Brettanomyces acidodurans sp. nov., a new acetic acid producing yeast species from olive oil.

PubMed

Péter, Gábor; Dlauchy, Dénes; Tóbiás, Andrea; Fülöp, László; Podgoršek, Martina; Čadež, Neža

2017-05-01

Two yeast strains representing a hitherto undescribed yeast species were isolated from olive oil and spoiled olive oil originating from Spain and Israel, respectively. Both strains are strong acetic acid producers, equipped with considerable tolerance to acetic acid. The cultures are not short-lived. Cellobiose is fermented as well as several other sugars. The sequences of their large subunit (LSU) rRNA gene D1/D2 domain are very divergent from the sequences available in the GenBank. They differ from the closest hit, Brettanomyces naardenensis by about 27%, mainly substitutions. Sequence analyses of the concatenated dataset from genes of the small subunit (SSU) rRNA, LSU rRNA and translation elongation factor-1α (EF-1α) placed the two strains as an early diverging member of the Brettanomyces/Dekkera clade with high bootstrap support. Sexual reproduction was not observed. The name Brettanomyces acidodurans sp. nov. (holotype: NCAIM Y.02178 T ; isotypes: CBS 14519 T  = NRRL Y-63865 T  = ZIM 2626 T , MycoBank no.: MB 819608) is proposed for this highly divergent new yeast species.

An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5′ UTRs and its implications for eukaryotic gene translation regulation

PubMed Central

Pánek, Josef; Kolář, Michal; Vohradský, Jiří; Shivaya Valášek, Leoš

2013-01-01

There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA–rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5′ untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5′ UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5′ UTRs of mRNAs. PMID:23804757

Protein-RNA crosslinking in Escherichia coli 30S ribosomal subunits. Identification of a 16S rRNA fragment crosslinked to protein S12 by the use of the chemical crosslinking reagent 1-ethyl-3-dimethyl-aminopropylcarbodiimide.

PubMed Central

Chiaruttini, C; Expert-Bezançon, A; Hayes, D; Ehresmann, B

1982-01-01

1-ethyl-3-dimethyl aminopropylcarbodiimide (EDC) was used to cross-link 30S ribosomal proteins to 16S rRNA within the E. coli 3OS ribosomal subunit. Covalently linked complexes containing 30S proteins and 16S rRNA, isolated by sedimentation of dissociated crosslinked 30S subunits through SDS containing sucrose gradients, were digested with RNase T1, and the resulting oligonucleotide-protein complexes were fractionated on SDS containing polyacrylamide gels. Eluted complexes containing 30S proteins S9 and S12 linked to oligonucleotides were obtained in pure form. Oligonucleotide 5'terminal labelling was successful in the case of S12 containing but not of the S9 containing complex and led to identification of the S12 bound oligonucleotide as CAACUCG which is located at positions 1316-1322 in the 16S rRNA sequence. Protein S12 is crosslinked to the terminal G of this heptanucleotide. Images PMID:6760129

Cross-linking of initiation factor IF3 to Escherichia coli 30S ribosomal subunit by trans-diamminedichloroplatinum(II): characterization of two cross-linking sites in 16S rRNA; a possible way of functioning for IF3.

PubMed Central

Ehresmann, C; Moine, H; Mougel, M; Dondon, J; Grunberg-Manago, M; Ebel, J P; Ehresmann, B

1986-01-01

The initiation factor IF3 is platinated with trans-diamminedichloroplatinum(II) and cross-linked to Escherichia coli 30S ribosomal subunit. Two cross-linking sites are unambiguously identified on the 16S rRNA: a major one, in the region 819-859 in the central domain, and a minor one, in the region 1506-1529 in the 3'-terminal domain. Specific features of these sequences together with their particular location within the 30S subunit lead us to postulate a role for IF3, that conciliates topographical and functional observations made so far. Images PMID:2425339

Description of Groenewaldozyma gen. nov. for placement of Candida auringiensis, Candida salmanticensis and Candida tartarivorans.

