FL-HSCs were more sensitive than BM-HSCs after exposure to HQ. The highest induction of LKB1 and adenosine monophosphate-activated protein kinase (AMPK) was observed with a much lower concentration of HQ in FL-HSCs than in BM-HSCs. LKB1 may play a critical role in apoptosis and cell cycle arrest of HQ-treated HSCs. This research has developed innovative ideas concerning benzene-induced hematopoietic toxicity or embryotoxicity, which can provide a new experimental evidence for preventing childhood leukemia. © 2014 Wiley Periodicals, Inc. Environ Toxicol 31: 830-841, 2016. © 2014 Wiley Periodicals, Inc.

Organization - NOAA's National Weather Service

Science.gov Websites

Virginia Charleston Alabama Birmingham Huntsville Mobile Arkansas Little Rock Florida Jacksonville Key West Mobile/Pensacola Tallahassee, FL Key West, FL Miami-South Florida, FL Tampa Bay, FL Melbourne, FL

Microbial Community Structure and Biogeochemistry of Three Small Eutrophic Lakes

EPA Science Inventory

Background: The three Jackson Lakes within the Bayou Chico Watershed in NW FL, USA were formed at different times from abandoned sand pits. The lakes experienced inundation with marine water during Hurricane Ivan 2004 and, despite their proximity and similar physical structures, ...

The establishment of insulin resistance model in FL83B and L6 cell

NASA Astrophysics Data System (ADS)

Liu, Lanlan; Han, Jizhong; Li, Haoran; Liu, Mengmeng; Zeng, Bin

2017-10-01

The insulin resistance models of mouse liver epithelial and rat myoblasts cells were induced by three kinds of inducers: dexamethasone, high insulin and high glucose. The purpose is to select the optimal insulin resistance model, to provide a simple and reliable TR cell model for the study of the pathogenesis of TR and the improvement of TR drugs and functional foods. The MTT method is used for toxicity screening of three compounds, selecting security and suitable concentration. We performed a Glucose oxidase peroxidase (GOD-POD) method involving FL83B and L6 cell with dexamethasone, high insulin and high glucose-induced insulin resistance. Results suggested that FL83B cells with dexamethasone-induced (0.25uM) were established insulin resistance and L6 cells with high-glucose (30mM) and dexamethasone-induced (0.25uM) were established insulin resistance.

A European mobile satellite system concept exploiting CDMA and OBP

NASA Technical Reports Server (NTRS)

Vernucci, A.; Craig, A. D.

1993-01-01

This paper describes a novel Land Mobile Satellite System (LMSS) concept applicable to networks allowing access to a large number of gateway stations ('Hubs'), utilizing low-cost Very Small Aperture Terminals (VSAT's). Efficient operation of the Forward-Link (FL) repeater can be achieved by adopting a synchronous Code Division Multiple Access (CDMA) technique, whereby inter-code interference (self-noise) is virtually eliminated by synchronizing orthogonal codes. However, with a transparent FL repeater, the requirements imposed by the highly decentralized ground segment can lead to significant efficiency losses. The adoption of a FL On-Board Processing (OBP) repeater is proposed as a means of largely recovering this efficiency impairment. The paper describes the network architecture, the system design and performance, the OBP functions and impact on implementation. The proposed concept, applicable to a future generation of the European LMSS, was developed in the context of a European Space Agency (ESA) study contract.

Llgl1 Connects Cell Polarity with Cell-Cell Adhesion in Embryonic Neural Stem Cells.

PubMed

Jossin, Yves; Lee, Minhui; Klezovitch, Olga; Kon, Elif; Cossard, Alexia; Lien, Wen-Hui; Fernandez, Tania E; Cooper, Jonathan A; Vasioukhin, Valera

2017-06-05

Malformations of the cerebral cortex (MCCs) are devastating developmental disorders. We report here that mice with embryonic neural stem-cell-specific deletion of Llgl1 (Nestin-Cre/Llgl1 fl/fl ), a mammalian ortholog of the Drosophila cell polarity gene lgl, exhibit MCCs resembling severe periventricular heterotopia (PH). Immunohistochemical analyses and live cortical imaging of PH formation revealed that disruption of apical junctional complexes (AJCs) was responsible for PH in Nestin-Cre/Llgl1 fl/fl brains. While it is well known that cell polarity proteins govern the formation of AJCs, the exact mechanisms remain unclear. We show that LLGL1 directly binds to and promotes internalization of N-cadherin, and N-cadherin/LLGL1 interaction is inhibited by atypical protein kinase C-mediated phosphorylation of LLGL1, restricting the accumulation of AJCs to the basolateral-apical boundary. Disruption of the N-cadherin-LLGL1 interaction during cortical development in vivo is sufficient for PH. These findings reveal a mechanism responsible for the physical and functional connection between cell polarity and cell-cell adhesion machineries in mammalian cells. Copyright © 2017 Elsevier Inc. All rights reserved.

The Relationship between FL Reading Strategies and FL Reading Proficiency: A Study on Turkish EFL Learners

ERIC Educational Resources Information Center

Gönen, Ipek Kuru

2015-01-01

Reading in FL possesses certain challenges for FL readers such as difficulty in inferring underlying messages in texts and dealing with unfamiliar cultural load. All these challenges may be associated with FL learners' reading proficiency and their use of FL reading strategies especially while reading academic materials. This study aims at…

Dodecyl and octyl esters of fluorescein as protonophores and uncouplers of oxidative phosphorylation in mitochondria at submicromolar concentrations.

PubMed

Shchepinova, Maria M; Denisov, Stepan S; Kotova, Elena A; Khailova, Ljudmila S; Knorre, Dmitry A; Korshunova, Galina A; Tashlitsky, Vadim N; Severin, Fedor F; Antonenko, Yuri N

2014-01-01

In our search for fluorescent uncouplers of oxidative phosphorylation, three esters of fluorescein, n-butyl-, n-octyl-, and n-dodecyl-oxycarbonyl-fluorescein (C4-FL, C8-FL, C12-FL) were synthesized and characterized. With increasing liposomal lipid content, the long-chain alkyl derivatives of fluorescein (C8-FL, C12-FL and commercially available C18-FL), but not C4-FL and unsubstituted fluorescein, exhibited an increase in fluorescence polarization reflecting the dye binding to liposomes. C12-FL induced proton permeability in lipid membranes, while C4-FL was inactive. In contrast to C4-FL and C18-FL, C12-FL and C8-FL increased the respiration rate and decreased the membrane potential of isolated rat liver mitochondria with half-maximal effective concentrations of 700nM and 300nM, respectively. The effect of Cn-FL on the respiration correlated with that on proton permeability of the inner mitochondrial membrane, as measured by induction of mitochondria swelling in the potassium acetate medium. Binding of C8-FL to mitochondria depended on their energization, which was apparently associated with pH gradient generation across the inner mitochondrial membrane in the presence of a respiratory substrate. In wild-type yeast cells, C12-FL localized predominantly in plasma membrane, whereas in AD1-8 mutants lacking MDR pumps, it stained cytoplasmic organelles with some preference for mitochondria. Fluorescent uncouplers can be useful as a tool for determining their localization in a cell or distribution between different tissues in a living animal by fluorescent microscopy. © 2013.

Rho GTPase protein Cdc42 is critical for postnatal cartilage development

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nagahama, Ryo; Department of Orthodontics, School of Dentistry, Showa University, Tokyo; Yamada, Atsushi, E-mail: yamadaa@dent.showa-u.ac.jp

2016-02-19

Cdc42, a small Rho GTPase family member, has been shown to regulate multiple cellular functions in vitro, including actin cytoskeletal reorganization, cell migration, proliferation, and gene expression. However, its tissue-specific roles in vivo remain largely unknown, especially in postnatal cartilage development, as cartilage-specific Cdc42 inactivated mice die within a few days after birth. In this study, we investigated the physiological functions of Cdc42 during cartilage development after birth using tamoxifen-induced cartilage-specific inactivated Cdc42 conditional knockout (Cdc42 {sup fl/fl}; Col2-CreERT) mice, which were generated by crossing Cdc42 flox mice (Cdc42 {sup fl/fl}) with tamoxifen-induced type II collagen (Col2) Cre transgenic mice using a Cre/loxP system.more » The gross morphology of the Cdc42 cKO mice was shorter limbs and body, as well as reduced body weight as compared with the controls. In addition, severe defects were found in growth plate chondrocytes of the long bones, characterized by a shorter proliferating zone (PZ), wider hypertrophic zone (HZ), and loss of columnar organization of proliferating chondrocytes, resulting in delayed endochondral bone formation associated with abnormal bone growth. Our findings demonstrate the importance of Cdc42 for cartilage development during both embryonic and postnatal stages. - Highlights: • Tamoxifen-induced cartilage specific inactivated Cdc42 mutant mice were generated. • Cdc42 mutant mice were shorter limbs and body. • Severe defects were found in growth plate chondrocytes.« less

Recent advances on edible films based on fruit and vegetables- a review

USDA-ARS?s Scientific Manuscript database

A food packaging system has different functions, including those related to containment, information, and marketing. However, its primary function is to separate food from the surrounding environment, reducing food exposure to deteriorating factors such as microorganisms, oxygen, water vapor, off-fl...

Structured Finite Volume Modeling of U.S. Navy Aircraft Engine Test Cells Task 2: Turboprop Engine Vol 1

DTIC Science & Technology

1993-06-01

propeller was modeled using an actuator disk model, where in all of the net results of the propeller (wash, swirl, turbulence) are modeled as source...8217)DUCTI* ~ hVAILJZL TV D0*C) ME.UUT FULLY’ LEGIBLE FREPROI)UCTIM 𔃾S \\JiA~v~r (r7, CL w4 bj4 APPENDIX B COPY AVAUAEL TO e MonC DO* IOT flR=1 VULL...dynamics HVAC systems, energy loss measurement, power ARMY FlAP generation) BDG Shore Faciltes 3B Controls and electrical conservation (electrical systems

Identification of 2-keto-3-deoxy-d-Gluconate Kinase and 2-keto-3-deoxy-d-Phosphogluconate Aldolase in an Alginate-Assimilating Bacterium, Flavobacterium sp. Strain UMI-01

PubMed Central

Nishiyama, Ryuji; Inoue, Akira; Ojima, Takao

2017-01-01

Recently, we identified an alginate-assimilating gene cluster in the genome of Flavobacterium sp. strain UMI-01, a member of Bacteroidetes. Alginate lyase genes and a 4-deoxy-l-erythro-5-hexoseulose uronic acid (DEH) reductase gene in the cluster have already been characterized; however, 2-keto-3-deoxy-d-gluconate (KDG) kinase and 2-keto-3-deoxy-6-phosphogluconate (KDPG) aldolase genes, i.e., flkin and flald, still remained uncharacterized. The amino acid sequences deduced from flkin and flald showed low identities with those of corresponding enzymes of Saccharophagus degradans 2-40T, a member of Proteobacteria (Kim et al., Process Biochem., 2016). This led us to consider that the DEH-assimilating enzymes of Bacteroidetes species are somewhat deviated from those of Proteobacteria species. Thus, in the present study, we first assessed the characteristics in the primary structures of KDG kinase and KDG aldolase of the strain UMI-01, and then investigated the enzymatic properties of recombinant enzymes, recFlKin and recFlAld, expressed by an Escherichia coli expression system. Multiple-sequence alignment among KDG kinases and KDG aldolases from several Proteobacteria and Bacteroidetes species indicated that the strain UMI-01 enzymes showed considerably low sequence identities (15%–25%) with the Proteobacteria enzymes, while they showed relatively high identities (47%–68%) with the Bacteroidetes enzymes. Phylogenetic analyses for these enzymes indicated the distant relationship between the Proteobacteria enzymes and the Bacteroidetes enzymes, i.e., they formed distinct clusters in the phylogenetic tree. recFlKin and recFlAld produced with the genes flkin and flald, respectively, were confirmed to show KDG kinase and KDPG aldolase activities. Namely, recFlKin produced 1.7 mM KDPG in a reaction mixture containing 2.5 mM KDG and 2.5 mM ATP in a 90-min reaction, while recFlAld produced 1.2 mM pyruvate in the reaction mixture containing 5 mM KDPG at the equilibrium state. An in vitro alginate-metabolizing system constructed from recFlKin, recFlAld, and previously reported alginate lyases and DEH reductase of the strain UMI-01 could convert alginate to pyruvate and glyceraldehyde-3-phosphate with an efficiency of 38%. PMID:28216576

FAA Aviation Forecasts

DTIC Science & Technology

1992-02-01

MKK) Daytona Beach, FL (DAB) Boise, ID (BOI) Fort Lauderdale, FL (FLL) Idaho Falls Fanning Field, ID (IDA) Fort Lauderdale Executive, FL (FXE... Lewiston , ID (LWS) Fort Myers Page Field, FL (FMY) Pocatello, ID (PIH) Fort Myers Regional, FL (RSW) Twin Falls, ID (TWF) Fort Pierce, FL (FPR) Alton St... Idaho (SUN) 6. Marion Williamson County, Illinois (MWA) 7. Waukegan, Illinois (UGN) 8. Topeka-Phillip Ballard, Kansas (TOP) 9. Owensboro-Daviees County

Publications - GMC 304 | Alaska Division of Geological & Geophysical

Science.gov Websites

DGGS GMC 304 Publication Details Title: Hard-rock geochemical data of core from the FL-001, FL-003, and . Bibliographic Reference Unknown, 2002, Hard-rock geochemical data of core from the FL-001, FL-003, and FL-004

CD10 down expression in follicular lymphoma correlates with gastrointestinal lesion involving the stomach and large intestine.

PubMed

Ohnishi, Nobuhiko; Takata, Katsuyoshi; Miyata-Takata, Tomoko; Sato, Yasuharu; Tari, Akira; Gion, Yuka; Noujima-Harada, Mai; Taniguchi, Kohei; Tabata, Tetsuya; Nagakita, Keina; Omote, Shizuma; Takahata, Hiroyuki; Iwamuro, Masaya; Okada, Hiroyuki; Maeda, Yoshinobu; Yanai, Hiroyuki; Yoshino, Tadashi

2016-11-01

Follicular lymphoma (FL) shows co-expression of B-cell lymphoma 2 (BCL2) and CD10, whereas downexpression of CD10 is occasionally experienced in gastrointestinal (GI) FL with unknown significance. Gastrointestinal FL is a rare variant of FL, and its similarity with mucosa-associated lymphoid tissue lymphoma was reported. We investigated the clinicopathological and genetic features of CD10 downexpressed (CD10 down ) GI-FL. The diagnosis of CD10 down FL was carried out with a combination of pathological and molecular analyses. The incidence of CD10 down GI-FL was shown in 35/172 (20.3%) cases, which was more frequent than nodal FL (3.5%, P < 0.001). The difference was additionally significant between GI-FL and nodal FL when the analysis was confined to primary GI-FL (55.2% vs 3.5%, P < 0.001). Compared to CD10 + GI-FL, CD10 down GI-FL significantly involved the stomach or large intestine (P = 0.015), and additionally showed the downexpression of BCL6 (P < 0.001). The follicular dendritic cell meshwork often showed a duodenal pattern in the CD10 down group (P = 0.12). Furthermore, a lymphoepithelial lesion was observed in 5/12 (40%) gastric FL cases, which indicated caution in the differentiation of mucosa-associated lymphoid tissue lymphoma. Molecular analyses were undertaken in seven cases of CD10 down GI-FL, and an identical clone was found between CD10 down follicles and CD10 + BCL2 + neoplastic follicles. In the diagnosis of cases with CD10 down BCL2 + follicles, careful examination with molecular studies should be carried out. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Functional genomics of fuzzless-lintless mutant of Gossypium hirsutum L. cv. MCU5 reveal key genes and pathways involved in cotton fibre initiation and elongation

PubMed Central

2012-01-01

Background Fuzzless-lintless cotton mutants are considered to be the ideal material to understand the molecular mechanisms involved in fibre cell development. Although there are few reports on transcriptome and proteome analyses in cotton at fibre initiation and elongation stages, there is no comprehensive comparative transcriptome analysis of fibre-bearing and fuzzless-lintless cotton ovules covering fibre initiation to secondary cell wall (SCW) synthesis stages. In the present study, a comparative transcriptome analysis was carried out using G. hirsutum L. cv. MCU5 wild-type (WT) and it’s near isogenic fuzzless-lintless (fl) mutant at fibre initiation (0 dpa/days post anthesis), elongation (5, 10 and 15 dpa) and SCW synthesis (20 dpa) stages. Results Scanning electron microscopy study revealed the delay in the initiation of fibre cells and lack of any further development after 2 dpa in the fl mutant. Transcriptome analysis showed major down regulation of transcripts (90%) at fibre initiation and early elongation (5 dpa) stages in the fl mutant. Majority of the down regulated transcripts at fibre initiation stage in the fl mutant represent calcium and phytohormone mediated signal transduction pathways, biosynthesis of auxin and ethylene and stress responsive transcription factors (TFs). Further, transcripts involved in carbohydrate and lipid metabolisms, mitochondrial electron transport system (mETS) and cell wall loosening and elongation were highly down-regulated at fibre elongation stage (5–15 dpa) in the fl mutant. In addition, cellulose synthases and sucrose synthase C were down-regulated at SCW biosynthesis stage (15–20 dpa). Interestingly, some of the transcripts (~50%) involved in phytohormone signalling and stress responsive transcription factors that were up-regulated at fibre initiation stage in the WT were found to be up-regulated at much later stage (15 dpa) in fl mutant. Conclusions Comparative transcriptome analysis of WT and its near isogenic fl mutant revealed key genes and pathways involved at various stages of fibre development. Our data implicated the significant role of mitochondria mediated energy metabolism during fibre elongation process. The delayed expression of genes involved in phytohormone signalling and stress responsive TFs in the fl mutant suggests the need for a coordinated expression of regulatory mechanisms in fibre cell initiation and differentiation. PMID:23151214

46 CFR 7.95 - St. Johns Point, FL to Miami Beach, FL.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 46 Shipping 1 2010-10-01 2010-10-01 false St. Johns Point, FL to Miami Beach, FL. 7.95 Section 7... LINES Atlantic Coast § 7.95 St. Johns Point, FL to Miami Beach, FL. (a) A line drawn from the seaward extremity of St. Augustine Inlet north jetty to latitude 29°55′ N. longitude 81°15.3′ W. (St. Augustine...

[Psychophysiological research of changes of the functional condition of the neuro-psychic sphere of younger schoolchildren during the school day at luminescent and LED lighting in the classroom].

PubMed

Teksheva, L M; Nadezhdin, D S

2014-01-01

The purpose of the study is to test the hypothesis that the LED lighting (LL) in training class does not have a negative impact on the change in the functional state of the neuro-psychiatric sphere in pupils by the end of the school day, if compared with traditional for schools fluorescent lighting (FL). With the help of specially matched methods for psychophysiological examination there was performed the testing of changes in the functional state of the neuro-psychiatric in pupils during the school day and there was made an analysis of these changes in dependence on the type of lighting the classroom. LL, if compared to FL, was established to lead to a significant weakening of the negative changes of functional lability of the visual analyzer, the power of excitation of the nervous system and cognitive functions, as well as to an increase in positive changes in psychomotorics. The data obtained allow us to recommend the use of LED lighting equipment in modern schools.

Pyrosequencing analysis of free-living and attached bacterial communities in Meiliang Bay, Lake Taihu, a large eutrophic shallow lake in China.

PubMed

Tang, Xiangming; Li, Linlin; Shao, Keqiang; Wang, Boweng; Cai, Xianlei; Zhang, Lei; Chao, Jianying; Gao, Guang

2015-01-01

To elucidate the relationship between particle-attached (PA, ≥ 5.0 μm) and free-living (FL, 0.2-5.0 μm) bacterial communities, samplings were collected seasonally from November 2011 to August 2012 in Meiliang Bay, Lake Taihu, China. We used 454 pyrosequencing of 16S rRNA genes to study bacterial diversity and structure of PA and FL communities. The analysis rendered 37,985 highly qualified reads, subsequently assigned to 1755 operational taxonomic units (97% similarity) for the 8 samples. Although 27 high-level taxonomic groups were obtained, the 3 dominant phyla (Proteobacteria, Actinobacteria, and Bacteroidetes) comprised about 75.9% and 82.4% of the PA and FL fractions, respectively. Overall, we found no significant differences between community types, as indicated by ANOSIM R statistics (R = 0.063, P > 0.05) and the Parsimony test (P = 0.222). Dynamics of bacterial communities were correlated with changes in concentrations of total suspended solids (TSS) and total phosphorus (TP). In summer, a significant taxonomic overlap in the 2 size fractions was observed when Cyanobacteria, a major contributor of TSS and TP, dominated in the water, highlighting the potential rapid exchange between PA and FL bacterial populations in large shallow eutrophic lakes.

Similarities of prosurvival signals in Bcl-2-positive and Bcl-2-negative follicular lymphomas identified by reverse phase protein microarray.

PubMed

Zha, Hongbin; Raffeld, Mark; Charboneau, Lu; Pittaluga, Stefania; Kwak, Larry W; Petricoin, Emanuel; Liotta, Lance A; Jaffe, Elaine S

2004-02-01

Overexpression of Bcl-2 protein has been known to play a role in the pathogenesis of follicular lymphoma (FL). However, 10-15% of FLs are negative for Bcl-2 by immunohistochemistry, raising the possibility that another gene product(s) may provide prosurvival signal(s). We used reverse phase protein microarray to analyze lysates of follicle center cells isolated by laser capture microdissection from: Bcl-2+ FL, Bcl-2- FL and reactive follicular hyperplasia (FH) (nine cases each group). TUNEL assay confirmed similar and reduced levels of apoptosis in Bcl-2+ FL and Bcl-2- FL, indicating the likelihood of Bcl-2-independent inhibition of apoptosis. Arrays were quantitatively analyzed with antibodies to proteins involved in the apoptotic pathway. As expected, Bcl-2 levels were up to eight-fold higher in Bcl-2+ FL than in FH and Bcl-2- FL. However, there was no difference in levels of Mcl-1 and survivin among these three groups. Bcl-X(L) showed a trend for increased expression in Bcl-2- FL as compared with Bcl-2+ FL, although the differences did not reach statistical significance (P>0.1). The increase in Bcl-X(L) may provide an alternative antiapoptotic signal in FL negative for Bcl-2 protein. Interestingly, Bax expression was higher in FL (Bcl-2+ or -) than in FH (P=0.001). Notably, phospho-Akt (Ser-473) was increased in FL (Bcl-2+ or -) (P<0.03) with increased phospho-Bad (Ser-136), as compared with levels in FH. The activation of the Akt/Bad pathway provides further evidence of prosurvival signals in FL, independent of Bcl-2 alone. These data suggest that nodal FL represents a single disease with a final common biochemical pathway.

Calmodulin gene expression in response to mechanical wounding and Botrytis cinerea infection in tomato fruit

USDA-ARS?s Scientific Manuscript database

Calmodulin, a ubiquitous calcium sensor, plays an important role in decoding the stress-triggered intracellular calcium changes and regulates the functions of numerous target proteins involved in various physiological responses in plants. To determine the functional significance of calmodulin in fl...

Colpocephaly

MedlinePlus

... Organizations Birth Defect Research for Children, Inc. 976 Lake Baldwin Lane Suite 104 Orlando FL Orlando, FL ... Organizations Birth Defect Research for Children, Inc. 976 Lake Baldwin Lane Suite 104 Orlando FL Orlando, FL ...

33 CFR 80.805 - Rock Island, FL to Cape San Blas, FL.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Rock Island, FL to Cape San Blas, FL. 80.805 Section 80.805 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Eighth District § 80.805 Rock Island, FL...

33 CFR 80.805 - Rock Island, FL to Cape San Blas, FL.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Rock Island, FL to Cape San Blas, FL. 80.805 Section 80.805 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Eighth District § 80.805 Rock Island, FL...

33 CFR 80.805 - Rock Island, FL to Cape San Blas, FL.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Rock Island, FL to Cape San Blas, FL. 80.805 Section 80.805 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Eighth District § 80.805 Rock Island, FL...

33 CFR 80.805 - Rock Island, FL to Cape San Blas, FL.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Rock Island, FL to Cape San Blas, FL. 80.805 Section 80.805 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Eighth District § 80.805 Rock Island, FL...

33 CFR 80.805 - Rock Island, FL to Cape San Blas, FL.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Rock Island, FL to Cape San Blas, FL. 80.805 Section 80.805 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Eighth District § 80.805 Rock Island, FL...

33 CFR 80.753 - St. Petersburg, FL to the Anclote, FL.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false St. Petersburg, FL to the Anclote, FL. 80.753 Section 80.753 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Gulf Coast § 80.753 St. Petersburg, FL to...

33 CFR 80.750 - Sanibel Island, FL to St. Petersburg, FL.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Sanibel Island, FL to St. Petersburg, FL. 80.750 Section 80.750 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... St. Petersburg, FL. (a) A line formed by the centerline of the highway bridge over Blind Pass...

Integrative transcriptome, proteome, phosphoproteome and genetic mapping reveals new aspects in a fiberless mutant of cotton

PubMed Central

Ma, Qi-Feng; Wu, Chun-Hui; Wu, Man; Pei, Wen-Feng; Li, Xing-Li; Wang, Wen-Kui; Zhang, Jinfa; Yu, Ji-Wen; Yu, Shu-Xun

2016-01-01

To investigate the molecular mechanisms of fiber initiation in cotton (Gossypium spp.), an integrated approach combining transcriptome, iTRAQ-based proteome and genetic mapping was taken to compare the ovules of the Xuzhou 142 wild type (WT) with its fuzzless-lintless (fl) mutant at −3 and 0 day post-anthesis. A total of 1,953 mRNAs, 187 proteins, and 131 phosphoproteins were differentially expressed (DE) between WT and fl, and the levels of transcripts and their encoded proteins and phosphoproteins were highly congruent. A functional analysis suggested that the abundance of proteins were mainly involved in amino sugar, nucleotide sugar and fatty acid metabolism, one carbon pool for folate metabolism and flavonoid biosynthesis. qRT-PCR, Western blotting, and enzymatic assays were performed to confirm the regulation of these transcripts and proteins. A molecular mapping located the lintless gene li3 in the fl mutant on chromosome 26 for the first time. A further in-silico physical mapping of DE genes with sequence variations between fl and WT identified one and four candidate genes in the li3 and n2 regions, respectively. Taken together, the transcript abundance, phosphorylation status of proteins at the fiber initiation stage and candidate genes have provided insights into regulatory processes underlying cotton fiber initiation. PMID:27075604

Discrepancy between social and nonsocial decision-making under uncertainty following prefrontal lobe damage: the impact of an interactionist approach.

PubMed

Besnard, J; Le Gall, D; Chauviré, V; Aubin, G; Etcharry-Bouyx, F; Allain, P

2017-08-01

Deficits in decision-making are thought to contribute significantly to socio-behavioral impairments of patients with frontal lobe damage. The purpose of this study was to test the hypothesis of whether the inappropriate social behavior of patients with frontal lesions can be viewed as the product of a general failure of decision-making ability or as the result of socio-cognitive impairment. We studied a group of patients with prefrontal lesions (FL patients, n = 15) and a group of matched healthy controls (n = 30) on the Iowa Gambling task (IGT) of nonsocial decision-making, environmental dependency phenomena (EDP) during social interaction, and the "reading the mind in the eyes" and "character intention task" of theory of mind (TOM) tasks. The FL patients were impaired in both TOM and EDP protocols but, surprisingly, they behaved appropriately in the IGT. In addition, FL patients with EDP did not differ in executive functioning, IGT and TOM measures from those who did not demonstrate these behavioral disorders. The right orbitofrontal cortex was associated with social decision-making deficits. By adopting an interactionist approach, this study raises the possibility of identifying components of social and nonsocial decision-making, which could be helpful in understanding the behavioral disorders of FL patients.

Double-blind, randomized, multicenter study comparing the effect of betahistine and flunarizine on the dizziness handicap in patients with recurrent vestibular vertigo.

PubMed

Albera, Roberto; Ciuffolotti, Roberto; Di Cicco, Maurizio; De Benedittis, Giuseppe; Grazioli, Irene; Melzi, Gabriella; Mira, Eugenio; Pallestrini, Eugenio; Passali, Desiderio; Serra, Agostino; Vicini, Claudio

2003-06-01

The aim of this double-blind, randomized, multicenter study was to compare the efficacy of betahistine dihydrochloride (BH) and flunarizine (FL) using the Dizziness Handicap Inventory (DHI), a validated self-assessment questionnaire that has not previously been used in a clinical trial to evaluate antivertigo drugs. Patients with recurrent vertigo of peripheral vestibular origin and who were severely handicapped by vertigo were randomized to an 8-week course of treatment with oral BH 48 mg daily or oral FL 10 mg daily. The efficacy endpoints were the total DHI score and the physical, functional and emotional subscores. Fifty-two patients completed the study. After 8 weeks of treatment the mean total DHI score and the physical subscore were significantly lower in the BH group compared to the FL group (7.5 and 3.6 points, respectively). The mean total DHI score as well as the three subscores decreased significantly after 4 and 8 weeks in both treatment groups. This study showed that at 8 weeks BH is significantly more effective than FL in terms of improving the total DHI score and the physical subscore. It was also established that the DHI is a useful and reliable method for evaluating the efficacy of antivertigo drugs.

Lead effects on Brassica napus photosynthetic organs.

PubMed

Ferreyroa, Gisele V; Lagorio, M Gabriela; Trinelli, María A; Lavado, Raúl S; Molina, Fernando V

2017-06-01

In this study, effects of lead on ultracellular structure and pigment contents of Brassica napus were examined. Pb(II) was added in soluble form to soil prior to sowing. Pb contents were measured in plant organs at the ontogenetic stages of flowering (FL) and physiological maturity (PM). Pigment contents were evaluated through reflectance measurements. Pb content in organs was found to decrease in the order; roots>stems>leaves. Lead content in senescent leaves at FL stage was significantly higher than harvested leaves, strongly suggesting a detoxification mechanism. Leaves and stems harvested at the PM stage showed damage at subcellular level, namely chloroplast disorganization, cell wall damage and presence of osmiophilic bodies. Chlorophyll content increased in the presence of Pb at the FL stage, compared with control; at the PM stage, chlorophyll contents decreased with low Pb concentration but showed no significant differences with control at high Pb soil concentration. The results suggest an increase in antioxidants at low Pb concentration and cell damage at higher lead concentration. Copyright © 2017 Elsevier Inc. All rights reserved.

Vibrational dynamics of the CO stretching of 9-fluorenone studied by visible-pump and infrared-probe spectroscopy.

PubMed

Fukui, Yuki; Ohta, Kaoru; Tominaga, Keisuke

2015-01-01

We studied the effects of hydrogen bonds on the vibrational structures and vibrational dynamics of the CO stretching mode of 9-fluorenone (FL) in the electronically excited state in aprotic and protic solvents using sub-picosecond visible-pump and IR-probe spectroscopy. The transient IR spectrum of the CO stretching band in methanol-d4 has two bands at 1529.9 cm(-1) and 1543.4 cm(-1), which are assigned to an FL-solvent complex and free FL, respectively. In the aprotic solvents, the CO stretching bands show blue-shifts in time. This shift is due to vibrational cooling, which is derived from anharmonic couplings with some low-frequency modes. Interestingly, a red-shift is observed at later delay time for the band at 1529.9 cm(-1) in methanol-d4. A possible mechanism of this spectral shift is related to the hydrogen bond dynamics between the solute and solvent.

Interferon-β Inhibits Neurotrophin 3 Signalling and Pro-Survival Activity by Upregulating the Expression of Truncated TrkC-T1 Receptor.

PubMed

Dedoni, Simona; Olianas, Maria C; Ingianni, Angela; Onali, Pierluigi

2017-04-01

Although clinically useful for the treatment of various diseases, type I interferons (IFNs) have been implicated as causative factors of a number of neuroinflammatory disorders characterized by neuronal damage and altered CNS functions. As neurotrophin 3 (NT3) plays a critical role in neuroprotection, we examined the effects of IFN-β on the signalling and functional activity of the NT3/TrkC system. We found that prolonged exposure of differentiated human SH-SY5Y neuroblastoma cells to IFN-β impaired the ability of NT3 to induce transphosphorylation of the full-length TrkC receptor (TrkC-FL) and the phosphorylation of downstream signalling molecules, including PLCγ1, Akt, GSK-3β and ERK1/2. NT3 was effective in protecting the cells against apoptosis triggered by serum withdrawal or thapsigargin but not IFN-β. Prolonged exposure to the cytokine had little effects on TrkC-FL levels but markedly enhanced the messenger RNA (mRNA) and protein levels of the truncated isoform TrkC-T1, a dominant-negative receptor that inhibits TrkC-FL activity. Cell depletion of TrkC-T1 by small interfering RNA (siRNA) treatment enhanced NT3 signalling through TrkC-FL and allowed the neurotrophin to counteract IFN-β-induced apoptosis. Furthermore, the upregulation of TrkC-T1 by IFN-β was associated with the inhibition of NT3-induced recruitment of the scaffold protein tamalin to TrkC-T1 and tamalin tyrosine phosphorylation. These data indicate that IFN-β exerts a negative control on NT3 pro-survival signalling through a novel mechanism involving the upregulation of TrkC-T1.

Gold–superheavy-element interaction in diatomics and cluster adducts: A combined four-component Dirac-Kohn-Sham/charge-displacement study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rampino, Sergio, E-mail: srampino@thch.unipg.it; Belpassi, Leonardo, E-mail: leonardo.belpassi@cnr.it; Storchi, Loriano

The chemistry of superheavy elements (Z ≥ 104) is actively investigated in atom-at-a-time experiments of volatility through adsorption on gold surfaces. In this context, common guidelines for interpretation based on group trends in the periodic table should be used cautiously, because relativistic effects play a central role and may cause predictions to fall short. In this paper, we present an all-electron four-component Dirac-Kohn-Sham comparative study of the interaction of gold with Cn (Z = 112), Fl (Z = 114), and Uuo (Z = 118) versus their lighter homologues of the 6th period, Hg, Pb, and Rn plus the noble gasmore » Xe. Calculations were carried out for Au–E (E = Hg, Cn, Pb, Fl, Xe, Rn, Uuo), Au{sub 7}– and Au{sub 20}–E (E = Hg, Cn, Pb, Fl, Rn) complexes, where Au{sub 7} (planar) and Au{sub 20} (pyramidal) are experimentally determined clusters having structures of increasing complexity. Results are analysed both in terms of the energetics of the complexes and of the electron charge rearrangement accompanying their formation. In line with the available experimental data, Cn and more markedly Fl are found to be less reactive than their lighter homologues. On the contrary, Uuo is found to be more reactive than Rn and Xe. Cn forms the weakest bond with the gold atom, compared to Fl and Uuo. The reactivity of Fl decreases with increasing gold-fragment size more rapidly than that of Cn and, as a consequence, the order of the reactivity of these two elements is inverted upon reaching the Au{sub 20}-cluster adduct. Density difference maps between adducts and fragments reveal similarities in the behaviour of Cn and Xe, and in that of Uuo and the more reactive species Hg and Pb. These findings are given a quantitative ground via charge-displacement analysis.« less

Gold-superheavy-element interaction in diatomics and cluster adducts: A combined four-component Dirac-Kohn-Sham/charge-displacement study.

PubMed

Rampino, Sergio; Storchi, Loriano; Belpassi, Leonardo

2015-07-14

The chemistry of superheavy elements (Z ≥ 104) is actively investigated in atom-at-a-time experiments of volatility through adsorption on gold surfaces. In this context, common guidelines for interpretation based on group trends in the periodic table should be used cautiously, because relativistic effects play a central role and may cause predictions to fall short. In this paper, we present an all-electron four-component Dirac-Kohn-Sham comparative study of the interaction of gold with Cn (Z = 112), Fl (Z = 114), and Uuo (Z = 118) versus their lighter homologues of the 6th period, Hg, Pb, and Rn plus the noble gas Xe. Calculations were carried out for Au-E (E = Hg, Cn, Pb, Fl, Xe, Rn, Uuo), Au7- and Au20-E (E = Hg, Cn, Pb, Fl, Rn) complexes, where Au7 (planar) and Au20 (pyramidal) are experimentally determined clusters having structures of increasing complexity. Results are analysed both in terms of the energetics of the complexes and of the electron charge rearrangement accompanying their formation. In line with the available experimental data, Cn and more markedly Fl are found to be less reactive than their lighter homologues. On the contrary, Uuo is found to be more reactive than Rn and Xe. Cn forms the weakest bond with the gold atom, compared to Fl and Uuo. The reactivity of Fl decreases with increasing gold-fragment size more rapidly than that of Cn and, as a consequence, the order of the reactivity of these two elements is inverted upon reaching the Au20-cluster adduct. Density difference maps between adducts and fragments reveal similarities in the behaviour of Cn and Xe, and in that of Uuo and the more reactive species Hg and Pb. These findings are given a quantitative ground via charge-displacement analysis.

Silver nanoparticles-enhanced time-resolved fluorescence sensor for VEGF(165) based on Mn-doped ZnS quantum dots.

PubMed

Zhu, Dong; Li, Wei; Wen, Hong-Mei; Yu, Sheng; Miao, Zhao-Yi; Kang, An; Zhang, Aihua

2015-12-15

A silver nanoparticles (AgNPs)-enhanced time-resolved fluorescence (TR-FL) sensor based on long-lived fluorescent Mn-doped ZnS quantum dots (QDs) is developed for the sensitive detection of vascular endothelial growth factor-165 (VEGF165), a predominant cancer biomarker in cancer angiogenesis. The aptamers bond with the Mn-doped ZnS QDs and the BHQ-2 quencher-labelling strands hybridized in duplex are coupled with streptavidin (SA)-functionalized AgNPs to form the AgNPs-enhanced TR-FL sensor, showing lower fluorescence intensity in the duplex state due to the fluorescence resonance energy transfer (FRET) between the Mn-doped ZnS QDs and quenchers. Upon the addition of VEGF165, the BHQ-2 quencher-labelling strands of the duplex are displaced, leading to the disruption of the FRET. As a result, the fluorescence of the Mn-doped QDs within the proximity of the AgNPs is recovered. The FL signal can be measured free of the interference of short-lived background by setting appropriate delay time and gate time, which offers a signal with high signal-to-noise ratio in photoluminescent biodetection. Compared with the bare TR-FL sensor, the AgNPs-based TR-FL sensor showed a huge improvement in fluorescence based on metal-enhanced fluorescence (MEF) effect, and the sensitivity increased 11-fold with the detection limit of 0.08 nM. In addition, the sensor provided a wide range of linear detection from 0.1 nM to 16 nM. Copyright © 2015 Elsevier B.V. All rights reserved.

[Prevalence of extrinsic allergic alveolitis in cattle breeders from the province of Reggio Emilia].

PubMed

Ferri, F; Ruggieri, Maria Paola; Guidetti, G; Azzarone, G; Giammartini, Pasquina; Capanni, S; Mantovani, P; Bertani, Marisa

2003-01-01

Several new cases of Extrinsic Allergic Alveolitis or Farmer's Lung (FL) in farm workers were reported to Occupational Health Services in the province of Reggio Emilia (Italy). This prompted the Public Health Department to study the prevalence of the disease among milk-cow breeders involved in Parmigiano-Reggiano cheese production: who are the biggest hay users. A suitable questionnaire was sent to 1875 farmers in three of the six districts of the province. Half of them (935: 841 males, 94 females) answered; further contacts and medical history research revealed 33 case of "likely FL". Twenty-three (2 females) (10 "missing"), underwent pulmonary function tests, chest X-rays, precipitins tests against Saccharopolyspora Rectivirgula and other fungal antigens and (22 farmers) bronchoalveolar lavage (BAL). According to the "Società Italiana di Medicina del Lavoro e di Igiene Industriale" diagnostic standards, we found 20 subjects suffering from FL among farmers collecting hay in large cylindrical (round) bales, dried on field (2.6%) and among others still using small (traditional), prismatic bales (0.5%). The prevalence on the whole exposed population (6000-9000 people) was estimated between 1.5% and 3.0% (90-270 people); no difference was found in FL prevalence between flat and hilly or mountain areas; the method of collecting hay in big "round" bales, dried on field, seems to produce higher frequencies of FL cases if compared with the traditional ones (more frequent in mountain areas). The new hay packing methods, using forced air driers, are suggested as a possible solution.

The Structure and Bonding State for Fullerene-Like Carbon Nitride Films with High Hardness Formed by Electron Cyclotron Resonance Plasma Sputtering

NASA Astrophysics Data System (ADS)

Kamata, Tomoyuki; Niwa, Osamu; Umemura, Shigeru; Hirono, Shigeru

2012-12-01

We studied pure carbon films and carbon nitride (CN) films by using electron cyclotron resonance (ECR) sputtering. The main feature of this method is high density ion irradiation during deposition, which enables the pure carbon films to have fullerene-like (FL) structures without nitrogen incorporation. Furthermore, without substrate heating, the ECR sputtered CN films exhibited an enhanced FL microstructure and hardness comparable to that of diamond at intermediate nitrogen concentration. This microstructure consisted of bent and cross-linked graphene sheets where layered areas remarkably decreased due to increased sp3 bonding. Under high nitrogen concentration conditions, the CN films demonstrated extremely low hardness because nitrile bonding not only decreased the covalent-bonded two-dimensional hexagonal network but also annihilated the bonding there. By evaluating lattice images obtained by transmission electron microscopy and the bonding state measured by X-ray photoelectron spectroscopy, we classified the ECR sputtered CN films and offered phase diagram and structure zone diagram.

