Sample records for study polymerase chain

  1. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

  2. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

    PubMed

    Garg, Pankaj

    2017-07-01

    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  3. Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia.

    PubMed

    Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

    2015-01-01

    Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.

  4. A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.

    PubMed

    Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat

    2016-12-01

    To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.

  5. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  6. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  7. Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

    PubMed

    Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

    2018-06-01

    Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

  8. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  9. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  10. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  11. Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

    USDA-ARS?s Scientific Manuscript database

    This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

  12. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  13. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  14. Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

    PubMed Central

    Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

    2015-01-01

    Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

  15. Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

    PubMed

    Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

    2012-12-01

    Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  16. DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

    EPA Science Inventory

    This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

  17. Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

    PubMed

    Adewale, B; Mafe, M A; Oyerinde, J P O

    2005-01-01

    Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

  18. Modified pseudomonas oleovorans phaC1 nucleic acids encoding bispecific polyhydroxyalkanoate polymerase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Srienc, Friedrich; Jackson, John K.; Somers, David A.

    A genetically engineered Pseudomonas oleovorans phaC1 polyhydroxyalkanoate (PHA) polymerase having tailored substrate specificity is provided. The modified PHA polymerase is preferably a "bispecific" PHA polymerase capable of copolymerizing a short chain length monomer and a medium chain length monomer is provided. Methods for making the modified PHA polymerase and for making nucleic acids encoding the modified PHA polymerase are also disclosed, as are methods of producing PHA using the modified PHA polymerase. The invention further includes methods to assay for altered substrate specificity.

  19. Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

    PubMed

    Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

    2016-08-01

    On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.

  20. Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

    PubMed

    Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

    1997-09-01

    In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

  1. Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

    PubMed

    Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

    2014-01-01

    Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  2. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  3. Inhibition of herpes simplex virus DNA polymerase by purine ribonucleoside monophosphates.

    PubMed

    Frank, K B; Cheng, Y C

    1986-02-05

    Purine ribonucleoside monophosphates were found to inhibit chain elongation catalyzed by herpes simplex virus (HSV) DNA polymerase when DNA template-primer concentrations were rate-limiting. Inhibition was fully competitive with DNA template-primer during chain elongation; however, DNA polymerase-associated exonuclease activity was inhibited noncompetitively with respect to DNA. Combinations of 5'-GMP and phosphonoformate were kinetically mutually exclusive in dual inhibitor studies. Pyrimidine nucleoside monophosphates and deoxynucleoside monophosphates were less inhibitory than purine riboside monophosphates. The monophosphates of 9-beta-D-arabinofuranosyladenine, Virazole (1-beta-D-ribofuranosyl-1,2,4-triazole-3-carboxamide), 9-(2-hydroxyethoxymethyl)guanine, and 9-(1,3-dihydroxy-2-propoxymethyl)guanine exerted little or no inhibition. In contrast to HSV DNA polymerase, human DNA polymerase alpha was not inhibited by purine ribonucleoside monophosphates. These studies suggest the possibility of a physiological role of purine ribonucleoside monophosphates as regulators of herpesvirus DNA synthesis and a new approach to developing selective anti-herpesvirus compounds.

  4. [The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

    PubMed

    Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

    2014-04-01

    The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

  5. Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

    PubMed

    Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

    2014-03-01

    The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

  6. Preemptive Isolation Precautions of Patients at High Risk for Methicillin-Resistant Staphylococcus aureus in Combination With Ultrarapid Polymerase Chain Reaction Screening as an Effective Tool for Infection Control.

    PubMed

    Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael

    2016-12-01

    This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.

  7. Blood grouping based on PCR methods and agarose gel electrophoresis.

    PubMed

    Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

    2015-01-01

    The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

  8. Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

    USDA-ARS?s Scientific Manuscript database

    The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

  9. Primer-independent RNA sequencing with bacteriophage phi6 RNA polymerase and chain terminators.

    PubMed

    Makeyev, E V; Bamford, D H

    2001-05-01

    Here we propose a new general method for directly determining RNA sequence based on the use of the RNA-dependent RNA polymerase from bacteriophage phi6 and the chain terminators (RdRP sequencing). The following properties of the polymerase render it appropriate for this application: (1) the phi6 polymerase can replicate a number of single-stranded RNA templates in vitro. (2) In contrast to the primer-dependent DNA polymerases utilized in the sequencing procedure by Sanger et al. (Proc Natl Acad Sci USA, 1977, 74:5463-5467), it initiates nascent strand synthesis without a primer, starting the polymerization on the very 3'-terminus of the template. (3) The polymerase can incorporate chain-terminating nucleotide analogs into the nascent RNA chain to produce a set of base-specific termination products. Consequently, 3' proximal or even complete sequence of many target RNA molecules can be rapidly deduced without prior sequence information. The new technique proved useful for sequencing several synthetic ssRNA templates. Furthermore, using genomic segments of the bluetongue virus we show that RdRP sequencing can also be applied to naturally occurring dsRNA templates. This suggests possible uses of the method in the RNA virus research and diagnostics.

  10. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  11. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less

  12. A novel mechanism of sugar selection utilized by a human X-family DNA polymerase.

    PubMed

    Brown, Jessica A; Fiala, Kevin A; Fowler, Jason D; Sherrer, Shanen M; Newmister, Sean A; Duym, Wade W; Suo, Zucai

    2010-01-15

    During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2'-hydroxyl group and the bulky side chain of an active-site residue. In this study, we demonstrated that human DNA polymerase lambda used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2'-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2'-position. Copyright 2009 Elsevier Ltd. All rights reserved.

  13. The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

    PubMed

    Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

    2006-07-01

    We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

  14. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  15. DNA Polymerase III Star Requires ATP to Start Synthesis on a Primed DNA†

    PubMed Central

    Wickner, William; Kornberg, Arthur

    1973-01-01

    DNA polymerase III star replicates a ϕX174 single-stranded, circular DNA primed with a fragment of RNA. This reaction proceeds in two stages. In stage I, a complex is formed requiring DNA polymerase III star, ATP, spermidine, copolymerase III*, and RNA-primed ϕX174 single-stranded, circular DNA. The complex, isolated by gel filtration, contains ADP and inorganic phosphate (the products of a specific ATP cleavage) as well as spermidine, polymerase III star, and copolymerase III star. In stage II, the chain grows upon addition of deoxynucleoside triphosphates; ADP and inorganic phosphate are discharged and chain elongation is resistant to antibody to copolymerase III star. Thus ATP and copolymerase III star are required to initiate chain growth but not to sustain it. Images PMID:4519657

  16. Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

    PubMed

    Chen, Y T; Mercer, G O; Chen, Y

    1993-11-01

    Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

  17. Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

    PubMed

    Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

    2002-07-01

    Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

  18. [Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

    PubMed

    Wang, F; Zhang, Y Q; Ding, J; Yu, L X

    2017-10-18

    To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

  19. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    USDA-ARS?s Scientific Manuscript database

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  20. Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

    PubMed

    Igarashi, T; Yamamoto, A; Goto, N

    1996-10-01

    Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

  1. Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

    PubMed

    Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

    2017-01-01

    Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

  2. Cerebrospinal fluid PCR analysis and biochemistry in bodies with severe decomposition.

    PubMed

    Palmiere, Cristian; Vanhaebost, Jessica; Ventura, Francesco; Bonsignore, Alessandro; Bonetti, Luca Reggiani

    2015-02-01

    The aim of this study was to assess whether Neisseria meningitidis, Listeria monocytogenes, Streptococcus pneumoniae and Haemophilus influenzae can be identified using the polymerase chain reaction technique in the cerebrospinal fluid of severely decomposed bodies with known, noninfectious causes of death or whether postmortem changes can lead to false positive results and thus erroneous diagnostic information. Biochemical investigations, postmortem bacteriology and real-time polymerase chain reaction analysis in cerebrospinal fluid were performed in a series of medico-legal autopsies that included noninfectious causes of death with decomposition, bacterial meningitis without decomposition, bacterial meningitis with decomposition, low respiratory tract infections with decomposition and abdominal infections with decomposition. In noninfectious causes of death with decomposition, postmortem investigations failed to reveal results consistent with generalized inflammation or bacterial infections at the time of death. Real-time polymerase chain reaction analysis in cerebrospinal fluid did not identify the studied bacteria in any of these cases. The results of this study highlight the usefulness of molecular approaches in bacteriology as well as the use of alternative biological samples in postmortem biochemistry in order to obtain suitable information even in corpses with severe decompositional changes. Copyright © 2014 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  3. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  4. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  5. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    USDA-ARS?s Scientific Manuscript database

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  6. Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

    PubMed

    Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

    2005-03-01

    We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

  7. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  8. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  9. Evaluation of immunomagnetic separation for the detection of Salmonella in surface waters by polymerase chain reaction.

    PubMed

    Hsu, Chao-Yu; Hsu, Bing-Mu; Chang, Tien-Yu; Hsu, Tsui-Kang; Shen, Shu-Min; Chiu, Yi-Chou; Wang, Hung-Jen; Ji, Wen-Tsai; Fan, Cheng-Wei; Chen, Jyh-Larng

    2014-09-19

    Salmonella spp. is associated with fecal pollution and capable of surviving for long periods in aquatic environments. Instead of the traditional, time-consuming biochemical detection, polymerase chain reaction (PCR) allows rapid identification of Salmonella directly concentrated from water samples. However, prevalence of Salmonella may be underestimated because of the vulnerability of PCR to various environmental chemicals like humic acid, compounded by the fact that various DNA polymerases have different susceptibility to humic acid. Because immunomagnetic separation (IMS) theoretically could isolate Salmonella from other microbes and facilitate removal of aquatic PCR inhibitors of different sizes, this study aims to compare the efficiency of conventional PCR combined with immunomagnetic separation (IMS) for Salmonella detection within a moderately polluted watershed. In our study, the positive rate was increased from 17.6% to 47% with nearly ten-fold improvement in the detection limit. These results suggest the sensitivity of Salmonella detection could be enhanced by IMS, particularly in low quality surface waters. Due to its effects on clearance of aquatic pollutants, IMS may be suitable for most DNA polymerases for Salmonella detection.

  10. DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

    EPA Science Inventory

    The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

  11. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    ERIC Educational Resources Information Center

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  12. Determining Annealing Temperatures for Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  13. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

    USDA-ARS?s Scientific Manuscript database

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  14. Polymerase chain reaction detection of Bartonella spp. in dogs from Spain with blood culture-negative infectious endocarditis.

    PubMed

    Roura, X; Santamarina, G; Tabar, M-D; Francino, O; Altet, L

    2018-05-25

    The presence of Bartonella spp. was detected by polymerase chain reaction (PCR) in dogs from Spain with blood culture-negative endocarditis. The aim of this study is to add information about canine infectious endocarditis in Europe. Thirty dogs with naturally occurring blood culture-negative endocarditis were examined from 2010 to 2017 at three veterinary referral hospitals, located in northwest, northeast, and southeast of Spain. It is a retrospective study. Medical records were reviewed to extract relevant data. Frozen or paraffin-embedded cardiac valve tissue and/or ethylenediamine tetraacetic acid blood samples were evaluated by PCR for the presence of Bartonella DNA. Positive results were sequenced to confirm the species. Polymerase chain reaction was positive for eight out of 30 dogs included (26.6%). Bartonella rochalimae, Bartonella vinsonii subsp. berkhoffii, and Bartonella koehlerae were detected in valve tissue or blood. Bartonella could be an important cause of blood culture-negative infectious endocarditis in dogs from Spain. The outcome for those dogs affected with Bartonella spp. was grave. Prompt empirical treatment with amoxicillin-clavulanate plus fluoroquinolones could be of value in cases of blood culture-negative endocarditis. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. [Roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis].

    PubMed

    Dai, Lin; Huang, Juan; Tang, Yuan; Liao, Dian-ying; Dong, Dan-dan; Xu, Gang; Li, Gan-di

    2010-06-01

    To study the roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis (TL). Forty-six archival cases of histologically diagnosed TL, encountered during the period from April, 1999 to September, 2009 and with the paraffin-embedded lymph node tissue blocks available, were enrolled into the study. The presence of genome fragments of Toxoplasma gondii (T. gondii) was analyzed using semi-nested polymerase chain reaction (PCR). Thirty cases of one or two histopathologic triad of TL as the controls. The positive rate of PCR in TL group was 76.1% (35/46), as compared to 10.0% (3/30) in the control group. The difference was of statistical significance. The sensitivity and specificity of the histologic triad in diagnosing TL was 92.1% (35/38) and 71.1% (27/38), respectively. The predictive value of positive and negative PCR results was 76.1% (35/46) and 90.0% (27/30). respectively. The high specificity but low sensitivity of applying the histologic triad in diagnosing TL cases may be due to the occurrence of atypical histologic pattern. The sensitivity is improved with the use of semi-nested PCR in detecting T. gondii DNA.

  16. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  17. Identification of Brucella spp. by using the polymerase chain reaction.

    PubMed Central

    Herman, L; De Ridder, H

    1992-01-01

    The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

  18. Detection of Listeria monocytogenes by using the polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  19. Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

    PubMed

    Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

    2012-07-09

    Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. 9 CFR 145.33 - Terminology and classification; flocks and products.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    .... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

  1. Expression and mutational analysis of Cip/Kip family in early glottic cancer.

    PubMed

    Kim, D-K; Lee, J H; Lee, O J; Park, C H

    2015-02-01

    Genetic alteration of cyclin-dependent kinase inhibitors has been associated with carcinogenesis mechanisms in various organs. This study aimed to evaluate the expression and mutational analysis of Cip/Kip family cyclin-dependent kinase inhibitors (p21CIP1/WAF1, p27KIP1 and p57KIP2) in early glottic cancer. Expressions of Cip/Kip family and p53 were determined by quantitative reverse transcription polymerase chain reaction and densitometry. For the analysis of p21 inactivation, sequence alteration was assessed using single-strand conformational polymorphism polymerase chain reaction. Additionally, the inactivation mechanism of p27 and p57 were investigated using DNA methylation analysis. Reduced expression of p27 and p57 were detected in all samples, whereas the expression of p21 was incompletely down-regulated in 6 of 11 samples. Additionally, single-strand conformational polymorphism polymerase chain reaction analysis showed the p53 mutation at exon 6. Methylation of p27 and p57 was detected by DNA methylation assay. Our results suggest that the Cip/Kip family may have a role as a molecular mechanism of carcinogenesis in early glottic cancer.

  2. Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

    PubMed Central

    Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter

    2006-01-01

    Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068

  3. Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

    PubMed

    Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

    2015-03-01

    Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.

  4. Molecular Evidence of Bartonella Infection in Domestic Dogs from Algeria, North Africa, by Polymerase Chain Reaction (PCR)

    PubMed Central

    Kernif, Tahar; Aissi, Meriem; Doumandji, Salah-Eddine; Chomel, Bruno B.; Raoult, Didier; Bitam, Idir

    2010-01-01

    Bartonella species are being recognized as important bacterial human and canine pathogens, and are associated with multiple arthropod vectors. Bartonella DNA extracted from blood samples was obtained from domestic dogs in Algiers, Algeria. Polymerase chain reaction (PCR) and DNA sequence analyses of the ftsZ gene and the 16S-23S intergenic spacer region (ITS) were performed. Three Bartonella species: Bartonella vinsonii subsp. berkhoffii, Bartonella clarridgeiae, and Bartonells elizabethae were detected infecting Algerian dogs. To our knowledge, this study is the first report of detection by PCR amplification of Bartonella in dogs in North Africa. PMID:20682871

  5. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    PubMed

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  6. Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

    USDA-ARS?s Scientific Manuscript database

    Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

  7. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  8. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

    PubMed

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

  9. Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

    PubMed

    Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

    2015-07-01

    Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

    PubMed

    Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

    2012-01-01

    The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

  11. Epstein-Barr viral load before a liver transplant in children with chronic liver disease.

    PubMed

    Shakibazad, Nader; Honar, Naser; Dehghani, Seyed Mohsen; Alborzi, Abdolvahab

    2014-12-01

    Many children with chronic liver disease require a liver transplant. These patients are prone to various infections, including Epstein-Barr virus infection. This study sought to measure the Epstein-Barr viral load by polymerase chain reaction before a liver transplant. This cross-sectional study was done at the Shiraz University of Medical Sciences, Shiraz, Iran, in 2011. All patients were aged younger than 18 years with chronic liver disease and were candidates for a liver transplant at the Shiraz Nemazee Hospital Organ Transplant Center. They had been investigated regarding their demographic characteristics, underlying disease, laboratory findings, and Epstein-Barr viral load by real-time TaqMan polymerase chain reaction. Ninety-eight patients were studied and the mean age was 6.5 ± 5.9 years. Cryptogenic cirrhosis was the most-prevalent reason for liver transplant, and the death rate before a transplant was 15%. Among the study subjects, 6 had measurable Epstein-Barr viral load by polymerase chain reaction before the transplant, and 4 of them had considerably higher Epstein-Barr viral loads (more than 1000 copies/mL). With respect to the close prevalence of posttransplant lymphoproliferative disease (6%) and the high Epstein-Barr viral load in the patients before a transplant (4%), high pretransplant Epstein-Barr viral load can be considered a risk factor for posttransplant lymphoproliferative disorder.

  12. Detection of egg drop syndrome 1976 virus by polymerase chain reaction and study of its persistence in experimentally infected layer birds.

    PubMed

    Kumar, N S; Kataria, J M; Koti, M; Dhama, K; Toroghi, R

    2003-01-01

    Polymerase chain reaction (PCR) assay was developed for the detection of Egg drop syndrome 1976 (EDS-76) virus in tissues, namely in the uterus, spleen and buffy coat. It was also used to study the persistence of the virus in tissues of experimentally infected layer birds. The PCR assay could detect as little as 10 fg of purified EDS-76 viral DNA. It also amplified the DNA of Fowl adenovirus serotypes 4 (FAV-4) and 8 (FAV-8). The virus persisted in the uterus up to day 21 post infection (p.i.). Detection of EDS-76 viral DNA in the buffy coat could be useful for studying the occurrence of the respective disease in layer bird flocks.

  13. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears

    PubMed Central

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

  14. Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

    Treesearch

    David E. Schreiber; Karen J. Garner; James M. Slavicek

    1997-01-01

    Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

  15. Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

    PubMed Central

    deWit, D; Wootton, M; Allan, B; Steyn, L

    1993-01-01

    A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

  16. An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

    PubMed Central

    Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

    2005-01-01

    Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159

  17. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    DOE PAGES

    McInerney, Peter; Adams, Paul; Hadi, Masood Z.

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error ratemore » measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

  18. Parvovirus B19 Infection in Children With Arterial Ischemic Stroke.

    PubMed

    Fullerton, Heather J; Luna, Jorge M; Wintermark, Max; Hills, Nancy K; Tokarz, Rafal; Li, Ying; Glaser, Carol; DeVeber, Gabrielle A; Lipkin, W Ian; Elkind, Mitchell S V

    2017-10-01

    Case-control studies suggest that acute infection transiently increases the risk of childhood arterial ischemic stroke. We hypothesized that an unbiased pathogen discovery approach utilizing MassTag-polymerase chain reaction would identify pathogens in the blood of childhood arterial ischemic stroke cases. The multicenter international VIPS study (Vascular Effects of Infection in Pediatric Stroke) enrolled arterial ischemic stroke cases, and stroke-free controls, aged 29 days through 18 years. Parental interview included questions on recent infections. In this pilot study, we used MassTag-polymerase chain reaction to test the plasma of the first 161 cases and 34 controls enrolled for a panel of 28 common bacterial and viral pathogens. Pathogen DNA was detected in no controls and 14 cases (8.7%): parvovirus B19 (n=10), herpesvirus 6 (n=2), adenovirus (n=1), and rhinovirus 6C (n=1). Parvovirus B19 infection was confirmed by serologies in all 10; infection was subclinical in 8. Four cases with parvovirus B19 had underlying congenital heart disease, whereas another 5 had a distinct arteriopathy involving a long-segment stenosis of the distal internal carotid and proximal middle cerebral arteries. Using MassTag-polymerase chain reaction, we detected parvovirus B19-a virus known to infect erythrocytes and endothelial cells-in some cases of childhood arterial ischemic stroke. This approach can generate new, testable hypotheses about childhood stroke pathogenesis. © 2017 American Heart Association, Inc.

  19. Transformation of soybean Gy3 gene into Artemisaarenaria mediated by corona discharge

    NASA Astrophysics Data System (ADS)

    Chao, Lu-meng; Na, Ri; Xue, Dan; Xu, Yongze; Liu, Teng

    2013-03-01

    In order to improve the protein content of desert plant, a method of genetic transformation mediated by corona discharge was established. Artemisia seeds were processed in corona electric field for 120 min at 12 kV, and then soaked in 0.1 SSC media that contained Soybean Gy3 gene DNA to incubate for 12 h at 26 °C. Finally the seeds were inoculated on the differentiation medium. Polymerase Chain Reaction (PCR) and Reverse Transcription Polymerase Chain Reaction (RT-PCR) detection showed that the Soybean Gy3 gene had been successfully introduced into genomic DNA of the regenerated plants of Artemisaarenaria. The study provided a new way for corona discharge in plant genetic modification.

  20. Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

    PubMed Central

    Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

    2013-01-01

    Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

  1. Real-Time Polymerase Chain Reaction for Detection of Schistosoma DNA in Small-Volume Urine Samples Reflects Focal Distribution of Urogenital Schistosomiasis in Primary School Girls in KwaZulu Natal, South Africa

    PubMed Central

    Pillay, Pavitra; Taylor, Myra; Zulu, Siphosenkosi G.; Gundersen, Svein G.; Verweij, Jaco J.; Hoekstra, Pytsje; Brienen, Eric A. T.; Kleppa, Elisabeth; Kjetland, Eyrun F.; van Lieshout, Lisette

    2014-01-01

    Schistosoma haematobium eggs and Schistosoma DNA levels were measured in urine samples from 708 girls recruited from 18 randomly sampled primary schools in South Africa. Microscopic analysis of two 10-mL urine subsamples collected on three consecutive days confirmed high day-to-day variation; 103 (14.5%) girls had positive results at all six examinations, and at least one positive sample was seen in 225 (31.8%) girls. Schistosoma-specific DNA, which was measured in a 200-μL urine subsample by using real-time polymerase chain reaction, was detected in 180 (25.4%) cases, and levels of DNA corresponded significantly with average urine egg excretion. In concordance with microscopic results, polymerase chain reaction results were significantly associated with history of gynecologic symptoms and confirmed highly focal distribution of urogenital schistosomiasis. Parasite-specific DNA detection has a sensitivity comparable to single urine microscopy and could be used as a standardized high-throughput procedure to assess distribution of urogenital schistosomiasis in relatively large study populations by using small sample volumes. PMID:24470560

  2. Exploring the limits of ultrafast polymerase chain reaction using liquid for thermal heat exchange: A proof of principle

    NASA Astrophysics Data System (ADS)

    Maltezos, George; Johnston, Matthew; Taganov, Konstantin; Srichantaratsamee, Chutatip; Gorman, John; Baltimore, David; Chantratita, Wasun; Scherer, Axel

    2010-12-01

    Thermal ramp rate is a major limiting factor in using real-time polymerase chain reaction (PCR) for routine diagnostics. We explored the limits of speed by using liquid for thermal exchange rather than metal as in traditional devices, and by testing different polymerases. In a clinical setting, our system equaled or surpassed state-of-the-art devices for accuracy in amplifying DNA/RNA of avian influenza, cytomegalovirus, and human immunodeficiency virus. Using Thermococcus kodakaraensis polymerase and optimizing both electrical and chemical systems, we obtained an accurate, 35 cycle amplification of an 85-base pair fragment of E. coli O157:H7 Shiga toxin gene in as little as 94.1 s, a significant improvement over a typical 1 h PCR amplification.

  3. Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

    EPA Science Inventory

    The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

  4. Identification of fragile X pre-mutation carriers in the Chinese obstetric population using a robust FMR1 polymerase chain reaction assay: implications for screening and prenatal diagnosis.

    PubMed

    Cheng, Y Ky; Lin, C Sw; Kwok, Y Ky; Chan, Y M; Lau, T K; Leung, T Y; Choy, K W

    2017-04-01

    There is significant morbidity associated with fragile X syndrome. Unfortunately, most maternal carriers are clinically silent during their reproductive years. Because of this, many experts have put forward the notion of preconception or prenatal fragile X carrier screening for females. This study aimed to determine the prevalence of fragile X syndrome pre-mutation and asymptomatic full-mutation carriers in a Chinese pregnant population, and the distribution of cytosine-guanine-guanine (CGG) repeat numbers using a robust fragile X mental retardation 1 (FMR1) polymerase chain reaction assay. This was a cross-sectional survey in prospectively recruited pregnant women from a university hospital in Hong Kong. Chinese pregnant women without a family history of fragile X syndrome were recruited between April 2013 and May 2015. A specific FMR1 polymerase chain reaction assay was performed on peripheral blood to determine the CGG repeat number of the FMR1 gene. Prenatal counselling was offered to full-mutation and pre-mutation carriers. In 2650 Chinese pregnant women, two individuals with pre-mutation alleles (0.08%, one in 1325) and one asymptomatic woman with full-mutation (0.04%, one in 2650) alleles were identified. The overall prevalence of pre-mutation and full-mutation alleles was 0.11% (1 in 883). Furthermore, 30 (1.1%) individuals with intermediate alleles were detected. In the 2617 women with normal CGG repeats, the most common CGG repeat allele was 30. The overall prevalence of pre-mutation and asymptomatic full-mutation carriers in the Chinese pregnant population was one in 883, detected by a new FMR1 polymerase chain reaction assay.

  5. A novel gammaherpesvirus in a large flying fox (Pteropus vampyrus) with blepharitis.

    PubMed

    Paige Brock, A; Cortés-Hinojosa, Galaxia; Plummer, Caryn E; Conway, Julia A; Roff, Shannon R; Childress, April L; Wellehan, James F X

    2013-05-01

    A novel gammaherpesvirus was identified in a large flying fox (Pteropus vampyrus) with conjunctivitis, blepharitis, and meibomianitis by nested polymerase chain reaction and sequencing. Polymerase chain reaction amplification and sequencing of 472 base pairs of the DNA-dependent DNA polymerase gene were used to identify a novel herpesvirus. Bayesian and maximum likelihood phylogenetic analyses indicated that the virus is a member of the genus Percavirus in the subfamily Gammaherpesvirinae. Additional research is needed regarding the association of this virus with conjunctivitis and other ocular pathology. This virus may be useful as a biomarker of stress and may be a useful model of virus recrudescence in Pteropus spp.

  6. [Pea (Pisum sativum) genes, participating in symbiosis with nitrogen-fixing bacteria. III. Study of the structure of the ENOD12 early nodulin gene for various types of peas using the polymerase chain reaction (PCR)].

    PubMed

    Kozik, A V; Matvienko, M A; Men', A E; Zalenskiĭ, A O; Tikhonovich, I A

    1992-01-01

    We have determined the length of early noduline gene ENOD12 in various varieties and lines of pea (Pisum sativum) using the polymerase chain reaction (PCR). It was demonstrated that promoter regions of ENOD12A and ENOD12B genes in line 2150 (Afghanistan) are longer than these in variety "Feltham first". The disparity is 14 bp. When studying these genes in 7 different lines and varieties of pea it was found that ENOD12A gene is more variable in size than the ENOD12B gene. We showed the possibility to analyze the heritage of ENOD12 gene's alleles by using the PCR method.

  7. Prevalence of Sexually Transmitted Diseases in Asymptomatic Renal Transplant Recipients.

    PubMed

    Sarier, Mehmet; Sepin Ozen, Nevgun; Guler, Hicran; Duman, Ibrahim; Yüksel, Yücel; Tekin, Sabri; Yavuz, Asuman Havva; Yucetin, Levent; Erdogan Yilmaz, Mine

    2018-04-04

    Sexually transmitted diseases, which may be asymptomatic, have the potential to cause serious health problems in renal transplant recipients. The aim of this study was to determine the prevalence of sexually transmitted diseases in sexually active asymptomatic renal transplant patients by using real-time multiplex polymerase chain reaction assays. This prospective controlled study was conducted between November 2016 and January 2017 in our hospital. Our study group included 80 consecutive, sexually active asymptomatic patients (40 men and 40 women) who had undergone renal transplant in our hospital and who presented to our outpatient clinic for routine follow-up. We also included a control group of 80 consecutive, sexually active nontransplant patients (40 men and 40 women). All patient samples were tested for Gardnerella vaginalis and obligate anaerobes (Prevotella bivia, Porphyromonas species), Candida species, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma species, Trichomonas vaginalis, Neisseria gonorrhoeae, Chlamydia trachomatis, herpes simplex virus 1 and 2, and Cytomegalovirus by real-time multiplex polymerase chain reaction. The prevalences of infection with Gardnerella vaginalis and obligate anaerobes (P = .043), Ureaplasma species (P = .02), and Cytomegalovirus (P = .016) were found to be significantly higher in the study group versus the control group. However, there was no difference between the 2 groups regarding the prevalence of Mycoplasma infection (P = .70). Sexually transmitted diseases may occur more frequently in sexually active asymptomatic renal transplant recipients than in nontransplanted individuals. Real-time multiplex polymerase chain reaction analysis may be a suitable method for determining these pathogens.

  8. Impact of toxigenic Clostridium difficile polymerase chain reaction testing on the clinical microbiology laboratory and inpatient epidemiology.

    PubMed

    Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E

    2013-08-01

    Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

    PubMed Central

    Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

    2006-01-01

    Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

  10. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    PubMed

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.

  11. Clinical Characteristics and Outcomes of Hematologic Malignancy Patients With Positive Clostridium difficile Toxin Immunoassay Versus Polymerase Chain Reaction Test Results.

    PubMed

    Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H

    2018-04-25

    In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.

  12. Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

    PubMed

    Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

    2001-03-01

    A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

  13. Expression of TGF-beta1, osteonectin, and BMP-4 in mandibular distraction osteogenesis with compression stimulation: reverse transcriptase-polymerase chain reaction study and biomechanical test.

    PubMed

    Kim, Uk-Kyu; Park, Seong-Jin; Seong, Wook-Jin; Heo, Jun; Hwang, Dae-Seok; Kim, Yong-Deok; Shin, Sang-Hun; Kim, Gyoo-Cheon

    2010-09-01

    This study compared the levels of transforming growth factor-beta1 (TGF-beta1), osteonectin, and bone morphogenetic protein-4 (BMP-4) expression in regenerated bone in a rabbit mandible that had undergone conventional distraction osteogenesis (DO) with those in regenerated bone from a modified DO technique with compression stimulation. A total of 42 rabbits were used in this reverse transcriptase-polymerase chain reaction study. In the control group, distraction was performed at 1 mm/day for 8 days. In the experimental group, overdistraction was performed for 10 days, followed by a 3-day latency period and 2 days of compression to achieve the same amount of DO. Three rabbits per subgroup were killed at 0, 5, 13, 20, 27, 34, and 41 days after the initial osteotomy. The levels of TGF-beta1, osteonectin, and BMP-4 in the bone regenerates were measured by reverse transcriptase-polymerase chain reaction. A biomechanical microhardness test was also performed in 8 rabbits as a separate experiment. Reverse transcriptase-polymerase chain reaction revealed a greater level of TGF-beta1 in the experimental group immediately after applying the compression force that continued for 2 weeks. The level then decreased to that of the control group at 3 weeks. The greater level of osteonectin in the experimental group after compression than that in the control group continued for 3 weeks. In the experimental group, the level of BMP-4 increased immediately after compression. However, the level in the control group decreased. The microhardness ratio of distracted bone to normal bone on the cortex was statistically different at 0.47 in the control group and 0.80 in the experimental group (P = .049) at 55 days after osteotomy. The effectiveness of the new DO technique with compression stimulation was confirmed by the gene expression study and the biomechanical test findings. Copyright 2010 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

  14. Micro-droplet Digital Polymerase Chain Reaction and Real-Time Quantitative Polymerase Chain Reaction Technologies Provide Highly Sensitive and Accurate Detection of Zika Virus.

    PubMed

    Hui, Yuan; Wu, Zhiming; Qin, Zhiran; Zhu, Li; Liang, Junhe; Li, Xujuan; Fu, Hanmin; Feng, Shiyu; Yu, Jianhai; He, Xiaoen; Lu, Weizhi; Xiao, Weiwei; Wu, Qinghua; Zhang, Bao; Zhao, Wei

    2018-06-01

    The establishment of highly sensitive diagnostic methods is critical in the early diagnosis and control of Zika virus (ZIKV) and in preventing serious neurological complications of ZIKV infection. In this study, we established micro-droplet digital polymerase chain reaction (ddPCR) and real-time quantitative PCR (RT-qPCR) protocols for the detection of ZIKV based on the amplification of the NS5 gene. For the ZIKV standard plasmid, the RT-qPCR results showed that the cycle threshold (Ct) value was linear from 10 1 to 10 8  copy/μL, with a standard curve R 2 of 0.999 and amplification efficiency of 92.203%; however, a concentration as low as 1 copy/μL could not be detected. In comparison with RT-qPCR, the ddPCR method resulted in a linear range of 10 1 -10 4  copy/μL and was able to detect concentrations as low as 1 copy/μL. Thus, for detecting ZIKV from clinical samples, RT-qPCR is a better choice for high-concentration samples (above 10 1  copy/μL), while ddPCR has excellent accuracy and sensitivity for low-concentration samples. These results indicate that the ddPCR method should be of considerable use in the early diagnosis, laboratory study, and monitoring of ZIKV.

  15. Development of polymerase chain reaction-based diagnostic tests for detection of Malsoor virus & adenovirus isolated from Rousettus species of bats in Maharashtra, India.

    PubMed

    Shete, Anita M; Yadav, Pragya; Kumar, Vimal; Nikam, Tushar; Mehershahi, Kurosh; Kokate, Prasad; Patil, Deepak; Mourya, Devendra T

    2017-01-01

    Bats are recognized as important reservoirs for emerging infectious disease and some unknown viral diseases. Two novel viruses, Malsoor virus (family Bunyaviridae, genus, Phlebovirus) and a novel adenovirus (AdV) (family, Adenoviridae genus, Mastadenovirus), were identified from Rousettus bats in the Maharashtra State of India. This study was done to develop and optimize real time reverse transcription - polymerase chain reaction (RT-PCR) assays for Malsoor virus and real time and nested PCR for adenovirus from Rousettus bats. For rapid and accurate screening of Malsoor virus and adenovirus a nested polymerase chain reaction and TaqMan-based real-time PCR were developed. Highly conserved region of nucleoprotein gene of phleboviruses and polymerase gene sequence from the Indian bat AdV isolate polyprotein gene were selected respectively for diagnostic assay development of Malsoor virus and AdV. Sensitivity and specificity of assays were calculated and optimized assays were used to screen bat samples. Molecular diagnostic assays were developed for screening of Malsoor virus and AdV and those were found to be specific. Based on the experiments performed with different parameters, nested PCR was found to be more sensitive than real-time PCR; however, for rapid screening, real-time PCR can be used and further nested PCR can be used for final confirmation or in those laboratories where real-time facility/expertise is not existing. This study reports the development and optimization of nested RT-PCR and a TaqMan-based real-time PCR for Malsoor virus and AdV. The diagnostic assays can be used for rapid detection of these novel viruses to understand their prevalence among bat population.

  16. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

    PubMed

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

    2014-04-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

  17. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

    PubMed Central

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

    2014-01-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

  18. Lymphogranuloma venereum variant L2b-specific polymerase chain reaction: insertion used to close an epidemiological gap.

    PubMed

    Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D

    2011-11-01

    The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

  19. Space-to-Ground: Genes in Space: 04/13/2018

    NASA Image and Video Library

    2018-04-12

    Can the Polymerase Chain Reaction be used to study DNA alterations on the International Space Station? NASA's Space to Ground is your weekly update on what's happening aboard the International Space Station.

  20. EPA Scientists Develop Research Methods for Studying Mold Fact Sheet

    EPA Pesticide Factsheets

    In 2002, U.S. Environmental Protection Agency researchers developed a DNA-based Mold Specific Quantitative Polymerase Chain Reaction method (MSQPCR) for identifying and quantifying over 100 common molds and fungi.

  1. Infectious agent screening in canine blood donors in the United Kingdom.

    PubMed

    Crawford, K; Walton, J; Lewis, D; Tasker, S; Warman, S M

    2013-08-01

    Transfusion of blood products is an important component of veterinary emergency medicine. Donors must be carefully selected to minimise risk of transmission of blood-borne infectious agents. This study was devised to assess the prevalence of such agents in healthy, non-travelled UK dogs screened as prospective donors. Ethylenediaminetetraacetic acid blood samples from dogs donating blood between August 2007 and January 2012 were screened by polymerase chain reaction for haemotropic mycoplasmas, Bartonella, Babesia, Leishmania, Ehrlichia and Anaplasma spp. Dogs with positive or inconclusive results underwent repeat polymerase chain reaction testing. Four of 262 dogs had positive or inconclusive results at initial screening. Repeat polymerase chain reaction testing in each dog was negative, and none of the dogs developed clinical signs of disease. The positive results on initial screening may have represented false positives from sample contamination or amplification of non-target DNA. It is also possible that dogs were infected at initial sampling but successfully cleared infection before repeat testing. The low number of positive results obtained suggests that prevalence of these agents in a population of healthy UK dogs is low and that use of blood products is unlikely to represent a significant risk of transmission of these diseases. © 2013 British Small Animal Veterinary Association.

  2. Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

    PubMed

    Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

    2015-04-01

    Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  3. Problem-Solving Test: Pyrosequencing

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2013-01-01

    Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…

  4. Recombinase polymerase amplification: Emergence as a critical molecular technology for rapid, low-resource diagnostics.

    PubMed

    James, Ameh; Macdonald, Joanne

    2015-01-01

    Isothermal molecular diagnostics are bridging the technology gap between traditional diagnostics and polymerase chain reaction-based methods. These new techniques enable timely and accurate testing, especially in settings where there is a lack of infrastructure to support polymerase chain reaction facilities. Despite this, there is a significant lack of uptake of these technologies in developing countries where they are highly needed. Among these novel isothermal technologies, recombinase polymerase amplification (RPA) holds particular potential for use in developing countries. This rapid nucleic acid amplification approach is fast, highly sensitive and specific, and amenable to countries with a high burden of infectious diseases. Implementation of RPA technology in developing countries is critically required to assess limitations and potentials of the diagnosis of infectious disease, and may help identify impediments that prevent adoption of new molecular technologies in low resource- and low skill settings. This review focuses on approaching diagnosis of infectious disease with RPA.

  5. Recombinase polymerase amplification-based assay to diagnose Giardia in stool samples.

    PubMed

    Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

    2015-03-01

    Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. © The American Society of Tropical Medicine and Hygiene.

  6. Recombinase Polymerase Amplification-Based Assay to Diagnose Giardia in Stool Samples

    PubMed Central

    Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

    2015-01-01

    Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. PMID:25510713

  7. The use of heteroduplex analysis of polymerase chain reaction products to support the possible transmission of Legionella pneumophila from a malfunctioning automobile air conditioner.

    PubMed

    Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T

    2002-03-01

    Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.

  8. Identification of co-infection by rotavirus and parvovirus in dogs with gastroenteritis in Mexico.

    PubMed

    Ortega, Ariadna Flores; Martínez-Castañeda, José Simón; Bautista-Gómez, Linda G; Muñoz, Raúl Fajardo; Hernández, Israel Quijano

    This is the first report on circulating canine rotavirus in Mexico. Fifty samples from dogs with gastroenteritis were analyzed used polymerase chain reaction and reverse transcription polymerase chain reaction in order to identify parvovirus and rotavirus, respectively; 7% of dogs were infected with rotavirus exclusively, while 14% were co-infected with both rotavirus and parvovirus; clinical signs in co-infected dogs were more severe. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  9. Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

    PubMed

    Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

    2016-01-01

    American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

  10. Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

    PubMed

    Law, Dennis K S; Tsang, Raymond S W

    2013-05-01

    A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.

  11. Geographic variation in marine turtle fibropapillomatosis

    USGS Publications Warehouse

    Greenblatt, R.J.; Work, Thierry M.; Dutton, P.; Sutton, C.A.; Spraker, T.R.; Casey, R.N.; Diez, C.E.; Parker, Dana C.; St. Ledger, J.; Balazs, G.H.; Casey, J.W.

    2005-01-01

    We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

  12. Geographic variation in marine turtle fibropapillomatosis.

    PubMed

    Greenblatt, Rebecca J; Work, Thierry M; Dutton, Peter; Sutton, Claudia A; Spraker, Terry R; Casey, Rufina N; Diez, Carlos E; Parker, Denise; St Leger, Judy; Balazs, George H; Casey, James W

    2005-09-01

    We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

  13. Polymerase chain reaction identification of three members of the Anopheles sundaicus (Diptera: Culicidae) complex, malaria vectors in Southeast Asia.

    PubMed

    Dusfour, Isabelle; Blondeau, Johanna; Harbach, Ralph E; Vythilingham, Indra; Baimai, Visut; Trung, Ho D; Sochanta, Tho; Bangs, Michael J; Manguin, Sylvie

    2007-09-01

    Anopheles sundaicus s.l., a major malaria vector taxon, occurs primarily along coastal areas and on islands in Southeast Asia. Our previous studies using cytochrome oxidase I, cytochrome-b, and internal transcribed spacer 2 markers discriminated three allopatric species: An. sundaicus s.s. in northern Borneo, An. epiroticus in Southeast Asia, and An. sundaicus E on Sumatra and Java, Indonesia. Morphological comparisons of three developmental stages did not reveal unique diagnostic characters that could reliably distinguish the three species. Therefore, we developed a multiplex polymerase chain reaction (PCR) assay based on two mitochondrial DNA markers to unambiguously identify them. This PCR was tested on 374 specimens from 24 different geographical populations, expanding our knowledge of the distribution of these species.

  14. Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Flores, J.; Sears, J.; Schael, I.P.

    1990-08-01

    We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated frommore » field studies.« less

  15. Susceptibility of Culicoides variipennis sonorensis to infection by polymerase chain reaction-detectable bluetongue virus in cattle blood.

    PubMed

    Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F

    1996-05-01

    Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.

  16. Brief ultrasonication improves detection of biofilm-formative bacteria around a metal implant.

    PubMed

    Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Fujishiro, Takaaki; Procop, Gary W

    2007-04-01

    Biofilms are complex microenvironments produced by microorganisms on surfaces. Ultrasonication disrupts biofilms and may make the microorganism or its DNA available for detection. We determined whether ultrasonication could affect our ability to detect bacteria adherent to a metal substrate. A biofilm-formative Staphylococcus aureus strain was used for an in vitro implant infection model (biofilm-formative condition). We used quantitative culture and real time-polymerase chain reaction to determine the influence of different durations of ultrasound on bacterial adherence and viability. Sonication for 1 minute increased the yield of bacteria. Sonication longer than 5 minutes led to fewer bacterial colonies by conventional culture but not by polymerase chain reaction. This suggests short periods of sonication help release bacteria from the metal substrate by disrupting the biofilm, but longer periods of sonication lyse bacteria prohibiting their detection in microbiologic cultures. A relatively short duration of sonication may be desirable for maximizing detection of biofilm-formative bacteria around implants by culture or polymerase chain reaction.

  17. Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

    PubMed

    Bridge, Julia A

    2017-01-01

    The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

  18. MAMMALIAN DNA IN PCR REAGENTS

    EPA Science Inventory

    Ancient DNA analysis is becoming widespread. These studies use polymerase chain reaction (PCR) to amplify minute quantities of heavily damaged template. Unusual steps are taken to achieve the sensitivity necessary to detect ancient DNA, including high- cycle PCR amplification t...

  19. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    PubMed Central

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  20. Polymerase chain reaction: A molecular diagnostic tool in periodontology.

    PubMed

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

  1. Sensitive and specific identification by polymerase chain reaction of Eimeria tenella and Eimeria maxima, important protozoan pathogens in laboratory avian facilities.

    PubMed

    Lee, Hyun-A; Hong, Sunhwa; Chung, Yungho; Kim, Okjin

    2011-09-01

    Eimeria tenella and Eimeria maxima are important pathogens causing intracellular protozoa infections in laboratory avian animals and are known to affect experimental results obtained from contaminated animals. This study aimed to find a fast, sensitive, and efficient protocol for the molecular identification of E. tenella and E. maxima in experimental samples using chickens as laboratory avian animals. DNA was extracted from fecal samples collected from chickens and polymerase chain reaction (PCR) analysis was employed to detect E. tenella and E. maxima from the extracted DNA. The target nucleic acid fragments were specifically amplified by PCR. Feces secreting E. tenella and E. maxima were detected by a positive PCR reaction. In this study, we were able to successfully detect E. tenella and E. maxima using the molecular diagnostic method of PCR. As such, we recommended PCR for monitoring E. tenella and E. maxima in laboratory avian facilities.

  2. Clinical characteristics of children with viral single- and co-infections and a petechial rash.

    PubMed

    Schneider, Henriette; Adams, Ortwin; Weiss, Christel; Merz, Ulrich; Schroten, Horst; Tenenbaum, Tobias

    2013-05-01

    Children with petechial rash are more likely to undergo invasive diagnostics, to be treated with antibiotics for potential bacterial infection and to be hospitalized. However, viruses have also been associated with petechial rash. Nonetheless, a systematic analysis of viral infections with modern available techniques as quantitative real-time polymerase chain reaction in the context of petechial rash is lacking. The purpose of this pediatric study was to prospectively uncover viral pathogens that may promote the emergence of petechiae and to analyze the correlation with the clinical characteristics and course. We conducted a prospective study in children (0 to 18 years) presenting with petechiae and signs or symptoms of infection at the emergency department between November 2009 and March 2012. In nasopharyngeal aspirates the following viruses were analyzed by quantitative real-time polymerase chain reaction: cytomegalovirus, Epstein-Barr virus, parvovirus B19, influenza A and B, parainfluenza viruses, human respiratory syncytial virus A and B, human metapneumovirus, rhinovirus, enterovirus, adenovirus, human coronavirus OC43, 229E, NL63 and human bocavirus. A viral pathogen was identified in 67% of the analyzed 58 cases with petechial rash. Virus positive patients showed a significantly higher incidence of lower respiratory tract infections. Forty-one percent were viral coinfections, which were significantly younger than virus negative patients, had a higher leukocyte count and were hospitalized for a longer time. A petechial rash is frequently associated viral single- and coinfections and can rapidly be identified via quantitative real-time polymerase chain reaction.

  3. Quantitation of Human Papillomavirus DNA in Plasma of Oropharyngeal Carcinoma Patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cao Hongbin; Banh, Alice; Kwok, Shirley

    Purpose: To determine whether human papillomavirus (HPV) DNA can be detected in the plasma of patients with HPV-positive oropharyngeal carcinoma (OPC) and to monitor its temporal change during radiotherapy. Methods and Materials: We used polymerase chain reaction to detect HPV DNA in the culture media of HPV-positive SCC90 and VU147T cells and the plasma of SCC90 and HeLa tumor-bearing mice, non-tumor-bearing controls, and those with HPV-negative tumors. We used real-time quantitative polymerase chain reaction to quantify the plasma HPV DNA in 40 HPV-positive OPC, 24 HPV-negative head-and-neck cancer patients and 10 non-cancer volunteers. The tumor HPV status was confirmed bymore » p16{sup INK4a} staining and HPV16/18 polymerase chain reaction or HPV in situ hybridization. A total of 14 patients had serial plasma samples for HPV DNA quantification during radiotherapy. Results: HPV DNA was detectable in the plasma samples of SCC90- and HeLa-bearing mice but not in the controls. It was detected in 65% of the pretreatment plasma samples from HPV-positive OPC patients using E6/7 quantitative polymerase chain reaction. None of the HPV-negative head-and-neck cancer patients or non-cancer controls had detectable HPV DNA. The pretreatment plasma HPV DNA copy number correlated significantly with the nodal metabolic tumor volume (assessed using {sup 18}F-deoxyglucose positron emission tomography). The serial measurements in 14 patients showed a rapid decline in HPV DNA that had become undetectable at radiotherapy completion. In 3 patients, the HPV DNA level had increased to a discernable level at metastasis. Conclusions: Xenograft studies indicated that plasma HPV DNA is released from HPV-positive tumors. Circulating HPV DNA was detectable in most HPV-positive OPC patients. Thus, plasma HPV DNA might be a valuable tool for identifying relapse.« less

  4. No implication of Simian virus 40 in pathogenesis of malignant pleural mesothelioma in Slovenia.

    PubMed

    Hmeljak, Julija; Kern, Izidor; Cör, Andrej

    2010-01-01

    Malignant mesothelioma is predominantly caused by asbestos exposure, although the association of Simian virus 40 in its pathogenesis is currently still under debate. Simian virus 40, a DNA rhesus monkey virus with oncogenic properties, accidentally contaminated early batches of polio vaccine in the 1960s. In the 1990s, viral sequences and proteins were discovered in several human tumors, which triggered research to find a link between Simian virus 40 and human cancers, especially malignant mesothelioma. The aim of our study was to establish an effective laboratory procedure for Simian virus 40 detection and to investigate the presence of Simian virus 40 DNA and small t antigen in mesothelioma samples from Slovenian patients. Paraffin-embedded malignant pleural mesothelioma specimens from 103 Slovenian patients were collected and used for total DNA isolation and real-time polymerase chain reaction for Simian virus 40 small t and large T DNA analysis. Special attention was devoted to primer design, good laboratory practice and polymerase chain reaction contamination prevention. Polymerase chain reaction products were sequenced and BLAST aligned. One 5 microm thick paraffin section from each patient's tissue block was stained with hematoxylin and eosin for histological typing and one for immunohistochemical detection of Simian virus 40 small t antigen using a monoclonal antibody against Simian virus 40 (Pab280). SV40-expressing Wi-38 cells were used as positive control in both PCR and immunohistochemistry. In real-time polymerase chain reaction analyses, only 4 samples gave products with primer pairs amplifying small t antigen and were inconsistent and poorly reproducible. BLAST alignment showed no homology with any deposited SV40 sequences. No immunopositive staining for SV40 small t antigen was found in any of the samples. We found no evidence of SV40 presence in tissue samples from 103 Slovenian patients with malignant pleural mesothelioma. Asbestos exposure remains the main risk factor for malignant pleural mesothelioma in Slovenia.

  5. An evaluation of microbial profile in halitosis with tongue coating using PCR (polymerase chain reaction)- a clinical and microbiological study.