PubMed

Kurtzman, Cletus P

2016-07-01

DNA sequence analyses have demonstrated that species of the polyphyletic anamorphic ascomycete genus Candida may be members of described teleomorphic genera, members of the Candida tropicalis clade upon which the genus Candida is circumscribed, or members of isolated clades that represent undescribed genera. From phylogenetic analysis of gene sequences from nuclear large subunit rRNA, mitochondrial small subunit rRNA and cytochrome oxidase II, Candida auringiensis (NRRL Y-17674(T), CBS 6913(T)), Candida salmanticensis (NRRL Y-17090(T), CBS 5121(T)), and Candida tartarivorans (NRRL Y-27291(T), CBS 7955(T)) were shown to be members of an isolated clade and are proposed for reclassification in the genus Groenewaldozyma gen. nov. (MycoBank MB 815817). Neighbouring taxa include species of the Wickerhamiella clade and Candida blankii.

Ballistosporomyces changbaiensis sp. nov. and Ballistosporomyces bomiensis sp. nov., two novel species isolated from shrub plant leaves.

PubMed

Han, Pei-Jie; Li, Ai-Hua; Wang, Qi-Ming; Bai, Feng-Yan

2016-07-01

Four strains, CB 266(T), CB 272, XZ 44D1(T) and XZ 49D2, isolated from shrub plant leaves in China were identified as two novel species of the genus Ballistosporomyces by the sequence analysis of the small subunit of ribosomal RNA (SSU rRNA), the D1/D2 domains of the large subunit of rRNA (LSU rRNA) and internal transcribed spacer (ITS) + 5.8S rRNA region, and physiological comparisons. Ballistosporomyces changbaiensis sp. nov. (type strain CB 266(T) = CGMCC 2.02298(T) = CBS 10124(T), Mycobank number MB 815700) and Ballistosporomyces bomiensis sp. nov. (type strain XZ 44D1(T) = CGMCC 2.02661(T) = CBS 12512(T), Mycobank number MB 815701) are proposed to accommodate these two new species.

The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae).

PubMed

Pan, Hong-Chun; Fang, Hong-Yan; Li, Shi-Wei; Liu, Jun-Hong; Wang, Ying; Wang, An-Tai

2014-12-01

The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae) is composed of two linear DNA molecules. The mitochondrial DNA (mtDNA) molecule 1 is 8010 bp long and contains six protein-coding genes, large subunit rRNA, methionine and tryptophan tRNAs, two pseudogenes consisting respectively of a partial copy of COI, and terminal sequences at two ends of the linear mtDNA, while the mtDNA molecule 2 is 7576 bp long and contains seven protein-coding genes, small subunit rRNA, methionine tRNA, a pseudogene consisting of a partial copy of COI and terminal sequences at two ends of the linear mtDNA. COI gene begins with GTG as start codon, whereas other 12 protein-coding genes start with a typical ATG initiation codon. In addition, all protein-coding genes are terminated with TAA as stop codon.

Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.

PubMed

Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M

2018-06-08

Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

Phylogenetic relationship of psychoactive fungi based on rRNA gene for a large subunit and their identification using the TaqMan assay (II).

PubMed

Maruyama, Takuro; Kawahara, Nobuo; Yokoyama, Kazumasa; Makino, Yukiko; Fukiharu, Toshimitsu; Goda, Yukihiro

2006-11-10

"Magic mushroom (MM)" is the name most commonly given to psychoactive fungi containing the hallucinogenic components: psilocin (1) and psilocybin (2). We investigated the rRNA gene (internal transcribed spacer (ITS) and large subunit (LSU)) of two Panaeolus species and four Psilocybe species fungi (of these, two are non-psilocybin species). On the basis of sequence alignment, we improved the identification system developed in our previous study. In this paper, we describe the new system capable of distinguishing MMs from non-psilocybin Psilocybe species, its application data and the phylogeny of MM species.

Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

PubMed Central

Feldman, Sanford H; Ntenda, Abraham M

2011-01-01

We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

Kondoa gutianensis f.a. sp. nov., a novel ballistoconidium-forming yeast species isolated from plant leaves.

PubMed

Liu, Xin-Zhan; Groenewald, Marizeth; Boekhout, Teun; Bai, Feng-Yan

2018-01-01

Two strains, GT-165 T and GT-261, isolated from plant leaves collected from Gutian Mountain in Zhejiang province in China were identified as a novel species of the genus Kondoa by the sequence analysis of the internal transcribed spacer (ITS) region, the D1/D2 domains of the large subunit of rRNA (LSU rRNA) and the RNA polymerase II second largest subunit (RPB2), complemented by physiological tests. Phylogenetic analysis based on the concatenated sequences of ITS, D1/D2 and RPB2 showed that the closest known relatives of the new species are three undescribed Kondoa species and Kondoa thailandica. The ITS and D1/D2 sequences of the new species differ from the closely related species by 11-22% and 2-9%, respectively. The name Kondoa gutianensis f.a. sp. nov. (MB 820648, holotype = CGMCC 2.5703 T ; isotype: CBS 14811 T = CGMCC 2.5703 T ) is proposed to accommodate the new taxon.