Light propagation in the averaged universe

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bagheri, Samae; Schwarz, Dominik J., E-mail: s_bagheri@physik.uni-bielefeld.de, E-mail: dschwarz@physik.uni-bielefeld.de

Cosmic structures determine how light propagates through the Universe and consequently must be taken into account in the interpretation of observations. In the standard cosmological model at the largest scales, such structures are either ignored or treated as small perturbations to an isotropic and homogeneous Universe. This isotropic and homogeneous model is commonly assumed to emerge from some averaging process at the largest scales. We assume that there exists an averaging procedure that preserves the causal structure of space-time. Based on that assumption, we study the effects of averaging the geometry of space-time and derive an averaged version of themore » null geodesic equation of motion. For the averaged geometry we then assume a flat Friedmann-Lemaître (FL) model and find that light propagation in this averaged FL model is not given by null geodesics of that model, but rather by a modified light propagation equation that contains an effective Hubble expansion rate, which differs from the Hubble rate of the averaged space-time.« less

Gastrectomy - slideshow

MedlinePlus

... the small intestine, and functions to break up food into small particles that can be absorbed by the small intestine. Review Date 11/10/2016 Updated by: Todd Gersten, MD, Hematology/Oncology, Florida Cancer Specialists & Research Institute, Wellington, FL. ...

Trends in Advertising Typography.

ERIC Educational Resources Information Center

Moriarty, Sandra Ernst

1982-01-01

Reviews advertising typography in general interest, special interest, and trade magazines and concludes that special interest magazine ads are making the most effort to be fashionable, but also have the greatest chance of having functional problems. (FL)

Financial Literacy among Israeli College Students

ERIC Educational Resources Information Center

Shahrabani, Shosh

2013-01-01

In this study, responses of 574 students from two colleges in Israel were used to examine three issues: (a) financial literacy (FL) among Israeli college students, (b) gaps in FL between Jews and Arabs, and (c) factors affecting students' FL. The results showed that Israeli students exhibit a low level of FL and that FL is affected by gender,…

Meeting the Needs of Foreign Language Teaching Assistants: Professional Development in American Universities

ERIC Educational Resources Information Center

Angus, Katie

2014-01-01

In our post-9/11 globalized society, the bifurcated governance structure that has traditionally dominated foreign language (FL) departments is no longer desirable. According to the 2007 Modern Language Association (MLA) report entitled "Foreign Languages and Higher Education: New Structures for a Changed World," these departments need to…

QuIP: A Writing Strategy to Improve Comprehension of Expository Structure.

ERIC Educational Resources Information Center

McLaughlin, Elaine M.

1987-01-01

Provides a rationale for the reading/writing connection through a brief review of research and describes Questions into Paragraphs (QuIP), a three-step procedure designed to improve expository awareness. (FL)

Individualized management of follicular lymphoma.

PubMed

Bai, Bing; Huang, Hui-Qiang

2015-03-01

Follicular lymphoma (FL) is the most common indolent non-hodgkin lymphoma. Most patients with FL are diagnosed with advanced disease and are considered incurable. The classical prognostic index in FL is the FL international prognostic index (FLIPI). The management of FL is mainly determined by histologic grading, clinical stage, and tumor burden. For patients with stage I and II disease, an involved-site radiation therapy (ISRT) is recommended and may be potentially curative approach with 60% to 80% of 10-year overall survival (OS) rates, while patients with stage III and IV should be treated with systemic therapy. The watchful waiting is still an option for patients without symptoms or/and low tumor burden. Induction of immuno-chemotherapy combined with consolidation of rituximab maintenance (MR) is standard care for patients with symptomatic disease or with high tumor burden when treatment indicated. The major indication for systemic therapy is including candidate for clinical trials, threatened end organ function, cytopenia secondary to lymphoma bulky disease and steady progress etc. at present time. Routine baseline and regular hepatitis B surface antigen (HBsAg) and hepatitis B core antibody (HBcAb) testing is strongly recommended for all patients before the initiation of immuno-chemotherapy in order to minimize the risk of hepatitis B virus (HBV) reactivation which has been observed approximately 20% to 50% of patients with positive HBsAg and 3% to 45% of patients with positive HBcAb. Prophylactic antiviral treatment in patients who are HBsAg-positive or HBcAb-positive is indicated before immuno-chemotherapy. The management for elderly patients should be carefully selected to avoid overtreatment and severe toxicities. Individualized dose adjustment for chemotherapy and an adequate supportive treatment are essential for this special population. Novel agents such as lenalidomide, ibrutinib and idelalisib are promising. In conclusion, individualized management of FL remains challenging and role of new targeted agents need to be defined.

Validated Computational Model to Compute Re-apposition Pressures for Treating Type-B Aortic Dissections.

PubMed

Ahuja, Aashish; Guo, Xiaomei; Noblet, Jillian N; Krieger, Joshua F; Roeder, Blayne; Haulon, Stephan; Chambers, Sean; Kassab, Ghassan S

2018-01-01

The use of endovascular treatment in the thoracic aorta has revolutionized the clinical approach for treating Stanford type B aortic dissection. The endograft procedure is a minimally invasive alternative to traditional surgery for the management of complicated type-B patients. The endograft is first deployed to exclude the proximal entry tear to redirect blood flow toward the true lumen and then a stent graft is used to push the intimal flap against the false lumen (FL) wall such that the aorta is reconstituted by sealing the FL. Although endovascular treatment has reduced the mortality rate in patients compared to those undergoing surgical repair, more than 30% of patients who were initially successfully treated require a new endovascular or surgical intervention in the aortic segments distal to the endograft. One reason for failure of the repair is persistent FL perfusion from distal entry tears. This creates a patent FL channel which can be associated with FL growth. Thus, it is necessary to develop stents that can promote full re-apposition of the flap leading to complete closure of the FL. In the current study, we determine the radial pressures required to re-appose the mid and distal ends of a dissected porcine thoracic aorta using a balloon catheter under static inflation pressure. The same analysis is simulated using finite element analysis (FEA) models by incorporating the hyperelastic properties of porcine aortic tissues. It is shown that the FEA models capture the change in the radial pressures required to re-appose the intimal flap as a function of pressure. The predictions from the simulation models match closely the results from the bench experiments. The use of validated computational models can support development of better stents by calculating the proper radial pressures required for complete re-apposition of the intimal flap.

Zc3h13/Flacc is required for adenosine methylation by bridging the mRNA-binding factor Rbm15/Spenito to the m6A machinery component Wtap/Fl(2)d

PubMed Central

Knuckles, Philip; Lence, Tina; Haussmann, Irmgard U.; Jacob, Dominik; Kreim, Nastasja; Carl, Sarah H.; Masiello, Irene; Hares, Tina; Villaseñor, Rodrigo; Hess, Daniel; Andrade-Navarro, Miguel A.; Biggiogera, Marco; Helm, Mark; Soller, Matthias; Bühler, Marc; Roignant, Jean-Yves

2018-01-01

N6-methyladenosine (m6A) is the most abundant mRNA modification in eukaryotes, playing crucial roles in multiple biological processes. m6A is catalyzed by the activity of methyltransferase-like 3 (Mettl3), which depends on additional proteins whose precise functions remain poorly understood. Here we identified Zc3h13 (zinc finger CCCH domain-containing protein 13)/Flacc [Fl(2)d-associated complex component] as a novel interactor of m6A methyltransferase complex components in Drosophila and mice. Like other components of this complex, Flacc controls m6A levels and is involved in sex determination in Drosophila. We demonstrate that Flacc promotes m6A deposition by bridging Fl(2)d to the mRNA-binding factor Nito. Altogether, our work advances the molecular understanding of conservation and regulation of the m6A machinery. PMID:29535189

Unusual Evolution of the Conduction-Electron State in CexLa1-xB6 from Non-Fermi Liquid to Fermi Liquid

NASA Astrophysics Data System (ADS)

Nakamura, S.; Endo, M.; Yamamoto, H.; Isshiki, T.; Kimura, N.; Aoki, H.; Nojima, T.; Otani, S.; Kunii, S.

2006-12-01

We report unusual evolution of the conduction-electron state in the localized f electron system CexLa1-xB6 from normal electron state to heavy Fermi liquid (FL) state through local FL and non-FL states with increasing Ce concentration and/or with increasing magnetic field. The effective mass of quasiparticle or the coefficient A of T2 term of resistivity is found to increase divergently near the boundary between FL state and non-FL state. The features of the non-FL state are also different from those of the typical non-FL systems previously observed or theoretically predicted.

Cost-effectiveness of quantitative fecal lactoferrin assay for diagnosis of symptomatic patients with ileal pouch-anal anastomosis.

PubMed

Parsi, Mansour A; Ellis, Jeffrey J; Lashner, Bret A

2008-08-01

To assess cost-effectiveness of fecal lactoferrin (FL) as the initial diagnostic approach to symptomatic patients with ileal pouch-anal anastomosis (IPAA). Four competing strategies [empiric metronidazole therapy (txMTZ), initial pouch endoscopy with biopsy (testBiop), initial FL assay followed by metronidazole therapy (testFL+MTZ), and initial FL assay followed by pouch endoscopy and biopsy (testFL+Biop)] were modeled in a decision tree. In the base-case, the average cost per patient was $241 for testFL+MTZ, $251 for txMTZ, $405 for testFL+Biop, and $431 for testBiop. The testBiop strategy had greater effectiveness compared with txMTZ but at an incremental cost of $158 per day. The txMTZ strategy was slightly more costly and minimally more effective than testFL+MTZ with an incremental cost effectiveness of just over $12 per day. However, the testFL+MTZ strategy was associated with a 31% absolute reduction in antibiotic exposure compared with the txMTZ strategy. Compared with empiric metronidazole therapy, FL before treatment with metronidazole is less costly with less exposure to antibiotics and less need for endoscopy, with only marginal decrease in effectiveness.

Flavagline analog FL3 induces cell cycle arrest in urothelial carcinoma cell of the bladder by inhibiting the Akt/PHB interaction to activate the GADD45α pathway.

PubMed

Yuan, Gangjun; Chen, Xin; Liu, Zhuowei; Wei, Wensu; Shu, Qinghai; Abou-Hamdan, Hussein; Jiang, Lijuan; Li, Xiangdong; Chen, Rixin; Désaubry, Laurent; Zhou, Fangjian; Xie, Dan

2018-02-07

Prohibitin 1 (PHB) is a potential target for the treatment of urothelial carcinoma of the bladder (UCB). FL3 is a newly synthesized agent that inhibits cancer cell proliferation by targeting the PHB protein; however, the effect of FL3 in UCB cells remains unexplored. FL3 was identified to be a potent inhibitor of UCB cell viability using CCK-8 (cell counting kit-8) assay. Then a series of in vitro and in vivo experiments were conducted to further demonstrate the inhibitory effect of FL3 on UCB cell proliferation and to determine the underlying mechanisms. FL3 inhibited UCB cell proliferation and growth both in vitro and in vivo. By targeting the PHB protein, FL3 inhibited the interaction of Akt and PHB as well as Akt-mediated PHB phosphorylation, which consequently decreases the localization of PHB in the mitochondria. In addition, FL3 treatment resulted in cell cycle arrest in the G2/M phase, and this inhibitory effect of FL3 could be mimicked by knockdown of PHB. Through the microarray analysis of mRNA expression after FL3 treatment and knockdown of PHB, we found that the mRNA expression of the growth arrest and DNA damage-inducible alpha (GADD45α) gene were significantly upregulated. When knocked down the expression of GADD45α, the inhibitory effect of FL3 on cell cycle was rescued, suggesting that FL3-induced cell cycle inhibition is GADD45α dependent. Our data provide that FL3 inhibits the interaction of Akt and PHB, which in turn activates the GADD45α-dependent cell cycle inhibition in the G2/M phase.

Lipophilic and hydrophilic antioxidant capacities of common foods in the United States.

PubMed

Wu, Xianli; Beecher, Gary R; Holden, Joanne M; Haytowitz, David B; Gebhardt, Susan E; Prior, Ronald L

2004-06-16

Both lipophilic and hydrophilic antioxidant capacities were determined using the oxygen radical absorbance capacity (ORAC(FL)) assay with fluorescein as the fluorescent probe and 2,2'-azobis(2-amidinopropane) dihydrochloride as a peroxyl radical generator on over 100 different kinds of foods, including fruits, vegetables, nuts, dried fruits, spices, cereals, infant, and other foods. Most of the foods were collected from four different regions and during two different seasons in U.S. markets. Total phenolics of each sample were also measured using the Folin-Ciocalteu reagent. Hydrophilic ORAC(FL) values (H-ORAC(FL)) ranged from 0.87 to 2641 micromol of Trolox equivalents (TE)/g among all of the foods, whereas lipophilic ORAC(FL) values (L-ORAC(FL)) ranged from 0.07 to 1611 micromol of TE/g. Generally, L-ORAC(FL) values were <10% of the H-ORAC(FL) values except for a very few samples. Total antioxidant capacity was calculated by combining L-ORAC(FL) and H-ORAC(FL). Differences of ORAC(FL) values in fruits and vegetables from different seasons and regions were relatively large for some foods but could not be analyzed in detail because of the sampling scheme. Two different processing methods, cooking and peeling, were used on selected foods to evaluate the impact of processing on ORAC(FL). The data demonstrated that processing can have significant effects on ORAC(FL). Considering all of the foods analyzed, the relationship between TP and H-ORAC(FL) showed a very weak correlation. Total hydrophilic and lipophilic antioxidant capacity intakes were calculated to be 5558 and 166 micromol of TE/day, respectively, on the basis of data from the USDA Continuing Survey of Food Intakes by Individuals (1994-1996).

MET Signaling Mediates Intestinal Crypt-Villus Development, Regeneration, and Adenoma Formation and Is Promoted by Stem Cell CD44 Isoforms.

PubMed

Joosten, Sander P J; Zeilstra, Jurrit; van Andel, Harmen; Mijnals, R Clinton; Zaunbrecher, Joost; Duivenvoorden, Annet A M; van de Wetering, Marc; Clevers, Hans; Spaargaren, Marcel; Pals, Steven T

2017-10-01

Resistance of metastatic human colorectal cancer cells to drugs that block epidermal growth factor (EGF) receptor signaling could be caused by aberrant activity of other receptor tyrosine kinases, activating overlapping signaling pathways. One of these receptor tyrosine kinases could be MET, the receptor for hepatocyte growth factor (HGF). We investigated how MET signaling, and its interaction with CD44 (a putative MET coreceptor regulated by Wnt signaling and highly expressed by intestinal stem cells [ISCs] and adenomas) affects intestinal homeostasis, regeneration, and adenoma formation in mini-gut organoids and mice. We established organoid cultures from ISCs stimulated with HGF or EGF and assessed intestinal differentiation by immunohistochemistry. Mice with total epithelial disruption of MET (Ah Cre /Met fl/fl /LacZ) or ISC-specific disruption of MET (Lgr5 Creert2 /Met fl/fl /LacZ) and control mice (Ah Cre /Met +/+ /LacZ, Lgr5 Creert2 /Met +/+ /LacZ) were exposed to 10 Gy total body irradiation; intestinal tissues were collected, and homeostasis and regeneration were assessed by immunohistochemistry. We investigated adenoma organoid expansion stimulated by HGF or EGF using adenomas derived from Lgr5 Creert2 /Met fl/fl /Apc fl/fl and Lgr5 Creert2 /Met +/+ /Apc fl/fl mice. The same mice were evaluated for adenoma prevalence and size. We also quantified adenomas in Ah Cre /Met fl/fl /Apc fl/+ mice compared with Ah Cre /Met +/+ /Apc fl/+ control mice. We studied expansion of organoids generated from crypts and adenomas, stimulated by HGF or EGF, that were derived from mice expressing different CD44 splice variants (Cd44 +/+ , Cd44 -/- , Cd44 s/s , or Cd44 v4-10/v4-10 mice). Crypts incubated with EGF or HGF expanded into self-organizing mini-guts with similar levels of efficacy and contained all differentiated cell lineages. MET-deficient mice did not have defects in intestinal homeostasis. Total body irradiation reduced numbers of proliferating crypts in Ah Cre /Met fl/fl /LacZ mice. Lgr5 Creert2 /Met fl/fl /LacZ mice had impaired regeneration of MET-deficient ISCs. Adenoma organoids stimulated with EGF or HGF expanded to almost twice the size of nonstimulated organoids. MET-deficient adenoma organoids did not respond to HGF stimulation, but did respond to EGF. ISC-specific disruption of Met (Lgr5 Creert2 /Met fl/fl /Apc fl/fl mice) caused a twofold increase in apoptosis in microadenomas, resulting in an approximately 50% reduction of microadenoma numbers and significantly reduced average adenoma size. Total epithelial disruption of Met (Ah Cre /Met fl/fl /Apc fl/+ mice) resulted in an approximate 50% reduction in (micro)adenoma numbers. Intestinal crypts from Cd44 -/- mice did not expand to the same extent as crypts from Cd44 +/+ mice on stimulation with HGF, but had the same response to EGF. The negative effect on HGF-mediated growth was overcome by expression of CD44v4-10, but not by CD44s. Similarly, HGF-mediated expansion of adenoma organoids required CD44v4-10. In studies of intestinal organoid cultures and mice with inducible deletion of MET, we found HGF receptor signaling to regulate intestinal homeostasis and regeneration, as well as adenoma formation. These activities of MET are promoted by the stem cell CD44 isoform CD44v4-10. Our findings provide rationale for targeting signaling via MET and CD44 during anti-EGF receptor therapy of patients with colorectal cancer or in patients resistant to EGF receptor inhibitors. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

A Global Theory of Internal Solitary Waves in Two-Fluid Systems.

DTIC Science & Technology

1985-09-01

Large Amplitude Since the branch of solutions S from Theorem 2.1 is unbounded in R x (H (T) fl C O , 1 (T)) and the range of I is bounded, the norms...all k i’. L (T) and (b) ’k + A and IwkI , + as k. H (T) 0 Then wk converges to w(XlX 2 ) in C(S) fl C (B r) T*) for each bounded set B. The function w...Beale, J. T., The existence of solitary water waves, Comm. Pure Appi. Math. 30 (1977), 373-389. 7. Beir-ao da Veiga , H., Serapioni, R., and Valli, A

The Rhetoric of Satire: Analyzing in Freshman English.

ERIC Educational Resources Information Center

Proctor, Betty Jane

1982-01-01

Presents a series of exercises designed to provide freshman composition students with a base for analyzing works rhetorically, to point out how language can be used persuasively, and to illustrate how satire functions. (FL)

Expansion of Countermine Lidar UAV-based System (CLUBS)

DTIC Science & Technology

2011-09-30

analysis with environmental conditions, namely; Ft. Lauderdale, FL, Looe Key, FL, Alpena , MI, and Buttermilk Bay, MA (Figure 2). We adopt a...estimated Dstat Looe Key, FL Ft. Lauderdale, FL Alpena , MI Buttermilk Bay, MA Figure 2. Regions of interests picked for the study to...Lauderdale, FL Alpena , MI Buttermilk Bay, MA Water properties Effective Fresnel reflectivity 0.002 0.0028 0.00144 0.0005 Diffuse

Assessing Cardiac Injury in Mice With Dual Energy-MicroCT, 4D-MicroCT, and MicroSPECT Imaging After Partial Heart Irradiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Chang-Lung; Min, Hooney; Befera, Nicholas

Purpose: To develop a mouse model of cardiac injury after partial heart irradiation (PHI) and to test whether dual energy (DE)-microCT and 4-dimensional (4D)-microCT can be used to assess cardiac injury after PHI to complement myocardial perfusion imaging using micro-single photon emission computed tomography (SPECT). Methods and Materials: To study cardiac injury from tangent field irradiation in mice, we used a small-field biological irradiator to deliver a single dose of 12 Gy x-rays to approximately one-third of the left ventricle (LV) of Tie2Cre; p53{sup FL/+} and Tie2Cre; p53{sup FL/−} mice, where 1 or both alleles of p53 are deleted in endothelialmore » cells. Four and 8 weeks after irradiation, mice were injected with gold and iodinated nanoparticle-based contrast agents, and imaged with DE-microCT and 4D-microCT to evaluate myocardial vascular permeability and cardiac function, respectively. Additionally, the same mice were imaged with microSPECT to assess myocardial perfusion. Results: After PHI with tangent fields, DE-microCT scans showed a time-dependent increase in accumulation of gold nanoparticles (AuNp) in the myocardium of Tie2Cre; p53{sup FL/−} mice. In Tie2Cre; p53{sup FL/−} mice, extravasation of AuNp was observed within the irradiated LV, whereas in the myocardium of Tie2Cre; p53{sup FL/+} mice, AuNp were restricted to blood vessels. In addition, data from DE-microCT and microSPECT showed a linear correlation (R{sup 2} = 0.97) between the fraction of the LV that accumulated AuNp and the fraction of LV with a perfusion defect. Furthermore, 4D-microCT scans demonstrated that PHI caused a markedly decreased ejection fraction, and higher end-diastolic and end-systolic volumes, to develop in Tie2Cre; p53{sup FL/−} mice, which were associated with compensatory cardiac hypertrophy of the heart that was not irradiated. Conclusions: Our results show that DE-microCT and 4D-microCT with nanoparticle-based contrast agents are novel imaging approaches complementary to microSPECT for noninvasive assessment of the change in myocardial vascular permeability and cardiac function of mice in whom myocardial injury develops after PHI.« less

Transcript profiling of genes expressed during fibre development in diploid cotton (Gossypium arboreum L.).

PubMed

Hande, Atul S; Katageri, Ishwarappa S; Jadhav, Mangesh P; Adiger, Sateesh; Gamanagatti, Savita; Padmalatha, Kethireddy Venkata; Dhandapani, Gurusamy; Kanakachari, Mogilicherla; Kumar, Polumetla Ananda; Reddy, Vanga Siva

2017-08-31

Cotton fibre is a single cell and it is one of the best platforms for unraveling the genes express during various stages of fibre development. There are reports devoted to comparative transcriptome study on fiber cell initiation and elongation in tetraploid cultivated cotton. However, in the present investigation, comparative transcriptome study was made in diploid cultivated cotton using isogenic fuzzy-lintless (Fl) and normal fuzzy linted (FL) lines belong to Gossypium arboreum, diploid species at two stages, 0 and 10 dpa (days post anthesis), using Affymetrix cotton GeneChip genome array. Scanning electron microscopy (SEM) analysis uncovered the occurrence of few fibre cell initials in the Fl line as compared to many in Normal FL at -2 and 0 dpa. However, at 10 dpa there were no fibre cells found elongated in Fl but many elongated cells were found in FL line. Up-regulation of transcription factors, AP2-EREBP, C2H2, C3H, HB and WRKY was observed at 0 dpa whereas in 10 dpa transcription factors, AP2-EREBP, AUX/IAA, bHLH, C2H2, C3H, HB, MYB, NAC, Orphans, PLATZ and WRKY were found down regulated in Fl line. These transcription factors were mainly involved in metabolic pathways such as phytohormone signaling, energy metabolism of cell, fatty acid metabolism, secondary metabolism and other signaling pathways and are related directly or indirectly in fiber development. Quantitative real-time PCR was performed to check fold up or down-regulation of these genes and transcription factors (TFs) down regulated in mutants as compared to normal at 0 and 10 dpa. This study elucidates that the up-regulation of transcription factors like AP2-EREBP, C2H2, C3H, HB, WRKY and phytohormone signaling genes at 0 dpa and their down-regulation at the 10 dpa might have constrain the fibre elongation in fuzzy-lintless line. Along with this the down-regulation of genes involved in synthesis of VLCFA chain, transcripts necessary for energy and cell wall metabolism, EXPANSINs, arabinogalactan proteins (AGPs), tubulin might also be the probable reason for reduced growth of fibres in the Fl. Plant receptor-like kinases (RLKs), Leucine Rich Repeats) LRR- family protein and signal transduction coding for mitogen-activated protein kinase (MAPK) cascade, have been engaged in coordination of cell elongation and SCW biosynthesis, down-regulation of these might loss the function leads to reduced fibre growth.

Implementation of an Adaptive Controller System from Concept to Flight Test

NASA Technical Reports Server (NTRS)

Larson, Richard R.; Burken, John J.; Butler, Bradley S.; Yokum, Steve

2009-01-01

The National Aeronautics and Space Administration (NASA) at the Dryden Flight Research Center (DFRC) has been conducting flight-test research using an F-15 aircraft (figure 1). This aircraft has been specially modified to interface a neural net (NN) controller as part of a single-string Airborne Research Test System (ARTS) computer with the existing quad-redundant flight control system (FCC) shown in figure 2. The NN commands are passed to FCC channels 2 and 4 and are cross channel data linked (CCDL) to the other computers as shown. Numerous types of fault-detection monitors exist in the FCC when the NN mode is engaged; these monitors would cause an automatic disengagement of the NN in the event of a triggering fault. Unfortunately, these monitors still may not prevent a possible NN hard-over command from coming through to the control laws. Therefore, an additional and unique safety monitor was designed for a single-string source that allows authority at maximum actuator rates but protects the pilot and structural loads against excessive g-limits in the case of a NN hard-over command input. This additional monitor resides in the FCCs and is executed before the control laws are computed. This presentation describes a "floating limiter" (FL) concept that was developed and successfully test-flown for this program (figure 3). The FL computes the rate of change of the NN commands that are input to the FCC from the ARTS. A window is created with upper and lower boundaries, which is constantly "floating" and trying to stay centered as the NN command rates are changing. The limiter works by only allowing the window to move at a much slower rate than those of the NN commands. Anywhere within the window, however, full rates are allowed. If a rate persists in one direction, it will eventually "hit" the boundary and be rate-limited to the floating limiter rate. When this happens, a persistent counter begins and after a limit is reached, a NN disengage command is generated. The tunable metrics for the FL are (1) window size, (2) drift rate, and (3) persistence counter. Ultimate range limits are also included in case the NN command should drift slowly to a limit value that would cause the FL to be defeated. The FL has proven to work as intended. Both high-g transients and excessive structural loads are controlled with NN hard-over commands. This presentation discusses the FL design features and presents test cases. Simulation runs are included to illustrate the dramatic improvement made to the control of NN hard-over effects. A mission control room display from a flight playback is presented to illustrate the neural net fault display representation. The FL is very adaptable to various requirements and is independent of flight condition. It should be considered as a cost-effective safety monitor to control single-string inputs in general.

Neural Net Safety Monitor Design

NASA Technical Reports Server (NTRS)

Larson, Richard R.

2007-01-01

The National Aeronautics and Space Administration (NASA) at the Dryden Flight Research Center (DFRC) has been conducting flight-test research using an F-15 aircraft (figure 1). This aircraft has been specially modified to interface a neural net (NN) controller as part of a single-string Airborne Research Test System (ARTS) computer with the existing quad-redundant flight control system (FCC) shown in figure 2. The NN commands are passed to FCC channels 2 and 4 and are cross channel data linked (CCDL) to the other computers as shown. Numerous types of fault-detection monitors exist in the FCC when the NN mode is engaged; these monitors would cause an automatic disengagement of the NN in the event of a triggering fault. Unfortunately, these monitors still may not prevent a possible NN hard-over command from coming through to the control laws. Therefore, an additional and unique safety monitor was designed for a single-string source that allows authority at maximum actuator rates but protects the pilot and structural loads against excessive g-limits in the case of a NN hard-over command input. This additional monitor resides in the FCCs and is executed before the control laws are computed. This presentation describes a floating limiter (FL) concept1 that was developed and successfully test-flown for this program (figure 3). The FL computes the rate of change of the NN commands that are input to the FCC from the ARTS. A window is created with upper and lower boundaries, which is constantly floating and trying to stay centered as the NN command rates are changing. The limiter works by only allowing the window to move at a much slower rate than those of the NN commands. Anywhere within the window, however, full rates are allowed. If a rate persists in one direction, it will eventually hit the boundary and be rate-limited to the floating limiter rate. When this happens, a persistent counter begins and after a limit is reached, a NN disengage command is generated. The tunable metrics for the FL are (1) window size, (2) drift rate, and (3) persistence counter. Ultimate range limits are also included in case the NN command should drift slowly to a limit value that would cause the FL to be defeated. The FL has proven to work as intended. Both high-g transients and excessive structural loads are controlled with NN hard-over commands. This presentation discusses the FL design features and presents test cases. Simulation runs are included to illustrate the dramatic improvement made to the control of NN hard-over effects. A mission control room display from a flight playback is presented to illustrate the neural net fault display representation. The FL is very adaptable to various requirements and is independent of flight condition. It should be considered as a cost-effective safety monitor to control single-string inputs in general.

Combining glial cell line-derived neurotrophic factor gene delivery (AdGDNF) with L-arginine decreases contusion size but not behavioral deficits after traumatic brain injury.

PubMed

Degeorge, M L; Marlowe, D; Werner, E; Soderstrom, K E; Stock, M; Mueller, A; Bohn, M C; Kozlowski, D A

2011-07-27

Our laboratory has previously demonstrated that viral administration of glial cell line-derived neurotrophic factor (AdGDNF), one week prior to a controlled cortical impact (CCI) over the forelimb sensorimotor cortex of the rat (FL-SMC) is neuroprotective, but does not significantly enhance recovery of sensorimotor function. One possible explanation for this discrepancy is that although protected, neurons may not have been functional due to enduring metabolic deficiencies. Additionally, metabolic events following TBI may interfere with expression of therapeutic proteins administered to the injured brain via gene therapy. The current study focused on enhancing the metabolic function of the brain by increasing cerebral blood flow (CBF) with l-arginine in conjunction with administration of AdGDNF immediately following CCI. An adenoviral vector harboring human GDNF was injected unilaterally into FL-SMC of the rat immediately following a unilateral CCI over the FL-SMC. Within 30min of the CCI and AdGDNF injections, some animals were injected with l-arginine (i.v.). Tests of forelimb function and asymmetry were administered for 4weeks post-injury. Animals were sacrificed and contusion size and GDNF protein expression measured. This study demonstrated that rats treated with AdGDNF and l-arginine post-CCI had a significantly smaller contusion than injured rats who did not receive any treatment, or injured rats treated with either AdGDNF or l-arginine alone. Nevertheless, no amelioration of behavioral deficits was seen. These findings suggest that AdGDNF alone following a CCI was not therapeutic and although combining it with l-arginine decreased contusion size, it did not enhance behavioral recovery. Copyright © 2011 Elsevier B.V. All rights reserved.

Role of Klotho in Osteoporosis and Renal Osteodystrophy

DTIC Science & Technology

2015-10-01

uremia induced increases in FGF23 transcription (Figure 6). VEGFa Runx2 Osx Col1a1 ALP OC 0 2 4 6 8 KL fl/fl Prx1-Cre; KL fl/fl m R N A ex pr es...week old mice revealed that Prx1cre;Klothofl/fl mice have significantly higher expression of osteoblastic and osteocytic markers such as Col1a1 , Runx2

Fbxw7 Deletion Accelerates KrasG12D-Driven Pancreatic Tumorigenesis via Yap Accumulation.

PubMed

Zhang, Qiang; Zhang, Yaqing; Parsels, Joshua D; Lohse, Ines; Lawrence, Theodore S; Pasca di Magliano, Marina; Sun, Yi; Morgan, Meredith A

2016-11-01

Pancreatic cancers driven by KRAS mutations require additional mutations for tumor progression. The tumor suppressor FBXW7 is altered in pancreatic cancers, but its contribution to pancreatic tumorigenesis is unknown. To determine potential cooperation between Kras mutation and Fbxw7 inactivation in pancreatic tumorigenesis, we generated P48-Cre;LSL-Kras G12D ;Fbxw7 fl/fl (KFC fl/fl ) compound mice. We found that KFC fl/fl mice displayed accelerated tumorigenesis: all mice succumbed to pancreatic ductal adenocarcinoma (PDA) by 40 days of age, with PDA onset occurring by 2 weeks of age. PDA in KFC fl/fl mice was preceded by earlier onset of acinar-to-ductal metaplasia (ADM) and pancreatic intraepithelial neoplasia (PanIN) lesions, and associated with chromosomal instability and the accumulation of Fbxw7 substrates Yes-associated protein (Yap), c-Myc, and Notch. Using KFC fl/fl and FBXW7-deficient human pancreatic cancer cells, we found that Yap silencing attenuated growth promotion by Fbxw7 deletion. Our data demonstrate that Fbxw7 is a potent suppressor of Kras G12D -induced pancreatic tumorigenesis due, at least in part, to negative regulation of Yap. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Ancestral Mutations Acquired in Refrex-1, a Restriction Factor against Feline Retroviruses, during its Cooption and Domestication

PubMed Central

Ito, Jumpei; Baba, Takuya; Kawasaki, Junna

2015-01-01

ABSTRACT Endogenous retroviruses (ERVs) are remnants of ancestral retroviral infections of germ cells. Retroviral endogenization is an adaptation process for the host genome, and ERVs are gradually attenuated or inactivated by mutation. However, some ERVs that have been “domesticated” by their hosts eventually gain physiological functions, such as placentation or viral resistance. We previously reported the discovery of Refrex-1, a soluble antiretroviral factor in domestic cats that specifically inhibits infection by feline leukemia virus subgroup D (FeLV-D), a chimeric virus of FeLV, and a feline ERV, ERV-DC. Refrex-1 is a truncated envelope protein (Env) encoded by both ERV-DC7 and ERV-DC16 proviral loci. Here, we reconstituted ancestral and functional Env from ERV-DC7 and ERV-DC16 envelope genes (env) by inducing reverse mutations. Unexpectedly, ERV-DC7 and ERV-DC16 full-length Env (ERV-DC7 fl and ERV-DC16 fl), reconstructed by removing stop codons, did not produce infectious viral particles. ERV-DC7 fl and ERV-DC16 fl were highly expressed in cells but were not cleaved into surface subunits (SU) and transmembrane subunits, nor were they incorporated into virions. G407R/N427I-A429T and Y431D substitutions within the SU C-terminal domain of ERV-DC7 fl and ERV-DC16 fl, respectively, caused these dysfunctions. The residues glycine 407 and tyrosine 431 are relatively conserved among infectious gammaretroviruses, and their substitution causes the same dysfunctions as the tested retroviruses. Our results reveal that specific mutations within the SU C-terminal domain suppressed Env cleavage and incorporation into virions and indicate that these mutations contributed to the domestication of Refrex-1 through multistep events that occurred in the postintegration period. IMPORTANCE Domestic cats are colonized with various exogenous retroviruses (exRVs), such as feline leukemia virus (FeLV), and their genomes contain numerous ERVs, some of which are replication-competent proviruses. The feline hosts, exRVs, and ERVs have complicated genetic interactions and provide an interesting field model for triangular relationships: recombination between FeLV and ERV-DC, which is a feline ERV, generated FeLV-D, a chimeric virus, and FeLV-D is restricted by Refrex-1, an antiretroviral factor corresponding to truncated Env of ERV-DC7 and ERV-DC16. Here, we reconstructed ancestral, functional Env from ERV-DC7 and ERV-DC16 env by inducing reverse mutations to elucidate how Refrex-1 was generated from its ancestor. Our results reveal that they were repeatedly inactivated by mutations preventing Env maturation. Our results provide insights into how ERVs were “domesticated” by their hosts and identify the mutations that mediated these evolutions. Notably, experiments that restore inactivated ERVs might uncover previously unrecognized features or properties of retroviruses. PMID:26581999

Photocopy of drawing. ALTITUDE CHAMBERS “L” & “R” STRUCTURES. NASA, ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Photocopy of drawing. ALTITUDE CHAMBERS “L” & “R” STRUCTURES. NASA, John F. Kennedy Space Center, Florida. Drawing 68-K-L-11213, NASA KSC, November, 1968. CHAMBER “R” ELEVATION. Sheet 4 - Cape Canaveral Air Force Station, Launch Complex 39, Altitude Chambers, First Street, between Avenue D and Avenue E, Cape Canaveral, Brevard County, FL

Photocopy of drawing. ALTITUDE CHAMBERS “L” & “R” STRUCTURES. NASA, ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Photocopy of drawing. ALTITUDE CHAMBERS “L” & “R” STRUCTURES. NASA, John F. Kennedy Space Center, Florida. Drawing 68-K-L-11213, NASA KSC, November, 1968. WORK PLATFORM DETAIL. Sheet 6 - Cape Canaveral Air Force Station, Launch Complex 39, Altitude Chambers, First Street, between Avenue D and Avenue E, Cape Canaveral, Brevard County, FL

Photocopy of drawing. ALTITUDE CHAMBERS “L” & “R” STRUCTURES. NASA, ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Photocopy of drawing. ALTITUDE CHAMBERS “L” & “R” STRUCTURES. NASA, John F. Kennedy Space Center, Florida. Drawing 68-K-L-11213, NASA KSC, November, 1968. CHAMBER “L” ELEVATION. Sheet 3 - Cape Canaveral Air Force Station, Launch Complex 39, Altitude Chambers, First Street, between Avenue D and Avenue E, Cape Canaveral, Brevard County, FL

Current-induced spin-orbit torque switching of perpendicularly magnetized Hf|CoFeB|MgO and Hf|CoFeB|TaO{sub x} structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akyol, Mustafa; Department of Physics, University of Çukurova, Adana 01330; Yu, Guoqiang

2015-04-20

We study the effect of the oxide layer on current-induced perpendicular magnetization switching properties in Hf|CoFeB|MgO and Hf|CoFeB|TaO{sub x} tri-layers. The studied structures exhibit broken in-plane inversion symmetry due to a wedged CoFeB layer, resulting in a field-like spin-orbit torque (SOT), which can be quantified by a perpendicular (out-of-plane) effective magnetic field. A clear difference in the magnitude of this effective magnetic field (H{sub z}{sup FL}) was observed between these two structures. In particular, while the current-driven deterministic perpendicular magnetic switching was observed at zero magnetic bias field in Hf|CoFeB|MgO, an external magnetic field is necessary to switch the CoFeBmore » layer deterministically in Hf|CoFeB|TaO{sub x}. Based on the experimental results, the SOT magnitude (H{sub z}{sup FL} per current density) in Hf|CoFeB|MgO (−14.12 Oe/10{sup 7} A cm{sup −2}) was found to be almost 13× larger than that in Hf|CoFeB|TaO{sub x} (−1.05 Oe/10{sup 7} A cm{sup −2}). The CoFeB thickness dependence of the magnetic switching behavior, and the resulting  H{sub z}{sup FL} generated by in-plane currents are also investigated in this work.« less

Helical Antimicrobial Sulfono- {gamma} -AApeptides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yaqiong; Wu, Haifan; Teng, Peng

Host-defense peptides (HDPs) such as magainin 2 have emerged as potential therapeutic agents combating antibiotic resistance. Inspired by their structures and mechanism of action, herein we report the fi rst example of antimicrobial helical sulfono- γ - AApeptide foldamers. The lead molecule displays broad-spectrum and potent antimicrobial activity against multi-drug-resistant Gram- positive and Gram-negative bacterial pathogens. Time-kill studies and fl uorescence microscopy suggest that sulfono- γ -AApeptides eradicate bacteria by taking a mode of action analogous to that of HDPs. Clear structure - function relationships exist in the studied sequences. Longer sequences, presumably adopting more-de fi ned helical structures, aremore » more potent than shorter ones. Interestingly, the sequence with less helical propensity in solution could be more selective than the stronger helix-forming sequences. Moreover, this class of antimicrobial agents are resistant to proteolytic degradation. These results may lead to the development of a new class of antimicrobial foldamers combating emerging antibiotic-resistant pathogens.« less

De facto molecular weight distributions of glucans by size-exclusion chromatography combined with mass/molar-detection of fluorescence labeled terminal hemiacetals.

PubMed

Praznik, Werner; Huber, Anton

2005-09-25

A major capability of polysaccharides in aqueous media is their tendency for aggregation and dynamic formation of supermolecular structures. Even extended dissolution processes will not eliminate these structures which dominate many analytical approaches, in particular absolute molecular weight determinations referring to light scattering data. An alternative approach for determination of de facto molecular weight for glucans with free terminal hemiacetal functionality (reducing end group) has been adjusted from carbohydrates for midrange and high-dp glucans: quantitative and stabilized labeling as aminopyridyl-derivatives (AP-glucans) and subsequent analysis of SEC-separated elution profiles based on simultaneously monitored mass and molar fractions by refractive index and fluorescence detection. SEC-DRI/FL of AP-glucans proved as an appropriate approach for determination of de facto molecular weight of constituting glucan molecules even in the presence of supermolecular structures for non-branched (pullulan), branched (dextran), narrow distributed and broad distributed and for mixes of compact and loose packed polymer coils (starch glucan hydrolizate).

Fear conditioning is associated with dynamic directed functional interactions between and within the human amygdala, hippocampus, and frontal lobe.

PubMed

Liu, C C; Crone, N E; Franaszczuk, P J; Cheng, D T; Schretlen, D S; Lenz, F A

2011-08-25

The current model of fear conditioning suggests that it is mediated through modules involving the amygdala (AMY), hippocampus (HIP), and frontal lobe (FL). We now test the hypothesis that habituation and acquisition stages of a fear conditioning protocol are characterized by different event-related causal interactions (ERCs) within and between these modules. The protocol used the painful cutaneous laser as the unconditioned stimulus and ERC was estimated by analysis of local field potentials recorded through electrodes implanted for investigation of epilepsy. During the prestimulus interval of the habituation stage FL>AMY ERC interactions were common. For comparison, in the poststimulus interval of the habituation stage, only a subdivision of the FL (dorsolateral prefrontal cortex, dlPFC) still exerted the FL>AMY ERC interaction (dlFC>AMY). For a further comparison, during the poststimulus interval of the acquisition stage, the dlPFC>AMY interaction persisted and an AMY>FL interaction appeared. In addition to these ERC interactions between modules, the results also show ERC interactions within modules. During the poststimulus interval, HIP>HIP ERC interactions were more common during acquisition, and deep hippocampal contacts exerted causal interactions on superficial contacts, possibly explained by connectivity between the perihippocampal gyrus and the HIP. During the prestimulus interval of the habituation stage, AMY>AMY ERC interactions were commonly found, while interactions between the deep and superficial AMY (indirect pathway) were independent of intervals and stages. These results suggest that the network subserving fear includes distributed or widespread modules, some of which are themselves "local networks." ERC interactions between and within modules can be either static or change dynamically across intervals or stages of fear conditioning. Copyright © 2011 IBRO. Published by Elsevier Ltd. All rights reserved.