    PubMed

    Kamaraj R, Dinesh; Bhushan, Kala S; K L, Vandana

    2014-01-01

    Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load.

  6. DD genotype of ace gene I/D polymorphism is associated in a Turkish study population with osteoarthritis.

    PubMed

    Bayram, Banu; Sayın, Emrah; Güneş, Hasan Veysi; Değirmenci, Irfan; Türkoğlu, Züleyha; Doganer, Fulya; Coşan, Didem Turgut

    2011-03-01

    This study was conducted in Turkish osteoarthritis patients to determine the frequency of I/D polymorphism genotypes of angiotensin converting enzyme gene, and to examine the role of this polymorphism in osteoarthritis development. Genomic DNA obtained from 200 persons (135 patients with osteoarthritis and 65 healthy controls) was used in the study. DNA was multiplied by polymerase chain reaction using I and D allele-specific primers. Polymerase chain reaction products were assessed with CCD camera by being exposed to 2% agarose gel electrophoresis. There was statistically significant difference between the groups with respect to genotype distribution (P < 0.001). The D allele frequency was indicated as 69% and I allele was as 31% in the patients, whereas it was 55-45% in the control group. Consequently, in this study, we may assert that ACE gene I/D polymorphism DD genotype determination is significant criteria for identifying patients who are likely to develop osteoarthritis in east population of Turkey.

  7. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    PubMed

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Single cell digital polymerase chain reaction on self-priming compartmentalization chip

    PubMed Central

    Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

    2017-01-01

    Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267

  9. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

    PubMed Central

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-01-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

  10. Single cell digital polymerase chain reaction on self-priming compartmentalization chip.

    PubMed

    Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

    2017-01-01

    Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.

  11. In Vitro Lesion Bypass Studies of O(4)-Alkylthymidines with Human DNA Polymerase η.

    PubMed

    Williams, Nicole L; Wang, Pengcheng; Wu, Jiabin; Wang, Yinsheng

    2016-04-18

    Environmental exposure and endogenous metabolism can give rise to DNA alkylation. Among alkylated nucleosides, O(4)-alkylthymidine (O(4)-alkyldT) lesions are poorly repaired in mammalian systems and may compromise the efficiency and fidelity of cellular DNA replication. To cope with replication-stalling DNA lesions, cells are equipped with translesion synthesis DNA polymerases that are capable of bypassing various DNA lesions. In this study, we assessed human DNA polymerase η (Pol η)-mediated bypass of various O(4)-alkyldT lesions, with the alkyl group being Me, Et, nPr, iPr, nBu, iBu, (R)-sBu, or (S)-sBu, in template DNA by conducting primer extension and steady-state kinetic assays. Our primer extension assay results revealed that human Pol η, but not human polymerases κ and ι or yeast polymerase ζ, was capable of bypassing all O(4)-alkyldT lesions and extending the primer to generate full-length replication products. Data from steady-state kinetic measurements showed that Pol η preferentially misincorporated dGMP opposite O(4)-alkyldT lesions with a straight-chain alkyl group. The nucleotide misincorporation opposite most lesions with a branched-chain alkyl group was, however, not selective, where dCMP, dGMP, and dTMP were inserted at similar efficiencies opposite O(4)-iPrdT, O(4)-iBudT, and O(4)-(R)-sBudT. These results provide important knowledge about the effects of the length and structure of the alkyl group in O(4)-alkyldT lesions on the fidelity and efficiency of DNA replication mediated by human Pol η.

  12. SWIMMING ASSOCIATED ILLNESS AND RAPID MEASURES OF WATER QUALITY AT A GULF BEACH

    EPA Science Inventory

    Studies at Great Lakes beaches have provided evidence that faster ways of measuring the fecal indicator bacteria (FIB) Enterococcus using quantitative polymerase chain reaction (qPCR) are predictive of swimming associated illness. In 2005 we conducted an epidemiology study to eva...

  13. Tuberculous otitis media: a resurgence?

    PubMed

    Kameswaran, M; Natarajan, K; Parthiban, M; Krishnan, P V; Raghunandhan, S

    2017-09-01

    Tuberculosis is a global health problem that is especially prevalent in developing countries such as India. Recently, atypical presentation has become more common and a high index of suspicion is essential. This study analysed the various presenting symptoms and signs of tuberculous otitis media and the role of diagnostic tests, with the aim of formulating criteria for the diagnosis. A total of 502 patients underwent tympanomastoidectomy over a two-year period. Microbiological and histopathological examinations and polymerase chain reaction analysis of tissue taken during tympanomastoidectomy were performed. A total of 25 patients (5 per cent) were diagnosed with tuberculous otitis media. Severe mixed hearing loss, facial palsy, labyrinthine fistula, post-aural fistula, perichondritis and extradural abscess were noted. There seems to be a resurgence in tuberculous otitis media in India. Microbiological, histopathological and polymerase chain reaction tests for tuberculosis are helpful for its diagnosis.

  14. Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

    PubMed

    Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

    2008-12-01

    One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

  15. High-throughput amplification of mature microRNAs in uncharacterized animal models using polyadenylated RNA and stem-loop reverse transcription polymerase chain reaction.

    PubMed

    Biggar, Kyle K; Wu, Cheng-Wei; Storey, Kenneth B

    2014-10-01

    This study makes a significant advancement on a microRNA amplification technique previously used for expression analysis and sequencing in animal models without annotated mature microRNA sequences. As research progresses into the post-genomic era of microRNA prediction and analysis, the need for a rapid and cost-effective method for microRNA amplification is critical to facilitate wide-scale analysis of microRNA expression. To facilitate this requirement, we have reoptimized the design of amplification primers and introduced a polyadenylation step to allow amplification of all mature microRNAs from a single RNA sample. Importantly, this method retains the ability to sequence reverse transcription polymerase chain reaction (RT-PCR) products, validating microRNA-specific amplification. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. ANIMAL DNA IN PCR REAGENTS PLAGUES ANCIENT DNA RESEARCH

    EPA Science Inventory

    Ancient DNA analysis is becoming widespread. These studies use polymerase chain reaction (PCR) to amplify minute quantities of heavily damaged template. Unusual steps are taken to achieve the sensitivity necessary to detect ancient DNA, including high-cycle PCR amplification targ...

  17. [Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

    PubMed

    Harano, K; Harano, T; Kushida, Y; Ueda, S

    1991-08-01

    Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

  18. Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

    PubMed Central

    Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

    2010-01-01

    Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

  19. A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

    PubMed

    Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

    2008-09-01

    Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

  20. Slow Joining of Newly Replicated DNA Chains in DNA Polymerase I-Deficient Escherichia coli Mutants*

    PubMed Central

    Okazaki, Reiji; Arisawa, Mikio; Sugino, Akio

    1971-01-01

    In Escherichia coli mutants deficient in DNA polymerase I, newly replicated short DNA is joined at about 10% of the rate in the wild-type strains. It is postulated that DNA polymerase I normally functions in filling gaps between the nascent short segments synthesized by the replication complex. Possible implications of the finding are discussed in relation to other abnormal properties of these mutants. PMID:4943548

  1. Molecular diagnostics of periodontitis.

    PubMed

    Korona-Głowniak, Izabela; Siwiec, Radosław; Berger, Marcin; Malm, Anna; Szymańska, Jolanta

    2017-01-28

    The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host's health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridization) come increasingly into use. On the basis of a literature review, the following methods are presented: polymerase chain reaction (PCR), real-time polymerase chain reaction (real-time PCR), 16S rRNA-encoding gene sequencing, checkerboard and reverse-capture checkerboard hybridization, microarrays, denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), as well as terminal restriction fragment length polymorphism (TRFLP) and next generation sequencing (NGS). The advantages and drawbacks of each method in the examination of periopathogens are indicated. The techniques listed above allow fast detection of even small quantities of pathogen present in diagnostic material and prove particularly useful to detect microorganisms that are difficult or impossible to grow in a laboratory.

  2. T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

    PubMed

    Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

    2012-01-01

    Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

  3. Direct and quantitative detection of HIV-1 RNA in human plasma with a branched DNA signal amplification assay.

    PubMed

    Urdea, M S; Wilber, J C; Yeghiazarian, T; Todd, J A; Kern, D G; Fong, S J; Besemer, D; Hoo, B; Sheridan, P J; Kokka, R

    1993-11-01

    To determine the relative effect of sample matrix on the quantitation of HIV RNA in plasma. Two HIV-positive specimens were diluted into five and 10 different HIV-negative plasma samples, respectively. Branched DNA signal amplification technology and reverse-transcriptase polymerase chain reaction were used to measure the viral load. In one sample the viral load by polymerase chain reaction ranged from undetectable to 1.9 x 10(5) copies/ml, and the branched DNA results ranged from 2.6 x 10(4) to 4.2 x 10(4) HIV RNA equivalent/ml. In the other sample the corresponding figures were 6.3 x 10(4) to 5.5 x 10(5) copies/ml and 5.7 x 10(4) to 7.5 x 10(4) HIV RNA equivalents/ml. In contrast to reverse-transcriptase polymerase chain reaction the branched DNA signal amplification assay does not require a separate extraction step or enzymatic amplification of the target. Therefore this measurement is less affected by the sample matrix and the signal generated is directly proportional to the viral load.

  4. Bi-parentally inherited species-specific markers identify hybridization between rainbow trout and cutthroat trout subspecies

    USGS Publications Warehouse

    Ostberg, C.O.; Rodriguez, R.J.

    2004-01-01

    Eight polymerase chain reaction primer sets amplifying bi-parentally inherited species-specific markers were developed that differentiate between rainbow trout (Oncorhynchus mykiss) and various cutthroat trout (O. clarki) subspecies. The primers were tested within known F1 and first generation hybrid backcrosses and were shown to amplify codominantly within hybrids. Heterozygous individuals also amplified a slower migrating band that was a heteroduplex, caused by the annealing of polymerase chain reaction products from both species. These primer sets have numerous advantages for native cutthroat trout conservation including statistical genetic analyses of known crosses and simple hybrid identification.

  5. Flow-through polymerase chain reaction inside a seamless 3D helical microreactor fabricated utilizing a silicone tube and a paraffin mold.

    PubMed

    Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon

    2015-03-07

    We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).

  6. Polymer-based microfluidic chips for isothermal amplification of nucleic acids

    NASA Astrophysics Data System (ADS)

    Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

    2017-11-01

    Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

  7. [Identification of human pathogenic variola and monkeypox viruses by real-time polymerase chain reaction].

    PubMed

    Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N

    2009-01-01

    A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.

  8. Identification of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) by using polymerase chain reaction amplification and restriction analysis of the mitochondrial cytochrome b gene.

    PubMed

    Carrera, E; García, T; Céspedes, A; González, I; Sanz, B; Hernández, P E; Martín, R

    1998-04-01

    Restriction site analysis of polymerase chain reaction (PCR) products from a conserved region of the cytochrome b gene has been used for the identification of fresh and smoked samples of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Digestion of the 359-bp PCR product with the endonucleases EcoRV and TaqI yielded specific banding patterns for salmon and trout. This genetic marker can be very useful for detecting fraudulent substitution of the cheaper smoked trout for the more expensive smoked salmon.

  9. Polymerase chain reaction with phase change as intrinsic thermal control

    NASA Astrophysics Data System (ADS)

    Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

    2013-04-01

    This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

  10. Building block synthesis using the polymerase chain assembly method.

    PubMed

    Marchand, Julie A; Peccoud, Jean

    2012-01-01

    De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).

  11. An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study

    PubMed Central

    Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana

    2014-01-01

    Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. Materials and Methods: The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. Result: The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. Conclusion: The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load. PMID:24596791

  12. Development of a Novel, Rapid Multiplex Polymerase Chain Reaction Assay for the Detection and Differentiation of Salmonella enterica Serovars Enteritidis and Typhimurium Using Ultra-Fast Convection Polymerase Chain Reaction.

    PubMed

    Kim, Tae-Hoon; Hwang, Hyun Jin; Kim, Jeong Hee

    2017-10-01

    Salmonella enterica serovars Enteritidis and Typhimurium are the most common causative agents of human nontyphoidal salmonellosis. The rapid detection and timely treatment of salmonellosis are important to increase the curative ratio and prevent spreading of the disease. In this study, we developed a rapid multiplex convection polymerase chain reaction (PCR) method to detect Salmonella spp. and differentiate Salmonella Enteritidis and Salmonella Typhimurium. We used the invA gene for Salmonella spp. detection. Salmonella Enteritidis-specific primers and Salmonella Typhimurium-specific primers were designed using the insertion element (IE) and spy genes, respectively. The primer set for Salmonella spp. detection clearly detected both Salmonella Enteritidis and Salmonella Typhimurium after a 21-min amplification reaction. Serovar-specific primer sets for Salmonella Enteritidis and Salmonella Typhimurium specifically detected each target species in a 21-min amplification reaction. We were able to detect Salmonella spp. at a single copy level in the singleplex mode. The limits of detection for Salmonella Enteritidis and Salmonella Typhimurium were 30 copies in both the singleplex and multiplex modes. The PCR run time could be reduced to 10.5 min/15 cycles. The multiplex convection PCR method developed in this study could detect the Salmonella spp. Salmonella Enteritidis and Salmonella Typhimurium in artificially contaminated milk with as few as 10 0 colony-forming unit/mL after 4-h enrichment. The PCR assay developed in this study provides a rapid, specific, and sensitive method for the detection of Salmonella spp. and the differentiation of Salmonella Enteritidis and Salmonella Typhimurium.

  13. [The development and implementation of polymerase chain reaction to detect in real-time operation mode yersinia pestis in field material].

    PubMed

    Afanas'ev, M V; Chipanin, E V; Shestakov, V E; Denisov, A V; Fomina, L A; Ostiak, A S; Balakhonov, S V

    2013-03-01

    The article presents the results of development and practical implementation of system of polymerase chain reaction testing in real-time operation mode to detect agent of plague infield material. In laboratory conditions the system demonstrated good results and hence it was applied in conditions of field laboratory of epidemiologic team during planned epizootologic examination of Gorno-Altaisk hot spot of plague. The sampling consisted of more than 1400 objects. It was demonstrated that high sensitivity and specificity is immanent to proposed system. The adaptation of the system to the real time amplifier "Smart Cycler" (Cephid, USA) having some specific technical characteristics makes it possible to consider the proposed test-system as an effective sensitive and precise instrument for screening studies in the process of regular epizootologic examinations of hot spots of plague.

  14. Simultaneous detection of hemagglutinin and neuraminidase genes of novel influenza A (H7N9) by duplex real-time reverse transcription polymerase chain reaction.

    PubMed

    Li, Yan; Wu, Tao; Qi, Xian; Ge, Yiyue; Guo, Xiling; Wu, Bin; Yu, Huiyan; Zhu, Yefei; Shi, Zhiyang; Wang, Hua; Cui, Lunbiao; Zhou, Minghao

    2013-12-01

    A novel reassortant influenza A (H7N9) virus emerged recently in China. In this study, a duplex real-time reverse transcription polymerase chain reaction (rRT-PCR) assay was developed for the simultaneous detection of hemagglutinin (HA) and neuraminidase (NA) genes of H7N9 influenza viruses. The sensitivity of the assay was determined to be 10 RNA copies per reaction for both HA and NA genes. No cross-reactivity was observed with other influenza virus subtypes or respiratory tract viruses. One hundred and forty-six clinical and environmental specimens were tested and compared with reference methods and were found to be consistent. The assay is suitable for large-scale screening due to short turnaround times and high specificity, sensitivity, and reproducibility. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Detection of human papillomaviruses type 16, 18 and 33 in bronchial aspirates of lung carcinoma patients by polymerase chain reaction: a study of 84 cases in Croatia.

    PubMed

    Branica, Bozica Vrabec; Smojver-Jezek, Silvana; Juros, Zrinka; Grgić, Sandra; Srpak, Nives; Mitrecić, Dinko; Gajović, Srećko

    2010-03-01

    Besides its well-known role in cervical carcinoma, HPV is also suggested to be involved in lung cancer development. A number of authors have been investigating the presence of HPV in histological materials. We used routine bronchial aspirates from 84 patients with lung carcinoma for DNA extraction and then performed polymerase chain reaction for high-risk HPV types 16, 18 and 33. The results were compared to those obtained from buccal and eyelid mucosa. Only three patients were positive for HPV in bronchial aspirates: one for HPV 16 type, one for HPV 18 type, and one for HPV 33. Our data indicated the low prevalence of HPV in patients with lung carcinomas in Croatia, therefore it seems unlikely that HPV contributes to the development of lung carcinomas in this region.

  16. Detection of human Pneumocystis carinii by the polymerase chain reaction.

    PubMed

    Becker-Hapak, M; Liberator, P; Graves, D

    1991-01-01

    Oligonucleotide primers were prepared from a clone (B12) which has been shown to be a repetitive sequence in the rat P. carinii genome. Polymerase chain reaction was employed to amplify both rat and human P. carinii DNA. The detection limit of the assay was approximately 600 ng of total nucleic acid. Amplification products from both the rat and human isolates (ca. 780 bp) were characterized by denaturing gradient gel electrophoresis after digestion with Sau3A. No amplification products were obtained when DNA from the following potential pulmonary pathogens were used in identical reactions: Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Mycobacterium avium-intracellulare and cytomegalovirus. In a blind study using the B12 primers, P. carinii DNA was successfully amplified in clinical samples which were positive by direct immunofluorescence assay (IFA) as well as in some specimens not identified by direct IFA.

  17. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji

    2011-01-01

    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  18. Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction

    PubMed Central

    Dong, X. Y.; Li, W. H.; Zhu, J. L.; Liu, W. J.; Zhao, M. Q.; Luo, Y. W.; Chen, J. D.

    2015-01-01

    Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance. PMID:27175171

  19. Mycobacterium avium restriction fragment length polymorphism-IS IS1245 and the simple double repetitive element polymerase chain reaction typing method to screen genetic diversity in Brazilian strains.

    PubMed

    Sequeira, Patrícia Carvalho de; Fonseca, Leila de Souza; Silva, Marlei Gomes da; Saad, Maria Helena Féres

    2005-11-01

    Simple double repetitive element polymerase chain reaction (MaDRE-PCR) and Pvu II-IS1245 restriction fragment length polymorphism (RFLP) typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 AIDS inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.

  20. Bacterial Polysaccharide Co-Polymerases Share a Common Framework for Control of Polymer Length

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tocilj,A.; Munger, C.; Proteau, A.

    2008-01-01

    The chain length distribution of complex polysaccharides present on the bacterial surface is determined by polysaccharide co-polymerases (PCPs) anchored in the inner membrane. We report crystal structures of the periplasmic domains of three PCPs that impart substantially different chain length distributions to surface polysaccharides. Despite very low sequence similarities, they have a common protomer structure with a long central alpha-helix extending 100 Angstroms into the periplasm. The protomers self-assemble into bell-shaped oligomers of variable sizes, with a large internal cavity. Electron microscopy shows that one of the full-length PCPs has a similar organization as that observed in the crystal formore » its periplasmic domain alone. Functional studies suggest that the top of the PCP oligomers is an important region for determining polysaccharide modal length. These structures provide a detailed view of components of the bacterial polysaccharide assembly machinery.« less

  1. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    USGS Publications Warehouse

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  2. Effective characterization of Salmonella Enteritidis by most probable number (MPN) followed by multiplex polymerase chain reaction (PCR) methods.

    PubMed

    Zappelini, Lincohn; Martone-Rocha, Solange; Dropa, Milena; Matté, Maria Helena; Tiba, Monique Ribeiro; Breternitz, Bruna Suellen; Razzolini, Maria Tereza Pepe

    2017-02-01

    Nontyphoidal Salmonella (NTS) is a relevant pathogen involved in gastroenteritis outbreaks worldwide. In this study, we determined the capacity to combine the most probable number (MPN) and multiplex polymerase chain reaction (PCR) methods to characterize the most important Salmonella serotypes in raw sewage. A total of 499 isolates were recovered from 27 raw sewage samples and screened using two previously described multiplex PCR methods. From those, 123 isolates were selected based on PCR banding pattern-identical or similar to Salmonella Enteritidis and Salmonella Typhimurium-and submitted to conventional serotyping. Results showed that both PCR assays correctly serotyped Salmonella Enteritidis, however, they presented ambiguous results for Salmonella Typhimurium identification. These data highlight that MPN and multiplex PCR can be useful methods to describe microbial quality in raw sewage and suggest two new PCR patterns for Salmonella Enteritidis identification.

  3. Studies on sex-organ development. Changes in chromatin structure during spermatogenesis in maturing rooster testis as demonstrated by the initiation pattern of ribonucleic acid synthesis in vitro.

    PubMed Central

    Mezquita, C; Teng, C S

    1978-01-01

    To probe the structural change in the genome of the differentiating germ cell of the maturing rooster testis, the chromatin from nuclei at various stages of differentiation were transcribed with prokaryotic RNA polymerase from Escherichia coli or with eukaryotic RNA polymerase II from wheat germ. The transcription was performed under conditions of blockage of RNA chain reinitiation in vitro with rifampicin or rifampicin AF/013. With the E. coli enzyme, the changes in (1) the titration curve for the enzyme-chromatin interaction, (2) the number of initiation sites, (3) the rate of elongation of RNA chains, and (4) the kinetics of the formation of stable initiation complexes revealed the unmasking of DNA in elongated spermatids and the masking of DNA in spermatozoa. In both cases the stability of the DNA duplex in the initiation region for RNA synthesis greatly increased. In contrast with the E. coli enzyme, the wheat-germ RNA polymerase II was relatively inefficient at transcribing chromatin of elongated spermatids. Such behaviour can be predicted if unmasked double-stranded DNA is present in elongated spermatids. PMID:346018

  4. Gene Polymorphism Studies in a Teaching Laboratory

    ERIC Educational Resources Information Center

    Shultz, Jeffry

    2009-01-01

    I present a laboratory procedure for illustrating transcription, post-transcriptional modification, gene conservation, and comparative genetics for use in undergraduate biology education. Students are individually assigned genes in a targeted biochemical pathway, for which they design and test polymerase chain reaction (PCR) primers. In this…

  5. Detection of Porphyromonas endodontalis in infected root canals by 16S rRNA gene-directed polymerase chain reaction.

    PubMed

    Machado de Oliveira, J C; Siqueira, J F; Alves, G B; Hirata, R; Andrade, A F

    2000-12-01

    Porphyromonas endodontalis has been isolated from the endodontic infections mainly in symptomatic teeth. This study evaluated the occurrence of P. endodontalis in both symptomatic and asymptomatic endodontic infections using 16S rRNA gene-directed polymerase chain reaction. P. endodontalis was detected in 39.5% of the cases (17 of 43 teeth). It was present in 4 of the 6 cases with acute periradicular abscess (66.7%) and in 13 of the 37 other cases (35.1%). The presence of P. endodontalis was associated with an asymptomatic periradicular lesion in 6 cases (25%) and in 10 teeth with tenderness to percussion (52.6%). P. endodontalis was also found in one asymptomatic case without evidence of periradicular pathosis. Our results indicated that, although P. endodontalis is commonly detected in symptomatic cases, it can be present in asymptomatic root canal infections. Further studies should determine if this bacterial species is really an important endodontopathogen.

  6. Actinomyces israelii in radicular cysts: a molecular study.

    PubMed

    Gomes, Nathália Rodrigues; Diniz, Marina Gonçalves; Pereira, Thais Dos Santos Fontes; Estrela, Carlos; de Macedo Farias, Luiz; de Andrade, Bruno Augusto Benevenuto; Gomes, Carolina Cavaliéri; Gomez, Ricardo Santiago

    2017-05-01

    To investigate whether the microscopic filamentous aggregates observed in radicular cysts are associated with the molecular identification of Actinomyces israelii. Moreover, to verify whether this bacterium can be detected in radicular cyst specimens not presenting aggregates. Microscopic colonies suggestive of Actinomyces were found in 8 out of 279 radicular cyst samples (case group). The case and control groups (n = 12; samples without filamentous colonies) were submitted to the semi-nested polymerase chain reaction to test the presence of A israelii. DNA sequencing was performed to validate polymerase chain reaction results. Two and 3 samples in the case and control groups, respectively, did not present a functional genomic DNA template and were excluded from the study. A israelii was identified in all samples of the case group and in 3 out of 9 samples of the control group. Although A israelii is more commonly identified in radicular cysts presenting filamentous aggregates, it also appears to be detected in radicular cysts without this microscopic finding. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. The Collaborative Ocular Tuberculosis Study (COTS)-1 Report 3: Polymerase Chain Reaction in the Diagnosis and Management of Tubercular Uveitis: Global Trends.

    PubMed

    Agarwal, Aniruddha; Agrawal, Rupesh; Gunasekaran, Dinesh Visva; Raje, Dhananjay; Gupta, Bhaskar; Aggarwal, Kanika; Murthy, Somasheila L; Westcott, Mark; Chee, Soon Phaik; Mccluskey, Peter; Su Ling, Ho; Teoh, Stephen; Cimino, Luca; Biswas, Jyotirmay; Narain, Shishir; Agarwal, Manisha; Mahendradas, Padmamalini; Khairallah, Moncef; Jones, Nicholas; Tugal-Tutkun, Ilknur; Babu, Kalpana; Basu, Soumayava; Carreño, Ester; Lee, Richard; Al-Dhibi, Hassan; Bodaghi, Bahram; Invernizzi, Alessandro; Goldstein, Debra A; Herbort, Carl P; Barisani-Asenbauer, Talin; González-López, Julio J; Androudi, Sofia; Bansal, Reema; Moharana, Bruttendu; Mahajan, Sarakshi; Esposti, Simona; Tasiopoulou, Anastasia; Nadarajah, Sengal; Agarwal, Mamta; Abraham, Sharanya; Vala, Ruchi; Singh, Ramandeep; Sharma, Aman; Sharma, Kusum; Zierhut, Manfred; Kon, Onn Min; Cunningham, Emmett; Nguyen, Quan Dong; Pavesio, Carlos; Gupta, Vishali

    2017-12-20

    To analyze the role of polymerase chain reaction (PCR) of ocular fluids in management of tubercular (TB) anterior, intermediate, posterior, and panuveitis. In Collaborative Ocular Tuberculosis Study (COTS)-1 (25 centers, n = 962), patients with TB-related uveitis were included. 59 patients undergoing PCR of intraocular fluids (18 females; 53 Asian Indians) were included. 59 (6.13%) of COTS-1 underwent PCR analysis. PCR was positive for Mycobacterium TB in 33 patients (23 males; all Asian Indians). 26 patients were PCR negative (18 males). Eight patients with negative PCR had systemic TB. Anti-TB therapy was given in 18 negative and 31 PCR cases. At 1-year follow-up, five patients with positive PCR (15.15%) and three with negative PCR (11.54%) had persistence/worsening of inflammation. Data from COTS-1 suggest that PCR is not commonly done for diagnosing intraocular TB and positive/negative results may not influence management or treatment outcomes in the real world scenario.

  8. Presence of Legionellaceae in warm water supplies and typing of strains by polymerase chain reaction.

    PubMed Central

    Zietz, B.; Wiese, J.; Brengelmann, F.; Dunkelberg, H.

    2001-01-01

    Outbreaks of Legionnaire's disease present a public health challenge especially because fatal outcomes still remain frequent. The aim of this study was to describe the abundance and epidemiology of Legionellaceae in the human-made environment. Water was sampled from hot-water taps in private and public buildings across the area of Göttingen, Germany, including distant suburbs. Following isolation, we used polymerase chain reaction in order to generate strain specific banding profiles of legionella isolates. In total, 70 buildings were examined. Of these 18 (26%) had the bacterium in at least one water sample. Legionella pneumophila serogroups 1, 4, 5 and 6 could be identified in the water samples. Most of the buildings were colonized solely by one distinct strain, as proven by PCR. In three cases equal patterns were found in separate buildings. There were two buildings in this study where isolates with different serogroups were found at the same time. PMID:11293675

  9. DNA polymerase preference determines PCR priming efficiency.

    PubMed

    Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

    2014-01-30

    Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.

  10. Single polysaccharide assembly protein that integrates polymerization, termination, and chain-length quality control

    PubMed Central

    Williams, Danielle M.; Ovchinnikova, Olga G.; Koizumi, Akihiko; Mainprize, Iain L.; Kimber, Matthew S.; Lowary, Todd L.

    2017-01-01

    Lipopolysaccharides (LPS) are essential outer membrane glycolipids in most gram-negative bacteria. Biosynthesis of the O-antigenic polysaccharide (OPS) component of LPS follows one of three widely distributed strategies, and similar processes are used to assemble other bacterial surface glycoconjugates. This study focuses on the ATP-binding cassette (ABC) transporter-dependent pathway, where glycans are completed on undecaprenyl diphosphate carriers at the cytosol:membrane interface, before export by the ABC transporter. We describe Raoultella terrigena WbbB, a prototype for a family of proteins that, remarkably, integrates several key activities in polysaccharide biosynthesis into a single polypeptide. WbbB contains three glycosyltransferase (GT) modules. Each of the GT102 and GT103 modules characterized here represents a previously unrecognized GT family. They form a polymerase, generating a polysaccharide of [4)-α-Rhap-(1→3)-β-GlcpNAc-(1→] repeat units. The polymer chain is terminated by a β-linked Kdo (3-deoxy-d-manno-oct-2-ulosonic acid) residue added by a third GT module belonging to the recently discovered GT99 family. The polymerase GT modules are separated from the GT99 chain terminator by a coiled-coil structure that forms a molecular ruler to determine product length. Different GT modules in the polymerase domains of other family members produce diversified OPS structures. These findings offer insight into glycan assembly mechanisms and the generation of antigenic diversity as well as potential tools for glycoengineering. PMID:28137848

  11. A Sensitive Detection Method for MPLW515L or MPLW515K Mutation in Chronic Myeloproliferative Disorders with Locked Nucleic Acid-Modified Probes and Real-Time Polymerase Chain Reaction

    PubMed Central

    Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.

    2008-01-01

    Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880

  12. No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

    PubMed

    D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

    2006-10-01

    Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

  13. Correlation between quantitative PCR and Culture-Based methods for measuring Enterococcus spp. over various temporal scales at three California marine beaches

    EPA Science Inventory

    Several studies have examined how fecal indicator bacteria (FIB) measurements compare between quantitative polymerase chain reaction (QPCR) and the culture methods it is intended to replace. Here we extend those studies by examining the stability of that relationship within a be...

  14. The Learning Gains and Student Perceptions of a Second Life Virtual Lab

    ERIC Educational Resources Information Center

    Cobb, Stephanie; Heaney, Rose; Corcoran, Olivia; Henderson-Begg, Stephanie

    2009-01-01

    This study examines students' reactions to the virtual biosciences laboratory developed in Second Life[R] (SL) at the University of East London. Final year undergraduates and masters students studying biotechnology took part in a trial of a virtual Polymerase Chain Reaction (PCR) experiment in Second Life and evaluated their experience by…

  15. Using the rate of bacterial clearance determined by real-time polymerase chain reaction as a timely surrogate marker to evaluate the appropriateness of antibiotic usage in critical patients with Acinetobacter baumannii bacteremia.

    PubMed

    Chuang, Yu-Chung; Chang, Shan-Chwen; Wang, Wei-Kung

    2012-08-01

    Bacteremia caused by Acinetobacter baumannii is becoming more frequent among critically ill patients, and has been associated with high mortality and prolonged hospital stay. Multidrug resistance and delay in blood culture have been shown to be significant barriers to appropriate antibiotic treatment. Quantitative polymerase chain reaction assays were recently used to monitor bacterial loads; we hypothesized that the rate of bacterial clearance determined by quantitative polymerase chain reaction can be used as a timely surrogate marker to evaluate the appropriateness of antibiotic usage. Prospective observational study. University hospital and research laboratory. Patients with culture-proven A. baumannii bacteremia in the intensive care units were prospectively enrolled from April 2008 to February 2009. Plasmid Oxa-51/pCRII-TOPO, which contained a 431-bp fragment of the A. baumannii-specific Oxa-51 gene in a pCRII-TOPO vector, was used as the standard. Sequential bacterial DNA loads in the blood were measured by a quantitative polymerase chain reaction assay. We enrolled 51 patients with A. baumannii bacteremia, and examined 318 sequential whole blood samples. The initial mean bacterial load was 2.15 log copies/mL, and the rate of bacterial clearance was 0.088 log copies/mL/day. Multivariate linear regression using the generalized estimation equation approach revealed that the use of immunosuppressants was an independent predictor for slower bacterial clearance (coefficient, 1.116; p<.001), and appropriate antibiotic usage was an independent predictor for more rapid bacterial clearance (coefficient, -0.995; p<.001). Patients with a slower rate of bacterial clearance experienced higher in-hospital mortality (odds ratio, 2.323; p=.04) Immunosuppression and appropriate antibiotic usage were independent factors affecting the rate of clearance of A. baumannii bacteremia in critical patients. These findings highlight the importance of appropriate antibiotic usage and development of effective antibiotics against A. baumannii in an era of emerging antibiotic resistance. The rate of bacterial clearance could serve as a timely surrogate marker for evaluating the appropriateness of antibiotics.

  16. Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections.

    PubMed

    Siqueira, José F; Rôças, Isabela N

    2003-08-01

    Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and persistent endodontic infections. This strengthens the assumption that this bacterial species is an endodontic pathogen associated with different forms of periradicular diseases. In contrast, A radicidentis was only occasionally detected in the patients examined. The role played by this species in endodontic infections remains to be clarified.

  17. Polymerase chain displacement reaction.

    PubMed

    Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang

    2013-02-01

    Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.

  18. [The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

    PubMed

    D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

    1993-01-01

    The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.

  19. Utilizing a polymerase chain reaction method for the detection of Toxocara canis and T. cati eggs in soil.

    PubMed

    Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H

    2007-03-01

    A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.

  20. Diagnosis of feline leukaemia virus infection by semi-quantitative real-time polymerase chain reaction.

    PubMed

    Pinches, Mark D G; Helps, Christopher R; Gruffydd-Jones, Tim J; Egan, Kathy; Jarrett, Oswald; Tasker, Séverine

    2007-02-01

    In this paper the design and use of a semi-quantitative real-time polymerase chain reaction assay (RT-PCR) for feline leukaemia virus (FeLV) provirus is described. Its performance is evaluated against established methods of FeLV diagnosis, including virus isolation and enzyme-linked immunoassay (ELISA) in a population of naturally infected cats. The RT-PCR assay is found to have both a high sensitivity (0.92) and specificity (0.99) when examined by expectation maximisation methods and is also able to detect a large number of cats with low FeLV proviral loads that were negative by other conventional test methods.

  1. Polymerase chain reaction-based detection of myc transduction in feline leukemia virus-infected cats.

    PubMed

    Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo

    2018-04-01

    Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.

  2. Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.

    PubMed

    Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C

    2012-09-27

    We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.

  3. Illegitimate transcription: transcription of any gene in any cell type.

    PubMed Central

    Chelly, J; Concordet, J P; Kaplan, J C; Kahn, A

    1989-01-01

    Using in vitro amplification of cDNA by the polymerase chain reaction, we have detected spliced transcripts of various tissue-specific genes (genes for anti-Müllerian hormone, beta-globin, aldolase A, and factor VIIIc) in human nonspecific cells, such as fibroblasts, hepatoma cells, and lymphoblasts. In rats, erythroid- and liver-type pyruvate kinase transcripts were also detected in brain, lung, and muscle. The abundance of these "illegitimate" transcripts is very low; yet, their existence and the possibility of amplifying them by the cDNA polymerase chain reaction provide a powerful tool to analyze pathological transcripts of any tissue-specific gene by using any accessible cell. Images PMID:2495532

  4. A Novel Mechanism of Sugar Selection Utilized by a Human X-family DNA Polymerase†

    PubMed Central

    Brown, Jessica A.; Fiala, Kevin A.; Fowler, Jason D.; Sherrer, Shanen M.; Newmister, Sean A.; Dyum, Wade W.; Suo, Zucai

    2009-01-01

    During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2′-hydroxyl group and the bulky side chain of an active site residue. Here, we demonstrated that human DNA polymerase λ used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2′-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such a steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2′ position. PMID:19900463

  5. DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

    PubMed

    Guthrie, J N; Moriarty, D J; Blackall, L L

    2000-12-15

    A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

  6. Use of polymerase chain reaction (PCR) in the diagnosis of congenital toxoplasmosis.

    PubMed

    Loveridge-Easther, Cam; Yardley, Anne-Marie; Breidenstein, Brenda

    2018-06-01

    Congenital toxoplasmosis (CT) is a parasitic disease that causes serious fetal and neonatal harm or death. In countries that do not have antenatal screening programs, the initiation of CT treatment relies on a postnatal diagnosis. Until recently, diagnosis was based on clinical signs and immunoglobulin seropositivity, which is fraught with difficulty. In these cases, diagnosis was often delayed or treatment, which carries risk, started empirically. We highlight the use of polymerase chain reaction to diagnose a case of congenital toxoplasmosis, allowing early treatment and justifying the treatment burden. Copyright © 2018 American Association for Pediatric Ophthalmology and Strabismus. Published by Elsevier Inc. All rights reserved.

  7. Diagnosis of ocular toxoplasmosis by two polymerase chain reaction (PCR) examinations: qualitative multiplex and quantitative real-time.

    PubMed

    Sugita, Sunao; Ogawa, Manabu; Inoue, Shizu; Shimizu, Norio; Mochizuki, Manabu

    2011-09-01

    To establish a two-step polymerase chain reaction (PCR) diagnostic system for ocular toxoplasmosis. A total of 13 ocular fluid samples (11 aqueous humor and 2 vitreous fluid) were collected from 13 patients with clinically suspected ocular toxoplasmosis. Ten ocular samples from other uveitis patients and 20 samples from subjects without ocular inflammation were used as controls. Two polymerase chain reaction (PCR) methods, i.e., qualitative multiplex PCR and quantitative real-time PCR, were used to measure the toxoplasma genome (T. gondii B1 gene). Qualitative multiplex PCR detected T. gondii B1 gene in the ocular fluids of 11 out of 13 patients with clinically suspected ocular toxoplasmosis. In real-time PCR, we detected high copy numbers of T. gondii DNA (5.1 × 10(2)-2.1 × 10(6) copies/mL) in a total of 10 patients (10/13, 77%). Only ocular toxoplasmosis scar lesions were observed in the three real-time PCR-negative patients. PCR assay results for the samples from the two control groups were all negative. The two-step PCR examination to detect toxoplasma DNA is a useful tool for diagnosing ocular toxoplasmosis.

  8. Differentiation of human-induced pluripotent stem cells into insulin-producing clusters.

    PubMed

    Shaer, Anahita; Azarpira, Negar; Vahdati, Akbar; Karimi, Mohammad Hosein; Shariati, Mehrdad

    2015-02-01

    In diabetes mellitus type 1, beta cells are mostly destroyed; while in diabetes mellitus type 2, beta cells are reduced by 40% to 60%. We hope that soon, stem cells can be used in diabetes therapy via pancreatic beta cell replacement. Induced pluripotent stem cells are a kind of stem cell taken from an adult somatic cell by "stimulating" certain genes. These induced pluripotent stem cells may be a promising source of cell therapy. This study sought to produce isletlike clusters of insulin-producing cells taken from induced pluripotent stem cells. A human-induced pluripotent stem cell line was induced into isletlike clusters via a 4-step protocol, by adding insulin, transferrin, and selenium (ITS), N2, B27, fibroblast growth factor, and nicotinamide. During differentiation, expression of pancreatic β-cell genes was evaluated by reverse transcriptase-polymerase chain reaction; the morphologic changes of induced pluripotent stem cells toward isletlike clusters were observed by a light microscope. Dithizone staining was used to stain these isletlike clusters. Insulin produced by these clusters was evaluated by radio immunosorbent assay, and the secretion capacity was analyzed with a glucose challenge test. Differentiation was evaluated by analyzing the morphology, dithizone staining, real-time quantitative polymerase chain reaction, and immunocytochemistry. Gene expression of insulin, glucagon, PDX1, NGN3, PAX4, PAX6, NKX6.1, KIR6.2, and GLUT2 were documented by analyzing real-time quantitative polymerase chain reaction. Dithizone-stained cellular clusters were observed after 23 days. The isletlike clusters significantly produced insulin. The isletlike clusters could increase insulin secretion after a glucose challenge test. This work provides a model for studying the differentiation of human-induced pluripotent stem cells to insulin-producing cells.

  9. Expression of Connexin 43 in Synovial Tissue of Patients With Rheumatoid Arthritis

    PubMed Central

    MATSUKI, Tomohiro; TSUCHIDA, Shinji; TERAUCHI, Ryu; ODA, Ryo; FUJIWARA, Hiroyoshi; MAZDA, Osam; KUBO, Toshikazu

    2016-01-01

    Objectives This study aims to identify the distribution and expression level of connexin 43 (Cx43) in synovial tissue in patients with rheumatoid arthritis (RA). Patients and methods The expression of Cx43 in synovial tissue from eight patients with RA (2 males, 6 females; mean age 59.5±2.7 years; range 52 to 71 years), five patients with osteoarthritis (2 males, 3 females; mean age 68.4±2.7 years; range 61 to 81 years), and one normal female subject (mean age 61 year) was analyzed by quantitative reverse transcriptase polymerase chain reaction and immunohistochemistry of tissue sections. Induction of Cx43 following stimulation of human RA synovial fibroblasts with tumor necrosis factor-alpha (TNF-a) cultures was examined by quantitative reverse transcriptase polymerase chain reaction. The effect of small interfering ribonucleic acid targeting Cx43 (siCx43) on the expression of TNF-a and interleukin-6 was examined using quantitative reverse transcriptase polymerase chain reaction and enzyme-linked immunosorbent assays. Results Connexin 43 was highly expressed in RA synovial tissue, which also expressed TNF-a, but was expressed lower in osteoarthritis and normal synovial tissue. Expression of Cx43 was markedly up-regulated in RA synovial fibroblasts after stimulation with TNF-a. The over-expression of pro- inflammatory cytokines was suppressed by transfection of siCx43. Conclusion This study shows that Cx43 is expressed in RA synovial tissue and that its expression is induced by stimulation with TNF-a. The expression of the pro-inflammatory cytokines was inhibited by transfection of siCx43. Cx43 may be a novel marker of inflammation in RA synovial tissue. PMID:29900991

  10. First report of Toxoplasma gondii sporulated oocysts and Giardia duodenalis in commercial green-lipped mussels (Perna canaliculus) in New Zealand.

    PubMed

    Coupe, Alicia; Howe, Laryssa; Burrows, Elizabeth; Sine, Abigail; Pita, Anthony; Velathanthiri, Niluka; Vallée, Emilie; Hayman, David; Shapiro, Karen; Roe, Wendi D

    2018-05-01

    Pollution of marine ecosystems with the protozoan parasites Toxoplasma gondii, Cryptosporidium spp. and Giardia duodenalis can be studied using bivalve shellfish as biosentinels. Although evidence suggests that these parasites are present in New Zealand coastal waters, the extent of protozoal pollution has not been investigated. This study used optimised molecular methods to detect the presence of Cryptosporidium spp., G. duodenalis and T. gondii in commercially sourced green-lipped mussel (Perna canaliculus), an endemic species found throughout coastal New Zealand. A nested polymerase chain reaction was validated for detection of T. gondii DNA and applied to 104 commercially sourced mussels. Thirteen mussels were positive for T. gondii DNA with an estimated true prevalence of 16.4% using Bayesian statistics, and the presence of T. gondii in mussels was significantly associated with collection during the summer compared with that in the winter (P = 0.003). Consumption of contaminated shellfish may also pose a health risk for humans and marine wildlife. As only sporulated T. gondii oocysts can be infectious, a reverse transcriptase-polymerase chain reaction was used to confirm presence of a sporozoite-specific marker (SporoSAG), detected in four mussels. G. duodenalis assemblage B, known to be pathogenic in humans, was also discovered in 1% mussels, tested by polymerase chain reaction (n = 90). Cryptosporidium spp. was not detected in the sampled mussel haemolymph. Results suggest that New Zealand may have high levels of coastal contamination with T. gondii, particularly in summer months, and that naturally exposed mussels can ingest and retain sporulated oocysts, further establishing shellfish consumption as a health concern.

  11. Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

    PubMed Central

    Atherton, Richard; Bhavnani, Darlene; Calvopiña, Manuel; Vicuña, Yosselin; Cevallos, William; Eisenberg, Joseph

    2013-01-01

    The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay) were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh) gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61%) were classified as assemblage B (26 as BIII and 16 as BIV), 22 (32%) as assemblage A (3 as AI and 19 as AII) and five (7%) as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A. PMID:23827993

  12. Identification of Echinococcus granulosus strains using polymerase chain reaction-restriction fragment length polymorphism amongst livestock in Moroto district, Uganda.

    PubMed

    Chamai, Martin; Omadang, Leonard; Erume, Joseph; Ocaido, Michael; Oba, Peter; Othieno, Emmanuel; Bonaventure, Straton; Kitibwa, Annah

    2016-07-29

    A descriptive study was conducted to identify the different strains of Echinococcus granulosus occurring in livestock in Moroto district, Uganda. Echinococcus cysts from 104 domestic animals, including cattle, sheep, goats and camels, were taken and examined by microscopy, polymerase chain reaction with restriction fragment length polymorphism and Sanger DNA sequencing. Echinococcus granulosus genotypes or strains were identified through use of Bioinformatics tools: BioEdit, BLAST and MEGA6. The major finding of this study was the existence of a limited number of E. granulosus genotypes from cattle, goats, sheep and camels. The most predominant genotype was G1 (96.05%), corresponding to the common sheep strain. To a limited extent (3.95%), the study revealed the existence of Echinococcus canadensis G6/7 in three (n = 3) of the E. granulosus-positive samples. No other strains of E. granulosus were identified. It was concluded that the common sheep strain of Echinococcus sensu stricto and G6/7 of E. canadensis were responsible for echinococcal disease in Moroto district, Uganda.

  13. Genomic DNA-based absolute quantification of gene expression in Vitis

    USDA-ARS?s Scientific Manuscript database

    Many studies in which gene expression is quantified by polymerase chain reaction represent the expression of a gene of interest (GOI) relative to that of a reference gene (RG). Relative expression is founded on the assumptions that RG expression is stable across samples, treatments, organs, etc., an...

  14. Reactivation of chickenpox contracted in infancy.

    PubMed Central

    Terada, K; Kawano, S; Hiraga, Y; Morita, T

    1995-01-01

    Varicella zoster virus DNA in mononuclear cells was studied by the polymerase chain reaction to obtain virological evidence of reactivation in the children who had contracted chickenpox in infancy. The results appear to explain why chickenpox in infancy is a risk factor for herpes zoster in immunocompetent children. PMID:7574864

  15. Results of the 2009 ASBVd survey of avocado accessions in the national germplasm collection in Florida

    USDA-ARS?s Scientific Manuscript database

    The presence of Avocado Sunblotch Viroid (ASBVd) infection among the avocado (Persea americana Mill.) accessions in the National Germplasm Repository at Miami (NGR-Mia) was established in previous studies. An ASBVd specific reverse transcription-polymerase chain reaction (RT-PCR) protocol was used t...

  16. A Model of Risk Analysis in Analytical Methodology for Biopharmaceutical Quality Control.

    PubMed

    Andrade, Cleyton Lage; Herrera, Miguel Angel De La O; Lemes, Elezer Monte Blanco

    2018-01-01

    One key quality control parameter for biopharmaceutical products is the analysis of residual cellular DNA. To determine small amounts of DNA (around 100 pg) that may be in a biologically derived drug substance, an analytical method should be sensitive, robust, reliable, and accurate. In principle, three techniques have the ability to measure residual cellular DNA: radioactive dot-blot, a type of hybridization; threshold analysis; and quantitative polymerase chain reaction. Quality risk management is a systematic process for evaluating, controlling, and reporting of risks that may affects method capabilities and supports a scientific and practical approach to decision making. This paper evaluates, by quality risk management, an alternative approach to assessing the performance risks associated with quality control methods used with biopharmaceuticals, using the tool hazard analysis and critical control points. This tool provides the possibility to find the steps in an analytical procedure with higher impact on method performance. By applying these principles to DNA analysis methods, we conclude that the radioactive dot-blot assay has the largest number of critical control points, followed by quantitative polymerase chain reaction, and threshold analysis. From the analysis of hazards (i.e., points of method failure) and the associated method procedure critical control points, we conclude that the analytical methodology with the lowest risk for performance failure for residual cellular DNA testing is quantitative polymerase chain reaction. LAY ABSTRACT: In order to mitigate the risk of adverse events by residual cellular DNA that is not completely cleared from downstream production processes, regulatory agencies have required the industry to guarantee a very low level of DNA in biologically derived pharmaceutical products. The technique historically used was radioactive blot hybridization. However, the technique is a challenging method to implement in a quality control laboratory: It is laborious, time consuming, semi-quantitative, and requires a radioisotope. Along with dot-blot hybridization, two alternatives techniques were evaluated: threshold analysis and quantitative polymerase chain reaction. Quality risk management tools were applied to compare the techniques, taking into account the uncertainties, the possibility of circumstances or future events, and their effects upon method performance. By illustrating the application of these tools with DNA methods, we provide an example of how they can be used to support a scientific and practical approach to decision making and can assess and manage method performance risk using such tools. This paper discusses, considering the principles of quality risk management, an additional approach to the development and selection of analytical quality control methods using the risk analysis tool hazard analysis and critical control points. This tool provides the possibility to find the method procedural steps with higher impact on method reliability (called critical control points). Our model concluded that the radioactive dot-blot assay has the larger number of critical control points, followed by quantitative polymerase chain reaction and threshold analysis. Quantitative polymerase chain reaction is shown to be the better alternative analytical methodology in residual cellular DNA analysis. © PDA, Inc. 2018.