A new version of the RDP (Ribosomal Database Project)

NASA Technical Reports Server (NTRS)

Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.;

The complete mitochondrial genome sequence of Eimeria magna (Apicomplexa: Coccidia).

PubMed

Tian, Si-Qin; Cui, Ping; Fang, Su-Fang; Liu, Guo-Hua; Wang, Chun-Ren; Zhu, Xing-Quan

2015-01-01

In the present study, we determined the complete mitochondrial DNA (mtDNA) sequence of Eimeria magna from rabbits for the first time, and compared its gene contents and genome organizations with that of seven Eimeria spp. from domestic chickens. The size of the complete mt genome sequence of E. magna is 6249 bp, which consists of 3 protein-coding genes (cytb, cox1 and cox3), 12 gene fragments for the large subunit (LSU) rRNA, and 7 gene fragments for the small subunit (SSU) rRNA, without transfer RNA genes, in accordance with that of Eimeria spp. from chickens. The putative direction of translation for three genes (cytb, cox1 and cox3) was the same as those of Eimeria species from domestic chickens. The content of A + T is 65.16% for E. magna mt genome (29.73% A, 35.43% T, 17.09 G and 17.75% C). The E. magna mt genome sequence provides novel mtDNA markers for studying the molecular epidemiology and population genetics of Eimeria spp. and has implications for the molecular diagnosis and control of rabbit coccidiosis.

Four new species of Metschnikowia and the transfer of seven Candida species to Metschnikowia and Clavispora as new combinations

USDA-ARS?s Scientific Manuscript database

From comparisons of ITS1-5.8S-ITS2 and gene sequences for nuclear D1/D2 LSU rRNA, nuclear SSU (18S) rRNA, translation elongation factor 1-a (EF1-a) and RNA polymerase II subunit 2 (RPB2), the following four new ascosporogenous yeast species were resolved and are described as Metschnikowia anglica (N...

Enterobacter xiangfangensis sp. nov., isolated from Chinese traditional sourdough, and reclassification of Enterobacter sacchari Zhu et al. 2013 as Kosakonia sacchari comb. nov.

PubMed

Gu, Chun Tao; Li, Chun Yan; Yang, Li Jie; Huo, Gui Cheng

2014-08-01

A Gram-stain-negative bacterial strain, 10-17(T), was isolated from traditional sourdough in Heilongjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, RNA polymerase β subunit (rpoB) gene sequence analysis, DNA gyrase (gyrB) gene sequence analysis, initiation translation factor 2 (infB) gene sequence analysis, ATP synthase β subunit (atpD) gene sequence analysis, fatty acid methyl ester analysis, determination of DNA G+C content, DNA-DNA hybridization and an analysis of phenotypic features. Strain 10-17(T) was phylogenetically related to Enterobacter hormaechei CIP 103441(T), Enterobacter cancerogenus LMG 2693(T), Enterobacter asburiae JCM 6051(T), Enterobacter mori LMG 25706(T), Enterobacter ludwigii EN-119(T) and Leclercia adecarboxylata LMG 2803(T), having 99.5%, 99.3%, 98.7%, 98.5%, 98.4% and 98.4% 16S rRNA gene sequence similarity, respectively. On the basis of polyphasic characterization data obtained in the present study, a novel species, Enterobacter xiangfangensis sp. nov., is proposed and the type strain is 10-17(T) ( = LMG 27195(T) = NCIMB 14836(T) = CCUG 62994(T)). Enterobacter sacchari Zhu et al. 2013 was reclassified as Kosakonia sacchari comb. nov. on the basis of 16S rRNA, rpoB, gyrB, infB and atpD gene sequence analysis and the type strain is strain SP1(T)( = CGMCC 1.12102(T) = LMG 26783(T)). © 2014 IUMS.

Phylogeny of the Haplosporidia (Eukaryota: Alveolata) based on small subunit ribosomal RNA gene sequence.