Germline Variation in Complement Genes and Event-Free Survival in Follicular and Diffuse Large B-Cell Lymphoma

PubMed Central

Charbonneau, Bridget; Maurer, Matthew J.; Fredericksen, Zachary S.; Zent, Clive S.; Link, Brian K.; Novak, Anne J.; Ansell, Stephen M.; Weiner, George J.; Wang, Alice H.; Witzig, Thomas E.; Dogan, Ahmet; Slager, Susan L.; Habermann, Thomas M.; Cerhan, James R.

2013-01-01

The complement pathway plays a central role in innate immunity, and also functions as a regulator of the overall immune response. We evaluated whether polymorphisms in complement genes are associated with event-free survival (EFS) in follicular (FL) and diffuse large B-cell (DLBCL) lymphoma. We genotyped 167 single nucleotide polymorphisms (SNPs) from 30 complement pathway genes in a prospective cohort study of newly diagnosed FL (N=107) and DLBCL (N=82) patients enrolled at the Mayo Clinic from 2002–2005. Cox regression was used to estimate Hazard Ratios (HRs) for individual SNPs with EFS, adjusting for FLIPI or IPI and treatment. For gene-level analyses, we used a principal components based gene-level test. In gene-level analyses for FL EFS, CFH (p=0.009), CD55 (p=0.006), CFHR5 (p=0.01), C9 (p=0.02), CFHR1 (p=0.03), and CD46 (p=0.03) were significant at p<0.05, and these genes remained noteworthy after accounting for multiple testing (q<0.15). SNPs in CFH, CFHR1, and CFHR5 showed stronger associations among patients receiving any rituximab, while SNPs from CD55 and CD46 showed stronger associations among patients who were observed. For DLBCL, only CLU (p=0.001) and C7 (p=0.03) were associated with EFS, but did not remain noteworthy after accounting for multiple testing (q>0.15). Genes from the Regulators of Complement Activation (CFH, CD55, CFHR1, CFHR5, CD46) at 1q32-q32.1, along with C9, were associated with FL EFS after adjusting for clinical variables, and if replicated, these findings add further support for the role of host innate immunity in FL prognosis. PMID:22718493

Family Impacts among Children with Autism Spectrum Disorder: The Role of Health Care Quality

PubMed Central

Zuckerman, Katharine E.; Lindly, Olivia J.; Bethell, Christina D.; Kuhlthau, Karen

2014-01-01

Objectives To compare health care quality and family employment and financial impacts among children with special health care needs (CSHCN) with autism spectrum disorder (CSHCN+ASD), CSHCN with functional limitations (CSHCN+FL), and CSHCN lacking these conditions (other CSHCN). To test whether high health care quality was associated with reduced family impacts among CSHCN+ASD. Methods Data from the 2009-2010 National Survey of CSHCN were used to compare 3025 CSHCN+ASD, 6505 CSHCN+FL, and 28 296 other CSHCN. Weighted multivariate logistic regression analyses examined six age-relevant, federally-defined health care quality indicators and five family financial and employment impact indicators. Two composite measures were additionally used: (1) receipt of care that met all age-relevant quality indicators; and (2) had ≥ two of the five adverse family impacts. Results Across all health care quality indicators CSHCN+ASD fared poorly, with only 7.4% meeting all age-relevant indicators. CSHCN+ASD had worse health care quality than other CSHCN, including CSHCN+FL. CSHCN+ASD also had high rates of adverse family impact, with over half experiencing two or more adverse impacts. Rates of adverse family impact were higher in CSHCN+ASD than other CSHCN, including CSHCN+FL. Among CSHCN+ASD, those whose health care that met federal quality standards were less likely to have multiple adverse family impacts than CSHCN+ASD whose health care did not meet federal quality standards. Conclusions CSHCN+ASD are more prone to experience poor health care quality and family impacts than other CSHCN, even CSHCN+FL. Receipt of care meeting federal quality standards may potentially lessen adverse family impacts for CSHCN+ASD. PMID:24976352

Impaired clearance of influenza A virus in obese, leptin receptor deficient mice is independent of leptin signaling in the lung epithelium and macrophages.

PubMed

Radigan, Kathryn A; Morales-Nebreda, Luisa; Soberanes, Saul; Nicholson, Trevor; Nigdelioglu, Recep; Cho, Takugo; Chi, Monica; Hamanaka, Robert B; Misharin, Alexander V; Perlman, Harris; Budinger, G R Scott; Mutlu, Gökhan M

2014-01-01

During the recent H1N1 outbreak, obese patients had worsened lung injury and increased mortality. We used a murine model of influenza A pneumonia to test the hypothesis that leptin receptor deficiency might explain the enhanced mortality in obese patients. We infected wild-type, obese mice globally deficient in the leptin receptor (db/db) and non-obese mice with tissue specific deletion of the leptin receptor in the lung epithelium (SPC-Cre/LepR fl/fl) or macrophages and alveolar type II cells (LysM-Cre/Lepr fl/fl) with influenza A virus (A/WSN/33 [H1N1]) (500 and 1500 pfu/mouse) and measured mortality, viral clearance and several markers of lung injury severity. The clearance of influenza A virus from the lungs of mice was impaired in obese mice globally deficient in the leptin receptor (db/db) compared to normal weight wild-type mice. In contrast, non-obese, SP-C-Cre+/+/LepR fl/fl and LysM-Cre+/+/LepR fl/fl had improved viral clearance after influenza A infection. In obese mice, mortality was increased compared with wild-type mice, while the SP-C-Cre+/+/LepR fl/fl and LysM-Cre+/+/LepR fl/fl mice exhibited improved survival. Global loss of the leptin receptor results in reduced viral clearance and worse outcomes following influenza A infection. These findings are not the result of the loss of leptin signaling in lung epithelial cells or macrophages. Our results suggest that factors associated with obesity or with leptin signaling in non-myeloid populations such as natural killer and T cells may be associated with worsened outcomes following influenza A infection.

Association between plasma fluorescent oxidation products and erectile dysfunction: A prospective study.

PubMed

Yang, Shuman; Giovannucci, Edward; Bracken, Bruce; Ho, Shuk-Mei; Wu, Tianying

2015-08-14

Existing epidemiological studies of the association between oxidative stress and erectile dysfunction (ED) are sparse and inconclusive, which is likely due to cross-sectional design and small sample size. Therefore, we investigated the association between biomarkers of oxidative stress and ED in prospective setting among a relatively large sample size of men. We conducted the prospective study among 917 men ages between 47 and 80 years at the time of blood draw, which is a part of nested prospective case-control study of prostate cancer in the Health Professionals Follow-up Study. Plasma fluorescent oxidation products (FlOPs), a global biomarker for oxidative stress, were measured at three excitation/emission wavelengths (360/420 nm named as FlOP_360; 320/420 nm named as FlOP_320 and 400/475 nm named as FlOP_400). Approximately 35% of men developed ED during follow-up. We did not find an independent association between FlOP_360, FlOP_320, FlOP_400 and risk of ED in the multivariable adjusted model (Tertile 3 vs. tertile 1: odds ratio [OR] = 0.90, 95% confidence interval [CI] = 0.61-1.34, P(trend) = 0.54 for FlOP_360; OR = 0.73, 95% CI = 0.49-1.07, P(trend) = 0.27 for FlOP_320; and OR = 0.98, 95% CI = 0.66-1.45, P(trend) = 0.72 for FlOP_400). Further analysis of the association between FlOPs and ED in the fasting samples or controls only (free of prostate cancer incidence) did not change the results appreciably. Plasma FlOPs were not associated with the risk of ED, suggesting oxidative stress may not be an independent risk factor for ED.

Estimation of ligament strains and joint moments in the ankle during a supination sprain injury.

PubMed

Wei, Feng; Fong, Daniel Tik-Pui; Chan, Kai-Ming; Haut, Roger C

2015-01-01

This study presents the ankle ligament strains and ankle joint moments during an accidental injury event diagnosed as a grade I anterior talofibular ligament (ATaFL) sprain. A male athlete accidentally sprained his ankle while performing a cutting motion in a laboratory setting. The kinematic data were input to a three-dimensional rigid-body foot model for simulation analyses. Maximum strains in 20 ligaments were evaluated in simulations that investigated various combinations of the reported ankle joint motions. Temporal strains in the ATaFL and the calcaneofibular ligament (CaFL) were then compared and the three-dimensional ankle joint moments were evaluated from the model. The ATaFL and CaFL were highly strained when the inversion motion was simulated (10% for ATaFL and 12% for CaFL). These ligament strains were increased significantly when either or both plantarflexion and internal rotation motions were added in a temporal fashion (up to 20% for ATaFL and 16% for CaFL). Interestingly, at the time strain peaked in the ATaFL, the plantarflexion angle was not large but apparently important. This computational simulation study suggested that an inversion moment of approximately 23 N m plus an internal rotation moment of approximately 11 N m and a small plantarflexion moment may have generated a strain of 15-20% in the ATaFL to produce a grade I ligament injury in the athlete's ankle. This injury simulation study exhibited the potentially important roles of plantarflexion and internal rotation, when combined with a large inversion motion, to produce a grade I ATaFL injury in the ankle of this athlete.

14. Photocopy of engineering drawing. PROJECT WS315A: INSTRUMENTATION TRENCH DETAILSSTRUCTURAL, ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

14. Photocopy of engineering drawing. PROJECT WS-315A: INSTRUMENTATION TRENCH DETAILS-STRUCTURAL, 17, APRIL 1956. - Cape Canaveral Air Station, Launch Complex 17, Facility 28401, East end of Lighthouse Road, Cape Canaveral, Brevard County, FL

4. GENERAL VIEW OF LAUNCH PAD B FROM LAUNCH PAD ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

4. GENERAL VIEW OF LAUNCH PAD B FROM LAUNCH PAD A MOBILE SERVICE STRUCTURE; VIEW TO SOUTH. - Cape Canaveral Air Station, Launch Complex 17, Facility 28402, East end of Lighthouse Road, Cape Canaveral, Brevard County, FL

Hurricane Imaging Radiometer (HIRAD) Wind Speed Retrieval Assessment with Dropsondes

NASA Technical Reports Server (NTRS)

Cecil, Daniel J.; Biswas, Sayak K.

2017-01-01

Map surface wind speed over wide swath (approximately 50-60 km, for aircraft greater than FL600) in hurricanes. Provide research data for understanding hurricane structure, and intensity change. Enable improved forecasts, warnings, and decision support.

Effects of FlAsH/Tetracysteine (TC) tag on PrP proteolysis and PrPres formation by TC-scanning

PubMed Central

Taguchi, Yuzuru; Hohsfield, Lindsay A.; Hollister, Jason R.

2014-01-01

The FlAsH/tetracysteine (FlAsH/TC) tag is a powerful tool for fluorescent labeling of proteins. However, even small tags such as FlAsH/TC could alter the behavior of the tagged proteins, especially if the insertion occurs at internal sites. Defining the influence of FlAsH/TC on nearby protein-protein interactions might aid in selecting appropriate positions for internal TC insertions and allow the exploitation of serial FlAsH/TC insertions (TC-scanning) as a probe to characterize sites of protein-protein interaction. To explore this application in the context of substrate-protease interactions, we analyzed the effect of FlAsH/TC insertions on proteolysis of cellular prion protein (PrPsen) in in vitro reactions and generation of the C1 metabolic fragment of PrPsen in live neuroblastoma cells. The influence of FlAsH/TC insertion was evaluated by TC-scanning across the cleavage sites of each protease. The results showed that FlAsH/TC inhibited protease cleavage only within limited ranges of the cleavage sites that varied from about 1 to 6 residues-wide depending on the protease, providing an estimate of the PrP residues interacting with each protease. TC-scanning was also used to probe a different type of protein-protein interaction, the conformational conversion of FlAsH-PrPsen to the prion disease-associated isoform, PrPres. PrP constructs with FlAsH/TC insertions at residues 90–96 but not 97–101 were converted to FlAsH-PrPres, identifying a boundary separating loosely versus compactly folded regions of PrPres. Our observations demonstrate that TC-scanning with the FlAsH/TC tag can be a versatile method for probing protein-protein interactions and folding processes. PMID:23943295

Association between Global Biomarkers of Oxidative Stress and Hip Fracture in Postmenopausal Women: A Prospective Study

PubMed Central

Yang, Shuman; Feskanich, Diane; Willett, Walter C.; Eliassen, A. Heather; Wu, Tianying

2014-01-01

Human studies suggest that oxidative stress is a risk factor for osteoporosis, but its relationship with fracture risk is poorly understood. The purpose of the present study was to investigate the association between biomarkers of oxidative stress and hip fracture in postmenopausal women. We conducted a prospective study in the Nurses’ Health Study among 996 women aged 60 years or older at baseline blood collection in 1989–1990. Plasma fluorescent oxidation products (FlOPs) were measured at three excitation/emission wavelengths (360/420 nm named as FlOP_360; 320/420 nm named as FlOP_320 and 400/475 nm named as FlOP_400). FlOPs are generated from many different pathways (lipid, protein and DNA) and reflect a global oxidation burden. FlOP assay is 10–100 times more sensitive than measurement of malondialdehyde. We used Cox proportional hazards regression model to investigate the association between baseline plasma FlOPs and risk of hip fracture, adjusting for multiple hip fracture risk factors such as age, history of osteoporosis, history of hypertension, prior fracture and smoking status. Forty four hip fractures (4.4%) were identified during the follow-up (Maximum = 23 years). In the multivariable model, the hazard ratios (HR) of hip fracture in the second and third tertiles of FlOP_320 were 2.11 (95% confidence interval [CI] = 0.88–5.10) and 2.67 (95% CI = 1.14–6.27), respectively, in comparison with the lowest tertile, and the risk increased linearly with increasing FlOP_320 (P for trend = 0.021). Neither FlOP_360 nor FlOP_400 was significantly associated with risk of hip fracture (Tertile 3 versus tertile 1: HR = 0.70, 95% CI = 0.32–1.54, P for trend = 0.386 for FlOP_360; and HR = 0.88, 95% CI = 0.40–1.96, P for trend = 0.900 for FlOP_400). In this prospective study, higher plasma FlOP_320 was an independent risk factor for hip fracture. Our results need further confirmation. PMID:24957524

Loss of Osteoblast Runx3 Produces Severe Congenital Osteopenia

PubMed Central

Bauer, Omri; Sharir, Amnon; Kimura, Ayako; Hantisteanu, Shay; Takeda, Shu

2015-01-01

Congenital osteopenia is a bone demineralization condition that is associated with elevated fracture risk in human infants. Here we show that Runx3, like Runx2, is expressed in precommitted embryonic osteoblasts and that Runx3-deficient mice develop severe congenital osteopenia. Runx3-deficient osteoblast-specific (Runx3fl/fl/Col1α1-cre), but not chondrocyte-specific (Runx3fl/fl/Col1α2-cre), mice are osteopenic. This demonstrates that an osteoblastic cell-autonomous function of Runx3 is required for proper osteogenesis. Bone histomorphometry revealed that decreased osteoblast numbers and reduced mineral deposition capacity in Runx3-deficient mice cause this bone formation deficiency. Neonatal bone and cultured primary osteoblast analyses revealed a Runx3-deficiency-associated decrease in the number of active osteoblasts resulting from diminished proliferation and not from enhanced osteoblast apoptosis. These findings are supported by Runx3-null culture transcriptome analyses showing significant decreases in the levels of osteoblastic markers and increases in the levels of Notch signaling components. Thus, while Runx2 is mandatory for the osteoblastic lineage commitment, Runx3 is nonredundantly required for the proliferation of these precommitted cells, to generate adequate numbers of active osteoblasts. Human RUNX3 resides on chromosome 1p36, a region that is associated with osteoporosis. Therefore, RUNX3 might also be involved in human bone mineralization. PMID:25605327

IL-15 converts human intestinal intraepithelial lymphocytes to CD94+ producers of IFN-γ and IL-10, the latter promoting Fas ligand-mediated cytotoxicity

PubMed Central

Ebert, Ellen C

2005-01-01

Intestinal intraepithelial lymphocytes (IELs), T-cell receptor αβ+ CD8+ T cells located between epithelial cells, are thought to contribute to Fas ligand (FL)-mediated epithelial cell death in coeliac disease, a condition characterized by excess interleukin-15 (IL-15). This study evaluates the effects of prolonged IL-15 stimulation on IELs. Human IELs were obtained from jejunal mucosa from gastric bypass operations for morbid obesity and cultured for 3 or 10 days with IL-15. As the culture progressed, an increasing number of IELs became CD94+ and produced massive quantities of interferon-γ (IFN-γ) and IL-10. There was a steady rate of transcription with no feedback regulation. Few chronically activated IELs produced IL-2, IL-4, or tumour necrosis factor-α (TNF-α). To determine whether the accumulation of IL-10 affected IEL functions, endogenous IL-10 was neutralized by antibody during culture with IL-15. This manipulation reduced expression of CD94, NKG2D, and FL as well as FL-mediated killing of Jurkat cells by IELs. It did not affect perforin or TNF-α expression or the associated cytotoxic activities. This study shows that IL-15 induces the development of CD94+ IELs containing IFN-γ and IL-10, and that endogenous IL-10 promotes FL-mediated cytotoxicity. PMID:15819704

Impact of vocal cord ultrasonography on endocrine surgery practices.

PubMed

Carneiro-Pla, Denise; Solorzano, Carmen C; Wilhelm, Scott M

2016-01-01

It is common practice to perform flexible laryngoscopy (FL) to ensure true vocal cord (TVC) mobility in patients with previous neck operations or patients with suspected VC dysfunction. Vocal cord ultrasonography (VCUS) is accurate in identifying TVC paralysis. The goal of this study is to evaluate the impact of VCUS as the initial study to confirm TVC mobility in patients requiring preoperative FL. A total of 194 consecutive patients with indications for preoperative FL underwent VCUS. In group 1, 52 patients had FL regardless of the results of VCUS, whereas in group 2, 142 patients had VCUS followed by FL only when VCUS was unsatisfactory. VCUS visualized TVC/arytenoids in 164 of 194 (85%) patients. TVC visualization was more common in women (95%) and in patients without thyroid cartilage calcification (92%) (P < .0005). VCUS predicted all paralyzed TVC. In group 2, 76% of patients had adequate VCUS and avoided preoperative FL. Among 24% of patients in whom VCUS was inadequate, 16 had preoperative FL attributable to a lack of TVC visualization, 6 had abnormal TVC mobility, 11 needed additional confirmations, and 2 had previous FL for another reason. VCUS changed surgeon practices by avoiding the need for preoperative FL in the majority of patients. This noninvasive and sensitive method demonstrates TVC mobility and safely precludes preoperative FL in most patients. Copyright © 2016 Elsevier Inc. All rights reserved.

Hepatitis C virus infection is an independent prognostic factor in follicular lymphoma

PubMed Central

Shimono, Joji; Miyoshi, Hiroaki; Kato, Takeharu; Sugio, Takeshi; Miyawaki, Kohta; Kamimura, Tomohiko; Miyagishima, Takuto; Eto, Tetsuya; Imaizumi, Yoshitaka; Kato, Koji; Nagafuji, Koji; Akashi, Koichi; Seto, Masao; Teshima, Takanori; Ohshima, Koichi

2018-01-01

Hepatitis C virus (HCV) is a single-stranded RNA virus that not only affects hepatocytes, by B cells as well. It is thought that HCV is involved in the onset of B-cell lymphoma. The clinicopathological characteristics of HCV-positive diffuse large B-cell lymphoma (DLBCL) and HCV-positive splenic marginal zone lymphoma (SMZL) are known, but there has been no report on HCV-positive follicular lymphoma (FL). In this study, the clinicopathological characteristics of HCV-positive FL were examined in 263 patients with FL who were classified into a HCV-positive group with HCV antibody and negative groups without one. The number of patients with HCV-positive FL and HCV-negative FL was 10 (3.8%) and 253 (96.2%), respectively. The patients with HCV-positive FL commonly had more than one region of lymphadenopathy, Ann Arbor stage III/IV, hemoglobin <120 g/l, elevated lactate dehydrogenase level, and high-risk categorization of Follicular Lymphoma International Prognostic Index (FLIPI) than in patients with HCV-negative FL. Overall survival and progression-free survival were poorer in patients with HCV-positive FL than in those with HCV-negative FL (p < 0.0001 and 0.006, respectively). Also, multivariate analysis revealed that positive HCV antibody was a poor prognostic factor of OS. In conclusion, HCV-positive FL has unique clinical features and may have a great impact on the overall survival of affected patients. PMID:29416725

Hepatitis C virus infection is an independent prognostic factor in follicular lymphoma.

PubMed

Shimono, Joji; Miyoshi, Hiroaki; Kato, Takeharu; Sugio, Takeshi; Miyawaki, Kohta; Kamimura, Tomohiko; Miyagishima, Takuto; Eto, Tetsuya; Imaizumi, Yoshitaka; Kato, Koji; Nagafuji, Koji; Akashi, Koichi; Seto, Masao; Teshima, Takanori; Ohshima, Koichi

2018-01-05

Hepatitis C virus (HCV) is a single-stranded RNA virus that not only affects hepatocytes, by B cells as well. It is thought that HCV is involved in the onset of B-cell lymphoma. The clinicopathological characteristics of HCV-positive diffuse large B-cell lymphoma (DLBCL) and HCV-positive splenic marginal zone lymphoma (SMZL) are known, but there has been no report on HCV-positive follicular lymphoma (FL). In this study, the clinicopathological characteristics of HCV-positive FL were examined in 263 patients with FL who were classified into a HCV-positive group with HCV antibody and negative groups without one. The number of patients with HCV-positive FL and HCV-negative FL was 10 (3.8%) and 253 (96.2%), respectively. The patients with HCV-positive FL commonly had more than one region of lymphadenopathy, Ann Arbor stage III/IV, hemoglobin <120 g/l, elevated lactate dehydrogenase level, and high-risk categorization of Follicular Lymphoma International Prognostic Index (FLIPI) than in patients with HCV-negative FL. Overall survival and progression-free survival were poorer in patients with HCV-positive FL than in those with HCV-negative FL ( p < 0.0001 and 0.006, respectively). Also, multivariate analysis revealed that positive HCV antibody was a poor prognostic factor of OS. In conclusion, HCV-positive FL has unique clinical features and may have a great impact on the overall survival of affected patients.

Suppression of Adaptive Immune Cell Activation Does Not Alter Innate Immune Adipose Inflammation or Insulin Resistance in Obesity.

PubMed

Subramanian, Manikandan; Ozcan, Lale; Ghorpade, Devram Sampat; Ferrante, Anthony W; Tabas, Ira

2015-01-01

Obesity-induced inflammation in visceral adipose tissue (VAT) is a major contributor to insulin resistance and type 2 diabetes. Whereas innate immune cells, notably macrophages, contribute to visceral adipose tissue (VAT) inflammation and insulin resistance, the role of adaptive immunity is less well defined. To address this critical gap, we used a model in which endogenous activation of T cells was suppressed in obese mice by blocking MyD88-mediated maturation of CD11c+ antigen-presenting cells. VAT CD11c+ cells from Cd11cCre+Myd88fl/fl vs. control Myd88fl/fl mice were defective in activating T cells in vitro, and VAT T and B cell activation was markedly reduced in Cd11cCre+Myd88fl/fl obese mice. However, neither macrophage-mediated VAT inflammation nor systemic inflammation were altered in Cd11cCre+Myd88fl/fl mice, thereby enabling a focused analysis on adaptive immunity. Unexpectedly, fasting blood glucose, plasma insulin, and the glucose response to glucose and insulin were completely unaltered in Cd11cCre+Myd88fl/fl vs. control obese mice. Thus, CD11c+ cells activate VAT T and B cells in obese mice, but suppression of this process does not have a discernible effect on macrophage-mediated VAT inflammation or systemic glucose homeostasis.

Use of Sodium Fluorescein in Meningioma Surgery Performed Under the YELLOW-560 nm Surgical Microscope Filter: Feasibility and Preliminary Results.

PubMed

Akçakaya, Mehmet Osman; Göker, Burcu; Kasımcan, Mustafa Ömür; Hamamcıoğlu, Mustafa Kemal; Kırış, Talat

2017-11-01

To evaluate the feasibility of sodium fluorescein (Na-Fl)-guided surgery involving the use of the PENTERO 900 surgical microscope equipped with the YELLOW-560 nm filter and low-dose Na-FL (200 mg/2-4 mg/kg) in meningioma surgery. The study included 30 patients with newly diagnosed or recurrent meningiomas who underwent Na-Fl-guided surgery between April 2015 and December 2016. Clinical features, surgical observations, extent of resection, and tumor histopathology were retrospectively analyzed. The Na-Fl enhancement pattern was assessed as "no enhancement," "diffuse homogenous enhancement," or "low heterogeneous enhancement." There were 30 meningiomas among the 30 patients. In 25 patients, Na-Fl was used for tumor demarcation, whereas in 5 patients, it was used for videoangiography. In this series, 88% of tumors showed diffuse homogeneous Na-Fl enhancement during the operation. The resection rate of the meningiomas was 87%. In 5 patients, in whom Na-Fl was used for videoangiography, the approach was useful to evaluate Na-Fl-stained vessels for patency and to understand their relationship with the tumor. No adverse events were encountered with regard to Na-Fl use. Na-Fl guidance with the use of the YELLOW-560 filter is safe and effective during meningioma surgery. Copyright © 2017 Elsevier Inc. All rights reserved.

Major human milk oligosaccharides are absorbed into the systemic circulation after oral administration in rats.

PubMed

Vazquez, E; Santos-Fandila, A; Buck, R; Rueda, R; Ramirez, M

2017-01-01

Human milk oligosaccharides (HMO) are involved in many biological functions influencing infant health. Although HMO act locally at the intestine, recent evidence has demonstrated that HMO are partially incorporated into the systemic circulation of breast-fed infants. In the last few years, a large amount of research has been conducted using preclinical models to uncover new biological functions of HMO. The aim of this study was to evaluate the absorption and urine excretion of HMO in rats. We administered a single oral dose of the following HMO: 2'-fucosyllactose (2'-FL), 6'-sialyllactose and lacto-N-neotetraose at different concentrations to adult rats. The time course of absorption of HMO into the bloodstream and their appearance in urine was studied. Our results showed that rats, similar to human infants, are able to effectively absorb a portion of HMO from the intestine into plasma and to excrete them in urine. On the basis of this, we also conducted a specific kinetic absorption study with 2'-FL, the most predominant HMO in human milk, in 9-11-d-old rat pups. Our results confirmed that a significant amount of 2'-FL was absorbed into the systemic circulation and subsequently excreted in urine during lactation in rats in a dose-depended manner. We also found basal levels of these HMO in plasma and urine of adult rats as well as rat pups as a natural result of nursing. Our data suggest that the rat may be a useful preclinical model that provides new insights into the metabolism and functions of HMO.

Wilms' tumorigenesis is altered by misexpression of the transcriptional co-activator, CITED1

PubMed Central

Lovvorn, Harold N.; Boyle, Scott; Shi, Genbin; Shyr, Yu; Wills, Marcia L.; Perantoni, Alan O.; de Caestecker, Mark

2011-01-01

Purpose Wilms' tumors arise from arrested differentiation of renal progenitor cells. CITED1 is a transcriptional regulator that blocks the metanephric mesenchymal-to-epithelial conversion and is expressed in the blastema of both the developing kidney and Wilms' tumors. We hypothesized that alterations of CITED1-dependent signaling promote persistence of blastema and thereby subject these pluripotent cells to future oncogenic events. Methods We used a retroviral delivery system to overexpress the full-length CITED1 (F/L) protein and 2 deletion mutants lacking either of its known functional domains, ΔSID (Smad-4 Interacting Domain) and ΔCR2 (Conserved Region 2; the CITED1 transactivation domain), in a human Wilms' tumor cell line that endogenously expresses CITED1. In vitro effects on cellular proliferation and apoptosis were assayed. In vivo effects on tumorigenesis, growth, proliferation, and apoptosis were determined after heterotransplantation into immunodeficient mice (n = 15 per cell line). Results In vitro, overexpression of CITED1-F/L significantly increased, whereas overexpression of the functionally inactivating mutant, CITED1-ΔCR2, significantly reduced cellular proliferation relative to the other lines ( P <.0001). In vivo, Wilms' tumor incidence was significantly reduced in animals injected with cells overexpressing the mutant CITED1-ΔCR2 (7%) compared with CITED1-F/L (40%, P = .03) and CITED1-ΔSID (60%, P < .002). Similarly, mean tumor volume was least in the CITED1-ΔCR2 animals when compared with CITED1-F/L ( P = .03) and CITED1-ΔSID animals ( P <.005). Furthermore, the CITED1-ΔCR2 tumor showed the least cellular proliferation. Misexpression of CITED1 did not affect apoptosis either in vitro or in vivo. Conclusions Overexpression of CITED1 in a human Wilms' tumor cell line significantly increases proliferation in vitro, whereas mutation of its functionally critical transactivation domain (ΔCR2) significantly reduces proliferation. This mutation further perturbs tumorigenesis and tumor growth after heterotransplantation into immunodeficient mice. We speculate that overexpression of CITED1 promotes expansion of a rapidly proliferating population of blastema and thereby induces an unstable environment highly susceptible to future oncogenic events. PMID:17336183

76 FR 6461 - Environmental Impacts Statements; Notice of Availability

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-04

... 01/28/2011 pursuant to 40 CFR 1506.9. Notice In accordance with Section 309(a) of the Clean Air Act..., Revised Final EIS, USACE, FL, C-111 Spreader Canal Western Project, To Restore Ecosystem Function in...

Logic and Mnemonics for Demons and Curiosities: Spelling Awareness for Middle- and Secondary-level Students.

ERIC Educational Resources Information Center

Templeton, Shane

1980-01-01

Examines the structural and historical reasons underlying the spelling of certain "demon" words and suggests that the study of these underlying reasons may be one way to improve student spelling competency. (Author/FL)

26. Photocopy of engineering drawing. PROJECT WS315A: FLUME AND RETENTION ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

26. Photocopy of engineering drawing. PROJECT WS-315A: FLUME AND RETENTION PONDS-STRUCTURAL AND MECHANICAL, APRIL 1956. - Cape Canaveral Air Station, Launch Complex 17, Facility 28501, East end of Lighthouse Road, Cape Canaveral, Brevard County, FL

27. Photocopy of engineering drawing. PROJECT WS315A: DISPOSAL PONDS AND ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

27. Photocopy of engineering drawing. PROJECT WS-315A: DISPOSAL PONDS AND DRAINAGE-STRUCTURAL AND MECHANICAL, 1969. - Cape Canaveral Air Station, Launch Complex 17, Facility 28501, East end of Lighthouse Road, Cape Canaveral, Brevard County, FL

9. DETAIL OF UMBILICAL MAST BASE WITH STEEL STOPS AT ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

9. DETAIL OF UMBILICAL MAST BASE WITH STEEL STOPS AT EAST END OF MOBILE SERVICE STRUCTURE RAIL; VIEW TO NORTHWEST. - Cape Canaveral Air Station, Launch Complex 17, Facility 28501, East end of Lighthouse Road, Cape Canaveral, Brevard County, FL

5. Photocopy of engineering drawing. LC17 HIGH PRESSURE GAS INSTALLATION: ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

5. Photocopy of engineering drawing. LC-17 HIGH PRESSURE GAS INSTALLATION: PLANS AND DETAILS (CHANGE HOUSE)-STRUCTURAL, APRIL 1969. - Cape Canaveral Air Station, Launch Complex 17, Facility 28409, East end of Lighthouse Road, Cape Canaveral, Brevard County, FL

Photocopy of drawing. ALTITUDE CHAMBERS “L” & “R” STRUCTURES. NASA, ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Photocopy of drawing. ALTITUDE CHAMBERS “L” & “R” STRUCTURES. NASA, John F. Kennedy Space Center, Florida. Drawing 68-K-L-11213, NASA KSC, March, 1971. DOOR LATCH MECHANISM & DOOR LATCHING RATCHET. Sheet 14 - Cape Canaveral Air Force Station, Launch Complex 39, Altitude Chambers, First Street, between Avenue D and Avenue E, Cape Canaveral, Brevard County, FL

Transformation of follicular lymphoma to plasmablastic lymphoma with c-myc gene rearrangement.

PubMed

Ouansafi, Ihsane; He, Bing; Fraser, Cory; Nie, Kui; Mathew, Susan; Bhanji, Rumina; Hoda, Rana; Arabadjief, Melissa; Knowles, Daniel; Cerutti, Andrea; Orazi, Attilio; Tam, Wayne

2010-12-01

Follicular lymphoma (FL) is an indolent lymphoma that transforms to high-grade lymphoma, mostly diffuse large B-cell lymphoma, in about a third of patients. We present the first report of a case of FL that transformed to plasmablastic lymphoma (PBL). Clonal transformation of the FL to PBL was evidenced by identical IGH/BCL2 gene rearrangements and VDJ gene usage in rearranged IGH genes. IGH/ BCL2 translocation was retained in the PBL, which also acquired c-myc gene rearrangement. Genealogic analysis based on somatic hypermutation of the rearranged IGH genes of both FL and PBL suggests that transformation of the FL to PBL occurred most likely by divergent evolution from a common progenitor cell rather than direct evolution from the FL clone. Our study of this unusual case expands the histologic spectrum of FL transformation and increases our understanding of the pathogenetic mechanisms of transformation of indolent lymphomas to aggressive lymphomas.

75 FR 82228 - IFR Altitudes; Miscellaneous Amendments

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-30

... Is Amended To Read in Part Shirt, OH FIX *Gloom, OH FIX 3000 *4000--MRA *Gloom, OH FIX Appleton, OH VORTAC..... 3000 *4000--MRA Appleton, OH VORTAC Mansfield, OH VORTAC.... 3000 Mansfield, OH VORTAC Dryer... in Part Lee County, FL VORTAC Jocks, FL FIX 2600 Jocks, FL FIX *Crowd, FL FIX **2300 *5000--MRA...

Draft Genome Sequence of Mycobacterium chimaera Type Strain Fl-0169

EPA Science Inventory

We report the draft genome sequence of the type strain Mycobacterium chimaera Fl-0169T, a member of the Mycobacterium avium complex (MAC). M. chimaera Fl-0169T was isolated from a patient in Italy and is highly similar to strains of M. chimaera isolated in Ireland, though Fl-016...

77 FR 38384 - Qualification of Drivers; Exemption Applications; Vision

Federal Register 2010, 2011, 2012, 2013, 2014

2012-06-27

... S. Johannsen (IA) Charles E. Johnston (MO) Harry L. Jones (OH) Mearl C. Kennedy (OH) Aaron C...) Bobby G. Minton (NC) Charles J. Morman (FL) Larry A. Nienhuis (MI) Corey L. Paraf (IL) Ronald M. Price (MD) John P. Raftis (FL) Scott D. Russell (WI) Alton M. Rutherford (FL) Charles L. Schnell (FL) Andrew...

33 CFR 80.760 - Horeshoe Point, FL to Rock Island, FL.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Horeshoe Point, FL to Rock Island... Rock Island, FL. (a) Except inside lines specifically described provided in this section, the 72 COLREGS shall apply on the bays, bayous, creeks, marinas, and rivers from Horseshoe Point to the Rock...

33 CFR 80.760 - Horeshoe Point, FL to Rock Island, FL.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Horeshoe Point, FL to Rock Island... Rock Island, FL. (a) Except inside lines specifically described provided in this section, the 72 COLREGS shall apply on the bays, bayous, creeks, marinas, and rivers from Horseshoe Point to the Rock...

33 CFR 80.760 - Horeshoe Point, FL to Rock Island, FL.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Horeshoe Point, FL to Rock Island... Rock Island, FL. (a) Except inside lines specifically described provided in this section, the 72 COLREGS shall apply on the bays, bayous, creeks, marinas, and rivers from Horseshoe Point to the Rock...

33 CFR 80.760 - Horeshoe Point, FL to Rock Island, FL.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Horeshoe Point, FL to Rock Island... Rock Island, FL. (a) Except inside lines specifically described provided in this section, the 72 COLREGS shall apply on the bays, bayous, creeks, marinas, and rivers from Horseshoe Point to the Rock...

33 CFR 80.760 - Horeshoe Point, FL to Rock Island, FL.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Horeshoe Point, FL to Rock Island... Rock Island, FL. (a) Except inside lines specifically described provided in this section, the 72 COLREGS shall apply on the bays, bayous, creeks, marinas, and rivers from Horseshoe Point to the Rock...

77 FR 21662 - Amendment of Class D Airspace; Cocoa Beach, FL

Federal Register 2010, 2011, 2012, 2013, 2014

2012-04-11

...-0099; Airspace Docket No. 12-ASO-11] Amendment of Class D Airspace; Cocoa Beach, FL AGENCY: Federal... Class D airspace at Cape Canaveral Skid Strip, Cocoa Beach, FL, by correcting the geographic coordinates... of Cape Canaveral Skid Strip, Cocoa Beach, FL. Also, the geographic coordinates for the airport need...

78 FR 38554 - Amendment of Class E Airspace; Live Oak, FL

Federal Register 2010, 2011, 2012, 2013, 2014

2013-06-27

... Live Oak, FL area, as new Standard Instrument Approach Procedures (SIAPs) have been developed at... from 700 feet above the surface within a 7-mile radius at Suwannee County Airport, Live Oak, FL. New...-0001; Airspace Docket No. 12-ASO-45] Amendment of Class E Airspace; Live Oak, FL AGENCY: Federal...

33 CFR 80.750 - Sanibel Island, FL to St. Petersburg, FL.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Sanibel Island, FL to St... SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Gulf Coast § 80.750 Sanibel Island, FL to..., between Captiva Island and Sanibel Island, and lines drawn across Redfish and Captiva Passes parallel to...

Protection of Flos Lonicerae against acetaminophen-induced liver injury and its mechanism.

PubMed

Jiang, Ping; Sheng, Yu-chen; Chen, Yu-hao; Ji, Li-li; Wang, Zheng-tao

2014-11-01

This study aims to observe the protective action of Flos Lonicerae (FL) aqueous extract against acetaminophen (AP)-induced liver injury and its mechanism. Results show that FL decreases AP-increased serum alanine/aspartate transaminases (ALT/AST) activity, as well as total bilirubin (TB) amount, in mice. Histological evaluation of the liver further confirms the protection of FL against AP-induced hepatotoxicity. TdT-mediated biotin-dUTP nick-end labeling (TUNEL) assay shows that FL reduces AP-increased apoptotic cells. Furthermore, AP-decreased liver glutamate-cysteine ligase (GCL) enzymatic activity and glutathione (GSH) amount are both reversed by FL because of the increased expression of the catalytic subunit of GCL (GCLC) protein. The amount of chlorogenic acid (CGA), caffeic acid, and luteolin, the main active compounds in FL, is detected by high-performance liquid chromatography (HPLC). In addition, cell viability assay demonstrates that polyphenols in FL, such as CGA, caffeic acid, as well as isochlorogenic acids A, B, and C, can reverse AP-induced cytotoxicity. In conclusion, FL can prevent AP-induced liver injury by inhibiting apoptosis. The cellular antioxidant enzyme GCL is also involved in such protection. Polyphenols may be the main active hepato-protective ingredients in FL. Copyright © 2014 Elsevier B.V. All rights reserved.

Enhancement of antioxidant activity, α-glucosidase and α-amylase inhibitory activities by spontaneous and bacterial monoculture fermentation of Indonesian black grape juices

NASA Astrophysics Data System (ADS)

Frediansyah, Andri; Nurhayati, Rifa; Romadhoni, Fitrio

2017-01-01

This study was conducted to evaluate the in vitro antioxidant activity, α-glucosidase and α-amylase inhibitor activity of fermented black grape (Vitisvinifera) juice. In the present study black grape juice was prepared using spontaneous (SF) and monoculture fermentation (FL) of Lactobacillus plantarum FNCC 0027 and incubated for 48 h. The antioxidant capacity increased after fermentation. FL had the highest DPPH inhibition (81.32±3.45; p ≤ 0.05) compared to SF and unfermented (UF) black grape juice (75.17±1.47 and 65.63±1.02%, respectively). The pH values decreased during fermentation for both, SF and FL. M also had highest inhibition of α-glucosidase (80.15±3.23) and α-amylase (39.95±0.88). Fermentation of black grape juice using monoculture of L. plantarum has higher antioxidant activities and enzyme inhibitor effect than spontaneous and unfermented black grape juices (p ≤ 0.05). Thus fermented black grape juice may have the potential to serve as enhanced functional juice with anti-diabetic properties.

Bim suppresses the development of SLE by limiting myeloid inflammatory responses

PubMed Central

Tsai, FuNien; Agrawal, Hemant; Abdala-Valencia, Hiam; Haines, G. Kenneth; Dominguez, Salina; Saber, Rana; Mohan, Chandra; Hutcheson, Jack; Budinger, G.R. Scott; Bouillet, Philippe; Dorfleutner, Andrea; Stehlik, Christian; Winter, Deborah R.