  17. Initiation, extension, and termination of RNA synthesis by a paramyxovirus polymerase.

    PubMed

    Jordan, Paul C; Liu, Cheng; Raynaud, Pauline; Lo, Michael K; Spiropoulou, Christina F; Symons, Julian A; Beigelman, Leo; Deval, Jerome

    2018-02-01

    Paramyxoviruses represent a family of RNA viruses causing significant human diseases. These include measles virus, the most infectious virus ever reported, in addition to parainfluenza virus, and other emerging viruses. Paramyxoviruses likely share common replication machinery but their mechanisms of RNA biosynthesis activities and details of their complex polymerase structures are unknown. Mechanistic and functional details of a paramyxovirus polymerase would have sweeping implications for understanding RNA virus replication and for the development of new antiviral medicines. To study paramyxovirus polymerase structure and function, we expressed an active recombinant Nipah virus (NiV) polymerase complex assembled from the multifunctional NiV L protein bound to its phosphoprotein cofactor. NiV is an emerging highly pathogenic virus that causes severe encephalitis and has been declared a global public health concern due to its high mortality rate. Using negative-stain electron microscopy, we demonstrated NiV polymerase forms ring-like particles resembling related RNA polymerases. We identified conserved sequence elements driving recognition of the 3'-terminal genomic promoter by NiV polymerase, and leading to initiation of RNA synthesis, primer extension, and transition to elongation mode. Polyadenylation resulting from NiV polymerase stuttering provides a mechanistic basis for transcription termination. It also suggests a divergent adaptation in promoter recognition between pneumo- and paramyxoviruses. The lack of available antiviral therapy for NiV prompted us to identify the triphosphate forms of R1479 and GS-5734, two clinically relevant nucleotide analogs, as substrates and inhibitors of NiV polymerase activity by delayed chain termination. Overall, these findings provide low-resolution structural details and the mechanism of an RNA polymerase from a previously uncharacterized virus family. This work illustrates important functional differences yet remarkable similarities between the polymerases of nonsegmented negative-strand RNA viruses.

  18. One-Step Reverse Transcription-Polymerase Chain Reaction for Ebola and Marburg Viruses.

    PubMed

    Park, Sun-Whan; Lee, Ye-Ji; Lee, Won-Ja; Jee, Youngmee; Choi, WooYoung

    2016-06-01

    Ebola and Marburg viruses (EBOVs and MARVs, respectively) are causative agents of severe hemorrhagic fever with high mortality rates in humans and nonhuman primates. In 2014, there was a major Ebola outbreak in various countries in West Africa, including Guinea, Liberia, Republic of Sierra Leone, and Nigeria. EBOV and MARV are clinically difficult to diagnose and distinguish from other African epidemic diseases. Therefore, in this study, we aimed to develop a method for rapid identification of the virus to prevent the spread of infection. We established a conventional one-step reverse transcription-polymerase chain reaction (RT-PCR) assay for these pathogens based on the Superscript Reverse Transcriptase-Platinum Taq polymerase enzyme mixture. All assays were thoroughly optimized using in vitro-transcribed RNA. We designed seven primer sets of nucleocapsid protein (NP) genes based on sequences from seven filoviruses, including five EBOVs and two MARVs. To evaluate the sensitivity of the RT-PCR assay for each filovirus, 10-fold serial dilutions of synthetic viral RNA transcripts of EBOV or MARV NP genes were used to assess detection limits of viral RNA copies. The potential for these primers to cross react with other filoviruses was also examined. The results showed that the primers were specific for individual genotype detection in the examined filoviruses. The assay established in this study may facilitate rapid, reliable laboratory diagnosis in suspected cases of Ebola and Marburg hemorrhagic fevers.

  19. [First attempts of detecting fetal cells in the maternal circulation].

    PubMed

    Nagy, Gyula Richárd; Bán, Zoltán; Sipos, Ferenc; Fent, János; Oroszné Nagy, Judit; Beke, Artúr; Furész, József; Papp, Zoltán

    2004-10-31

    In prenatal diagnosis there is great interest for noninvasive diagnostic methods. Authors report their first results in detecting fetal cells in the maternal circulation during pregnancy. The aim of the study was to detect fetal gender from maternal peripheral blood samples during pregnancy. Authors have analysed fetal nucleated red blood cells. In 12 cases after a double density Percoll gradient separation they labelled the surface antigens of the cells with anti-glycophorin-A and anti-CD45 fluorescent antibodies, did an intracellular staining of the epsilon haemoglobin chain, and analysed the cells with flow cytometry. The CD45 negative/glycophorin-A positive/epsilon-haemoglobin chain positive cells were considered as fetal cells. Having the results, in another 13 cases magnetic activated cell sorting with CD71 antibody were used as an enrichment step. Authors made an intracellular staining of the epsilon haemoglobin chain, the positive cells were isolated by micromanipulation, and analysed by single cell fluorescent polymerase chain reaction. Primers for the amelogenin gene were used to detect fetal gender. Only the Percoll enrichment step itself is not enough for using the samples for diagnostic molecular-biologic examinations, a following enrichment step is needed. For this the authors used magnetic activated cell sorting with CD71 antibody. With the help of this enrichment step, after the intracellular staining of the epsilon haemoglobin chain the direct micromanipulator isolation of the epsilon haemoglobin chain positive cells could be done. After analysing single cells by fluorescent polymerase chain reaction, in 8 out of the 11 comparable cases the results were similar to those, what was found during the genetic amniocentesis. In 2 cases from this 8, genetic amniocentesis proved Klinefelter syndrome, which they could also confirm with the examination of fetal cells in the maternal circulation. The results of the study suggest that the method described above can be useful in prenatal genetic diagnosis, and improving it could be useful to detect other genetic abnormalities (chromosomal abnormalities, single gene disorders) as well.

  20. Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).

    PubMed

    Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli

    2018-02-26

    Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.

  1. MHC Class I Chain-Related Gene A Polymorphisms and Linkage Disequilibrium with HLA-B and HLA-C Alleles in Ocular Toxoplasmosis.

    PubMed

    Ayo, Christiane Maria; Camargo, Ana Vitória da Silveira; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Previato, Mariana; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; Barbosa, Amanda Pires; Brandão de Mattos, Cinara de Cássia; de Mattos, Luiz Carlos

    2015-01-01

    This study investigated whether polymorphisms of the MICA (major histocompatibility complex class I chain-related gene A) gene are associated with eye lesions due to Toxoplasma gondii infection in a group of immunocompetent patients from southeastern Brazil. The study enrolled 297 patients with serological diagnosis of toxoplasmosis. Participants were classified into two distinct groups after conducting fundoscopic exams according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of the ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping of the MICA and HLA alleles was performed by the polymerase chain reaction-sequence specific oligonucleotide technique (PCR-SSO; One Lambda®) and the MICA-129 polymorphism (rs1051792) was identified by nested polymerase chain reaction (PCR-RFLP). Significant associations involving MICA polymorphisms were not found. Although the MICA*002~HLA-B*35 haplotype was associated with increased risk of developing ocular toxoplasmosis (P-value = 0.04; OR = 2.20; 95% CI = 1.05-4.60), and the MICA*008~HLA-C*07 haplotype was associated with protection against the development of manifestations of ocular toxoplasmosis (P-value = 0.009; OR: 0.44; 95% CI: 0.22-0.76), these associations were not statistically significant after adjusting for multiple comparisons. MICA polymorphisms do not appear to influence the development of ocular lesions in patients diagnosed with toxoplasmosis in this study population.

  2. MHC Class I Chain-Related Gene A Polymorphisms and Linkage Disequilibrium with HLA-B and HLA-C Alleles in Ocular Toxoplasmosis

    PubMed Central

    Ayo, Christiane Maria; Camargo, Ana Vitória da Silveira; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Previato, Mariana; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; Barbosa, Amanda Pires; Brandão de Mattos, Cinara de Cássia; de Mattos, Luiz Carlos

    2015-01-01

    This study investigated whether polymorphisms of the MICA (major histocompatibility complex class I chain-related gene A) gene are associated with eye lesions due to Toxoplasma gondii infection in a group of immunocompetent patients from southeastern Brazil. The study enrolled 297 patients with serological diagnosis of toxoplasmosis. Participants were classified into two distinct groups after conducting fundoscopic exams according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of the ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping of the MICA and HLA alleles was performed by the polymerase chain reaction-sequence specific oligonucleotide technique (PCR-SSO; One Lambda®) and the MICA-129 polymorphism (rs1051792) was identified by nested polymerase chain reaction (PCR-RFLP). Significant associations involving MICA polymorphisms were not found. Although the MICA*002~HLA-B*35 haplotype was associated with increased risk of developing ocular toxoplasmosis (P-value = 0.04; OR = 2.20; 95% CI = 1.05–4.60), and the MICA*008~HLA-C*07 haplotype was associated with protection against the development of manifestations of ocular toxoplasmosis (P-value = 0.009; OR: 0.44; 95% CI: 0.22–0.76), these associations were not statistically significant after adjusting for multiple comparisons. MICA polymorphisms do not appear to influence the development of ocular lesions in patients diagnosed with toxoplasmosis in this study population. PMID:26672749

  3. Sustained high-throughput polymerase chain reaction diagnostics during the European epidemic of Bluetongue virus serotype 8.

    PubMed

    van Rijn, Piet A; Heutink, René G; Boonstra, Jan; Kramps, Hans A; van Gennip, René G P

    2012-05-01

    A real-time reverse transcription polymerase chain reaction assay (PCR test) based on genome segment 10 of Bluetongue virus (BTV) was developed. The PCR test consists of robotized viral RNA isolation from blood samples and an all-in-one method including initial denaturation of genomic double-stranded RNA, reverse transcription polymerase chain reaction (RT-PCR), and real-time detection and analysis. Reference strains of the 24 recognized BTV serotypes, isolates from different years, and geographic origins were detected. Other orbiviruses such as African horse sickness virus, Epizootic hemorrhagic disease virus, and Equine encephalosis virus were not detected. Experimentally infected animals were PCR positive from 2 days postinoculation, which was earlier than fever, other clinical signs, or seroconversion. The diagnostic sensitivity and specificity were very close to or even 100%. The PCR test played a key role in the detection of BTV serotype 8 in August 2006 in The Netherlands. The outbreak in a completely naive ruminant population allowed for further evaluation of the PCR test with field samples. In 2006, the correlation between enzyme-linked immunosorbent assay and PCR results was estimated to be 95%. In the following years, the PCR test was used for diagnosis of diseased animals, for testing of healthy animals for trade purposes, and for detection of BTV RNA in different species of the insect vector, Culicoides. In the autumn of 2008, BTV serotype 6 unexpectedly emerged in northwest Europe and was also detected with the PCR test developed in the current study. The performance in routine use over 5 years has been recorded and evaluated.

  4. COLD-PCR Technologies in the Area of Personalized Medicine: Methodology and Applications.

    PubMed

    Mauger, Florence; How-Kit, Alexandre; Tost, Jörg

    2017-06-01

    Somatic mutations bear great promise for use as biomarkers for personalized medicine, but are often present only in low abundance in biological material and are therefore difficult to detect. Many assays for mutation analysis in cancer-related genes (hotspots) have been developed to improve diagnosis, prognosis, prediction of drug resistance, and monitoring of the response to treatment. Two major approaches have been developed: mutation-specific amplification methods and methods that enrich and detect mutations without prior knowledge on the exact location and identity of the mutation. CO-amplification at Lower Denaturation temperature Polymerase Chain Reaction (COLD-PCR) methods such as full-, fast-, ice- (improved and complete enrichment), enhanced-ice, and temperature-tolerant COLD-PCR make use of a critical temperature in the polymerase chain reaction to selectively denature wild-type-mutant heteroduplexes, allowing the enrichment of rare mutations. Mutations can subsequently be identified using a variety of laboratory technologies such as high-resolution melting, digital polymerase chain reaction, pyrosequencing, Sanger sequencing, or next-generation sequencing. COLD-PCR methods are sensitive, specific, and accurate if appropriately optimized and have a short time to results. A large variety of clinical samples (tumor DNA, circulating cell-free DNA, circulating cell-free fetal DNA, and circulating tumor cells) have been studied using COLD-PCR in many different applications including the detection of genetic changes in cancer and infectious diseases, non-invasive prenatal diagnosis, detection of microorganisms, or DNA methylation analysis. In this review, we describe in detail the different COLD-PCR approaches, highlighting their specificities, advantages, and inconveniences and demonstrating their use in different fields of biological and biomedical research.

  5. Sensitivity, specificity and comparison of three commercially available immunological tests in the diagnosis of Cryptosporidium species in animals.

    PubMed

    Danišová, Olga; Halánová, Monika; Valenčáková, Alexandra; Luptáková, Lenka

    The study was conducted to compare the specificity of immunological diagnostic methods used for the diagnosis of Cryptosporidium species capable of causing life-threatening infection in both immunosuppressed and immunocompetent patients. For the detection of Cryptosporidium species in 79 animals with diarrhoea, we used three Copro-antigen tests: RIDASCREEN ® Cryptosporidium test, Cryptosporidium 2nd Generation (ELISA) and RIDA ® QUICK Cryptosporidium. For immunoassays we used positive and negative samples detected by means of polymerase chain reaction and validated by sequencing and nested polymerase chain reaction to confirm the presence six different species of Cryptosporidium species. Prevalence of cryptosporidiosis in the entire group determined by enzyme immunoassay, enzyme linked immunosorbent assay, immuno-chromatographic test and polymerase chain reaction was 34.17%, 27.84%, 6.33% and 27.84%, respectively. Sensitivity of animal samples with enzyme immunoassay, enzyme linked immunosorbent assay, and immuno-chromatographic test was 63.6%, 40.9% and 22.7%, resp., when questionable samples were considered positive, whereas specificity of enzyme immunoassay, enzyme linked immunosorbent assay and immuno-chromatographic test was 75.9%, 78.9% and 100%, respectively. Positive predictive values and negative predictive values were different for all the tests. These differences results are controversial and therefore reliability and reproducibility of immunoassays as the only diagnostic method is questionable. The use of various Cryptosporidium species in diagnosis based on immunological testing and different results obtained by individual tests indicate potential differences in Copro-antigens produced by individual Cryptosporidium species. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  6. RNA Initiation with Dinucleoside Monophosphates during Transcription of Bacteriophage T4 DNA with RNA Polymerase of Escherichia coli

    PubMed Central

    Hoffman, David J.; Niyogi, Salil K.

    1973-01-01

    The effects of dinucleoside monophosphates on the transcription of phage T4 DNA by E. coli RNA polymerase have been examined at various concentrations of the sigma subunit and extremely low concentration of ribonucleoside triphosphate. The following conclusions were reached: (i) Labeled specific dinucleoside monophosphates are incorporated as chain initiators. (ii) When the ratio of sigma factor to core enzyme is small, there is a general stimulation by most 5′-guanosyl dinucleoside monophosphates. (iii) When the ratio is increased or holoenzyme is present, ApU, CpA, UpA, and GpU are the most effective stimulators. (iv) At high concentrations of sigma factor, only certain adenosine-containing dinucleoside monophosphates (ApU, CpA, UpA, and ApA) stimulate the reaction. (v) Competition hybridization studies indicate that the RNAs stimulated by dinucleoside monophosphates (ApU, CpA, UpA, and GpU) are of the T4 “early” type. (vi) Studies involving both combinations of stimulatory dinucleoside monophosphates and competitive effects of these compounds on chain initiation by ATP and GTP suggest that the stimulatory dinucleoside monophosphates act as chain initiators and may recognize part of a continuous sequence in a promoter region. Studies based on the incorporation of 3H-labeled stimulatory dinucleoside monophosphates support the above conclusions. PMID:4568732

  7. Prevalence of human immunodeficiency virus type 1 p24 antigen in U.S. blood donors--an assessment of the efficacy of testing in donor screening. The HIV-Antigen Study Group.

    PubMed

    Alter, H J; Epstein, J S; Swenson, S G; VanRaden, M J; Ward, J W; Kaslow, R A; Menitove, J E; Klein, H G; Sandler, S G; Sayers, M H

    1990-11-08

    We performed a multicenter study in 1989 to determine whether screening whole-blood donors for human immunodeficiency virus type 1 (HIV-1) p24 antigen would improve transfusion safety by identifying carriers of the virus who are seronegative for HIV-1 antibody. More than 500,000 donations were tested at 13 U.S. blood centers with test kits from two manufacturers. Units found repeatedly reactive were retested in a central laboratory; if the results were positive, they were confirmed by a neutralization assay. A subgroup of units was also tested for HIV-1 by the polymerase chain reaction. Selected donors confirmed or not confirmed as having p24 antigen were contacted for follow-up interviews to identify risk factors and undergo retesting for HIV-1 markers. Positive tests for p24 antigen were confirmed by neutralization in five donors (0.001 percent of all donations tested), all of whom were also positive for HIV-1 antibody and HIV-1 by polymerase chain reaction. Three of the antigen-positive donors had other markers of infectious disease that would have resulted in the exclusion of their blood; two had risk factors for HIV-1 that should have led to self-exclusion. Of 220 blood units with repeatedly reactive p24 antigen whose presence could not be confirmed by neutralization (0.04 percent of the donations studied), none were positive for HIV-1 antibody, HIV-1 by polymerase chain reaction (120 units tested), or virus culture (76 units tested)--attesting to the specificity of confirmatory neutralization. The finding that no donation studied was positive for p24 antigen and negative for HIV-1 antibody suggests that screening donors for p24 antigen with tests of the current level of sensitivity would not add substantially to the safety of the U.S. blood supply.

  8. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    EPA Science Inventory

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  9. Identifying of meat species using polymerase chain reaction (PCR)

    NASA Astrophysics Data System (ADS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  10. Identifying of meat species using polymerase chain reaction (PCR)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reactionmore » (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.« less

  11. Enhancing the specificity of polymerase chain reaction by graphene oxide through surface modification: zwitterionic polymer is superior to other polymers with different charges.

    PubMed

    Zhong, Yong; Huang, Lihong; Zhang, Zhisen; Xiong, Yunjing; Sun, Liping; Weng, Jian

    Graphene oxides (GOs) with different surface characteristics, such as size, reduction degree and charge, are prepared, and their effects on the specificity of polymerase chain reaction (PCR) are investigated. In this study, we demonstrate that GO with a large size and high reduction degree is superior to small and nonreduced GO in enhancing the specificity of PCR. Negatively charged polyacrylic acid (PAA), positively charged polyacrylamide (PAM), neutral polyethylene glycol (PEG) and zwitterionic polymer poly(sulfobetaine) (pSB) are used to modify GO. The PCR specificity-enhancing ability increases in the following order: GO-PAA < GO-PAM < GO-PEG < GO-pSB. Thus, zwitterionic polymer-modified GO is superior to other GO derivatives with different charges in enhancing the specificity of PCR. GO derivatives are also successfully used to enhance the specificity of PCR for the amplification of human mitochondrial DNA using blood genomic DNA as template. Molecular dynamics simulations and molecular docking are performed to elucidate the interaction between the polymers and Pfu DNA polymerase. Our data demonstrate that the size, reduction degree and surface charge of GO affect the specificity of PCR. Based on our results, zwitterionic polymer-modified GO may be used as an efficient additive for enhancing the specificity of PCR.

  12. Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

    PubMed Central

    Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

    2011-01-01

    To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642

  13. Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions.

    PubMed

    Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

    2011-04-01

    To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.

  14. relA-dependent RNA polymerase activity in Escherichia coli.

    PubMed Central

    Ryals, J; Bremer, H

    1982-01-01

    Parameters relating to RNA synthesis were measured after a temperature shift from 30 to 42 degrees C, in a relA+ and relA- isogenic pair of Escherichia coli strains containing a temperature-sensitive valyl tRNA synthetase. The following results were obtained: (i) the rRNA chain growth rate increased 2-fold in both strains; (ii) newly synthesized rRNA became unstable in both strains; (iii) the stable RNA gene activity (rRNA and tRNA, measured as stable RNA synthesis rate relative to the total instantaneous rate of RNA synthesis) decreased 1.7-fold in the relA+ strain and increased 1.9-fold in the relA mutant; and (iv) the RNA polymerase activity (measured by the percentage of total RNA polymerase enzyme active in transcription an any instant) decreased from 20 to 3.6% in the relA+ strain and remained unchanged (or increased at most to 22%) in the relA mutant. It is suggested that both rRNA gene activity and the RNA polymerase activity depend on the intracellular concentration of guanosine tetraphosphate, whereas the altered chain elongation rate and stability of rRNA are temperature or amino acid starvation effects, respectively, without involvement of relA function. PMID:6174501

  15. Distinct Mechanisms of Transcription Initiation by RNA Polymerases I and II.

    PubMed

    Engel, Christoph; Neyer, Simon; Cramer, Patrick

    2018-05-20

    RNA polymerases I and II (Pol I and Pol II) are the eukaryotic enzymes that catalyze DNA-dependent synthesis of ribosomal RNA and messenger RNA, respectively. Recent work shows that the transcribing forms of both enzymes are similar and the fundamental mechanisms of RNA chain elongation are conserved. However, the mechanisms of transcription initiation and its regulation differ between Pol I and Pol II. Recent structural studies of Pol I complexes with transcription initiation factors provided insights into how the polymerase recognizes its specific promoter DNA, how it may open DNA, and how initiation may be regulated. Comparison with the well-studied Pol II initiation system reveals a distinct architecture of the initiation complex and visualizes promoter- and gene-class-specific aspects of transcription initiation. On the basis of new structural studies, we derive a model of the Pol I transcription cycle and provide a molecular movie of Pol I transcription that can be used for teaching.

  16. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

    PubMed

    Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

    2009-01-01

    A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

  17. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    USGS Publications Warehouse

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  18. Gonorrhoea of the sigmoid neovagina in a male-to-female transgender.

    PubMed

    van der Sluis, Wouter B; Bouman, Mark-Bram; Gijs, Luk; van Bodegraven, Adriaan A

    2015-07-01

    A 33-year-old male-to-female transgender consulted our outpatient clinic with perneovaginal bleeding during and following coitus. Four years before, she underwent a total laparoscopic sigmoid neovaginoplasty. Physical, histological and endoscopic examination revealed neither focus of active bleeding nor signs of active inflammation. A polymerase chain reaction test performed on a neovaginal swab showed gonococcal infection. Treatment consisted of 500 mg intramuscular ceftriaxone. Three weeks later, our patient reported resolution of symptoms, consistent with eradication of the infection demonstrated by a follow-up neovaginal swab polymerase chain reaction. To our knowledge, this is the first case report of gonococcal infection of the sigmoid neovagina. © The Author(s) 2014.

  19. Multiple papillomas in a diamond python, Morelia spilota spilota.

    PubMed

    Gull, Jessica M; Lange, Christian E; Favrot, Claude; Dorrestein, Gerry M; Hatt, Jean-Michel

    2012-12-01

    A 4-yr-old male diamond python (Morelia spilota spilota) was evaluated for multiple black papillated exophytic skin proliferations and signs of pneumonia. The histopathologic structure of the skin biopsy specimens led to the diagnosis of a benign papilloma-like neoplasia. In this case, papillomavirus DNA could be amplified from a biopsy sample with a broad range polymerase chain reaction. Nested pan-herpes polymerase chain reaction was negative, and herpesvirus inclusion bodies were not found. Because of the histologically benign nature of the papilloma, the skin proliferations were left untreated. Ten mo after the first presentation, the skin lesions had regressed almost completely; 34 mo later, only scars from the biopsies were left.

  20. Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest

    Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required formore » PCR.« less

  1. Detection of trypanosomatid Phytomonas parasitic in plants by polymerase chain reaction amplification of small subunit ribosomal DNA.

    PubMed

    Teixeira, M M; Campaner, M; Camargo, E P

    1994-01-01

    To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.

  2. Diagnostic exercise: chronic vomiting in a dog.

    PubMed

    Ellis, A E; Brown, C A; Miller, D L

    2010-09-01

    An approximately one-and-a-half-year-old, neutered male, mixed-breed dog was presented for a chronic history of vomiting. Profuse diarrhea was also noted during examination. An exploratory laparotomy was performed, bone chips were removed from the stomach, and a raised, circular area of gastric mucosa was biopsied. Histologically, there was severe gastric cryptosporidiosis as well as numerous spiral bacteria, consistent with Helicobacter spp. Polymerase chain reaction revealed visible bands for the 18S ribosomal RNA gene for Cryptosporidium spp. The polymerase chain reaction product was sequenced and was found to be most similar to Cryptosporidium muris. Both the gastric location and the species of Cryptosporidium are unusual in a dog.

  3. Vertebral Osteomyelitis Caused by Helicobacter cinaedi Identified Using Broad-range Polymerase Chain Reaction with Sequencing of the Biopsied Specimen.

    PubMed

    Hase, Ryota; Hirooka, Takuya; Itabashi, Takashi; Endo, Yasunobu; Otsuka, Yoshihito

    2018-05-15

    A 65-year-old man presented with gradually exacerbating low back pain. Magnetic resonance imaging revealed vertebral osteomyelitis in the Th11-L2 vertebral bodies and discs. The patient showed negative findings on conventional cultures. Direct broad-range polymerase chain reaction (PCR) with sequencing of the biopsied specimen had the highest similarity to the 16S rRNA gene of Helicobacter cinaedi. This case suggests that direct broad-range PCR with sequencing should be considered when conventional cultures cannot identify the causative organism of vertebral osteomyelitis, and that this method may be particularly useful when the pathogen is a fastidious organism, such as H. cinaedi.

  4. Cerebral Toxoplasmosis Diagnosed by Nested-polymerase Chain Reaction in a Patient with Rheumatoid Arthritis.

    PubMed

    Matsuura, Jun; Fujii, Akihiro; Mizuta, Ikuko; Norose, Kazumi; Mizuno, Toshiki

    2018-05-15

    A 65-year-old woman with rheumatoid arthritis (RA) visited our hospital because of right facial sensory hypoesthesia. Cerebral toxoplasmosis was suspected on brain magnetic resonance imaging. We discontinued methotrexate for RA and started a sulfamethoxazole/trimethoprim (ST) mixture. Although ST treatment was interrupted because of adverse reactions, her prognosis was favorable. The Toxoplasma 18S rDNA gene was detected by nested-polymerase chain reaction (PCR) from blood and cerebrospinal fluid. Detecting the Toxoplasma 18S rDNA gene by nested-PCR is useful for the diagnosis and safer than a brain biopsy. In addition, the discontinuation of immunosuppressants may be recommended in patients compromised by those immunosuppressants.

  5. Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

    PubMed Central

    Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

    2004-01-01

    A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703

  6. Detection of coliform bacteria and Escherichia coli by multiplex polymerase chain reaction: comparison with defined substrate and plating methods for water quality monitoring.

    PubMed Central

    Bej, A K; McCarty, S C; Atlas, R M

    1991-01-01

    Multiplex polymerase chain reaction (PCR) and gene probe detection of target lacZ and uidA genes were used to detect total coliform bacteria and Escherichia coli, respectively, for determining water quality. In tests of environmental water samples, the lacZ PCR method gave results statistically equivalent to those of the plate count and defined substrate methods accepted by the U.S. Environmental Protection Agency for water quality monitoring and the uidA PCR method was more sensitive than 4-methylumbelliferyl-beta-D-glucuronide-based defined substrate tests for specific detection of E. coli. Images PMID:1768116

  7. Nested methylation-specific polymerase chain reaction cancer detection method

    DOEpatents

    Belinsky, Steven A [Albuquerque, NM; Palmisano, William A [Edgewood, NM

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  8. Vascular endothelial growth factor and platelet-derived growth factor are potential angiogenic and metastatic factors in human breast cancer.

    PubMed

    Anan, K; Morisaki, T; Katano, M; Ikubo, A; Kitsuki, H; Uchiyama, A; Kuroki, S; Tanaka, M; Torisu, M

    1996-03-01

    Angiogenesis is a prerequisite for tumor growth and metastasis. Tumor angiogenesis may be mediated by several angiogenic factors such as vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), transforming growth factor-alpha, and basic fibroblast growth factor. Differential mRNA expressions of VEGF, PDGF (A chain), transforming growth factor-alpha and basic fibroblast growth factor in 32 primary invasive breast tumors were examined by reverse transcriptase-polymerase chain reaction. We analyzed relationships between mRNA expressions of these angiogenic factors and the degree of angiogenesis, tumor size, and metastasis. Quantification of angiogenesis was achieved by the immunohistochemical staining of endothelial cells with antibody to CD31. VEGF and PDGF-A mRNAs were expressed more frequently in breast tumors than in nontumor breast tissues, whereas no difference was found in expression frequency of either transforming growth factor-alpha or basic fibroblast growth factor mRNA. Vascular counts in tumors correlated with each expression frequency of VEGF and PDGF-A mRNA. PDGF-A mRNA was expressed more frequently in tumors with lymph node metastasis than in those without metastasis. Expression of VEGF and PDGF mRNAs detected by reverse transcriptase-polymerase chain reaction in breast tumors correlates with tumor-related characteristics of angiogenesis and metastatic potential. Analysis of these mRNAs by reverse transcriptase-polymerase chain reaction may be useful for assessing the biologic behavior of a breast tumor before surgical treatment.

  9. Specific Inhibition of Herpes Simplex Virus DNA Polymerase by Helical Peptides Corresponding to the Subunit Interface

    NASA Astrophysics Data System (ADS)

    Digard, Paul; Williams, Kevin P.; Hensley, Preston; Brooks, Ian S.; Dahl, Charles E.; Coen, Donald M.

    1995-02-01

    The herpes simplex virus DNA polymerase consists of two subunits-a catalytic subunit and an accessory subunit, UL42, that increases processivity. Mutations affecting the extreme C terminus of the catalytic subunit specifically disrupt subunit interactions and ablate virus replication, suggesting that new antiviral drugs could be rationally designed to interfere with polymerase heterodimerization. To aid design, we performed circular dichroism (CD) spectroscopy and analytical ultracentrifugation studies, which revealed that a 36-residue peptide corresponding to the C terminus of the catalytic subunit folds into a monomeric structure with partial α-helical character. CD studies of shorter peptides were consistent with a model where two separate regions of α-helix interact to form a hairpin-like structure. The 36-residue peptide and a shorter peptide corresponding to the C-terminal 18 residues blocked UL42-dependent long-chain DNA synthesis at concentrations that had no effect on synthesis by the catalytic subunit alone or by calf thymus DNA polymerase δ and its processivity factor. These peptides, therefore, represent a class of specific inhibitors of herpes simplex virus DNA polymerase that act by blocking accessory-subunit-dependent synthesis. These peptides or their structures may form the basis for the synthesis of clinically effective drugs.

  10. Application of multiplex PCR, pulsed-field gel electrophoresis (PFGE), and BOX-PCR for molecular analysis of enterococci

    USDA-ARS?s Scientific Manuscript database

    The objective of the study was to use band-based molecular methods including BOX-PCR (Polymerase Chain Reaction) and Pulsed-Field Gel Electrophoresis (PFGE) to determine if genetically related enterococci were found among different stores, food types, or years. Enterococci were also characterized f...

  11. Bacterial biodiversity from an anaerobic up flow bioreactor with ANAMMOX activity inoculated with swine sludge

    USDA-ARS?s Scientific Manuscript database

    The present study aimed to identify organisms with ANAMMOX activity in a reactor maintained in a laboratory. Molecular methods as fluorescence in situ hybridization (FISH), polymerase chain reaction (PCR) and cloning of 16S-rDNA genes probing for Planctomycetes were performed. Seventeen clones were ...

  12. Evaluation of reference genes for expression studies in ash (Fraxinus spp.)

    Treesearch

    Loren Rivera-Vega; Praveen Mamidala; Jennifer L. Koch; Mary E. Mason; Omprakash Mittapalli

    2012-01-01

    Ash (Fraxinus spp.) is a dominant tree species in North America, in both managed and natural landscapes. However, due to the rapid invasion by the emerald ash borer (Agrilus planipennis), an exotic invasive insect pest, millions of North American ash trees have been killed. Real-time quantitative polymerase chain reaction (RTq-PCR...

  13. EVALUATION OF STACHYBOTRYS CHARTARUM IN THE HOUSE OF AN INFANT WITH PULMONARY HEMORRHAGE: QUANTITATIVE ASSESSMENT BEFORE, DURING, AND AFTER REMEDIATION

    EPA Science Inventory

    Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage (PH) cases in the Cleveland, Ohio area. This study applied two new quantitative measurements to air samples from a home where an infant developed PH. Quantitative polymerase chain reacti...

  14. Market surveillance on non-halal additives incorporated in surimi based products using polymerase chain reaction (PCR)-southern hybridization analysis

    NASA Astrophysics Data System (ADS)

    Aravindran, S.; Sahilah, A. M.; Aminah, A.

    2014-09-01

    Halal surveillance on halal ingredients incorporated in surimi based products were studied using polymerase chain reaction (PCR)-southern hybridization on chip analysis. The primers used in this technique were targeted on mitochondria DNA (mtDNA) of cytochrome b (cyt b) gene sequence which able to differentiate 7 type (beef, chicken, duck, goat, buffalo, lamb and pork) of species on a single chip. 17 (n = 17*3) different brands of surimi-based product were purchased randomly from Selangor local market in January 2013. Of 17 brands, 3 (n = 3*3) brands were positive for chicken DNA, 1 (n = 1*3) brand was positive for goat DNA, and the remainder 13 brands (n = 13*3) have no DNA species detected. The sensitivity of PCR-southern hybridization primers to detect each meat species was 0.1 ng. In the present study, it is evidence that PCR-Southern Hybridization analysis offered a reliable result due to its highly specific and sensitive properties in detecting non-halal additive such as plasma protein incorporation in surimi-based product.

  15. Enhanced detection rate of typhoid fever among clinically suspected patients in a tertiary referral hospital in Dhaka, Bangladesh using nested polymerase chain reaction technology.

    PubMed

    Khan, S; Miah, M R; Khatun, S

    2015-12-01

    A nested polymerase chain reaction (PCR) specific for Salmonella enterica subspecies enteric serovar Typhi was used for the detection of the pathogen, in blood. This study was done during the period of March 2013 to February 2014. A total of 80 clinically suspected cases of typhoid fever were included in the study. Blood was collected from all participating individuals. Nested PCR targeting the flagellin gene (fliC) of Salmonella Typhi & blood culture were done for each of the cases. The positivity rate of PCR & blood culture was 70%& 20% respectively. The positivity rate of PCR was significantly higher than blood culture (P< 0.05). With the nested PCR, S. Typhi DNAs were detected from blood specimens of 67.2% (43/64) patients among the suspected typhoid fever cases on the basis of clinical features but with negative cultures. We conclude that the PCR technique could be used as a novel diagnostic method of typhoid fever, particularly in culture-negative cases in an endemic country like Bangladesh.

  16. Pilot study of the utility and acceptability of tampon sampling for the diagnosis of Neisseria gonorrhoeae and Chlamydia trachomatis infections by duplex realtime polymerase chain reaction in United Kingdom sex workers.

    PubMed

    Kimmitt, P T; Tabrizi, S N; Crosatti, M; Garland, S M; Schober, P C; Rajakumar, K; Chapman, C A

    2010-04-01

    We aimed to evaluate the acceptability of self-collected tampon samples for the screening of female sex workers for sexually transmitted infections. We recruited 65 sex workers, and 63 agreed to provide tampon samples. The tampon samples were processed by realtime polymerase chain reaction (PCR) targeting Neisseria gonorrhoeae and Chlamydia trachomatis. Urethral and endocervical swabs were also obtained from 61 of 63 participants and tested using culture (N. gonorrhoeae) and the BD ProbeTec strand displacement amplification (SDA) (C. trachomatis) assay. Tampon sampling was preferred by 95% of the women and all favoured being tested away from genitourinary medicine clinics; the most common reasons cited were avoidance of embarrassment (40%) and convenience (30%). Besides near-universal acceptability of tampon sampling, the tampon sampling-PCR approach described in this study appeared to have enhanced sensitivity compared with conventional testing, suggesting the possibility of a residual hidden burden of N. gonorrhoeae and/or C. trachomatis genital infections in UK female sex workers.

  17. Human metapneumovirus-associated hospital admissions over five consecutive epidemic seasons: evidence for alternating circulation of different genotypes.

    PubMed

    Apostoli, Paola; Zicari, Sonia; Lo Presti, Alessandra; Ciccozzi, Massimo; Ciotti, Marco; Caruso, Arnaldo; Fiorentini, Simona

    2012-03-01

    Human metapneumovirus (hMPV) is a pathogen of the respiratory tract with a worldwide distribution. The purpose of this study was to identify hMPV as the cause of acute respiratory diseases in children admitted at Spedali Civili, a public hospital in Brescia, Italy. Eight hundred forty-six nasopharyngeal aspirate samples negative for the presence of other common respiratory viruses were tested for the presence of hMPV RNA by reverse transcription-polymerase chain reaction. Of the 846 samples, 79 (9.3%) were positive for hMPV. Polymerase chain reaction products, obtained by amplification of the partial nucleotide sequence of gene F, were sequenced and compared with sequences deposited in GenBank. All four hMPV subtypes were identified, including the proposed subtype A2 sublineages "A" and "B". In successive epidemic seasons, large outbreaks of hMPV alternated with small outbreaks in a biannual pattern. This local study provides further evidence that hMPV infection should be considered as a reason for hospital admission for acute respiratory disease in children. Copyright © 2012 Wiley Periodicals, Inc.

  18. Quantification of concentrated Chinese medicine granules by quantitative polymerase chain reaction.

    PubMed

    Lo, Yat-Tung; Shaw, Pang-Chui

    2017-10-25

    Determination of the amount of constituent in a multi-herb product is important for quality control. In concentrated Chinese medicine granules (CCMG), no dregs are left after dissolution of the CCMG. This study is the first to examine the feasibility of using quantitative polymerase chain reaction (qPCR) to find the amount of CCMG in solution form. DNA was extracted from Hirudo and Zaocys CCMG mixed at different ratios and amplified in qPCR using species-specific primers. The threshold cycle (C T ) obtained was compared with the respective standard curves. Results showed that reproducible quantification results could be obtained (1) for 5-50mg CCMG using a modified DNA extraction protocol, (2) amongst DNA extracted from the same batch of CCMG and (3) amongst different batches of CCMG from the same company. This study demonstrated the constitute amount of CCMG in a mixture could be determined using qPCR. This work has extended the application of DNA techniques for the quantification of herbal products and this approach may be developed for quality assurance in the CCMG industry. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Use of multiplex polymerase chain reaction-based assay to conduct epidemiological studies on bovine hemoparasites in Mexico.

    PubMed

    Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M

    1993-01-01

    A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.

  20. Methylation pattern of IFNG in periapical granulomas and radicular cysts.

    PubMed

    Campos, Kelma; Gomes, Carolina Cavaliéri; de Fátima Correia-Silva, Jeane; Farias, Lucyana Conceição; Fonseca-Silva, Thiago; Bernardes, Vanessa Fátima; Pereira, Cláudia Maria; Gomez, Ricardo Santiago

    2013-04-01

    Interferon-γ plays an important role in the pathogenesis of periapical lesions, and the methylation of IFNG has been associated with transcriptional inactivation. The purpose of the present study was to investigate IFNG promoter methylation in association with gene transcription and protein levels in periapical granulomas and radicular cysts. Methylation-specific polymerase chain reaction was used to assess the DNA methylation pattern of the IFNG gene in 16 periapical granulomas and 13 radicular cyst samples. The transcription levels of IFNG mRNA were verified by quantitative real-time polymerase chain reaction, and protein expression was evaluated by immunohistochemistry. All the periapical lesion samples exhibited partial or total methylation of the IFNG gene. In addition, an increased methylation profile was found in radicular cysts compared with periapical granulomas. Increased IFNG mRNA expression was observed in the partially methylated periapical lesion samples relative to the samples that were completely methylated. The present study provides the first evidence of the possible impact of IFNG methylation on IFNG transcription in periapical lesions. Copyright © 2013 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  1. Recurrent uveitis in horses: vitreal examinations with ultrastructural detection of leptospires.

    PubMed

    Brandes, K; Wollanke, B; Niedermaier, G; Brem, S; Gerhards, H

    2007-06-01

    This study documents the examination of 17 horses (both sexes, 3-18 years old) suffering from spontaneous equine recurrent uveitis (ERU). Vitreal samples obtained by pars plana vitrectomy were examined macroscopically and ultrastructurally, and in most cases also by cultural examination, by microscopic agglutination test (MAT) and by polymerase chain reaction. In 24% (4/17) of the animals, ultrastructural examination by electron microscopy revealed intact leptospiral bacteria in the vitreous. The leptospires were detected freely in the vitreous and also incorporated by a phagocyte. They were surrounded by a rim of proteinaceous material which was reduced around a phagocytosed leptospira. Ninety-four per cent (16/17) of the vitreal samples presented significant antibody levels in the MAT, mostly against leptospiral serovar Grippotyphosa. Seventy-five per cent (9/12) of bacterial culture examinations were positive for leptospira. Polymerase chain reaction was positive in all (16/16) examinations performed. Our findings support previous reports suggesting that leptospires play an important role in the pathogenesis of ERU. Interestingly, this study found leptospires after secondary and later acute episodes. A persistent leptospiral infection is therefore suggested as the cause of ERU.

  2. Development of an immunomagnetic separation-polymerase chain reaction (IMS-PCR) assay specific for Enterocytozoon bieneusi in water samples.

    PubMed

    Sorel, N; Guillot, E; Thellier, M; Accoceberry, I; Datry, A; Mesnard-Rouiller, L; Miégeville, M

    2003-01-01

    Microsporidia have become widely recognized as important human pathogens. Among Microsporidia, Enterocytozoon bieneusi is responsible for severe gastrointestinal disease. To date, no current therapy has been proven effective. Their mode of transmission and environmental occurrence are poorly documented because of the lack of detection methods that are both species-specific and sensitive. In this study, we developed a sensitive and specific molecular method to detect E. bieneusi spores in water samples. The molecular assay combined immunomagnetic separation (IMS) and polymerase chain reaction (PCR) amplification to detect E. bieneusi spores. A comparison was made of IMS magnetic beads coated with two different monoclonal antibodies, one specific for the Encephalitozoon genus that cross-reacts with E. bieneusi and the other specific only for the E. bieneusi species itself. Immunotech beads coated with the antibody specific for E. bieneusi were found to be the most effective combination. The highly specific IMS-PCR assay developed in this study provides a rapid and sensitive means of screening water samples for the presence of E. bieneusi spores.

  3. Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction.

    PubMed

    Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

    2008-07-23

    A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

  4. Diagnosis of Gestational, Congenital, and Placental Malaria in Colombia: Comparison of the Efficacy of Microscopy, Nested Polymerase Chain Reaction, and Histopathology

    PubMed Central

    Campos, Ivón M.; Uribe, Mary L.; Cuesta, Carolina; Franco-Gallego, Alexander; Carmona-Fonseca, Jaime; Maestre, Amanda

    2011-01-01

    The technical capability of different methods to diagnose Plasmodium in maternal peripheral blood, placenta, and umbilical cord blood has not been assessed in Colombia and seldom explored in other malaria-endemic regions. We designed a study to compare the technical and the operational-economical performances of light microscopy (LM), nested polymerase chain reaction (nPCR), and histopathology (HP). In maternal blood, LM had 41% sensitivity and 100% specificity and in placental blood, 35% and 100%, respectively, compared with nPCR. In placental tissue, LM had 33% sensitivity and 95% specificity; and nPCR 47% and 77%, respectively; compared with HP. Light microscopy had the best operational-economical qualification. We concluded that nPCR and HP performed better compared with LM, but field implementation of these two techniques remains a problem. Therefore, LM is recommended as the gold standard for diagnosis of gestational malaria and placental blood infection in the field. PMID:21633030

  5. Multiplex polymerase chain reaction detection of black-pigmented bacteria in infections of endodontic origin.

    PubMed

    Seol, Jung-Hwan; Cho, Byung-Hoon; Chung, Chong-Pyoung; Bae, Kwang-Shik

    2006-02-01

    The purpose of this study was to detect the presence of Porphyromonas endodontalis, P. gingivalis, Prevotella intermedia, P. nigrescens, and P. tannerae from clinical samples using multiplex polymerase chain reactions (PCR). Two different multiplex PCR protocols were used (one for the two Porphyromonas species and the other for the three Prevotella species), each one using a primer pair specific for each target species. The results were compared to those of the conventional culture procedures. Microbial samples were taken aseptically from 40 infected root canals and abscesses from patients. Samples were cultured in an anaerobic condition for conventional identification using a Rapid ID 32 A kit. Multiplex PCR was processed using the DNA extracted from each sample. At least one of the five species of black-pigmented bacteria (BPB) were detected in 65% (26 of 40) of the samples using multiplex PCR, and in 15% (6 of 40) using the conventional culture procedures. Multiplex PCR was more rapid, sensitive, specific, and effective in detecting BPB than the conventional culture procedures.

  6. Identification of the people from whom engorged Aedes aegypti took blood meals in Florida, Puerto Rico, using polymerase chain reaction-based DNA profiling.

    PubMed

    De Benedictis, John; Chow-Shaffer, Esther; Costero, Adriana; Clark, Gary G; Edman, John D; Scott, Thomas W

    2003-04-01

    We used polymerase chain reaction-based DNA profiling to construct allelic profiles for residents and visitors of 22 houses in Florida, Puerto Rico, and human DNA from blood meals in Aedes aegypti that were collected in those homes. Complete profiles were obtained for < or = 2 days after blood ingestion. Eighteen percent of the meals came from two different people. There was no evidence of meals from > or = 2 people. Eighty percent of the meal sources were identified, > 70% were taken from residents of the collection house, and > 90% were from residents of the study community. Across the community, feeding was non-random with a bias towards young adults and males. Three people accounted for 56% of the meals. Our results confirm that multiple feeding on different people is an important component in the role of Ae. aegypti in dengue virus transmission and help explain the spatial distribution of dengue cases in a previous epidemic in Florida, Puerto Rico.

  7. Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis

    PubMed Central

    Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y.; Whelen, A. Christian; Calimlim, Precilia S.; Sciulli, Rebecca H.; Honda, Stacey A. A.; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M.; da Silva, Alexandre J.

    2016-01-01

    Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. PMID:26526920

  8. Genetic diversity of Chlamydia among captive birds from central Argentina.

    PubMed

    Frutos, María C; Monetti, Marina S; Vaulet, Lucia Gallo; Cadario, María E; Fermepin, Marcelo Rodríguez; Ré, Viviana E; Cuffini, Cecilia G

    2015-01-01

    To study the occurrence of Chlamydia spp. and their genetic diversity, we analysed 793 cloacal swabs from 12 avian orders, including 76 genera, obtained from 80 species of asymptomatic wild and captive birds that were examined with conventional nested polymerase chain reaction and quantitative polymerase chain reaction. Chlamydia spp. were not detected in wild birds; however, four species (Chlamydia psittaci, Chlamydia pecorum, Chlamydia pneumoniae and Chlamydia gallinacea) were identified among captive birds (Passeriformes, n = 20; Psittaciformes, n = 15; Rheiformes, n = 8; Falconiformes n = 2; Piciformes n = 2; Anseriformes n = 1; Galliformes n = 1; Strigiformes n = 1). Two pathogens (C. pneumoniae and C. pecorum) were identified simultaneously in samples obtained from captive birds. Based on nucleotide-sequence variations of the ompA gene, three C. psittaci-positive samples detected were grouped into a cluster with the genotype WC derived from mammalian hosts. A single positive sample was phylogenetically related to a new strain of C. gallinacea. This report contributes to our increasing understanding of the abundance of Chlamydia in the animal kingdom.

  9. Rectal Lymphogranuloma Venereum in HIV-infected Patients Can Mimic Lymphoma.

    PubMed

    Crickx, Etienne; Meignin, Véronique; Gérard, Laurence; Plantier-Colcher, Isabelle; Walker-Combrouze, Francine; Boutboul, David; Galicier, Lionel; Fieschi, Claire; Oksenhendler, Eric

    2016-01-01

    An outbreak of rectal lymphogranuloma venereum (LGV) has been reported since 2003 in men who have sex with men, most of them being infected with human immunodeficiency virus. In these patients, unusual clinical presentations such as rectal tumor or intense lymphoproliferation on rectal biopsies may lead to an erroneous diagnosis of aggressive non-Hodgkin lymphoma. Three patients were referred to our center for the management of rectal B-cell non-Hodgkin lymphoma on the basis of a rectal pathologic specimen showing intense lymphoproliferation, the very suspect of lymphoma. Because of anamnesis of anal intercourses and venereal diseases, additional study revealed that all 3 had a positive Chlamydia trachomatis polymerase chain reaction on the rectal biopsy specimen. Rectal LGV was therefore considered and successfully treated with antibiotics. We propose that all patients presenting with a suspected rectal lymphoma should have a careful anamnesis of sexual behavior and a specific detection of C. trachomatis using polymerase chain reaction analysis on biopsy specimen to rule out the possibility of rectal LGV.

  10. Evidence of simian retrovirus type D by polymerase chain reaction.

    PubMed

    Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A

    2017-06-01

    Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Detection and identification of cutaneous leishmaniasis isolates by culture, Polymerase chain reaction and sequence analyses in Syrian and Central Anatolia patients.

    PubMed

    Beyhan, Yunus E; Karakus, Mehmet; Karagoz, Alper; Mungan, Mesut; Ozkan, Aysegul T; Hokelek, Murat

    2017-09-01

    To characterize the cutaneous leishmaniasis (CL) isolates of Syrian and Central Anatolia patients at species levels. Methods: Skin scrapings of 3 patients (2 Syrian, 1 Turkish) were taken and examined by direct examination, culture in Novy-MacNeal-Nicole (NNN) medium, internal transcribed spacer polymerase chain reaction and sequence analysis (PCR). Results:According to microscopic examination, culture and PCR methods, 3 samples were detected positive. The sequencing results of all isolates in the study were identified as Leishmania tropica. The same genotypes were detected in the 3 isolates and nucleotide sequence submitted into GenBank with the accession number: KP689599. Conclusion: This finding could give information about the transmission of CL between Turkey and Syria. Because of the Syrian civil war, most of the Syrian citizens circulating in Turkey and different part of Europe, this can be increase the risk of spreading the disease. So, prevention measurements must be taken urgently.

  12. [Usefulness of conventional polymerase chain reaction for the detection of Mycoplasma hominis, Ureaplasma spp. and Trichomonas vaginalis in female outpatient's genital samples].

    PubMed

    Alarcón, Gonzalo; Barraza, Gabriela; Vera, Andrea; Wozniak, Aniela; García, Patricia

    2016-02-01

    Trichomonas vaginalis, Mycoplasma hominis and Ureaplasma spp. are microorganisms responsible for genitourinary and pregnancy pathologies. Nucleic acid amplification methods have shown several advantages, but have not been widely studied for the detection of these microorganisms. To implement a conventional polymerase chain reaction (PCR) for the detection of the microorganisms and to compare its results versus the methods currently used at our laboratory. 91 available samples were processed by PCR, culture (M. hominis y Ureaplasma spp.) and wet mount (T vaginalis). Results were compared and statistically analyzed by kappa agreement test. 85, 80 and 87 samples resulted in agreement for the detection of M. hominis, Ureaplasma spp. y T. vaginalis, respectively. For M. hominis and Ureaplasma spp., agreement was substantial, whereas for T. vaginalis it was moderate, however, for the latter, PCR detected more cases than wet mount. We recommend the implementation of PCR for detection of T. vaginalis whereas culture kit is still a useful method for the other microorganisms.

  13. The actin multigene family and livestock speciation using the polymerase chain reaction.

    PubMed

    Fairbrother, K S; Hopwood, A J; Lockley, A K; Bardsley, R G

    1998-01-01

    Actins constitute a family of highly-conserved multifunctional intracellular proteins, best known as myofibrillar components in striated muscle fibres. Most vertebrate genomes contain numerous actin genes with high sequence homology in protein coding regions but considerable variability in intron number and sizes. This genetic diversity can be utilised for livestock speciation purposes. The high sequence conservation has enabled a single pair of oligonucleotides to be used to prime the polymerase chain reaction (PCR) with DNA extracted from all animals so far studied. Multiple amplification products were obtained which on gel electrophoresis constituted characteristic species-specific 'fingerprints'. The patterns were reproducible, did not vary between individuals of the same breed or between different breeds within a species, and could be generated even from heat-processed muscle held at 120 degrees C for one hour. Given the capacity of PCR to amplify relatively short sequences in highly-degraded DNA, this approach may be suitable for authentication of processed meat products.

  14. A Comparative Analysis of Polymerase Chain Reaction and Direct Fluorescent Antibody Test for Diagnosis of Genital Herpes.

    PubMed

    Patwardhan, Vrushali; Bhalla, Preena; Rawat, Deepti; Garg, Vijay Kumar; Sardana, Kabir; Sethi, Sumit

    2017-01-01

    To compare laboratory tests that can simultaneously detect and type herpes simplex virus (HSV) directly from the genital ulcer specimens in clinically suspected cases of genital herpes. A study was conducted over 10 months and 44 adult male and female patients clinically suspected with genital herpes were recruited. Genital ulcer swab specimens were subjected to glycoprotein-G gene-based conventional polymerase chain reaction (PCR) and commercially available direct fluorescent antibody (DFA) test and the results were compared. PCR for HSV was positive in 82% (36/44) cases. DFA was positive in 68.2% (30/44) cases. There was 100% agreement between HSV types detected by DFA and PCR. The strength of agreement between the results was better in primary genital herpes than recurrent cases. PCR was found to be better in the detection of HSV in recurrent genital herpes patients. It is a better modality, especially when genital herpes clinically presents with ulcerative or crusted lesions, and is also a cheaper alternative as compared to DFA.

  15. Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo

    PubMed Central

    Yang, Jin-Long; Cheng, An-Chun; Wang, Ming-Shu; Pan, Kang-Cheng; Li, Min; Guo, Yu-Fei; Li, Chuan-Feng; Zhu, De-Kang; Chen, Xiao-Yue

    2009-01-01

    Background Goose parvovirus (GPV) is a Dependovirus associated with latent infection and mortality in geese. Currently, it severely affects geese production worldwide. The objective of this study was to develop a fluorescent quantitative real-time polymerase chain reaction (PCR) (FQ-PCR) assay for fast and accurate quantification of GPV DNA in infected goslings, which can aid in the understanding of the regular distribution pattern and the nosogenesis of GPV in vivo. Results The detection limit of the assay was 2.8 × 101 standard DNA copies, with a sensitivity of 3 logs higher than that of the conventional gel-based PCR assay targeting the same gene. The real-time PCR was reproducible, as shown by satisfactory low intraassay and interassay coefficients of variation. Conclusion The high sensitivity, specificity, simplicity, and reproducibility of the GPV fluorogenic PCR assay, combined with a high throughput, make this method suitable for a broad spectrum of GPV etiology-related applications. PMID:19754946

  16. Novel cytochrome P450 genes, CYP6EB1 and CYP6EC1, are over-expressed in acrinathrin-resistant Frankliniella occidentalis (Thysanoptera: Thripidae).

    PubMed

    Cifuentes, D; Chynoweth, R; Guillén, J; De la Rúa, P; Bielza, P

    2012-06-01

    Control of Frankliniella occidentalis (Pergande) is a serious problem for agriculture all over the world because of the limited range of insecticides that are available. Insecticide resistance in F. occidentalis has been reported for all major insecticide groups. Our previous studies showed that cytochrome P450-mediated detoxification is a major mechanism responsible for insecticide resistance in this pest. Degenerate polymerase chain reaction was used to identify P450 genes that might be involved in acrinathrin resistance, in a laboratory population of F. occidentalis. Associated sequences were classified as belonging to the CYP4 and CYP6 families. Real-time quantitative polymerase chain reaction analyses revealed that two genes, CYP6EB1 and CYP6EC1, were over-expressed in adults and L2 larvae of the resistant population, when compared with the susceptible population, suggesting their possible involvement in resistance to acrinathrin.

  17. Interobserver variability and feasibility of polymerase chain reaction-based assay in distinguishing ischemic colitis from Clostridium difficile colitis in endoscopic mucosal biopsies.

    PubMed

    Wiland, Homer O; Procop, Gary W; Goldblum, John R; Tuohy, Marion; Rybicki, Lisa; Patil, Deepa T

    2013-06-01

    Polymerase chain reaction (PCR)-based assays using stool samples are currently the most effective method of detecting Clostridium difficile. This study examines the feasibility of this assay using mucosal biopsy samples and evaluates the interobserver reproducibility in diagnosing and distinguishing ischemic colitis from C difficile colitis. Thirty-eight biopsy specimens were reviewed and classified by 3 observers into C difficile and ischemic colitis. The findings were correlated with clinical data. PCR was performed on 34 cases using BD GeneOhm C difficile assay. The histologic interobserver agreement was excellent (κ= 0.86) and the agreement between histologic and clinical diagnosis was good (κ = 0.84). All 19 ischemic colitis cases tested negative (100% specificity) and 3 of 15 cases of C difficile colitis tested positive (20% sensitivity). C difficile colitis can be reliably distinguished from ischemic colitis using histologic criteria. The C difficile PCR test on endoscopic biopsy specimens has excellent specificity but limited sensitivity.

  18. Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources.

    PubMed

    Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

    2017-01-01

    Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli . PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources.

  19. Allele and genotype frequencies of polymorphisms in cytokine genes in ethnic Russian individuals from Moscow, Russia.

    PubMed

    Shadrina, Alexandra; Voronina, Elena; Zolotukhin, Igor; Filipenko, Maxim

    2017-02-01

    Two hundred and twenty eight ethnic Russian individuals from Moscow, Russia, were genotyped at 14 single nucleotide polymorphisms CCL2 A-2578G; VEGFA C-2578A, G-634C, and C+936T; TNF G+419A and G-308A; IL1A G-889A; IL1RN T+1018C; IL6G-174C and G-572C; IFNG T+874A; IL1B C-511T; IL10 A+1082G; TGFB1 C-509T. Genotypes were determined using real-time polymerase chain reaction with TaqMan probes and polymerase chain reaction followed by melting analysis of dual-labeled probe. Genotype distribution was in accordance with Hardy-Weinberg equilibrium for all studied polymorphisms. Genotype data are available in the Allele Frequencies Net Database under identifier AFND 3367 and the population name "Russia Moscow Cytokine". Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  20. Review of Detection of Brucella sp. by Polymerase Chain Reaction

    PubMed Central

    Yu, Wei Ling; Nielsen, Klaus

    2010-01-01

    Here we present a review of most of the currently used polymerase chain reaction (PCR)-based methods for identification of Brucella bacteria in biological samples. We focused in particular on methods using single-pair primers, multiplex primers, real-time PCRs, PCRs for marine Brucella, and PCRs for molecular biotyping. These methods are becoming very important tools for the identification of Brucella, at the species level and recently also at the biovar level. These techniques require minimum biological containment and can provide results in a very short time. In addition, genetic fingerprinting of isolates aid in epidemiological studies of the disease and its control. PCR-based methods are more useful and practical than conventional methods used to identify Brucella spp., and new methods for Brucella spp identification and typing are still being developed. However, the sensitivity, specificity, and issues of quality control and quality assurance using these methods must be fully validated on clinical samples before PCR can be used in routine laboratory testing for brucellosis. PMID:20718083

  1. A Case-control Study on the Relationship between Mycoplasma genitalium Infection in Women with Normal Pregnancy and Spontaneous Abortion using Polymerase Chain Reaction.

    PubMed

    Ramazanzadeh, Rashid; Khodabandehloo, Mazaher; Farhadifar, Fariba; Rouhi, Samaneh; Ahmadi, Amjad; Menbari, Shaho; Fallahi, Fariba; Mirnejad, Reza

    2016-10-01

    Mycoplasma genitalium infections are suggested as causes of a number of pathological outcomes in pregnant women. The aim of this study was to evaluate the frequency of M. genitalium infections among pregnant women and its association with spontaneous abortion. In this case-control study we included 109 women with spontaneous abortion with a gestational age of 10-20 weeks (patients), and 109 women with normal pregnancy with a gestational age of 20-37 weeks (controls) in Sanandaj, Iran. Using specific primers and extracted DNA from endocervical swabs, a polymerase chain reaction was conducted for the detection of M. genitalium infection in both groups. The frequency of M. genitalium infection in patient and control groups was one (0.91%) and three (2.75%), respectively. In both control and patient groups using Fisher test, no association between mycoplasma infection and spontaneous abortion was seen. M. genitalium may be positive in the genital tract of some pregnant women but was not associated with spontaneous abortion. Further powerful studies with larger sample sizes are needed for the determination of a possible role of M. genitalium in pregnancy outcomes and spontaneous abortion.

  2. Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

    PubMed

    Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

    2016-05-01

    In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.

  3. The cellular level of O-antigen polymerase Wzy determines chain length regulation by WzzB and WzzpHS-2 in Shigella flexneri 2a.

    PubMed

    Carter, Javier A; Jiménez, Juan C; Zaldívar, Mercedes; Alvarez, Sergio A; Marolda, Cristina L; Valvano, Miguel A; Contreras, Inés

    2009-10-01

    The lipopolysaccharide O antigen of Shigella flexneri 2a has two preferred chain lengths, a short (S-OAg) composed of an average of 17 repeated units and a very long (VL-OAg) of about 90 repeated units. These chain length distributions are controlled by the chromosomally encoded WzzB and the plasmid-encoded Wzz(pHS-2) proteins, respectively. In this study, genes wzzB, wzz(pHS-2) and wzy (encoding the O-antigen polymerase) were cloned under the control of arabinose- and rhamnose-inducible promoters to investigate the effect of varying their relative expression levels on O antigen polysaccharide chain length distribution. Controlled expression of the chain length regulators wzzB and wzz(pHS-2) revealed a dose-dependent production of each modal length. Increase in one mode resulted in a parallel decrease in the other, indicating that chain length regulators compete to control the degree of O antigen polymerization. Also, when expression of the wzy gene is low, S-OAg but not VL-OAg is produced. Production of VL-OAg requires high induction levels of wzy. Thus, the level of expression of wzy is critical in determining O antigen modal distribution. Western blot analyses of membrane proteins showed comparable high levels of the WzzB and Wzz(pHS-2) proteins, but very low levels of Wzy. In vivo cross-linking experiments and immunoprecipitation of membrane proteins did not detect any direct interaction between Wzy and WzzB, suggesting the possibility that these two proteins may not interact physically but rather by other means such as via translocated O antigen precursors.

  4. Digital PCR Quantitation of Muscle Mitochondrial DNA: Age, Fiber Type, and Mutation-Induced Changes.

    PubMed

    Herbst, Allen; Widjaja, Kevin; Nguy, Beatrice; Lushaj, Entela B; Moore, Timothy M; Hevener, Andrea L; McKenzie, Debbie; Aiken, Judd M; Wanagat, Jonathan

    2017-10-01

    Definitive quantitation of mitochondrial DNA (mtDNA) and mtDNA deletion mutation abundances would help clarify the role of mtDNA instability in aging. To more accurately quantify mtDNA, we applied the emerging technique of digital polymerase chain reaction to individual muscle fibers and muscle homogenates from aged rodents. Individual fiber mtDNA content correlated with fiber type and decreased with age. We adapted a digital polymerase chain reaction deletion assay that was accurate in mixing experiments to a mutation frequency of 0.03% and quantitated an age-induced increase in deletion frequency from rat muscle homogenates. Importantly, the deletion frequency measured in muscle homogenates strongly correlated with electron transport chain-deficient fiber abundance determined by histochemical analyses. These data clarify the temporal accumulation of mtDNA deletions that lead to electron chain-deficient fibers, a process culminating in muscle fiber loss. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter... of high-processivity polymerase with novel internal amplification controls for rapid and specific detection.

    USDA-ARS?s Scientific Manuscript database

    Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowl...

  6. RNA Polymerase Structure, Function, Regulation, Dynamics, Fidelity, and Roles in GENE EXPRESSION | Center for Cancer Research

    Cancer.gov

    Multi-subunit RNA polymerases (RNAP) are ornate molecular machines that translocate on a DNA template as they generate a complementary RNA chain. RNAPs are highly conserved in evolution among eukarya, eubacteria, archaea, and some viruses. As such, multi-subunit RNAPs appear to be an irreplaceable advance in the evolution of complex life on earth. Because of their stepwise

  7. Temporal relationships between colds, upper respiratory viruses detected by polymerase chain reaction, and otitis media in young children followed through a typical cold season.

    PubMed

    Winther, Birgit; Alper, Cuneyt M; Mandel, Ellen M; Doyle, William J; Hendley, J Owen

    2007-06-01

    Otitis media is a frequent complication of a viral upper respiratory tract infection, and the reported co-incidence of those diseases increases with assay sensitivity and sampling density. We determined the incidence of otitis-media complications in young children when referenced to cold-like illnesses and to concurrent virus recovery from the nasopharynx. A total of 60 children from 24 families were followed from October 2003 through April 30, 2004, by daily parental recording of illness signs, weekly pneumatic otoscopic examinations, and periodic polymerase chain reaction assay of collected nasal fluids for common viruses. One hundred ninety-nine cold-like illnesses were observed, but a sample for virus assay was not collected concurrent with 71 episodes. Of the remainder, 73% of cold-like illnesses were temporally related to recovery of 1 or a combination of the assayed viruses, with rhinovirus predominating. For non-cold-like illness periods, 54 (18%) of 297 assays were positive for virus, and the virus frequency distribution was similar to that for cold-like illnesses. There were 93 diagnosed otitis-media episodes; 65 (70%) of these occurred during a cold-like illness. For the 79 otitis-media episodes with available nasal samples, 61 (77%) were associated with a positive virus result. In this population, the otitis-media complication rate for a cold-like illness was 33%. A cold-like illness was not a prerequisite for polymerase chain reaction detection of viruses in the nose and nasopharynx of young children. Viral detection by polymerase chain reaction in the absence of a cold-like illness is associated with complications in some subjects. Otitis media is a complication of viral infection both with and without concurrent cold-like illnesses, thus downwardly biasing coincidence estimates that use cold-based illnesses as the denominator.

  8. DNA and RNA polymerase activity in a Moniliophthora perniciosa mitochondrial plasmid and self-defense against oxidative stress.

    PubMed

    Andrade, B S; Villela-Dias, C; Gomes, D S; Micheli, F; Góes-Neto, A

    2013-06-13

    Moniliophthora perniciosa (Stahel) Aime and Phillips-Mora is a hemibiotrophic basidiomycete (Agaricales, Tricholomataceae) that causes witches' broom disease in cocoa (Theobroma cacao L.). This pathogen carries a stable integrated invertron-type linear plasmid in its mitochondrial genome that encodes viral-like DNA and RNA polymerases related to fungal senescence and longevity. After culturing the fungus and obtaining its various stages of development in triplicate, we carried out total RNA extraction and subsequent complementary DNA synthesis. To analyze DNA and RNA polymerase expression levels, we performed real-time reverse transcriptase polymerase chain reaction for various fungal phases of development. Our results showed that DNA and RNA polymerase gene expression in the primordium phase of M. perniciosa is related to a potential defense mechanism against T. cacao oxidative attack.

  9. Detection of a putative novel adenovirus by PCR amplification, sequencing and phylogenetic characterisation of two gene fragments from formalin-fixed paraffin-embedded tissues of a cat diagnosed with disseminated adenovirus disease.

    PubMed

    Lakatos, Béla; Hornyák, Ákos; Demeter, Zoltán; Forgách, Petra; Kennedy, Frances; Rusvai, Miklós

    2017-12-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in formalin-fixed paraffin-embedded tissue samples of a cat that had suffered from disseminated adenovirus infection. The identity of the amplified products from the hexon and DNA-dependent DNA polymerase genes was confirmed by DNA sequencing. The sequences were clearly distinguishable from corresponding hexon and polymerase sequences of other mastadenoviruses, including human adenoviruses. These results suggest the possible existence of a distinct feline adenovirus.

  10. Detection of Brucella spp. in milk from seronegative cows by real-time polymerase chain reaction in the region of Batna, Algeria

    PubMed Central

    Sabrina, Rabehi; Mossadak, Hamdi Taha; Bakir, Mamache; Asma, Meghezzi; Khaoula, Boushaba

    2018-01-01

    Aim: The aim of this study was to detect Brucella spp. DNA in milk samples collected from seronegative cows using the real-time polymerase chain reaction (PCR) assay for diagnosis of brucellosis in seronegative dairy cows to prevent transmission of disease to humans and to reduce economic losses in animal production. Materials and Methods: In this study, 65 milk samples were investigated for the detection of Brucella spp. The detection of the IS711 gene in all samples was done by real-time PCR assay by comparative cycle threshold method. Results: The results show that of the 65 DNA samples tested, 2 (3.08%) were positive for Brucella infection. The mean cyclic threshold values of IS711 real-time PCR test were 37.97 and 40.48, indicating a positive reaction. Conclusion: The results of the present study indicated that the real-time PCR appears to offer several advantages over serological tests. For this reason, the real-time PCR should be validated on representative numbers of Brucella-infected and free samples before being implemented in routine diagnosis in human and animal brucellosis for controlling this disease. PMID:29657430

  11. RNA-Dependent DNA Polymerase Activity of RNA Tumor Viruses II. Directing Influence of RNA in the Reaction

    PubMed Central

    Leis, Jonathan P.; Hurwitz, Jerard

    1972-01-01

    The role of ribonucleic acid (RNA) in deoxyribonucleic acid (DNA) synthesis with the purified DNA polymerase from the avian myeloblastosis virus has been studied. The polymerase catalyzes the synthesis of DNA in the presence of four deoxynucleoside triphosphates, Mg2+, and a variety of RNA templates including those isolated from avian myeloblastosis, Rous sarcoma, and Rauscher leukemia viruses; phages f2, MS2, and Qβ; and synthetic homopolymers such as polyadenylate·polyuridylic acid. The enzyme does not initiate the synthesis of new chains but incorporates deoxynucleotides at 3′ hydroxyl ends of primer strands. The product is an RNA·DNA hybrid in which the two polynucleotide components are covalently linked. Free DNA has not been detected among the products formed with the purified enzyme in vitro. The DNA synthesized with avian myeloblastosis virus RNA after alkaline hydrolysis has a sedimentation coefficient of 6 to 7S. PMID:4333539

  12. Development of a recombinase polymerase amplification assay for the diagnosis of banana bunchy top virus in different banana cultivars.

    PubMed

    Kapoor, Reetika; Srivastava, Nishant; Kumar, Shailender; Saritha, R K; Sharma, Susheel Kumar; Jain, Rakesh Kumar; Baranwal, Virendra Kumar

    2017-09-01

    Recombinase polymerase amplification (RPA) is a rapid, isothermal amplification method with high specificity and sensitivity. In this study, an assay was developed and evaluated for the detection of banana bunchy top virus (BBTV) in infected banana plants. Three oligonucleotide primer pairs were designed from the replicase initiator protein gene sequences of BBTV to function both in RPA as well as in polymerase chain reaction (PCR). A total of 133 symptomatic as well as asymptomatic banana leaf samples from various cultivars were collected from the different regions of India and evaluated for BBTV infection using the RPA assay. BBTV was efficiently detected using crude leaf sap in RPA and the results obtained were consistent with PCR-based detection using purified DNA as template. To our knowledge, this is the first report of reliable diagnosis of BBTV infection by RPA using crude leaf sap as a template.

  13. Genetic traits of avascular necrosis of the femoral head analyzed by array comparative genomic hybridization and real-time polymerase chain reaction.

    PubMed

    Hwang, Jung-Taek; Baik, Seung-Ho; Choi, Jin-Soo; Lee, Kweon-Haeng; Rhee, Seung-Koo

    2011-01-03

    In an attempt to observe the genetic traits of avascular necrosis of the femoral head, we analyzed the genomic alterations in blood samples of 18 patients with avascular necrosis of the femoral head (9 idiopathic and 9 alcoholic cases) using the array comparative genomic hybridization method and real-time polymerase chain reaction. Several candidate genes were identified that may induce avascular necrosis of the femoral head, and we investigated their role in the pathomechanism of osteonecrosis of bone. The frequency of each candidate gene over all the categories of avascular necrosis of the femoral head was also calculated by real-time polymerase chain reaction. The highest frequency specific genes in each category were FLJ40296, CYP27C1, and CTDP1. FLJ40296 and CYP27C1 had the highest frequency (55.6%) in the idiopathic category. FLJ40296 had a high frequency (44.4%) in the alcoholic category, but CYP27C1 had a relatively low frequency (33.3%) in the alcoholic category. However, CTDP1 showed a significantly high frequency (55.6%) in the alcoholic category and a low frequency (22.2%) in the idiopathic category. Although we statistically analyzed the frequency of each gene with Fisher's exact test, we could not prove statistical significance due to the small number of samples. Further studies are needed with larger sample numbers. If the causal genes of avascular necrosis of the femoral head are found, they may be used for early detection, prognosis prediction, and genomic treatment of avascular necrosis of the femoral head in the future. Copyright 2011, SLACK Incorporated.

  14. Mutations blocking side chain assembly, polymerization, or transport of a Wzy-dependent Streptococcus pneumoniae capsule are lethal in the absence of suppressor mutations and can affect polymer transfer to the cell wall.

    PubMed

    Xayarath, Bobbi; Yother, Janet

    2007-05-01

    Extracellular polysaccharides of many bacteria are synthesized by the Wzy polymerase-dependent mechanism, where long-chain polymers are assembled from undecaprenyl-phosphate-linked repeat units on the outer face of the cytoplasmic membrane. In gram-positive bacteria, Wzy-dependent capsules remain largely cell associated via membrane and peptidoglycan linkages. Like many Wzy-dependent capsules, the Streptococcus pneumoniae serotype 2 capsule is branched. In this study, we found that deletions of cps2K, cps2J, or cps2H, which encode a UDP-glucose dehydrogenase necessary for side chain synthesis, the putative Wzx transporter (flippase), and the putative Wzy polymerase, respectively, were obtained only in the presence of suppressor mutations. Most of the suppressor mutations were in cps2E, which encodes the initiating glycosyltransferase for capsule synthesis. The cps2K mutants containing the suppressor mutations produced low levels of high-molecular-weight polymer that was detected only in membrane fractions. cps2K-repaired mutants exhibited only modest increases in capsule production due to the effect of the secondary mutation, but capsule was detectable in both membrane and cell wall fractions. Lethality of the cps2K, cps2J, and cps2H mutations was likely due to sequestration of undecaprenyl-phosphate in the capsule pathway and either preclusion of its turnover for utilization in essential pathways or destabilization of the membrane due to an accumulation of lipid-linked intermediates. The results demonstrate that proper polymer assembly requires not only a functional transporter and polymerase but also complete repeat units. A central role for the initiating glycosyltransferase in controlling capsule synthesis is also suggested.

  15. Diagnosing leprosy: revisiting the role of the slit-skin smear with critical analysis of the applicability of polymerase chain reaction in diagnosis.

    PubMed

    Banerjee, Surajita; Biswas, Nibir; Kanti Das, Nilay; Sil, Amrita; Ghosh, Pramit; Hasanoor Raja, Abu Hena; Dasgupta, Sarbani; Kanti Datta, Pijush; Bhattacharya, Basudev

    2011-12-01

    Diagnosing leprosy is challenging, especially in early-stage cases, and the need for a sensitive diagnostic tool is urgent. Polymerase chain reaction (PCR) holds promise as a simple and sensitive diagnostic tool, but its usefulness in the Indian context requires further evaluation. Slit-skin smear (SSS) remains the conventional method of leprosy detection. Hence, this study was undertaken to evaluate and compare the diagnostic efficacy of PCR versus that of SSS. Punch biopsy of skin and SSS were obtained from the active margins of lesions. Cases were clinically grouped according to whether they were multibacillary (MB) or paucibacillary (PB) and classified into tuberculoid (TT), borderline tuberculoid (BT), borderline lepromatous (BL), lepromatous (LL), histoid, and indeterminate groups after clinicopathological correlation. DNA was extracted from biopsy specimens, and multiplex PCR was carried out incorporating primers intended for the amplification of a specific 372-bp fragment of a repetitive sequence of Mycobacterium leprae DNA. Among 164 patients, PCR was positive in 82.3%. The sensitivity of PCR was significantly greater (P < 0.0001) than that of SSS in both the MB (85.9% vs. 59.8%) and PB (75.4% vs. 1.8%) subgroups; the difference in sensitivity in the PB subgroup is remarkable. Positivity by PCR and SSS was found in 100% of LL and histoid leprosy, but PCR had significantly greater (P < 0.0001) positivity in BT leprosy and was of definite increased value in indeterminate and TT leprosy. Polymerase chain reaction had higher sensitivity compared with SSS, especially in diagnostically challenging and PB cases. Thus, the use of this costly but sensitive tool should be restricted to this subgroup, because SSS is sufficiently sensitive in the diagnosis of LL and histoid leprosy. © 2011 The International Society of Dermatology.

  16. Antibiotic resistance and molecular typing among cockle (Anadara granosa) strains of Vibrio parahaemolyticus by polymerase chain reaction (PCR)-based analysis.

    PubMed

    Sahilah, A M; Laila, R A S; Sallehuddin, H Mohd; Osman, H; Aminah, A; Ahmad Azuhairi, A

    2014-02-01

    Genomic DNA of Vibrio parahaemolyticus were characterized by antibiotic resistance, enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) and random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) analysis. These isolates originated from 3 distantly locations of Selangor, Negeri Sembilan and Melaka (East coastal areas), Malaysia. A total of 44 (n = 44) of tentatively V. parahaemolyticus were also examined for the presence of toxR, tdh and trh gene. Of 44 isolates, 37 were positive towards toxR gene; while, none were positive to tdh and trh gene. Antibiotic resistance analysis showed the V. parahaemolyticus isolates were highly resistant to bacitracin (92%, 34/37) and penicillin (89%, 33/37) followed by resistance towards ampicillin (68%, 25/37), cefuroxime (38%, 14/37), amikacin (6%, 2/37) and ceftazidime (14%, 5/37). None of the V. parahaemolyticus isolates were resistant towards chloramphenicol, ciprofloxacin, ceftriaxone, enrofloxacin, norfloxacin, streptomycin and vancomycin. Antibiogram patterns exhibited, 9 patterns and phenotypically less heterogenous when compared to PCR-based techniques using ERIC- and RAPD-PCR. The results of the ERIC- and RAPD-PCR were analyzed using GelCompare software. ERIC-PCR with primers ERIC1R and ERIC2 discriminated the V. parahaemolyticus isolates into 6 clusters and 21 single isolates at a similarity level of 80%. While, RAPD-PCR with primer Gen8 discriminated the V. parahaemolyticus isolates into 11 clusters and 10 single isolates and Gen9 into 8 clusters and 16 single isolates at the same similarity level examined. Results in the presence study demonstrated combination of phenotypically and genotypically methods show a wide heterogeneity among cockle isolates of V. parahaemolyticus.

  17. A Degradome-Based Polymerase Chain Reaction to Resolve the Potential of Environmental Samples for 2,4-Dichlorophenol Biodegradation.

    PubMed

    Ibrahim, Eslam S; Kashef, Mona T; Essam, Tamer M; Ramadan, Mohammed A

    2017-12-01

    A clean way to overcome environmental pollution is biodegradation. In this perspective, at the intersection of biodegradation and metagenomics, the degradome is defined as the totality of genes related to the biodegradation of a certain compound. It includes the genetic elements from both culturable and uncultured microorganisms. The possibility of assessing the biodegradation potential of an environmental samples, using a degradome-based polymerase chain reaction, was explored. 2,4-Dichlorophenol (2,4-DCP) was chosen as a model and the use of tfdB gene as a biodegradation marker was confirmed by bioinformatics study of TfdB protein. Five primer pairs were designed for the detection of different tfdB gene families. A total of 16 environmental samples were collected from Egyptian agricultural soils and wastewaters and tested for the presence of 2,4-DCP. The biodegradation capacity of 2,4-DCP was determined, for all isolated consortia, to reach up to 350 mg/l. Metagenomic DNA was extracted directly from the soil samples while successive 2,4-DCP-degrading microbial communities were enriched, with increasing concentrations of 2,4-DCP, then their DNA was extracted. The extracted DNA was tested for the distribution of the tfdB gene using a degradome-based polymerase chain reaction. tfdB-1 and tfdB-2 were detected in 5 and 9 samples, respectively. However, the co-existence of both genes was detected only in five samples. All tfdB positive samples were capable of 2,4-DCP degradation. The developed approach of assessing the potential of different environments for degrading 2,4-DCP was successfully measured in terms of accuracy (81.25%) and specificity (100%).

  18. Molecular analysis and association with clinical and laboratory manifestations in children with sickle cell anemia

    PubMed Central

    Camilo-Araújo, Roberta Faria; Amancio, Olga Maria Silverio; Figueiredo, Maria Stella; Cabanãs-Pedro, Ana Carolina; Braga, Josefina Aparecida Pellegrini

    2014-01-01

    Objectives To analyze the frequency of βS-globin haplotypes and alpha-thalassemia, and their influence on clinical manifestations and the hematological profile of children with sickle cell anemia. Method The frequency of βS-globin haplotypes and alpha-thalassemia and any association with clinical and laboratorial manifestations were determined in 117 sickle cell anemia children aged 3–71 months. The confirmation of hemoglobin SS and determination of the haplotypes were achieved by polymerase chain reaction-restriction fragment length polymorphism, and alpha-thalassemia genotyping was by multiplex polymerase chain reaction (single-tube multiplex-polymerase chain reaction). Results The genotype distribution of haplotypes was 43 (36.7%) Central African Republic/Benin, 41 (35.0%) Central African Republic/Central African Republic, 20 (17.0%) Rare/atypical, and 13 (11.1%) Benin/Benin. The frequency of the α3.7 deletion was 1.71% as homozygous (−α3.7/−α3.7) and 11.9% as heterozygous (−α3.7/αα). The only significant association in respect to haplotypes was related to the mean corpuscular volume. The presence of alpha-thalassemia was significantly associated to decreases in mean corpuscular volume, mean corpuscular hemoglobin and reticulocyte count and to an increase in the red blood cell count. There were no significant associations of βS-globin haplotypes and alpha-thalassemia with clinical manifestations. Conclusions In the study population, the frequency of alpha-thalassemia was similar to published data in Brazil with the Central African Republic haplotype being the most common, followed by the Benin haplotype. βS-globin haplotypes and interaction between alpha-thalassemia and sickle cell anemia did not influence fetal hemoglobin concentrations or the number of clinical manifestations. PMID:25305165

  19. [Applying competitive polymerase chain reaction to the detection of hepatitis B virus DNA].

    PubMed

    Wang, Ling; Yang, Peng; Li, Shuang-qing; Xu, Shu-hui; Cao, Gui-qun; Zhang, Fa-qiang; Zhang, Mei-xia; Chen, Qing-ying; Xia, Qing-jie; Liu, Kai; Tang, Fang; Zhang, Yuan-zheng

    2004-11-01

    To reduce the rate of accidental false negative result in the HBV DNA PCR test on clinical serum samples. A competitive polymerase chain reaction (C-PCR) was used to decrease the false negative ratio. In the C-PCR, a constructed inner control DNA was added for co-amplification with the HBV target DNA. In a 20 microl C-PCR system, about 60 to 200 copies of inner control DNA could give apparent co-amplification signal band after electrophoresis on a 2% agarose gel. Five of 120 samples of clinical serum (4.2%) could not be amplified. C-PCR has the advantage of yielding information on false negative in the HBV DNA PCR assay of clinical serum samples.

  20. Cytomegalovirus retinitis after intravitreal bevacizumab injection in an immunocompetent patient.

    PubMed

    Bae, So Hyun; Kim, Tae Wan; Chung, Hum; Heo, Jang Won

    2013-02-01

    We report a case of cytomegalovirus (CMV) retinitis after intravitreal bevacizumab injection. A 61-year-old woman with diabetic macular edema developed dense vitritis and necrotizing retinitis 3 weeks after intravitreal bevacizumab injection. A diagnostic vitrectomy was performed. The undiluted vitreous sample acquired by vitrectomy was analyzed by polymerase chain reaction and culture. Polymerase chain reaction of the vitreous was positive for CMV DNA. Other laboratory results did not show evidence of other infectious retinitis and systemic immune dysfunction. Human immunodeficiency virus antibodies were also negative. After systemic administration of ganciclovir, retinitis has resolved and there has been no recurrence of retinitis during the follow-up period of 12 months. Ophthalmologists should be aware of potential risk for CMV retinitis after intravitreal bevacizumab injection.

  1. Sexing chick mRNA: A protocol based on quantitative real-time polymerase chain reaction.

    PubMed

    Wan, Z; Lu, Y; Rui, L; Yu, X; Li, Z

    2017-03-01

    The accurate identification of sex in birds is important for research on avian sex determination and differentiation. Polymerase chain reaction (PCR)-based methods have been widely applied for the molecular sexing of birds. However, these methods have used genomic DNA. Here, we present the first sexing protocol for chick mRNA based on real-time quantitative PCR. We demonstrate that this method can accurately determine sex using mRNA from chick gonads and other tissues, such as heart, liver, spleen, lung, and muscle. The strategy of this protocol also may be suitable for other species in which sex is determined by the inheritance of sex chromosomes (ZZ male and ZW female). © 2016 Poultry Science Association Inc.

  2. Plague in a Pediatric Patient: Case Report and Use of Polymerase Chain Reaction as a Diagnostic Aid.

    PubMed

    Drummond, Wendi K; Nelson, Christina A; Fowler, Joe; Epson, Erin E; Mead, Paul S; Lawaczeck, Elisabeth W

    2014-12-01

    We report a case of bubonic plaque in a 7-year-old patient who presented with a core temperature of 107°F, seizures, vomiting, altered mental status, and septic shock. This case highlights the utility of polymerase chain reaction (PCR) as a diagnostic aid for rapid presumptive identification of Yersinia pestis as well as the importance of correlating PCR results with clinical data. We discuss the various manifestations of plague as they relate to infection control, postexposure prophylaxis, antimicrobial therapy, and treatment duration. © The Author 2014. Published by Oxford University Press on behalf of the Pediatric Infectious Diseases Society. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  3. Reverse Transcription Quantitative Polymerase Chain Reaction for Detection of and Differentiation Between RNA and DNA of HIV-1-Based Lentiviral Vectors.

    PubMed

    Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E

    2017-08-01

    The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.

  4. [DIAGNOSTIC VALUE OF COMBINED USE OF COMBINED METHOD OF ENZYME IMMUNOASSAY AND POLYMERASE CHAIN REACTION TO DETECT OF INTRAUTERINE FETAL INFECTION BY PARVOVIRUS B19].

    PubMed

    Bondarenko, N P; Lakatosh, V P; Lakatosh, P V; Malanchuk, O B; Poladich, I V

    2015-01-01

    The combined method of diagnosis parvovirus infection during pregnancy by maternal serum enzyme immunoassay and deoxyribonucleic acid isolation parvovirus B19 polymerase chain reaction in amnniotic fluid and fetal cord blood newborns, can diagnose vertical transmission and anticipate a negative effect on the fetus parvovirus. Lack of maternal IgM antibodies in serum due to parvovirus seroconversion during pregnancy does not exclude the persistence of the virus in the fetus. To analyze the diagnostic value of the method for determining the LHP parvovirus B19 DNA in the amniotic fluid, umbilical cord blood of newborns to determine vertical transmission of parvovirus infection when infected mothers B19 during pregnancy.

  5. Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

    PubMed

    Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

    2008-03-01

    Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

  6. A case of Pitt-Hopkins syndrome with absence of hyperventilation.

    PubMed

    Inati, Adlette; Abbas, Hussein A; Korjian, Serge; Daaboul, Yazan; Harajeily, Mohamad; Saab, Raya

    2013-12-01

    Pitt-Hopkins syndrome is characterized by mental retardation, hyperventilation, and dysmorphic features due to TCF4 mutations. We report a case of Pitt-Hopkins syndrome in a 2½-year-old boy presenting with psychomotor retardation, recurrent respiratory tract infections, and dysmorphic features with absence of hyperventilation or other breathing abnormalities. Comparative genomic hybridization and quantitative real-time polymerase chain reaction were used to confirm TCF4 haploinsufficiency. Pitt-Hopkins syndrome is a rare debilitating disease that should be in the differential diagnosis of other neurodevelopmental disorders characterized by mental retardation and hypotonicity despite the absence of hyperapnea and seizures. Quantitative real-time polymerase chain reaction is another method to identify TCF4 and to confirm Pitt-Hopkins syndrome diagnosis.

  7. Multiplex polymerase chain reaction assay for the detection of minute virus of mice and mouse parvovirus infections in laboratory mice.

    PubMed

    Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H

    2013-04-01

    Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.

  8. Optimisation of techniques for quantification of Botrytis cinerea in grape berries and receptacles by quantitative polymerase chain reaction

    USDA-ARS?s Scientific Manuscript database

    Quantitative PCR (qPCR) can be used to detect and monitor pathogen colonization, but early attempts to apply the technology to Botrytis cinerea infection of grape berries have identified limitations to current techniques. In this study, four DNA extraction methods, two grinding methods, two grape or...

  9. Nanoparticles affect PCR primarily via surface interactions with PCR components: using amino-modified silica-coated magnetic nanoparticles as a main model

    USDA-ARS?s Scientific Manuscript database

    Nanomaterials have been widely reported to affect the polymerase chain reaction (PCR). However, many studies in which these effects were observed were not comprehensive, and many of the proposed mechanisms have been primarily speculative. In this work, we used amino-modified silica-coated magnetic n...

  10. Molecular detection of Xanthomonas oryzae pv. oryzae, Xanthomonas oryzae pv. oryzicola, and Burkholderia glumae in infected rice seeds and leaves

    USDA-ARS?s Scientific Manuscript database

    Polymerase chain reaction (PCR) is particularly useful for plant pathogen detection. In the present study, multiplex PCR and SYBR green real-time PCR were developed to facilitate simultaneous detection of three important rice pathogens, Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, and Bur...

  11. FECAL INDICATOR BACTERIA MEASUREMENTS BY QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) ANALYSIS IN FRESH ARCHIVED DNA EXTRACT OF WATER SAMPLE FILTRATES

    EPA Science Inventory

    The U.S. EPA has initiated a new recreational water study to evaluate the correlation between illness rates in swimmers and Enterococcus concentrations determined by the mEI agar membrane filter (MF) method and several new technologies including QPCR analysis. Results of this stu...

  12. Replicon typing of plasmids encoding resistance to newer beta-lactams.

    PubMed

    Carattoli, Alessandra; Miriagou, Vivi; Bertini, Alessia; Loli, Alexandra; Colinon, Celine; Villa, Laura; Whichard, Jean M; Rossolini, Gian Maria

    2006-07-01

    Polymerase chain reaction-based replicon typing represents a novel method to describe the dissemination and follow the evolution of resistance plasmids. We used this approach to study 26 epidemiologically unrelated Enterobacteriaceae and demonstrate the dominance of incompatibility (Inc) A/C or Inc N-related plasmids carrying some emerging resistance determinants to extended-spectrum cephalosporins and carbapenems.

  13. Development of a non invasion real-time PCR assay for the quantitation of chicken parvovirus in fecal swabs

    USDA-ARS?s Scientific Manuscript database

    The present study describes the development of a real time Taqman polymerase chain reaction (PCR) assay using a fluorescent labeled probe for the detection and quantitation of chicken parvovirus (ChPV) in feces. The primers and probes were designed based on the nucleotide sequence of the non struct...

  14. Identification and validation of biomarkers of IgV(H) mutation status in chronic lymphocytic leukemia using microfluidics quantitative real-time polymerase chain reaction technology.

    PubMed

    Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R

    2007-09-01

    To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.

  15. Recombinase Polymerase Amplification Compared to Real-Time Polymerase Chain Reaction Test for the Detection of Fasciola hepatica in Human Stool

    PubMed Central

    Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton

    2017-01-01

    Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691

  16. Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis in the rumen epithelium

    USDA-ARS?s Scientific Manuscript database

    The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA) metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following intro...

  17. [THE COMPARATIVE ANALYSIS OF EFFECTIVENESS OF QUICK TESTS IN DIAGNOSTIC OF INFLUENZA AND RESPIRATORY SYNCYTIAL VIRAL INFECTION IN CHILDREN].

    PubMed

    Petrova, E R; Sukhovetskaia, V P; Pisareva, M M; Maiorova, V G; Sverlova, M V; Danilenko, D M; Petrova, P A; Krivitskaia, V Z; Sominina, A A

    2015-11-01

    The analysis was implemented concerning diagnostic parameters of commercial quick tests (immune chromatographic tests BinaxNOW Influenza A&B and BinaxNow RSV Alere, Scarborough Inc., USA) under detection of antigens of influenza virus A and respiratory syncytial virus in clinical materials. The polymerase chain reaction in real-time and isolation ofviruses in cell cultures. The analysis of naso-pharyngeal smears from 116 children demonstrated that sensitivity and specifcity of detection of influenza virus A using device mariPOC in comparison with polymerase chain reaction made up to 93.8% and 99.0% correspondingly at total concordance of results of both techniques as 98.3%. At diagnosing of respiratory syncytial virus using device mariPOC parameters made up to 77.3%, 98.9% and 862% as compared with polymerase chain reaction. The sensitivity, specificity and total concordance of results of immune chromatographic tests BinaxNOW in comparison ofpolymerase chain reaction made up to 86.7%, 100% and 96.2% correspondingly at detection of influenza virus A and 80.9%, 97.4% and 91.6% correspondingly at detection of respiratory syncytial virus. In comparison with isolation technique in cell cultures sensitivity of system mariPOC and immune chromatographic tests proved to be in 1.3-1.4 times higher at detection of influenza virus A and in 1.7-2 times higher in case of isolation of respiratory syncytial virus. There is no statistically significant differences between diagnostic parameters received for mariPOC and immune chromatographic tests at diagnosing influenza virus A and respiratory syncytial viral infection.

  18. The uncoupling of catalysis and translocation in the viral RNA-dependent RNA polymerase

    PubMed Central

    Shu, Bo; Gong, Peng

    2017-01-01

    ABSTRACT The nucleotide addition cycle of nucleic acid polymerases includes 2 major events: the pre-chemistry active site closure leading to the addition of one nucleotide to the product chain; the post-chemistry translocation step moving the polymerase active site one position downstream on its template. In viral RNA-dependent RNA polymerases (RdRPs), structural and biochemical evidences suggest that these 2 events are not tightly coupled, unlike the situation observed in A-family polymerases such as the bacteriophage T7 RNA polymerase. Recently, an RdRP translocation intermediate crystal structure of enterovirus 71 shed light on how translocation may be controlled by elements within RdRP catalytic motifs, and a series of poliovirus apo RdRP crystal structures explicitly suggest that a motif B loop may assist the movement of the template strand in late stages of transcription. Implications of RdRP catalysis-translocation uncoupling and the remaining challenges to further elucidate RdRP translocation mechanism are also discussed. PMID:28277928

  19. A polymerase chain reaction strategy for the diagnosis of camelpox.

    PubMed

    Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar

    2009-03-01

    Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.

  20. Chloroplast and nuclear DNA studies in a few members of the Brassica oleracea L. group using PCR-RFLP and ISSR-PCR markers: a population genetic analysis.

    PubMed

    Panda, S; Martín, J P; Aguinagalde, I

    2003-04-01

    A population genetic analysis of chloroplast and nuclear DNA was performed covering nine wild populations of Brassica oleracea. Three members of the n = 9 group, all close to B. oleracea, Brassica alboglabra Bailey, Brassica bourgeaui (Webb) O. Kuntze and Brassica montana Pourret, were also studied to better understand their relationship with B. oleracea. Chloroplast DNA was analysed using the PCR-RFLP (polymerase chain reaction - restriction fragment length polymorphism) method. The ISSR-PCR (inter-simple sequence repeat - polymerase chain reaction) technique was adopted to study nuclear DNA. Twelve primer pairs of chloroplast DNA showed very good amplification. The amplified product of each primer pair, digested by three restriction enzymes, revealed no variation of cpDNA among the taxa studied. This indicates they may have the same chloroplast genotype. Seven selected ISSR primers have detected genetic variation, both within and among the populations/taxa surveyed. The information obtained on the intra- and inter-populational genetic diversity of wild populations of B. oleracea neatly defined the individual plants. It could provide important guidelines for backing management and conservation strategies in this species. The study confirms a close relationship between B. alboglabra, B. bourgeaui and B. montana, which is parallel to their morphological similitude.

  1. Stochastic model of template-directed elongation processes in biology.

    PubMed

    Schilstra, Maria J; Nehaniv, Chrystopher L

    2010-10-01

    We present a novel modular, stochastic model for biological template-based linear chain elongation processes. In this model, elongation complexes (ECs; DNA polymerase, RNA polymerase, or ribosomes associated with nascent chains) that span a finite number of template units step along the template, one after another, with semaphore constructs preventing overtaking. The central elongation module is readily extended with modules that represent initiation and termination processes. The model was used to explore the effect of EC span on motor velocity and dispersion, and the effect of initiation activator and repressor binding kinetics on the overall elongation dynamics. The results demonstrate that (1) motors that move smoothly are able to travel at a greater velocity and closer together than motors that move more erratically, and (2) the rate at which completed chains are released is proportional to the occupancy or vacancy of activator or repressor binding sites only when initiation or activator/repressor dissociation is slow in comparison with elongation. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  2. Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain.

    PubMed

    Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur

    2017-05-17

    Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

  3. Amplification of ST50 gene using dry-reagent-based polymerase chain reaction for the detection of Salmonella typhi.

    PubMed

    Aziah, Ismail; Ravichandran, Manickam; Ismail, Asma

    2007-12-01

    Conventional polymerase chain reaction (PCR) testing requires many pipetting steps and has to be transported and stored in cold chain. To overcome these limitations, we designed a ready-to-use PCR test for Salmonella typhi using PCR reagents, primers against the ST50 gene of S. typhi, a built-in internal amplification control (IAC), and gel loading dye mixed and freeze-dried in a single tube. The 2-step dry-reagent-based assay was used to amplify a 1238-bp target gene and an 810-bp IAC gene from 73 BACTEC blood culture broths (33 true positives for S. typhi and 40 true negatives for non-S. typhi). The sensitivity, specificity, positive predictive value, and negative predictive value of the PCR assay were 87.9%, 100%, 100%, and 90.9%, respectively. We suggest that this rapid 2-step PCR test could be used for the rapid diagnosis of typhoid fever.

  4. Detection of epsilon class switching and IgE synthesis in human B cells.

    PubMed

    Pène, Jérôme; Guilhot, Florence; Cognet, Isabelle; Guglielmi, Paul; Guay-Giroux, Angélique; Bonnefoy, Jean-Yves; Elson, Greg C; Yssel, Hans; Gauchat, Jean-François

    2006-01-01

    We observed that mast cells, as other cells expressing the CD40 ligand CD154, can trigger IgE synthesis in B cells in the presence of interleukin (IL)-4. Numerous complementary techniques can be used to follow the succession of molecular events leading to IgE synthesis. This chapter will illustrate how human B cells (naïve or memory) can be purified, stored, and cultivated in medium that is permissive for IgE synthesis and stimulated with IL-4 or IL-13 and CD40 activation, the latter being induced by soluble CD154, anti-CD40 antibodies, or CD154-expressing cells. All these molecules are expressed by mast cells. The quantification of the epsilon-sterile transcript synthesis by polymerase chain reaction or Northern blot, the epsilon excision circles produced during immunoglobulin heavy chain locus rearrangement by polymerase chain reaction, and the IgE production by enzyme-linked immunosorbent assay will be described.

  5. Optimizing Virus Identification in Critically Ill Children Suspected of Having an Acute Severe Viral Infection.

    PubMed

    Randolph, Adrienne G; Agan, Anna A; Flanagan, Ryan F; Meece, Jennifer K; Fitzgerald, Julie C; Loftis, Laura L; Truemper, Edward J; Li, Simon; Ferdinands, Jill M

    2016-04-01

    Multiplex rapid viral tests and nasopharyngeal flocked swabs are increasingly used for viral testing in PICUs. This study aimed at evaluating how the sampling site and the type of diagnostic test influence test results in children with suspected severe viral infection. Prospective cohort study. PICUs at 21 tertiary pediatric referral centers in the United States. During the 2010-2011 and 2011-2012 influenza seasons, we enrolled children (6 mo to 17 yr old) who were suspected to have severe viral infection. We collected samples by using a standardized protocol for nasopharyngeal aspirate and nasopharyngeal flocked swabs in nonintubated patients and for endotracheal tube aspirate and nasopharyngeal flocked swabs in intubated patients. Viral testing included a single reverse transcription-polymerase chain reaction influenza test and the GenMark Respiratory Viral Panel (20 viruses). We enrolled 90 endotracheally intubated and 133 nonintubated children. We identified influenza in 45 patients with reverse transcription-polymerase chain reaction testing; the multiplex panel was falsely negative for influenza in two patients (4.4%). Six patients (13.3%) had not been diagnosed with influenza in the PICU. Non-influenza viruses were identified in 172 of 223 children (77.1%). In nonintubated children, the same virus was identified by nasopharyngeal flocked swabs and nasopharyngeal aspirate in 133 of 183 paired samples (72.7%), with +nasopharyngeal aspirate/-nasopharyngeal flocked swabs in 32 of 183 paired samples (17.4%). In intubated children, the same virus was identified by nasopharyngeal flocked swabs and endotracheal tube aspirate in 67 of 94 paired samples (71.3%), with +nasopharyngeal flocked swabs/- endotracheal tube aspirate in 22 of 94 paired samples (23.4%). Most discrepancies were either adenovirus or rhinovirus in both groups. Standardized specimen collection and sensitive diagnostic testing with a reverse transcription-polymerase chain reaction increased the identification of influenza in critically ill children. For most pathogenic viruses identified, results from nasopharyngeal flocked swabs agreed with those from nasopharyngeal or endotracheal aspirates.