2017-01-01

The Bcl-2 family is considered the guardian of the mitochondrial apoptotic pathway. We demonstrate that Bim acts as a molecular rheostat by controlling macrophage function not only in lymphoid organs but also in end organs, thereby preventing the break in tolerance. Mice lacking Bim in myeloid cells (LysMCreBimfl/fl) develop a systemic lupus erythematosus (SLE)–like disease that mirrors aged Bim−/− mice, including loss of marginal zone macrophages, splenomegaly, lymphadenopathy, autoantibodies (including anti-DNA IgG), and a type I interferon signature. LysMCreBimfl/fl mice exhibit increased mortality attributed to glomerulonephritis (GN). Moreover, the toll-like receptor signaling adaptor protein TRIF (TIR-domain–containing adapter-inducing interferon-β) is essential for GN, but not systemic autoimmunity in LysMCreBimfl/fl mice. Bim-deleted kidney macrophages exhibit a novel transcriptional lupus signature that is conserved within the gene expression profiles from whole kidney biopsies of patients with SLE. Collectively, these data suggest that the Bim may be a novel therapeutic target in the treatment of SLE. PMID:29114065

DC-SIGN–expressing macrophages trigger activation of mannosylated IgM B-cell receptor in follicular lymphoma

PubMed Central

Amin, Rada; Mourcin, Frédéric; Uhel, Fabrice; Pangault, Céline; Ruminy, Philippe; Dupré, Loic; Guirriec, Marion; Marchand, Tony; Fest, Thierry; Lamy, Thierry

2015-01-01

Follicular lymphoma (FL) results from the accumulation of malignant germinal center (GC) B cells leading to the development of an indolent and largely incurable disease. FL cells remain highly dependent on B-cell receptor (BCR) signaling and on a specific cell microenvironment, including T cells, macrophages, and stromal cells. Importantly, FL BCR is characterized by a selective pressure to retain surface immunoglobulin M (IgM) BCR despite an active class-switch recombination process, and by the introduction, in BCR variable regions, of N-glycosylation acceptor sites harboring unusual high-mannose oligosaccharides. However, the relevance of these 2 FL BCR features for lymphomagenesis remains unclear. In this study, we demonstrated that IgM+ FL B cells activated a stronger BCR signaling network than IgG+ FL B cells and normal GC B cells. BCR expression level and phosphatase activity could both contribute to such heterogeneity. Moreover, we underlined that a subset of IgM+ FL samples, displaying highly mannosylated BCR, efficiently bound dendritic cell–specific intercellular adhesion molecule-3–grabbing nonintegrin (DC-SIGN), which could in turn trigger delayed but long-lasting BCR aggregation and activation. Interestingly, DC-SIGN was found within the FL cell niche in situ. Finally, M2 macrophages induced a DC-SIGN–dependent adhesion of highly mannosylated IgM+ FL B cells and triggered BCR-associated kinase activation. Interestingly, pharmacologic BCR inhibitors abolished such crosstalk between macrophages and FL B cells. Altogether, our data support an important role for DC-SIGN–expressing infiltrating cells in the biology of FL and suggest that they could represent interesting therapeutic targets. PMID:26272216

Activation of liver X receptor decreases atherosclerosis in Ldlr⁻/⁻ mice in the absence of ATP-binding cassette transporters A1 and G1 in myeloid cells.

PubMed

Kappus, Mojdeh S; Murphy, Andrew J; Abramowicz, Sandra; Ntonga, Vusisizwe; Welch, Carrie L; Tall, Alan R; Westerterp, Marit

2014-02-01

Liver X receptor (LXR) activators decrease atherosclerosis in mice. LXR activators (1) directly upregulate genes involved in reverse cholesterol transport and (2) exert anti-inflammatory effects mediated by transrepression of nuclear factor-κB target genes. We investigated whether myeloid cell deficiency of ATP-binding cassette transporters A1 and G1 (ABCA1/G1), principal targets of LXR that promote macrophage cholesterol efflux and initiate reverse cholesterol transport, would abolish the beneficial effects of LXR activation on atherosclerosis. LXR activator T0901317 substantially reduced inflammatory gene expression in macrophages lacking ABCA1/G1. Ldlr(-/-) mice were transplanted with Abca1(-/-)Abcg1(-/-) or wild-type bone marrow (BM) and fed a Western-type diet for 6 weeks with or without T0901317 supplementation. Abca1/g1 BM deficiency increased atherosclerotic lesion complexity and inflammatory cell infiltration into the adventitia and myocardium. T0901317 markedly decreased lesion area, complexity, and inflammatory cell infiltration in the Abca1(-/-)Abcg1(-/-) BM-transplanted mice. To investigate whether this was because of macrophage Abca1/g1 deficiency, Ldlr(-/-) mice were transplanted with LysmCreAbca1(fl/fl)Abcg1(fl/fl) or Abca1(fl/fl)Abcg1(fl/fl) BM and fed Western-type diet with or without the more specific LXR agonist GW3965 for 12 weeks. GW3965 decreased lesion size in both groups, and the decrease was more prominent in the LysmCreAbca1(fl/fl)Abcg1(fl/fl) group. The results suggest that anti-inflammatory effects of LXR activators are of key importance to their antiatherosclerotic effects in vivo independent of cholesterol efflux pathways mediated by macrophage ABCA1/G1. This has implications for the development of LXR activators that lack adverse effects on lipogenic genes while maintaining the ability to transrepress inflammatory genes.

Reduced Cx43 expression triggers increased fibrosis due to enhanced fibroblast activity.

PubMed

Jansen, John A; van Veen, Toon A B; de Jong, Sanne; van der Nagel, Roel; van Stuijvenberg, Leonie; Driessen, Helen; Labzowski, Ronald; Oefner, Carolin M; Bosch, Astrid A; Nguyen, Tri Q; Goldschmeding, Roel; Vos, Marc A; de Bakker, Jacques M T; van Rijen, Harold V M

2012-04-01

Arrhythmogenic ventricular remodeling is hallmarked by both reduced gap junction expression and increased collagen deposition. We hypothesized that reduced connexin43 (Cx43) expression is responsible for enhanced fibrosis in the remodeled heart, resulting in an arrhythmogenic substrate. Therefore, we investigated the effect of normal or reduced Cx43 expression on the formation of fibrosis in a physiological (aging) and pathophysiological (transverse aortic constriction [TAC]) mouse model. The Cx43(fl/fl) and Cx43(CreER(T)/fl) mice were aged 18 to 21 months or, at the age of 3 months, either TAC or sham operated and euthanized after 16 weeks. Epicardial activation mapping of the right and left ventricles was performed on Langendorff perfused hearts. Sustained ventricular arrhythmias were induced in 0 of 11 aged Cx43(fl/fl) and 10 of 15 Cx43(Cre-ER(T)/fl) mice (P<0.01). Cx43 expression was reduced by half in aged Cx43(CreER(T)/fl) compared with aged Cx43(fl/fl) mice, whereas collagen deposition was significantly increased from 1.1±0.2% to 7.4±1.3%. Aged Cx43(CreER(T)/fl) mice with arrhythmias had significantly higher levels of fibrosis and conduction heterogeneity than aged Cx43(CreER(T)/fl) mice without arrhythmias. The TAC operation significantly increased fibrosis in control compared with sham (4.0±1.2% versus 0.4±0.06%), but this increase was significantly higher in Cx43(CreER(T)/fl) mice (10.8±1.4%). Discoidin domain receptor 2 expression was unchanged, but procollagen peptide I and III expression and collagen type 1α2 mRNA levels were higher in TAC-operated Cx43HZ mice. Reduced cellular coupling results in more excessive collagen deposition during aging or pressure overload in mice due to enhanced fibroblast activity, leading to increased conduction in homogeneity and proarrhythmia.

The t(14;18) translocation is absent from endothelial and follicular dendritic cells of follicular lymphoma (FL) and shows heterogeneous presence in preserved FL mantle zones.

PubMed

Kosmidis, Perikles; Mankel, Barbara; Fend, Falko; Adam, Patrick

2018-05-02

The translocation t(14;18)(q32;q21) is the genetic hallmark of follicular lymphoma (FL) and can be observed in 85-90% of cases. Whether the translocation is restricted to cells with germinal center B-cell phenotype or can be observed in other cell types of the microenvironment remains debated. Of interest, cases of associated histiocytic and dendritic cell sarcomas arising in the background of FL have been shown to be clonally related and carry the t(14;18), suggesting a "transdifferentiation" of the malignant FL clone into a neoplasm of a different hematopoietic lineage. We analyzed the presence of the t(14;18)(q32;q21) as a surrogate marker of the malignant clone in cells of the FL microenvironment using combined fluorescence immunophenotyping and interphase cytogenetics targeting the BCL2 gene locus. In addition to non-lymphoid cells in FL, we analysed FL with preserved IgD+ mantle zones and cases of in situ follicular neoplasia (ISFN) to investigate whether cells of non-germinal center B-cell phenotype are part of the malignant clone. Six (40%) of 15 manifest FL cases with preserved IgD+ mantle zones did not harbour the t(14;18)(q32;q21) translocation. In all t(14;18) + FL cases, follicular dendritic cells and endothelial cells lacked the t(14;18) translocation. 2/9 FL revealed t(14;18)- IgD+ mantle zone B-cells. In the seven ISFN cases, the t(14;18) translocation was strictly confined to germinal center cells. The t(14;18) translocation in follicular lymphoma is limited to B-cells. The origin of IgD+ mantle cells is heterogeneous, in the majority of cases belonging to the neoplastic clone, whereas a minority of cases of manifest FL show nonneoplastic mantle zones, similar to ISFN.

Association between global biomarkers of oxidative stress and hip fracture in postmenopausal women: a prospective study.

PubMed

Yang, Shuman; Feskanich, Diane; Willett, Walter C; Eliassen, A Heather; Wu, Tianying

2014-12-01

Human studies suggest that oxidative stress is a risk factor for osteoporosis, but its relationship with fracture risk is poorly understood. The purpose of the present study was to investigate the association between biomarkers of oxidative stress and hip fracture in postmenopausal women. We conducted a prospective study in the Nurses' Health Study among 996 women aged 60 years or older at baseline blood collection in 1989-1990. Plasma fluorescent oxidation products (FlOPs) were measured at three excitation/emission wavelengths (360/420 nm named as FlOP_360; 320/420 nm named as FlOP_320; and 400/475 nm named as FlOP_400). FlOPs are generated from many different pathways (lipid, protein, and DNA) and reflect a global oxidation burden. FlOP assay is 10-100 times more sensitive than measurement of malondialdehyde. We used Cox proportional hazards regression model to investigate the association between baseline plasma FlOPs and the risk of hip fracture, adjusting for multiple hip fracture risk factors such as age, history of osteoporosis, history of hypertension, prior fracture, and smoking status. Forty-four hip fractures (4.4%) were identified during the follow-up (maximum = 23 years). In the multivariable model, the hazard ratios (HRs) of hip fracture in the second and third tertiles of FlOP_320 were 2.11 (95% confidence interval [CI] = 0.88-5.10) and 2.67 (95% CI = 1.14-6.27), respectively, in comparison with the lowest tertile, and the risk increased linearly with increasing FlOP_320 (p for trend = 0.021). Neither FlOP_360 nor FlOP_400 was significantly associated with risk of hip fracture (tertile 3 versus tertile 1: HR = 0.70, 95% CI = 0.32-1.54, p for trend = 0.386 for FlOP_360; and HR = 0.88, 95% CI = 0.40-1.96, p for trend = 0.900 for FlOP_400). In this prospective study, higher plasma FlOP_320 was an independent risk factor for hip fracture. Our results need further confirmation. © 2014 American Society for Bone and Mineral Research.

21. Photocopy of engineering drawing. COMPLEX 17A AND B: SERVICE ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

21. Photocopy of engineering drawing. COMPLEX 17A AND B: SERVICE STRUCTURE SPACECRAFT AREA-MECHANICAL, ELEVATIONS, SHEET 4, DECEMBER 1965. - Cape Canaveral Air Station, Launch Complex 17, Facility 28417, East end of Lighthouse Road, Cape Canaveral, Brevard County, FL

Cross-Cultural Perspective of FL Teaching and Learning in the Polish Context

ERIC Educational Resources Information Center

Sobkowiak, Pawel

2012-01-01

This study examines whether learners' capacity to use a foreign language (FL) successfully in the global world is developed in the FL classroom in Polish high schools. The article reports results of the quantitative research which aimed at assessing whether and to what extent homogeneous FL classes in Poland are conducive to developing learners'…

75 FR 20608 - Notice of Re-Designation of the Service Delivery Area for the Cowlitz Indian Tribe

Federal Register 2010, 2011, 2012, 2013, 2014

2010-04-20

..., Louisiana Grand Parish, LA,\\22\\ LaSalle Parish, LA, Rapides Parish, LA. Jicarilla Apache Nation, New Mexico... Mexico. NM. Miccosukee Tribe of Indians of Florida. Broward, FL, Collier, FL, Miami- Dade, FL, Hendry, FL.... Narragansett Indian Tribe of Rhode Washington, RI.\\32\\ Island. Navajo Nation, Arizona, New Mexico and Apache...

77 FR 28243 - Amendment of Class D Airspace; Cocoa Beach, FL

Federal Register 2010, 2011, 2012, 2013, 2014

2012-05-14

...-0099; Airspace Docket No. 12-ASO-11] Amendment of Class D Airspace; Cocoa Beach, FL AGENCY: Federal... Federal Register on April 11, 2012 that amends Class D airspace at Cocoa Beach, FL. DATES: Effective 0901...), amends Class D airspace at Cape Canaveral Skid Strip, Cocoa Beach, FL. A typographical error was made in...

78 FR 37105 - Modification of VOR Federal Airway V-537, GA

Federal Register 2010, 2011, 2012, 2013, 2014

2013-06-20

..., GA, VOR/DME navigation aid which currently forms a point along the route. DATES: Effective date 0901... and the Macon, GA, VORTAC. The modified V-537 extends between Palm Beach, FL, and Greenville, FL. VOR... * * * * * V-537 [Amended] From Palm Beach, FL; INT Palm Beach 356[deg] and Treasure, FL, 143[deg] radials...

33 CFR 80.748 - Cape Romano, FL to Sanibel Island, FL.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Cape Romano, FL to Sanibel Island... Sanibel Island, FL. (a) A line drawn across Big Marco Pass parallel to the general trend of the seaward, highwater shoreline. (b) A line drawn from the northwesternmost extremity of Coconut Island 000°T across...

33 CFR 80.748 - Cape Romano, FL to Sanibel Island, FL.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Cape Romano, FL to Sanibel Island... Sanibel Island, FL. (a) A line drawn across Big Marco Pass parallel to the general trend of the seaward, highwater shoreline. (b) A line drawn from the northwesternmost extremity of Coconut Island 000°T across...

33 CFR 80.748 - Cape Romano, FL to Sanibel Island, FL.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Cape Romano, FL to Sanibel Island... Sanibel Island, FL. (a) A line drawn across Big Marco Pass parallel to the general trend of the seaward, highwater shoreline. (b) A line drawn from the northwesternmost extremity of Coconut Island 000°T across...

33 CFR 80.748 - Cape Romano, FL to Sanibel Island, FL.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Cape Romano, FL to Sanibel Island... Sanibel Island, FL. (a) A line drawn across Big Marco Pass parallel to the general trend of the seaward, highwater shoreline. (b) A line drawn from the northwesternmost extremity of Coconut Island 000°T across...

33 CFR 80.748 - Cape Romano, FL to Sanibel Island, FL.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Cape Romano, FL to Sanibel Island... Sanibel Island, FL. (a) A line drawn across Big Marco Pass parallel to the general trend of the seaward, highwater shoreline. (b) A line drawn from the northwesternmost extremity of Coconut Island 000°T across...

Teachers' Role, Learners' Gender Differences, and FL Anxiety among Seventh-Grade Students Studying English as a FL

ERIC Educational Resources Information Center

Abu-Rabia, Salim

2004-01-01

This study investigated the relationship between foreign language (FL) anxiety and achievement in that language. The role of the FL teacher as perceived by the learners was also tested. Participants were 67 seventh-grade students. They were administered an anxiety questionnaire, a Hebrew reading comprehension test, an English reading comprehension…

Synchronized delta oscillations correlate with the resting-state functional MRI signal

PubMed Central

Lu, Hanbing; Zuo, Yantao; Gu, Hong; Waltz, James A.; Zhan, Wang; Scholl, Clara A.; Rea, William; Yang, Yihong; Stein, Elliot A.

2007-01-01

Synchronized low-frequency spontaneous fluctuations of the functional MRI (fMRI) signal have recently been applied to investigate large-scale neuronal networks of the brain in the absence of specific task instructions. However, the underlying neural mechanisms of these fluctuations remain largely unknown. To this end, electrophysiological recordings and resting-state fMRI measurements were conducted in α-chloralose-anesthetized rats. Using a seed-voxel analysis strategy, region-specific, anesthetic dose-dependent fMRI resting-state functional connectivity was detected in bilateral primary somatosensory cortex (S1FL) of the resting brain. Cortical electroencephalographic signals were also recorded from bilateral S1FL; a visual cortex locus served as a control site. Results demonstrate that, unlike the evoked fMRI response that correlates with power changes in the γ bands, the resting-state fMRI signal correlates with the power coherence in low-frequency bands, particularly the δ band. These data indicate that hemodynamic fMRI signal differentially registers specific electrical oscillatory frequency band activity, suggesting that fMRI may be able to distinguish the ongoing from the evoked activity of the brain. PMID:17991778

Forkhead Box O1 Regulates Macrophage Polarization Following Staphylococcus aureus Infection: Experimental Murine Data and Review of the Literature.

PubMed

Wang, Yu-Chen; Ma, Hong-Di; Yin, Xue-Ying; Wang, Yin-Hu; Liu, Qing-Zhi; Yang, Jing-Bo; Shi, Qing-Hua; Sun, Baolin; Gershwin, M Eric; Lian, Zhe-Xiong

2016-12-01

The functions of macrophages that lead to effective host responses are critical for protection against Staphylococcus aureus. Deep tissue-invading S. aureus initially countered by macrophages trigger macrophage accumulation and induce inflammatory responses through surface receptors, especially toll-like receptor 2 (TLR2). Here, we found that macrophages formed sporadic aggregates in the liver during infection. Within those aggregates, macrophages co-localized with T cells and were indispensable for their infiltration. In addition, we have focused on the mechanisms underlying the polarization of macrophages in Forkhead box transcription factor O1 (FoxO1) conditional knockout Lys Cre/+ FoxO1 fl/fl mice following S. aureus infection and report herein that macrophage M1-M2 polarization via TLR2 is intrinsically regulated by FoxO1. Indeed, for effective FoxO1 activity, stimulation of TLR2 is essential. However, following S. aureus challenge, there was a decrease in macrophage FoxO1, with increased phosphorylation of FoxO1 because of TLR2-mediated activation of PI3K/Akt and c-Raf/MEK/ERK pathway. Following infection in Lys Cre/+ FoxO1 fl/fl mice, mice became more susceptible to S. aureus with reduced macrophage aggregation in the liver and attenuated Th1 and Th17 responses. FoxO1 abrogation reduced M1 pro-inflammatory responses triggered by S. aureus and enhanced M2 polarization in macrophages. In contrast, overexpression of FoxO1 in macrophages increased pro-inflammatory mediators and functional surface molecule expression. In conclusion, macrophage FoxO1 is critical to promote M1 polarization and maintain a competent T cell immune response against S. aureus infection in the liver. FoxO1 regulates macrophage M1-M2 polarization downstream of TLR2 dynamically through phosphorylation.

Alteration/Deficiency in Activation 3 (ADA3) Protein, a Cell Cycle Regulator, Associates with the Centromere through CENP-B and Regulates Chromosome Segregation.

PubMed

Mohibi, Shakur; Srivastava, Shashank; Wang-France, Jun; Mirza, Sameer; Zhao, Xiangshan; Band, Hamid; Band, Vimla

2015-11-20

ADA3 (alteration/deficiency in activation 3) is a conserved component of several transcriptional co-activator and histone acetyltransferase (HAT) complexes. Recently, we generated Ada3 knock-out mice and demonstrated that deletion of Ada3 leads to early embryonic lethality. The use of Ada3(FL/FL) mouse embryonic fibroblasts with deletion of Ada3 using adenovirus Cre showed a critical role of ADA3 in cell cycle progression through mitosis. Here, we demonstrate an association of ADA3 with the higher order repeat region of the α-satellite region on human X chromosome centromeres that is consistent with its role in mitosis. Given the role of centromere proteins (CENPs) in mitosis, we next analyzed whether ADA3 associates with the centromere through CENPs. Both an in vivo proximity ligation assay and immunofluorescence studies confirmed the association of ADA3 with CENP-B protein, a highly conserved centromeric protein that binds to the 17-bp DNA sequences on α-satellite DNA. Deletional analysis showed that ADA3 directly associates with CENP-B through its N terminus, and a CENP-B binding-deficient mutant of ADA3 was incompetent in cell proliferation rescue. Notably, knockdown of ADA3 decreased binding of CENP-B onto the centromeres, suggesting that ADA3 is required for the loading of CENP-B onto the centromeres. Finally, we show that deletion of Ada3 from Ada3(FL/FL) mouse embryonic fibroblasts exhibited various chromosome segregation defects. Taken together, we demonstrate a novel ADA3 interaction with CENP-B-centromere that may account for its previously known function in mitosis. This study, together with its known function in maintaining genomic stability and its mislocalization in cancers, suggests an important role of ADA3 in mitosis. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Correlation between porous texture and cell seeding efficiency of gas foaming and microfluidic foaming scaffolds.

PubMed

Costantini, Marco; Colosi, Cristina; Mozetic, Pamela; Jaroszewicz, Jakub; Tosato, Alessia; Rainer, Alberto; Trombetta, Marcella; Święszkowski, Wojciech; Dentini, Mariella; Barbetta, Andrea

2016-05-01

In the design of scaffolds for tissue engineering applications, morphological parameters such as pore size, shape, and interconnectivity, as well as transport properties, should always be tailored in view of their clinical application. In this work, we demonstrate that a regular and ordered porous texture is fundamental to achieve an even cell distribution within the scaffold under perfusion seeding. To prove our hypothesis, two sets of alginate scaffolds were fabricated using two different technological approaches of the same method: gas-in-liquid foam templating. In the first one, foam was obtained by insufflating argon in a solution of alginate and a surfactant under stirring. In the second one, foam was generated inside a flow-focusing microfluidic device under highly controlled and reproducible conditions. As a result, in the former case the derived scaffold (GF) was characterized by polydispersed pores and interconnects, while in the latter (μFL), the porous structure was highly regular both with respect to the spatial arrangement of pores and interconnects and their monodispersity. Cell seeding within perfusion bioreactors of the two scaffolds revealed that cell population inside μFL scaffolds was quantitatively higher than in GF. Furthermore, seeding efficiency data for μFL samples were characterized by a lower standard deviation, indicating higher reproducibility among replicates. Finally, these results were validated by simulation of local flow velocity (CFD) inside the scaffolds proving that μFL was around one order of magnitude more permeable than GF. Copyright © 2016 Elsevier B.V. All rights reserved.

Phobic Anxiety and Plasma Levels of Global Oxidative Stress in Women.

PubMed

Hagan, Kaitlin A; Wu, Tianying; Rimm, Eric B; Eliassen, A Heather; Okereke, Olivia I

2015-01-01

Psychological distress has been hypothesized to be associated with adverse biologic states such as higher oxidative stress and inflammation. Yet, little is known about associations between a common form of distress - phobic anxiety - and global oxidative stress. Thus, we related phobic anxiety to plasma fluorescent oxidation products (FlOPs), a global oxidative stress marker. We conducted a cross-sectional analysis among 1,325 women (aged 43-70 years) from the Nurses' Health Study. Phobic anxiety was measured using the Crown-Crisp Index (CCI). Adjusted least-squares mean log-transformed FlOPs were calculated across phobic categories. Logistic regression models were used to calculate odds ratios (OR) comparing the highest CCI category (≥6 points) vs. lower scores, across FlOPs quartiles. No association was found between phobic anxiety categories and mean FlOP levels in multivariable adjusted linear models. Similarly, in multivariable logistic regression models there were no associations between FlOPs quartiles and likelihood of being in the highest phobic category. Comparing women in the highest vs. lowest FlOPs quartiles: FlOP_360: OR=0.68 (95% CI: 0.40-1.15); FlOP_320: OR=0.99 (95% CI: 0.61-1.61); FlOP_400: OR=0.92 (95% CI: 0.52, 1.63). No cross-sectional association was found between phobic anxiety and a plasma measure of global oxidative stress in this sample of middle-aged and older women.

Temperature-driven flower longevity in a high-alpine species of Oxalis influences reproductive assurance.

PubMed

Arroyo, Mary T K; Dudley, Leah S; Jespersen, Gus; Pacheco, Diego A; Cavieres, Lohengrin A

2013-12-01

How high-alpine plants confront stochastic conditions for animal pollination is a critical question. We investigated the effect of temperature on potential flower longevity (FL) measured in pollinator-excluded flowers and actual FL measured in pollinated flowers in self-incompatible Oxalis compacta and evaluated if plastically prolonged potential FL can ameliorate slow pollination under cool conditions. Pollinator-excluded and hand-pollinated flowers were experimentally warmed with open-top chambers (OTCs) on a site at 3470 m above sea level (asl). Flower-specific temperatures, and pollinator-excluded and open-pollination flower life-spans were measured at six alpine sites between 3100 and 3470 m asl. Fruit set was analyzed in relation to inferred pollination time. Warming reduced potential FL. Variable thermal conditions across the alpine landscape predicted potential and actual FL; flower senescence was pollination-regulated. Actual FL and potential FL were coupled. Prolonged potential FL generally increased fruit set under cooler conditions. Plastic responses permit virgin flowers of O. compacta to remain open longer under cooler temperatures, thereby ameliorating slow pollination, and to close earlier when pollination tends to be faster under warmer conditions. Plastic potential FL provides adaptive advantages in the cold, thermally variable alpine habitat, and has important implications for reproductive success in alpine plants in a warming world. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

When Language Experience Fails to Explain Word Reading Development: Early Cognitive and Linguistic Profiles of Young Foreign Language Learners

ERIC Educational Resources Information Center

Hu, Chieh-Fang; Schuele, C. Melanie

2015-01-01

Although language experience is a key factor in successful foreign language (FL) learning, many FL learners fail to achieve performance levels that were predicted on the basis of their FL experience. This retrospective study investigated early cognitive and linguistic correlates of learning English as a foreign language (FL) in a group of…

33 CFR 80.810 - Cape San Blas, FL to Perdido Bay, FL.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., FL to Perdido Bay, FL. (a) A line drawn from St. Joseph Bay Entrance Range A Rear Light through St. Joseph Bay Entrance Range B Front Light to St. Joseph Point. (b) A line drawn across the mouth of Salt Creek as an extension of the general trend of the shoreline to continue across the inlet to St. Andrews...

Structural insight and flexible features of NS5 proteins from all four serotypes of Dengue virus in solution

PubMed Central

Saw, Wuan Geok; Tria, Giancarlo; Grüber, Ardina; Subramanian Manimekalai, Malathy Sony; Zhao, Yongqian; Chandramohan, Arun; Srinivasan Anand, Ganesh; Matsui, Tsutomu; Weiss, Thomas M.; Vasudevan, Subhash G.; Grüber, Gerhard

2015-01-01

Infection by the four serotypes of Dengue virus (DENV-1 to DENV-4) causes an important arthropod-borne viral disease in humans. The multifunctional DENV nonstructural protein 5 (NS5) is essential for capping and replication of the viral RNA and harbours a methyltransferase (MTase) domain and an RNA-dependent RNA polymerase (RdRp) domain. In this study, insights into the overall structure and flexibility of the entire NS5 of all four Dengue virus serotypes in solution are presented for the first time. The solution models derived revealed an arrangement of the full-length NS5 (NS5FL) proteins with the MTase domain positioned at the top of the RdRP domain. The DENV-1 to DENV-4 NS5 forms are elongated and flexible in solution, with DENV-4 NS5 being more compact relative to NS5 from DENV-1, DENV-2 and DENV-3. Solution studies of the individual MTase and RdRp domains show the compactness of the RdRp domain as well as the contribution of the MTase domain and the ten-residue linker region to the flexibility of the entire NS5. Swapping the ten-residue linker between DENV-4 NS5FL and DENV-3 NS5FL demonstrated its importance in MTase–RdRp communication and in concerted interaction with viral and host proteins, as probed by amide hydrogen/deuterium mass spectrometry. Conformational alterations owing to RNA binding are presented. PMID:26527147

Two 3D structured Co-Ni bimetallic oxides as cathode catalysts for high-performance alkaline direct methanol fuel cells

NASA Astrophysics Data System (ADS)

Liu, Yan; Shu, Chengyong; Fang, Yuan; Chen, Yuanzhen; Liu, Yongning

2017-09-01

Two NiCo2O4 bimetallic oxides were synthesized via a facile hydrothermal method. SEM and TEM observations show that these materials have three-dimensional (3D) dandelion-like (DL) and flower-like (FL) morphologies. Their large specific surface areas (90.68 and 19.8 m2·g-1) and porous structures provide many active sites and effective transport pathways for the oxygen reduction reaction (ORR). Electrochemical measurements with a rotating ring-disc electrode (RRDE) indicate that the electron transfer numbers of the NiCo2O4-DL and NiCo2O4-FL catalysts for ORR in an alkaline solution are 3.97 and 3.91, respectively. Fuel cells were assembled with the bimetallic oxides, PtRu/C and a polymer fiber membrane (PFM) as cathode catalysts, anode catalyst and electrolyte film, respectively. For NiCo2O4-DL, the peak power density reaches up to 73.5 mW·cm-2 at 26 °C, which is the highest room-temperature value reported to date. The high catalytic activity of NiCo2O4 is mainly attributed to the presence of many Co3+ cations that directly donate electrons to O2 to reduce it via a more efficient and effective route. Furthermore, the catalytic performance of NiCo2O4-DL is superior to that of NiCo2O4-FL because it has a higher specific surface area and is less crystalline.

Structural insight and flexible features of NS5 proteins from all four serotypes of Dengue virus in solution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saw, Wuan Geok; Tria, Giancarlo; Grüber, Ardina

Infection by the four serotypes ofDengue virus(DENV-1 to DENV-4) causes an important arthropod-borne viral disease in humans. The multifunctional DENV nonstructural protein 5 (NS5) is essential for capping and replication of the viral RNA and harbours a methyltransferase (MTase) domain and an RNA-dependent RNA polymerase (RdRp) domain. In this study, insights into the overall structure and flexibility of the entire NS5 of all fourDengue virusserotypes in solution are presented for the first time. The solution models derived revealed an arrangement of the full-length NS5 (NS5FL) proteins with the MTase domain positioned at the top of the RdRP domain. The DENV-1more » to DENV-4 NS5 forms are elongated and flexible in solution, with DENV-4 NS5 being more compact relative to NS5 from DENV-1, DENV-2 and DENV-3. Solution studies of the individual MTase and RdRp domains show the compactness of the RdRp domain as well as the contribution of the MTase domain and the ten-residue linker region to the flexibility of the entire NS5. Swapping the ten-residue linker between DENV-4 NS5FL and DENV-3 NS5FL demonstrated its importance in MTase–RdRp communication and in concerted interaction with viral and host proteins, as probed by amide hydrogen/deuterium mass spectrometry. Conformational alterations owing to RNA binding are presented.« less

Influence of Watershed Characteristics on Wetland Hydrology (Tampa, FL)

EPA Science Inventory

The availability of oxygen in wetland soils is a major driver of rate changes for several important ecological functions (e.g. nutrient processing, carbon sequestration) that the Tampa Bay Ecosystem Services Research Program (TB-ESRP) is quantifying to estimate ecosystem services...

Bone marrow stromal cells spontaneously produce Flt3-ligand: influence of ionizing radiations and cytokine stimulation.

PubMed

Bertho, Jean Marc; Demarquay, Christelle; Mouiseddine, Moubarak; Douenat, Noémie; Stefani, Johanna; Prat, Marie; Paquet, François

2008-08-01

To define the ability of human bone marrow (BM) stromal cells to produce fms-like tyrosine kinase 3 (Flt3)-ligand (FL), and the effect of irradiation, tumour necrosis factor-alpha (TNFalpha) or tumour growth factor beta (TGFbeta) on FL production. Primary BM stromal cell cultures were irradiated at 2-10 Gy or were stimulated with TNFalpha or TGFbeta1. The presence of FL was tested in culture supernatants and in cell lysate. The presence of a membrane-bound form of FL and the level of gene expression were also tested. Primary BM stromal cells spontaneously released FL. This production was increased by TNFalpha but not by TGFbeta1 or by irradiation. Chemical induction of osteoblastic differentiation from BM stromal cells also induced an increase in FL release. Our results suggest that the observed increase in FL concentration after in vivo irradiation is an indirect effect. The possible implication of BM stromal cells in these mechanisms is discussed.

Shp1 regulates T cell homeostasis by limiting IL-4 signals

PubMed Central

Johnson, Dylan J.; Pao, Lily I.; Dhanji, Salim; Murakami, Kiichi

2013-01-01

The protein-tyrosine phosphatase Shp1 is expressed ubiquitously in hematopoietic cells and is generally viewed as a negative regulatory molecule. Mutations in Ptpn6, which encodes Shp1, result in widespread inflammation and premature death, known as the motheaten (me) phenotype. Previous studies identified Shp1 as a negative regulator of TCR signaling, but the severe systemic inflammation in me mice may have confounded our understanding of Shp1 function in T cell biology. To define the T cell–intrinsic role of Shp1, we characterized mice with a T cell–specific Shp1 deletion (Shp1fl/fl CD4-cre). Surprisingly, thymocyte selection and peripheral TCR sensitivity were unaltered in the absence of Shp1. Instead, Shp1fl/fl CD4-cre mice had increased frequencies of memory phenotype T cells that expressed elevated levels of CD44. Activation of Shp1-deficient CD4+ T cells also resulted in skewing to the Th2 lineage and increased IL-4 production. After IL-4 stimulation of Shp1-deficient T cells, Stat 6 activation was sustained, leading to enhanced Th2 skewing. Accordingly, we observed elevated serum IgE in the steady state. Blocking or genetic deletion of IL-4 in the absence of Shp1 resulted in a marked reduction of the CD44hi population. Therefore, Shp1 is an essential negative regulator of IL-4 signaling in T lymphocytes. PMID:23797092

Inactivation of a Single Copy of Crebbp Selectively Alters Pre-mRNA Processing in Mouse Hematopoietic Stem Cells

PubMed Central

Lemieux, Madeleine E.; Cheng, Ziming; Zhou, Qing; White, Ruth; Cornell, John; Kung, Andrew L.; Rebel, Vivienne I.

2011-01-01

Global expression analysis of fetal liver hematopoietic stem cells (FL HSCs) revealed the presence of unspliced pre-mRNA for a number of genes in normal FL HSCs. In a subset of these genes, Crebbp+/− FL HSCs had less unprocessed pre-mRNA without a corresponding reduction in total mRNA levels. Among the genes thus identified were the key regulators of HSC function Itga4, Msi2 and Tcf4. A similar but much weaker effect was apparent in Ep300+/− FL HSCs, indicating that, in this context as in others, the two paralogs are not interchangeable. As a group, the down-regulated intronic probe sets could discriminate adult HSCs from more mature cell types, suggesting that the underlying mechanism is regulated with differentiation stage and is active in both fetal and adult hematopoiesis. Consistent with increased myelopoiesis in Crebbp hemizygous mice, targeted reduction of CREBBP abundance by shRNA in the multipotent EML cell line triggered spontaneous myeloid differentiation in the absence of the normally required inductive signals. In addition, differences in protein levels between phenotypically distinct EML subpopulations were better predicted by taking into account not only the total mRNA signal but also the amount of unspliced message present. CREBBP thus appears to selectively influence the timing and degree of pre-mRNA processing of genes essential for HSC regulation and thereby has the potential to alter subsequent cell fate decisions in HSCs. PMID:21901164

19. Photocopy of engineering drawing. COMPLEX 17A AND B: SERVICE ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

19. Photocopy of engineering drawing. COMPLEX 17A AND B: SERVICE STRUCTURE SPACECRAFT AREA A/C-MECHANICAL, ELEVATIONS, SHEET 3, DECEMBER 1965. - Cape Canaveral Air Station, Launch Complex 17, Facility 28416, East end of Lighthouse Road, Cape Canaveral, Brevard County, FL

The Mad Fox Disease: Rabies.

ERIC Educational Resources Information Center

Keller, Rosanne

One of a series of instructional materials produced by the Literacy Council of Alaska, this booklet provides information about the control of rabies. Using both simplified sentence structure and vocabulary, it describes how rabies may be spread, its symptoms, its treatment, and ways it can be prevented. (FL)

17. DETAIL OF STEEL STOPS AT WEST END OF MOBILE ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

17. DETAIL OF STEEL STOPS AT WEST END OF MOBILE SERVICE STRUCTURE RAIL WITH STEEL STOPS AND CONCRETE TIE-DOWN BLOCK; VIEW TO NORTHWEST. - Cape Canaveral Air Station, Launch Complex 17, Facility 28416, East end of Lighthouse Road, Cape Canaveral, Brevard County, FL

Pigment Fluorescence Signatures as an Index to the Taxonomic Structure of Phytoplankton Communities

DTIC Science & Technology

2001-09-30

1 Pigment Fluorescence Signatures as an Index to the Taxonomic Structure of Phytoplankton Communities Dr. Gary Hitchcock Marine Biology and... Fisheries Rosenstiel School of Marine and Atmospheric Science 4600 Rickenbacker Cswy. Miami, FL 3149 phone: (305) 361-4926 fax: (305) 361-4765...ghitchcock.html LONG-TERM GOALS The spatial distribution and taxonomic composition of phytoplankton communities are important determinants of the

N-cadherin{sup +} HSCs in fetal liver exhibit higher long-term bone marrow reconstitution activity than N-cadherin{sup -} HSCs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Toyama, Hirofumi; Arai, Fumio; Hosokawa, Kentaro

Highlights: Black-Right-Pointing-Pointer High N-cad expression was detected in E12.5 mouse FL LT-HSCs (EPCR{sup +} LSK cells). Black-Right-Pointing-Pointer Immunohistochemically, N-cad{sup +} HSCs co-localized with sinusoidal ECs (Lyve-1{sup +} cells) in E12.5 FL, but these gradually detached in E15.5 and E18.5 FL. Black-Right-Pointing-Pointer N-cad{sup +} LSK cells in E12.5 FL exhibited higher LTR activity versus N-cad{sup -} LSK cells, which decreased in E15.5 and E18.5. Black-Right-Pointing-Pointer N-cad expression may confer high LTR activity to HSCs by facilitating interactions with the perisinusoidal niche in FL. -- Abstract: Adult hematopoietic stem cells (HSCs) are maintained in a microenvironment known as the stem cell niche.more » The regulation of HSCs in fetal liver (FL) and their niche, however, remains to be elucidated. In this study, we investigated the role of N-cadherin (N-cad) in the maintenance of HSCs during FL hematopoiesis. By using anti-N-cad antibodies (Abs) produced by our laboratory, we detected high N-cad expression in embryonic day 12.5 (E12.5) mouse FL HSCs, but not in E15.5 and E18.5 FL. Immunofluorescence staining revealed that N-cad{sup +}c-Kit{sup +} and N-cad{sup +} endothelial protein C receptor (EPCR){sup +} HSCs co-localized with Lyve-1{sup +} sinusoidal endothelial cells (ECs) in E12.5 FL and that some of these cells also expressed N-cad. However, N-cad{sup +} HSCs were also observed to detach from the perisinusoidal niche at E15.5 and E18.5, concomitant with a down-regulation of N-cad and an up-regulation of E-cadherin (E-cad) in hepatic cells. Moreover, EPCR{sup +} long-term (LT)-HSCs were enriched in the N-cad{sup +}Lin{sup -}Sca-1{sup +}c-Kit{sup +} (LSK) fraction in E12.5 FL, but not in E15.5 or E18.5 FL. In a long-term reconstitution (LTR) activity assay, higher engraftment associated with N-cad{sup +} LSK cells versus N-cad{sup -} LSK cells in E12.5 FL when transplanted into lethally irradiated recipient mice. However, the higher engraftment of N-cad{sup +} LSK cells decreased subsequently in E15.5 and E18.5 FL. It is possible that N-cad expression conferred higher LTR activity to HSCs by facilitating interactions with the perisinusoidal niche, especially at E12.5. The down-regulation of N-cad during FL hematopoiesis may help us better understand the regulation and mobility of HSCs before migration into BM.« less

Protein kinase Cι/λ is dispensable for platelet function in thrombosis and hemostasis in mice.

PubMed

Beck, Sarah; Leitges, Michael; Stegner, David

2017-10-01

Platelet activation at sites of vascular injury is crucial for hemostasis, but it may also cause myocardial infarction or ischemic stroke. Upon platelet activation, cytoskeletal reorganization is essential for platelet secretion and thrombus formation. Members of the protein kinase C family, which includes 12 isoforms, are involved in most platelet responses required for thrombus formation. The atypical protein kinase Cι/λ (PKCι/λ) has been implicated as an important mediator of cell polarity, carcinogenesis and immune cell responses. PKCι/λ is known to be associated with the small GTPase Cdc42, an important mediator of multiple platelet functions; however, its exact function in platelets is not known. To study the role of PKCι/λ, we generated platelet- and megakaryocyte-specific PKCι/λ knockout mice (Prkci fl/fl, Pf4-Cre ) and used them to investigate the function of PKCι/λ in platelet activation and aggregation in vitro and in vivo. Surprisingly, lack of PKCι/λ had no detectable effect on platelet spreading and function in vitro and in vivo under all tested conditions. These results indicate that PKCι/λ is dispensable for Cdc42-triggered processes and for thrombosis and hemostasis in mice. Copyright © 2017 Elsevier Inc. All rights reserved.

Analysis of speech and tongue motion in normal and post-glossectomy speaker using cine MRI.

PubMed

Ha, Jinhee; Sung, Iel-Yong; Son, Jang-Ho; Stone, Maureen; Ord, Robert; Cho, Yeong-Cheol

2016-01-01

Since the tongue is the oral structure responsible for mastication, pronunciation, and swallowing functions, patients who undergo glossectomy can be affected in various aspects of these functions. The vowel /i/ uses the tongue shape, whereas /u/ uses tongue and lip shapes. The purpose of this study is to investigate the morphological changes of the tongue and the adaptation of pronunciation using cine MRI for speech of patients who undergo glossectomy. Twenty-three controls (11 males and 12 females) and 13 patients (eight males and five females) volunteered to participate in the experiment. The patients underwent glossectomy surgery for T1 or T2 lateral lingual tumors. The speech tasks "a souk" and "a geese" were spoken by all subjects providing data for the vowels /u/ and /i/. Cine MRI and speech acoustics were recorded and measured to compare the changes in the tongue with vowel acoustics after surgery. 2D measurements were made of the interlip distance, tongue-palate distance, tongue position (anterior-posterior and superior-inferior), tongue height on the left and right sides, and pharynx size. Vowel formants Fl, F2, and F3 were measured. The patients had significantly lower F2/Fl ratios (F=5.911, p=0.018), and lower F3/F1 ratios that approached significance. This was seen primarily in the /u/ data. Patients had flatter tongue shapes than controls with a greater effect seen in /u/ than /i/. The patients showed complex adaptation motion in order to preserve the acoustic integrity of the vowels, and the tongue modified cavity size relationships to maintain the value of the formant frequencies.

Flexibility in the structure of spiral flowers and its underlying mechanisms.

PubMed

Wang, Peipei; Liao, Hong; Zhang, Wengen; Yu, Xianxian; Zhang, Rui; Shan, Hongyan; Duan, Xiaoshan; Yao, Xu; Kong, Hongzhi

2015-12-07

Spiral flowers usually bear a variable number of organs, suggestive of the flexibility in structure. The mechanisms underlying the flexibility, however, remain unclear. Here we show that in Nigella damascena, a species with spiral flowers, different types of floral organs show different ranges of variation in number. We also show that the total number of organs per flower is largely dependent on the initial size of the floral meristem, whereas the respective numbers of different types of floral organs are determined by the functional domains of corresponding genetic programmes. By conducting extensive expression and functional studies, we further elucidate the genetic programmes that specify the identities of different types of floral organs. Notably, the AGL6-lineage member NdAGL6, rather than the AP1-lineage members NdFL1/2, is an A-function gene, whereas petaloidy of sepals is not controlled by AP3- or PI-lineage members. Moreover, owing to the formation of a regulatory network, some floral organ identity genes also regulate the boundaries between different types of floral organs. On the basis of these results, we propose that the floral organ identity determination programme is highly dynamic and shows considerable flexibility. Transitions from spiral to whorled flowers, therefore, may be explained by evolution of the mechanisms that reduce the flexibility.

Draft Genome Sequence of Mycobacterium chimaera Type Strain Fl-0169.

PubMed

Pfaller, Stacy; Tokarev, Vasily; Kessler, Collin; McLimans, Christopher; Gomez-Alvarez, Vicente; Wright, Justin; King, Dawn; Lamendella, Regina

2017-02-23

We report here the draft genome sequence of the type strain Mycobacterium chimaera Fl-0169, a member of the Mycobacterium avium complex (MAC). M. chimaera Fl-0169 T was isolated from a patient in Italy and is highly similar to strains of M. chimaera isolated in Ireland, although Fl-0169 T possesses unique virulence genes. Copyright © 2017 Pfaller et al.

Development of a Time-Variant Figure-of-Merit for Use in Analysis of Air Combat Maneuvering Engagements

DTIC Science & Technology

1976-07-16

Influence of Range 10 5 Range Performance Penalty Function II 6 Influence of Closing Velocity 12 7 Energy Influence Function 14 8 Comparison of the...flELtSHAlL, ..E^) RANGE RANGE Figure 7 Energy Influence Function 14 TM 76-1 SA ! PERFORMANCE INDEX COMPARATIVE ANALYSIS Maneuver Conversion Model...hnergy Integral ■’> E s K Energy Influence Function K* Proportionality Constant MT Target Mach Number N Normal Acceleration (load factor) z

Exon 3-deleted/full-length growth hormone receptor polymorphism genotype frequencies in Spanish short small-for-gestational-age (SGA) children and adolescents (n = 247) and in an adult control population (n = 289) show increased fl/fl in short SGA.

PubMed

Audí, Laura; Esteban, Cristina; Carrascosa, Antonio; Espadero, Rosa; Pérez-Arroyo, Annalisa; Arjona, Rosa; Clemente, María; Wollmann, Hartmut; Fryklund, Linda; Parodi, Luis A

2006-12-01

A polymorphism in the human GH receptor gene (d3/fl-GHR) resulting in genomic deletion of exon 3 has been associated with the degree of height increase in response to GH therapy. The objective of the study was to evaluate the frequencies of d3/fl-GHR polymorphism genotypes in control and short small-for-gestational-age (SGA) populations. An adult control population with heights normally distributed (ACPNH) between -2 and +2 sd score (SDS) and a short non-GH-deficient SGA child population were selected. Thirty Spanish hospitals participated in the selection of the short non-GH-deficient SGA children in the setting of a controlled, randomized trial, and one of these hospitals selected the ACPNH. CONTROLS AND PATIENTS: Two hundred eighty-nine adult subjects of both sexes constituted the ACPNH and 247 children and adolescents of both sexes the short SGA patients. Heights and weights were recorded in the ACPNH, and auxologic and biochemical data were recorded at each hospital for the SGA patients; d3/fl-GHR genotypes were determined and data analyzed in a single hospital. In short SGA patients, d3/fl-GHR genotype frequencies were significantly different from those in ACPNH, with a higher frequency of fl/fl genotype (P < 0.0001). In ACPNH, a trend toward diminished d3/d3 genotype frequency was observed in the shortest height group (height or=-2 SDS, n = 60). Our data showed significant differences in the frequency distribution of the d3/fl-GHR genotypes between a normally distributed adult height population and short SGA children, with the biologically less active fl/fl genotype being almost twice as frequent in SGA patients. These data suggest that the d3/fl-GHR polymorphism might be considered among the factors that contribute to the phenotypic expression of growth.

Activation of Liver X Receptor Decreases Atherosclerosis in Ldlr−/− mice in the Absence of ABCA1 and ABCG1 in Myeloid Cells

PubMed Central

Kappus, Mojdeh S.; Murphy, Andrew J.; Abramowicz, Sandra; Ntonga, Vusisizwe; Welch, Carrie L.; Tall, Alan R.; Westerterp, Marit

2014-01-01

Objective Liver X Receptor (LXR) activators decrease atherosclerosis in mice. LXR activators (1) directly up-regulate genes involved in reverse cholesterol transport (RCT) and (2) exert anti-inflammatory effects mediated by transrepression of NFκB target genes. We investigated whether myeloid cell deficiency of ATP-binding cassette transporters A1 and G1 (ABCA1/G1), principal targets of LXR that promote macrophage cholesterol efflux and initiate RCT, would abolish the beneficial effects of LXR activation on atherosclerosis. Approach and Results LXR activator T0901317 (T0) substantially reduced inflammatory gene expression in macrophages lacking ABCA1/G1. Ldlr−/− mice were transplanted with Abca1−/−Abcg1−/− or wild-type bone marrow (BM) and fed a Western-type diet (WTD) for 6 weeks with or without T0 supplementation. Abca1/g1 BM deficiency increased atherosclerotic lesion complexity and inflammatory cell infiltration into the adventitia and myocardium. T0 markedly decreased lesion area, complexity and inflammatory cell infiltration in the Abca1−/−Abcg1−/− BM transplanted mice. To investigate whether this was due to macrophage Abca1/g1 deficiency, Ldlr−/− mice were transplanted with LysmCreAbca1fl/flAbcg1fl/fl or Abca1fl/flAbcg1fl/fl BM and fed WTD with or without the more specific LXR agonist GW3965 for 12 weeks. GW3965 decreased lesion size in both groups and the decrease was more prominent in the LysmCreAbca1fl/flAbcg1fl/fl group. Conclusions The results suggest that anti-inflammatory effects of LXR activators are of key importance to their anti-atherosclerotic effects in vivo independent of cholesterol efflux pathways mediated by macrophage ABCA1/G1. This has implications for the development of LXR activators that lack adverse effects on lipogenic genes while maintaining the ability to trans-repress inflammatory genes. PMID:24311381

False Lumen Flow Patterns and their Relation with Morphological and Biomechanical Characteristics of Chronic Aortic Dissections. Computational Model Compared with Magnetic Resonance Imaging Measurements

PubMed Central

Segers, Patrick; Pineda, Victor; Cuellar, Hug; García-Dorado, David; Evangelista, Arturo

2017-01-01

Aortic wall stiffness, tear size and location and the presence of abdominal side branches arising from the false lumen (FL) are key properties potentially involved in FL enlargement in chronic aortic dissections (ADs). We hypothesize that temporal variations on FL flow patterns, as measured in a cross-section by phase-contrast magnetic resonance imaging (PC-MRI), could be used to infer integrated information on these features. In 33 patients with chronic descending AD, instantaneous flow profiles were quantified in the FL at diaphragm level by PC-MRI. We used a lumped-parameter model to assess the changes in flow profiles induced by wall stiffness, tear size/location, and the presence of abdominal side branches arising from the FL. Four characteristic FL flow patterns were identified in 31/33 patients (94%) based on the direction of flow in systole and diastole: BA = systolic biphasic flow and primarily diastolic antegrade flow (n = 6); BR = systolic biphasic flow and primarily diastolic retrograde flow (n = 14); MA = systolic monophasic flow and primarily diastolic antegrade flow (n = 9); MR = systolic monophasic flow and primarily diastolic retrograde flow (n = 2). In the computational model, the temporal variation of flow directions within the FL was highly dependent on the position of assessment along the aorta. FL flow patterns (especially at the level of the diaphragm) showed their characteristic patterns due to variations in the cumulative size and the spatial distribution of the communicating tears, and the incidence of visceral side branches originating from the FL. Changes in wall stiffness did not change the temporal variation of the flows whereas it importantly determined intraluminal pressures. FL flow patterns implicitly codify morphological information on key determinants of aortic expansion in ADs. This data might be taken into consideration in the imaging protocol to define the predictive value of FL flows. PMID:28125720

Development of a novel fluorogenic proteolytic beacon for in vivo detection and imaging of tumour-associated matrix metalloproteinase-7 activity.

PubMed Central

McIntyre, J Oliver; Fingleton, Barbara; Wells, K Sam; Piston, David W; Lynch, Conor C; Gautam, Shiva; Matrisian, Lynn M

2004-01-01

The present study describes the in vivo detection and imaging of tumour-associated MMP-7 (matrix metalloproteinase-7 or matrilysin) activity using a novel polymer-based fluorogenic substrate PB-M7VIS, which serves as a selective 'proteolytic beacon' (PB) for this metalloproteinase. PB-M7VIS is built on a PAMAM (polyamido amino) dendrimer core of 14.2 kDa, covalently coupled with an Fl (fluorescein)-labelled peptide Fl(AHX)RPLALWRS(AHX)C (where AHX stands for aminohexanoic acid) and with TMR (tetramethylrhodamine). PB-M7VIS is efficiently and selectively cleaved by MMP-7 with a k (cat)/ K (m) value of 1.9x10(5) M(-1).s(-1) as measured by the rate of increase in Fl fluorescence (up to 17-fold for the cleavage of an optimized PB-M7VIS) with minimal change in the TMR fluorescence. The K (m) value for PB-M7VIS is approx. 0.5 microM, which is approx. two orders of magnitude lower when compared with that for an analogous soluble peptide, indicating efficient interaction of MMP-7 with the synthetic polymeric substrate. With MMP-2 or -3, the k (cat)/ K (m) value for PB-M7VIS is approx. 56- or 13-fold lower respectively, when compared with MMP-7. In PB-M7VIS, Fl(AHX)RPLALWRS(AHX)C is a selective optical sensor of MMP-7 activity and TMR serves to detect both the uncleaved and cleaved reagents. Each of these can be visualized as subcutaneous fluorescent phantoms in a mouse and optically discriminated based on the ratio of green/red (Fl/TMR) fluorescence. The in vivo specificity of PB-M7VIS was tested in a mouse xenograft model. Intravenous administration of PB-M7VIS gave significantly enhanced Fl fluorescence from MMP-7-positive tumours, but not from control tumours ( P <0.0001), both originally derived from SW480 human colon cancer cells. Prior systemic treatment of the tumour-bearing mice with an MMP inhibitor BB-94 ([4-( N -hydroxyamino)-2 R -isobutyl-3 S -(thienylthiomethyl)-succinyl]-L-phenylalanine- N -methylamide), markedly decreased the Fl fluorescence over the MMP-7-positive tumour by approx. 60%. Thus PB-M7VIS functions as a PB for in vivo detection of MMP-7 activity that serves to light this optical beacon and is, therefore, a selective in vivo optical molecular imaging contrast reagent. PMID:14556651

A role of the SAM domain in EphA2 receptor activation.

PubMed

Shi, Xiaojun; Hapiak, Vera; Zheng, Ji; Muller-Greven, Jeannine; Bowman, Deanna; Lingerak, Ryan; Buck, Matthias; Wang, Bing-Cheng; Smith, Adam W

2017-03-24

Among the 20 subfamilies of protein receptor tyrosine kinases (RTKs), Eph receptors are unique in possessing a sterile alpha motif (SAM domain) at their C-terminal ends. However, the functions of SAM domains in Eph receptors remain elusive. Here we report on a combined cell biology and quantitative fluorescence study to investigate the role of the SAM domain in EphA2 function. We observed elevated tyrosine autophosphorylation levels upon deletion of the EphA2 SAM domain (EphA2ΔS) in DU145 and PC3 prostate cancer cells and a skin tumor cell line derived from EphA1/A2 knockout mice. These results suggest that SAM domain deletion induced constitutive activation of EphA2 kinase activity. In order to explain these effects, we applied fluorescence correlation spectroscopy to investigate the lateral molecular organization of EphA2. Our results indicate that SAM domain deletion (EphA2ΔS-GFP) increases oligomerization compared to the full length receptor (EphA2FL-GFP). Stimulation with ephrinA1, a ligand for EphA2, induced further oligomerization and activation of EphA2FL-GFP. The SAM domain deletion mutant, EphA2ΔS-GFP, also underwent further oligomerization upon ephrinA1 stimulation, but the oligomers were larger than those observed for EphA2FL-GFP. Based on these results, we conclude that the EphA2 SAM domain inhibits kinase activity by reducing receptor oligomerization.

Oxidative stress biomarkers and asthma characteristics in adults of the EGEA study.

PubMed

Andrianjafimasy, Miora; Zerimech, Farid; Akiki, Zeina; Huyvaert, Helene; Le Moual, Nicole; Siroux, Valérie; Matran, Régis; Dumas, Orianne; Nadif, Rachel

2017-12-01

Asthma is an oxidative stress related disease, but associations with asthma outcomes are poorly studied in adults. We aimed to study the associations between several biomarkers related to oxidative stress and various asthma outcomes.Cross-sectional analyses were conducted in 1388 adults (mean age 43 years, 44% with asthma) from the Epidemiological Study of the Genetics and Environment of Asthma (EGEA2). Three blood antioxidant enzyme activities (biomarkers of response to oxidative stress) and exhaled breath condensate 8-isoprostanes and plasma fluorescent oxidation products (FlOPs) levels (two biomarkers of damage) were measured. Associations between biomarkers and 1) ever asthma and 2) asthma attacks, asthma control and lung function in participants with asthma were evaluated using regression models adjusted for age, sex and smoking.Biomarkers of response were unrelated to asthma outcomes. Higher 8-isoprostane levels were significantly associated with ever asthma (odds ratio for one interquartile range increase 1.28 (95% CI 1.06-1.67). Among participants with asthma, 8-isoprostane levels were negatively associated with adult-onset asthma (0.63, 0.41-0.97) and FlOPs levels were positively associated with asthma attacks (1.33, 1.07-1.65), poor asthma control (1.30, 1.02-1.66) and poor lung function (1.34, 1.04-1.74).Our results suggest that 8-isoprostanes are involved in childhood-onset asthma and FlOPs are linked to asthma expression. Copyright ©ERS 2017.

78 FR 9711 - Changes in Flood Hazard Determinations

Federal Register 2010, 2011, 2012, 2013, 2014

2013-02-11

..., Department, 2798 Key West, FL 33040. Overseas Highway, Marathon, FL 33050. Monroe (FEMA Docket No.: B.... Overseas Highway, Marathon, FL 33050. Sumter (FEMA Docket No.: B- Unincorporated areas The Honorable Garry...

Deficiency of angiotensinogen in hepatocytes markedly decreases blood pressure in lean and obese male mice.

PubMed

Yiannikouris, Frederique; Wang, Yu; Shoemaker, Robin; Larian, Nika; Thompson, Joel; English, Victoria L; Charnigo, Richard; Su, Wen; Gong, Ming; Cassis, Lisa A

2015-10-01

We recently demonstrated that adipocyte deficiency of angiotensinogen (AGT) ablated high-fat diet-induced elevations in plasma angiotensin II (Ang II) concentrations and obesity-hypertension in male mice. Hepatocytes are the predominant source of systemic AGT. Therefore, in this study, we defined the contribution of hepatocyte-derived AGT to obesity-induced elevations in plasma AGT concentrations and hypertension. Male Agt(fl/fl) mice expressing albumin-driven Cre recombinase were bred to female Agt(fl/fl) mice to generate Agt(fl/fl) or hepatocyte AGT-deficient male mice (Agt(Alb)). Mice were fed a low-fat or high-fat diet for 16 weeks. Hepatocyte AGT deficiency had no significant effect on body weight. Plasma AGT concentrations were increased in obese Agt(fl/fl) mice. Hepatocyte AGT deficiency markedly reduced plasma AGT and Ang II concentrations in lean and obese mice. Moreover, hepatocyte AGT deficiency reduced the content and release of AGT from adipose explants. Systolic blood pressure was markedly decreased in lean (by 18 mm Hg) and obese Agt(Alb) mice (by 54 mm Hg) compared with Agt(fl/fl) controls. To define mechanisms, we quantified effects of Ang II on mRNA abundance of megalin, an AGT uptake transporter, in 3T3-L1 adipocytes. Ang II stimulated adipocyte megalin mRNA abundance and decreased media AGT concentrations. These results demonstrate that hepatocytes are the predominant source of systemic AGT in both lean and obese mice. Moreover, reductions in plasma angiotensin concentrations in obese hepatocyte AGT-deficient mice may have limited megalin-dependent uptake of AGT into adipocytes for the production of Ang II in the development of obesity-hypertension. © 2015 American Heart Association, Inc.

Three-Dimensional Magnetic Restructuring in Two Homologous Solar Flares in the Seismically Active NOAA AR 11283

NASA Technical Reports Server (NTRS)

Liu, Chang; Deng, Na; Lee, Jeongwoo; Wiegelmann, Thomas; JIang, Chaowei; Dennis, Brian R.; Su, Yang; Donea, Alina; Wang, Haimin

2014-01-01

We carry out a comprehensive investigation comparing the three-dimensional magnetic field restructuring, flare energy release, and the helioseismic response of two homologous flares, the 2011 September 6 X2.1 (FL1) and September 7 X1.8 (FL2) flares in NOAA AR 11283. In our analysis, (1) a twisted flux rope (FR) collapses onto the surface at a speed of 1.5 km s(exp-1) after a partial eruption in FL1. The FR then gradually grows to reach a higher altitude and collapses again at 3 km s(exp-1) after a fuller eruption in FL2. Also, FL2 shows a larger decrease of the flux-weighted centroid separation of opposite magnetic polarities and a greater change of the horizontal field on the surface. These imply a more violent coronal implosion with corresponding more intense surface signatures in FL2. (2) The FR is inclined northward and together with the ambient fields, it undergoes a southward turning after both events. This agrees with the asymmetric decay of the penumbra observed in the peripheral regions. (3) The amounts of free magnetic energy and nonthermal electron energy released during FL1 are comparable to those of FL2 within the uncertainties of the measurements. (4) No sunquake was detected in FL1; in contrast, FL2 produced two seismic emission sources S1 and S2 both lying in the penumbral regions. Interestingly, S1 and S2 are connected by magnetic loops, and the stronger source S2 has a weaker vertical magnetic field. We discuss these results in relation to the implosion process in the low corona and the sunquake generation.

Three-dimensional magnetic restructuring in two homologous solar flares in the seismically active NOAA AR 11283

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Chang; Deng, Na; Lee, Jeongwoo

We carry out a comprehensive investigation comparing the three-dimensional magnetic field restructuring, flare energy release, and the helioseismic response of two homologous flares, the 2011 September 6 X2.1 (FL1) and September 7 X1.8 (FL2) flares in NOAA AR 11283. In our analysis, (1) a twisted flux rope (FR) collapses onto the surface at a speed of 1.5 km s{sup –1} after a partial eruption in FL1. The FR then gradually grows to reach a higher altitude and collapses again at 3 km s{sup –1} after a fuller eruption in FL2. Also, FL2 shows a larger decrease of the flux-weighted centroidmore » separation of opposite magnetic polarities and a greater change of the horizontal field on the surface. These imply a more violent coronal implosion with corresponding more intense surface signatures in FL2. (2) The FR is inclined northward and together with the ambient fields, it undergoes a southward turning after both events. This agrees with the asymmetric decay of the penumbra observed in the peripheral regions. (3) The amounts of free magnetic energy and nonthermal electron energy released during FL1 are comparable to those of FL2 within the uncertainties of the measurements. (4) No sunquake was detected in FL1; in contrast, FL2 produced two seismic emission sources S1 and S2 both lying in the penumbral regions. Interestingly, S1 and S2 are connected by magnetic loops, and the stronger source S2 has a weaker vertical magnetic field. We discuss these results in relation to the implosion process in the low corona and the sunquake generation.« less

Transforming growth factor-beta regulates mammary carcinoma cell survival and interaction with the adjacent microenvironment.

PubMed

Bierie, Brian; Stover, Daniel G; Abel, Ty W; Chytil, Anna; Gorska, Agnieszka E; Aakre, Mary; Forrester, Elizabeth; Yang, Li; Wagner, Kay-Uwe; Moses, Harold L

2008-03-15

Transforming growth factor (TGF)-beta signaling has been associated with early tumor suppression and late tumor progression; however, many of the mechanisms that mediate these processes are not known. Using Cre/LoxP technology, with the whey acidic protein promoter driving transgenic expression of Cre recombinase (WAP-Cre), we have now ablated the type II TGF-beta receptor (T beta RII) expression specifically within mouse mammary alveolar progenitors. Transgenic expression of the polyoma virus middle T antigen, under control of the mouse mammary tumor virus enhancer/promoter, was used to produce mammary tumors in the absence or presence of Cre (T beta RII((fl/fl);PY) and T beta RII((fl/fl);PY;WC), respectively). The loss of TGF-beta signaling significantly decreased tumor latency and increased the rate of pulmonary metastasis. The loss of TGF-beta signaling was significantly correlated with increased tumor size and enhanced carcinoma cell survival. In addition, we observed significant differences in stromal fibrovascular abundance and composition accompanied by increased recruitment of F4/80(+) cell populations in T beta RII((fl/fl);PY;WC) mice when compared with T beta RII((fl/fl);PY) controls. The recruitment of F4/80(+) cells correlated with increased expression of known inflammatory genes including Cxcl1, Cxcl5, and Ptgs2 (cyclooxygenase-2). Notably, we also identified an enriched K5(+) dNp63(+) cell population in primary T beta RII((fl/fl);PY;WC) tumors and corresponding pulmonary metastases, suggesting that loss of TGF-beta signaling in this subset of carcinoma cells can contribute to metastasis. Together, our current results indicate that loss of TGF-beta signaling in mammary alveolar progenitors may affect tumor initiation, progression, and metastasis through regulation of both intrinsic cell signaling and adjacent stromal-epithelial interactions in vivo.

77 FR 74856 - Changes in Flood Hazard Determinations

Federal Register 2010, 2011, 2012, 2013, 2014

2012-12-18

... Resources, Whitehead Street, Suite 2798 Overseas Highway, 102, Key West, FL 33040. Marathon, FL 33050.... Marathon, FL 33050. Orange (FEMA Docket No.: B- City of Orlando (11- The Honorable Buddy Dyer, Permitting...

A novel function for Foxm1 in interkinetic nuclear migration in the developing telencephalon and anxiety-related behavior.

PubMed

Wu, Xiaojing; Gu, Xiaochun; Han, Xiaoning; Du, Ailing; Jiang, Yan; Zhang, Xiaoyun; Wang, Yanjie; Cao, Guangliang; Zhao, Chunjie

2014-01-22

Interkinetic nuclear migration (INM) is a key feature of cortical neurogenesis. INM functions to maximize the output of the neuroepithelium, and more importantly, balance the self-renewal and differentiation of the progenitors. Although INM has been reported to be highly correlated with the cell cycle, little is known about the effects of cell cycle regulators on INM. In this study, by crossing Foxm1(fl/fl) mice with Emx1-Cre line, we report that a conditional disruption of forkhead transcription factor M1 (Foxm1) in dorsal telencephalon results in abnormal cell cycle progression, leading to impaired INM through the downregulation of Cyclin b1 and Cdc25b. The impairment of INM disturbs the synchronization of apical progenitors (APs) and promotes the transition from APs to basal progenitors (BPs) in a cell-autonomous fashion. Moreover, ablation of Foxm1 causes anxiety-related behaviors in adulthood. Thus, this study provides evidence of linkages among the cell cycle regulator Foxm1, INM, and adult behavior.

The Eph-Receptor A7 Is a Soluble Tumor Suppressor for Follicular Lymphoma

PubMed Central

Oricchio, Elisa; Nanjangud, Gourd; Wolfe, Andrew L.; Schatz, Jonathan H.; Mavrakis, Konstantinos J.; Jiang, Man; Liu, Xiaoping; Bruno, Joanne; Heguy, Adriana; Olshen, Adam B.; Socci, Nicholas D.; Teruya-Feldstein, J.; Weis-Garcia, Frances; Tam, Wayne; Shaknovich, Rita; Melnick, Ari; Himanen, Juha P.; Chaganti, R.S.K.; Wendel, Hans-Guido

2011-01-01

Insights into cancer genetics can lead to therapeutic opportunities. By cross-referencing chromosomal changes with an unbiased genetic screen we identify the ephrin receptor A7 (EPHA7) as a tumor suppressor in follicular lymphoma (FL). EPHA7 is a target of 6q deletions and inactivated in 72 % of FLs. Knockdown of EPHA7 drives lymphoma development in a murine FL model. In analogy to its physiological function in brain development, a soluble splice variant of EPHA7 (EPHA7TR) interferes with another Eph-receptor and blocks oncogenic signals in lymphoma cells. Consistent with this drug-like activity, administration of the purified EPHA7TR protein produces anti-tumor effects against xenografted human lymphomas. Further, by fusing EPHA7TR to the anti-CD20 antibody (rituximab) we can directly target this tumor suppressor to lymphomas in vivo. Our study attests to the power of combining descriptive tumor genomics with functional screens and reveals EPHA7TR as tumor suppressor with immediate therapeutic potential. PMID:22036564

Longitudinal Monitoring of Antibody Responses against Tumor Cells Using Magneto-nanosensors with a Nanoliter of Blood.

PubMed

Lee, Jung-Rok; Chan, Carmel T; Ruderman, Daniel; Chuang, Hui-Yen; Gaster, Richard S; Atallah, Michelle; Mallick, Parag; Lowe, Scott W; Gambhir, Sanjiv S; Wang, Shan X

2017-11-08

Each immunoglobulin isotype has unique immune effector functions. The contribution of these functions in the elimination of pathogens and tumors can be determined by monitoring quantitative temporal changes in isotype levels. Here, we developed a novel technique using magneto-nanosensors based on the effect of giant magnetoresistance (GMR) for longitudinal monitoring of total and antigen-specific isotype levels with high precision, using as little as 1 nL of serum. Combining in vitro serologic measurements with in vivo imaging techniques, we investigated the role of the antibody response in the regression of firefly luciferase (FL)-labeled lymphoma cells in spleen, kidney, and lymph nodes in a syngeneic Burkitt's lymphoma mouse model. Regression status was determined by whole body bioluminescent imaging (BLI). The magneto-nanosensors revealed that anti-FL IgG2a and total IgG2a were elevated and sustained in regression mice compared to non-regression mice (p < 0.05). This platform shows promise for monitoring immunotherapy, vaccination, and autoimmunity.

Phobic Anxiety and Plasma Levels of Global Oxidative Stress in Women

PubMed Central

Hagan, Kaitlin A.; Wu, Tianying; Rimm, Eric B.; Eliassen, A. Heather; Okereke, Olivia I.

2015-01-01

Background and Objectives Psychological distress has been hypothesized to be associated with adverse biologic states such as higher oxidative stress and inflammation. Yet, little is known about associations between a common form of distress – phobic anxiety – and global oxidative stress. Thus, we related phobic anxiety to plasma fluorescent oxidation products (FlOPs), a global oxidative stress marker. Methods We conducted a cross-sectional analysis among 1,325 women (aged 43-70 years) from the Nurses’ Health Study. Phobic anxiety was measured using the Crown-Crisp Index (CCI). Adjusted least-squares mean log-transformed FlOPs were calculated across phobic categories. Logistic regression models were used to calculate odds ratios (OR) comparing the highest CCI category (≥6 points) vs. lower scores, across FlOPs quartiles. Results No association was found between phobic anxiety categories and mean FlOP levels in multivariable adjusted linear models. Similarly, in multivariable logistic regression models there were no associations between FlOPs quartiles and likelihood of being in the highest phobic category. Comparing women in the highest vs. lowest FlOPs quartiles: FlOP_360: OR=0.68 (95% CI: 0.40-1.15); FlOP_320: OR=0.99 (95% CI: 0.61-1.61); FlOP_400: OR=0.92 (95% CI: 0.52, 1.63). Conclusions No cross-sectional association was found between phobic anxiety and a plasma measure of global oxidative stress in this sample of middle-aged and older women. PMID:26635425

Assessment of femur length for fetal biometry in Malaysian pregnant women

NASA Astrophysics Data System (ADS)

Ramli, Ramzun Maizan; Adam, Noraina; Jaafar, Mohamad Suhaimi; Rahman, Azhar Abdul; Mustafa, Iskandar Shahrim; Radzi, Yasmin; Nordin, Suriani; Kamarudin, Izyani

2013-05-01

The fetal biometry assessment of femur length (FL) was developed in most countries to evaluate the foetus growth. In this study, the FL values for Malaysia population were determined. A prospective study was conducted and a number of 6501 pregnant women were involved with 12372 FL data were collected, performed at antenatal care clinic of Hospital Pulau Pinang, Malaysia. The SPSS software version 17 (regression analysis and paired sample t-test) were used for analysis. The FL values of this study were constructed and rapid FL growth rate in second trimester (2.59 mm/week) than third trimester (1.43 mm/week) was observed. By ethnicity, no significant difference (p ≥ 0.05) was found between the FL values for fetuses of Malay and Indian ethnic's mother (t = -2.042), however these two groups shows significantly (p < 0.05) higher values than those of Chinese ethnic's mother (t = 4.019, 4.083; accordingly). The FL values of Malaysian resulted as significant difference with the common reference FL values from USA and UK, and also with selected Asian populations (India, China, Korea and Japan). As conclusion, it is strong suggested that medical practitioner in Malaysia should avoid in using biometry references based on other population to avoid under- or over-estimation and for accurate assessment of the fetus growth. As this study involved local Malaysian fetuses, therefore the medical practitioner can use the FL values of this study as reference value for fetus biometry assessment in Malaysia.

1. GENERAL VIEW OF LAUNCH PAD A WITH MOBILE SERVICE ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

1. GENERAL VIEW OF LAUNCH PAD A WITH MOBILE SERVICE STRUCTURE IN LOCKED POSITION OVER LAUNCHER BUILDING AND RETENTION POND AT RIGHT; VIEW TO NORTHWEST. - Cape Canaveral Air Station, Launch Complex 17, Facility 28501, East end of Lighthouse Road, Cape Canaveral, Brevard County, FL

40. Photocopy of engineering drawing. LC17B LONG TANK DELTA UPBUILD ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

40. Photocopy of engineering drawing. LC-17B LONG TANK DELTA UPBUILD LAUNCH DECK: NEW PLATE AT LAUNCH MOUNT AREA-STRUCTURAL, APRIL 1969. - Cape Canaveral Air Station, Launch Complex 17, Facility 28402, East end of Lighthouse Road, Cape Canaveral, Brevard County, FL

LATITUDINAL GRADIENTS IN BENTHIC COMMUNITY COMPOSITION IN WESTERN ATLANTIC ESTUARIES

EPA Science Inventory

The community structure of benthic macroinvertebrates from estuaries along the Atlantic coast of North America from Cape Cod, MA, to Biscayne Bay, FL, were compared. Benthic data were collected over a 5 year period (1990 to 1995) by the U.S. Environmental Protection Agency's Envi...

Implementation of Slag Stabilized Blended Calcium Sulfate (BCS) in a Pavement Structure : Research Project Capsule

DOT National Transportation Integrated Search

2012-09-01

Blended calcium sulfate (BCS) is fl uorogypsum (FG), an industrial byproduct, : blended with lime or limestone. Approximately 90,000 metric tons (100,000 : tons) of FG are generated annually in the United States, posing a serious : problem for enviro...

8. VIEW OF NEW CONSTRUCTION ON LAUNCH DECK WITH CASTINPLACE ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

8. VIEW OF NEW CONSTRUCTION ON LAUNCH DECK WITH CAST-IN-PLACE CONCRETE WALLS AND STEEL STRUCTURE FOR NEW SOUTH-FACING FLAME DEFLECTOR; VIEW TO EAST. - Cape Canaveral Air Station, Launch Complex 17, Facility 28402, East end of Lighthouse Road, Cape Canaveral, Brevard County, FL

7. DETAIL OF UPPER SECTIONS OF WEST SIDE SHOWING WHITE ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

7. DETAIL OF UPPER SECTIONS OF WEST SIDE SHOWING WHITE INSULATED DUCTWORK VENTILATING CLEAN ROOM AT TOP LEVELS OF MOBILE SERVICE STRUCTURE; VIEW TO NORTHEAST. - Cape Canaveral Air Station, Launch Complex 17, Facility 28417, East end of Lighthouse Road, Cape Canaveral, Brevard County, FL

Explosive Strength Imbalances in Professional Basketball Players

PubMed Central

Schiltz, Marc; Lehance, Cédric; Maquet, Didier; Bury, Thierry; Crielaard, Jean-Michel; Croisier, Jean-Louis

2009-01-01

Context: Despite the high rate of lower limb injuries in basketball players, studies of the dominant-limb effect in elite athletes often neglect injury history. Objective: To determine lower limb explosive-strength asymmetries in professional basketball players compared with junior basketball players and control participants. Design: Cohort study. Setting: Academic medical institution. Patients or Other Participants: 15 professional basketball players, 10 junior basketball players, and 20 healthy men. Main Outcome Measure(s): We performed an isokinetic examination to evaluate the knee extensor (Ext) and flexor (Fl) concentric peak torque at 60°·s−1 and 240°·s−1 and (Fl only) eccentric peak torque at 30°·s−1 and 120°·s−1. Functional evaluation included countermovement jump, countermovement jump with arms, 10-m sprint, single-leg drop jump, and single-leg, 10-second continuous jumping. Variables were compared among groups using analysis of variance or a generalized linear mixed model for bilateral variables. Results: The 2 groups of basketball players demonstrated better isokinetic and functional performances than the control group did. No differences in functional or relative isokinetic variables were noted between professional and junior basketball players. Professional players with a history of knee injury failed to reach normal knee extensor strength at 60°·s−1. Knee Ext (60°·s−1) and Fl (eccentric 120°·s−1) torque values as well as 10-second continuous jumping scores were higher in those professional players without a history of knee injury than those with such a history. Compared with the group without a history of knee injury, the group with a history of knee injury maintained leg asymmetry ratios greater than 10% for almost all isokinetic variables and more than 15% for unilateral functional variables. Conclusions: The relative isokinetic and functional performances of professional basketball players were similar to those of junior players, with no dominant-side effect. A history of knee injury in the professional athlete, however, was reflected in bilateral isokinetic and functional asymmetries and should be considered in future studies of explosive strength. PMID:19180217

46 CFR 7.100 - Florida Reefs and Keys from Miami, FL to Marquesas Keys, FL.

Code of Federal Regulations, 2014 CFR

2014-10-01

... latitude 24°27.7′ N. longitude 81°48.1′ W. (Key West Entrance Lighted Whistle Buoy); thence to Cosgrove... 46 Shipping 1 2014-10-01 2014-10-01 false Florida Reefs and Keys from Miami, FL to Marquesas Keys... TO THE PUBLIC BOUNDARY LINES Atlantic Coast § 7.100 Florida Reefs and Keys from Miami, FL to...

46 CFR 7.100 - Florida Reefs and Keys from Miami, FL to Marquesas Keys, FL.

Code of Federal Regulations, 2012 CFR

2012-10-01

... latitude 24°27.7′ N. longitude 81°48.1′ W. (Key West Entrance Lighted Whistle Buoy); thence to Cosgrove... 46 Shipping 1 2012-10-01 2012-10-01 false Florida Reefs and Keys from Miami, FL to Marquesas Keys... TO THE PUBLIC BOUNDARY LINES Atlantic Coast § 7.100 Florida Reefs and Keys from Miami, FL to...

46 CFR 7.100 - Florida Reefs and Keys from Miami, FL to Marquesas Keys, FL.

Code of Federal Regulations, 2010 CFR

2010-10-01

... latitude 24°27.7′ N. longitude 81°48.1′ W. (Key West Entrance Lighted Whistle Buoy); thence to Cosgrove... 46 Shipping 1 2010-10-01 2010-10-01 false Florida Reefs and Keys from Miami, FL to Marquesas Keys... TO THE PUBLIC BOUNDARY LINES Atlantic Coast § 7.100 Florida Reefs and Keys from Miami, FL to...

46 CFR 7.100 - Florida Reefs and Keys from Miami, FL to Marquesas Keys, FL.

Code of Federal Regulations, 2011 CFR

2011-10-01

... latitude 24°27.7′ N. longitude 81°48.1′ W. (Key West Entrance Lighted Whistle Buoy); thence to Cosgrove... 46 Shipping 1 2011-10-01 2011-10-01 false Florida Reefs and Keys from Miami, FL to Marquesas Keys... TO THE PUBLIC BOUNDARY LINES Atlantic Coast § 7.100 Florida Reefs and Keys from Miami, FL to...

46 CFR 7.100 - Florida Reefs and Keys from Miami, FL to Marquesas Keys, FL.

Code of Federal Regulations, 2013 CFR

2013-10-01

... latitude 24°27.7′ N. longitude 81°48.1′ W. (Key West Entrance Lighted Whistle Buoy); thence to Cosgrove... 46 Shipping 1 2013-10-01 2013-10-01 false Florida Reefs and Keys from Miami, FL to Marquesas Keys... TO THE PUBLIC BOUNDARY LINES Atlantic Coast § 7.100 Florida Reefs and Keys from Miami, FL to...

75 FR 80372 - Proposed Amendment of Restricted Areas R-2907A and R-2907B, Lake George, FL; and R-2910...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-22

...-1146; Airspace Docket No. 10-ASO-25] Proposed Amendment of Restricted Areas R-2907A and R-2907B, Lake George, FL; and R-2910, Pinecastle, FL AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice... limits of restricted areas R-2907A and R-2907B, Lake George, FL; and restricted area R-2910, Pinecastle...

Influence of the target molecule on the oxygen radical absorbance capacity index: a comparison between alizarin red- and fluorescein-based methodologies.

PubMed

Martin, I; Aspée, A; Torres, P; Lissi, E; López-Alarcón, C

2009-12-01

A comparison of alizarin red (AR) and fluorescein (FL) as target molecules in oxygen radical absorbance capacity (ORAC)-like methods is reported. Galangin, apigenin, ferulic acid, and coumaric acid decreased AR initial consumption rate, whereas quercetin, kaempferol, luteolin, caffeic acid, and sinapic acid inhibited its consumption through an induction time, associated with a repair mechanism. On the other hand, all compounds protected FL with a clear induction time. AR was more selective and provides ORAC-AR values considerably smaller for compounds of low reactivity. The ORAC-AR value for luteolin was nearly 200 times that of coumaric acid. However, the ratio of ORAC-FL values for luteolin and coumaric acid was only 1.2. This different selectivity implies that AR provides ORAC values more related to reactivity than FL. ORAC-AR values of infusions were considerably smaller than the corresponding ORAC-FL values. These differences are interpreted in terms of the capacity of FL to generate induction times, irrespective of the reactivity of the additive. It is proposed that comparison of ORAC-AR and ORAC-FL values could afford a rough estimation of the average reactivity of the antioxidants titrated by the ORAC-FL methodology.

Intelligent control of a multi-degree-of freedom reaction compensating platform system using fuzzy logic

NASA Technical Reports Server (NTRS)

Choi, Benjamin B.; Lawrence, Charles; Lin, Yueh-Jaw

1994-01-01

This paper presents the development of a general-purpose fuzzy logic (FL) control methodology for isolating the external vibratory disturbances of space-based devices. According to the desired performance specifications, a full investigation regarding the development of an FL controller was done using different scenarios, such as variances of passive reaction-compensating components and external disturbance load. It was shown that the proposed FL controller is robust in that the FL-controlled system closely follows the prespecified ideal reference model. The comparative study also reveals that the FL-controlled system achieves significant improvement in reducing vibrations over passive systems.

Light-induced fluorescence changes in Phycomyces: evidence for blue light-receptor associated flavo-semiquinones.