  6. Development of a multiplex polymerase chain reaction-sequence-specific primer method for NKG2D and NKG2F single-nucleotide polymorphism typing using isothermal multiple displacement amplification products.

    PubMed

    Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C

    2013-06-01

    Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.

  7. Nasopharyngeal bacterial load as a marker for rapid and easy diagnosis of invasive pneumococcal disease in children from Mozambique

    PubMed Central

    Lanaspa, Miguel; Henares, Desiree; Perez-Arguello, Amaresh; Madrid, Lola; Balcells, Reyes; Acacio, Sozinho; Andres-Franch, Maria; Marcos, Maria Angeles; Valero-Rello, Ana

    2017-01-01

    Background Current diagnostic methods for detection of Streptococcus pneumoniae in children with suspected invasive pneumococcal disease have limitations of accuracy, timeliness, and patient convenience. This study aimed to determine the performance of pneumococcal load quantified with a real-time polymerase-chain reaction in nasopharyngeal samples to diagnose invasive pneumococcal disease in children. Methods Matched case-control study of patients <5 years of age with invasive pneumococcal disease admitted to the Manhiça District Hospital (Mozambique) and asymptomatic controls recruited in different periods between 2006 and 2014. Cases were confirmed by a positive bacterial culture for S. pneumoniae in blood or cerebrospinal fluid. Nasopharyngeal aspirates were collected from cases and controls and pneumococcal density was quantified by lytA real-time polymerase-chain reaction. Results Thirty cases (median age 12.8 months) and sixty controls (median age 11.7 months) were enrolled and 70% of them were male. Nasopharyngeal pneumococcal carriage was high in both groups: 28/30 (93.3%) for cases vs. 53/60 (88.3%) for controls (p = 0.71). Mean nasopharyngeal pneumococcal load was identified as a marker for invasive pneumococcal disease (7.0 log10 copies/mL in cases vs. 5.8 log10 copies/mL in controls, p<0.001) and showed good discriminatory power (AUC-ROC: 82.1%, 95% CI 72.5%-91.8%). A colonization density of 6.5 log10 copies/mL was determined as the optimal cut-off value to distinguish cases from controls (sensitivity 75.0%, specificity 73.6%). Conclusion Use of non-invasive nasopharyngeal aspirates coupled with rapid and accurate quantification of pneumococcal load by real-time polymerase chain reaction has the potential to become a useful surrogate marker for early diagnosis of invasive pneumococcal disease in children. PMID:28910402

  8. Multisite analytic performance studies of a real-time polymerase chain reaction assay for the detection of BRAF V600E mutations in formalin-fixed, paraffin-embedded tissue specimens of malignant melanoma.

    PubMed

    Anderson, Steven; Bloom, Kenneth J; Vallera, Dino U; Rueschoff, Josef; Meldrum, Cliff; Schilling, Robert; Kovach, Barbara; Lee, Ju Ruey-Jiuan; Ochoa, Pam; Langland, Rachel; Halait, Harkanwal; Lawrence, H Jeffrey; Dugan, Michael C

    2012-11-01

    A polymerase chain reaction-based companion diagnostic (cobas 4800 BRAF V600 Mutation Test) was recently approved by the US Food and Drug Administration to select patients with BRAF-mutant metastatic melanoma for treatment with the BRAF inhibitor vemurafenib. (1) To compare the analytic performance of the cobas test to Sanger sequencing by using screening specimens from phase II and phase III trials of vemurafenib, and (2) to assess the reproducibility of the cobas test at different testing sites. Specimens from 477 patients were used to determine positive and negative percent agreements between the cobas test and Sanger sequencing for detecting V600E (1799T>A) mutations. Specimens were evaluated with a massively parallel pyrosequencing method (454) to resolve discordances between polymerase chain reaction and Sanger results. Reproducibility of the cobas test was assessed at 3 sites by using 3 reagent lots and an 8-member panel of melanoma samples. A valid cobas result was obtained for all eligible patients. Sanger sequencing had a failure rate of 9.2% (44 of 477). For the remaining 433 specimens, positive percent agreement was 96.4% (215 of 223) and negative percent agreement, 80% (168 of 210). Among 42 cobas mutation-positive/Sanger V600E-negative specimens, 17 were V600E positive and 24 were V600K positive by 454. The cobas test detected 70% of V600K mutations. In the reproducibility study, a correct interpretation was made for 100% of wild-type specimens and specimens with greater than 5% mutant alleles; V600E mutations were detected in 90% of specimens with less than 5% mutant alleles. The cobas test (1) had a lower assay failure rate than that of Sanger, (2) was more sensitive in detecting V600E mutations, (3) detected most V600K mutations, and (4) was highly reproducible.

  9. Development of a rapid and sensitive one-step reverse transcription-nested polymerase chain reaction in a single tube using the droplet-polymerase chain reaction machine.

    PubMed

    Yamaguchi, Akemi; Matsuda, Kazuyuki; Sueki, Akane; Taira, Chiaki; Uehara, Masayuki; Saito, Yasunori; Honda, Takayuki

    2015-08-25

    Reverse transcription (RT)-nested polymerase chain reaction (PCR) is a time-consuming procedure because it has several handling steps and is associated with the risk of cross-contamination during each step. Therefore, a rapid and sensitive one-step RT-nested PCR was developed that could be performed in a single tube using a droplet-PCR machine. The K562 BCR-ABL mRNA-positive cell line as well as bone marrow aspirates from 5 patients with chronic myelogenous leukemia (CML) and 5 controls without CML were used. We evaluated one-step RT-nested PCR using the droplet-PCR machine. One-step RT-nested PCR performed in a single tube using the droplet-PCR machine enabled the detection of BCR-ABL mRNA within 40min, which was 10(3)-fold superior to conventional RT nested PCR using three steps in separate tubes. The sensitivity of the one-step RT-nested PCR was 0.001%, with sample reactivity comparable to that of the conventional assay. One-step RT-nested PCR was developed using the droplet-PCR machine, which enabled all reactions to be performed in a single tube accurately and rapidly and with high sensitivity. This one-step RT-nested PCR may be applicable to a wide spectrum of genetic tests in clinical laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. A screening method for the detection of the 35S promoter and the nopaline synthase terminator in genetically modified organisms in a real-time multiplex polymerase chain reaction using high-resolution melting-curve analysis.

    PubMed

    Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko

    2009-11-01

    To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.

  11. Combined subtraction hybridization and polymerase chain reaction amplification procedure for isolation of strain-specific Rhizobium DNA sequences.

    PubMed Central

    Bjourson, A J; Stone, C E; Cooper, J E

    1992-01-01

    A novel subtraction hybridization procedure, incorporating a combination of four separation strategies, was developed to isolate unique DNA sequences from a strain of Rhizobium leguminosarum bv. trifolii. Sau3A-digested DNA from this strain, i.e., the probe strain, was ligated to a linker and hybridized in solution with an excess of pooled subtracter DNA from seven other strains of the same biovar which had been restricted, ligated to a different, biotinylated, subtracter-specific linker, and amplified by polymerase chain reaction to incorporate dUTP. Subtracter DNA and subtracter-probe hybrids were removed by phenol-chloroform extraction of a streptavidin-biotin-DNA complex. NENSORB chromatography of the sequences remaining in the aqueous layer captured biotinylated subtracter DNA which may have escaped removal by phenol-chloroform treatment. Any traces of contaminating subtracter DNA were removed by digestion with uracil DNA glycosylase. Finally, remaining sequences were amplified by polymerase chain reaction with a probe strain-specific primer, labelled with 32P, and tested for specificity in dot blot hybridizations against total genomic target DNA from each strain in the subtracter pool. Two rounds of subtraction-amplification were sufficient to remove cross-hybridizing sequences and to give a probe which hybridized only with homologous target DNA. The method is applicable to the isolation of DNA and RNA sequences from both procaryotic and eucaryotic cells. Images PMID:1637166

  12. Performance of transport and selective media for swine Bordetella bronchiseptica recovery and it comparison to polymerase chain reaction detection

    PubMed Central

    Coutinho, Tania Alen; Bernardi, Mari Lourdes; de Itapema Cardoso, Marisa Ribeiro; Borowski, Sandra Maria; Moreno, Andrea Micke; de Barcellos, David Emilio Santos Neves

    2009-01-01

    Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10°C and 27°C) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27°C and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures. PMID:24031390

  13. Nuclear TRIM25 Specifically Targets Influenza Virus Ribonucleoproteins to Block the Onset of RNA Chain Elongation.

    PubMed

    Meyerson, Nicholas R; Zhou, Ligang; Guo, Yusong R; Zhao, Chen; Tao, Yizhi J; Krug, Robert M; Sawyer, Sara L

    2017-11-08

    TRIM25 is an E3 ubiquitin ligase that activates RIG-I to promote the antiviral interferon response. The NS1 protein from all strains of influenza A virus binds TRIM25, although not all virus strains block the interferon response, suggesting alternative mechanisms for TRIM25 action. Here we present a nuclear role for TRIM25 in specifically restricting influenza A virus replication. TRIM25 inhibits viral RNA synthesis through a direct mechanism that is independent of its ubiquitin ligase activity and the interferon pathway. This activity can be inhibited by the viral NS1 protein. TRIM25 inhibition of viral RNA synthesis results from its binding to viral ribonucleoproteins (vRNPs), the structures containing individual viral RNA segments, the viral polymerase, and multiple viral nucleoproteins. TRIM25 binding does not inhibit initiation of capped-RNA-primed viral mRNA synthesis by the viral polymerase. Rather, the onset of RNA chain elongation is inhibited because TRIM25 prohibits the movement of RNA into the polymerase complex. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. MATERIALS SUPPORTING THE NEW RECREATIONAL ...

    EPA Pesticide Factsheets

    EPA is developing new, rapid methods for monitoring water quality at beaches to determine adequacy of water quality for swimming. The methods being developed rely upon quantitive polymerase chain reaction technology. They will permit real time decisions regarding beach closures. The methods are supported by a series of epidemiology studies evaluating the rate of GI illness resulting from swimming events. Implementation of BEACH Act amendments

  15. Replicon Typing of Plasmids Encoding Resistance to Newer β-Lactams

    PubMed Central

    Miriagou, Vivi; Bertini, Alessia; Loli, Alexandra; Colinon, Celine; Villa, Laura; Whichard, Jean M.; Rossolini, Gian Maria

    2006-01-01

    Polymerase chain reaction–based replicon typing represents a novel method to describe the dissemination and follow the evolution of resistance plasmids. We used this approach to study 26 epidemiologically unrelated Enterobacteriaceae and demonstrate the dominance of incompatibility (Inc) A/C or Inc N-related plasmids carrying some emerging resistance determinants to extended-spectrum cephalosporins and carbapenems. PMID:16836838

  16. Genetic Detection and Isolation of Crimean-Congo hemorrhagic fever virus, Kosovo, Yugoslavia

    PubMed Central

    Boźović, Bojana; Pavlidou, Vassiliki; Papadimitriou, Evangelia; Pelemis, Mijomir; Antoniadis, Aantonis

    2002-01-01

    Crimean-Congo hemorrhagic fever virus (C-CHFV) strains were isolated from a fatal case and the attending physician in Kosovo, Yugoslavia. Early, rapid diagnosis of the disease was achieved by reverse transcription-polymerase chain reaction. The physician was successfully treated with oral ribavirin. These cases yielded the first genetically studied C-CHFV human isolates in the Balkans. PMID:12141973

  17. Culture, Polymerase Chain Reaction and Restriction Fragment Length Polymorphism Studies in Bartonella bacilliformis

    DTIC Science & Technology

    1998-09-22

    within the BA lesions ofHIV-infected patients that appeared similar to the CSD bacillus. ReIman et aI. provided the first infotmation on the genus of the...1993. 31(7): 1730-1734. 21. ReIman DA. Bacillary angiomatosis and Rochalimaea species. Curro CUn. Top. Infect. Dis. pp. 205-219. MElliODS and MATERIALS

  18. A simple and rapid DNA extraction method for Chlamydia trachomatis detection from urogenital swabs.

    PubMed

    Butzler, Matthew A; Reed, Jennifer L; McFall, Sally M

    2017-11-01

    A highly sensitive and specific Chlamydia trachomatis (CT) diagnostic test was developed by combining filtration isolation of nucleic acid (FINA) extraction with quantitative polymerase chain reaction including an internal control to identify test inhibition. A pilot study of 40 clinical specimens yielded 100% sensitivity and specificity. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Bioelectrochemical Systems Workshop:Standardized Analyses, Design Benchmarks, and Reporting

    DTIC Science & Technology

    2012-01-01

    related to the exoelectrogenic biofilm activity, and to investigate whether the community structure is a function of design and operational parameters...where should biofilm samples be collected? The most prevalent methods of community characterization in BES studies have entailed phylogenetic ...of function associated with this genetic marker, and in methods that involve polymerase chain reaction (PCR) amplification the quantitative

  20. Sequences of heavy and light chain variable regions from four bovine immunoglobulins.

    PubMed

    Armour, K L; Tempest, P R; Fawcett, P H; Fernie, M L; King, S I; White, P; Taylor, G; Harris, W J

    1994-12-01

    Oligodeoxyribonucleotide primers based on the 5' ends of bovine IgG1/2 and lambda constant (C) region genes, together with primers encoding conserved amino acids at the N-terminus of mature variable (V) regions from other species, have been used in cDNA and polymerase chain reactions (PCRs) to amplify heavy and light chain V region cDNA from bovine heterohybridomas. The amino acid sequences of VH and V lambda from four bovine immunoglobulins of different specificities are presented.

  1. Quantitative polymerase chain reaction for transforming growth factor-β applied to a field study of fish health in Chesapeake Bay tributaries

    USGS Publications Warehouse

    Harms, Craig A.; Ottinger, Christopher A.; Blazer, Vicki S.; Densmore, Christine L.; Pieper, L.H.; Kennedy-Stoskopf, S.

    2000-01-01

    Fish morbidity and mortality events in Chesapeake Bay tributaries have aroused concern over the health of this important aquatic ecosystem. We applied a recently described method for quantifying mRNA of an immunosuppressive cytokine, transforming growth factor-β (TGF-β), by reverse transcription quantitative-competitive polymerase chain reaction to a field study of fish health in the Chesapeake Basin, and compared the results to those of a traditional cellular immunoassay macrophage bactericidal activity. We selected the white perch (Morone americana) as the sentinel fish species because of its abundance at all of the collection sites. White perch were sampled from Chesapeake Bay tributaries in June, August, and October 1998. Splenic mononuclear cell TGF-β mRNA levels increased and anterior kidney macrophage bactericidal activity decreased, particularly in eastern shore tributaries, from June to August and October. The results of the two assays correlated inversely (Kendall's τ b = -0.600; p = 0.0102). The results indicated both temporal and spatial modulation of white perch immune systems in the Chesapeake Basin, and demonstrated the utility of quantitative PCR for TGF-β as a molecular biomarker for field assessment of teleost fish immune status.

  2. A Blood-based Test for the Detection of ROS1 and RET Fusion Transcripts from Circulating Ribonucleic Acid Using Digital Polymerase Chain Reaction

    PubMed Central

    Mellert, Hestia S.; Alexander, Kristin E.; Jackson, Leisa P.; Pestano, Gary A.

    2018-01-01

    We have developed novel methods for the isolation and characterization of tumor-derived circulating ribonucleic acid (cRNA) for blood-based liquid biopsy. Robust detection of cRNA recovered from blood represents a solution to a critical unmet need in clinical diagnostics. The test begins with the collection of whole blood into blood collection tubes containing preservatives that stabilize cRNA. Cell-free, exosomal, and platelet-associated RNA is isolated from plasma in this test system. The cRNA is reverse transcribed to complementary DNA (cDNA) and amplified using digital polymerase chain reaction (dPCR). Samples are evaluated for both the target biomarker as well as a control gene. Test validation included limit of detection, accuracy, and robustness studies with analytic samples. The method developed as a result of these studies reproducibly detect multiple fusion variants for ROS1 (C-Ros proto-oncogene 1; 8 variants) and RET (rearranged during transfection proto-oncogene; 8 variants). The sample processing workflow has been optimized so that test results can consistently be generated within 72 hours of sample receipt. PMID:29683453

  3. Description of polymerase chain reaction and sequencing DNA Mycobacterium tuberculosis from specimen sputum of tuberculosis patients in Medan

    NASA Astrophysics Data System (ADS)

    Lily; Siregar, Y.; Ilyas, S.

    2018-03-01

    This study purposed to describe the product Polymerase Chain Reaction (PCR) and sequencing of DNA Mycobacterium (M.) tuberculosis from sputum of tuberculosis (TB) patients in Medan. Sputum was collected from patients that diagnosed with pulmonary TB by a physician. Specimen processed by PCR method of Li et al. and sequencing at Macrogen Laboratory. All of 12 product PCR were showed brightness bands at 126 base pair (bp). These results indicated similarity to the study of Li et al. Sequencing analysis showed the presence of a mutation and non-mutation groups of M. tuberculosis. The reference and outcome berange of the mutation and non-mutation of M. tuberculosis were 56-107, 59-85, 60-120 and 63-94, respectively. The percentage bp difference between the outcome and references for mutation and non-mutation were 3.448-6.569and 3.278-7.428%, respectively. In conclusion, the successful amplification of PCR products in a 1.5% agarose gel electrophoresis where all 12 sputa contained rpoB-positive M. tuberculosis and 0.644% difference was found between the outcome with reference bp of the mutation and non-mutation M. tuberculosis groups.

  4. Comparison between ICT and PCR for diagnosis of Chlamydia trachomatis.

    PubMed

    Khan, E R; Hossain, M A; Paul, S K; Mahmud, C; Hasan, M M; Rahman, M M; Nahar, K; Kubayashi, N

    2012-04-01

    Chlamydia trachomatis is an obligate intracellular gram-negative bacterium which is the most prevalent cause of bacterial sexually transmitted infections (STI). The present study was carried to diagnose genital Chlamydia trachomatis infection among women of reproductive age, attending Mymensingh Medical College Hospital, during July 2009 to June 2010 by Immunochromatographic test (ICT) and Polymerase chain reaction (PCR). A total of 70 females were included in this study. Out of 70 cases 56 were symptomatic and 14 asymptomatic. Endocervical swabs were collected from each of the cases and examined by Immunochromatographic test (ICT) for antigen detection and Polymerase chain reaction (PCR) for detection of endogenous plasmid-based nucleic acid. A total 29(41.4%) of the cases were found positive for C. trachomatis either by ICT or PCR. Of the 56 symptomatic cases, 19(33.9%) were found ICT positive and 17(30.4%) were PCR positive. Among 14 asymptomatic females, 2(14.3%) were ICT positive and none were PCR positive. Though PCR is highly sensitive but a total of twelve cases were found ICT positive but PCR negative. It may be due to presence of plasmid deficient strain of C trachomatis which could be amplified by ompA based (Chromosomal gene) multiplex PCR.

  5. Genetic Diversity of Plasmodium falciparum Merozoite Surface Protein-1 Block 2 in Sites of Contrasting Altitudes and Malaria Endemicities in the Mount Cameroon Region

    PubMed Central

    Wanji, Samuel; Kengne-Ouafo, Arnaud J.; Joan Eyong, Ebanga E.; Kimbi, Helen K.; Tendongfor, Nicholas; Ndamukong-Nyanga, Judith L.; Nana-Djeunga, Hugues C.; Bourguinat, Catherine; Sofeu-Feugaing, David D.; Charvet, Claude L.

    2012-01-01

    The present study analyzed the relationship between the genetic diversity of Plasmodium falciparum and parasitologic/entomologic indices in the Mount Cameroon region by using merozoite surface protein 1 as a genetic marker. Blood samples were collected from asymptomatic children from three altitude zones (high, intermediate, and low). Parasitologic and entomologic indices were determined by microscopy and landing catch mosquito collection/circumsporozoite protein–enzyme-linked immunosorbent assay, respectively. A total of 142 randomly selected P. falciparum-positive blood samples were genotyped by using a nested polymerase chain reaction–based technique. K-1 polymerase chain reaction products were also sequenced. As opposed to high altitude, the highest malaria prevalence (70.65%) and entomologic inoculation rate (2.43 infective/bites/night) were recorded at a low altitude site. Seven (18.91%), 22 (36.66%), and 19 (42.22%) samples from high, intermediate, and low altitudes, respectively, contained multiclonal infections. A new K-1 polymorphism was identified. This study shows a positive non-linear association between low/intermediate altitude (high malaria transmission) and an increase in P. falciparum merozoite surface protein 1 block 2 polymorphisms. PMID:22556072

  6. Epidemiology of Imported Cutaneous Leishmaniasis at the Hospital for Tropical Diseases, London, United Kingdom: Use of Polymerase Chain Reaction to Identify the Species

    PubMed Central

    Wall, Emma C.; Watson, Julie; Armstrong, Margaret; Chiodini, Peter L.; Lockwood, Diana N.

    2012-01-01

    This study reviewed all patients diagnosed with imported cutaneous leishmaniasis (CL) at the Hospital for Tropical Diseases in London, United Kingdom, over an 11-year period. Diagnostic and epidemiologic information was collected prospectively for all patients with imported CL to this hospital during 1998–2009. A total of 223 patients were given a diagnosis of CL. Ninety patients were diagnosed with Old World CL, which was caused most commonly by Leishmania donovani complex (n = 20). A total of 71% were tourists to the Mediterranean region, 36% were migrants or visiting friends and relatives, and 17% were soldiers. One hundred thirty-three patients were given a diagnosis of New World CL. The Leishmania subgenus Viannia caused 97 of these cases; 44% of these were in backpackers and 29% were in soldiers. Polymerase chain reaction was more sensitive and faster for detecting Leishmania DNA (86% for Old World CL and 96% for New World CL) than culture. This is the largest study of imported leishmaniasis, and demonstrates that tourists to the Mediterranean and backpackers in Central and South America are at risk for this disease. PMID:22232460

  7. Quantitative real-time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies.

    PubMed

    Tricarico, Carmela; Pinzani, Pamela; Bianchi, Simonetta; Paglierani, Milena; Distante, Vito; Pazzagli, Mario; Bustin, Stephen A; Orlando, Claudio

    2002-10-15

    Careful normalization is essential when using quantitative reverse transcription polymerase chain reaction assays to compare mRNA levels between biopsies from different individuals or cells undergoing different treatment. Generally this involves the use of internal controls, such as mRNA specified by a housekeeping gene, ribosomal RNA (rRNA), or accurately quantitated total RNA. The aim of this study was to compare these methods and determine which one can provide the most accurate and biologically relevant quantitative results. Our results show significant variation in the expression levels of 10 commonly used housekeeping genes and 18S rRNA, both between individuals and between biopsies taken from the same patient. Furthermore, in 23 breast cancers samples mRNA and protein levels of a regulated gene, vascular endothelial growth factor (VEGF), correlated only when normalized to total RNA, as did microvessel density. Finally, mRNA levels of VEGF and the most popular housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were significantly correlated in the colon. Our results suggest that the use of internal standards comprising single housekeeping genes or rRNA is inappropriate for studies involving tissue biopsies.

  8. Real-time polymerase chain reaction assay for rapid and sensitive detection of anthrax spores in spiked soil and talcum powder.

    PubMed

    Jain, Neha; Merwyn, S; Rai, G P; Agarwal, G S

    2012-05-01

    Real-time polymerase chain reaction (real-time PCR) is a laboratory technique based on PCR. This technique is able to detect sequence-specific PCR products as they accumulate in "real time" during the PCR amplification, and also to quantify the number of substrates present in the initial PCR mixture before amplification begins. In the present study, real-time PCR assay was employed for rapid and real-time detection of Bacillus anthracis spores spiked in 0.1 g of soil and talcum powder ranging from 5 to 10(7) spores. DNA was isolated from spiked soil and talcum powder, using PBS containing 1 % Triton-X-100, followed by heat treatment. The isolated DNA was used as template for real-time PCR and PCR. Real-time PCR amplification was obtained in 60 min under the annealing condition at 60°C by employing primers targeting the pag gene of B. anthracis. In the present study, the detection limit of real-time PCR assay in soil was 10(3) spores and 10(2) spores in talcum powder, respectively, whereas PCR could detect 10(4) spores in soil and 10(3) spores in talcum powder, respectively.

  9. Genetic diversity of Plasmodium falciparum merozoite surface protein-1 block 2 in sites of contrasting altitudes and malaria endemicities in the Mount Cameroon region.

    PubMed

    Wanji, Samuel; Kengne-Ouafo, Arnaud J; Eyong, Ebanga E Joan; Kimbi, Helen K; Tendongfor, Nicholas; Ndamukong-Nyanga, Judith L; Nana-Djeunga, Hugues C; Bourguinat, Catherine; Sofeu-Feugaing, David D; Charvet, Claude L

    2012-05-01

    The present study analyzed the relationship between the genetic diversity of Plasmodium falciparum and parasitologic/entomologic indices in the Mount Cameroon region by using merozoite surface protein 1 as a genetic marker. Blood samples were collected from asymptomatic children from three altitude zones (high, intermediate, and low). Parasitologic and entomologic indices were determined by microscopy and landing catch mosquito collection/circumsporozoite protein-enzyme-linked immunosorbent assay, respectively. A total of 142 randomly selected P. falciparum-positive blood samples were genotyped by using a nested polymerase chain reaction-based technique. K-1 polymerase chain reaction products were also sequenced. As opposed to high altitude, the highest malaria prevalence (70.65%) and entomologic inoculation rate (2.43 infective/bites/night) were recorded at a low altitude site. Seven (18.91%), 22 (36.66%), and 19 (42.22%) samples from high, intermediate, and low altitudes, respectively, contained multiclonal infections. A new K-1 polymorphism was identified. This study shows a positive non-linear association between low/intermediate altitude (high malaria transmission) and an increase in P. falciparum merozoite surface protein 1 block 2 polymorphisms.

  10. Impact of polymerase chain reaction results on patient management during a viral meningitis outbreak in Tropical North Queensland.

    PubMed

    Stonehouse, Vicki; Furyk, Jeremy; Norton, Robert

    2012-02-01

    Enterovirus is the most commonly isolated pathogen in viral meningitis. We report on the first outbreak of viral meningitis in Tropical Queensland and the effect of polymerase chain reaction (PCR) results on antibiotic use and hospital length of stay. Retrospective case series of consecutive patients presenting to the Townsville ED with viral meningitis were evaluated by examining hospital medical records. The study period was November 2008 to February 2009. Forty-three patients were available for full analysis of which 17 (40%) were female and 17 (40%) had a positive enteroviral PCR. Antibiotics were commenced on 37 (86%) of patients. There was no difference in hospital length of stay in patients with a negative versus positive PCR (2.52 vs 2.72 days, P = 0.68) or duration of antibiotic therapy (2.20 vs 1.94 days, P = 0.61). In our study a positive result on PCR was not associated with a shorter hospital length of stay or a shorter duration of antibiotic therapy. This contrasts with previous reports on this topic and requires further evaluation. © 2011 The Authors. EMA © 2011 Australasian College for Emergency Medicine and Australasian Society for Emergency Medicine.

  11. Galactomannan, β-D-Glucan, and Polymerase Chain Reaction-Based Assays for the Diagnosis of Invasive Fungal Disease in Pediatric Cancer and Hematopoietic Stem Cell Transplantation: A Systematic Review and Meta-Analysis.

    PubMed

    Lehrnbecher, Thomas; Robinson, Paula D; Fisher, Brian T; Castagnola, Elio; Groll, Andreas H; Steinbach, William J; Zaoutis, Theoklis E; Negeri, Zelalem F; Beyene, Joseph; Phillips, Bob; Sung, Lillian

    2016-11-15

    We systematically reviewed and analyzed the available data for galactomannan (GM), β-D-glucan (BG), and polymerase chain reaction (PCR)-based assays to detect invasive fungal disease (IFD) in patients with pediatric cancer or undergoing hematopoietic stem cell transplantation when used as screening tools during immunosuppression or as diagnostic tests in patients presenting with symptoms such as fever during neutropenia (FN). Of 1532 studies screened, 25 studies reported on GM (n = 19), BG (n = 3), and PCR (n = 11). All fungal biomarkers demonstrated highly variable sensitivity, specificity, and positive predictive values, and these were generally poor in both clinical settings. GM negative predictive values were high, ranging from 85% to 100% for screening and 70% to 100% in the diagnostic setting, but failure to identify non-Aspergillus molds limits its usefulness. Future work could focus on the usefulness of combinations of fungal biomarkers in pediatric cancer and HSCT. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  12. Molecular Detection of the Carriage Rate of Four Intestinal Protozoa with Real-Time Polymerase Chain Reaction: Possible Overdiagnosis of Entamoeba histolytica in Nigeria

    PubMed Central

    Efunshile, Michael A.; Ngwu, Bethrand A. F.; Kurtzhals, Jørgen A. L.; Sahar, Sumrin; König, Brigitte; Stensvold, Christen R.

    2015-01-01

    Diarrhea remains the second largest killer of children worldwide, and Nigeria ranks number two on the list of global deaths attributable to diarrhea. Meanwhile, prevalence studies on potentially diarrheagenic protozoa in asymptomatic carriers using molecular detection methods remain scarce in sub-Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia intestinalis, and Cryptosporidium. Questionnaires were administered for epidemiological data collection. E. histolytica was not detected in any of the samples, whereas Giardia (37.2%), E. dispar (18.6%), and Cryptosporidium (1%) were found. Most of the children sourced their drinking water from community wells (91%), while the majority disposed of feces in the bush (81.9%). Our study is the first to use real-time PCR to evaluate the epidemiology of E. histolytica, Giardia, and Cryptosporidium in Nigeria where previous studies using traditional diagnostic techniques have suggested higher and lower carriage rates of E. histolytica and Giardia, respectively. It is also the first study to accurately identify the prevalence of common potentially diarrheagenic protozoa in asymptomatic carriers in sub-Saharan Africa. PMID:26101274

  13. Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

    PubMed

    Brzezinski, Jennifer L

    2006-01-01

    The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

  14. Case Report of Focal Epithelial Hyperplasia (Heck's Disease) with Polymerase Chain Reaction Detection of Human Papillomavirus 13.

    PubMed

    Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna

    2016-05-01

    Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. © 2016 Wiley Periodicals, Inc.

  15. Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique tilapia (Oreochromis mossambicus) by polymerase chain reaction

    USGS Publications Warehouse

    Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.

    2004-01-01

    We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

  16. Leishmania chagasi in Opossums (Didelphis albiventris) in an Urban Area Endemic for Visceral Leishmaniasis, Campo Grande, Mato Grosso do Sul, Brazil

    PubMed Central

    Humberg, Roberta M. P.; Oshiro, Elisa T.; Cruz, Maria do Socorro Pires e; Ribolla, Paulo E. M.; Alonso, Diego P.; Ferreira, Alda M. T.; Bonamigo, Raquel A.; Tasso, Norton; de Oliveira, Alessandra Gutierrez

    2012-01-01

    We investigated the occurrence of Leishmania infantum chagasi in Didelphis albiventris opossums at a wild animal rehabilitation center in the city of Campo Grande, Brazil. A total of 54 opossums were tested for L. i. chagasi infection in peripheral blood and bone marrow samples. The samples were analyzed by direct examination, culturing in a specific medium, and polymerase chain reaction–restriction fragment length polymorphism. Leishmania i. chagasi DNA was detected by polymerase chain reaction–restriction fragment length polymorphism in 11 (20.37%) animals. A total of 81.81% of positive opossums were captured in areas of known visceral leishmaniasis transmission. These results suggest a role for D. albiventris in the urban transmission of visceral leishmaniasis. PMID:22802435

  17. Subacute Sclerosing Panencephalitis in an Infant: Diagnostic Role of Viral Genome Analysis

    PubMed Central

    Baram, Tallie Z.; Gonzalez-Gomez, Ignacio; Xie, Zong-De; Yao, Dapeng; Gilles, Floyd H.; Nelson, Marvin D.; Nguyen, Hahn T.; Peters, Julius

    2013-01-01

    Subacute sclerosing panencephalitis (SSPE) is related to “defective” measles virus or vaccination, though an association with parainfluenza viruses has been reported. SSPE is characterized by a slow, erratic course and elevated cerebrospinal fluid measles titers. An immunocompetent, vaccinated infant, with onset of symptoms in parainfiuenza virus season and a catastrophic course is described. Cerebrospinal fluid titers were negative, but postmortem brain had typical SSPE lesions. Patient brain-derived RNA, subjected to reverse transcription followed by polymerase chain reaction yielded polymerase chain reaction products with measles virus but not parainfluenza virus genes. The sequenced fragment revealed multiple mutations, typical for SSPE. SSPE can thus present in infants, with short latency and no cerebrospinal fluid antibodies. Viral genomic analysis may be diagnostic, permitting early therapy. PMID:8024248

  18. Detection of Escherichia coli, Salmonella species, and Vibrio cholerae in tap water and bottled drinking water in Isfahan, Iran.

    PubMed

    Momtaz, Hassan; Dehkordi, Farhad Safarpoor; Rahimi, Ebrahim; Asgarifar, Amin

    2013-06-07

    The quality of drinking water has an important role in human infection and disease. This study was aimed at comparing polymerase chain reaction and culture in detecting Escherichia coli, Salmonella species and Vibrio cholera in tape water and bottled drinking water in various seasons in Isfahan province, Iran. A total of 448 water samples from tap water and bottled mineral water were taken over 6 months, from July 2010 to December 2010, and after filtration, samples were examined by culture and polymerase chain reaction methods for detection of Escherichia coli, Salmonella species, and Vibrio cholerae. The culture method showed that 34 (7.58%), 4 (0.89%) and 3 (0.66%) of all 448 water samples were positive for Escherichia coli, Salmonella species, and Vibrio cholera, respectively. The uidA gene from Escherichia coli, IpaB gene from Salmonella species, and epsM gene from Vibrio cholera were detected in 38 (26.38%), 5 (3.47%), and 3 (2.08%) of 144 tap-water samples, respectively. Escherichia coli was detected in 8 (2.63%) of 304 samples of bottled drinking water from 5 companies. The water of southern part of Isfahan and company 5 had the highest prevalence of bacteria. The Escherichia coli water contamination was significantly higher (P < 0.05) in the hot seasons (July-August) than cold (November-December) seasons and in company 5 than other companies. There were significant differences (P < 0.05) for the prevalence of bacteria between the tap waters of southern part and tap waters of central part of Isfahan. This study showed that the polymerase chain reaction assays can be an extremely accurate, fast, safe, sensitive and specific approach to monitor drinking water quality from purification facilities and bottled water companies. Also, our study confirmed the presence of Escherichia coli, Salmonella species, and Vibrio cholerae as water-borne pathogens in tap water and bottled drinking water of Isfahan, Iran. The present study showed the important public health problem in Isfahan, Iran.

  19. Detection of Escherichia coli, Salmonella species, and Vibrio cholerae in tap water and bottled drinking water in Isfahan, Iran

    PubMed Central

    2013-01-01

    Background The quality of drinking water has an important role in human infection and disease. This study was aimed at comparing polymerase chain reaction and culture in detecting Escherichia coli, Salmonella species and Vibrio cholera in tape water and bottled drinking water in various seasons in Isfahan province, Iran. Methods A total of 448 water samples from tap water and bottled mineral water were taken over 6 months, from July 2010 to December 2010, and after filtration, samples were examined by culture and polymerase chain reaction methods for detection of Escherichia coli, Salmonella species, and Vibrio cholerae. Results The culture method showed that 34 (7.58%), 4 (0.89%) and 3 (0.66%) of all 448 water samples were positive for Escherichia coli, Salmonella species, and Vibrio cholera, respectively. The uidA gene from Escherichia coli, IpaB gene from Salmonella species, and epsM gene from Vibrio cholera were detected in 38 (26.38%), 5 (3.47%), and 3 (2.08%) of 144 tap-water samples, respectively. Escherichia coli was detected in 8 (2.63%) of 304 samples of bottled drinking water from 5 companies. The water of southern part of Isfahan and company 5 had the highest prevalence of bacteria. The Escherichia coli water contamination was significantly higher (P < 0.05) in the hot seasons (July-August) than cold (November-December) seasons and in company 5 than other companies. There were significant differences (P < 0.05) for the prevalence of bacteria between the tap waters of southern part and tap waters of central part of Isfahan. Conclusions This study showed that the polymerase chain reaction assays can be an extremely accurate, fast, safe, sensitive and specific approach to monitor drinking water quality from purification facilities and bottled water companies. Also, our study confirmed the presence of Escherichia coli, Salmonella species, and Vibrio cholerae as water-borne pathogens in tap water and bottled drinking water of Isfahan, Iran. The present study showed the important public health problem in Isfahan, Iran. PMID:23742181

  20. Prevalence and risk factors for Campylobacter spp., Salmonella spp., Coxiella burnetii, and Newcastle disease virus in feral pigeons (Columba livia) in public areas of Montreal, Canada

    PubMed Central

    Gabriele-Rivet, Vanessa; Fairbrother, Julie-Hélène; Tremblay, Donald; Harel, Josée; Côté, Nathalie; Arsenault, Julie

    2016-01-01

    Feral pigeons (Columbia livia) can harbor a range of zoonotic pathogens. A transversal study was undertaken to estimate the prevalence of feral pigeons infected by various pathogens in public areas in Montreal, Quebec. Cloacal swabs from captured birds were cultured for Salmonella spp. and Campylobacter spp. and tested by real-time polymerase chain reaction (RT-PCR) for the detection of Coxiella burnetii. An oropharyngeal swab was also submitted to real-time reverse-transcription polymerase chain reaction (RRT-PCR) for the detection of Newcastle disease virus. Among the 187 pigeons tested from 10 public areas, 9.1% (95% CI: 3.0 to 15.2) were positive for Campylobacter spp. with all strains identified as Campylobacter jejuni. The Campylobacter status of birds was not associated with individual characteristics of birds, with the exception of body score. None of the pigeons tested positive for the other pathogens. Direct or indirect contacts with feral pigeons may constitute a potential risk for Campylobacter infection in humans. PMID:26733736

  1. FlindersTechnology Associates (FTA) filter paper-based DNA extraction with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii from respiratory specimens of immunocompromised patients.

    PubMed

    Nuchprayoon, Surang; Saksirisampant, Wilai; Jaijakul, Siraya; Nuchprayoon, Issarang

    2007-01-01

    We evaluated the diagnostic value of Flinders Technology Associates (FTA) filter paper together with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii (carinii) from induced sputum (IS) and bronchoalveolar lavage fluid (BALF) samples. The study involved 162 patients with clinical diagnosis of pneumocystis pneumonia (PcP) of human immunodeficiency virus/acquired immune deficiency syndrome (HIV/AIDS) patients and other immunocompromised patients. P. jirovecii cysts or trophozoites were detected in IS and BALF by cytological method. The mitochondrial 5S ribosomal ribonucleic acid (rRNA) gene of P. jirovecii was amplified from these samples by using FTA filters together with a one-step PCR method (FTA-PCR). With the FTA-PCR method, the sensitivity and specificity of the test compared to microscopic examination were 67% and 90% for IS, while they were 67% and 91% for BALF, respectively. The sensitivity and specificity of the FTA-PCR test was also comparable to PCR with the conventional deoxyribonucleic acid (DNA) extraction method. We concluded that FTA-PCR is useful to detect P. jirovecii in noninvasive IS.

  2. Collaborative ring trial of the papaya endogenous reference gene and its polymerase chain reaction assays for genetically modified organism analysis.

    PubMed

    Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao

    2013-11-27

    The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.

  3. Susceptibility Testing by Polymerase Chain Reaction DNA Quantitation: A Method to Measure Drug Resistance of Human Immunodeficiency Virus Type 1 Isolates

    NASA Astrophysics Data System (ADS)

    Eron, Joseph J.; Gorczyca, Paul; Kaplan, Joan C.; D'Aquila, Richard T.

    1992-04-01

    Polymerase chain reaction (PCR) DNA quantitation (PDQ) susceptibility testing rapidly and directly measures nucleoside sensitivity of human immunodeficiency virus type 1 (HIV-1) isolates. PCR is used to quantitate the amount of HIV-1 DNA synthesized after in vitro infection of peripheral blood mononuclear cells. The relative amounts of HIV-1 DNA in cell lysates from cultures maintained at different drug concentrations reflect drug inhibition of virus replication. The results of PDQ susceptibility testing of 2- or 3-day cultures are supported by assays measuring HIV-1 p24 antigen production in supernatants of 7- or 10-day cultures. DNA sequence analyses to identify mutations in the reverse transcriptase gene that cause resistance to 3'-azido-3'-deoxythymidine also support the PDQ results. With the PDQ method, both infectivity titration and susceptibility testing can be performed on supernatants from primary cultures of peripheral blood mononuclear cells. PDQ susceptibility testing should facilitate epidemiologic studies of the clinical significance of drug-resistant HIV-1 isolates.

  4. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

    PubMed

    Focke, Felix; Haase, Ilka; Fischer, Markus

    2011-01-26

    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  5. Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis.

    PubMed

    Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J

    2016-01-01

    Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. © The American Society of Tropical Medicine and Hygiene.

  6. The association of factor V leiden mutation with recurrent pregnancy loss.

    PubMed

    Kashif, Sumreen; Kashif, Muhammad Ali; Saeed, Anjum

    2015-11-01

    To determine the association of factor V Leiden mutation with recurrent pregnancy loss. The case-control study was conducted at the Department of Haematology, Armed Forces Institute of Pathology, Rawalpindi, Pakistan, from January to June 2012, and comprised women of 18 to 45 years of age who had a history of recurrent pregnancy loss, and controls with no history of pregnancy loss. All the subjects belonged to Punjabi ethnic group. Three ml blood was taken from cases and controls and deoxyribonucleic acid was extracted. In order to identify Factor V Leiden mutation, polymerase chain reaction method was utilised combined with the amplification refractory mutation system. Data was analysed using SPSS 17. Of the 112 subjects, 56(50%) were in each of the two groups. The presence of factor V Leiden mutation among the cases was 3(5.4%) while it was absent among the controls. The mutation was significantly associated with recurrent pregnancy loss (p=0.017).Recurrent pregnancy loss was higher in cases than controls (p=0.001). Factor V Leiden mutation, Recurrent pregnancy loss, PCR (Polymerase chain reaction).

  7. Clinical value of whole-blood interferon-gamma assay in patients with suspected pulmonary tuberculosis and AFB smear- and polymerase chain reaction-negative bronchial aspirates.

    PubMed

    Lee, Jaehee; Lee, Shin Yup; Yoo, Seung Soo; Cha, Seung Ick; Won, Dong Il; Park, Jae Yong; Lee, Won-Kil; Kim, Chang Ho

    2012-07-01

    Combining a polymerase chain reaction (PCR) test with bronchoscopy is frequently performed to allow a rapid diagnosis of smear-negative pulmonary tuberculosis (PTB). However, limited data are available concerning clinical judgment in patients with suspected PTB and AFB smear- and PCR-negative bronchial aspirates (BA). The present study evaluated the usefulness of whole-blood QuantiFERON-TB Gold In-Tube (QFT) testing in these patients. Of 166 patients with suspected PTB who had undergone bronchoscopy because of smear-negative sputum or inadequate sputum production, 93 (56%) were diagnosed with culture-positive PTB. Seventy-four patients were either AFB smear- or PCR-positive. In the 75 patients whose BA AFB smear and PCR results were both negative, 19 were finally diagnosed with PTB by culture. The QFT test had a negative predictive value of 91% for PTB. The QFT test may be useful for excluding PTB in patients with suspected PTB whose BA AFB smear and PCR results are both negative. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. Focal epithelial hyperplasia associated with human papillomavirus 13 and common human leukocyte antigen alleles in a Turkish family.

    PubMed

    Akoğlu, Gülşen; Metin, Ahmet; Ceylan, Gülay Güleç; Emre, Selma; Akpolat, Demet; Süngü, Nuran

    2015-02-01

    Focal epithelial hyperplasia (FEH) is a rare and benign papillomatous disease of the oral cavity, which is closely associated with human papillomavirus (HPV) type 13 and 32. Genetic susceptibility to HPV infections are supported by recent studies involving the human leukocyte antigen system (HLA). In this report, we aimed to determine the clinicopathological features of a Turkish family with FEH and to detect the shared HLA DR and DQ types. HPV DNA typing of tissue samples and HLA determination from blood samples of four family members were performed by polymerase chain reaction. Histopathological examination of all patients revealed acanthotic papillomatous epidermis, koilocytes, apoptotic keratinocytes, and mitosoid bodies. HPV13 was detected by polymerase chain reaction. HLA DQA1*0501, HLA DQB1*0302, and HLA DRB1*11 alleles were common in all family members. HLA DRB1*04 was detected in three of them. This report is the first step for the investigation of involvement of HLA types in the pathogenesis of Turkish patients with FEH. © 2014 The International Society of Dermatology.

  9. Reverse transcriptase polymerase chain reaction on fine needle aspirates for rapid detection of translocations in synovial sarcoma.

    PubMed

    Nilsson, G; Wang, M; Wejde, J; Kanter, L; Karlén, J; Tani, E; Kreicbergs, A; Larsson, O

    1998-01-01

    To evaluate the utilization of fine needle aspiration (FNA) biopsy to obtain material for reverse-transcriptase polymerase chain reaction (RT-PCR) in the detection of the t(X;18)(p11.2;q11.2) translocation in synovial sarcomas. We applied RT-PCR to detection of synovial sarcoma fusion gene transcripts on fine needle aspirates. Five clinical samples were first analyzed: one was a tumor previously diagnosed as malignant hemangiopericytoma, one was a poorly defined tumor, and three were suspected synovial sarcomas. FNA material was transferred directly to the RT-PCR reaction tube without RNA extraction. The t(X;18) translocation could be detected on the limited amount of material that FNA provides. In each of the cases studied the representivity of the tumor samples was confirmed microscopically. Our protocol permits analysis directly on representative samples without extraction of RNA. The results imply that RT-PCR offers reliable detection of sarcoma fusion gene transcripts on fine needle aspirates. The procedure, apart from being applicable to outpatients, is rapid and sensitive.

  10. Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

    PubMed

    Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

    1999-08-02

    Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

  11. Evaluation of repetitive element polymerase chain reaction for surveillance of methicillin-resistant Staphylococcus aureus at a large academic medical center and community hospitals.

    PubMed

    Wang, Shu-Hua; Stevenson, Kurt B; Hines, Lisa; Mediavilla, José R; Khan, Yosef; Soni, Ruchi; Dutch, Wendy; Brandt, Eric; Bannerman, Tammy; Kreiswirth, Barry N; Pancholi, Preeti

    2015-01-01

    Repetitive element polymerase chain reaction (rep-PCR) typing has been used for methicillin-resistant Staphylococcus aureus (MRSA) strain characterization. The goal of this study was to determine if a rapid commercial rep-PCR system, DiversiLab™ (DL; bioMérieux, Durham, NC, USA), could be used for MRSA surveillance at a large medical center and community hospitals. A total of 1286 MRSA isolates genotyped by the DL system were distributed into 84 distinct rep-PCR patterns: 737/1286 (57%) were clustered into 6 major rep-PCR patterns. A subset of 220 isolates was further typed by pulsed-field gel electrophoresis (PFGE), spa typing, and SCCmec typing. The 220 isolates were distributed into 80 rep-PCR patterns, 94 PFGE pulsotypes, 27 spa, and 3 SCCmec types. The DL rep-PCR system is sufficient for surveillance, but the DL system alone cannot be used to compare data to other institutions until a standardized nomenclature is established and the DL MRSA reference library is expanded. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. On-site identification of meat species in processed foods by a rapid real-time polymerase chain reaction system.

    PubMed

    Furutani, Shunsuke; Hagihara, Yoshihisa; Nagai, Hidenori

    2017-09-01

    Correct labeling of foods is critical for consumers who wish to avoid a specific meat species for religious or cultural reasons. Therefore, gene-based point-of-care food analysis by real-time Polymerase Chain Reaction (PCR) is expected to contribute to the quality control in the food industry. In this study, we perform rapid identification of meat species by our portable rapid real-time PCR system, following a very simple DNA extraction method. Applying these techniques, we correctly identified beef, pork, chicken, rabbit, horse, and mutton in processed foods in 20min. Our system was sensitive enough to detect the interfusion of about 0.1% chicken egg-derived DNA in a processed food sample. Our rapid real-time PCR system is expected to contribute to the quality control in food industries because it can be applied for the identification of meat species, and future applications can expand its functionality to the detection of genetically modified organisms or mutations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Quantification of Wilms' tumor 1 mRNA by digital polymerase chain reaction.

    PubMed

    Koizumi, Yuki; Furuya, Daisuke; Endo, Teruo; Asanuma, Kouichi; Yanagihara, Nozomi; Takahashi, Satoshi

    2018-02-01

    Wilms' tumor 1 (WT1) is overexpressed in various hematopoietic tumors and widely used as a marker of minimal residual disease. WT1 mRNA has been analyzed using quantitative real-time polymerase chain reaction (real-time PCR). In the present study, we analyzed 40 peripheral blood and bone marrow samples obtained from cases of acute myeloid leukemia, acute lymphoblastic leukemia, and myelodysplastic syndrome at Sapporo Medical University Hospital from April 2012 to January 2015. We performed quantification of WT1 was performed using QuantStudio 3D Digital PCR System (Thermo Fisher Scientific‎) and compared the results between digital PCR and real-time PCR technology. The correlation between digital PCR and real-time PCR was very strong (R = 0.99), and the detection limits of the two methods were equivalent. Digital PCR was able to accurately detect lower WT levels compared with real-time PCR. Digital PCR technology can thus be utilized to predict WT1/ABL1 expression level accurately and should thus be useful for diagnosis or the evaluation of drug efficiency in patients with leukemia.