PubMed

Galland, Paul; Tölle, Nadja

2003-10-01

Light-induced fluorescence changes (LIFCs) were detected in sporangiophores of the blue-light-sensitive fungus Phycomyces blakesleeanus (Burgeff). The LIFCs can be utilized as a spectrophotometric assay for blue-light photoreceptors and for the in vivo characterization of their photochemical primary reactions. Blue-light irradiation of sporangiophores elicited a transient decrease and subsequent regeneration of flavin-like fluorescence emission at 525 nm. The signals recovered in darkness in about 120 min. In contrast to blue light, near-UV (370 nm) caused an increase in the fluorescence emission at 525 nm. Because the LIFCs were altered in a light-insensitive madC mutant with a defective photoreceptor, the fluorescence changes must be associated with early photochemical events of the transduction chain. Action spectra for the fluorescence changes at 525 nm showed major peaks near 470 and 600 nm. Double-pulse experiments involving two consecutive pulses of either blue and near-UV, blue and red, or near-UV and red showed that the responses depended on the sequence in which the different wavelengths were applied. The results indicate a blue-light receptor with intermediates in the near-UV, blue and red spectral regions. We explain the results in the framework of a general model, in which the three redox states of the flavin photoreceptor, the oxidized flavin (Fl), the flavo-semiquinone (FlH*), and the flavo-hydroquinone (FlH2) are each acting as chromophores with their own characteristic photochemical primary reactions. These consist of the photoreduction of the oxidized flavin generating semiquinone, the photoreduction of the semiquinone generating hydroquinone, and the photooxidation of the flavo-hydroquinone regenerating the pool of oxidized flavins. The proposed mechanism represents a photocycle in which two antagonistic photoreceptor forms, Fl and FlH2, determine the pool size of the biological effector molecule, the flavo-semiquinone. The redox changes that are associated with the photocycle are maintained by redox partners, pterins, that function in the near-UV as secondary chromophores.

Coulombic interactions on the deposition and rotational mobility distributions of dyes in polyelectrolyte multilayer thin films.

PubMed

Li, Ye; Yip, Wai Tak

2004-12-07

We employed negatively charged fluorescein (FL), positively charged rhodamine 6G (R6G), and neutral Nile Red (NR) as molecular probes to investigate the influence of Coulombic interaction on their deposition into and rotational mobility inside polyelectrolyte multilayer (PEM) films. The entrapment efficiency of the dyes reveals that while Coulombic repulsion has little effect on dye deposition, Coulombic attraction can dramatically enhance the loading efficiency of dyes into a PEM film. By monitoring the emission polarization of single dye molecules in polyethylenimine (PEI) films, the percentages of mobile R6G, NR, and FL were determined to be 87 +/- 4%, 76 +/- 5%, and 68 +/- 3%, respectively. These mobility distributions suggest that cationic R6G enjoys the highest degree of rotational freedom, whereas anionic FL shows the least mobility because of Coulombic attraction toward cationic PEI. Regardless of charges, this high percentage of mobile molecules is in stark contrast to the 5-40% probe mobility reported from spun-cast polymer films, indicating that our PEI films contain more free volume and display richer polymer dynamics. These observations demonstrate the potential of using isolated fluorescent probes to interrogate the internal structure of a PEM film at a microscopic level.

Exploring Risk Factors for Follicular Lymphoma

PubMed Central

Ambinder, Alexander J.; Shenoy, Pareen J.; Malik, Neha; Maggioncalda, Alison; Nastoupil, Loretta J.; Flowers, Christopher R.

2012-01-01

Follicular lymphoma (FL) is an indolent malignancy of germinal center B cells with varied incidence across racial groups and geographic regions. Improvements in the classification of non-Hodgkin lymphoma subtypes provide an opportunity to explore associations between environmental exposures and FL incidence. Our paper found that aspects of Western lifestyle including sedentary lifestyle, obesity, and diets high in meat and milk are associated with an increased risk of FL. Diets rich in fruits and vegetables, polyunsaturated fatty acids, vitamin D, and certain antioxidants are inversely associated with FL risk. A medical history of Sjogren's syndrome, influenza vaccination, and heart disease may be associated with FL incidence. Associations between FL and exposure to pesticides, industrial solvents, hair dyes, and alcohol/tobacco were inconsistent. Genetic risk factors include variants at the 6p21.32 region of the MHC II locus, polymorphisms of the DNA repair gene XRCC3, and UV exposure in individuals with certain polymorphisms of the vitamin D receptor. Increasing our understanding of risk factors for FL must involve integrating epidemiological studies of genetics and exposures to allow for the examination of risk factors and interactions between genes and environment. PMID:23028387

Expression pattern and function of tyrosine receptor kinase B isoforms in rat mesenteric arterial smooth muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Otani, Kosuke; Okada, Muneyoshi; Yamawaki, Hideyuki, E-mail: yamawaki@vmas.kitasato-u.ac.jp

Tyrosine receptor kinaseB (TrkB) is a high affinity receptor for brain-derived neurotrophic factor (BDNF). TrkB isoforms involve full length TrkB (TrkB FL) and truncated TrkB type1 (TrkB T1) and type 2 (TrkB T2) in rats. The aim of present study was to explore their expression pattern and function in mesenteric arterial smooth muscle cells (MASMCs). The expression of TrkB isoform protein and mRNA was examined by Western blotting, immunofluorescence and quantitative RT-PCR analyses. Cell proliferation was measured by a bromodeoxyuridine (BrdU) incorporation assay. Cell migration was measured by a Boyden chamber assay. Cell morphology was observed with a phase-contrast microscope.more » Protein and mRNA expression of BDNF and TrkB isoforms was confirmed in MASMCs. Expression level of TrkB FL was less, while that of TrkB T1 was the highest in MASMCs. Although BDNF increased phosphorylation of ERK, it had no influence on migration and proliferation of MASMCs. TrkB T1 gene knockdown by a RNA interference induced morphological changes and reduced expression level of α-smooth muscle actin (α-SMA) in MASMCs. Similar morphological changes and reduced α-SMA expression were induced in MASMCs by a Rho kinase inhibitor, Y-27632. In conclusion, we for the first time demonstrate that TrkB T1 expressed highly in MASMCs contributes to maintain normal cell morphology possibly via regulation of Rho activity. This study firstly defined expression level of TrkB isoforms and partly revealed their functions in peripheral vascular cells. - Highlights: • BDNF-TrkB axis mediates neurogenesis, growth, differentiation and survival. • Expression pattern and function of TrkB in vascular smooth muscle remain unclear. • Expression of TrkB FL is low, while that of TrkB T1 is the highest. • TrkB T1 contributes to maintain normal morphology possibly via activating Rho.« less

A Species Distribution Modeling Informed Conservation Assessment of Bog Spicebush

DTIC Science & Technology

2016-09-14

small populations, or establishing new popu- lations to increase the metapopulation structure within clusters of popula- tions. These outplanting data...fire suppression, and flooding (e.g., due to beaver activity) on vege- tation composition and structure . This effort used vegetation and disturb- ance...Suppression to Prescription. Tall Timbers Research Station, Tallahassee, FL, pp 70–81. Godefroid, S., C. Piazza, G. Rossi, S. Buord, A. D. Stevens, R

Sex-Linked Characteristics of Brain Functioning: Why Jimmy Reads Differently.

ERIC Educational Resources Information Center

Helfeldt, John P.

1983-01-01

Presents evidence to support the premise that boys reflect a predilection to process information visually, while girls reflect a preference to process information auditorally. Cautions against relying on isolated components such as hemispheric dominance or laterality during the identification and correction of reading problems. (FL)

Fatigue Assessment: Subjective Peer-to-Peer Fatigue Scoring (Reprint)

DTIC Science & Technology

2013-10-01

impor- tant role of fatigue in aviation safety and fl ight perfor- mance, the compelling tasks of predicting dangerous fatigued states and quantifying ... risk and associated per- formance defi cits have been immoderately diffi cult. This is particularly true for an individual functioning within the

Medical Surveillance Programs for Aircraft Maintenance Personnel Performing Nondestructive Inspection and Testing

DTIC Science & Technology

2005-11-01

visible and fl uorescent inspection techniques, while radiography relies on the individual’s ability to detect subtle differences in contrast either...binocular measurement of visual acuity may better predict a person’s functional capability in the workplace . However, measurement of monocular acuities

32. Photocopy of engineering drawing. NEW WHITE ROOM AND MULTISOLIDS ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

32. Photocopy of engineering drawing. NEW WHITE ROOM AND MULTISOLIDS MODIFICATIONS FOR STRETCHED TANK DELTA, LAUNCH COMPLEX 17-A: UMBILICAL MAST ELEVATIONS-REMOVAL WORK, STRUCTURAL, APRIL 1969. - Cape Canaveral Air Station, Launch Complex 17, Facility 28501, East end of Lighthouse Road, Cape Canaveral, Brevard County, FL

Foreign Language Listening Anxiety and Listening Performance: Conceptualizations and Causal Relationships

ERIC Educational Resources Information Center

Zhang, Xian

2013-01-01

This study used structural equation modeling to explore the possible causal relations between foreign language (English) listening anxiety and English listening performance. Three hundred participants learning English as a foreign language (FL) completed the foreign language listening anxiety scale (FLLAS) and IELTS test twice with an interval of…

Photocopy of drawing (original drawing of War Department Theater in ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Photocopy of drawing (original drawing of War Department Theater in possession of MacDill Air Force Base, Civil Engineering, Tampa, Florida; 1940 architectural drawings by Construction Division, Office of the Quartermaster General)STRUCTURAL - FOUNDATIONS - MacDill Air Force Base, Base Theater, 2420 Florida Keys Avenue, Tampa, Hillsborough County, FL

Ultrasonographic monitoring of fetal development in unrestrained bonobos (Pan paniscus) at the Milwaukee County Zoo.

PubMed

Drews, Barbara; Harmann, Leanne M; Beehler, Leann L; Bell, Barbara; Drews, Reinhard F; Hildebrandt, Thomas B

2011-01-01

The bonobo, Pan paniscus, is one of the most endangered primate species. In the context of the Bonobo Species Survival Plan(®), the Milwaukee County Zoo established a successful breeding group. Although the bonobo serves as a model species for human evolution, no prenatal growth curves are available. To develop growth graphs, the animals at the Milwaukee County Zoo were trained by positive reinforcement to allow for ultrasound exams without restraint. With this method, the well being of mother and fetus were maintained and ultrasound exams could be performed frequently. The ovulation date of the four animals in the study was determined exactly so that gestational age was known for each examination. Measurements of biparietal diameter (BPD), head circumference (HC), abdominal circumference (AC), and femur length (FL) were used to create growth curves. Prenatal growth of P. paniscus was compared with the data of humans and the common chimpanzee, P. troglodytes. With respect to cranial structures, such as BPD and HC, humans have significant acceleration of growth compared with P. paniscus and P. troglodytes. In P. paniscus, growth of AC was similar to HC throughout pregnancy, whereas in humans AC only reaches the level of HC close to term. Growth rate of FL was similar in humans and the two Pan species until near day 180 post-ovulation. After that, the Pan species FL growth slowed compared with human FL. The newly developed fetal growth curves of P. paniscus will assist in monitoring prenatal development and predicting birth dates of this highly endangered species. © 2010 Wiley-Liss, Inc.

Genomic analysis of fibrolamellar hepatocellular carcinoma.

PubMed

Xu, Lei; Hazard, Florette K; Zmoos, Anne-Flore; Jahchan, Nadine; Chaib, Hassan; Garfin, Phillip M; Rangaswami, Arun; Snyder, Michael P; Sage, Julien

2015-01-01

Pediatric tumors are relatively infrequent, but are often associated with significant lethality and lifelong morbidity. A major goal of pediatric cancer research has been to identify key drivers of tumorigenesis to eventually develop targeted therapies to enhance cure rate and minimize acute and long-term toxic effects. Here, we used genomic approaches to identify biomarkers and candidate drivers for fibrolamellar hepatocellular carcinoma (FL-HCC), a very rare subtype of pediatric liver cancer for which limited therapeutic options exist. In-depth genomic analyses of one tumor followed by immunohistochemistry validation on seven other tumors showed expression of neuroendocrine markers in FL-HCC. DNA and RNA sequencing data further showed that common cancer pathways are not visibly altered in FL-HCC but identified two novel structural variants, both resulting in fusion transcripts. The first, a 400 kb deletion, results in a DNAJB1-PRKCA fusion transcript, which leads to increased cAMP-dependent protein kinase (PKA) activity in the index tumor case and other FL-HCC cases compared with normal liver. This PKA fusion protein is oncogenic in HCC cells. The second gene fusion event, a translocation between the CLPTM1L and GLIS3 genes, generates a transcript whose product also promotes cancer phenotypes in HCC cell lines. These experiments further highlight the tumorigenic role of gene fusions in the etiology of pediatric solid tumors and identify both candidate biomarkers and possible therapeutic targets for this lethal pediatric disease. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

The Specific Role of FAM20C in Dentinogenesis

PubMed Central

Wang, X.; Wang, J.; Liu, Y.; Yuan, B.; Ruest, L.B.; Feng, J.Q.

2015-01-01

FAM20C is an evolutionarily reserved molecule highly expressed in mineralized tissues. Previously we demonstrated that Sox2-Cre;Fam20Cfl/fl mice, in which Fam20C was ubiquitously inactivated, had dentin and enamel defects as well as hypophosphatemic rickets. We also showed that K14-Cre;Fam20Cfl/fl mice, in which Fam20C was specifically inactivated in the epithelium, had enamel defects but lacked hypophosphatemia and defects in the bone and dentin. These results indicated that the enamel defects in the Sox2-Cre;Fam20Cfl/fl mice were independent of dentin defects and hypophosphatemia. To determine if the dentin defects in the Sox2-Cre;Fam20Cfl/fl mice were associated with the enamel defects and hypophosphatemia, we crossed Fam20Cfl/fl mice with Wnt1-Cre and Osr2-Cre transgenic mice to inactivate Fam20C in the craniofacial mesenchymal cells that form dentin and alveolar bone. The resulting Wnt1-Cre;Fam20Cfl/fl and Osr2-Cre;Fam20Cfl/fl mice showed remarkable dentin and alveolar bone defects, while their enamel did not show apparent defects. The serum FGF23 levels in these mice were higher than normal but lower than those in the Sox2-Cre;Fam20Cfl/fl mice; they developed a mild type of hypophosphatemia that did not cause major defects in long bones. These results indicate that the dentin defects in the Sox2-Cre;Fam20Cfl/fl mice were independent of the enamel defects. PMID:25515778

[Electronic spectra of triphenodioxazines dyes by modified PPP-MO method].

PubMed

Wang, Xue-jie

2002-02-01

The triphenodioxazines dyes have good colour and luster, excellent colour fastness to light, and strong painted. They are used as the dyes and pigment extensively, and also be used as the photoelectronic transformation, laser dyes and far-infrared anti-radiation material. The colour and constitution of triphenodioxazines dyes were evaluated by means of the modified PPP-SCF-MO method with variable R, beta approximation. The calculated wavelengths of maximum absorption are in good agreement with experimental results. It was found that there exists a good correlated relationship between the wavenumber of fluorescence maximum nu fl and the calculated fluorescence emission energy delta Efl, as nu fl = 11.6837 delta Efl + 3.3485(k.cm-1), r = 0.9547. The relationship between structure of molecular and properties of electronic spectra has been discussed.

Starch-assisted synthesis and optical properties of ZnS nanoparticles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tian, Xiuying, E-mail: xiuyingt@yahoo.com; Wen, Jin; Wang, Shumei

Highlights: • ZnS spherical nanostructure was prepared via starch-assisted method. • The crystalline lattice structure, morphologies, chemical and optical properties of ZnS nanoparticles. • The forming mechanism of ZnS nanoparticles. • ZnS spherical nano-structure can show blue emission at 460–500 nm. - Abstract: ZnS nanoparticles are fabricated via starch-assisted method. The effects of different starch amounts on structure and properties of samples are investigated, and the forming mechanism of ZnS nanoparticles is discussed. By X-ray diffraction (XRD), high resolution transmission electron microscopy (HRTEM) and selected area electron diffraction (SAED), scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (FTIR), ultraviolet–visible (UV–vis)more » spectroscopy and fluorescence (FL) spectrometer, their phases, crystalline lattice structure, morphologies, chemical and optical properties are characterized. The results show that ZnS has polycrystalline spherical structure with the mean diameter of 130 nm. Sample without starch reveals irregular aggregates with particle size distribution of 0.5–2 μm. The band gap value of ZnS is 3.97 eV. The chemical interaction exists between starch molecules and ZnS nanoparticles by hydrogen bonds. The stronger FL emission peaks of ZnS synthesized with starch, indicate a larger content of sulfur vacancies or defects than ZnS synthesized without starch.« less

Aerobic and Anaerobic Transformation of cis-Dichloroethene (cis-DCE) and Vinyl Chloride (VC): Steps for Reliable Remediation

DTIC Science & Technology

2003-12-01

populations. (ii) Characterization of Dehalococeoides sp . strain FL2. The isolate, designate d Dehalococcoides sp . strain FL2, reductively...Pinellas group of the Dehalococcoides cluster, and demonstrated that strain FL2 shared an identical 165 rRNA gene sequence with Dehalococcoides sp ...strain CBDBI, a chlorobenzene-dechlorinating strain. The 165 rRNA gene sequence of Dehalococcoides sp . strain FL2 was submitted to GenBank (AF357918.2

The specific role of FAM20C in amelogenesis.

PubMed

Wang, X; Jung, J; Liu, Y; Yuan, B; Lu, Y; Feng, J Q; Qin, C

2013-11-01

Previously, we showed that Sox2-Cre;Fam20C(fl/fl) mice in which Fam20C was ubiquitously inactivated had severe defects in dentin, enamel, and bone, along with hypophosphatemia. It remains to be determined if the enamel defects in the mice with universal inactivation of Family with sequence similarity 20-C (FAM20C) were associated with the dentin defects and whether hypophosphatemia in the knockout mice contributed to the enamel defects. In this study, we crossed Fam20C(fl/fl) mice with keratin 14-Cre (K14-Cre) transgenic mice to specifically inactivate Fam20C in the epithelial cells, including the dental epithelial cells that are responsible for forming tooth enamel. X-ray, backscattered scanning electron microscopic, and histological analyses showed that the K14-Cre;Fam20C(fl/fl) mice had severe enamel and ameloblast defects, while their dentin and alveolar bone were not significantly affected. Accordingly, serum biochemistry of the K14-Cre;Fam20C(fl/fl) mice showed normal phosphate and FGF23 levels in the circulation. Analysis of these data indicates that, while FAM20C is a molecule essential to amelogenesis, its inactivation in the dental epithelium does not significantly affect dentinogenesis. Hypophosphatemia makes no significant contribution to the enamel defects in the mice with the ubiquitous deletion of Fam20C.

Establishment of highly metastatic KRAS mutant lung cancer cell sublines in long-term three-dimensional low attachment cultures

PubMed Central

Nakano, Tomoyuki; Kanai, Yoshihiko; Amano, Yusuke; Yoshimoto, Taichiro; Matsubara, Daisuke; Shibano, Tomoki; Tamura, Tomoko; Oguni, Sachiko; Katashiba, Shizuka; Ito, Takeshi; Murakami, Yoshinori; Fukayama, Masashi; Murakami, Takashi; Endo, Shunsuke; Niki, Toshiro

2017-01-01

Decreased cell-substratum adhesion is crucially involved in metastasis. Previous studies demonstrated that lung cancer with floating cell clusters in histology is more likely to develop metastasis. In the present study, we investigated whether cancer cells in long-term, three-dimensional low attachment cultures acquire high metastatic potential; these cells were then used to examine the mechanisms underlying metastasis. Two KRAS-mutated adenocarcinoma cell lines (A549 and H441) were cultured and selected on ultra-low attachment culture dishes, and the resulting cells were defined as FL (for floating) sublines. Cancer cells were inoculated into NOD/SCID mice via an intracardiac injection, and metastasis was evaluated using luciferase-based imaging and histopathology. In vitro cell growth (in attachment or suspension cultures), migration, and invasion were assayed. A whole genomic analysis was performed to identify key molecular alterations in FL sublines. Upon detachment on low-binding dishes, parental cells initially formed rounded spheroids with limited growth activity. However, over time in cultures, cells gradually formed smaller spheroids that grew slowly, and, after 3–4 months, we obtained FL sublines that regained prominent growth potential in suspension cultures. On ordinary dishes, FL cells reattached and exhibited a more spindle-shaped morphology than parental cells. No marked differences were observed in cell growth with attachment, migration, or invasion between FL sublines and parental cell lines; however, FL cells exhibited markedly increased growth potential under suspended conditions in vitro and stronger metastatic abilities in vivo. A genomic analysis identified epithelial-mesenchymal transition (EMT) and c-Myc amplification in A549-FL and H441-FL cells, respectively, as candidate mechanisms for metastasis. The growth potential of FL cells was markedly inhibited by lentiviral ZEB1 knockdown in A549-FL cells and by the inhibition of c-Myc through lentiviral knockdown or the pharmacological inhibitor JQ1 in H441-FL cells. Long-term three-dimensional low attachment cultures may become a useful method for investigating the mechanisms underlying metastasis mediated by decreased cell-substratum adhesion. PMID:28786996

River restoration strategies in channelized, low-gradient landscapes of West Tennessee, USA

USGS Publications Warehouse

Smith, D.P.; Diehl, T.H.; Turrini-Smith, L. A.; Maas-Baldwin, J.; Croyle, Z.

2009-01-01

West Tennessee has a complex history of watershed disturbance, including agricultural erosion, channelization, accelerated valley sedimentation, and the removal and reestablishment of beaver. Watershed management has evolved from fl oodplain drainage via pervasive channelization to include local drainage canal maintenance and local river restoration. Many unmaintained canals are undergoing excessive aggradation and complex channel evolution driven by upland erosion and low valley gradient. The locus of aggradation in fully occluded canals (valley plugs) moves up-valley as sediment continues to accumulate in the backwater behind the plug. Valley plugs that cause canal avulsion can lead to redevelopment of meandering channels in less disturbed areas of the fl oodplain, in a process of passive self-restoration. Some valley plugs have brought restored fl oodplain function, reoccupation of extant historic river channels, and formation of a "sediment shadow" that protects downstream reaches from excess sedimentation. Despite the presence of numerous opportunities, there is presently no mechanism for including valley plugs in mitigation projects. In 1997 a survey of 14 reference reach cross sections documented relations between drainage area and bankfull geometry of relatively unmodified streams in West Tennessee. Reassessment of seven of those sites in 2007 showed that one had been dammed by beaver and that two sites could not be analyzed further because of signifi cant vertical or lateral instability. In contrast to other regions of North America, the results suggest that stream channels in this region fl ood more frequently than once each year, and can remain out of banks for several weeks each year. ?? 2009 Geological Society of America.

Identification of sites of STAT3 action in the female reproductive tract through conditional gene deletion.

PubMed

Robker, Rebecca L; Watson, Laura N; Robertson, Sarah A; Dunning, Kylie R; McLaughlin, Eileen A; Russell, Darryl L

2014-01-01

The STAT3 transcription factor is a pleiotropic transducer of signalling by hormones, growth factors and cytokines that has been identified in the female reproductive tract from oocytes and granulosa cells of the ovary to uterine epithelial and stromal cells. In the present study we used transgenic models to investigate the importance of STAT3 for reproductive performance in these different tissues. The Cre-LoxP system was used to delete STAT3 in oocytes by crossing Stat3fl/fl with Zp3-cre+ mice, or in ovarian granulosa cells and uterine stroma by crossing with Amhr2-Cre+ mice. Surprisingly, deletion of STAT3 in oocytes had no effect on fertility indicating that the abundance of STAT3 protein in maturing oocytes and fertilized zygotes is not essential to these developmental stages. In Stat3fl/fl;Amhr2-cre+ females impaired fertility was observed through significantly fewer litters and smaller litter size. Ovulation rate, oocyte fertilization and development to blastocyst were unaffected in this line; however, poor recombination efficiency in granulosa cells had yielded no net change in STAT3 protein abundance. In contrast, uteri from these mice showed STAT3 protein depletion selectively from the stomal compartment. A significant reduction in number of viable fetuses on gestational day 18, increased fetal resorptions and disrupted placental morphology were evident causes of the reduced fertility. In conclusion, this study defines an important role for STAT3 in uterine stromal cells during embryo implantation and the development of a functional placenta.

Human CD34(lo)CD133(lo) fetal liver cells support the expansion of human CD34(hi)CD133(hi) hematopoietic stem cells.

PubMed

Yong, Kylie Su Mei; Keng, Choong Tat; Tan, Shu Qi; Loh, Eva; Chang, Kenneth Te; Tan, Thiam Chye; Hong, Wanjin; Chen, Qingfeng

2016-09-01

We have recently discovered a unique CD34(lo)CD133(lo) cell population in the human fetal liver (FL) that gives rise to cells in the hepatic lineage. In this study, we further characterized the biological functions of FL CD34(lo)CD133(lo) cells. Our findings show that these CD34(lo)CD133(lo) cells express markers of both endodermal and mesodermal lineages and have the capability to differentiate into hepatocyte and mesenchymal lineage cells by ex vivo differentiation assays. Furthermore, we show that CD34(lo)CD133(lo) cells express growth factors that are important for human hematopoietic stem cell (HSC) expansion: stem cell factor (SCF), insulin-like growth factor 2 (IGF2), C-X-C motif chemokine 12 (CXCL12), and factors in the angiopoietin-like protein family. Co-culture of autologous FL HSCs and allogenic HSCs derived from cord blood with CD34(lo)CD133(lo) cells supports and expands both types of HSCs.These findings are not only essential for extending our understanding of the HSC niche during the development of embryonic and fetal hematopoiesis but will also potentially benefit adult stem cell transplantations in clinics because expanded HSCs demonstrate the same capacity as primary cells to reconstitute the human immune system and mediate long-term hematopoiesis in vivo. Together, CD34(lo)CD133(lo) cells not only serve as stem/progenitor cells for liver development but are also an essential component of the HSC niche in the human FL.

Increased efficacy of metformin corresponds to differential metabolic effects in the ovarian tumors from obese versus lean mice

PubMed Central

Han, Jianjun; Wysham, Weiya Z.; Zhong, Yan; Guo, Hui; Zhang, Lu; Malloy, Kim M.; Dickens, Hallum K.; Huh, Gene; Lee, Douglas; Makowski, Liza; Zhou, Chunxiao; Bae-Jump, Victoria L.

2017-01-01

Obesity is a significant risk factor for ovarian cancer (OC) and associated with worse outcomes for this disease. We assessed the anti-tumorigenic effects of metformin in human OC cell lines and a genetically engineered mouse model of high grade serous OC under obese and lean conditions. Metformin potently inhibited growth in a dose-dependent manner in all four human OC cell lines through AMPK/mTOR pathways. Treatment with metformin resulted in G1 arrest, induction of apoptosis, reduction of invasion and decreased hTERT expression. In the K18-gT121+/-; p53fl/ fl; Brca1fl/fl (KpB) mouse model, metformin inhibited tumor growth in both lean and obese mice. However, in the obese mice, metformin decreased tumor growth by 60%, whereas tumor growth was only decreased by 32% in the lean mice (p=0.003) compared to vehicle-treated mice. The ovarian tumors from obese mice had evidence of impaired mitochondrial complex 2 function and energy supplied by omega fatty acid oxidation rather than glycolysis as compared to lean mice, as assessed by metabolomic profiling. The improved efficacy of metformin in obesity corresponded with inhibition of mitochondrial complex 1 and fatty acid oxidation, and stimulation of glycolysis in only the OCs of obese versus lean mice. In conclusion, metformin had anti-tumorigenic effects in OC cell lines and the KpB OC pre-clinical mouse model, with increased efficacy in obese versus lean mice. Detected metabolic changes may underlie why ovarian tumors in obese mice have heightened susceptibility to metformin. PMID:29340030

Waveband specific transcriptional control of select genetic pathways in vertebrate skin (Xiphophorus maculatus).

PubMed

Walter, Ronald B; Boswell, Mikki; Chang, Jordan; Boswell, William T; Lu, Yuan; Navarro, Kaela; Walter, Sean M; Walter, Dylan J; Salinas, Raquel; Savage, Markita

2018-05-10

Evolution occurred exclusively under the full spectrum of sunlight. Conscription of narrow regions of the solar spectrum by specific photoreceptors suggests a common strategy for regulation of genetic pathways. Fluorescent light (FL) does not possess the complexity of the solar spectrum and has only been in service for about 60 years. If vertebrates evolved specific genetic responses regulated by light wavelengths representing the entire solar spectrum, there may be genetic consequences to reducing the spectral complexity of light. We utilized RNA-Seq to assess changes in the transcriptional profiles of Xiphophorus maculatus skin after exposure to FL ("cool white"), or narrow wavelength regions of light between 350 and 600 nm (i.e., 50 nm or 10 nm regions, herein termed "wavebands"). Exposure to each 50 nm waveband identified sets of genes representing discrete pathways that showed waveband specific transcriptional modulation. For example, 350-400 or 450-500 nm waveband exposures resulted in opposite regulation of gene sets marking necrosis and apoptosis (i.e., 350-400 nm; necrosis suppression, apoptosis activation, while 450-500 nm; apoptosis suppression, necrosis activation). Further investigation of specific transcriptional modulation employing successive 10 nm waveband exposures between 500 and 550 nm showed; (a) greater numbers of genes may be transcriptionally modulated after 10 nm exposures, than observed for 50 nm or FL exposures, (b) the 10 nm wavebands induced gene sets showing greater functional specificity than 50 nm or FL exposures, and (c) the genetic effects of FL are primarily due to 30 nm between 500 and 530 nm. Interestingly, many genetic pathways exhibited completely opposite transcriptional effects after different waveband exposures. For example, the epidermal growth factor (EGF) pathway exhibits transcriptional suppression after FL exposure, becomes highly active after 450-500 nm waveband exposure, and again, exhibits strong transcriptional suppression after exposure to the 520-530 nm waveband. Collectively, these results suggest one may manipulate transcription of specific genetic pathways in skin by exposure of the intact animal to specific wavebands of light. In addition, we identify genes transcriptionally modulated in a predictable manner by specific waveband exposures. Such genes, and their regulatory elements, may represent valuable tools for genetic engineering and gene therapy protocols.

Transcriptional analysis of abdominal fat in genetically fat and lean chickens reveals adipokines, lipogenic genes and a link between hemostasis and leanness

PubMed Central

2013-01-01

Background This descriptive study of the abdominal fat transcriptome takes advantage of two experimental lines of meat-type chickens (Gallus domesticus), which were selected over seven generations for a large difference in abdominal (visceral) fatness. At the age of selection (9 wk), the fat line (FL) and lean line (LL) chickens exhibit a 2.5-fold difference in abdominal fat weight, while their feed intake and body weight are similar. These unique avian models were originally created to unravel genetic and endocrine regulation of adiposity and lipogenesis in meat-type chickens. The Del-Mar 14K Chicken Integrated Systems microarray was used for a time-course analysis of gene expression in abdominal fat of FL and LL chickens during juvenile development (1–11 weeks of age). Results Microarray analysis of abdominal fat in FL and LL chickens revealed 131 differentially expressed (DE) genes (FDR≤0.05) as the main effect of genotype, 254 DE genes as an interaction of age and genotype and 3,195 DE genes (FDR≤0.01) as the main effect of age. The most notable discoveries in the abdominal fat transcriptome were higher expression of many genes involved in blood coagulation in the LL and up-regulation of numerous adipogenic and lipogenic genes in FL chickens. Many of these DE genes belong to pathways controlling the synthesis, metabolism and transport of lipids or endocrine signaling pathways activated by adipokines, retinoid and thyroid hormones. Conclusions The present study provides a dynamic view of differential gene transcription in abdominal fat of chickens genetically selected for fatness (FL) or leanness (LL). Remarkably, the LL chickens over-express a large number of hemostatic genes that could be involved in proteolytic processing of adipokines and endocrine factors, which contribute to their higher lipolysis and export of stored lipids. Some of these changes are already present at 1 week of age before the divergence in fatness. In contrast, the FL chickens have enhanced expression of numerous lipogenic genes mainly after onset of divergence, presumably directed by multiple transcription factors. This transcriptional analysis shows that abdominal fat of the chicken serves a dual function as both an endocrine organ and an active metabolic tissue, which could play a more significant role in lipogenesis than previously thought. PMID:23947536

Ruhende Flüssigkeiten und Gase

NASA Astrophysics Data System (ADS)

Heintze, Joachim

Das mechanische Verhalten von Flüssigkeiten und Gasen ist dadurch gekennzeichnet, dass sie keine statische Schubfestigkeit besitzen, andernfalls würden sie nicht beginnen, zu fließen. In ruhenden Flüssigkeiten und Gasen können daher keine Schubspannungen bestehen:

78 FR 54564 - Standard Instrument Approach Procedures, and Takeoff Minimums and Obstacle Departure Procedures...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-09-05

... Linder Rgnl, Takeoff Minimums and Obstacle DP, Amdt 1 Venice, FL, Venice Muni, RNAV (GPS) RWY 5, Orig Venice, FL, Venice Muni, RNAV (GPS) RWY 23, Orig Venice, FL, Venice Muni, Takeoff Minimums and Obstacle...

The dissipation of three fungicides in a biobed organic substrate and their impact on the structure and activity of the microbial community.

PubMed

Marinozzi, Maria; Coppola, Laura; Monaci, Elga; Karpouzas, Dimitrios G; Papadopoulou, Evangelia; Menkissoglu-Spiroudi, Urania; Vischetti, Costantino

2013-04-01

Biopurification systems (BPS) have been introduced to minimise the risk for point source contamination of natural water resources by pesticides. Their depuration efficiency relies mostly on the high biodegradation of their packing substrate (biomixture). Despite that, little is known regarding the interactions between biomixture microflora and pesticides, especially fungicides which are expected to have a higher impact on the microbial community. This study reports the dissipation of the fungicides azoxystrobin (AZX), fludioxonil (FL) and penconazole (PC), commonly used in vineyards, in a biomixture composed of pruning residues and straw used in vineyard BPS. The impact of fungicides on the microbial community was also studied via microbial biomass carbon, basal respiration and phospholipid fatty acid analysis. AZX dissipated faster (t1/2 = 30.1 days) than PC (t1/2 = 99.0 days) and FL (t1/2 = 115.5 days). Fungicides differently affected the microbial community. PC showed the highest adverse effect on both the size and the activity of the biomixture microflora. A significant change in the structure of the microbial community was noted for PC and FL, and it was attributed to a rapid inhibition of the fungal fraction while bacteria showed a delayed response which was attributed to indirect effects by the late proliferation of fungi. All effects observed were transitory and a full recovery of microbial indices was observed 60 days post-application. Overall, no clear link between pesticide persistence and microbial responses was observed stressing the complex nature of interactions between pesticides in microflora in BPS.

The buccohypophyseal canal is an ancestral vertebrate trait maintained by modulation in sonic hedgehog signaling.

PubMed

Khonsari, Roman H; Seppala, Maisa; Pradel, Alan; Dutel, Hugo; Clément, Gaël; Lebedev, Oleg; Ghafoor, Sarah; Rothova, Michaela; Tucker, Abigael; Maisey, John G; Fan, Chen-Ming; Kawasaki, Maiko; Ohazama, Atsushi; Tafforeau, Paul; Franco, Brunella; Helms, Jill; Haycraft, Courtney J; David, Albert; Janvier, Philippe; Cobourne, Martyn T; Sharpe, Paul T

2013-03-28

The pituitary gland is formed by the juxtaposition of two tissues: neuroectoderm arising from the basal diencephalon, and oral epithelium, which invaginates towards the central nervous system from the roof of the mouth. The oral invagination that reaches the brain from the mouth is referred to as Rathke's pouch, with the tip forming the adenohypophysis and the stalk disappearing after the earliest stages of development. In tetrapods, formation of the cranial base establishes a definitive barrier between the pituitary and oral cavity; however, numerous extinct and extant vertebrate species retain an open buccohypophyseal canal in adulthood, a vestige of the stalk of Rathke's pouch. Little is currently known about the formation and function of this structure. Here we have investigated molecular mechanisms driving the formation of the buccohypophyseal canal and their evolutionary significance. We show that Rathke's pouch is located at a boundary region delineated by endoderm, neural crest-derived oral mesenchyme and the anterior limit of the notochord, using CD1, R26R-Sox17-Cre and R26R-Wnt1-Cre mouse lines. As revealed by synchrotron X-ray microtomography after iodine staining in mouse embryos, the pouch has a lobulated three-dimensional structure that embraces the descending diencephalon during pituitary formation. Polaris(fl/fl); Wnt1-Cre, Ofd1(-/-) and Kif3a(-/-) primary cilia mouse mutants have abnormal sonic hedgehog (Shh) signaling and all present with malformations of the anterior pituitary gland and midline structures of the anterior cranial base. Changes in the expressions of Shh downstream genes are confirmed in Gas1(-/-) mice. From an evolutionary perspective, persistence of the buccohypophyseal canal is a basal character for all vertebrates and its maintenance in several groups is related to a specific morphology of the midline that can be related to modulation in Shh signaling. These results provide insight into a poorly understood ancestral vertebrate structure. It appears that the opening of the buccohypophyseal canal depends upon Shh signaling and that modulation in this pathway most probably accounts for its persistence in phylogeny.

Medical Surveillance Monthly Report (MSMR). Volume 18, Number 03, March 2011

DTIC Science & Technology

2011-03-01

nervous system dysfunction; the diagnosis was also applicable to patients with laboratory evidence of injury to the liver , muscles, or kidneys. Th e...decrease cerebral blood fl ow and disrupt brain function (e.g., hypotonic encephalopathy , seizures, coma). Without rapid and defi nitive treatment to

Mangrove soil and vegetation change after tidal wetland creation: a 20-year chronosequence in Tampa Bay, FL

EPA Science Inventory

Mangrove restoration and creation efforts are increasingly proposed as mechanisms to compensate for mangrove loss (which has been high in recent decades: ~30-50% global loss). However, ecosystem development and functionality following mangrove restoration and creation is poorly u...

Isolation of uv-sensitive variants of human FL cells by a viral suicide method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shiomi, T.; Sato, K.

A new method (viral suicide method) for the isolation of uv-sensitive mutants is described. Colonies of mutagenized human FL cells were infected with uv-irradiated Herpes simplex viruses and surviving ones which seemed to be deficient in host cell reactivation (HCR) were examined for their uv sensitivity. Nineteen of 238 clones examined were sensitive to uv irradiation at the time of the isolation. After recloning, four of these clones have been studied and two (UVS-1 and UVS-2) of them are stable in their uv sensitivity for 4 months in culture. uv sensitivity of UVS-1, UVS-2, and the parental FL cells aremore » as follows: the extrapolation numbers (n) are 2.2, 2.1, and 1.8 and mean lethal doses (DO) are 2.9, 3.7, and 7.8 J/m/sup 2/ for UVS-1, UVS-2, and the parental FL cells, respectively. They are no more sensitive than FL cells to x-irradiation. The ability of HCR in UVS-2 cells is apparently lower than that in FL cells, whereas UVS-1 cells are the same as FL cells in the ability.« less

Ratiometric, visual, dual-signal fluorescent sensing and imaging of pH/copper ions in real samples based on carbon dots-fluorescein isothiocyanate composites.

PubMed

Zhu, Xinxin; Jin, Hui; Gao, Cuili; Gui, Rijun; Wang, Zonghua

2017-01-01

In this article, a facile aqueous synthesis of carbon dots (CDs) was developed by using natural kelp as a new carbon source. Through hydrothermal carbonization of kelp juice, fluorescent CDs were prepared and the CDs' surface was modified with polyethylenimine (PEI). The PEI-modified CDs were conjugated with fluorescein isothiocyanate (FITC) to fabricate CDs-FITC composites. To exploit broad applications, the CDs-FITC composites were developed as fluorescent sensing or imaging platforms of pH and Cu 2+ . Analytical performances of the composites-based fluorescence (FL) sensors were evaluated, including visual FL imaging of pH in glass bottle, ratiometric FL sensing of pH in yogurt samples, visual FL latent fingerprint and leaf imaging detection of [Cu 2+ ], dual-signal FL sensing of [Cu 2+ ] in yogurt and human serum samples. Experimental results from ratiometric, visual, dual-signal FL sensing and imaging applications confirmed the high feasibility, accuracy, stabilization and simplicity of CDs-FITC composites-based FL sensors for the detection of pH and Cu 2+ ions in real samples. Copyright © 2016 Elsevier B.V. All rights reserved.

Neural correlates of foreign-language learning in childhood: a 3-year longitudinal ERP study.

PubMed

Ojima, Shiro; Nakamura, Naoko; Matsuba-Kurita, Hiroko; Hoshino, Takahiro; Hagiwara, Hiroko

2011-01-01

A foreign language (a language not spoken in one's community) is difficult to master completely. Early introduction of foreign-language (FL) education during childhood is becoming a standard in many countries. However, the neural process of child FL learning still remains largely unknown. We longitudinally followed 322 school-age children with diverse FL proficiency for three consecutive years, and acquired children's ERP responses to FL words that were semantically congruous or incongruous with the preceding picture context. As FL proficiency increased, various ERP components previously reported in mother-tongue (L1) acquisition (such as a broad negativity, an N400, and a late positive component) appeared sequentially, critically in an identical order to L1 acquisition. This finding was supported not only by cross-sectional analyses of children at different proficiency levels but also by longitudinal analyses of the same children over time. Our data are consistent with the hypothesis that FL learning in childhood reproduces identical developmental stages in an identical order to L1 acquisition, suggesting that the nature of the child's brain itself may determine the normal course of FL learning. Future research should test the generalizability of the results in other aspects of language such as syntax.

77 FR 4394 - Release of Airport Property: Orlando Executive Airport, Orlando, FL

Federal Register 2010, 2011, 2012, 2013, 2014

2012-01-27

... DEPARTMENT OF TRANSPORTATION Federal Aviation Administration Release of Airport Property: Orlando Executive Airport, Orlando, FL AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Request for... 12.4 acres at the Orlando Executive Airport, Orlando, FL from the conditions, release certain...