  14. [Association of muscle segment homeobox gene 1 polymorphisms with nonsyndromic cleft lip with or without cleft palate].

    PubMed

    Zhang, Li; Tang, Jun-Ling; Liang, Shang-Zheng

    2008-06-01

    Muscle segment homeobox gene (MSX)1 has been proposed as a gene in which mutations may contribute to nonsyndromic cleft lip with or without cleft palate (NSCL/P). To study MSX1 polymorphisms in NSCL/ P by means of polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP), and investigate the association of MSX1 exons 1 polymorphisms with NSCL/P. DNA were extracted from blood samples from NSCL/P and unrelated normal subjects. Genome DNA from peripheral leukocyte with these blood samples were extracted, which was used as template to amplify desired gene fragment of MSX1 exons 1 by means of polymerase chain reaction (PCR). The PCR products were examined by single-strand conformation polymorphism (SSCP). The MSX1 exons 1 polymorphisms were examined by sequencing if mutations were found. MSX1 genes of exon 1 mutation was not been found in the NSCL/P and unrelated normal subjects by SSCP. No correlation between MSX1 exon 1 and NSCL/P was found. MSX1 exon 1 may not be a key gene (susceptibility gene) in NSCL/P.

  15. Quantitative competitive (QC) PCR for quantification of porcine DNA.

    PubMed

    Wolf, C; Lüthy, J

    2001-02-01

    Many meat products nowadays may contain several species in different proportions. To protect consumers from fraud and misdeclarations, not only a qualitative but also a quantitative monitoring of ingredients of complex food products is necessary. DNA based techniques like the polymerase chain reaction (PCR) are widely used for identification of species but no answer to the proportional amount of a certain species could be given using current techniques. In this study we report the development and evaluation of a quantitative competitive polymerase chain reaction (QC-PCR) for detection and quantification of porcine DNA using a new porcine specific PCR system based on the growth hormone gene of sus scrofa. A DNA competitor differing by 30 bp in length from the porcine target sequence was constructed and used for PCR together with the target DNA. Specificity of the new primers was evaluated with DNA from cattle, sheep, chicken and turkey. The competitor concentration was adjusted to porcine DNA contents of 2 or 20% by coamplification of mixtures containing porcine and corresponding amounts of bovine DNA in defined ratios.

  16. Identification of Helicobacter and Wolinella spp. in Oral Cavity of Toy Breed Dogs With Periodontal Disease.

    PubMed

    Nowroozilarki, Negar; Jamshidi, Shahram; Zahraei Salehi, Taghi; Kolahian, Saeed

    2017-09-01

    Periodontal diseases are the most common oral cavity infectious diseases in adult dogs. We aimed in this study to identify Helicobacter and Wolinella spp. in saliva and dental plaque of dogs with periodontitis. Sixty-two small-breed pet dogs, aged more than 6 years from both sexes, were categorized into healthy and periodontitis groups. Samples from saliva and dental plaques were collected, and Helicobacter and Wolinella were identified on genus and species levels using polymerase chain reaction. Our results showed significant increase in infection rate of Wolinella spp. in periodontitis compared with healthy dogs (P = .002). Furthermore, infection rate of Helicobacter genus was significantly higher in periodontitis compared with healthy dogs (P = .007). Infection with Wolinella spp. showed higher rate than Helicobacter spp. in dogs with periodontitis. According to species-specific polymerase chain reaction results, Helicobacter felis (9.76%) was the main Helicobacter spp. in dogs with periodontitis compared with healthy dogs (P < .001). Oral cavity of pet dogs with periodontitis could be considered as an important source of Wolinella and Helicobacter spp. infections. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

    PubMed

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

    2011-06-01

    The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

  18. Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources

    PubMed Central

    Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

    2017-01-01

    Background: Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Materials and Methods: Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Results: Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli. PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. Conclusion: The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources. PMID:29142893

  19. Loop-mediated isothermal PCR (LAMP) for the diagnosis of falciparum malaria.

    PubMed

    Paris, Daniel H; Imwong, Mallika; Faiz, Abul M; Hasan, Mahtabuddin; Yunus, Emran Bin; Silamut, Kamolrat; Lee, Sue J; Day, Nicholas P J; Dondorp, Arjen M

    2007-11-01

    A recently described loop-mediated isothermal polymerase chain reaction (LAMP) for molecular detection of Plasmodium falciparum was compared with microscopy, PfHRP2-based rapid diagnostic test (RDT), and nested polymerase chain reaction (PCR) as the "gold standard" in 115 Bangladeshi in-patients with fever. DNA extraction for LAMP was conducted by conventional methods or simple heating of the sample; test results were either assessed visually or by gel electrophoresis. Conventional DNA extraction followed by gel electrophoresis had the highest agreement with the reference method (81.7%, kappa = 0.64), with a sensitivity (95% CI) of 76.1% (68.3-83.9%), comparable to RDT and microscopy, but a specificity of 89.6% (84.0-95.2%) compared with 100% for RDT and microscopy. DNA extraction by heat treatment deteriorated specificity to unacceptable levels. LAMP enables molecular diagnosis of falciparum malaria in settings with limited technical resources but will need further optimization. The results are in contrast with a higher accuracy reported in an earlier study comparing LAMP with a non-validated PCR method.

  20. Development and use of a real-time polymerase chain reaction assay for the detection of Ophidiomyces ophiodiicola in snakes.

    PubMed

    Allender, Matthew C; Bunick, David; Dzhaman, Elena; Burrus, Lucienne; Maddox, Carol

    2015-03-01

    Fungal pathogens threatening the conservation of wildlife are becoming increasingly common. Since 2008, free-ranging snakes across North America have been experiencing a marked increase in the prevalence of snake fungal disease associated with Ophidiomyces ophiodiicola. Diagnosis has historically relied on histology, microbiology, and conventional polymerase chain reaction (PCR). More sensitive methods are needed to adequately characterize the epidemiology. The current study describes the development of a real-time PCR (qPCR) assay for detecting a segment of the internal transcribed spacer 1 region between the 18S and 5.8S ribosomal RNA gene. The assay was able to detect as few as 1.05 × 10(1) gene copies per reaction. An additional 4 positive cases were detected when comparing a conventional PCR (n = 3) and the qPCR (n = 7) when used on swab samples from 47 eastern massasauga rattlesnakes. The newly developed assay is a sensitive and specific tool for surveillance and monitoring in the conservation of free-ranging snakes. © 2015 The Author(s).

  1. Using Reference Quantitative Polymerase Chain Reaction to Assess the Clinical Performance of the Paracheck-Pf® Rapid Diagnostic Test in a Field Setting in Uganda.

    PubMed

    Mitran, Catherine J; Mbonye, Anthony K; Hawkes, Michael; Yanow, Stephanie K

    2018-06-04

    Malaria rapid diagnostic tests (RDTs) are widely used in clinical and surveillance settings. However, the performance of most RDTs has not been characterized at parasite densities below detection by microscopy. We present findings from Uganda, where RDT results from 491 participants with suspected malaria were correlated with quantitative polymerase chain reaction (qPCR)-defined parasitemia. Compared with qPCR, the sensitivity and specificity of the RDT for Plasmodium falciparum mono-infections were 76% (95% confidence interval [CI]: 68-83%) and 95% (95% CI: 92-97%), respectively. The sensitivity of the RDT at parasite densities between 0.2 and 200 parasites/μL was surprisingly high (87%, 95% CI: 74-94%). The high sensitivity of the RDT is likely because of histidine-rich protein 2 from submicroscopic infections, gametocytes, or sequestered parasites. These findings underscore the importance of evaluating different RDTs in field studies against qPCR reference testing to better define the sensitivity and specificity, particularly at low parasite densities.

  2. Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter with application of high-processivity polymerase and novel internal amplification controls for rapid and specific detection.

    PubMed

    Oakley, Brian B; Line, J Eric; Berrang, Mark E; Johnson, Jessica M; Buhr, R Jeff; Cox, Nelson A; Hiett, Kelli L; Seal, Bruce S

    2012-02-01

    Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowledge none has been empirically tested for specificity using high-throughput sequencing. Here we demonstrate the power of next-generation sequencing to determine the specificity of a widely cited Campylobacter-specific polymerase chain reaction (PCR) assay and describe a rapid method for direct cell suspension PCR to quickly and easily screen samples for Campylobacter. We present a specific protocol which eliminates the need for time-consuming and expensive genomic DNA extractions and, using a high-processivity polymerase, demonstrate conclusive screening of samples in <1 h. Pyrosequencing results show the assay to be extremely (>99%) sensitive, and spike-back experiments demonstrated a detection threshold of <10(2) CFU mL(-1). Additionally, we present 2 newly designed broad-range bacterial primer sets targeting the 23S rRNA gene that have wide applicability as internal amplification controls. Empirical testing of putative taxon-specific assays using high-throughput sequencing is an important validation step that is now financially feasible for research, regulatory, or clinical applications. Published by Elsevier Inc.

  3. Molecular Basis for the Selective Inhibition of Respiratory Syncytial Virus RNA Polymerase by 2'-Fluoro-4'-Chloromethyl-Cytidine Triphosphate

    PubMed Central

    Deval, Jerome; Hong, Jin; Wang, Guangyi; Taylor, Josh; Smith, Lucas K.; Fung, Amy; Stevens, Sarah K.; Liu, Hong; Jin, Zhinan; Dyatkina, Natalia; Prhavc, Marija; Stoycheva, Antitsa D.; Serebryany, Vladimir; Liu, Jyanwei; Smith, David B.; Tam, Yuen; Zhang, Qingling; Moore, Martin L.; Fearns, Rachel; Chanda, Sushmita M.; Blatt, Lawrence M.; Symons, Julian A.; Beigelman, Leo

    2015-01-01

    Respiratory syncytial virus (RSV) causes severe lower respiratory tract infections, yet no vaccines or effective therapeutics are available. ALS-8176 is a first-in-class nucleoside analog prodrug effective in RSV-infected adult volunteers, and currently under evaluation in hospitalized infants. Here, we report the mechanism of inhibition and selectivity of ALS-8176 and its parent ALS-8112. ALS-8176 inhibited RSV replication in non-human primates, while ALS-8112 inhibited all strains of RSV in vitro and was specific for paramyxoviruses and rhabdoviruses. The antiviral effect of ALS-8112 was mediated by the intracellular formation of its 5'-triphosphate metabolite (ALS-8112-TP) inhibiting the viral RNA polymerase. ALS-8112 selected for resistance-associated mutations within the region of the L gene of RSV encoding the RNA polymerase. In biochemical assays, ALS-8112-TP was efficiently recognized by the recombinant RSV polymerase complex, causing chain termination of RNA synthesis. ALS-8112-TP did not inhibit polymerases from host or viruses unrelated to RSV such as hepatitis C virus (HCV), whereas structurally related molecules displayed dual RSV/HCV inhibition. The combination of molecular modeling and enzymatic analysis showed that both the 2'F and the 4'ClCH2 groups contributed to the selectivity of ALS-8112-TP. The lack of antiviral effect of ALS-8112-TP against HCV polymerase was caused by Asn291 that is well-conserved within positive-strand RNA viruses. This represents the first comparative study employing recombinant RSV and HCV polymerases to define the selectivity of clinically relevant nucleotide analogs. Understanding nucleotide selectivity towards distant viral RNA polymerases could not only be used to repurpose existing drugs against new viral infections, but also to design novel molecules. PMID:26098424

  4. Detection of Natural Toxoplasma gondii Infection in Chicken in Thika Region of Kenya Using Nested Polymerase Chain Reaction

    PubMed Central

    Karanja, Simon Muturi; Ngotho, Maina; Kamau, David Muchina; Njuguna, Adele Nyambura

    2016-01-01

    The detection of Toxoplasma gondii in free-range chickens is a good indicator of possible risk to human beings. The aim of this study was to investigate the occurrence of T. gondii in free-range chicken using polymerase chain reaction (PCR). Brain samples from 105 free-range chickens from three administrative areas in Thika region, Kenya, were collected, DNA-extracted, and analyzed using PCR to detect presence of T. gondii. The overall prevalence of T. gondii in all the three areas was 79.0% (95% CI: 70.0–86.4%) and the prevalence across the three areas was not significantly different (P = 0.5088; χ 2 = 1.354). Female chickens had higher (79.4%) prevalence than males (78.6%), although the difference was not significant (P = 0.922, χ 2 = 0.01). However, chickens that were more than 2 years old had significantly (P = 0.003; χ 2 = 11.87) higher prevalence compared to younger ones. The study indicates that there was a high occurrence of T. gondii infection in free-range chickens from Thika region and that the infection rate is age dependent. Further studies should be carried out to determine the possible role of roaming chickens in the epidemiology of the disease among humans in the area. PMID:27981052

  5. Habitat associations of two entomopathogenic nematodes: a quantitative study using real-time quantitative polymerase chain reactions.

    PubMed

    Torr, Peter; Spiridonov, Sergei E; Heritage, Stuart; Wilson, Michael J

    2007-03-01

    1. Despite nematodes being the most abundant animals on earth, very few animal ecologists study them, probably because of the difficulties of identifying them to species by morphological methods. 2. A group of nematodes that are important both ecologically and economically is the entomopathogenic nematodes, which play a key role in regulating soil food webs and are sold throughout the world as biological insecticides, yet for which very little is known of their population ecology. 3. A novel detection and quantification method was developed for soil nematodes using real-time polymerase chain reaction (PCR), and the technique was used to estimate numbers of two closely related species of entomopathogenic nematodes, Steinernema kraussei and S. affine in 50 soil samples from 10 sites in Scotland representing two distinct habitats (woodland and grassland). 4. There was a high degree of correlation between our molecular and traditional morphological estimates of population size and our data clearly showed that Steinernema affine occurred only in grassland areas, whereas S. kraussei was found in grassland and woodland samples to a similar degree. 5. Real-time PCR offers a rapid and accurate method of detecting individual nematode species from soil samples without the need for a specialist taxonomist, and has much potential for use in studies of nematode population ecology.

  6. Expression of Leptin and Visfatin in Gingival Tissues of Chronic Periodontitis With and Without Type 2 Diabetes Mellitus: A Study Using Enzyme-Linked Immunosorbent Assay and Real-Time Polymerase Chain Reaction.

    PubMed

    Ghallab, Noha A; Amr, Eman M; Shaker, Olfat G

    2015-07-01

    The aim of this study is to investigate the protein and gene expression of leptin and visfatin in gingival tissue from patients with chronic periodontitis (CP), patients with CP and type 2 diabetes mellitus (T2DM), and healthy individuals. The study includes 50 individuals: 10 healthy individuals, 20 patients with CP, and 20 patients with CP and T2DM. Plaque index, gingival index, probing depth, and clinical attachment loss were measured, and gingival biopsies were obtained. Leptin and visfatin protein expression in gingival tissues was determined using enzyme-linked immunosorbent assay, and messenger RNA (mRNA) expression was measured via real-time polymerase chain reaction. The highest leptin mRNA and protein expression was observed in the control group and was significantly (P ≤0.05) different from the CP and CP+T2DM groups. Gingival tissues from patients with CP and T2DM had a significant increase in visfatin and a decrease in leptin gene and protein expression (P <0.05) compared with both controls and patients with CP. Expression of leptin and visfatin in the gingival tissues suggests a possible role for these adipokines in the pathogenesis of CP and T2DM.

  7. Evidence of West Nile virus infection in Nepal.

    PubMed

    Rutvisuttinunt, Wiriya; Chinnawirotpisan, Piyawan; Klungthong, Chonticha; Shrestha, Sanjaya Kumar; Thapa, Amod Bahadur; Pant, Arjun; Yingst, Samuel L; Yoon, In-Kyu; Fernandez, Stefan; Pavlin, Julie A

    2014-11-27

    Acute febrile illness is common among those seeking medical care and is frequently treated empirically with the underlying illness remaining undiagnosed in resource-poor countries. A febrile illness study was conducted 2009-2010 to identify known and unknown pathogens circulating in Nepal. Study methods included diagnostic testing and preliminary ELISA screening of acute and convalescent samples for diseases both known and unknown to be circulating in Nepal, including West Nile virus (WNV). The molecular assays including Polymerase Chain Reaction (PCR), Sanger sequencing and ultra deep sequencing on MiSeq Illumina Platform were conducted to further confirm the presence of WNV. The study enrolled 2,046 patients presenting undifferentiated febrile illness with unknown etiology. Sera from 14 out of 2,046 patients were tested positive for west nile virus (WNV) by nested Reverse Transcription-Polymerase Chain Reaction (RT-PCR). Only two out of 14 cases were confirmed for the presence of WNV by sequencing and identified as WNV lineage 1 phylogentically. The two patients were adult males with fever and no neurological symptoms from Kathmandu and Bharatpur, Nepal. Two out of 2,046 serum samples contained fragments of WNV genome resembling WNV lineage 1, which is evidence of the continued spread of WNV which should be considered a possible illness cause in Nepal.

  8. Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum.

    PubMed

    Tan, Ching Giap; Ideris, Aini; Omar, Abdul R; Yii, Chen Pei; Kleven, Stanley H

    2014-09-02

    The present study was based on the reverse transcription polymerase chain reaction (RT-PCR) of the 16S ribosomal nucleic acid (rRNA) of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20-25 h at 37 °C, 22-25 h at 16 °C, and 23-27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h). The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.

  9. Detection of Natural Toxoplasma gondii Infection in Chicken in Thika Region of Kenya Using Nested Polymerase Chain Reaction.

    PubMed

    Mose, John Mokua; Kagira, John Maina; Karanja, Simon Muturi; Ngotho, Maina; Kamau, David Muchina; Njuguna, Adele Nyambura; Maina, Naomi Wangari

    2016-01-01

    The detection of Toxoplasma gondii in free-range chickens is a good indicator of possible risk to human beings. The aim of this study was to investigate the occurrence of T. gondii in free-range chicken using polymerase chain reaction (PCR). Brain samples from 105 free-range chickens from three administrative areas in Thika region, Kenya, were collected, DNA-extracted, and analyzed using PCR to detect presence of T. gondii . The overall prevalence of T. gondii in all the three areas was 79.0% (95% CI: 70.0-86.4%) and the prevalence across the three areas was not significantly different ( P = 0.5088; χ 2 = 1.354). Female chickens had higher (79.4%) prevalence than males (78.6%), although the difference was not significant ( P = 0.922, χ 2 = 0.01). However, chickens that were more than 2 years old had significantly ( P = 0.003; χ 2 = 11.87) higher prevalence compared to younger ones. The study indicates that there was a high occurrence of T. gondii infection in free-range chickens from Thika region and that the infection rate is age dependent. Further studies should be carried out to determine the possible role of roaming chickens in the epidemiology of the disease among humans in the area.

  10. Higher risk of cytomegalovirus reactivation in human immunodeficiency virus-1-infected patients homozygous for MICA5.1.

    PubMed

    Moenkemeyer, Maren; Heiken, Hans; Schmidt, Reinhold E; Witte, Torsten

    2009-03-01

    Infection with cytomegalovirus (CMV) induces surface expression of major histocompatibility complex (MHC)-class-I-chain-related A (MICA), a ligand for NKG2D. This leads to improved recognition and elimination of infected cells by natural killer (NK) as well as CD8+ T cells. The MICA5.1 allele codes for a truncated protein. This study was performed to test whether impaired expression of a functional MICA protein would influence the susceptibility to severe CMV reactivation in immunocompromised individuals. In this study, the frequency of MICA5.1 was assessed by polymerase chain reaction in 230 Caucasian human immunodeficiency virus (HIV)-1-infected patients and in 219 healthy controls. Patients co-infected with hepatitis C virus (HCV) and GB virus-C served as controls. MICA5.1 allele was analyzed by polymerase chain reaction. Association of MICA5.1 homozygosity and risk of CMV reactivation was calculated by Pearson chi2 test. Comparison of patients with and without a history of CMV disease manifestation revealed that homozygous MICA5.1 genotype was present in a significantly higher frequency in patients with CMV reactivation (33%) than in those without (16%; p 0.032; odds ratio 0.330). The percentage was similar in HIV-1-infected patients and healthy controls. Furthermore, there was no difference in the frequency of MICA5.1 with respect to infection with HCV and GB virus-C. Our study provides the first in vivo demonstration of an association between homozygous MICA5.1 genotype and susceptibility to CMV reactivation in immunocompromised individuals.

  11. Measurement of messenger RNA encoding the alpha-chain, polymeric immunoglobulin receptor, and J-chain in duodenal mucosa from dogs with and without chronic diarrhea by use of quantitative real-time reverse transcription-polymerase chain reaction assays.

    PubMed

    Peters, Iain R; Helps, Chris R; Calvert, Emma L; Hall, Edward J; Day, Michael J

    2005-01-01

    To examine the difference in expression of messenger RNA (mRNA) transcripts for polymeric immunoglobulin receptor (plgR), alpha-chain, and J-chain determined by use of quantitative real-time reverse transcription-polymerase chain reaction (QRT-PCR) assays in duodenal biopsy specimens obtained from dogs with and without chronic diarrhea. Biopsy specimens of the proximal portion of the duodenum were obtained endoscopically from 39 dogs evaluated because of chronic diarrhea (12 German Shepherd Dogs and 27 non-German Shepherd Dog breeds); specimens were also obtained from a control group of 7 dogs evaluated because of other gastrointestinal tract diseases and 2 dogs that were euthanatized as a result of nongastrointestinal tract disease. Dogs were anesthetized, and multiple mucosal biopsy specimens were obtained endoscopically at the level of the caudal duodenal flexure by use of biopsy forceps; in 2 control dogs, samples were obtained from the descending duodenum within 5 minutes of euthanasia. One-step QRT-PCR was used to quantify the level of expression of transcripts for the housekeeper gene glyceraldehyde-3-phosphate dehydrogenase, plgR, alpha-chain, and J-chain in duodenal mucosal tissue. There was no significant difference in the level of expression of any transcript among non-German Shepherd Dog breeds without diarrhea (control group), non-German Shepherd Dog breeds with chronic diarrhea, and German Shepherd Dogs with chronic diarrhea. Conclusions and Clinical Relevance-Results indicated that the susceptibility of German Shepherd Dogs to chronic diarrhea is not a result of simple failure of transcription of the key genes that encode molecules involved in mucosal IgA secretion.

  12. Anaplasma phagocytophilum infection (granulocytic anaplasmosis) in a dog from Vancouver Island

    PubMed Central

    2005-01-01

    Abstract A 7-year-old Labrador retriever had nonspecific clinical signs that included lethargy, malaise, and difficult ambulation. The dog was native to Vancouver Island, British Columbia, and had never left this area. Morulae were identified in polymorphonuclear cells. Serologic studies and polymerase chain reaction (PCR) testing confirmed canine anaplasmosis caused by Anaplasma phagocytophilum. The dog recovered after treatment with tetracycline. PMID:16231653

  13. Inhalation Toxicology Research Institute Annual Report, 1992-1993

    DTIC Science & Technology

    1993-11-01

    for Mineral and Energy Technology ( CANMET ). The ITRI team participated in all phases of the intercomparison studies. The methods, procedures, and...differential cloning, and differential hybridization techniques. However, with recent advances in polymerase chain reaction (PCR) technology , an...viii I. AEROSOL TECHNOLOGY AND CHARACTERIZATION OF AIRBORNE MATERIALS Measurement of Thoron and Thoron/Radon Mixtures Y. S. Cheng and H. C. Yeh Use of a

  14. Diagnostic application of polymerase chain reaction for detection of Ehrlichia risticii in equine monocytic ehrlichiosis (Potomac horse fever).

    PubMed

    Biswas, B; Mukherjee, D; Mattingly-Napier, B L; Dutta, S K

    1991-10-01

    Genomic amplification by the polymerase chain reaction (PCR) was used to identify a unique genomic sequence of Ehrlichia risticii directly in DNA isolated from peripheral-blood buffy coat cells of E. risticii-infected horses (Potomac horse fever) and from infected cell cultures. A specific primer pair, selected from a cloned, species-specific, 1-kb DNA fragment of the E. risticii genome as a template, was used for the amplification of the target DNA of 247 bp. The optimal number of 40 PCR cycles, determined by analyzing an amplification profile obtained with a constant Taq polymerase concentration, was used to achieve maximum amplification of the E. risticii DNA segment. Efficient amplification of target DNA was achieved with specimens processed by either the phenol extraction or rapid lysis method. The specificity of the amplified DNA product was confirmed by the proper size (247 bp) and appropriate restriction enzyme cleavage pattern of the amplified target DNA, as well as by the specific hybridization signal obtained by using a PCR-amplified 185-bp internal DNA probe. A 10(5)- to 10(6)-fold amplification of target DNA, which allowed detection of E. risticii from as few as two to three infected cells in culture and from a very small volume of buffy coat cells from infected horses, was achieved. This PCR amplification procedure was found to be highly specific and sensitive for the detection of E. risticii for the study of Potomac horse fever.

  15. Development of a Tandem Repeat-Based Polymerase Chain Displacement Reaction Method for Highly Sensitive Detection of 'Candidatus Liberibacter asiaticus'.

    PubMed

    Lou, Binghai; Song, Yaqin; RoyChowdhury, Moytri; Deng, Chongling; Niu, Ying; Fan, Qijun; Tang, Yan; Zhou, Changyong

    2018-02-01

    Huanglongbing (HLB) is one of the most destructive diseases in citrus production worldwide. Early detection of HLB pathogens can facilitate timely removal of infected citrus trees in the field. However, low titer and uneven distribution of HLB pathogens in host plants make reliable detection challenging. Therefore, the development of effective detection methods with high sensitivity is imperative. This study reports the development of a novel method, tandem repeat-based polymerase chain displacement reaction (TR-PCDR), for the detection of 'Candidatus Liberibacter asiaticus', a widely distributed HLB-associated bacterium. A uniquely designed primer set (TR2-PCDR-F/TR2-PCDR-1R) and a thermostable Taq DNA polymerase mutant with strand displacement activity were used for TR-PCDR amplification. Performed in a regular thermal cycler, TR-PCDR could produce more than two amplicons after each amplification cycle. Sensitivity of the developed TR-PCDR was 10 copies of target DNA fragment. The sensitive level was proven to be 100× higher than conventional PCR and similar to real-time PCR. Data from the detection of 'Ca. L. asiaticus' with filed samples using the above three methods also showed similar results. No false-positive TR-PCDR amplification was observed from healthy citrus samples and water controls. These results thereby illustrated that the developed TR-PCDR method can be applied to the reliable, highly sensitive, and cost-effective detection of 'Ca. L. asiaticus'.

  16. Identification of duck plague virus by polymerase chain reaction.

    PubMed

    Hansen, W R; Brown, S E; Nashold, S W; Knudson, D L

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3' ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primers sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague.

  17. Modulating the DNA polymerase β reaction equilibrium to dissect the reverse reaction

    PubMed Central

    Shock, David D.; Freudenthal, Bret D.; Beard, William A.; Wilson, Samuel H.

    2017-01-01

    DNA polymerases catalyze efficient and high fidelity DNA synthesis. While this reaction favors nucleotide incorporation, polymerases also catalyze a reverse reaction, pyrophosphorolysis, removing the DNA primer terminus and generating deoxynucleoside triphosphates. Since pyrophosphorolysis can influence polymerase fidelity and sensitivity to chain-terminating nucleosides, we analyzed pyrophosphorolysis with human DNA polymerase β and found the reaction to be inefficient. The lack of a thio-elemental effect indicated that it was limited by a non-chemical step. Utilizing a pyrophosphate analog, where the bridging oxygen is replaced with an imido-group (PNP), increased the rate of the reverse reaction and displayed a large thio-elemental effect indicating that chemistry was now rate determining. Time-lapse crystallography with PNP captured structures consistent with a chemical equilibrium that favored the reverse reaction. These results highlight the importance of the bridging atom between the β- and γ-phosphates of the incoming nucleotide in reaction chemistry, enzyme conformational changes, and overall reaction equilibrium. PMID:28759020

  18. A movie of the RNA polymerase nucleotide addition cycle.

    PubMed

    Brueckner, Florian; Ortiz, Julio; Cramer, Patrick

    2009-06-01

    During gene transcription, RNA polymerase (Pol) passes through repetitive cycles of adding a nucleotide to the growing mRNA chain. Here we obtained a movie of the nucleotide addition cycle by combining structural information on different functional states of the Pol II elongation complex (EC). The movie illustrates the two-step loading of the nucleoside triphosphate (NTP) substrate, closure of the active site for catalytic nucleotide incorporation, and the presumed two-step translocation of DNA and RNA, which is accompanied by coordinated conformational changes in the polymerase bridge helix and trigger loop. The movie facilitates teaching and a mechanistic analysis of transcription and can be downloaded from http://www.lmb.uni-muenchen.de/cramer/pr-materials.

  19. Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland.

    PubMed

    Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw

    2011-05-01

    A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)

  20. Biotechnical use of polymerase chain reaction for microbiological analysis of biological samples.

    PubMed

    Lantz, P G; Abu al-Soud, W; Knutsson, R; Hahn-Hägerdal, B; Rådström, P

    2000-01-01

    Since its introduction in the mid-80s, polymerase chain reaction (PCR) technology has been recognised as a rapid, sensitive and specific molecular diagnostic tool for the analysis of micro-organisms in clinical, environmental and food samples. Although this technique can be extremely effective with pure solutions of nucleic acids, it's sensitivity may be reduced dramatically when applied directly to biological samples. This review describes PCR technology as a microbial detection method, PCR inhibitors in biological samples and various sample preparation techniques that can be used to facilitate PCR detection, by either separating the micro-organisms from PCR inhibitors and/or by concentrating the micro-organisms to detectable concentrations. Parts of this review are updated and based on a doctoral thesis by Lantz [1] and on a review discussing methods to overcome PCR inhibition in foods [2].

  1. Vanadium accelerates polymerase chain reaction and expands the applicability of forensic DNA testing.

    PubMed

    Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko

    2013-05-01

    Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  2. Large pathogenic expansions in the SCA2 and SCA7 genes can be detected by fluorescent repeat-primed polymerase chain reaction assay.

    PubMed

    Cagnoli, Claudia; Stevanin, Giovanni; Michielotto, Chiara; Gerbino Promis, Giovanni; Brussino, Alessandro; Pappi, Patrizia; Durr, Alexandra; Dragone, Elisa; Viemont, Michelle; Gellera, Cinzia; Brice, Alexis; Migone, Nicola; Brusco, Alfredo

    2006-02-01

    Large expansions in the SCA2 and SCA7 genes (>100 CAG repeats) have been associated with juvenile and infantile forms of cerebellar ataxias that cannot be detected using standard polymerase chain reaction (PCR). Here, we describe a successful application of the fluorescent short tandem repeat-primed PCR method for accurate identification of these expanded repeats. The test is robust, reliable, and inexpensive and can be used to screen large series of patients, although it cannot give a precise evaluation of the size of the expansion. This test may be of practical value in prenatal diagnoses offered to affected or pre-symptomatic at-risk parents, in which a very large expansion inherited from one of the parents can be missed in the fetus by standard PCR.

  3. Large Pathogenic Expansions in the SCA2 and SCA7 Genes Can Be Detected by Fluorescent Repeat-Primed Polymerase Chain Reaction Assay

    PubMed Central

    Cagnoli, Claudia; Stevanin, Giovanni; Michielotto, Chiara; Gerbino Promis, Giovanni; Brussino, Alessandro; Pappi, Patrizia; Durr, Alexandra; Dragone, Elisa; Viemont, Michelle; Gellera, Cinzia; Brice, Alexis; Migone, Nicola; Brusco, Alfredo

    2006-01-01

    Large expansions in the SCA2 and SCA7 genes (>100 CAG repeats) have been associated with juvenile and infantile forms of cerebellar ataxias that cannot be detected using standard polymerase chain reaction (PCR). Here, we describe a successful application of the fluorescent short tandem repeat-primed PCR method for accurate identification of these expanded repeats. The test is robust, reliable, and inexpensive and can be used to screen large series of patients, although it cannot give a precise evaluation of the size of the expansion. This test may be of practical value in prenatal diagnoses offered to affected or pre-symptomatic at-risk parents, in which a very large expansion inherited from one of the parents can be missed in the fetus by standard PCR. PMID:16436644

  4. [Polymerase chain reaction applied for detection of Toxoplasma gondii in lymph nodes].

    PubMed

    Liu, C; Ouyang, K; Tan, D

    1998-01-01

    In order to investigate the morbidity of toxoplasmic lymphadenitis, polymerase chain reaction (PCR) was used to detect DNA of Toxoplasma gondii within lymph nodes in 3 groups of 120 patients with different diseases. After extracting the DNA of each sample, PCR was employed to amplify toxoplasma DNA. The results showed that the amplification product of 210 bp was confirmed in 7 patients: 3 cases of Hodgkin's disease (HD), 2 cases of non-Hodgkin's lymphoma (NHL) and 2 cases of chronic lymphadenitis (CL). Each PCR product was then subjected to Southern blot hybridization. Besides the 7 cases proved by PCR, 1 case of CL was found positive. The positive percentages of HD, NHL and CL were 9.38% (3/32), 4.88% (2/41), and 6.38% (3/47), respectively. The total positive rate was 6.67% (8/120).

  5. Advances in digital polymerase chain reaction (dPCR) and its emerging biomedical applications.

    PubMed

    Cao, Lei; Cui, Xingye; Hu, Jie; Li, Zedong; Choi, Jane Ru; Yang, Qingzhen; Lin, Min; Ying Hui, Li; Xu, Feng

    2017-04-15

    Since the invention of polymerase chain reaction (PCR) in 1985, PCR has played a significant role in molecular diagnostics for genetic diseases, pathogens, oncogenes and forensic identification. In the past three decades, PCR has evolved from end-point PCR, through real-time PCR, to its current version, which is the absolute quantitive digital PCR (dPCR). In this review, we first discuss the principles of all key steps of dPCR, i.e., sample dispersion, amplification, and quantification, covering commercialized apparatuses and other devices still under lab development. We highlight the advantages and disadvantages of different technologies based on these steps, and discuss the emerging biomedical applications of dPCR. Finally, we provide a glimpse of the existing challenges and future perspectives for dPCR. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Norrie disease in a family with a manifesting female carrier.

    PubMed

    Sims, K B; Irvine, A R; Good, W V

    1997-04-01

    To show that Norrie disease can occur in a girl and to describe her ophthalmologic and genetic features. Amplification of DNA polymerase chain reaction and sequencing of asymmetric polymerase chain reaction for exon 3 were performed on the blood specimen obtained from a girl born with bilateral retinal detachments. A female child with bilateral retinal detachment who had 2 uncles in whom Norrie disease had already been diagnosed. The child had a mutation in the third exon (T776-->A; Ile 123-->Asn) identical to the mutation found in her uncles. Norrie disease can occur in girls. The most likely explanation is nonrandom or unfavorable X inactivation, although timing of development of the peripheral retina and its blood supply could render it vulnerable to effects of the mutant allele at a critical developmental phase.

  7. Development of the polymerase chain reaction for diagnosis of chancroid.

    PubMed Central

    Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

    1993-01-01

    The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

  8. A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    NASA Astrophysics Data System (ADS)

    Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen S.; Skov, Julia; Sun, Yi; Duong Bang, Dang; Pedersen, Michael E.; Hansen, Mikkel F.; Wolff, Anders

    2013-07-01

    We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence signal from Rhodamine B. The method was validated with the PCR amplification of mecA gene (162 bp) from methicillin-resistant Staphylococcus aureus bacterium (MRSA), where the time for 30 cycles was reduced from 50 min (without over- and undershooting) to 20 min.

  9. Absence of giant blood Marseille-like virus DNA detection by polymerase chain reaction in plasma from healthy US blood donors and serum from multiply transfused patients from Cameroon.

    PubMed

    Phan, Tung Gia; Desnues, Christelle; Switzer, William M; Djoko, Cyrille F; Schneider, Bradley S; Deng, Xutao; Delwart, Eric

    2015-06-01

    A new Marseilleviridae virus family member, giant blood Marseille-like (GBM) virus, was recently reported in persons from France in the serum of an infant with adenitis, in the blood of 4% of healthy blood donors, and in 9% of multiply transfused thalassemia patients. These results suggested the presence of a nucleocytoplasmic large DNA virus potentially transmissible by blood product transfusion. To investigate this possibility we tested the plasma from 113 US blood donors and 74 multiply transfused Cameroon patients for GBM viral DNA using highly sensitive polymerase chain reaction (PCR) assays. GBM DNA was not detected by nested PCR in any of these 187 human specimens. Further testing is required to confirm the occurrence of human GBM virus infections. © 2015 AABB.

  10. Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

    PubMed

    Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2010-06-01

    Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons <150 base pairs) of the mitochondrial 12S rRNA gene, and an endogenous control primer pair that amplifies a 141-bp fragment of the nuclear 18S rRNA gene from eukaryotic DNA. Analysis of experimental raw and heat-treated binary mixtures as well as of commercial meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

  11. Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

    DOEpatents

    Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

    2001-01-01

    Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

  12. A novel polymerase chain reaction (PCR) - denaturing gradient gel electrophoresis (DGGE) for the identification of Micrococcaceae strains involved in meat fermentations. Its application to naturally fermented Italian sausages.

    PubMed

    Cocolin, L; Manzano, M; Aggio, D; Cantoni, C; Comi, G

    2001-05-01

    A new molecular method consisting of polymerase chain reaction (PCR) amplification and denaturing gradient gel electrophoresis (DGGE) of a small fragment from the 16S rRNA gene identified the Micrococcaceae strains isolated from natural fermented Italian sausages. Lactic acid bacteria, total aerobic mesophilic flora, Enterobacteriaceae and faecal enterococci were also monitored. Micrococcaceaea control strains from international collections were used to optimise the method and 90 strains, isolated from fermented sausages, were identified by biochemical tests and PCR-DGGE. No differences were observed between the methods used. The results reported in this paper prove that Staphylococcus xylosus is the main bacterium involved in fermented sausage production, representing, from the tenth day of ripening, the only Micrococcaceaea species isolated.

  13. Real-time quantitative polymerase chain reaction methods for four genetically modified maize varieties and maize DNA content in food.

    PubMed

    Brodmann, Peter D; Ilg, Evelyn C; Berthoud, Hélène; Herrmann, Andre

    2002-01-01

    Quantitative detection methods are needed for enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients. This labeling threshold, which is set to 1% in the European Union and Switzerland, must be applied to all approved GMOs. Four different varieties of maize are approved in the European Union: the insect-resistant Bt176 maize (Maximizer), Btl 1 maize, Mon810 (YieldGard) maize, and the herbicide-tolerant T25 (Liberty Link) maize. Because the labeling must be considered individually for each ingredient, a quantitation system for the endogenous maize content is needed in addition to the GMO-specific detection systems. Quantitative real-time polymerase chain reaction detection methods were developed for the 4 approved genetically modified maize varieties and for an endogenous maize (invertase) gene system.

  14. [Development of molecular detection of food-borne pathogenic bacteria using miniaturized microfluidic devices].

    PubMed

    Iván, Kristóf; Maráz, Anna

    2015-12-20

    Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification - most frequently real-time polymerase chain reaction - methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple - often automated - use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors' research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria.

  15. Granulomatous herpes simplex encephalitis in an infant with multicystic encephalopathy: a distinct clinicopathologic entity?

    PubMed

    Schutz, Peter W; Fauth, Clarissa T; Al-Rawahi, Ghada N; Pugash, Denise; White, Valerie A; Stockler, Sylvia; Dunham, Christopher P

    2014-04-01

    Herpes simplex virus encephalitis can manifest as a range of clinical presentations including classic adult, neonatal, and biphasic chronic-granulomatous herpes encephalitis. We report an infant with granulomatous herpes simplex virus type 2 encephalitis with a subacute course and multicystic encephalopathy. A 2-month-old girl presented with lethargy and hypothermia. Computed tomography scan of the head showed multicystic encephalopathy and calcifications. Cerebrospinal fluid analysis by polymerase chain reaction testing for herpes simplex virus 1 and 2, enterovirus, and cytomegalovirus was negative. Normal cerebrospinal fluid interferon-α levels argued against Aicardi-Goutières syndrome. The patient died 2 weeks after presentation. At autopsy, multicystic encephalopathy was confirmed with bilateral gliosis, granulomatous inflammation with multinucleated giant cells, and calcifications. Bilateral healing necrotizing retinitis suggested a viral etiology, but retina and brain were free of viral inclusions and immunohistochemically negative for herpes simplex virus-2 and cytomegalovirus. However, polymerase chain reaction analysis showed herpes simplex virus-2 DNA in four cerebral paraffin blocks. Subsequent repeat testing of the initial cerebrospinal fluid sample using a different polymerase chain reaction assay was weakly positive for herpes simplex virus-2 DNA. Granulomatous herpes simplex virus encephalitis in infants can present with subacute course and result in multicystic encephalopathy with mineralization and minimal cerebrospinal fluid herpes simplex virus DNA load. Infectious etiologies should be carefully investigated in the differential diagnosis of multicystic encephalopathy with mineralization, in particular if multinucleated giant cells are present. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Molecular testing for familial hypercholesterolaemia-associated mutations in a UK-based cohort: development of an NGS-based method and comparison with multiplex polymerase chain reaction and oligonucleotide arrays.

    PubMed

    Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K

    2016-11-01

    Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.

  17. Real-Time Polymerase Chain Reaction-Based Detection of Bordetella pertussis in Mexican Infants and Their Contacts: A 3-Year Multicenter Study.

    PubMed

    Aquino-Andrade, Alejandra; Martínez-Leyva, Gabriel; Mérida-Vieyra, Jocelin; Saltigeral, Patricia; Lara, Antonino; Domínguez, Wendy; García de la Puente, Silvestre; De Colsa, Agustín

    2017-09-01

    To evaluate the usefulness of real-time polymerase chain reaction (RT-PCR) as a diagnostic method for the detection of Bordetella pertussis in hospitalized patients aged <1 year with a clinical diagnosis of whooping cough, as well as to identify the role of household contacts as a source of infection. This was a prospective, multicenter study of infants aged <1 year who were hospitalized with symptoms suggestive of whooping cough. Nasopharyngeal samples were obtained for culture and RT-PCR testing. The clinical and epidemiologic characteristics and outcomes were analyzed. B pertussis detection and symptoms in household contacts of patients diagnosed with pertussis were studied. A total of 286 patients were included; of these, 67.1% had B pertussis and 4.5% had Bordetella spp. Complications occurred in 20% of patients, and the mortality rate was 6.7%. Of 434 contacts studied, 111 were mothers of study infants, representing the most frequently B pertussis-infected group and the main symptomatic contact. The use of RT-PCR permits improved detection and diagnosis of pertussis and a better understanding of the epidemiology of sources of infection. The complications and mortality rate of pertussis continue to be high. Household contacts are confirmed as a frequent source of infection of B pertussis in young children. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Gene 1.7 of bacteriophage T7 confers sensitivity of phage growth to dideoxythymidine.

    PubMed

    Tran, Ngoc Q; Rezende, Lisa F; Qimron, Udi; Richardson, Charles C; Tabor, Stanley

    2008-07-08

    Bacteriophage T7 DNA polymerase efficiently incorporates dideoxynucleotides into DNA, resulting in chain termination. Dideoxythymidine (ddT) present in the medium at levels not toxic to Escherichia coli inhibits phage T7. We isolated 95 T7 phage mutants that were resistant to ddT. All contained a mutation in T7 gene 1.7, a nonessential gene of unknown function. When gene 1.7 was expressed from a plasmid, T7 phage resistant to ddT still arose; analysis of 36 of these mutants revealed that all had a single mutation in gene 5, which encodes T7 DNA polymerase. This mutation changes tyrosine-526 to phenylalanine, which is known to increase dramatically the ability of T7 DNA polymerase to discriminate against dideoxynucleotides. DNA synthesis in cells infected with wild-type T7 phage was inhibited by ddT, suggesting that it resulted in chain termination of DNA synthesis in the presence of gene 1.7 protein. Overexpression of gene 1.7 from a plasmid rendered E. coli cells sensitive to ddT, indicating that no other T7 proteins are required to confer sensitivity to ddT.

  19. Interactions of long DNA chains with charged surfaces: Entropy, Conformations and Applications

    NASA Astrophysics Data System (ADS)

    Rondelez, Francis

    2004-03-01

    The adsorption of long DNA chains on positively charged surfaces is controlled by electrostatics. We demonstrate experimentally on two different systems that the driving force for adsorption is the release of the small counterions surrounding the DNA chains and the charged surface. We then proceed to the study of the conformation of the adsorbed DNA chains. In the first series of experiments, the DNA is in contact with a Langmuir monolayer of cationic amphiphiles. The advantage is that the surface charge density can be varied over a factor of 10 and also that the immobilized DNA chains can be mechanically manipulated. We observe by neutron reflectometry that the chains are essentially flat on the interface, with a few dangling loops. In the second series of experiments the DNA chains are in contact with a solution of cationic polystyrene microspheres. Due to the small size of the particles, the DNA chains adsorb only partially. The fraction of nucleotides localized around the beads can be measured by fluorescence spectroscopy and we compare it to the total number of charges on the particle. We also study the conditions to maximize the wrapping. Such experiments should be useful to better understand the compaction of DNA by histone proteins and formation of nucleosomes. The immobilization of DNA by surfaces also provides a way to control the interactions of DNA with proteins like DNases, exonucleases or RNA polymerases.

  20. NMR solution structure of poliovirus uridylyated peptide linked to the genome (VPgpU)

    PubMed Central

    Schein, Catherine H.; Oezguen, Numan; van der Heden van Noort, Gerbrand J.; Filippov, Dmitri V.; Paul, Aniko; Kumar, Eric; Braun, Werner

    2010-01-01

    Picornaviruses have a 22–24 amino acid peptide, VPg, bound covalently at the 5’ end of their RNA, that is essential for replication. VPgs are uridylylated at a conserved Tyrosine to form VPgpU, the primer of RNA synthesis by the viral polymerase. This first complete structure for any uridylylated VPg, of poliovirus type 1 (PV1)-VPgpU, shows that conserved amino acids in VPg stabilize the bound UMP, with the uridine atoms involved in base pairing and chain elongation projected outward. Comparing this structure to PV1-VPg and partial structures of VPg/VPgpU from other picornaviruses suggests that enteroviral polymerases require a more stable VPg structure than does the distantly related aphthovirus, foot and mouth disease virus (FMDV). The glutamine residue at the C-terminus of PV1-VPgpU lies in back of the uridine base and may stabilize its position during chain elongation and/or contribute to base specificity. Under in vivo-like conditions with the authentic cre(2C) hairpin RNA and Mg++, 5-methylUTP cannot compete with UTP for VPg uridylyation in an in vitro uridylyation assay, but both nucleotides are equally incorporated by PV1-polymerase with Mn++ and a poly-A RNA template. This indicates the 5 position is recognized under in vivo conditions. The compact VPgpU structure docks within the active site cavity of the PV-polymerase, close to the position seen for the fragment of FMDV-VPgpU with its polymerase. This structure could aid in design of novel enterovirus inhibitors, and stabilization upon uridylylation may also be pertinent for post-translational uridylylation reactions that underlie other biological processes. PMID:20441784

  1. Validation of Reference Genes in mRNA Expression Analysis Applied to the Study of Asthma.

    PubMed

    Segundo-Val, Ignacio San; Sanz-Lozano, Catalina S

    2016-01-01

    The quantitative Polymerase Chain Reaction is the most used technique for the study of gene expression. To correct putative experimental errors of this technique is necessary normalizing the expression results of the gene of interest with the obtained for reference genes. Here, we describe an example of the process to select reference genes. In this particular case, we select reference genes for expression studies in the peripheral blood mononuclear cells of asthmatic patients.

  2. 64Cu-DOTATATE PET/MRI for Detection of Activated Macrophages in Carotid Atherosclerotic Plaques: Studies in Patients Undergoing Endarterectomy.

    PubMed

    Pedersen, Sune Folke; Sandholt, Benjamin Vikjær; Keller, Sune Høgild; Hansen, Adam Espe; Clemmensen, Andreas Ettrup; Sillesen, Henrik; Højgaard, Liselotte; Ripa, Rasmus Sejersten; Kjær, Andreas

    2015-07-01

    A feature of vulnerable atherosclerotic plaques of the carotid artery is high activity and abundance of lesion macrophages. There is consensus that this is of importance for plaque vulnerability, which may lead to clinical events, such as stroke and transient ischemic attack. We used positron emission tomography (PET) and the novel PET ligand [(64)Cu] [1,4,7,10-tetraazacyclododecane-N,N',N″,N‴-tetraacetic acid]-d-Phe1,Tyr3-octreotate ((64)Cu-DOTATATE) to specifically target macrophages via the somatostatin receptor subtype-2 in vivo. Ten patients underwent simultaneous PET/MRI to measure (64)Cu-DOTATATE uptake in carotid artery plaques before carotid endarterectomy. (64)Cu-DOTATATE uptake was significantly higher in symptomatic plaque versus the contralateral carotid artery (P<0.001). Subsequently, a total of 62 plaque segments were assessed for gene expression of selected markers of plaque vulnerability using real-time quantitative polymerase chain reaction. These results were compared with in vivo (64)Cu-DOTATATE uptake calculated as the mean standardized uptake value. Univariate analysis of real-time quantitative polymerase chain reaction and PET showed that cluster of differentiation 163 (CD163) and CD68 gene expression correlated significantly but weakly with mean standardized uptake value in scans performed 85 minutes post injection (P<0.001 and P=0.015, respectively). Subsequent multivariate analysis showed that CD163 correlated independently with (64)Cu-DOTATATE uptake (P=0.031) whereas CD68 did not contribute significantly to the final model. The novel PET tracer (64)Cu-DOTATATE accumulates in atherosclerotic plaques of the carotid artery. CD163 gene expression correlated independently with (64)Cu-DOTATATE uptake measured by real-time quantitative polymerase chain reaction in the final multivariate model, indicating that (64)Cu-DOTATATE PET is detecting alternatively activated macrophages. This association could potentially improve noninvasive identification and characterization of vulnerable plaques. © 2015 The Authors.

  3. Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls.

    PubMed

    Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol

    2010-03-05

    The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90%) were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8%) and the lowest in fibroblastic DNA (92.3%, P < or = 0.05). Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P < or = 0.05). The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic cells.

  4. Characterization of an Avipoxvirus From a Bald Eagle ( Haliaeetus leucocephalus ) Using Novel Consensus PCR Protocols for the rpo147 and DNA-Dependent DNA Polymerase Genes.

    PubMed

    Stephen, Alexa A; Leone, Angelique M; Toplon, David E; Archer, Linda L; Wellehan, James F X

    2016-12-01

    A juvenile female bald eagle ( Haliaeetus leucocephalus ) was presented with emaciation and proliferative periocular lesions. The eagle did not respond to supportive therapy and was euthanatized. Histopathologic examination of the skin lesions revealed plaques of marked epidermal hyperplasia parakeratosis, marked acanthosis and spongiosis, and eosinophilic intracytoplasmic inclusion bodies. Novel polymerase chain reaction (PCR) assays were done to amplify and sequence DNA polymerase and rpo147 genes. The 4b gene was also analyzed by a previously developed assay. Bayesian and maximum likelihood phylogenetic analyses of the obtained sequences found it to be poxvirus of the genus Avipoxvirus and clustered with other raptor isolates. Better phylogenetic resolution was found in rpo147 rather than the commonly used DNA polymerase. The novel consensus rpo147 PCR assay will create more accurate phylogenic trees and allow better insight into poxvirus history.

  5. Identification of a whitefly species by genomic and behavioral studies

    USGS Publications Warehouse

    Perring, T.M.; Cooper, A.D.; Rodriguez, R.J.; Farrar, C.A.; Bellows, T.S.

    1993-01-01

    An introduced whitefly species, responsible for over a half billion dollars in damage to U.S. agricultural production in 1991, is morphologically indistinguishable from Bemisia tabaci (Gennadius). However, with the use of polymerase chain reaction-based DNA differentiation tests, allozymic frequency analyses, crossing experiments, and mating behavior studies, the introduced whitefly is found to be a distinct species. Recognition of this new species, the silverleaf whitefly, is critical in the search for management options.

  6. Concurrent detection of herpes simplex and varicella-zoster viruses by polymerase chain reaction from the same anatomic location.

    PubMed

    Dhiman, Neelam; Wright, Patricia A; Espy, Mark J; Schneider, Susan K; Smith, Thomas F; Pritt, Bobbi S

    2011-08-01

    Herpes simplex virus (HSV) and varicella-zoster virus (VZV) may cause latent infection of the same peripheral nerve ganglia. However, there are no large studies addressing the frequency of concurrent HSV/VZV PCR positivity from the same anatomic location. In an eight-year retrospective study, we observed 1.3% dual positivity from dermal, genital, and oral mucosal sources. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Molecular Detection of the Carriage Rate of Four Intestinal Protozoa with Real-Time Polymerase Chain Reaction: Possible Overdiagnosis of Entamoeba histolytica in Nigeria.

    PubMed

    Efunshile, Michael A; Ngwu, Bethrand A F; Kurtzhals, Jørgen A L; Sahar, Sumrin; König, Brigitte; Stensvold, Christen R

    2015-08-01

    Diarrhea remains the second largest killer of children worldwide, and Nigeria ranks number two on the list of global deaths attributable to diarrhea. Meanwhile, prevalence studies on potentially diarrheagenic protozoa in asymptomatic carriers using molecular detection methods remain scarce in sub-Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia intestinalis, and Cryptosporidium. Questionnaires were administered for epidemiological data collection. E. histolytica was not detected in any of the samples, whereas Giardia (37.2%), E. dispar (18.6%), and Cryptosporidium (1%) were found. Most of the children sourced their drinking water from community wells (91%), while the majority disposed of feces in the bush (81.9%). Our study is the first to use real-time PCR to evaluate the epidemiology of E. histolytica, Giardia, and Cryptosporidium in Nigeria where previous studies using traditional diagnostic techniques have suggested higher and lower carriage rates of E. histolytica and Giardia, respectively. It is also the first study to accurately identify the prevalence of common potentially diarrheagenic protozoa in asymptomatic carriers in sub-Saharan Africa. © The American Society of Tropical Medicine and Hygiene.

  8. Development of a polymerase chain reaction assay for the rapid detection of the oral pathogenic bacterium, Selenomonas noxia.

    PubMed

    Cruz, Patricia; Mehretu, Arthuro M; Buttner, Mark P; Trice, Theresa; Howard, Katherine M

    2015-08-14

    In recent studies, periodontal health has been linked to being overweight and/or obese. Among common oral bacteria, Selenomonas noxia has been implicated in converting periodontal health to disease, and Selenomonas species have also been found in gastric ulcers. The objective of this study was to develop and validate a quantitative polymerase chain reaction (qPCR) assay for the specific and rapid detection of S. noxia. Two oligonucleotide primer pairs and one probe were designed and tested to determine optimal amplification signal with three strains of S. noxia. The PCR assay was tested against fourteen non-target organisms, including closely related oral Selenomonads, one phylogenetically closely related bacterium, and two commonly isolated oral bacteria. One of the primer sets was more sensitive at detecting the target organism and was selected for optimization and validation experiments. The designed primers and probe amplified the target organism with 100% specificity. PCR inhibition was observed with an internal positive control, and inhibition was resolved by diluting the DNA extract. The qPCR assay designed in this study can be used to specifically detect S. noxia in the clinical setting and in future research involving the enhanced detection of S. noxia. The assay can also be used in epidemiological studies for understanding the role of S. noxia in disease processes including, but not limited to, oral health and obesity of infectious origin.

  9. Epidemiology of Bordetella pertussis in San Luis Potosí, Mexico.

    PubMed

    Ochoa-Perez, Uciel R; Hernández-Sierra, Juan F; Escalante-Padrón, Francisco J; Contreras-Vidales, Soledad; Berman-Puente, Ana M; Hernandez-Maldonado, Fernando; Noyola, Daniel E

    2014-05-01

    We analyzed data from 147 patients with suspected pertussis in San Luis Potosí, Mexico. Bordetella pertussis was detected by real-time polymerase chain reaction in 59 (40.1%) cases. The incidence of B. pertussis infection was 2.3 per 100,000 population. There were 6 deaths among the study patients. We conclude that the impact of pertussis in our state is significantly higher than previously estimated.

  10. Tested Studies for Laboratory Teaching. Proceedings of the Workshop/Conference of the Association for Biology Laboratory Education (ABLE) (15th, Toronto, Ontario, Canada, June 8-12, 1993). Volume 15.

    ERIC Educational Resources Information Center

    Goldman, Corey A., Ed.

    The focus of the Association for Biology Laboratory Education (ABLE) is to improve the undergraduate biology laboratory experience by promoting the development and dissemination of interesting, innovative, and reliable laboratory exercises. This proceedings volume contains 18 papers: "Human DNA Fingerprinting by Polymerase Chain Reaction" (M. V.…

  11. A practical molecular identification of nonfermenting Gram-negative bacteria from cystic fibrosis.

    PubMed

    Capizzani, Carolina Paulino da Costa; Caçador, Natália Candido; Marques, Elizabeth Andrade; Levy, Carlos Emílio; Tonani, Ludmilla; Torres, Lidia Alice Gomes Monteiro Marin; Darini, Ana Lúcia da Costa

    Identification of nonfermenting Gram-negative bacteria (NFGNB) of cystic fibrosis patients is hard and misidentification could affect clinical outcome. This study aimed to propose a scheme using polymerase chain reaction to identify NFGNB. This scheme leads to reliable identification within 3 days in an economically viable manner when compared to other methods. Copyright © 2018 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  12. Incorporating microbiota data into epidemiologic models: examples from vaginal microbiota research.

    PubMed

    van de Wijgert, Janneke H; Jespers, Vicky

    2016-05-01

    Next generation sequencing and quantitative polymerase chain reaction technologies are now widely available, and research incorporating these methods is growing exponentially. In the vaginal microbiota (VMB) field, most research to date has been descriptive. The purpose of this article is to provide an overview of different ways in which next generation sequencing and quantitative polymerase chain reaction data can be used to answer clinical epidemiologic research questions using examples from VMB research. We reviewed relevant methodological literature and VMB articles (published between 2008 and 2015) that incorporated these methodologies. VMB data have been analyzed using ecologic methods, methods that compare the presence or relative abundance of individual taxa or community compositions between different groups of women or sampling time points, and methods that first reduce the complexity of the data into a few variables followed by the incorporation of these variables into traditional biostatistical models. To make future VMB research more clinically relevant (such as studying associations between VMB compositions and clinical outcomes and the effects of interventions on the VMB), it is important that these methods are integrated with rigorous epidemiologic methods (such as appropriate study designs, sampling strategies, and adjustment for confounding). Crown Copyright © 2016. Published by Elsevier Inc. All rights reserved.

  13. Human papillomavirus type 2 associated with pyogenic granuloma in patients without clinical evidence of warts.

    PubMed

    Vázquez-Martínez, Osvaldo T; González-Betancourt, Anajulia; Barboza-Cerda, María Carmen; González-González, Sergio E; Lugo-Trampe, Ángel; Welsh, Oliverio; Rojas-Martínez, Augusto; Martínez-Rodríguez, Herminia G; Ocampo-Candiani, Jorge; Ortiz-López, Rocío

    2016-07-01

    Pyogenic granuloma is a non-neoplastic lesion that frequently occurs in the skin and mucous membranes of children and pregnant women. The anatomical sites of pyogenic granulomas overlap with those of wart infections caused by the human papillomavirus (HPV). This study assessed the presence of HPV DNA in pyogenic granuloma samples by polymerase chain reaction. Eighteen pyogenic granuloma biopsies from patients without a clinical history or evidence of verruca in the studied area were tested for the presence of the HPV genome. The presence of HPV DNA was screened by three independent polymerase chain reaction reactions using standard consensus primer sets targeted to the L1 or E1 consensus regions of HPV genome. The HPV DNA-positive samples were genotyped using methodologies enabling the identification of up to 30 HPVs, including oncogenic, nononcogenic, and cutaneous viral types. The HPV DNA was detected in 44.4% (eight of 18) of the samples, with HPV-2 being the only type in the eight HPV DNA-positive samples. Contamination with HPV-2 sequences throughout the entire process was reliably eliminated. This report is the first to suggest an association between HPV-2 and pyogenic granuloma. This relationship is similar to that observed between HPV-2 and nongenital warts. © 2015 The International Society of Dermatology.

  14. Monitoring of polyomavirus BK viruria in bone marrow transplantation patients by DNA hybridization assay and by polymerase chain reaction: an approach to assess the relationship between BK viruria and hemorrhagic cystitis.

    PubMed

    Azzi, A; Fanci, R; Bosi, A; Ciappi, S; Zakrzewska, K; de Santis, R; Laszlo, D; Guidi, S; Saccardi, R; Vannucchi, A M

    1994-08-01

    An association between long-lasting hemorrhagic cystitis (HC) in bone marrow transplantation (BMT) patients and viral infections, mostly with reactivation of the human polyomavirus BK (BKV), is suggested by several previous reports. We have carried out a prospective study in 55 (30 allogeneic, 24 autologous, 1 syngeneic) BMT recipients with the aim of evaluating the role of BKV in this frequent complication after BMT. To overcome the well known difficulties in BK virus isolation in cell cultures, a DNA hybridization assay and the polymerase chain reaction (PCR) were used for the detection and monitoring of viral urinary shedding, respectively. The presence of human polyomavirus JC and adenovirus DNA was also sought in urine specimens. BK viruria was demonstrated in 52.7% of patients (in 53.3% allogeneic and in 54.1% autologous BMT), whereas JCV and adenovirus were seldom present. Seven cases of HC (20% in allogeneic and 4% in autologous BMT) occurred and in all cases the clinical event was associated with BKV urinary shedding. This study suggests that BKV infection alone does not invariably lead to HC in BMT patients; for HC to occur the presence of other, at present unidentified, factors seems to be necessary.

  15. Ureaplasma urealyticum biovar determination in women attending a family planning clinic in Guiné-Bissau, using polymerase chain reaction of the multiple-banded antigen gene.

    PubMed

    Domingues, D; Tavira, L Távora; Duarte, A; Sanca, A; Prieto, E; Exposto, F

    2002-01-01

    Although Ureaplasma urealyticum is commonly found in the genital tract of asymptomatic women, it has been suggested that only certain subgroups of this microorganism are disease associated. Vaginal specimens were collected to determine the distribution of U. urealyticum biovars and to estimate their possible association with age, absence of lactobacilli, and tetracycline resistance. Of the 94 women studied, 40 (43%) carried U. urealyticum and were biotyped by polymerase chain reaction (PCR). Twenty-nine (73%) strains presented with parvo biovar, 10 (25%) with T960 biovar, and one (2.5%) with both biovars. Parvo biovar was predominant in all age groups and appears to be more frequent in women 20-25 years of age (41%), whereas T960 was common in women 30-35 years of age (22%). In this study, U. urealyticum was not associated with changes in vaginal flora, although the inverse apparently was true for Mycoplasma hominis. However, T960 biovar was more associated with the loss of lactobacilli than was parvo biovar. The number of T960 biovar strains that presented tetracycline (40%) or multiple (100%) resistance was higher than that of parvo biovar strains (27% and 69%, respectively). Copyright 2002 Wiley-Liss, Inc.

  16. [Development of a diagnostic test system for early non-invasive detection of prostate cancer based on PCA3 mRNA levels in urine sediment using quantitative reverse tanscription polymerase chain reaction (qRT-PCR)].

    PubMed

    Pavlov, K A; Shkoporov, A N; Khokhlova, E V; Korchagina, A A; Sidorenkov, A V; Grigor'ev, M É; Pushkar', D Iu; Chekhonin, V P

    2013-01-01

    The wide introduction of prostatic specific antigen (PSA) determination into clinical practice has resulted in a larger number of prostate biopsies, while the lower age threshold for PSA has led to a larger number of unnecessary prostate biopsies. Hence, there is a need for new biomarkers that can detect prostate cancer. PCA3 is a noncoding messenger ribonucleic acid (mRNA) that is expressed exclusively in prostate cells. The aim of the study has been to develop a diagnostic test system for early non-invasive detection of prostate cancer based on PCA3 mRNA levels in urine sediment using quantitative reverse transcription polymerase chain reaction (qRT-PCR). As part of the study, a laboratory diagnostic test system prototype has been designed, an application methodology has been developed and specificity and sensitivity data of the method has been assessed. The diagnostic system has demonstrated its ability to detect significantly elevated levels of PCA 3/KLK 3 in samples from prostate cancer (PCa) patients compared with those from healthy men. The findings have shown relatively high diagnostic sensitivity, specificity and negative-predictive values for an early non-invasive screening of prostate cancer

  17. Understanding colonization and proliferation potential of endophytes and pathogen in planta via plating, polymerase chain reaction and ergosterol assay.

    PubMed

    Chow, Yiing Yng; Rahman, Sadequr; Ting, Adeline Su Yien

    2017-01-01

    This study aimed to establish the colonization behavior and proliferation potential of three endophytes and one pathogen Ganoderma boninense (Gb) introduced into oil palm ramets (host model). The endophytes selected were Diaporthe phaseolorum (WAA02), Trichoderma asperellum (T2), and Penicillium citrinum (BTF08). Ramets were first inoculated with 100 mL of fungal cells (10 6  cfu mL - 1 ) via soil drenching. For the next 7 days, ramets were sampled and subjected to three different assays to detect and identify fungal colonization, and establish their proliferation potential in planta . Plate assay revealed the presence of endophytes in root, stem and leaf tissues within 7 days after inoculation. Polymerase Chain Reaction (PCR) detected and identified the isolates from the plant tissues. The ergosterol assay (via high performance liquid chromatography, HPLC) confirmed the presence of endophytes and Gb in planta . The increase in ergosterol levels throughout 49 days was however insignificant, suggesting that proliferation may be absent or may occur very slowly in planta . This study strongly suggests that the selected endophytes could colonize the host upon inoculation, but proliferation occurs at a slower rate, which may subsequently influence the biocontrol expression of endophytes against the pathogen.

  18. Determination of adsorption and desorption of DNA molecules on freshwater and marine sediments.

    PubMed

    Xue, J; Feng, Y

    2018-06-01

    Free DNA and its adsorption by sediment in the aquatic environment lead to ambiguity in the identification of recent faecal pollution sources. The goal of this study was to understand the mechanisms of DNA adsorption and desorption on aquatic sediment under various conditions using quantitative polymerase chain reaction (qPCR). Both raw sewage (RS) DNA and purified PCR product (PPP) were used in adsorption and desorption experiments; autoclaved freshwater and marine sediments served as sorbents. Thirty-six hours were needed for adsorption to reach equilibrium. More DNA was adsorbed on both sediments in stream water than in 5 mmol l -1 NaCl and DNA adsorption increased in the presence of Ca 2+ and Mg 2+ . Successive desorption experiments showed that between 5% and 22% of adsorbed DNA was desorbed. Organic matter and clay played a significant role in determining the DNA adsorption capacity on sediment. The data suggest the presence of multilayer adsorption. DNA molecules on sediments were mostly adsorbed through ligand binding rather than electrostatic binding. Quantitative polymerase chain reaction assays provide a better way to investigate the DNA adsorption and desorption mechanisms by sediment. DNA desorption can potentially complicate the outcomes of microbial source tracking studies. © 2018 The Society for Applied Microbiology.

  19. Use of extremely short Förster resonance energy transfer probes in real-time polymerase chain reaction

    PubMed Central

    Kutyavin, Igor V.

    2013-01-01

    Described in the article is a new approach for the sequence-specific detection of nucleic acids in real-time polymerase chain reaction (PCR) using fluorescently labeled oligonucleotide probes. The method is based on the production of PCR amplicons, which fold into dumbbell-like secondary structures carrying a specially designed ‘probe-luring’ sequence at their 5′ ends. Hybridization of this sequence to a complementary ‘anchoring’ tail introduced at the 3′ end of a fluorescent probe enables the probe to bind to its target during PCR, and the subsequent probe cleavage results in the florescence signal. As it has been shown in the study, this amplicon-endorsed and guided formation of the probe-target duplex allows the use of extremely short oligonucleotide probes, up to tetranucleotides in length. In particular, the short length of the fluorescent probes makes possible the development of a ‘universal’ probe inventory that is relatively small in size but represents all possible sequence variations. The unparalleled cost-effectiveness of the inventory approach is discussed. Despite the short length of the probes, this new method, named Angler real-time PCR, remains highly sequence specific, and the results of the study indicate that it can be effectively used for quantitative PCR and the detection of polymorphic variations. PMID:24013564

  20. Polymerase chain reaction-hybridization method using urease gene sequences for high-throughput Ureaplasma urealyticum and Ureaplasma parvum detection and differentiation.

    PubMed

    Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing

    2016-04-15

    In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Individual and combined influence of ACE and ACTN3 genes on muscle phenotypes in Polish athletes.

    PubMed

    Orysiak, Joanna; Mazur-Różycka, Joanna; Busko, Krzysztof; Gajewski, Jan; Szczepanska, Beata; Malczewska-Lenczowska, Jadwiga

    2017-02-08

    The aim of this study was to examine the association between ACE and ACTN3 genes, independently or in combination, and muscle strength and power in male and female athletes. The study involved 398 young male (n=266) and female (n=132) athletes representing various sport disciplines (ice hockey, canoeing, swimming, volleyball). All were Caucasians. The following measurements were taken: height of jump and mechanical power in countermovement jump (CMJ) and spike jump (SPJ), and muscle strength of 10 muscle groups (flexors and extensors of the elbow, shoulder, hip, knee and trunk). The ID polymorphism of ACE and the R577X polymorphism of ACTN3 were typed using PCR (polymerase chain reaction) and PCR-RFLP (polymerase chain reaction - restriction fragment length polymorphism), respectively. The genotype distribution of the ACE and ACTN3 genes did not differ significantly between groups of athletes for either sex. There was no association between ACE and ACTN3 genotypes (alone or in combination) and sum of muscle strength, height of jump or mechanical power in both jump tests (CMJ and SPJ) for male and female athletes. These findings do not support an influential role of the ACE and ACTN3 genes in determining power/strength performance of elite athletes.

  2. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems.

    PubMed

    Ximenes, Camila; Brandão, Eduardo; Oliveira, Paula; Rocha, Abraham; Rego, Tamisa; Medeiros, Rafael; Aguiar-Santos, Ana; Ferraz, João; Reis, Christian; Araujo, Paulo; Carvalho, Luiz; Melo, Fabio L

    2014-12-01

    The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2) and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  3. Clinical utility of methicillin-resistant Staphylococcus aureus nasal polymerase chain reaction assay in critically ill patients with nosocomial pneumonia.

    PubMed

    Smith, Melanie N; Erdman, Michael J; Ferreira, Jason A; Aldridge, Petra; Jankowski, Christopher A

    2017-04-01

    This study investigated the diagnostic performance characteristics of a methicillin-resistant Staphylococcus aureus (MRSA) nasal polymerase chain reaction (PCR) assay in critically ill patients with nosocomial pneumonia. This retrospective, single-center study included adult patients admitted to an intensive care unit with suspected nosocomial pneumonia. Patients must have received an MRSA nasal PCR assay and respiratory culture within predetermined time intervals. The primary outcome included the diagnostic performance characteristics of the assay. Secondary outcomes included the change in negative predictive value (NPV) over time, rate of acute kidney injury, and cost avoidance associated with vancomycin and monitoring. In 400 patients meeting inclusion criteria, the prevalence of culture confirmed MRSA pneumonia was 9.3%. When compared to initial cultures, the PCR assay demonstrated 91.89% sensitivity and 84.3% specificity with a positive predictive value and NPV of 37.36% and 99.03%. The NPV decreased to 87.5% at 21.9 days. No difference was found in rates of acute kidney injury. A cost avoidance of $108 per patient was estimated in patients de-escalated based on negative results. In critically ill patients, an MRSA nasal PCR assay has a high NPV for nosocomial pneumonia and can be used to guide vancomycin de-escalation. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. A Continuous-Flow Polymerase Chain Reaction Microchip With Regional Velocity Control

    PubMed Central

    Li, Shifeng; Fozdar, David Y.; Ali, Mehnaaz F.; Li, Hao; Shao, Dongbing; Vykoukal, Daynene M.; Vykoukal, Jody; Floriano, Pierre N.; Olsen, Michael; McDevitt, John T.; Gascoyne, Peter R.C.; Chen, Shaochen

    2009-01-01

    This paper presents a continuous-flow polymerase chain reaction (PCR) microchip with a serpentine microchannel of varying width for “regional velocity control.” Varying the channel width by incorporating expanding and contracting conduits made it possible to control DNA sample velocities for the optimization of the exposure times of the sample to each temperature phase while minimizing the transitional periods during temperature transitions. A finite element analysis (FEA) and semi-analytical heat transfer model was used to determine the distances between the three heating assemblies that are responsible for creating the denaturation (96 °C), hybridization (60 °C), and extension (72 °C) temperature zones within the microchip. Predictions from the thermal FEA and semi-analytical model were compared with temperature measurements obtained from an infrared (IR) camera. Flow-field FEAs were also performed to predict the velocity distributions in the regions of the expanding and contracting conduits to study the effects of the microchannel geometry on flow recirculation and bubble nucleation. The flow fields were empirically studied using micro particle image velocimetry (μ-PIV) to validate the flow-field FEA’s and to determine experimental velocities in each of the regions of different width. Successful amplification of a 90 base pair (bp) bacillus anthracis DNA fragment was achieved. PMID:19829760

  5. [REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].

    PubMed

    Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A

    2015-01-01

    Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.

  6. Determination of haemolytic and non haemolytic genes profiles of Bacillus cereus strains isolated from food samples by polymerase chain reaction (pcr) technique

    NASA Astrophysics Data System (ADS)

    Jawad, Nisreen; Ahemd, Asmat; Abdullah, Aminah

    2018-04-01

    The aim of this study was to investigate the presence of Bacillus cereus and detection of enterotoxigenic genes in food samples by utilizing a Polymerase Chain Reaction technique (PCR). In this study the providence of B. cereus was carried out to food samples. The B. cereus isolates were investigated for enterotoxigenic gene. The cooked seafood, and raw milk samples were purchased from several restaurants and market in the area of (Bangi, Kajang, Serdang and UKM) Selangor, Malaysia. A total of 60 samples have been analyzed. B. cereus contamination has been formed between 1.4×105 - 3×105 cfu/mL of cooked seafood and raw milk samples. Five colonies have been detected as B. cereus using biochemical test. All B. cereus isolates named BC1 to BC27, were characterized for haemolytic enterotoxin (HBL) complex encoding genes (hblA), non-haemolytic enterotoxin encoding gene (NheA). 10 isolates have been reported to be positive towards hblA and 12 isolates were positive towards NheA. The presence of B. cereus and their enterotoxigenic genes in cooked seafood and raw milk from to food samples obtained may pose a potential risk for public health.

  7. Development and validation of a reverse transcription quantitative polymerase chain reaction for tilapia lake virus detection in clinical samples and experimentally challenged fish.

    PubMed

    Tattiyapong, P; Sirikanchana, K; Surachetpong, W

    2018-02-01

    Tilapia lake virus (TiLV) is an emerging pathogen associated with high mortalities of wild and farm-raised tilapia in different countries. In this study, a SYBR green-based reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay targeting segment three of the virus was developed to detect and quantify TiLV in clinical samples and experimentally challenged fish. All 30 field samples with clinical signs and history consistent with TiLV infection were positive for TiLV as detected by the developed RT-qPCR method. The RT-qPCR technique provided 100 and 10,000 times more sensitive for virus detection than those offered by the RT-PCR and virus isolation in cell culture methods, respectively. The detection limit of the RT-qPCR method was as low as two viral copies/μl. Moreover, the RT-qPCR technique could be applied for TiLV detection in various fish tissues including gills, liver, brain, heart, anterior kidney and spleen. Significantly, this study delivered an accurate and reliable method for rapid detection of TiLV viruses that facilitates active surveillance programme and disease containment. © 2017 John Wiley & Sons Ltd.

  8. Prevalence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using multiplex polymerase chain reaction

    PubMed Central

    Latha, C.; Anu, C. J.; Ajaykumar, V. J.; Sunil, B.

    2017-01-01

    Aim: The objective of the study was to investigate the occurrence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using the multiplex polymerase chain reaction (PCR) method. Materials and Methods: The assay combined an enrichment step in tryptic soy broth with yeast extract formulated for the simultaneous growth of target pathogens, DNA isolation and multiplex PCR. A total of 1134 samples including beef (n=349), chicken (n=325), pork (n=310), chevon (n=50), and meat products (n=100) were collected from different parts of Kerala, India. All the samples were subjected to multiplex PCR analysis and culture-based detection for the four pathogens in parallel. Results: Overall occurrence of L. monocytogenes was 0.08 % by cultural method. However, no L. monocytogenes was obtained by multiplex PCR method. Yersinia enterocolitica was obtained from beef and pork samples. A high prevalence of S. aureus (46.7%) was found in all types of meat samples tested. None of the samples was positive for S. Typhimurium. Conclusion: Multiplex PCR assay used in this study can detect more than one pathogen simultaneously by amplifying more than one target gene in a single reaction, which can save time and labor cost. PMID:28919685

  9. Supercoil Formation During DNA Melting

    NASA Astrophysics Data System (ADS)

    Sayar, Mehmet; Avsaroglu, Baris; Kabakcioglu, Alkan

    2009-03-01

    Supercoil formation plays a key role in determining the structure-function relationship in DNA. Biological and technological processes, such as protein synthesis, polymerase chain reaction, and microarrays relys on separation of the two strands in DNA, which is coupled to the unwinding of the supercoiled structure. This problem has been studied theoretically via Peyrard-Bishop and Poland-Scheraga type models, which include a simple representation of the DNA structural properties. In recent years, computational models, which provide a more realtistic representaion of DNA molecule, have been used to study the melting behavior of short DNA chains. Here, we will present a new coarse-grained model of DNA which is capable of simulating sufficiently long DNA chains for studying the supercoil formation during melting, without sacrificing the local structural properties. Our coarse-grained model successfully reproduces the local geometry of the DNA molecule, such as the 3'-5' directionality, major-minor groove structure, and the helical pitch. We will present our initial results on the dynamics of supercoiling during DNA melting.

  10. Transcription boundaries of U1 small nuclear RNA.

    PubMed Central

    Kunkel, G R; Pederson, T

    1985-01-01

    Transcription-proximal stages of U1 small nuclear RNA biosynthesis were studied by 32P labeling of nascent chains in isolated HeLa cell nuclei. Labeled RNA was hybridized to nitrocellulose-immobilized, single-stranded M13 DNA clones corresponding to regions within or flanking a human U1 RNA gene. Transcription of U1 RNA was inhibited by greater than 95% by alpha-amanitin at 1 microgram/ml, consistent with previous evidence that it is synthesized by RNA polymerase II. No hybridization to DNA immediately adjacent to the 5' end of mature U1 RNA (-6 to -105 nucleotides) was detected, indicating that, like all studied polymerase II initiation, transcription of U1 RNA starts at or very near the cap site. However, in contrast to previously described transcription units for mRNA, in which equimolar transcription occurs for hundreds or thousands of nucleotides beyond the mature 3' end of the mRNA, labeled U1 RNA hybridization dropped off sharply within a very short region (approximately 60 nucleotides) immediately downstream from the 3' end of mature U1 RNA. Also in contrast to pre-mRNA, which is assembled into ribonucleoprotein (RNP) particles while still nascent RNA chains, the U1 RNA transcribed in isolated nuclei did not form RNP complexes by the criterion of reaction with a monoclonal antibody for the small nuclear RNP Sm proteins. This suggests that, unlike pre-mRNA-RNP particle formation, U1 small nuclear RNP assembly does not occur until after the completion of transcription. These results show that, despite their common synthesis by RNA polymerase II, mRNA and U1 small nuclear RNA differ markedly both in their extents of 3' processing and their temporal patterns of RNP assembly. Images PMID:2942763

  11. Role of disulfide bridges in archaeal family-B DNA polymerases.

    PubMed

    Killelea, Tom; Connolly, Bernard A

    2011-06-14

    The family-B DNA polymerases obtained from the order Thermococcales, for example, Pyrococcus furiosus (Pfu-Pol) are commonly used in the polymerase chain reaction (PCR) because of their high thermostability and low error rates. Most of these polymerases contain four cysteines, arranged as two disulfide bridges. With Pfu-Pol C429-C443 forms one of the disulfides (DB1) and C507-C510 (DB2) the other. Although the disulfides are well conserved in the enzymes from the hyperthermophilic Thermococcales, they are less prevalent in euryarchaeal polymerases from other orders, and tend to be only found in other hyperthermophiles. Here, we report on the effects of deleting the disulfide bridges by mutating the relevant cysteines to serines. A variety of techniques, including differential scanning calorimetry and differential scanning fluorimetry, have shown that both disulfides make a contribution to thermostability, with DB1 being more important than DB2. However, even when both disulfides are removed, sufficient thermostability remains for normal (identical to the wild type) performance in PCR and quantitative (real-time) PCR. Therefore, polymerases totally lacking cysteine are fully compatible with most PCR-based applications. This observation opens the way to further engineering of polymerases by introduction of a single cysteine followed by appropriate chemical modification. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Validation of a polymerase chain reaction aided transcript titration assay (PATTY) for topoisomerase II in lung cancer samples.

    PubMed

    Dingemans, A M; Van Ark-Otte, J; Smit, E F; Postmus, P E; Giaccone, G

    This report describes the validation of a polymerase chain reaction aided transcript titration assay (PATTY) for tumor samples. The results obtained with the PATTY were compared to those of RNase protection in a set of 7 human lung cancer cell lines and in 23 non-small cell lung cancer samples derived from resected patients. Whereas between PATTY and RNase protection assay a good correlation was observed in the cell lines (r = 0.74, p = 0.057), no correlation was observed within the tumor samples (r = 0.06, p = 0.78). This was also the case when only tumors with a high percentage of tumor cells (> 90%) were selected. Although PATTY is a valuable tool to measure mRNA expression in cell lines, our results caution the use of PATTY in human tumor samples without proper validation. The possible causes of these results are discussed.

  13. Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

    PubMed

    Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2013-01-01

    A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

  14. Detection and genotyping of bovine diarrhea virus by reverse transcription-polymerase chain amplification of the 5' untranslated region.

    PubMed

    Letellier, C; Kerkhofs, P; Wellemans, G; Vanopdenbosch, E

    1999-01-01

    A reverse-transcription polymerase chain reaction (RT-PCR) was developed to differentiate the bovine diarrhea virus (BVDV) from other pestiviruses, and to determine the genotype of the BVDV isolates. For this purpose, primer pairs were selected in the 5' untranslated region (5'UTR). The primers BE and B2 were located in highly conserved regions and were pestivirus-specific. Two primer pairs named B3B4 and B5B6 were specific of BVDV genotypes I and II, respectively. With this technique, an amplification product of the expected size was obtained with either the B3B4 or the B5B6 primer pairs for the 107 BVDV isolates tested but not for BDV or CSFV. For some isolates that were grouped in the genotype II, sequence analysis of the PCR fragments confirmed their classification into this genotype.

  15. Successful treatment of toxoplasmic encephalitis diagnosed early by polymerase chain reaction after allogeneic hematopoietic stem cell transplantation: two case reports and review of the literature.

    PubMed

    Miyagi, T; Itonaga, H; Aosai, F; Taguchi, J; Norose, K; Mochizuki, K; Fujii, H; Furumoto, A; Ohama, M; Karimata, K; Yamanoha, A; Taniguchi, H; Sato, S; Taira, N; Moriuchi, Y; Fukushima, T; Masuzaki, H; Miyazaki, Y

    2015-08-01

    Toxoplasmic encephalitis represents a rare, but often fatal infection after allogeneic hematopoietic stem cell transplantation. Polymerase chain reaction (PCR)-based preemptive therapy is considered promising for this disease, but is not routinely applied, especially in low seroprevalence countries including Japan. We encountered 2 cases of toxoplasmic encephalitis after transplantation that were successfully treated. The diagnosis of toxoplasmic encephalitis in these cases was confirmed by PCR testing when neurological symptoms were observed. Both patients received pyrimethamine and sulfadiazine treatments within 2 weeks of the development of neurological symptoms, and remained free of recurrence for 32 and 12 months. These results emphasized the importance of the PCR test and immediate treatment after diagnosis for the management of toxoplasmic encephalitis. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Removal of inhibitor(s) of the polymerase chain reaction from formalin fixed, paraffin wax embedded tissues.

    PubMed

    An, S F; Fleming, K A

    1991-11-01

    A problem associated with use of the polymerase chain reaction to amplify specific DNA fragments from formalin fixed, paraffin wax embedded tissues is the not infrequent failure of amplification. One possible reason for this could be the presence of inhibitor(s), which interfere with the activity of the reaction. It has been shown that such inhibitor(s) exist when amplifying the human beta globin gene (which exists in human genomic DNA as a single copy gene) from routine clinical samples. A variety of methods to remove such inhibitor(s) were investigated. The results indicate that inhibitor(s) are removed by proteinase K digestion, followed by purification with phenol/chloroform, and centrifugation through a Centricon-30 membrane (30,000 molecular weight cut off). Other factors, including the length and concentration of the DNA sequence to be amplified, can also affect amplification.

  17. Aspergillus vertebral osteomyelitis in chronic leukocyte leukemia patient diagnosed by a novel panfungal polymerase chain reaction method.

    PubMed

    Dayan, Lior; Sprecher, Hannah; Hananni, Amos; Rosenbaum, Hana; Milloul, Victor; Oren, Ilana

    2007-01-01

    Vertebral osteomyelitis and disciitis caused by Aspergillus spp is a rare event. Early diagnosis and early antifungal therapy are critical in improving the prognosis for these patients. The diagnosis of invasive fungal infections is, in many cases, not straightforward and requires invasive procedures so that histological examination and culture can be performed. Furthermore, current traditional microbiological tests (ie, cultures and stains) lack the sensitivity for diagnosis of invasive aspergillosis. To present a case of vertebral osteomyelitis caused by Aspergillus spp diagnosed using a novel polymerase chain reaction (PCR) assay. Case report. Aspergillus DNA was detected in DNA extracted from the necrotic bone tissue by using a "panfungal" PCR novel method. Treatment with voriconazole was started based on the diagnosis. Using this novel technique enabled us to diagnose accurately an unusual bone pathogen that requires a unique treatment.

  18. Relationship Between Ebola Virus Real-Time Quantitative Polymerase Chain Reaction-Based Threshold Cycle Value and Virus Isolation From Human Plasma.

    PubMed

    Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F

    2015-10-01

    We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  19. Analysis of raw meats and fats of pigs using polymerase chain reaction for Halal authentication.

    PubMed

    Aida, A A; Che Man, Y B; Wong, C M V L; Raha, A R; Son, R

    2005-01-01

    A method for species identification from pork and lard samples using polymerase chain reaction (PCR) analysis of a conserved region in the mitochondrial (mt) cytochrome b (cyt b) gene has been developed. Genomic DNA of pork and lard were extracted using Qiagen DNeasy(®) Tissue Kits and subjected to PCR amplification targeting the mt cyt b gene. The genomic DNA from lard was found to be of good quality and produced clear PCR products on the amplification of the mt cyt b gene of approximately 360 base pairs. To distinguish between species, the amplified PCR products were cut with restriction enzyme BsaJI resulting in porcine-specific restriction fragment length polymorphisms (RFLP). The cyt b PCR-RFLP species identification assay yielded excellent results for identification of pig species. It is a potentially reliable technique for detection of pig meat and fat from other animals for Halal authentication.

  20. Identification of the five human Plasmodium species including P. knowlesi by real-time polymerase chain reaction.

    PubMed

    Oddoux, O; Debourgogne, A; Kantele, A; Kocken, C H; Jokiranta, T S; Vedy, S; Puyhardy, J M; Machouart, M

    2011-04-01

    Recently, Plasmodium knowlesi has been recognised as the fifth Plasmodium species causing malaria in humans. Hundreds of human cases infected with this originally simian Plasmodium species have been described in Asian countries and increasing numbers are reported in Europe from travellers. The growing impact of tourism and economic development in South and Southeast Asia are expected to subsequently lead to a further increase in cases both among locals and among travellers. P. knowlesi is easily misidentified in microscopy as P. malariae or P. falciparum. We developed new primers for the rapid and specific detection of this species by low-cost real-time polymerase chain reaction (PCR) and added this method to an already existing panel of primers used for the molecular identification of the other four species in one reaction. Reference laboratories should now be able to identify undisputably and rapidly P. knowlesi, as it is a potentially fatal pathogen.

  1. Apparent polyploidization after gamma irradiation: pitfalls in the use of quantitative polymerase chain reaction (qPCR) for the estimation of mitochondrial and nuclear DNA gene copy numbers.

    PubMed

    Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard

    2013-05-30

    Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.

  2. Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation.

    PubMed

    Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum

    2014-08-01

    A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Peptostreptococcus micros in primary endodontic infections as detected by 16S rDNA-based polymerase chain reaction.

    PubMed

    Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton

    2003-02-01

    A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.

  4. Polymerase chain reaction technology as analytical tool in agricultural biotechnology.

    PubMed

    Lipp, Markus; Shillito, Raymond; Giroux, Randal; Spiegelhalter, Frank; Charlton, Stacy; Pinero, David; Song, Ping

    2005-01-01

    The agricultural biotechnology industry applies polymerase chain reaction (PCR) technology at numerous points in product development. Commodity and food companies as well as third-party diagnostic testing companies also rely on PCR technology for a number of purposes. The primary use of the technology is to verify the presence or absence of genetically modified (GM) material in a product or to quantify the amount of GM material present in a product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains. The document highlights the many areas to which attention must be paid in order to produce reliable test results. These include sample preparation, method validation, choice of appropriate reference materials, and biological and instrumental sources of error. The article also discusses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

  5. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

    PubMed

    Ririe, K M; Rasmussen, R P; Wittwer, C T

    1997-02-15

    A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

  6. Principles and applications of polymerase chain reaction in medical diagnostic fields: a review

    PubMed Central

    Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

    2009-01-01

    Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310

  7. Electrically controlled microvalves to integrate microchip polymerase chain reaction and capillary electrophoresis.

    PubMed

    Kaigala, Govind V; Hoang, Viet N; Backhouse, Christopher J

    2008-07-01

    Microvalves are key in realizing portable miniaturized diagnostic platforms. We present a scalable microvalve that integrates well with standard lab on a chip (LOC) implementations, yet which requires essentially no external infrastructure for its operation. This electrically controlled, phase-change microvalve is used to integrate genetic amplification and analysis via capillary electrophoresis--the basis of many diagnostics. The microvalve is actuated using a polymer (polyethylene glycol, PEG) that exhibits a large volumetric change between its solid and liquid phases. Both the phase change of the PEG and the genetic amplification via polymerase chain reaction (PCR) are thermally controlled using thin film resistive elements that are patterned using standard microfabrication methods. By contrast with many other valve technologies, these microvalves and their control interface scale down in size readily. The novelty here lies in the use of fully integrated microvalves that require only electrical connections to realize a portable and inexpensive genetic analysis platform.

  8. Dual phase multiplex polymerase chain reaction

    DOEpatents

    Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  9. Allele related mutation specific-polymerase chain reaction for rapid diagnosis of Hb New York (beta 113 (G15) Val-->Glu, beta(CD113 GTG-->GAG)).

    PubMed

    Viprakasit, Vip; Tachavanich, Kalaya; Suwantol, Lerlugsn; Pung-Amritt, Parichat; Chinchang, Worawut; Tanphaichitr, Voravarn S

    2002-08-01

    Hemoglobin New York (beta 113 (G15) Val-->Glu), a beta-globin variant, was first reported in a Chinese family living in New York. Subsequently, this abnormal hemoglobin was reported in many Chinese descendants from several groups and it was also known as Hb Kaohsiung. The subtle change in alpha1beta1 contact region apart from the heme group connecting area by Val-->Glu substitution has minor changes in both the electrophoretic mobility and stability making this hemoglobin variant difficult to distinguish from Hb A using routine hemoglobin analysis. The authors described a case of heterozygosity of Hb New York diagnosed by a molecular technique and revealed a mutation in beta(CD113 GTG-->GAG). A novel Allele Related Mutation Specific-Polymerase Chain Reaction (ARMS-PCR) for rapid diagnosis of this mutation has been proposed.

  10. Theory and applications of the polymerase chain reaction.

    PubMed

    Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

    1990-04-01

    The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

  11. Capillary sample introduction of polymerase chain reaction (PCR) products separated in ultrathin slab gels.

    PubMed

    Bullard, K M; Hietpas, P B; Ewing, A G

    1998-01-01

    Polymerase chain reaction (PCR) amplified short tandem repeat (STR) samples from the HUMVWF locus have been analyzed using a unique sample introduction and separation technique. A single capillary is used to transfer samples onto an ultrathin slab gel (57 microm thin). This ultrathin nondenaturing polyacrylamide gel is used to separate the amplified fragments, and laser-induced fluorescence with ethidium bromide is used for detection. The feasibility of performing STR analysis using this system has been investigated by examining the reproducibility for repeated samples. Reproducibility is examined by comparing the migration of the 14 and 17 HUMVWF alleles on three consecutive separations on the ultrathin slab gel. Using one locus, separations match in migration time with the two alleles 42 s apart for each of the three consecutive separations. This technique shows potential to increase sample throughput in STR analysis techniques although separation resolution still needs to be improved.

  12. International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method.

    PubMed

    Jacchia, Sara; Nardini, Elena; Bassani, Niccolò; Savini, Christian; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

    2015-05-27

    This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3' junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in haploid genome equivalents. We assessed trueness, precision, efficiency, and linearity of the two assays, and the results demonstrate that both the assays independently assessed and the entire method fulfill European and international requirements for methods for genetically modified organism (GMO) testing, within the dynamic range tested. The homogeneity of the results of the collaborative trial between Europe and Asia is a good indicator of the robustness of the method.

  13. Development of a peptide nucleic acid polymerase chain reaction clamping assay for semiquantitative evaluation of genetically modified organism content in food.

    PubMed

    Peano, C; Lesignoli, F; Gulli, M; Corradini, R; Samson, M C; Marchelli, R; Marmiroli, N

    2005-09-15

    In the present study a peptide nucleic acid (PNA)-mediated polymerase chain reaction (PCR) clamping method was developed and applied to the detection of genetically modified organisms (GMO), to test PCR products for band identity and to obtain a semiquantitative evaluation of GMO content. The minimal concentration of PNA necessary to block the PCR was determined by comparing PCRs containing a constant amount of DNA in the presence of increasing concentration of target-specific PNA. The lowest PNA concentration at which specific inhibition took place, by the inhibition of primer extension and/or steric hindrance, was the most efficient condition. Optimization of PCR clamping by PNA was observed by testing five different PNAs with a minimum of 13 bp to a maximum of 15 bp, designed on the target sequence of Roundup Ready soybean. The results obtained on the DNA extracted from Roundup Ready soybean standard flour were verified also on DNA extracted from standard flours of maize GA21, Bt176, Bt11, and MON810. A correlation between the PNA concentration necessary for inducing PCR clamping and the percentage of the GMO target sequence in the sample was found.

  14. Focal posterior pole viral retinitis.

    PubMed

    Hazirolan, Dicle; Sungur, Gulten; Demir, Necati; Kasim, Remzi; Duman, Sunay

    2010-01-01

    To describe the clinical features of an atypical form of viral retinitis in immunocompetent patients. This was a retrospective noncomparative case series. The charts of 8 patients diagnosed with and treated for focal posterior viral retinitis were reviewed. Clinical and demographic features were evaluated. All the patients had extensive laboratory tests, fundus fluorescein angiography, optical coherence tomography of macula, and polymerase chain reaction of vitreous. All the patients were referred to our Uveitis Service from other hospitals, as their uveitis symptoms deteriorated in spite of treatment. The mean age of 4 male and 4 female patients was 32.1 years (range, 22-42 years). The mean follow-up period was 10 months (range, 6-18 months). All of the patients had unilateral disease. Polymerase chain reaction analysis of vitreous specimen was positive for herpes simplex virus-1 in 5 patients and varicella zoster virus in 3 patients. Retinitis resolved after systemic acyclovir treatment in all patients. Viral etiology must be borne in mind in the differential diagnosis of atypical retinitis. It can be a milder form of viral retinitis like focal viral retinitis, as mentioned in this study. The prognosis of this disease is better than the other forms of necrotizing retinopathies involving a larger area of retina.

  15. Detecting Malaria Hotspots: A Comparison of Rapid Diagnostic Test, Microscopy, and Polymerase Chain Reaction

    PubMed Central

    Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip

    2017-01-01

    Abstract Background Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. Methods We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Results Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Conclusion Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. PMID:28973672

  16. The value of routine polymerase chain reaction analysis of intraocular fluid specimens in the diagnosis of infectious posterior uveitis.

    PubMed

    Scheepers, Marius A; Lecuona, Karin A; Rogers, Graeme; Bunce, Catey; Corcoran, Craig; Michaelides, Michel

    2013-01-01

    To assess the value of routine polymerase chain reaction (PCR) analysis on intraocular fluid from patients presenting with a first episode of suspected active infectious posterior uveitis in a population with a high prevalence of human immunodeficiency virus infection. Retrospective, interventional case series. Participants. 159 consecutive patients presenting at a tertiary care hospital over a five-year period. PCR analysis was performed for cytomegalovirus, varicella zoster virus, herpes simplex virus types 1 and 2, Toxoplasma gondii, and Mycobacterium tuberculosis. PCR analysis confirmed the initial clinical diagnosis in 55 patients (35%) and altered the initial clinical diagnosis in 36 patients (23%). The clinical diagnosis prior to PCR testing was nonspecific (uncertain) in 51 patients (32%), with PCR providing a definitive final diagnosis in 20 of these patients (39%); necrotizing herpetic retinopathy and ocular toxoplasmosis were particularly difficult to diagnose correctly without the use of PCR analysis. The clinical phenotype alone was unreliable in diagnosing the underlying infectious cause in a quarter of patients in this study. Since the outcome of incorrectly treated infective uveitis can be blinding, PCR analysis of ocular fluids is recommended early in the disease even in resource poor settings.

  17. Short-term application of dexamethasone on stem cells derived from human gingiva reduces the expression of RUNX2 and β-catenin.

    PubMed

    Kim, Bo-Bae; Kim, Minji; Park, Yun-Hee; Ko, Youngkyung; Park, Jun-Beom

    2017-06-01

    Objective Next-generation sequencing was performed to evaluate the effects of short-term application of dexamethasone on human gingiva-derived mesenchymal stem cells. Methods Human gingiva-derived stem cells were treated with a final concentration of 10 -7  M dexamethasone and the same concentration of vehicle control. This was followed by mRNA sequencing and data analysis, gene ontology and pathway analysis, quantitative real-time polymerase chain reaction of mRNA, and western blot analysis of RUNX2 and β-catenin. Results In total, 26,364 mRNAs were differentially expressed. Comparison of the results of dexamethasone versus control at 2 hours revealed that 7 mRNAs were upregulated and 25 mRNAs were downregulated. The application of dexamethasone reduced the expression of RUNX2 and β-catenin in human gingiva-derived mesenchymal stem cells. Conclusion The effects of dexamethasone on stem cells were evaluated with mRNA sequencing, and validation of the expression was performed with qualitative real-time polymerase chain reaction and western blot analysis. The results of this study can provide new insights into the role of mRNA sequencing in maxillofacial areas.

  18. Usefulness of quantitative polymerase chain reaction in amniotic fluid as early prognostic marker of fetal infection with Toxoplasma gondii.

    PubMed

    Romand, Stéphane; Chosson, Muriel; Franck, Jacqueline; Wallon, Martine; Kieffer, François; Kaiser, Karine; Dumon, Henri; Peyron, François; Thulliez, Philippe; Picot, Stéphane

    2004-03-01

    Our purpose was to evaluate Toxoplasma gondii concentration in amniotic fluid (AF) samples as a prognostic marker of congenital toxoplasmosis. A retrospective study was carried out in 88 consecutive AF samples from 86 pregnant women, which were found positive by prospective polymerase chain reaction (PCR) testing. Parasite AF concentrations were estimated by real-time quantitative PCR and analyzed in relation to the clinical outcome of infected fetuses during pregnancy and at birth, taking into account the gestational age at maternal infection. A significant negative linear regression was observed between gestational age at maternal infection and T gondii DNA loads in AF. After adjusting for time at maternal seroconversion by multivariate analysis, higher parasite concentrations were significantly associated with a severe outcome of congenital infection (odds ratio [OR]=15.38/log (parasites/mL AF) [95% CI=2.45-97.7]). PCR quantification of T gondii in AF can be highly contributive for early prognosis of congenital toxoplasmosis. Maternal infections acquired before 20 weeks with a parasite load greater than 100/mL of AF have the highest risk of severe fetal outcome.