Targeting Peripheral-Derived Regulatory T Cells as a Means of Enhancing Immune Responses Directed against Prostate Cancer

DTIC Science & Technology

2016-08-01

TRAMP transgenic mice) that lack or preferentially generate pTregs (TRAMP+ mice bred onto Lck-cre; Klf2fl/fl and Smurf1-/- backgrounds, respectively...We have successfully generated TRAMP+; Lck-cre; Klf2fl/fl and TRAMP+; Smurf1-/- breeding lines, which will provide us with the necessary animals to...Aim 1: Determine how blocking pTreg production impacts PCa Major Task 1: Score tumors in TRAMP cohorts that contain or lack pTregs. The breeding

Development of EBM-CDSS (Evidence-Based Clinical Decision Support System) to AIG Prognostication in Terminally Ill Patients

DTIC Science & Technology

2016-03-01

Mbah, PhD2*, Ambuj Kumar, MD, MPH3, Kim Sehwan, PhD4*, Ronald Schonwetter, MD5* and Benjamin Djulbegovic, MD, PhD6 1Center for Evidence - Based Medicine , University...of South Florida, Tampa, FL 2USF, Tampa, FL 3University of South Florida, College of Medicine, Center for Evidence Based Medicine , Tampa...4HPC healthcare, Tampa, FL 5HPC Healthcare, Tampa, FL 6Center for Evidence - Based Medicine & Health Outcomes Research, University of South

Several immune escape patterns in non-Hodgkin's lymphomas

PubMed Central

Laurent, Camille; Charmpi, Konstantina; Gravelle, Pauline; Tosolini, Marie; Franchet, Camille; Ysebaert, Loïc; Brousset, Pierre; Bidaut, Alexandre; Ycart, Bernard; Fournié, Jean-Jacques

2015-01-01

Follicular Lymphomas (FL) and diffuse large B cell lymphomas (DLBCL) must evolve some immune escape strategy to develop from lymphoid organs, but their immune evasion pathways remain poorly characterized. We investigated this issue by transcriptome data mining and immunohistochemistry (IHC) of FL and DLBCL lymphoma biopsies. A set of genes involved in cancer immune-evasion pathways (Immune Escape Gene Set, IEGS) was defined and the distribution of the expression levels of these genes was compared in FL, DLBCL and normal B cell transcriptomes downloaded from the GEO database. The whole IEGS was significantly upregulated in all the lymphoma samples but not in B cells or other control tissues, as shown by the overexpression of the PD-1, PD-L1, PD-L2 and LAG3 genes. Tissue microarray immunostainings for PD-1, PD-L1, PD-L2 and LAG3 proteins on additional biopsies from 27 FL and 27 DLBCL patients confirmed the expression of these proteins. The immune infiltrates were more abundant in FL than DLBCL samples, and the microenvironment of FL comprised higher rates of PD-1+ lymphocytes. Further, DLBCL tumor cells comprised a higher proportion of PD-1+, PD-L1+, PD-L2+ and LAG3+ lymphoma cells than the FL tumor cells, confirming that DLBCL mount immune escape strategies distinct from FL. In addition, some cases of DLBCL had tumor cells co-expressing both PD-1, PD-L1 and PD-L2. Among the DLBCLs, the activated B cell (ABC) subtype comprised more PD-L1+ and PD-L2+ lymphoma cells than the GC subtype. Thus, we infer that FL and DLBCL evolved several pathways of immune escape. PMID:26405585

Early Relapse of Follicular Lymphoma After Rituximab Plus Cyclophosphamide, Doxorubicin, Vincristine, and Prednisone Defines Patients at High Risk for Death: An Analysis From the National LymphoCare Study

PubMed Central

Casulo, Carla; Byrtek, Michelle; Dawson, Keith L.; Zhou, Xiaolei; Farber, Charles M.; Flowers, Christopher R.; Hainsworth, John D.; Maurer, Matthew J.; Cerhan, James R.; Link, Brian K.; Zelenetz, Andrew D.; Friedberg, Jonathan W.

2015-01-01

Purpose Twenty percent of patients with follicular lymphoma (FL) experience progression of disease (POD) within 2 years of initial chemoimmunotherapy. We analyzed data from the National LymphoCare Study to identify whether prognostic FL factors are associated with early POD and whether patients with early POD are at high risk for death. Patients and Methods In total, 588 patients with stage 2 to 4 FL received first-line rituximab plus cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP). Two groups were defined: patients with early POD 2 years or less after diagnosis and those without POD within 2 years, the reference group. An independent validation set, 147 patients with FL who received first-line R-CHOP, was analyzed for reproducibility. Results Of 588 patients, 19% (n = 110) had early POD, 71% (n = 420) were in the reference group, 8% (n = 46) were lost to follow-up, and 2% (n = 12) died without POD less than 2 years after diagnosis. Five-year overall survival was lower in the early-POD group than in the reference group (50% v 90%). This trend was maintained after we adjusted for FL International Prognostic Index (hazard ratio, 6.44; 95% CI, 4.33 to 9.58). Results were similar for the validation set (FL International Prognostic Index–adjusted hazard ratio, 19.8). Conclusion In patients with FL who received first-line R-CHOP, POD within 2 years after diagnosis was associated with poor outcomes and should be further validated as a standard end point of chemoimmunotherapy trials of untreated FL. This high-risk FL population warrants further study in directed prospective clinical trials. PMID:26124482

Effects of structural deformations on optical properties of tetrabenzoporphyrins: free-bases and Pd complexes.

PubMed

Lebedev, Artem Y; Filatov, Mikhail A; Cheprakov, Andrei V; Vinogradov, Sergei A

2008-08-21

A recently developed method of synthesis of pi-extended porphyrins made it possible to prepare a series of tetrabenzoporphyrins (TBP) with different numbers of meso-aryl substituents. The photophysical parameters of free-bases and Pd complexes of meso-unsubstituted TBP's, 5,15-diaryl-TBP's (Ar2TBP's) and 5,10,15,20-tetraaryl-TBP's (Ar4TBP's) were measured. For comparison, similarly meso-arylsubstituted porphyrins fused with nonaromatic cyclohexeno-rings, i.e. Ar(n)-tetracyclohexenoporphyrins (Ar(n)TCHP's, n = 0, 2, 4), were also synthesized and studied. Structural information was obtained by ab initio (DFT) calculations and X-ray crystallography. It was found that: 1) Free-base Ar4TBP's are strongly distorted out-of-plane (saddled), possess broadened, red-shifted spectra, short excited-state lifetimes and low fluorescence quantum yields (tau(fl) = 2-3 ns, phi(fl) = 0.02-0.03). These features are characteristic of other nonplanar free-base porphyrins, including Ar4TCHP's. 2) Ar2TBP free-bases possess completely planar geometries, although with significant in-plane deformations. These deformations have practically no effect on the singlet excited-state properties of Ar2TBP's as compared to planar meso-unsubstituted TBP's. Both types of porphyrins retain strong fluorescence (tau(fl) = 10-12 ns, phi(fl) = 0.3-0.4), and their radiative rate constants (k(r)) are 3-4 times higher than those of planar H2TCHP's. 3) Nonplanar deformations dramatically enhance nonradiative decay of triplet states of regular Pd porphyrins. For example, planar PdTCHP phosphoresces with high quantum yield (phi(phos) = 0.45, tau(phos) = 1118 micros), while saddled PdPh4TCHP is practically nonemissive. In contrast, both ruffled and saddled PdAr(n)TBP's retain strong phosphorescence at ambient temperatures (PdPh2TBP: tau(phos) = 496 micros, phi(phos) = 0.15; PdPh4TBP: tau(phos) = 258 micros, phi(phos) = 0.08). It appears that pi-extension is capable of counterbalancing deleterious effects of nonplanar deformations on triplet emissivity of Pd porphyrins.

Effects of Structural Deformations on Optical Properties of Tetrabenzoporphyrins: Free-Bases and Pd Complexes

PubMed Central

Lebedev, Artem Y.; Filatov, Mikhail A.; Cheprakov, Andrei V.; Vinogradov, Sergei A.

2009-01-01

A recently developed method of synthesis of π-extended porphyrins made it possible to prepare a series of tetrabenzoporphyrins (TBP) with different numbers of meso-aryl substituents. The photophysical parameters of free-bases and Pd complexes of meso-unsubstituted TBP’s, 5,15-diaryl-TBP’s (Ar2TBP’s) and 5,10,15,20-tetraaryl-TBP’s (Ar4TBP’s) were measured. For comparison, similarly meso-arylsubstituted porphyrins fused with nonaromatic cyclohexeno-rings, i.e. Arn-tetracyclohexenoporphyrins (ArnTCHP’s, n = 0, 2, 4), were also synthesized and studied. Structural information was obtained by ab initio (DFT) calculations and X-ray crystallography. It was found that: 1) Free-base Ar4TBP’s are strongly distorted out-of-plane (saddled), possess broadened, red-shifted spectra, short excited-state lifetimes and low fluorescence quantum yields (τfl = 2–3 ns, ϕfl = 0.02–0.03). These features are characteristic of other nonplanar free-base porphyrins, including Ar4TCHP’s. 2) Ar2TBP free-bases possess completely planar geometries, although with significant in-plane deformations. These deformations have practically no effect on the singlet excited-state properties of Ar2TBP’s as compared to planar meso-unsubstituted TBP’s. Both types of porphyrins retain strong fluorescence (τfl = 10–12 ns, ϕfl = 0.3–0.4), and their radiative rate constants (kr) are 3–4 times higher than those of planar H2TCHP’s. 3) Nonplanar deformations dramatically enhance nonradiative decay of triplet states of regular Pd porphyrins. For example, planar PdTCHP phosphoresces with high quantum yield (ϕphos = 0.45, τphos = 1118 µs), while saddled PdPh4TCHP is practically nonemissive. In contrast, both ruffled and saddled PdArnTBP’s retain strong phosphorescence at ambient temperatures (PdPh2TBP: τphos = 496 µs, ϕphos = 0.15; PdPh4TBP: τphos = 258 µs, ϕphos = 0.08). It appears that π-extension is capable of counterbalancing deleterious effects of nonplanar deformations on triplet emissivity of Pd porphyrins. PMID:18665576

General Aviation Avionics Statistics: 1977.

DTIC Science & Technology

1980-06-01

combustion of fuel, the gases of combustion (or the heated air) being used both to rotate the turbine and to create a thrust-producing engine. Turboprop...cc 0 4) 0 𔃾) cu z 4) 0 a$. .- MCI 1001 APPENDIX D AIRSPACE STRUCTURE 101 APPENDIX D. AIRSPACE STRUCTURE -t FLIO* - -FL450 I ContinentalI Control...Compass 9. Landing gear 4. Tachometer 10. Belts 5. Oil temperature 11. Special equipment for 6. Emergency locator over water flights transmitter

Genetic Evidence for a Silent SUC Gene in Yeast

PubMed Central

Carlson, Marian; Osmond, Barbara C.; Botstein, David

1981-01-01

The SUC genes (SUC1–SUC7) of Saccharomyces are a family of genes that are dispersed in the yeast genome. A SUC+ allele at any locus confers the ability to produce the enzyme invertase and, thus, to ferment sucrose. Most yeast strains do not carry SUC+ alleles at all possible SUC loci. We have investigated the naturally occurring negative (suc0) alleles present at SUC loci with the aim of distinguishing between two possible models for the structure of suc0 alleles: (1) suc0 alleles correspond to a simple absence of SUC genetic information; (2) suc0 alleles are "silent" SUC genes that either produce a defective product or are not expressed. To facilitate these studies, sucrose-nonfermenting strains were constructed that are congenic to S. cerevisiae strain S288C (SUC2+), but carry at the SUC2 locus the naturally occurring negative allele, suc20, of strain FL100 (Lacroute 1968). These strains were used to study the genetic properties of the suc20 allele of FL100 and the suc0 alleles (suc10, suc30, etc.) of S288C. The suc20 allele was shown to revert to an active Suc+ state and to provide functional information at three points in the SUC2 gene in recombination experiments; this suc20 gene thus appears to be a "silent" gene. Similar tests for silent SUC genes in S288C (corresponding to loci other than SUC2) failed to reveal any additional silent genes. PMID:7040164

77 FR 34210 - Amendment of Class E Airspace; Orlando, FL

Federal Register 2010, 2011, 2012, 2013, 2014

2012-06-11

...-0503; Airspace Docket No. 11-ASO-19] Amendment of Class E Airspace; Orlando, FL AGENCY: Federal... Orlando, FL, as new Standard Instrument Approach Procedures have been developed at Orlando Executive... coordinates of Orlando Executive Airport, Orlando International Airport, and Kissimmee Municipal Airport...

77 FR 70681 - Special Local Regulations; 2012 Holiday Boat Parades, Captain of the Port Miami Zone; FL

Federal Register 2010, 2011, 2012, 2013, 2014

2012-11-27

... east of the Glynn Mayo Highway Bridge in Jupiter, FL. A special local regulation was previously... Palm Beach and end at Loxahatchee River Daymark 7 east of the Glynn Mayo Highway Bridge in Jupiter, FL...

Dual-Modality Optical/PET Imaging of PARP1 in Glioblastoma.

PubMed

Carlucci, Giuseppe; Carney, Brandon; Brand, Christian; Kossatz, Susanne; Irwin, Christopher P; Carlin, Sean D; Keliher, Edmund J; Weber, Wolfgang; Reiner, Thomas

2015-12-01

The current study presents [(18)F]PARPi-FL as a bimodal fluorescent/positron emission tomography (PET) agent for PARP1 imaging. [(18)F]PARPi-FL was obtained by (19)F/(18)F isotopic exchange and PET experiments, biodistribution studies, surface fluorescence imaging, and autoradiography carried out in a U87 MG glioblastoma mouse model. [(18)F]PARPi-FL showed high tumor uptake in vivo and ex vivo in small xenografts (< 2 mm) with both PET and optical imaging technologies. Uptake of [(18)F]PARPi-FL in blocked U87 MG tumors was reduced by 84 % (0.12 ± 0.02 %injected dose/gram (%ID/g)), showing high specificity of the binding. PET imaging showed accumulation in the tumor (1 h p.i.), which was confirmed by ex vivo phosphor autoradiography. The fluorescent component of [(18)F]PARPi-FL enables cellular resolution optical imaging, while the radiolabeled component of [(18)F]PARPi-FL allows whole-body deep-tissue imaging of malignant growth.

The DNA-recognition mode shared by archaeal feast/famine-regulatory proteins revealed by the DNA-binding specificities of TvFL3, FL10, FL11 and Ss-LrpB

PubMed Central

Yokoyama, Katsushi; Nogami, Hideki; Kabasawa, Mamiko; Ebihara, Sonomi; Shimowasa, Ai; Hashimoto, Keiko; Kawashima, Tsuyoshi; Ishijima, Sanae A.; Suzuki, Masashi

2009-01-01

The DNA-binding mode of archaeal feast/famine-regulatory proteins (FFRPs), i.e. paralogs of the Esherichia coli leucine-responsive regulatory protein (Lrp), was studied. Using the method of systematic evolution of ligands by exponential enrichment (SELEX), optimal DNA duplexes for interacting with TvFL3, FL10, FL11 and Ss-LrpB were identified as TACGA[AAT/ATT]TCGTA, GTTCGA[AAT/ATT]TCGAAC, CCGAAA[AAT/ATT]TTTCGG and TTGCAA[AAT/ATT]TTGCAA, respectively, all fitting into the form abcdeWWWedcba. Here W is A or T, and e.g. a and a are bases complementary to each other. Apparent equilibrium binding constants of the FFRPs and various DNA duplexes were determined, thereby confirming the DNA-binding specificities of the FFRPs. It is likely that these FFRPs recognize DNA in essentially the same way, since their DNA-binding specificities were all explained by the same pattern of relationship between amino-acid positions and base positions to form chemical interactions. As predicted from this relationship, when Gly36 of TvFL3 was replaced by Thr, the b base in the optimal DNA duplex changed from A to T, and, when Thr36 of FL10 was replaced by Ser, the b base changed from T to G/A. DNA-binding characteristics of other archaeal FFRPs, Ptr1, Ptr2, Ss-Lrp and LysM, are also consistent with the relationship. PMID:19468044

25. Photocopy of engineering drawing. NEW WHITE ROOM AND MULTISOLIDS ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

25. Photocopy of engineering drawing. NEW WHITE ROOM AND MULTISOLIDS MODS FOR STRETCHED TANK DELTA LAUNCH COMPLEX 17-A, PAD AREA: PLAN-RAIL BEAMS AND HURRICANE ANCHOR FOUNDATIONS, STRUCTURAL, APRIL 1972. - Cape Canaveral Air Station, Launch Complex 17, Facility 28416, East end of Lighthouse Road, Cape Canaveral, Brevard County, FL

Proceedings of Damping 89, Volume 2, West Palm Beach, FL, 8-10 February 1989

DTIC Science & Technology

1989-11-01

Vinyl Methyl Ether)-Polystyrene Blends and IPN’s J. J. Fay, Dr. C. J. Murphy, Dr. D. A. Thomas and Prof. L. H. Sperling BAA Time-Temperature...Structural Vibrations with Piezoelectric Materials and Passive Electrical Networks N. W. Hagood and Prof. A. von Flotow ICC Passive Electromagnetic

Higher-Order Exploratory Factor Analysis of the Reynolds Intellectual Assessment Scales with a Referred Sample

ERIC Educational Resources Information Center

Nelson, Jason M.; Canivez, Gary L.; Lindstrom, Will; Hatt, Clifford V.

2007-01-01

The factor structure of the Reynolds Intellectual Assessment Scales (RIAS; [Reynolds, C.R., & Kamphaus, R.W. (2003). "Reynolds Intellectual Assessment Scales". Lutz, FL: Psychological Assessment Resources, Inc.]) was investigated with a large (N=1163) independent sample of referred students (ages 6-18). More rigorous factor extraction criteria…

Developing and Validating a Survey of Korean Early Childhood English Teachers' Knowledge

ERIC Educational Resources Information Center

Kim, Jung In

2015-01-01

The main purpose of this study is to develop and validate a valid measure of the early childhood (EC) English teacher knowledge. Through extensive literature review on second/foreign language (L2/FL) teacher knowledge, early childhood teacher knowledge and early childhood language teacher knowledge, and semi-structured interviews from current…

The Professional Development of Future Professors of Foreign Languages: Looking Back, Looking Forward

ERIC Educational Resources Information Center

Allen, Heather Willis; Negueruela-Azarola, Eduardo

2010-01-01

Although the professional development of graduate students in foreign language (FL) departments is of critical importance, discussion of its significance and evolution was all but absent in the 2007 Modern Language Association report "Foreign Languages and Higher Education: New Structures for a Changed World," a document advocating curricular and…

Find a Dermatologic Surgeon

MedlinePlus

... class="button-learn-more"> State AL AK AZ AR CA CO CT DE DC FL GA HI ... 250 Miles Locality City: State: AB AK AL AR AZ BC CA CO CT DC DE FL ... clicking on the procedure name. State AK AL AR AZ CA CO CT DC DE FL GA ...

The effect of continuous passive motion and sling exercise training on clinical and functional outcomes following total knee arthroplasty: a randomized active-controlled clinical study.

PubMed

Mau-Moeller, Anett; Behrens, Martin; Finze, Susanne; Bruhn, Sven; Bader, Rainer; Mittelmeier, Wolfram

2014-05-09

The parallel-group randomized active-controlled clinical study was conducted to compare the effectiveness of two in-hospital range of motion (ROM) exercise programs following total knee arthroplasty (TKA). Continuous passive motion (CPM) is frequently used to increase ROM and improve postoperative recovery despite little conclusive scientific evidence. In contrast, a new active sling-based ROM therapy requires the activation of the knee joint muscles and dynamic joint stabilization. It was hypothesized that higher demands on muscle strength and muscle coordination during sling exercise training (ST) might be advantageous for early recovery following TKA. A total of 125 patients undergoing primary TKA were assessed for eligibility. Thirty-eight patients were randomly assigned to receive ST or CPM (control intervention) during hospital stay. Patients were assessed before TKA for baseline measurement (pretest), 1 day before discharge (posttest) and 3 months after TKA (follow-up). The passive knee flexion range of motion (pFL) was the primary outcome measure. Secondary outcome measures included active knee flexion range of motion, active and passive knee extension ROM, static postural control, physical activity, pain, length of hospital stay as well as clinical, functional and quality-of-life outcomes (SF-36, HSS and WOMAC scores). Data were analyzed according to the intention-to-treat principle. Differences between the groups were tested for significance by the unpaired Student's t test or an analysis of covariance (ANCOVA) adjusted for baseline, weight, sex, age, pain and physical activity. A between-group difference could be determined at posttest. The pFL was significantly higher by 6.0° (95% CI 0.9 to 11.2°; P = 0.022) in the ST group. No difference between groups in pFL was documented at follow-up. Furthermore, no significant differences could be observed for any secondary outcome measure at posttest and follow-up. ST seems to have a clinically relevant beneficial short-term effect on pFL compared to CPM. The results support the implementation of ST in rehabilitation programs following TKA. Therapy, level 2b.

Targeting hepatic cancer cells with pegylated dendrimers displaying N-acetylgalactosamine and SP94 peptide ligands.

PubMed

Medina, Scott H; Tiruchinapally, Gopinath; Chevliakov, Maxim V; Durmaz, Yasemin Yuksel; Stender, Rachell N; Ensminger, William D; Shewach, Donna S; Elsayed, Mohamed E H

2013-10-01

Poly(amidoamine) (PAMAM) dendrimers are branched water-soluble polymers defined by consecutive generation numbers (Gn) indicating a parallel increase in size, molecular weight, and number of surface groups available for conjugation of bioactive agents. In this article, we compare the biodistribution of N-acetylgalactosamine (NAcGal)-targeted [(14) C]1 -G5-(NH2 )5 -(Ac)108 -(NAcGal)14 particles to non-targeted [(14) C]1 -G5-(NH2 )127 and PEGylated [(14) C]1 -G5-(NH2 )44 -(Ac)73 -(PEG)10 particles in a mouse hepatic cancer model. Results show that both NAcGal-targeted and non-targeted particles are rapidly cleared from the systemic circulation with high distribution to the liver. However, NAcGal-targeted particles exhibited 2.5-fold higher accumulation in tumor tissue compared to non-targeted ones. In comparison, PEGylated particles showed a 16-fold increase in plasma residence time and a 5-fold reduction in liver accumulation. These results motivated us to engineer new PEGylated G5 particles with PEG chains anchored to the G5 surface via acid-labile cis-aconityl linkages where the free PEG tips are functionalized with NAcGal or SP94 peptide to investigate their potential as targeting ligands for hepatic cancer cells as a function of sugar conformation (α versus β), ligand concentration (100-4000 nM), and incubation time (2 and 24 hours) compared to fluorescently (Fl)-labeled and non-targeted G5-(Fl)6 -(NH2 )122 and G5-(Fl)6 -(Ac)107 -(cPEG)15 particles. Results show G5-(Fl)6 -(Ac)107 -(cPEG[NAcGalβ ])14 particles achieve faster uptake and higher intracellular concentrations in HepG2 cancer cells compared to other G5 particles while escaping the non-specific adsorption of serum protein and phagocytosis by Kupffer cells, which make these particles the ideal carrier for selective drug delivery into hepatic cancer cells. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Families Learning Together in Colorado: A Report on Family Literacy.

ERIC Educational Resources Information Center

Anderson, Jean E.

This report, which is intended for individuals developing family literacy (FL) programs, contains background information on the research, development, operation, evaluation, and outcomes of federal- and state-level FL initiatives. Discussed in section 1 are the following topics: the importance/benefits of FL programs; definitions of literacy and…

BACTERIOPLANKTON DYNAMICS IN PENSACOLA BAY, FL, USA: ROLE OF PHYTOPLANKTON AND DETRIAL CARBON SOURCES

EPA Science Inventory

Bacterioplankton Dynamics in Pensacola Bay, FL, USA: Role of Phytoplankton and Detrital Carbon Sources (Abstract). To be presented at the16th Biennial Conference of the Estuarine Research Foundation, ERF 2001: An Estuarine Odyssey, 4-8 November 2001, St. Pete Beach, FL. 1 p. (ER...

77 FR 51470 - Drawbridge Operation Regulations; Gulf Intracoastal Waterway, St. Petersburg/Tampa, FL

Federal Register 2010, 2011, 2012, 2013, 2014

2012-08-24

... Operation Regulations; Gulf Intracoastal Waterway, St. Petersburg/Tampa, FL AGENCY: Coast Guard, DHS. ACTION... from the operating schedules that govern seven bridges in St. Petersburg and Tampa, Florida. The... Sector St Petersburg, FL has requested temporary modifications to the operating schedules of seven...

33 CFR 100.728 - Special Local Regulations; Hurricane Offshore Classic, St. Petersburg, FL.

Code of Federal Regulations, 2010 CFR

2010-07-01

...; Hurricane Offshore Classic, St. Petersburg, FL. 100.728 Section 100.728 Navigation and Navigable Waters... WATERS § 100.728 Special Local Regulations; Hurricane Offshore Classic, St. Petersburg, FL. (a) Regulated... commander designated by Coast Guard Sector St. Petersburg, Florida. (2) Spectator craft will be permitted...

Update on sensory evaluation of University of Florida strawberry selections

USDA-ARS?s Scientific Manuscript database

The University of Florida strawberry breeding program has evaluated eating quality of fruit from advanced selections using sensory taste panels. Selections FL 05-107, FL 06-38 and FL 09-127 were compared with the commercial cultivars ‘Strawberry Festival’ and FLorida Radiance’ during two consecutive...

77 FR 16783 - Proposed Amendment of Class E Airspace; Orlando, FL

Federal Register 2010, 2011, 2012, 2013, 2014

2012-03-22

...-0503; Airspace Docket No. 11-ASO-19] Proposed Amendment of Class E Airspace; Orlando, FL AGENCY... action proposes to amend Class E Airspace at Orlando, FL, as new Standard Instrument Approach Procedures have been developed at Orlando Executive Airport. This action would enhance the safety and airspace...

77 FR 3031 - Release of Airport Property: Tampa International Airport, Tampa, FL

Federal Register 2010, 2011, 2012, 2013, 2014

2012-01-20

... Hazeltine National Drive, Suite 400, Orlando, FL 32822. Written comments on the Sponsor's request must be delivered or mailed to: Rebecca R. Henry, Program Manager, Orlando Airports District Office, 5950 Hazeltine National Drive, Suite 400, Orlando, FL 32822-5024. FOR FURTHER INFORMATION CONTACT: Rebecca R. Henry...

76 FR 47061 - Amendment of Class E Airspace; Lakeland, FL

Federal Register 2010, 2011, 2012, 2013, 2014

2011-08-04

...-0005; Airspace Docket No. 10-ASO-42] Amendment of Class E Airspace; Lakeland, FL AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Final rule. SUMMARY: This action amends Class E airspace at... proposed rulemaking (NPRM) to amend Class E airspace at Lakeland Linder Regional Airport, Lakeland, FL (75...

78 FR 66901 - Endangered Species; File No. 16482-01

Federal Register 2010, 2011, 2012, 2013, 2014

2013-11-07

..., University of Georgia, Athens, Georgia 30602 [Douglas Peterson: Responsible Party], has applied in due form... (GA), and Saint Marys (GA/FL) Rivers using gill nets and trammel nets to measure, weigh, photograph... (GA), Saint Marys Rivers (GA/FL) and Saint Johns and Nassau Rivers (FL); and new takes of Atlantic...

FL3, a Synthetic Flavagline and Ligand of Prohibitins, Protects Cardiomyocytes via STAT3 from Doxorubicin Toxicity

PubMed Central

Gasser, Adeline; Basmadjian, Christine; Zhao, Qian; Wilmet, Jean-Philippe; Désaubry, Laurent; Nebigil, Canan G.

2015-01-01

Aims The clinical use of doxorubicin for the treatment of cancer is limited by its cardiotoxicity. Flavaglines are natural products that have both potent anticancer and cardioprotective properties. A synthetic analog of flavaglines, FL3, efficiently protects mice from the cardiotoxicity of doxorubicin. The mechanism underlying this cardioprotective effect has yet to be elucidated. Methods and Results Here, we show that FL3 binds to the scaffold proteins prohibitins (PHBs) and thus promotes their translocation to mitochondria in the H9c2 cardiomyocytes. FL3 induces heterodimerization of PHB1 with STAT3, thereby ensuring cardioprotection from doxorubicin toxicity. This interaction is associated with phosphorylation of STAT3. A JAK2 inhibitor, WP1066, suppresses both the phosphorylation of STAT3 and the protective effect of FL3 in cardiomyocytes. The involvement of PHBs in the FL3-mediated cardioprotection was confirmed by means of small interfering RNAs (siRNAs) targeting PHB1 and PHB2. The siRNA knockdown of PHBs inhibits both phosphorylation of STAT3 and the cardioprotective effect of FL3. Conclusion Activation of mitochondrial STAT3/PHB1 complex by PHB ligands may be a new strategy against doxorubicin-induced cardiotoxicity and possibly other cardiac problems. PMID:26536361

Absorption and emission spectroscopic characterization of photo-dynamics of photoactivated adenylyl cyclase mutant bPAC-Y7F of Beggiatoa sp.

PubMed

Penzkofer, Alfons; Stierl, Manuela; Mathes, Tilo; Hegemann, Peter

2014-11-01

The photoactivated cyclase bPAC of the microbial mats bacterium Beggiatoa sp. consists of a BLUF domain and an adenylyl cyclase domain. It has strong activity of photo-induced cyclic adenylyl monophosphate (cAMP) formation and is therefore an important optogenetic tool in neuroscience applications. The SUMO-bPAC-Y7F mutant where Tyr-7 is replaced by Phe-7 in the BLUF domain has lost the typical BLUF domain photo-cycle dynamics. Instead, the investigated SUMO-bPAC-Y7F mutant consisted of three protein conformations with different triplet based photo-dynamics: (i) reversible flavin quinone (Fl) cofactor reduction to flavin semiquinone (FlH), (ii) reversible violet/near ultraviolet absorbing flavin photoproduct (FlA) formation, and (iii) irreversible red absorbing flavin photoproduct (FlC) formation. Absorption and emission spectroscopic measurements on SUMO-bPAC-Y7F were carried out before, during and after light exposure. Flavin photo-dynamics schemes are developed for the SUMO-bPAC-Y7F fractions performing photo-induced FlH, FlA, and FlC formation. Quantitative parameters of the flavin cofactor excitation, relaxation and recovery dynamics in SUMO-bPAC-Y7F are determined. Copyright © 2014 Elsevier B.V. All rights reserved.

Development of a Plantar Load Estimation Algorithm for Evaluation of Forefoot Load of Diabetic Patients during Daily Walks Using a Foot Motion Sensor

PubMed Central

Noguchi, Hiroshi; Sanada, Hiromi

2017-01-01

Forefoot load (FL) contributes to callus formation, which is one of the pathways to diabetic foot ulcers (DFU). In this study, we hypothesized that excessive FL, which cannot be detected by plantar load measurements within laboratory settings, occurs in daily walks. To demonstrate this, we created a FL estimation algorithm using foot motion data. Acceleration and angular velocity data were obtained from a motion sensor attached to each shoe of the subjects. The accuracy of the estimated FL was validated by correlation with the FL measured by force sensors on the metatarsal heads, which was assessed using the Pearson correlation coefficient. The mean of correlation coefficients of all the subjects was 0.63 at a level corridor, while it showed an intersubject difference at a slope and stairs. We conducted daily walk measurements in two diabetic patients, and additionally, we verified the safety of daily walk measurement using a wearable motion sensor attached to each shoe. We found that excessive FL occurred during their daily walks for approximately three hours in total, when any adverse event was not observed. This study indicated that FL evaluation method using wearable motion sensors was one of the promising ways to prevent DFUs. PMID:28840130

Development of a Plantar Load Estimation Algorithm for Evaluation of Forefoot Load of Diabetic Patients during Daily Walks Using a Foot Motion Sensor.

PubMed

Watanabe, Ayano; Noguchi, Hiroshi; Oe, Makoto; Sanada, Hiromi; Mori, Taketoshi

2017-01-01

Forefoot load (FL) contributes to callus formation, which is one of the pathways to diabetic foot ulcers (DFU). In this study, we hypothesized that excessive FL, which cannot be detected by plantar load measurements within laboratory settings, occurs in daily walks. To demonstrate this, we created a FL estimation algorithm using foot motion data. Acceleration and angular velocity data were obtained from a motion sensor attached to each shoe of the subjects. The accuracy of the estimated FL was validated by correlation with the FL measured by force sensors on the metatarsal heads, which was assessed using the Pearson correlation coefficient. The mean of correlation coefficients of all the subjects was 0.63 at a level corridor, while it showed an intersubject difference at a slope and stairs. We conducted daily walk measurements in two diabetic patients, and additionally, we verified the safety of daily walk measurement using a wearable motion sensor attached to each shoe. We found that excessive FL occurred during their daily walks for approximately three hours in total, when any adverse event was not observed. This study indicated that FL evaluation method using wearable motion sensors was one of the promising ways to prevent DFUs.

Large-Scale Collection and Analysis of Full-Length cDNAs from Brachypodium distachyon and Integration with Pooideae Sequence Resources

PubMed Central

Mochida, Keiichi; Uehara-Yamaguchi, Yukiko; Takahashi, Fuminori; Yoshida, Takuhiro; Sakurai, Tetsuya; Shinozaki, Kazuo

2013-01-01

A comprehensive collection of full-length cDNAs is essential for correct structural gene annotation and functional analyses of genes. We constructed a mixed full-length cDNA library from 21 different tissues of Brachypodium distachyon Bd21, and obtained 78,163 high quality expressed sequence tags (ESTs) from both ends of ca. 40,000 clones (including 16,079 contigs). We updated gene structure annotations of Brachypodium genes based on full-length cDNA sequences in comparison with the latest publicly available annotations. About 10,000 non-redundant gene models were supported by full-length cDNAs; ca. 6,000 showed some transcription unit modifications. We also found ca. 580 novel gene models, including 362 newly identified in Bd21. Using the updated transcription start sites, we searched a total of 580 plant cis-motifs in the −3 kb promoter regions and determined a genome-wide Brachypodium promoter architecture. Furthermore, we integrated the Brachypodium full-length cDNAs and updated gene structures with available sequence resources in wheat and barley in a web-accessible database, the RIKEN Brachypodium FL cDNA database. The database represents a “one-stop” information resource for all genomic information in the Pooideae, facilitating functional analysis of genes in this model grass plant and seamless knowledge transfer to the Triticeae crops. PMID:24130698

Parton distributions with small- x resummation: evidence for BFKL dynamics in HERA data

NASA Astrophysics Data System (ADS)

Ball, Richard D.; Bertone, Valerio; Bonvini, Marco; Marzani, Simone; Rojo, Juan; Rottoli, Luca

2018-04-01

We present a determination of the parton distribution functions of the proton in which NLO and NNLO fixed-order calculations are supplemented by NLL x small- x resummation. Deep-inelastic structure functions are computed consistently at NLO+NLLx or NNLO+NLLx, while for hadronic processes small- x resummation is included only in the PDF evolution, with kinematic cuts introduced to ensure the fitted data lie in a region where the fixed-order calculation of the hard cross-sections is reliable. In all other respects, the fits use the same methodology and are based on the same global dataset as the recent NNPDF3.1 analysis. We demonstrate that the inclusion of small- x resummation leads to a quantitative improvement in the perturbative description of the HERA inclusive and charm-production reduced cross-sections in the small x region. The impact of the resummation in our fits is greater at NNLO than at NLO, because fixed-order calculations have a perturbative instability at small x due to large logarithms that can be cured by resummation. We explore the phenomenological implications of PDF sets with small- x resummation for the longitudinal structure function F_L at HERA, for parton luminosities and LHC benchmark cross-sections, for ultra-high-energy neutrino-nucleus cross-sections, and for future high-energy lepton-proton colliders such as the LHeC.

Lithofacies and sequence stratigraphic analysis of the Upper Jurassic siliciclastics in the eastern Kopet-Dagh Basin, NE Iran

NASA Astrophysics Data System (ADS)

Zand-Moghadam, Hamed; Moussavi-Harami, Reza; Mahboubi, Asadollah; Aghaei, Ali

2016-05-01

The Upper Jurassic (Oxfordian-Kimmeridgian) Mozduran Formation is the most important gas reservoirs of the northeast Iran. Siliciclastic facies of this formation in eastern most parts of the basin have not been studied yet. Therefore, four stratigraphic sections of Mozduran Formation have been selected in the Kole-Malekabad, Kale-Karab, Deraz-Ab and Karizak to interpret depositional history and analyze depositional sequences. Based on texture and sedimentary structures, 14 slilciclastic lithofacies were identified and classified into four categories, including conglomerate (Gms, Gp, Gt), sandstone (Sh, Sp, St, Sr, Sl, Sm, Se), mud rock (Fl) and intermediate sandstone-mud rock (Sr (Fl), Sr/Fl, Fl (Sr)). Identified lithofacies formed four architectural elements CH, SB, LA and FF. Lithofacies characteristics and architectural elements with mostly bimodal pattern of paleocurrents show that the majority of Mozduran lithofacies deposited in the coastal environment (tidal influence). Sequence stratigraphic analysis shows that the Kole-Malekabad section consists of two depositional sequences while other sections are characterized by three depositional sequences. The lower and upper sequence boundaries of the Mozduran Formation in all stratigraphic sections are SB1 that are distinguished by paleosol and sometime conglomerate horizons. Most of depositional sequences in studied sections are composed only of TST and HST. The TST deposits consist mostly of quartzarenite and litharenite petrofacies that have been deposited in the tidal zone. HST packages are mostly including mud rocks with interdeds of sandstone lithofacies that are deposited in supratidal setting. The LST facies is recognized only in the DS3 (equivalent to the second depositional sequences of the Kole-Malekabad), which consist of conglomerate facies. Instead, the Kole-Malekabad section is often composed of supratidal gypsiferrous shales, indicating sea level fall in the study area.

Extending applicability of the oxygen radical absorbance capacity (ORAC-fluorescein) assay.

PubMed

Dávalos, Alberto; Gómez-Cordovés, Carmen; Bartolomé, Begoña

2004-01-14

The ORAC-fluorescein (ORAC-FL) method recently validated using automatic liquid handling systems has now been adapted to manual handling and using a conventional fluorescence microplate reader. As calculated for Trolox, the precision of the method was <3.0, expressed as percent coefficient of variation. The accuracy of the method was <2.3, expressed as percent variation of the mean. The detection and quantification limits were those corresponding to 0.5- and 1-microM Trolox standard solutions, respectively. The method has been applied to 10 pure compounds (benzoic and cinnamic acids and aldehydes, flavonoids, and butylated hydroxyanisole), to 30 white, rose, and bottled- and oak-aged red wines, and to 7 commercial dietary antioxidant supplements. All samples exhibited a good linear response with concentration. As seen by other methodologies, the chemical structure of a compound determines its antioxidant activity (ORAC-FL value). Of particular interest were the results with oak-aged red wines from different vintages (1989-2002) that confirm influence of vintage, but not origin of the oak, in the antioxidant activity of wines from the same variety. Dietary antioxidant supplements presented a great variability (170-fold difference) in their antioxidant potency. This work proves applicability of the ORAC-FL assay in evaluating the antioxidant activity of diverse food samples.

Three-Dimensional Characterization of Microstructure by Electron Back-Scatter Diffraction

DTIC Science & Technology

2007-03-28

Costa LDF, Cesar RM, Cesar J. 2000. Shape Analysis and Classification: Theory and Practice. Boca Raton, FL: CRC Press. 660 pp. 7. Williams RE. 1968...The distribution of grain boundaries in magnesia as a function of five macroscopic parameters. Acta Mater. 51:3663–74 27. Schaeben H, Apel M, Frank T

Spatial and functional characterization, identification and assessment of isolated wetlands in Alachua County, Florida, USA - GIS and remote sensing techniques

EPA Science Inventory

In this study, Geographic Information Systems (GIS) and remote sensing mapping techniques were developed to identify the locations of isolated wetlands in Alachua County, FL, a 2510 sq km area in north-central Florida with diverse geology and numerous isolated wetlands. The resul...

pH shift protein recovery with organic acids on texture and color of cooked gels.

PubMed

Paker, Ilgin; Beamer, Sarah; Jaczynski, Jacek; Matak, Kristen E

2015-01-01

Isoelectric solubilization and precipitation (ISP) processing uses pH shifts to separate protein from fish frames, which may increase commercial interest for silver carp. Texture and color properties of gels made from silver carp protein recovered at different pH strategies and organic acid types were compared. ISP was applied to headed gutted silver carp using 10 mol L(-1) sodium hydroxide (NaOH) and either glacial acetic acid (AA) or a (1:1) formic and lactic acid combination (F&L). Protein gels were made with recovered protein and standard functional additives. Texture profile analysis and the Kramer shear test showed that protein gels made from protein solubilized at basic pH values were firmer, harder, more cohesive, gummier and chewier (P < 0.05) than proteins solubilized under acidic conditions. Acidic solubilization led to whiter (P < 0.05) gels, and using F&L during ISP yielded whiter gels under all treatments (P < 0.05). Gels made from ISP-recovered silver carp protein using organic acids show potential for use as a functional ingredient in restructured foods. © 2014 Society of Chemical Industry.

GnRH Neuron-Specific Ablation of Gαq/11 Results in Only Partial Inactivation of the Neuroendocrine-Reproductive Axis in Both Male and Female Mice: In Vivo Evidence for Kiss1r-Coupled Gαq/11-Independent GnRH Secretion.