  19. Randomized, Prospective, Three-Arm Study to Confirm the Auditory Safety and Efficacy of Artemether-Lumefantrine in Colombian Patients with Uncomplicated Plasmodium falciparum Malaria

    PubMed Central

    Carrasquilla, Gabriel; Barón, Clemencia; Monsell, Edwin M.; Cousin, Marc; Walter, Verena; Lefèvre, Gilbert; Sander, Oliver; Fisher, Laurel M.

    2012-01-01

    The safety of artemether-lumefantrine in patients with acute, uncomplicated Plasmodium falciparum malaria was investigated prospectively using the auditory brainstem response (ABR) and pure-tone thresholds. Secondary outcomes included polymerase chain reaction-corrected cure rates. Patients were randomly assigned in a 3:1:1 ratio to either artemether-lumefantrine (N = 159), atovaquone-proguanil (N = 53), or artesunate-mefloquine (N = 53). The null hypothesis (primary outcome), claiming that the percentage of patients with a baseline to Day-7 ABR Wave III latency increase of > 0.30 msec is ≥ 15% after administration of artemether-lumefantrine, was rejected; 2.6% of patients (95% confidence interval: 0.7–6.6) exceeded 0.30 msec, i.e., significantly below 15% (P < 0.0001). A model-based analysis found no apparent relationship between drug exposure and ABR change. In all three groups, average improvements (2–4 dB) in pure-tone thresholds were observed, and polymerase chain reaction-corrected cure rates were > 95% to Day 42. The results support the continued safe and efficacious use of artemether-lumefantrine in uncomplicated falciparum malaria. PMID:22232454

  20. Late-onset Papillon-Lefèvre syndrome without alteration of the cathepsin C gene.

    PubMed

    Pilger, Ulrike; Hennies, Hans Christian; Truschnegg, Astrid; Aberer, Elisabeth

    2003-11-01

    Mutations in the cathepsin C gene have recently been detected in Papillon-Lefèvre syndrome (PLS). Until now, 5 cases with the late-onset variation of this disease have been reported in the literature. The genetic background of this type of PLS is still unknown. We describe a 46-year-old woman with late-onset transgredient palmar hyperkeratosis and a 10-year history of severe periodontal disease. Histology of skin biopsy specimens revealed a psoriasiform pattern. Dental examination showed severe gingival inflammation with loss of alveolar bone. Dental plaque investigated by a polymerase chain reaction method revealed DNA signals of 5 different dental bacteria. DNA from EDTA blood was investigated for mutations in the cathepsin C gene by polymerase chain reaction analysis and direct sequencing. A silent variation in the codon for proline-459 was detected but interpreted as a polymorphism of this gene. All genetic linkage and mutation studies for PLS performed so far have shown that PLS is genetically homogeneous. Our patient with late-onset variation of PLS, however, did not show a mutation in the cathepsin C gene. Thus, we suspect that there is another genetic cause for the late-onset forms of PLS.

  1. Expression of Fra-1 in human hepatocellular carcinoma and its prognostic significance.

    PubMed

    Gao, Xiao-Qiang; Ge, Yong-Sheng; Shu, Qing-Hua; Ma, Hua-Xing

    2017-06-01

    This study aimed to explore the clinical significance and prognostic value of Fra-1 in hepatocellular carcinoma patients after curative resection. Fra-1 expression was investigated using a combination of techniques: immunohistochemistry for 66 samples of hepatocellular carcinoma and quantitative real-time polymerase chain reaction and western blotting assays for 19 matched hepatocellular carcinoma specimens. Fra-1 was present in 38 of 66 (57.6%) tumor tissues, with intense staining in the nuclei. There was also positive staining in 14 of 66 (21.2%) adjacent peritumoral tissues, with weak staining in the cytoplasm. Quantitative real-time polymerase chain reaction and western blotting assays confirmed higher expression of Fra-1 messenger RNA and Fra-1 protein in tumor tissues than adjacent non-tumor tissues for 19 hepatocellular carcinoma samples (p < 0.001). Positive expression of Fra-1 was significantly related to vascular invasion and serum alpha-fetoprotein. Kaplan-Meier survival analysis found that overexpressed Fra-1 was correlated with poor overall survival and disease-free survival. Multivariate analysis identified Fra-1 as an independent prognostic factor. Fra-1 may be involved in the progress of hepatocellular carcinoma and could be a promising molecular candidate in the diagnosis and treatment of hepatocellular carcinoma.

  2. Development of an Escherichia coli K12-specific quantitative polymerase chain reaction assay and DNA isolation suited to biofilms associated with iron drinking water pipe corrosion products.

    PubMed

    Lu, Jingrang; Gerke, Tammie L; Buse, Helen Y; Ashbolt, Nicholas J

    2014-12-01

    A quantitative polymerase chain reaction assay (115 bp amplicon) specific to Escherichia coli K12 with an ABI(TM) internal control was developed based on sequence data encoding the rfb gene cluster. Assay specificity was evaluated using three E. coli K12 strains (ATCC W3110, MG1655 & DH1), 24 non-K12 E. coli and 23 bacterial genera. The biofilm detection limit was 10(3) colony-forming units (CFU) E. coli K12 mL(-1), but required a modified protocol, which included a bio-blocker Pseudomonas aeruginosa with ethylenediaminetetraacetic acid buffered to pH 5 prior to cell lysis/DNA extraction. The novel protocol yielded the same sensitivity for drinking water biofilms associated with Fe3O4 (magnetite)-coated SiO2 (quartz) grains and biofilm-surface iron corrosion products from a drinking water distribution system. The novel DNA extraction protocol and specific E. coli K12 assay are sensitive and robust enough for detection and quantification within iron drinking water pipe biofilms, and are particularly well suited for studying enteric bacterial interactions within biofilms.

  3. Randomized, prospective, three-arm study to confirm the auditory safety and efficacy of artemether-lumefantrine in Colombian patients with uncomplicated Plasmodium falciparum malaria.

    PubMed

    Carrasquilla, Gabriel; Barón, Clemencia; Monsell, Edwin M; Cousin, Marc; Walter, Verena; Lefèvre, Gilbert; Sander, Oliver; Fisher, Laurel M

    2012-01-01

    The safety of artemether-lumefantrine in patients with acute, uncomplicated Plasmodium falciparum malaria was investigated prospectively using the auditory brainstem response (ABR) and pure-tone thresholds. Secondary outcomes included polymerase chain reaction-corrected cure rates. Patients were randomly assigned in a 3:1:1 ratio to either artemether-lumefantrine (N = 159), atovaquone-proguanil (N = 53), or artesunate-mefloquine (N = 53). The null hypothesis (primary outcome), claiming that the percentage of patients with a baseline to Day-7 ABR Wave III latency increase of > 0.30 msec is ≥ 15% after administration of artemether-lumefantrine, was rejected; 2.6% of patients (95% confidence interval: 0.7-6.6) exceeded 0.30 msec, i.e., significantly below 15% (P < 0.0001). A model-based analysis found no apparent relationship between drug exposure and ABR change. In all three groups, average improvements (2-4 dB) in pure-tone thresholds were observed, and polymerase chain reaction-corrected cure rates were > 95% to Day 42. The results support the continued safe and efficacious use of artemether-lumefantrine in uncomplicated falciparum malaria.

  4. Detection of medically important Candida species by absolute quantitation real-time polymerase chain reaction.

    PubMed

    Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong

    2015-01-01

    The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.

  5. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

    PubMed

    Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Selection of suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using quantitative real-time polymerase chain reaction.

    PubMed

    Zornhagen, K W; Kristensen, A T; Hansen, A E; Oxboel, J; Kjaer, A

    2015-12-01

    Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours. The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm was used to analyse the most suitable reference genes. Eight potential reference genes were excluded from this final analysis because of their dissociation curves. β-Glucuronidase (GUSB) and proteasome subunit, beta type, 6 (PSMB6) were most stably expressed with an M value of 0.154 and a CV of 0.053 describing their average stability. We suggest that choice of reference genes should be based on specific testing in every new experimental set-up. © 2014 John Wiley & Sons Ltd.

  7. Tumour necrosis factor-alpha polymorphism as one of the complex inherited factors in pemphigus.

    PubMed Central

    Torzecka, Jolanta Dorota; Narbutt, Joanna; Sysa-Jedrzejowska, Anna; Borowiec, Maciej; Ptasinska, Anetta; Woszczek, Grzegorz; Kowalski, Marek L

    2003-01-01

    The aim of our study was to analyse a significance of tumour necrosis factor (TNF)-alpha promoter gene polymorphisms in relation to the HLA-DR locus in genetic predisposition to pemphigus. TNF-alpha gene polymorphisms in position -238 and -308 were identified using a modified polymerase chain reaction-restriction fragment length polymorphism method in 53 patients with pemphigus (38 with pemphigus vulgaris, 15 with pemphigus foliaceus) and 87 healthy controls. The HLA-DRB1 locus was typed using the polymerase chain reaction SSO method in all the patients and 152 population controls. Carriers of the TNF-alpha polymorphic -308 A allele were found to be more frequent in the pemphigus foliaceus group in comparison with the control group (odds ratio (OR) = 8.12; p = 0.0005). A significant association between HLA-DRB1*04 (OR = 3.86; pcor = 0.0001) and DRB1*14 (OR = 8.4; pcor = 0.0001) and pemphigus vulgaris was found. In this group of patients a decreased frequency of HLA-DRB1*07 (OR = 0.08; pcor = 0.006) was also identified. We have shown for the first time a positive association of TNF-alpha polymorphism in position -308 with pemphigus foliaceus. PMID:14760938

  8. A nested multiplex polymerase chain reaction assay for the differential identification of three zooanthroponotic chlamydial strains in porcine swab samples.

    PubMed

    Li, Yingguo; Wang, Yu; Nie, Fuping; Xiao, Jinwen; Wang, Guoming; Yuan, Ling; Li, Zhengguo

    2011-07-01

    Porcine chlamydial infection is an enzootic infectious disease caused by multiple members of the family Chlamydiaceae (e.g. Chlamydophila abortus, Chlamydia suis, and Chlamydophila pneumoniae). Rapid and accurate differentiation of these pathogens is critical in the control and prevention of disease. The aim of the current study was to develop a nested multiplex polymerase chain reaction (nmPCR) assay to simultaneously detect the 3 chlamydial pathogens in clinical samples. In the first round of the nmPCR, 1 pair of family-specific primers were used to amplify the 1,100 base pair (bp) fragment of chlamydial ompA gene. In the second round of the nmPCR, 4 inner primers were designed for Ch. abortus, C. suis, and Ch. pneumoniae. Each pathogen produced a specific amplicon with a size of 340 bp, 526 bp, and 267 bp respectively. The assay was sensitive and specific for detecting target pathogens in both cell cultures and clinical specimens. The results, incorporated with the improved rapid DNA extraction protocol, suggest that the nmPCR could be a promising assay for differential identification of different chlamydial strains in pigs.

  9. Serine proteases in rodent hippocampus.

    PubMed

    Davies, B J; Pickard, B S; Steel, M; Morris, R G; Lathe, R

    1998-09-04

    Brain serine proteases are implicated in developmental processes, synaptic plasticity, and in disorders including Alzheimer's disease. The spectrum of the major enzymes expressed in brain has not been established previously. We now present a systematic study of the serine proteases expressed in adult rat and mouse hippocampus. Using a combination of techniques including polymerase chain reaction amplification and Northern blotting we show that tissue-type plasminogen activator (t-PA) is the major species represented. Unexpectedly, the next most abundant species were RNK-Met-1, a lymphocyte protease not reported previously in brain, and two new family members, BSP1 (brain serine protease 1) and BSP2. We report full-length sequences of the two new proteases; homologies indicate that these are of tryptic specificity. Although BSP2 is expressed in several brain regions, BSP1 expression is strikingly restricted to hippocampus. Other enzymes represented, but at lower levels, included elastase IV, proteinase 3, complement C2, chymotrypsin B, chymotrypsin-like protein, and Hageman factor. Although thrombin and urokinase-type plasminogen activator were not detected in the primary screen, low level expression was confirmed using specific polymerase chain reaction primers. In contrast, and despite robust expression of t-PA, the usual t-PA substrate plasminogen was not expressed at detectable levels.

  10. Tumour necrosis factor-alpha polymorphism as one of the complex inherited factors in pemphigus.

    PubMed

    Torzecka, Jolanta Dorota; Narbutt, Joanna; Sysa-Jedrzejowska, Anna; Borowiec, Maciej; Ptasinska, Anetta; Woszczek, Grzegorz; Kowalski, Marek L

    2003-10-01

    The aim of our study was to analyse a significance of tumour necrosis factor (TNF)-alpha promoter gene polymorphisms in relation to the HLA-DR locus in genetic predisposition to pemphigus. TNF-alpha gene polymorphisms in position -238 and -308 were identified using a modified polymerase chain reaction-restriction fragment length polymorphism method in 53 patients with pemphigus (38 with pemphigus vulgaris, 15 with pemphigus foliaceus) and 87 healthy controls. The HLA-DRB1 locus was typed using the polymerase chain reaction SSO method in all the patients and 152 population controls. Carriers of the TNF-alpha polymorphic -308 A allele were found to be more frequent in the pemphigus foliaceus group in comparison with the control group (odds ratio (OR) = 8.12; p = 0.0005). A significant association between HLA-DRB1*04 (OR = 3.86; pcor = 0.0001) and DRB1*14 (OR = 8.4; pcor = 0.0001) and pemphigus vulgaris was found. In this group of patients a decreased frequency of HLA-DRB1*07 (OR = 0.08; pcor = 0.006) was also identified. We have shown for the first time a positive association of TNF-alpha polymorphism in position -308 with pemphigus foliaceus.

  11. Detection by hemi-nested reverse transcription polymerase chain reaction and genetic characterization of wild type strains of Canine distemper virus in suspected infected dogs.

    PubMed

    Di Francesco, Cristina E; Di Francesco, Daniela; Di Martino, Barbara; Speranza, Roberto; Santori, Domenico; Boari, Andrea; Marsilio, Fulvio

    2012-01-01

    A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-PCR) assay was applied to detect nucleoprotein (NP) gene of Canine distemper virus (CDV) in samples collected from dogs showing respiratory, gastrointestinal, and neurological signs. Thirty-eight out of 86 samples were positive suggesting that despite the vaccination, canine distemper may still represent a high risk to the canine population. The 968 base pair (bp) fragments from the hemagglutinin (H) gene of 10 viral strains detected in positive samples were amplified and analyzed by restriction fragment length polymorphism (RFLP) using AluI and PsiI enzymes in order to differentiate among vaccine and wild-type CDV strains and to characterize the field viral strains. The products of the both enzymatic digestions allowed identification all viruses as wild strains of CDV. In addition, the RFLP analysis with AluI provided additional information about the identity level among the strains analyzed on the basis of the positions of the cleavage site in the nucleotide sequences of the H gene. The method could be a more useful and simpler method for molecular studies of CDV strains.

  12. Accuracy of mucocutaneous leishmaniasis diagnosis using polymerase chain reaction: systematic literature review and meta-analysis

    PubMed Central

    Gomes, Ciro Martins; Mazin, Suleimy Cristina; dos Santos, Elisa Raphael; Cesetti, Mariana Vicente; Bächtold, Guilherme Albergaria Brízida; Cordeiro, João Henrique de Freitas; Theodoro, Fabrício Claudino Estrela Terra; Damasco, Fabiana dos Santos; Carranza, Sebastián Andrés Vernal; Santos, Adriana de Oliveira; Roselino, Ana Maria; Sampaio, Raimunda Nonata Ribeiro

    2015-01-01

    The diagnosis of mucocutaneous leishmaniasis (MCL) is hampered by the absence of a gold standard. An accurate diagnosis is essential because of the high toxicity of the medications for the disease. This study aimed to assess the ability of polymerase chain reaction (PCR) to identify MCL and to compare these results with clinical research recently published by the authors. A systematic literature review based on the Preferred Reporting Items for Systematic Reviews and Meta-Analyses: the PRISMA Statement was performed using comprehensive search criteria and communication with the authors. A meta-analysis considering the estimates of the univariate and bivariate models was performed. Specificity near 100% was common among the papers. The primary reason for accuracy differences was sensitivity. The meta-analysis, which was only possible for PCR samples of lesion fragments, revealed a sensitivity of 71% [95% confidence interval (CI) = 0.59; 0.81] and a specificity of 93% (95% CI = 0.83; 0.98) in the bivariate model. The search for measures that could increase the sensitivity of PCR should be encouraged. The quality of the collected material and the optimisation of the amplification of genetic material should be prioritised. PMID:25946238

  13. Characterization of fecal microbiota across seven Chinese ethnic groups by quantitative polymerase chain reaction.

    PubMed

    Kwok, Lai-yu; Zhang, Jiachao; Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping

    2014-01-01

    The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.

  14. Methicillin-resistant Staphylococcus sp. colonizing health care workers of a cancer hospital

    PubMed Central

    Costa, Dayane de Melo; Kipnis, André; Leão-Vasconcelos, Lara Stefânia Netto de Oliveira; Rocha-Vilefort, Larissa Oliveira; Telles, Sheila Araújo; André, Maria Cláudia Dantas Porfírio Borges; Tipple, Anaclara Ferreira Veiga; Lima, Ana Beatriz Mori; Ribeiro, Nádia Ferreira Gonçalves; Pereira, Mayara Regina; Prado-Palos, Marinésia Aparecida

    2014-01-01

    The aim of the study was to analyze epidemiological and microbiological aspects of oral colonization by methicillin-resistant Staphylococcus of health care workers in a cancer hospital. Interview and saliva sampling were performed with 149 health care workers. Antimicrobial resistance was determined by disk diffusion and minimum inhibitory concentration. Polymerase Chain Reaction, Internal Transcribed Spacer-Polymerase Chain Reaction and Pulsed Field Gel Electrophoresis were performed for genotypic characterization of methicillin-resistant Staphylococcus. Risk factors were determined by logistic regression. Methicillin-resistant Staphylococcus colonization prevalence was 19.5%, denture wearing (p = 0.03), habit of nail biting (p = 0.04) and preparation and administration of antimicrobial (p = 0.04) were risk factors identified. All methicillin-resistant Staphylococcus were S. epidermidis, 94.4% of them had mecA gene. Closely related and indistinguishable methicillin-resistant S. epidermidis were detected. These results highlight that HCWs which have contact with patient at high risk for developing infections were identified as colonized by MRSE in the oral cavity, reinforcing this cavity as a reservoir of these bacteria and the risk to themselves and patients safety, because these microorganisms may be spread by coughing and talking. PMID:25477910

  15. Application and Comparative Evaluation of Fluorescent Antibody, Immunohistochemistry and Reverse Transcription Polymerase Chain Reaction Tests for the Detection of Rabies Virus Antigen or Nucleic Acid in Brain Samples of Animals Suspected of Rabies in India.

    PubMed

    Prabhu, K Nithin; Isloor, Shrikrishna; Veeresh, B Hanchinal; Rathnamma, Doddamane; Sharada, R; Das, Lekshmi J; Satyanarayana, M L; Hegde, Nagendra R; Rahman, Sira Abdul

    2018-02-28

    Accurate and early diagnosis of animal rabies is critical for undertaking public health measures. Whereas the direct fluorescent antibody (DFA) technique is the recommended test, the more convenient, direct rapid immunochemistry test (dRIT), as well as the more sensitive, reverse transcription polymerase chain reaction (RT-PCR), have recently been employed for the laboratory diagnosis of rabies. We compared the three methods on brain samples from domestic (dog, cat, cattle, buffalo, horse, pig and goat) and wild (leopard, wolf and jackal) animals from various parts of India. Of the 257 samples tested, 167 were positive by all the three tests; in addition, 35 of the 36 decomposed samples were positive by RT-PCR. This is the first study in which such large number of animal samples have been subjected to the three tests simultaneously. The results confirm 100% corroboration between DFA and dRIT, buttress the applicability of dRIT in the simple and rapid diagnosis of rabies in animals, and reaffirm the suitability of RT-PCR for samples unfit for testing either by DFA or dRIT.

  16. Detection of alveolar rhabdomyosarcoma in pleural fluid with immunocytochemistry on cell block and determination of PAX/FKHR fusion mRNA by reverse transcription-polymerase chain reaction.

    PubMed

    Sawangpanich, Ruchchadol; Larbcharoensub, Noppadol; Jinawath, Artit; Pongtippan, Atcharaporn; Anurathapan, Usanarat; Hongeng, Suradej

    2011-11-01

    Alveolar rhabdomyosarcoma is a primitive malignant round cell neoplasm, which shows skeletal muscle differentiation. Although their histopathologic and immunohistochemical findings are well known, the cytology, immunocytochemistry and molecular study on pleural effusion have not been well documented. To apply molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma. The case of a 14-year-old Thai male, who presented with dyspnea and left pleural effusion. Computed tomography of the chest and abdomen showed a huge heterogeneous enhancing mass at the left retroperitoneum. Pleural fluid cytology showed malignant small round blue cells. Immunocytochemical stains on cell block material showed positive reactivity to vimentin, sarcomeric actin, desmin, MyoD1, myogenin, and CD56 in round cell tumor Reverse transcription-polymerase chain reaction (RT-PCR) demonstrated PAX/FKHR fusion transcript. The patient received chemotherapeutic regimen for advanced-stage rhabdomyosarcoma. Finally, he succumbed to the disease, thirteen months after the diagnosis. Immunocytochemistry on cell block in conjunction with determination of PAX/FKHR fusion mRNA by RT-PCR is a molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma inpleural fluid.

  17. Characterization of Fecal Microbiota across Seven Chinese Ethnic Groups by Quantitative Polymerase Chain Reaction

    PubMed Central

    Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping

    2014-01-01

    The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota. PMID:24699404

  18. Expression and function of CD8 alpha/beta chains on rat and human mast cells.

    PubMed

    Kim, Mi-Sun; Kim, Sung-Hoon; Lee, Hye-Jung; Kim, Hyung-Min

    2004-03-01

    The expression and functional role of CD8 glycoprotein, a marker of cytotoxic/suppressor T lymphocytes and NK cells, were not studied on freshly isolated connective tissue type rat peritoneal mast cells, a rat mucosal type mast cell line (RBL 2H3), or human mast cell line (HMC-1). We used the reverse transcription-polymerase chain reaction (RT-PCR) and Western blot analysis, immunohistochemistry and enzyme-linked immunosorbent assay. RT-PCR and Western blot analysis identified the presence of CD8 alpha/beta chains on the mast cells, and immunohistochemistry confirmed CD8alpha expression on rat or human mast cells. Functional studies demonstrated that stimulation of CD8 alpha/beta chains on rat mast cells induced the secretion of tumor necrosis factor-alpha (TNF-alpha) and interleukin-6 (IL-6), which are regarded as important mediators during infection. However, co-stimulation with stem cell factor had no effect on CD8-induced mediator secretion. Our findings demonstrate novel biological roles of CD8 molecules in mast cells.

  19. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis.

    PubMed

    Peeters, M; Huang, C L; Vonk, L A; Lu, Z F; Bank, R A; Helder, M N; Doulabi, B Zandieh

    2016-11-01

    Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised.Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016;5:560-568. DOI: 10.1302/2046-3758.511.BJR-2016-0033.R3. © 2016 Peeters et al.

  20. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis

    PubMed Central

    Peeters, M.; Huang, C. L.; Vonk, L. A.; Lu, Z. F.; Bank, R. A.; Doulabi, B. Zandieh

    2016-01-01

    Objectives Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Materials and Methods Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. Results No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. Conclusion For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised. Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016;5:560–568. DOI: 10.1302/2046-3758.511.BJR-2016-0033.R3. PMID:27881439

  1. Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

    PubMed

    Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

    2017-09-01

    The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species. Nevertheless, to accurately differentiate among the taxonomically related species, PCR-RFLP should be implemented.

  2. Proteomic identification of potential biomarkers for cervical squamous cell carcinoma and human papillomavirus infection.

    PubMed

    Qing, Song; Tulake, Wuniqiemu; Ru, Mingfang; Li, Xiaohong; Yuemaier, Reziwanguli; Lidifu, Dilare; Rouzibilali, Aierken; Hasimu, Axiangu; Yang, Yun; Rouziahong, Reziya; Upur, Halmurat; Abudula, Abulizi

    2017-04-01

    It is known that high-risk human papillomavirus infection is the main etiological factor in cervical carcinogenesis. However, human papillomavirus screening is not sufficient for early diagnosis. In this study, we aimed to identify potential biomarkers common to cervical carcinoma and human papillomavirus infection by proteomics for human papillomavirus-based early diagnosis and prognosis. To this end, we collected 76 cases of fresh cervical tissues and 116 cases of paraffin-embedded tissue slices, diagnosed as cervical squamous cell carcinoma, cervical intraepithelial neoplasia II-III, or normal cervix from ethnic Uighur and Han women. Human papillomavirus infection by eight oncogenic human papillomavirus types was detected in tissue DNA samples using a quantitative polymerase chain reaction. The protein profile of cervical specimens from human papillomavirus 16-positive squamous cell carcinoma and human papillomavirus-negative normal controls was analyzed by proteomics and bioinformatics. The expression of candidate proteins was further determined by quantitative reverse transcriptase-polymerase chain reaction and immunohistochemistry. We identified 67 proteins that were differentially expressed in human papillomavirus 16-positive squamous cell carcinoma compared to normal cervix. The quantitative reverse transcriptase-polymerase chain reaction analysis verified the upregulation of ASAH1, PCBP2, DDX5, MCM5, TAGLN2, hnRNPA1, ENO1, TYPH, CYC, and MCM4 in squamous cell carcinoma compared to normal cervix ( p < 0.05). In addition, the transcription of PCBP2, MCM5, hnRNPA1, TYPH, and CYC was also significantly increased in cervical intraepithelial neoplasia II-III compared to normal cervix. Immunohistochemistry staining further confirmed the overexpression of PCBP2, hnRNPA1, ASAH1, and DDX5 in squamous cell carcinoma and cervical intraepithelial neoplasia II-III compared to normal controls ( p < 0.05). Our data suggest that the expression of ASAH1, PCBP2, DDX5, and hnRNPA1, and possibly MCM4, MCM5, CYC, ENO1, and TYPH, is upregulated during cervical carcinogenesis and potentially associated with human papillomavirus infection. Further validation studies of the profile will contribute to establishing auxiliary diagnostic markers for human papillomavirus-based cancer prognosis.

  3. Differentiating Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii using nested polymerase chain reaction (PCR) in rural communities in Malaysia

    PubMed Central

    2012-01-01

    Background In this study, a total of 426 human faecal samples were examined for the presence of Entamoeba histolytica, Entamoeba dispar, Entamoeba moshkovskii infection via a combination of microscopic examination and nested polymerase chain reaction (PCR) targeting 16S ribosomal RNA of Entamoeba species. Methods Faecal sample were collected from 426 participants in five rural villages in Peninsular Malaysia. The faecal samples were processed by direct wet smear and formalin ethyl acetate concentration technique followed by iodine staining and examined via microscopy for the presence of Entamoeba species and other intestinal parasites. Microscopically positive samples for Entamoeba species cysts were further characterized using a Nested Polymerase Chain Reaction (Nested-PCR) targeting 16S-like ribosomal RNA gene. The data entry and analysis was carried out using the SPSS software (Statistical Package for the Social Sciences) program for Windows version 17 (SPSS, Chicago, IL, USA). Results Based on single faecal examination, overall prevalence of Entamoeba infection was 17.6% (75/426). Females (19.1%) were more commonly infected compared to males (15.9%). Comparison by age groups showed that adults (23.9%) had higher infection rates than children (15.3%). The PCR results showed that 52 out of 75 microscopy positive samples successfully generated species-specific amplicons. The infection with E. histolytica (75.0%; 39/52) was the most common, followed by E. dispar (30.8%; 18/52) and E. moshkovskii (5.8%; 3/52). Of these, 33 (63.5%) were shown to contain only E. histolytica, 10 (19.2%) contained E. dispar and 3 (5.8%) contained only E. moshkovskii. Mixed infection with E. histolytica and E. dispar was found in 6 (11.5%) samples. Conclusions The present study essentially emphasized the benefit of molecular techniques in discriminating the pathogenic Entamoeba species from the non-pathogenic for accurate diagnosis and better management of amoebiasis. The presence of E. moshkovskii is of great public health concern as it was the first time it has been reported in Malaysia. PMID:22947430

  4. Selective amplification of T-cell receptor variable region species is demonstrable but not essential in early lesions of psoriasis vulgaris: analysis by anchored polymerase chain reaction and hypervariable region size spectratyping.

    PubMed

    Vekony, M A; Holder, J E; Lee, A J; Horrocks, C; Eperon, I C; Camp, R D

    1997-07-01

    Several groups have investigated the role of T cells in the pathogenesis of psoriasis by determination of T-cell receptor (TCR) B-chain variable (V) region usage, both in chronic plaque (psoriasis vulgaris) and guttate forms, with various results. Because there are no data on TCR expression in early psoriasis vulgaris, when specific cellular immune events may be expected to be most pronounced, we have analyzed early lesions (less than 3 wk old) of ten patients, with highly reproducible results. We have developed a highly controlled anchored polymerase chain reaction (PCR) method in which TCR beta chain species are all amplified with the same primer pair and products are quantified by dot blot hybridization with BV family-specific oligonucleotide probes. Overexpression of certain TCR BV genes was observed in the majority of lesional biopsies, but in samples in which the expanded BV family formed more than 10% of total lesional BV (half of the samples analyzed), BV2 and BV6 predominated. The consistency of overexpression of these BV species between patients was much less than in previous studies of TCRBV usage in established chronic plaque psoriasis lesions. Complementarity-determining region 3 (CDR3) size spectratyping demonstrated evidence for selective clonal T cell accumulation in less than half of the lesional samples showing BV expansion. These results indicate that selective amplification of TCRBV species occurs in early psoriasis vulgaris but is not essential to the pathogenic process and may be more important in the maintenance or expansion of chronic lesions.

  5. Generation of human scFv antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences.

    PubMed

    Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F

    2011-09-01

    The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human scFv (single chain antibody fragment) libraries using a short linker (GGSSRSS) or a long linker (GGSSRSSSSGGGGSGGGG). In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final scFv products that are used for cloning.

  6. The Recent Emergence of Clostridium difficile Infection in Romanian Hospitals is Associated with a High Prevalence of Polymerase Chain Reaction Ribotype 027.

    PubMed

    Popescu, Gabriel Adrian; Serban, Roxana; Pistol, Adriana; Niculcea, Andreea; Preda, Andreea; Lemeni, Daniela; Macovei, Ioana Sabina; Tălăpan, Daniela; Rafila, Alexandru; Florea, Dragoş

    2018-03-15

    To investigate the epidemiology of Clostridium difficile infection in Romanian hospitals. A survey was conducted at nine hospitals throughout Romania between November 2013 and February 2014. The survey identified 393 patients with Clostridium difficile infection. The median age was 67 years (range: 2-94 years); 56% of patients were aged >65 years. The mean prevalence of Clostridium difficile infection was 5.2 cases per 10.000 patient-days. The highest prevalences were 24.9 and 20 per 10.000 patient-days in hospitals specializing in gastroenterology and infectious diseases, respectively. Clostridium difficile infections were health care-associated in 70.5% patients and community-acquired in 10.2%. The origin was not determined in 19.3%. Clostridium difficile infection was severe in 12.3% of patients, and the in-hospital all-cause mortality was 8.8%. Polymerase chain reaction ribotype 027 had the highest prevalence in all participating hospitals and represented 82.6% of the total ribotyped isolates. The minimum inhibitory concentration of moxifloxacin was >4 μg/mL for 59 of 80 tested isolates (73.8%). Of 59 isolates, 54 were highly resistant to moxifloxacin (minimum inhibitory concentration ≥32 μg/mL), and the majority were polymerase chain reaction ribotype 027 (p<0.0001). The ribotype 027 was the predominant cause of Clostridium difficile infections in Romania. In some specialized hospitals, the prevalence of Clostridium difficile infection was higher than the European mean prevalence, and this demonstrates the need for strict adherence to infection control programs.

  7. Screening test recommendations for methicillin-resistant Staphylococcus aureus surveillance practices: A cost-minimization analysis.

    PubMed

    Whittington, Melanie D; Curtis, Donna J; Atherly, Adam J; Bradley, Cathy J; Lindrooth, Richard C; Campbell, Jonathan D

    2017-07-01

    To mitigate methicillin-resistant Staphylococcus aureus (MRSA) infections, intensive care units (ICUs) conduct surveillance through screening patients upon admission followed by adhering to isolation precautions. Two surveillance approaches commonly implemented are universal preemptive isolation and targeted isolation of only MRSA-positive patients. Decision analysis was used to calculate the total cost of universal preemptive isolation and targeted isolation. The screening test used as part of the surveillance practice was varied to identify which screening test minimized inappropriate and total costs. A probabilistic sensitivity analysis was conducted to evaluate the range of total costs resulting from variation in inputs. The total cost of the universal preemptive isolation surveillance practice was minimized when a polymerase chain reaction screening test was used ($82.51 per patient). Costs were $207.60 more per patient when a conventional culture was used due to the longer turnaround time and thus higher isolation costs. The total cost of the targeted isolation surveillance practice was minimized when chromogenic agar 24-hour testing was used ($8.54 per patient). Costs were $22.41 more per patient when polymerase chain reaction was used. For ICUs that preemptively isolate all patients, the use of a polymerase chain reaction screening test is recommended because it can minimize total costs by reducing inappropriate isolation costs. For ICUs that only isolate MRSA-positive patients, the use of chromogenic agar 24-hour testing is recommended to minimize total costs. Copyright © 2017 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  8. Allele-Specific Polymerase Chain Reaction for the Imatinib-Resistant KIT D816V and D816F Mutations in Mastocytosis and Acute Myelogenous Leukemia

    PubMed Central

    Corless, Christopher L.; Harrell, Patina; Lacouture, Mario; Bainbridge, Troy; Le, Claudia; Gatter, Ken; White, Clifton; Granter, Scott; Heinrich, Michael C.

    2006-01-01

    Oncogenic mutations of the receptor tyrosine kinase KIT contribute to the pathogenesis of gastrointestinal stromal tumors, systemic mastocytosis (SM), and some cases of acute myelogenous leukemia (AML). The D816V substitution in the activation loop of KIT results in relative resistance to the kinase inhibitor imatinib (Gleevec). Because this mutation occurs in 80 to 95% of adult SM, its detection has diagnostic and predictive significance. Unfortunately, the fraction of mutation-positive cells in clinical SM samples is often below the 20 to 30% threshold needed for detection by direct DNA sequencing. We have developed an allele-specific polymerase chain reaction assay using a mutation-specific primer combined with a wild-type blocking oligonucleotide that amplifies D816V at the level of 1% mutant allele in DNA extracted from formalin-fixed, paraffin-embedded tissue. There were no amplifications among 64 KIT wild-type tumors and cell lines, whereas all D816V-mutant samples (eight AML and 11 mast cell disease) were positive. Other D816 substitutions associated with resistance to imatinib in vitro are rare in SM. Among these D816F was detectable with the assay whereas D816H, D816Y, and D816G did not amplify. Nine biopsies (bone marrow, skin, or colon) with suspected SM were negative by denaturing high performance liquid chromatography and/or DNA sequencing but positive by allele-specific polymerase chain reaction. Thus, the assay may be useful in confirming the diagnosis of SM. PMID:17065430

  9. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    NASA Astrophysics Data System (ADS)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  10. Molecular screening by polymerase chain reaction detects panleukopenia virus DNA in formalin-fixed hearts from cats with idiopathic cardiomyopathy and myocarditis.

    PubMed

    Meurs, K M; Fox, P R; Magnon, A L; Liu, S; Towbin, J A

    2000-01-01

    Viral myocarditis has been suggested as an etiology for cardiomyopathy in several mammalian species. Myocarditis and idiopathic cardiomyopathy have been reported in the domestic cat, although a viral etiology has not been demonstrated. Because of the continuing interest in the potential relationship between viral myocarditis and cardiomyopathy, we evaluated hearts from cats with spontaneous, idiopathic cardiomyopathy for viral genomic material within myocytes by polymerase chain reaction, and for the presence of myocarditis by light microscopy. Thirty-one (31) formalin-fixed hearts from domestic cats who died of idiopathic cardiomyopathy were randomly selected from pathology archives. Seventeen (17) formalin-fixed hearts from healthy cats were similarly selected as normal controls. The polymerase chain reaction (PCR) was used to evaluate myocardial tissue for the presence of viral genome from feline panleukopenia virus, herpes virus, calici virus, and corona virus. Hearts were examined using light microscopy for histologic evidence of myocarditis according to the Dallas criteria. Panleukopenia virus was identified by PCR in 10 of 31 cats with cardiomyopathy but in none of the controls. Neither cardiomyopathic or control cats tested positive by PCR for herpes virus, calici virus, and corona virus. Myocarditis was detected by histologic examination in 18 of 31 cardiomyopathic cats and in none of 17 control cats. Myocarditis and or feline panleukopenia virus genome was detected in felines with idiopathic hypertrophic, dilated, and restrictive cardiomyopathy, suggesting a possible role of viral infection and inflammation in the pathogenesis of cardiomyopathy in this species.

  11. [Diagnosis of congenital cytomegalovirus infection in newborn dried blood spots on Guthrie cards. A promissory technique].

    PubMed

    Distéfano, Angélica L; González, Cecilia A; Pardón, Fabián; Sarubi, María A; Canero Velazco, Cristina

    2008-04-01

    Laboratories play a crucial role in the diagnosis of congenital and perinatal cytomegalovirus infection, considering that other viral infections in newborn infants have similar clinical characteristics. The objectives of this work are to compare the results of the polymerase reaction in blood spots and urine as well as point out the relevance of the result in the Guthrie cards to differentiate congenital from perinatal infection. A total of 148 patients suspicious of CMVH infections were studied in the Congenital Perinatal Infections and Sexual Transmission Laboratory, at the National Institute "Carlos G. Malbrán". The dry blood samples (Guthrie cards) and urine of all patients were studied through the polymerase chain reaction. From the 148 patients, 3 presented other infections, 95 tested negative and 50 positive for cytomegalovirus: 35 had congenital infection and 15 perinatal. In the congenital cases, the polymerase reaction in dry blood was positive (sensitivity 100%, specificity 98.9%, VPP 98% and VPN 100%). Four of them with tardive symptoms were studied retrospectively. The urine specimens from the remaining 15 patients that were taken 15 days after birth were analyzed through the same methods, showing a sensitivity of 100%, the retrospective analysis of this dry blood group yielded negative results, so the infection was considered perinatal. Thus, the dry blood polymerase reaction of the newborn infants makes it a reliable assay for diagnosing congenital cytomegalovirus infection and could be used as an alternative method to urine polymerase reaction. In addition, this test is able to reveal whether the infection is congenital or perinatal in those cases of late symptom or other cases of controversial origin.

  12. Correlation between MGMT promoter methylation and response to temozolomide-based therapy in neuroendocrine neoplasms: an observational retrospective multicenter study.

    PubMed

    Campana, Davide; Walter, Thomas; Pusceddu, Sara; Gelsomino, Fabio; Graillot, Emmanuelle; Prinzi, Natalie; Spallanzani, Andrea; Fiorentino, Michelangelo; Barritault, Marc; Dall'Olio, Filippo; Brighi, Nicole; Biasco, Guido

    2018-06-01

    Temozolomide (TEM) based therapy has been reported being effective in the treatment of metastatic neuroendocrine neoplasms (NEN), with response rates ranging from 30 to 70%. Among patients affected by advanced glioblastoma or melanoma and treated with TEM, loss of tumoral O6-methylguanine DNA methyltransferase (MGMT) is correlated with improved survival. In NEN patients, the role of MGMT deficiency in predicting clinical outcomes of TEM treatment is still under debate. In this study we evaluated 95 patients with advanced NENs undergoing treatment with TEM-based therapy. MGMT promoter methylation status was evaluated with two techniques: methylation specific-polymerase chain reaction or pyrosequencing. Treatment with TEM-based therapy was associated with an overall response rate of 27.4% according to RECIST criteria (51.8% of patients with and 17.7% without MGMT promoter methylation). Response to therapy, progression free survival and overall survival was correlated to MGMT status at univariate and multivariate analysis. Methylation of MGMT promoter could be a strong predictive factor of objective response and an important prognostic factor of a longer PFS and OS. According to our results, MGMT methylation status, evaluated with methylation specific-polymerase chain reaction or pyrosequencing, should have an important role in patients with metastatic NENs, in order to guide therapeutic options. These results need further confirmation with prospective studies.

  13. The molecular genetic basis of mitochondrial malfunction in bladder tissue following outlet obstruction.

    PubMed

    Levin, Robert M; Hudson, Alan P

    2004-08-01

    Bladder dysfunction following partial outlet obstruction is a frequent consequence of benign prostatic hyperplasia and an increasingly common problem given the aging of the general population. Recent studies from this and other groups have begun to elucidate the molecular bases for the well described physiological malfunctions that characterize this clinical entity. We summarized and synthesized that information. Using modern methods of molecular genetics, including real-time polymerase chain reaction, real-time reverse transcriptase-polymerase chain reaction and others, as well as traditional experimental techniques such as electron microscopy we and others examined the transcriptional profile, morphology, etc of bladder smooth muscle mitochondria in experimental models of outlet obstruction. Data from many studies have demonstrated that aberrant gene expression in the mitochondrial and mitochondria related nuclear genetic systems underlies the loss of compliance and other attributes of bladder dysfunction following outlet obstruction. Such aberrant transcriptional characteristics engender loss of function in the electron transport and oxidative phosphorylation systems. Morphological studies of mitochondria in the animal model systems support this conclusion. In large part the loss of function in bladder smooth muscle following outlet obstruction results from the attenuation of mitochondrial energy production. In this article we reviewed and synthesized all available experimental observations relevant to this problem and we suggest future lines of inquiry that should prove fruitful in developing new strategies to treat the condition.

  14. Simultaneous and Rapid Detection of Salmonella typhi, Bacillus anthracis, and Yersinia pestis by Using Multiplex Polymerase Chain Reaction (PCR)

    PubMed Central

    Safari Foroshani, Nargess; Karami, Ali; Pourali, Fatemeh

    2013-01-01

    Background Salmonella typhi, Bacillus anthracis, and Yersinia pestis are some serious human pathogens, which their early diagnosis is of great importance. Salmonella typhi, Bacillus anthracis, and Yersinia pestis cause typhoid fever, anthrax, and plague respectively. These bacteria can be used to make biologic weapons. Objectives In this study, we designed a new and rapid diagnostic method based on Uniplex and Multiplex PCR method. Materials and Methods Uniplex and multiplex Polymerase Chain Reaction (PCR) were conducted on virulent genes of hp and invA of Salmonella typhimurium, Pa and chr of Bacillus anthracis, and pla of Yersinia pestis. A genome from other bacteria was used to study the specificity of the primer and the PCR test. Results Standard strains used in this study showed that primers were specific. As for sensitivity, it was shown that this method can diagnose 1-10 copies of the genome, or 1-10 Colony Forming Units (CFU) for each of the bacteria. All pieces except anthrax were sequenced in PCR to validate the product. DNA fragment resulted from Bacillus anthracis was confirmed by restriction enzyme digestions. Conclusion The designed methods are accurate, rapid, and inexpensive to find and differentiate these bacteria from similar bacteria. They can be applied for rapid diagnosis of these agents in different specimens, and bioterrorism cases. PMID:24719692

  15. Detection and a possible link between parvovirus B19 and thyroid cancer.

    PubMed

    Etemadi, Ashkan; Mostafaei, Shayan; Yari, Kheirollah; Ghasemi, Amir; Minaei Chenar, Hamzeh; Moghoofei, Mohsen

    2017-06-01

    Human parvovirus B19 (B19) is a small, non-enveloped virus and belongs to Parvoviridae family. B19 persists in many tissues such as thyroid tissue and even thyroid cancer. The main aim of this study was to determine the presence of B19, its association with increased inflammation in thyroid tissue, and thus its possible role in thyroid cancer progression. Studies have shown that virus replication in non-permissive tissue leads to overexpression of non-structural protein and results in upregulation of proinflammatory cytokines such as interleukin 6 and tumor necrosis factor alpha. A total of 36 paraffin-embedded thyroid specimens and serum were collected from patients and 12 samples were used as control. Various methods were employed, including polymerase chain reaction, real-time polymerase chain reaction, and enzyme-linked immunosorbent assay. The results have shown the presence of B19 DNA in 31 of 36 samples (86.11%). Almost in all samples, the levels of non-structural protein 1, nuclear factor kappa B, tumor necrosis factor alpha, and interleukin 6 were simultaneously high. The presence of parvovirus B19 has a significant positive correlation with nuclear factor kappa B, tumor necrosis factor alpha, and interleukin 6 levels. This study suggests that B19 infection may play an important role in tumorigenesis and thyroid cancer development via the inflammatory mechanisms.

  16. Evaluation of p16 hypermethylation in oral submucous fibrosis: A quantitative and comparative analysis in buccal cells and saliva using real-time methylation-specific polymerase chain reaction.

    PubMed

    Kaliyaperumal, Subadra; Sankarapandian, Sathasivasubramanian

    2016-01-01

    The aim of this study was to quantitatively investigate the hypermethylation of p16 gene in buccal cells and saliva of oral submucous fibrosis (OSMF) patients using real-time quantitative methylation-specific polymerase chain reaction (PCR) and to compare the values of two methods. A total of 120 samples were taken from 60 subjects selected for this study, of which 30 were controls and 30 patients were clinically and histopathologically diagnosed with OSMF. In both groups, two sets of samples were collected, one directly from the buccal cells through cytobrush technique and the other through salivary rinse. We analyzed the samples for the presence of p16 hypermethylation using quantitative real-time PCR. In OSMF, the hypermethylation status of p16 in buccal cells was very high (93.3%) and in salivary samples, it was partially methylated (50%). However, no hypermethylation was found in controls suggesting that significant quantity of p16 hypermethylation was present in buccal cells and saliva in OSMF. This study indicates that buccal cell sampling may be a better method for evaluation than the salivary samples. It signifies that hypermethylation of p16 is an important factor to be considered in epigenetic alterations of normal cells to oral precancer, i.e. OSMF.

  17. Biochemical Evaluation of the Inhibition Properties of Favipiravir and 2′-C-Methyl-Cytidine Triphosphates against Human and Mouse Norovirus RNA Polymerases

    PubMed Central

    Tucker, Kathryn; Lin, Xiaoyan; Kao, C. Cheng; Shaw, Ken; Tan, Hua; Symons, Julian; Behera, Ishani; Rajwanshi, Vivek K.; Dyatkina, Natalia; Wang, Guangyi; Beigelman, Leo

    2015-01-01

    Norovirus (NoV) is a positive-sense single-stranded RNA virus that causes acute gastroenteritis and is responsible for 200,000 deaths per year worldwide. No effective vaccine or treatment is available. Recent studies have shown that the nucleoside analogs favipiravir (T-705) and 2′-C-methyl-cytidine (2CM-C) inhibit NoV replication in vitro and in animal models, but their precise mechanism of action is unknown. We evaluated the molecular interactions between nucleoside triphosphates and NoV RNA-dependent RNA polymerase (NoVpol), the enzyme responsible for replication and transcription of NoV genomic RNA. We found that T-705 ribonucleoside triphosphate (RTP) and 2CM-C triphosphate (2CM-CTP) equally inhibited human and mouse NoVpol activities at concentrations resulting in 50% of maximum inhibition (IC50s) in the low micromolar range. 2CM-CTP inhibited the viral polymerases by competing directly with natural CTP during primer elongation, whereas T-705 RTP competed mostly with ATP and GTP at the initiation and elongation steps. Incorporation of 2CM-CTP into viral RNA blocked subsequent RNA synthesis, whereas T-705 RTP did not cause immediate chain termination of NoVpol. 2CM-CTP and T-705 RTP displayed low levels of enzyme selectivity, as they were both recognized as substrates by human mitochondrial RNA polymerase. The level of discrimination by the human enzyme was increased with a novel analog of T-705 RTP containing a 2′-C-methyl substitution. Collectively, our data suggest that 2CM-C inhibits replication of NoV by acting as a classic chain terminator, while T-705 may inhibit the virus by multiple mechanisms of action. Understanding the precise mechanism of action of anti-NoV compounds could provide a rational basis for optimizing their inhibition potencies and selectivities. PMID:26392512

  18. Generation of human Fab antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences.

    PubMed

    Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F

    2011-09-01

    The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human Fab (fragment antigen binding) antibody libraries. In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final Fab products that are used for cloning.

  19. Presidential Green Chemistry Challenge: 2013 Greener Synthetic Pathways Award

    EPA Pesticide Factsheets

    Presidential Green Chemistry Challenge 2013 award winner, Life Technologies, developed a one-pot synthesis for polymerase chain reaction (PCR), which is a much more efficient process that prevents about 1.5 million pounds of hazardous waste a year.

  20. A Two-State Model for the Dynamics of the Pyrophosphate Ion Release in Bacterial RNA Polymerase

    PubMed Central

    Da, Lin-Tai; Pardo Avila, Fátima; Wang, Dong; Huang, Xuhui

    2013-01-01

    The dynamics of the PPi release during the transcription elongation of bacterial RNA polymerase and its effects on the Trigger Loop (TL) opening motion are still elusive. Here, we built a Markov State Model (MSM) from extensive all-atom molecular dynamics (MD) simulations to investigate the mechanism of the PPi release. Our MSM has identified a simple two-state mechanism for the PPi release instead of a more complex four-state mechanism observed in RNA polymerase II (Pol II). We observed that the PPi release in bacterial RNA polymerase occurs at sub-microsecond timescale, which is ∼3-fold faster than that in Pol II. After escaping from the active site, the (Mg-PPi)2− group passes through a single elongated metastable region where several positively charged residues on the secondary channel provide favorable interactions. Surprisingly, we found that the PPi release is not coupled with the TL unfolding but correlates tightly with the side-chain rotation of the TL residue R1239. Our work sheds light on the dynamics underlying the transcription elongation of the bacterial RNA polymerase. PMID:23592966

Top