PubMed

Babwah, Andy V; Navarro, Víctor M; Ahow, Maryse; Pampillo, Macarena; Nash, Connor; Fayazi, Mehri; Calder, Michele; Elbert, Adrienne; Urbanski, Henryk F; Wettschureck, Nina; Offermanns, Stefan; Carroll, Rona S; Bhattacharya, Moshmi; Tobet, Stuart A; Kaiser, Ursula B

2015-09-16

The gonadotropin-releasing hormone (GnRH) is the master regulator of fertility and kisspeptin (KP) is a potent trigger of GnRH secretion from GnRH neurons. KP signals via KISS1R, a Gαq/11-coupled receptor, and mice bearing a global deletion of Kiss1r (Kiss1r(-/-)) or a GnRH neuron-specific deletion of Kiss1r (Kiss1r(d/d)) display hypogonadotropic hypogonadism and infertility. KISS1R also signals via β-arrestin, and in mice lacking β-arrestin-1 or -2, KP-triggered GnRH secretion is significantly diminished. Based on these findings, we hypothesized that ablation of Gαq/11 in GnRH neurons would diminish but not completely block KP-triggered GnRH secretion and that Gαq/11-independent GnRH secretion would be sufficient to maintain fertility. To test this, Gnaq (encodes Gαq) was selectively inactivated in the GnRH neurons of global Gna11 (encodes Gα11)-null mice by crossing Gnrh-Cre and Gnaq(fl/fl);Gna11(-/-) mice. Experimental Gnaq(fl/fl);Gna11(-/-);Gnrh-Cre (Gnaq(d/d)) and control Gnaq(fl/fl);Gna11(-/-) (Gnaq(fl/fl)) littermate mice were generated and subjected to reproductive profiling. This process revealed that testicular development and spermatogenesis, preputial separation, and anogenital distance in males and day of vaginal opening and of first estrus in females were significantly less affected in Gnaq(d/d) mice than in previously characterized Kiss1r(-/-) or Kiss1r(d/d) mice. Additionally, Gnaq(d/d) males were subfertile, and although Gnaq(d/d) females did not ovulate spontaneously, they responded efficiently to a single dose of gonadotropins. Finally, KP stimulation triggered a significant increase in gonadotropins and testosterone levels in Gnaq(d/d) mice. We therefore conclude that the milder reproductive phenotypes and maintained responsiveness to KP and gonadotropins reflect Gαq/11-independent GnRH secretion and activation of the neuroendocrine-reproductive axis in Gnaq(d/d) mice. The gonadotropin-releasing hormone (GnRH) is the master regulator of fertility. Over the last decade, several studies have established that the KISS1 receptor, KISS1R, is a potent trigger of GnRH secretion and inactivation of KISS1R on the GnRH neuron results in infertility. While KISS1R is best understood as a Gαq/11-coupled receptor, we previously demonstrated that it could couple to and signal via non-Gαq/11-coupled pathways. The present study confirms these findings and, more importantly, while it establishes Gαq/11-coupled signaling as a major conduit of GnRH secretion, it also uncovers a significant role for non-Gαq/11-coupled signaling in potentiating reproductive development and function. This study further suggests that by augmenting signaling via these pathways, GnRH secretion can be enhanced to treat some forms of infertility. Copyright © 2015 the authors 0270-6474/15/3512904-14$15.00/0.

Influence of Glyceride Structure and Fatty Acid Composition on Fat Nutrition.

DTIC Science & Technology

1981-02-25

11-eicosaenoic acid ), decreasing the chain length (9- hexadecenoic acid ), and changing the position of the double bond (6-octadecenofc acid ) reduced...AD-AU97 422 NORTH CAROLINA STATE l*JIV RALEIGH F/B 6/1 I NFLUENCE OF GLYCERIDE STRUCTURE AND FATTY ACID COMPOSITION O -TI UCAS FIEFB RI S B OE DAA62...78-G-0006 UNCLSSIIEDARO 14728.2-L NL 11111125 I’ *1. MIKIRO(A)PY R( S(LUTION fl->1 CHART LEVEL "Influence of Glyceride Structure and Fatty Acid

Genetic analysis of feet and leg conformation traits in Nelore cattle.

PubMed

Vargas, G; Neves, H H R; Cardoso, V; Munari, D P; Carvalheiro, R

2017-06-01

Feet and leg conformation scores are important traits in beef cattle because they encompass a wide range of locomotion disorders that can lead to productive and reproductive losses. Thus, the study of feet and legs in beef cattle is essential for evaluating possible responses to selection focusing on minimizing economic losses caused by the occurrence of feet and leg problems. The aim of this study was to estimate variance components for feet and leg conformation traits in Nelore cattle. The data set contained records of approximately 300,000 animals that were born between 2000 and 2013. These animals belonged to the commercial beef cattle breeding program of the CRV Lagoa (). Feet and legs were evaluated by assigning visual scores at 2 different time points: feet and leg evaluated as a binary trait (FL1), measured at yearling (about 550 d of age) to identify whether (or not) an animal has feet and leg defects, and feet and leg score (FL2), ranging from 1 (less desirable) to 5 (more desirable) was assigned to the top 20% of animals according to the selection index adopted by the beef cattle breeding program, which was measured 2 to 5 mo after the yearling evaluation. The FL1 and FL2 traits were analyzed together with yearling weight (YW). The (co)variance components and breeding values were estimated by Bayesian inference using 2-trait animal models. The posterior means (standard errors) of the heritabilities for FL1, FL2, and YW were 0.18 (0.04), 0.39 (0.07), and 0.47 (0.01), respectively. The results indicate that the incidence of feet and leg problems in this population might be reduced by selection. The genetic correlation between FL1 and FL2 (-0.47) was moderate and negative as expected because the classification score that holds up each trait has opposite numerical values. The genetic trends estimated for FL1 and FL2 (-0.042 and 0.021 genetic standard deviations per year, respectively) were favorable and they indicate that the independent culling strategy for feet and leg problems promotes favorable changes and contributes to the genetic progress of these traits in the population under study.

Producibility and Serviceability of Kevlar-49 Structures Made on Hot Layup Tools

DTIC Science & Technology

1975-05-01

changes for a typical airframe composite part and established improved machining practices for Kevlar-49. Some of the more signifi- cant conclusions...reverse side if necessary 8nd identify by block number) Composite Materials Inlet Fairing Helicopters Hot Layup Tools (HLT) Kevlar -49 20. ABSTRACT...CLASSlFlCATlON OF THIS PAGE(Whm Data Bnlorod) 0 Demonstrate the low cost aspects of using Hot Layup Tools (HLT) to fabricate composite structures. a

Proceedings of Damping Volume 1 of 3

DTIC Science & Technology

1993-06-01

paper. This work will present a passive piezoelectric damping implementation on ASTREX, a large space structure. The motivation behind this research is...Presented at Damping 󈨡 San Francisco, CA February 24-26, 1993 Motivation "• Accurate design of precision structures "* Computer modelling - Design...14) (KI f(0)/Fl,.) FRom equations (3) and (6), Young’s modulus of rubber specimen is written as; L Ea-K (15) A E - EJ(I+ PS4 ) (16) NONRESONANT TEST

Amphibian antimicrobial peptide fallaxin analogue FL9 affects virulence gene expression and DNA replication in Staphylococcus aureus.

PubMed

Gottschalk, Sanne; Gottlieb, Caroline T; Vestergaard, Martin; Hansen, Paul R; Gram, Lone; Ingmer, Hanne; Thomsen, Line E

2015-12-01

The rapid rise in antibiotic-resistant pathogens is causing increased health concerns, and consequently there is an urgent need for novel antimicrobial agents. Antimicrobial peptides (AMPs), which have been isolated from a wide range of organisms, represent a very promising class of novel antimicrobials. In the present study, the analogue FL9, based on the amphibian AMP fallaxin, was studied to elucidate its mode of action and antibacterial activity against the human pathogen Staphylococcus aureus. Our data showed that FL9 may have a dual mode of action against S. aureus. At concentrations around the MIC, FL9 bound DNA, inhibited DNA synthesis and induced the SOS DNA damage response, whereas at concentrations above the MIC the interaction between S. aureus and FL9 led to membrane disruption. The antibacterial activity of the peptide was maintained over a wide range of NaCl and MgCl(2) concentrations and at alkaline pH, while it was compromised by acidic pH and exposure to serum. Furthermore, at subinhibitory concentrations of FL9, S. aureus responded by increasing the expression of two major virulence factor genes, namely the regulatory rnaIII and hla, encoding α-haemolysin. In addition, the S. aureus-encoded natural tolerance mechanisms included peptide cleavage and the addition of positive charge to the cell surface, both of which minimized the antimicrobial activity of FL9. Our results add new information about FL9 and its effect on S. aureus, which may aid in the future development of analogues with improved therapeutic potential.

Front-Loaded Versus Weekly Counseling for Treatment of Tobacco Addiction

PubMed Central

Kalman, David; Hoskinson, Randall A.; Kinnunen, Taru; Wadler, Brianna M.; Thomson, Carey C.; Rosner, Bernard

2012-01-01

Introduction: Approximately 60%–70% of cigarette smokers who try to quit relapse by 2 weeks postcessation. We tested the efficacy of a front-loaded (FL) counseling intervention whose goal was to increase the likelihood of successful early abstinence and subsequent long-term abstinence. Methods: We randomized 278 adult smokers to an FL or weekly behavioral smoking cessation counseling schedule. The total number of sessions across treatment was the same for both groups. However, those assigned to the FL schedule received 6 counseling sessions in the first 2 weeks postcessation, while those in the weekly condition received 2 sessions. Participants in both groups also received standard nicotine patch treatment. Results: At 1 year postcessation, FL participants were significantly less likely to have relapsed when continuous abstinence was used as the definition of abstinence/relapse (11.7% abstinent vs. 6.3%, hazard ratio [HR] = 0.69, p = .007); and there were nonsignificant trends for FL subjects to have better outcomes when abstinence was defined as never smoking for 7 or more consecutive days nor for 7 or more consecutive episodes (18.4% abstinent vs. 14.8%, HR = 0.83, p = .20) and as point prevalence abstinence (15.6% abstinent vs. 12.9%, p = .11). The relationship between FL counseling treatment and continuous abstinence was partially mediated by higher postcessation levels of social support perceived from counseling and greater use of cessation-related coping strategies. Conclusions: We conclude that FL counseling is a promising treatment model that should be evaluated further, perhaps using modifications of the FL schedule used in this study. PMID:22058190

Impact of replacing Chinese ethnicity-specific fetal biometry charts with the INTERGROWTH-21(st) standard.

PubMed

Cheng, Yky; Leung, T Y; Lao, Tth; Chan, Y M; Sahota, D S

2016-09-01

To assess the impact of adopting the INTERGROWTH-21(st) biometry standards in a Chinese population. Retrospective cohort study. A teaching hospital in Hong Kong. A total of 10 527 Chinese women with a singleton pregnancy having a second- or third-trimester fetal anomaly or growth scan between January 2009 and June 2014. Z-scores were derived for fetal abdominal circumference (AC), head circumference (HC), and femur length (FL) using the INTERGROWTH-21(st) and Chinese biometry standards. Pregnancies with aneuploidy, structural or skeletal abnormalities, or that developed pre-eclampsia were excluded. Z-scores were stratified as <2.5th, <5th, <10th, >90th, >95th, or >97.5th percentile. Birthweight centile, adjusted for gestation and gender, was categorised as ≤3rd, 3rd to ≤5th, 5th to ≤10th, and >10th. Pairwise comparison and the McNemar test were performed to assess biometry Z-score differences and concordance between the INTERGROWTH-21(st) and Chinese standards. The sensitivity of both the local and INTERGROWTH-21(st) AC standards to identify pregnancies that were small-for-gestational-age (SGA) was assessed. INTERGROWTH-21(st) AC, HC, and FL Z-scores were significantly lower than those obtained using our local reference for AC, HC, and FL (P < 0.0001 for all). The proportion of fetuses with biometry in the <2.5th, <5th, <10th, >90th, >95th, or >97.5th percentiles was statistically significant (P < 0.01 for all). A total of 1224 (15.5%) of the scans at 18-22 weeks of gestation had AC, HC, or FL below the 3rd percentile of the INTERGROWTH-21(st) standard. Adopting the INTERGROWTH-21(st) standard would lead to a significant number of fetuses being at risk of misdiagnosis for small fetal size, particularly when using HC and FL measures. INTERGROWTH-21(st) biometry assessment in Chinese leads to fetuses being at risk of misdiagnosis of small fetal size. © 2016 Royal College of Obstetricians and Gynaecologists.

Leukemia/lymphoma‐related factor (LRF) exhibits stage‐ and context‐dependent transcriptional controls in the oligodendrocyte lineage and modulates remyelination

PubMed Central

Davidson, Nathan L.; Yu, Fengshan; Kijpaisalratana, Naruchorn; Le, Tuan Q.; Beer, Laurel A.; Radomski, Kryslaine L.

2017-01-01

ABSTRACT Leukemia/lymphoma‐related factor (LRF), a zinc‐finger transcription factor encoded by Zbtb7a, is a protooncogene that regulates differentiation in diverse cell lineages, and in the CNS, its function is relatively unexplored. This study is the first to examine the role of LRF in CNS pathology. We first examined LRF expression in a murine viral model of spinal cord demyelination with clinically relevant lesion characteristics. LRF was rarely expressed in oligodendrocyte progenitors (OP) yet, was detected in nuclei of the majority of oligodendrocytes in healthy adult CNS and during remyelination. Plp/CreER T :Zbtb7a fl/fl mice were then used with cuprizone demyelination to determine the effect of LRF knockdown on oligodendrocyte repopulation and remyelination. Cuprizone was given for 6 weeks to demyelinate the corpus callosum. Tamoxifen was administered at 4, 5, or 6 weeks after the start of cuprizone. Tamoxifen‐induced knockdown of LRF impaired remyelination during 3 or 6‐week recovery periods after cuprizone. LRF knockdown earlier within the oligodendrocyte lineage using NG2CreER T :Zbtb7a fl/fl mice reduced myelination after 6 weeks of cuprizone. LRF knockdown from either the Plp/CreER T line or the NG2CreER T line did not significantly change OP or oligodendrocyte populations. In vitro promoter assays demonstrated the potential for LRF to regulate transcription of myelin‐related genes and the notch target Hes5, which has been implicated in control of myelin formation and repair. In summary, in the oligodendrocyte lineage, LRF is expressed mainly in oligodendrocytes but is not required for oligodendrocyte repopulation of demyelinated lesions. Furthermore, LRF can modulate the extent of remyelination, potentially by contributing to interactions regulating transcription. PMID:28556945

Genetic Evidence Supports a Major Role for Akt1 in VSMCs During Atherogenesis

PubMed Central

Rotllan, Noemi; Wanschel, Amarylis C.; Fernandez-Hernando, Ana; Salerno, Alessandro G.; Offermanns, Stefan; Sessa, William C.; Fernández-Hernando, Carlos

2015-01-01

Rationale Coronary artery disease (CAD), the direct result of atherosclerosis, is the most common cause of death in Western societies. Vascular smooth muscle cell (VSMC) apoptosis occurs during the progression of atherosclerosis and in advanced lesions, promotes plaque necrosis, a common feature of high-risk/vulnerable atherosclerotic plaques. Akt1, a serine-threonine protein kinase, regulates several key endothelial cell (EC) and VSMC functions including cell growth, migration, survival and vascular tone. While global deficiency of Akt1 results in impaired angiogenesis and massive atherosclerosis, the specific contribution of VSMC Akt1 remains poorly characterized. Objective To investigate the contribution of VSMC Akt1 during atherogenesis and in established atherosclerotic plaques. Methods and Results We generated two mouse models in which Akt1 expression can be suppressed specifically in VSCMs before (Apoe−/−Akt1fl/flSm22αCRE) and after (Apoe−/−Akt1fl/flSM-MHC-CreERT2E) the formation of atherosclerotic plaques. This approach allows us to interrogate the role of Akt1 during the initial and late steps of atherogenesis. Absence of Akt1 in VSMCs during the progression of atherosclerosis results in larger atherosclerotic plaques characterized by bigger necrotic core areas, enhanced VSMC apoptosis and reduced fibrous cap and collagen content. In contrast, VSMC Akt1 inhibition in established atherosclerotic plaques does not influence lesion size but markedly reduces the relative fibrous cap area in plaques and increases VSMC apoptosis. Conclusions Akt1 expression in VSMCs influences early and late stages of atherosclerosis. Absence of Akt1 in VSMCs induces features of plaque vulnerability including fibrous cap thinning and extensive necrotic core areas. These observations suggest that interventions enhancing Akt1 expression specifically in VSMCs may lessen plaque progression. PMID:25868464

Dealing with time-varying recruitment and length in Hill-type muscle models.

PubMed

Hamouda, Ahmed; Kenney, Laurence; Howard, David

2016-10-03

Hill-type muscle models are often used in muscle simulation studies and also in the design and virtual prototyping of functional electrical stimulation systems. These models have to behave in a sufficiently realistic manner when recruitment level and contractile element (CE) length change continuously. For this reason, most previous models have used instantaneous CE length in the muscle׳s force vs. length (F-L) relationship, but thereby neglect the instability problem on the descending limb (i.e. region of negative slope) of the F-L relationship. Ideally CE length at initial recruitment should be used but this requires a multiple-motor-unit muscle model to properly account for different motor-units having different initial lengths when recruited. None of the multiple-motor-unit models reported in the literature have used initial CE length in the muscle׳s F-L relationship, thereby also neglecting the descending limb instability problem. To address the problem of muscle modelling for continuously varying recruitment and length, and hence different values of initial CE length for different motor-units, a new multiple-motor-unit muscle model is presented which considers the muscle to comprise 1000 individual Hill-type virtual motor-units, which determine the total isometric force. Other parts of the model (F-V relationship and passive elements) are not dependent on the initial CE length and, therefore, they are implemented for the muscle as a whole rather than for the individual motor-units. The results demonstrate the potential errors introduced by using a single-motor-unit model and also the instantaneous CE length in the F-L relationship, both of which are common in FES control studies. Copyright © 2016 Elsevier Ltd. All rights reserved.

75 FR 34524 - Decision That Certain Nonconforming Motor Vehicles Are Eligible for Importation

Federal Register 2010, 2011, 2012, 2013, 2014

2010-06-17

... Harley Davidson FX, FL, XL and VR Series Motorcycles. Substantially Similar U.S. Certified Vehicles: 2009 Harley Davidson FX, FL, XL and VR Series Motorcycles. Notice of Petition Published at: 74 FR 51943... and VR Series Motorcycles. Substantially Similar U.S. Certified Vehicles: 2008 Harley Davidson FX, FL...

77 FR 50065 - Safety Zone; Jacksonville Sea and Sky Spectacular, Atlantic Ocean; Jacksonville Beach, FL

Federal Register 2010, 2011, 2012, 2013, 2014

2012-08-20

... 1625-AA00 Safety Zone; Jacksonville Sea and Sky Spectacular, Atlantic Ocean; Jacksonville Beach, FL... during the Jacksonville Sea and Sky Spectacular air show. The event is scheduled to take place from....T07-0660 Safety Zone; Jacksonville Sea and Sky Spectacular, Atlantic Ocean, Jacksonville Beach, FL. (a...

76 FR 30298 - Proposed Amendment of Class E Airspace; Cocoa, FL

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-25

...-0070; Airspace Docket No. 10-ASO-43] Proposed Amendment of Class E Airspace; Cocoa, FL AGENCY: Federal... proposes to amend Class E Airspace at Cocoa, FL, as the Merritt Island Non-Directional Beacon (NDB) has... surface to support new standard instrument approach procedures developed at Merritt Island Airport, Cocoa...

78 FR 25227 - Proposed Amendment of Class E Airspace; Live Oak, FL

Federal Register 2010, 2011, 2012, 2013, 2014

2013-04-30

... action proposes to amend Class E Airspace in the Live Oak, FL area, as new Standard Instrument Approach...-0001; Airspace Docket No. 12-ASO-45] Proposed Amendment of Class E Airspace; Live Oak, FL AGENCY... continued safety and management of instrument flight rules (IFR) operations for SIAPs within the Live Oak...

33 CFR 100.728 - Special Local Regulations; Hurricane Offshore Classic, St. Petersburg, FL.

Code of Federal Regulations, 2013 CFR

2013-07-01

...; Hurricane Offshore Classic, St. Petersburg, FL. 100.728 Section 100.728 Navigation and Navigable Waters... WATERS § 100.728 Special Local Regulations; Hurricane Offshore Classic, St. Petersburg, FL. (a) Regulated..., from 10 a.m. to 6 p.m. EDT. (3) All vessel traffic, not involved in the Hurricane Offshore Classic...

78 FR 25383 - Amendment of Class E Airspace; West Palm Beach, FL

Federal Register 2010, 2011, 2012, 2013, 2014

2013-05-01

...-0922; Airspace Docket No. 12-ASO-38] Amendment of Class E Airspace; West Palm Beach, FL AGENCY: Federal... West Palm Beach, FL area, as new Standard Instrument Approach Procedures (SIAPs) have been developed at Palm Beach County Park Airport. Airspace reconfiguration is necessary for the continued safety and...

33 CFR 100.718 - Annual Suncoast Kilo Run; Sarasota Bay, Sarasota, FL.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Annual Suncoast Kilo Run; Sarasota Bay, Sarasota, FL. 100.718 Section 100.718 Navigation and Navigable Waters COAST GUARD, DEPARTMENT... Suncoast Kilo Run; Sarasota Bay, Sarasota, FL. (a) Regulated area. The regulated area is established in...

First report of tomato spotted wilt virus causing potato tuber necrosis in Texas

USDA-ARS?s Scientific Manuscript database

In the summer of 2008, potato tubers (cv FL1867, FL2053, and FL1922) from commercial fields near Dalhart, Texas were observed with distinct external erumpent rings and severe internal discolorations including blotches, spots, and dry, cork-like tissue. The presence of rings suggested the possible i...

33 CFR 100.728 - Special Local Regulations; Hurricane Offshore Classic, St. Petersburg, FL.

Code of Federal Regulations, 2011 CFR

2011-07-01

...; Hurricane Offshore Classic, St. Petersburg, FL. 100.728 Section 100.728 Navigation and Navigable Waters... WATERS § 100.728 Special Local Regulations; Hurricane Offshore Classic, St. Petersburg, FL. (a) Regulated..., from 10 a.m. to 6 p.m. EDT. (3) All vessel traffic, not involved in the Hurricane Offshore Classic...

33 CFR 100.728 - Special Local Regulations; Hurricane Offshore Classic, St. Petersburg, FL.

Code of Federal Regulations, 2012 CFR

2012-07-01

...; Hurricane Offshore Classic, St. Petersburg, FL. 100.728 Section 100.728 Navigation and Navigable Waters... WATERS § 100.728 Special Local Regulations; Hurricane Offshore Classic, St. Petersburg, FL. (a) Regulated..., from 10 a.m. to 6 p.m. EDT. (3) All vessel traffic, not involved in the Hurricane Offshore Classic...

33 CFR 100.728 - Special Local Regulations; Hurricane Offshore Classic, St. Petersburg, FL.

Code of Federal Regulations, 2014 CFR

2014-07-01

...; Hurricane Offshore Classic, St. Petersburg, FL. 100.728 Section 100.728 Navigation and Navigable Waters... WATERS § 100.728 Special Local Regulations; Hurricane Offshore Classic, St. Petersburg, FL. (a) Regulated..., from 10 a.m. to 6 p.m. EDT. (3) All vessel traffic, not involved in the Hurricane Offshore Classic...

76 FR 35966 - Amendment of Class E Airspace; Cocoa, FL

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-21

...-0070; Airspace Docket No. 10-ASO-43] Amendment of Class E Airspace; Cocoa, FL AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Final rule. SUMMARY: This action amends Class E Airspace at Cocoa, FL, as the... published in the Federal Register a notice of proposed rulemaking to amend Class E airspace at Merritt...

75 FR 13670 - Establishment of Class D and E Airspace; Panama City, FL

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-23

..., Atlanta, Georgia 30320; telephone (404) 305-5610. SUPPLEMENTARY INFORMATION: History On February 1, 2010... Surface of the Earth. * * * * * ASO FL E5 Panama City, FL [NEW] Northwest Florida-Panama City... 700 feet above the surface of the Earth within a 7.2-mile radius of the Northwest Florida- Panama City...

Tailoring the charge carrier in few layers MoS2 field-effect transistors by Au metal adsorbate

NASA Astrophysics Data System (ADS)

Singh, Arun Kumar; Pandey, Rajiv K.; Prakash, Rajiv; Eom, Jonghwa

2018-04-01

It is an essential to tune the charge carrier concentrations in semiconductor in order to approach high-performance of the electronic and optoelectronic devices. Here, we report the effect of thin layer of gold (Au) metal on few layer (FL) molybdenum disulfide (MoS2) by atomic force microscopy (AFM), Raman spectroscopy and electrical charge transport measurements. The Raman spectra and charge transport measurements show that Au thin layer affect the electronic properties of the FL MoS2. After deposition of Au thin layer, the threshold voltages of FL MoS2 field-effect transistors (FETs) shift towards positive gate voltages, this reveal the p-doping in FL MoS2 nanosheets. The shift of peak frequencies of the Raman bands are also analyzed after the deposition of Au metal films of different thickness on FL MoS2 nanosheets. The surface morphology of Au metal on FL MoS2 is characterized by AFM and shows the smoother and denser film in comparison to Au metal on SiO2.

Characteristics of Multi-Organ Lymphangiectasia Resulting from Temporal Deletion of Calcitonin Receptor-Like Receptor in Adult Mice

PubMed Central

Hoopes, Samantha L.; Willcockson, Helen H.; Caron, Kathleen M.

2012-01-01

Adrenomedullin (AM) and its receptor complexes, calcitonin receptor-like receptor (Calcrl) and receptor activity modifying protein 2/3, are highly expressed in lymphatic endothelial cells and are required for embryonic lymphatic development. To determine the role of Calcrl in adulthood, we used an inducible Cre-loxP system to temporally and ubiquitously delete Calcrl in adult mice. Following tamoxifen injection, Calcrlfl/fl/CAGGCre-ER™ mice rapidly developed corneal edema and inflammation that was preceded by and persistently associated with dilated corneoscleral lymphatics. Lacteals and submucosal lymphatic capillaries of the intestine were also dilated, while mesenteric collecting lymphatics failed to properly transport chyle after an acute Western Diet, culminating in chronic failure of Calcrlfl/fl/CAGGCre-ER™ mice to gain weight. Dermal lymphatic capillaries were also dilated and chronic edema challenge confirmed significant and prolonged dermal lymphatic insufficiency. In vivo and in vitro imaging of lymphatics with either genetic or pharmacologic inhibition of AM signaling revealed markedly disorganized lymphatic junctional proteins ZO-1 and VE-cadherin. The maintenance of AM signaling during adulthood is required for preserving normal lymphatic permeability and function. Collectively, these studies reveal a spectrum of lymphatic defects in adult Calcrlfl/fl/CAGGCre-ER™ mice that closely recapitulate the clinical symptoms of patients with corneal, intestinal and peripheral lymphangiectasia. PMID:23028890

A prototype hand-held tri-modal instrument for in vivo ultrasound, photoacoustic, and fluorescence imaging

NASA Astrophysics Data System (ADS)

Kang, Jeeun; Chang, Jin Ho; Wilson, Brian C.; Veilleux, Israel; Bai, Yanhui; DaCosta, Ralph; Kim, Kang; Ha, Seunghan; Lee, Jong Gun; Kim, Jeong Seok; Lee, Sang-Goo; Kim, Sun Mi; Lee, Hak Jong; Ahn, Young Bok; Han, Seunghee; Yoo, Yangmo; Song, Tai-Kyong

2015-03-01

Multi-modality imaging is beneficial for both preclinical and clinical applications as it enables complementary information from each modality to be obtained in a single procedure. In this paper, we report the design, fabrication, and testing of a novel tri-modal in vivo imaging system to exploit molecular/functional information from fluorescence (FL) and photoacoustic (PA) imaging as well as anatomical information from ultrasound (US) imaging. The same ultrasound transducer was used for both US and PA imaging, bringing the pulsed laser light into a compact probe by fiberoptic bundles. The FL subsystem is independent of the acoustic components but the front end that delivers and collects the light is physically integrated into the same probe. The tri-modal imaging system was implemented to provide each modality image in real time as well as co-registration of the images. The performance of the system was evaluated through phantom and in vivo animal experiments. The results demonstrate that combining the modalities does not significantly compromise the performance of each of the separate US, PA, and FL imaging techniques, while enabling multi-modality registration. The potential applications of this novel approach to multi-modality imaging range from preclinical research to clinical diagnosis, especially in detection/localization and surgical guidance of accessible solid tumors.

The caffeine contents of non-alcoholic beverages.

PubMed

Galasko, G T; Furman, K I; Alberts, E

1989-01-01

The caffeine content of a number of non-alcoholic beverages was determined using HPLC. It was found that Diet Coke had a greater caffeine content than Coke (4.15 compared with 3.13 mg/fl oz), Tab is virtually caffeine free, and Lucozade, sold as a tonic, contains more caffeine than any of the other carbonated beverages tested (5.17 mg/fl oz). The pure instant coffee tested contained much more caffeine than the coffee/chicory mixtures (12.61 compared with 3.18 mg/fl oz). The caffeine content of Ceylon tea blends increases with the time the tea is allowed to draw (from about 8 mg/fl oz after 1 min to about 12 mg/fl oz after 20 min). Tea that has been allowed to draw for 20 min has a caffeine content similar to that of pure coffee.

Mechanical properties and tribological behavior of fullerene-like hydrogenated carbon films prepared by changing the flow rates of argon gas

NASA Astrophysics Data System (ADS)

Guo, Junmeng; Wang, Yongfu; Liang, Hongyu; Liang, Aimin; Zhang, Junyan

2016-02-01

Fullerene-like hydrogenated carbon (FL-C:H) films as carbon materials were prepared by direct current plasma enhanced chemical vapor deposition (dc-PECVD) technique. The content of FL nanostructure was confirmed by high-resolution transmission electron microscopy (HRTEM), visible Raman spectroscopy, and X-ray photoelectron spectroscopy (XPS). The effect of fullerene-like nanostructure on the friction behavior of the films was studied using a reciprocating ball-on-flat tribometer in humid environment. It is concluded that the curved FL nanostructure provide the film excellent mechanical properties and friction performance. Interestingly, combining with the results of Raman analyses of the wear debris, we find that new FL nanostructure form during the friction process. These new FL nanostructure may originate from the rapid annealing and stress relaxation of unstable carbon clusters.

Anti-quorum sensing activity of Psidium guajava L. flavonoids against Chromobacterium violaceum and Pseudomonas aeruginosa PAO1.

PubMed

Vasavi, Halkare Suryanarayana; Arun, Ananthapadmanabha Bhagwath; Rekha, Punchapady-Devasya

2014-05-01

Psidium guajava L., which has been used traditionally as a medicinal plant, was explored for anti-quorum sensing (QS) activity. The anti-QS activity of the flavonoid (FL) fraction of P. guajava leaves was determined using a biosensor bioassay with Chromobacterium violaceum CV026. Detailed investigation of the effects of the FL-fraction on QS-regulated violacein production in C. violaceum ATCC12472 and pyocyanin production, proteolytic, elastolytic activities, swarming motility and biofilm formation in Pseudomonas aeruginosa PAO1 was performed using standard methods. Possible mechanisms of QS-inhibition were studied by assessing violacein production in response to N-acyl homoserine lactone (AHL) synthesis in the presence of the FL-fraction in C. violaceum ATCC31532 and by evaluating the induction of violacein in the mutant C. violaceum CV026 by AHL extracted from the culture supernatants of C. violaceum 31532. Active compounds in the FL-fraction were identified by liquid chromatography-mass spectrometry (LC-MS). Inhibition of violacein production by the FL-fraction in a C. violaceum CV026 biosensor bioassay indicated possible anti-QS activity. The FL-fraction showed concentration-dependent decreases in violacein production in C. violaceum 12472 and inhibited pyocyanin production, proteolytic and elastolytic activities, swarming motility and biofilm formation in P. aeruginosa PAO1. Interestingly, the FL-fraction did not inhibit AHL synthesis; AHL extracted from cultures of C. violaceum 31532 grown in the presence of the FL-fraction induced violacein in the mutant C. violaceum CV026. LC-MS analysis revealed the presence of quercetin and quercetin-3-O-arabinoside in the FL-fraction. Both quercetin and quercetin-3-O-arabinoside inhibited violacein production in C. violaceum 12472, at 50 and 100 μg/mL, respectively. Results of this study provide scope for further research to exploit these active molecules as anti-QS agents. © 2014 The Societies and Wiley Publishing Asia Pty Ltd.

Demographic Structure, Sex Ratio and Growth Rates of Southern Bluefin Tuna (Thunnus maccoyii) on the Spawning Ground

PubMed Central

Farley, Jessica H.; Eveson, J. Paige; Davis, Tim L. O.; Andamari, Retno; Proctor, Craig H.; Nugraha, Budi; Davies, Campbell R.

2014-01-01

The demographics of the southern bluefin tuna (SBT) Thunnus maccoyii spawning stock were examined through a large-scale monitoring program of the Indonesian longline catch on the spawning ground between 1995 and 2012. The size and age structure of the spawning population has undergone significant changes since monitoring began. There has been a reduction in the relative abundance of larger/older SBT in the catch since the early 2000s, and a corresponding decrease in mean length and age, but there was no evidence of a significant truncation of the age distribution. Pulses of young SBT appear in the catches in the early- and mid-2000s and may be the first evidence of increased recruitment into the spawning stock since 1995. Fish in these two recruitment pulses were spawned around 1991 and 1997. Size-related variations in sex ratio were also observed with female bias for fish less than 170 cm FL and male bias for fish greater than 170 cm FL. This trend of increasing proportion of males with size above 170 cm FL is likely to be related to sexual dimorphism in growth rates as male length-at-age is greater than that for females after age 10 years. Mean length-at-age of fish aged 8–10 years was greater for both males and females on the spawning ground than off the spawning ground, suggesting that size may be the dominant factor determining timing of maturation in SBT. In addition to these direct results, the data and samples from this program have been central to the assessment and management of this internationally harvested stock. PMID:24797529

New insights into the antioxidant activity of hydroxycinnamic and hydroxybenzoic systems: spectroscopic, electrochemistry, and cellular studies.

PubMed

Mura, F; Silva, T; Castro, C; Borges, F; Zuñiga, M C; Morales, J; Olea-Azar, C

2014-12-01

A series hydroxycinnamic and gallic acids and their derivatives were studied with the aim of evaluating their in vitro antioxidant properties both in homogeneous and in cellular systems. It was concluded from the oxygen radical absorbance capacity-fluorescein (ORAC-FL), 1,1-diphenyl-2-picrylhydrazyl (DPPH), and cyclic voltammetry data that some compounds exhibit remarkable antioxidant properties. In general, in homogeneous media (DPPH assay), galloyl-based cinnamic and benzoic systems (compounds 7-11) were the most active, exhibiting the lowest oxidation potentials in both dimethyl sulfoxide (DMSO) and phosphate buffer. Yet, p-coumaric acid and its derivatives (compounds 1-3) disclosed the highest scavenging activity toward peroxyl radicals (ORAC-FL assay). Interesting structure-property- activity relationships between ORAC-FL, or DPPH radical, and redox potentials have been attained, showing that the latter parameter can be a valuable antioxidant measure. It was evidenced that redox potentials are related to the structural features of cinnamic and benzoic systems and that their activities are also dependent on the radical generated in the assay. Electron spin resonance data of the phenoxyl radicals generated both in DMSO and phosphate buffer support the assumption that radical stability is related to the type of phenolic system. Galloyl-based cinnamic and benzoic ester-type systems (compounds 9 and 11) were the most active and effective compounds in cell-based assays (51.13 ± 1.27% and 54.90 ± 3.65%, respectively). In cellular systems, hydroxycinnamic and hydroxybenzoic systems operate based on their intrinsic antioxidant outline and lipophilic properties, so the balance between these two properties is considered of the utmost importance to ensure their performance in the prevention or minimization of the effects due to free radical overproduction.

Soluble guanylyl cyclase-activated cyclic GMP-dependent protein kinase inhibits arterial smooth muscle cell migration independent of VASP-serine 239 phosphorylation.

PubMed

Holt, Andrew W; Martin, Danielle N; Shaver, Patti R; Adderley, Shaquria P; Stone, Joshua D; Joshi, Chintamani N; Francisco, Jake T; Lust, Robert M; Weidner, Douglas A; Shewchuk, Brian M; Tulis, David A

2016-09-01

Coronary artery disease (CAD) accounts for over half of all cardiovascular disease-related deaths. Uncontrolled arterial smooth muscle (ASM) cell migration is a major component of CAD pathogenesis and efforts aimed at attenuating its progression are clinically essential. Cyclic nucleotide signaling has long been studied for its growth-mitigating properties in the setting of CAD and other vascular disorders. Heme-containing soluble guanylyl cyclase (sGC) synthesizes cyclic guanosine monophosphate (cGMP) and maintains vascular homeostasis predominantly through cGMP-dependent protein kinase (PKG) signaling. Considering that reactive oxygen species (ROS) can interfere with appropriate sGC signaling by oxidizing the cyclase heme moiety and so are associated with several CVD pathologies, the current study was designed to test the hypothesis that heme-independent sGC activation by BAY 60-2770 (BAY60) maintains cGMP levels despite heme oxidation and inhibits ASM cell migration through phosphorylation of the PKG target and actin-binding vasodilator-stimulated phosphoprotein (VASP). First, using the heme oxidant ODQ, cGMP content was potentiated in the presence of BAY60. Using a rat model of arterial growth, BAY60 significantly reduced neointima formation and luminal narrowing compared to vehicle (VEH)-treated controls. In rat ASM cells BAY60 significantly attenuated cell migration, reduced G:F actin, and increased PKG activity and VASP Ser239 phosphorylation (pVASP·S239) compared to VEH controls. Site-directed mutagenesis was then used to generate overexpressing full-length wild type VASP (FL-VASP/WT), VASP Ser239 phosphorylation-mimetic (FL-VASP/239D) and VASP Ser239 phosphorylation-resistant (FL-VASP/239A) ASM cell mutants. Surprisingly, FL-VASP/239D negated the inhibitory effects of FL-VASP/WT and FL-VASP/239A cells on migration. Furthermore, when FL-VASP mutants were treated with BAY60, only the FL-VASP/239D group showed reduced migration compared to its VEH controls. Intriguingly, FL-VASP/239D abrogated the stimulatory effects of FL-VASP/WT and FL-VASP/239A cells on PKG activity. In turn, pharmacologic blockade of PKG in the presence of BAY60 reversed the inhibitory effect of BAY60 on naïve ASM cell migration. Taken together, we demonstrate for the first time that BAY60 inhibits ASM cell migration through cGMP/PKG/VASP signaling yet through mechanisms independent of pVASP·S239 and that FL-VASP overexpression regulates PKG activity in rat ASM cells. These findings implicate BAY60 as a potential pharmacotherapeutic agent against aberrant ASM growth disorders such as CAD and also establish a unique mechanism through which VASP controls PKG activity. Copyright © 2016 Elsevier Inc. All rights reserved.

Interferon regulatory factor 5-dependent immune responses in the draining lymph node protect against West Nile virus infection.

PubMed

Thackray, Larissa B; Shrestha, Bimmi; Richner, Justin M; Miner, Jonathan J; Pinto, Amelia K; Lazear, Helen M; Gale, Michael; Diamond, Michael S

2014-10-01

Upon activation of Toll-like and RIG-I-like receptor signaling pathways, the transcription factor IRF5 translocates to the nucleus and induces antiviral immune programs. The recent discovery of a homozygous mutation in the immunoregulatory gene guanine exchange factor dedicator of cytokinesis 2 (Dock2mu/mu) in several Irf5-/- mouse colonies has complicated interpretation of immune functions previously ascribed to IRF5. To define the antiviral functions of IRF5 in vivo, we infected backcrossed Irf5-/-×Dock2wt/wt mice (here called Irf5-/- mice) and independently generated CMV-Cre Irf5fl/fl mice with West Nile virus (WNV), a pathogenic neurotropic flavivirus. Compared to congenic wild-type animals, Irf5-/- and CMV-Cre Irf5fl/fl mice were more vulnerable to WNV infection, and this phenotype was associated with increased infection in peripheral organs, which resulted in higher virus titers in the central nervous system. The loss of IRF5, however, was associated with only small differences in the type I interferon response systemically and in the draining lymph node during WNV infection. Instead, lower levels of several other proinflammatory cytokines and chemokines, as well as fewer and less activated immune cells, were detected in the draining lymph node 2 days after WNV infection. WNV-specific antibody responses in Irf5-/- mice also were blunted in the context of live or inactivated virus infection and this was associated with fewer antigen-specific memory B cells and long-lived plasma cells. Our results with Irf5-/- mice establish a key role for IRF5 in shaping the early innate immune response in the draining lymph node, which impacts the spread of virus infection, optimal B cell immunity, and disease pathogenesis. Although the roles of IRF3 and IRF7 in orchestrating innate and adaptive immunity after viral infection are established, the function of the related transcription factor IRF5 remains less certain. Prior studies in Irf5-/- mice reported conflicting results as to the contribution of IRF5 in regulating type I interferon and adaptive immune responses. The lack of clarity may stem from a recently discovered homozygous loss-of-function mutation of the immunoregulatory gene Dock2 in several colonies of Irf5-/- mice. Here, using a mouse model with a deficiency in IRF5 and wild-type Dock2 alleles, we investigated how IRF5 modulates West Nile virus (WNV) pathogenesis and host immune responses. Our in vivo studies indicate that IRF5 has a key role in shaping the early proinflammatory cytokine response in the draining lymph node, which impacts immunity and control of WNV infection. Copyright © 2014, American Society for Microbiology. All Rights Reserved.