PubMed

Flores, B S; Siddall, M E; Burreson, E M

1996-08-01

The phylogenetic position of the phylum Haplosporidia was investigated with the complete small subunit rRNA gene sequences from 5 species in the phylum: Haplosporidium nelsoni and Haplosporidium costale, parasites of the eastern oyster Crassostrea virginica; Haplosporidium louisiana, a parasite of the mudcrab Panopeus herbstii; Minchinia teredinis, a parasite of shipworms (Teredo spp.) and Urosporidium crescens, a hyperparasite found in metacercariae of the trematode Megalophallus sp. in the blue crab, Callinectes sapidus. Multiple alignments of small subunit rRNA gene sequences included the 5 haplosporidian taxa and 14 taxa in the alveolate phyla Ciliophora, Dinoflagellida, and Apicomplexa. Maximum parsimony analysis placed the phylum Haplosporidia as a monophyletic group within the alveolate clade, as a taxon of equal rank with the other 3 alveolate phyla, and as a sister taxon to the clade composed of the phyla Dinoflagellida and Apicomplexa. Transversionally weighted parsimony placed the haplosporidians as a sister taxon to the ciliates. A separate analysis focused on the relationships of species in the genus Haplosporidium. Analyses were conducted with the haplosporidians as a functional ingroup, using each of the alveolate phyla individually as functional outgroups. The results indicated that species in the genus Haplosporidium do not form a monophyletic assemblage. As such, the present morphological criteria for distinguishing the genera Haplosporidium and Minchinia are insufficient.

Evaluation of sequence alignments and oligonucleotide probes with respect to three-dimensional structure of ribosomal RNA using ARB software package

PubMed Central

Kumar, Yadhu; Westram, Ralf; Kipfer, Peter; Meier, Harald; Ludwig, Wolfgang

2006-01-01

Background Availability of high-resolution RNA crystal structures for the 30S and 50S ribosomal subunits and the subsequent validation of comparative secondary structure models have prompted the biologists to use three-dimensional structure of ribosomal RNA (rRNA) for evaluating sequence alignments of rRNA genes. Furthermore, the secondary and tertiary structural features of rRNA are highly useful and successfully employed in designing rRNA targeted oligonucleotide probes intended for in situ hybridization experiments. RNA3D, a program to combine sequence alignment information with three-dimensional structure of rRNA was developed. Integration into ARB software package, which is used extensively by the scientific community for phylogenetic analysis and molecular probe designing, has substantially extended the functionality of ARB software suite with 3D environment. Results Three-dimensional structure of rRNA is visualized in OpenGL 3D environment with the abilities to change the display and overlay information onto the molecule, dynamically. Phylogenetic information derived from the multiple sequence alignments can be overlaid onto the molecule structure in a real time. Superimposition of both statistical and non-statistical sequence associated information onto the rRNA 3D structure can be done using customizable color scheme, which is also applied to a textual sequence alignment for reference. Oligonucleotide probes designed by ARB probe design tools can be mapped onto the 3D structure along with the probe accessibility models for evaluation with respect to secondary and tertiary structural conformations of rRNA. Conclusion Visualization of three-dimensional structure of rRNA in an intuitive display provides the biologists with the greater possibilities to carry out structure based phylogenetic analysis. Coupled with secondary structure models of rRNA, RNA3D program aids in validating the sequence alignments of rRNA genes and evaluating probe target sites. Superimposition of the information derived from the multiple sequence alignment onto the molecule dynamically allows the researchers to observe any sequence inherited characteristics (phylogenetic information) in real-time environment. The extended ARB software package is made freely available for the scientific community via . PMID:16672074

The structural analysis of the mitochondrial SSUrRNA implies a close phylogenetic relationship between mitochondria from plants and from the heterotrophic alga Prototheca wickerhamii.

PubMed

Wolff, G; Kück, U

1990-04-01

The gene for the mitochondrial small subunit rRNA (SSUrRNA) from the heterotrophic alga Prototheca wickerhamii has been isolated from a gene library of extranuclear DNA. Sequence and structural analyses allow the determination of a secondary structure model for this rRNA. In addition, several sequence motifs are present which are typically found in SSUrRNAs of various mitochondrial origins. Unexpectedly, the Prototheca RNA sequence has more features in common with mitochondrial SSUrRNAs from plants than with that from the green alga Chlamydomonas reinhardtii. The phylogenetic relationship between mitochondria from plants and algae is discussed.

An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

NASA Technical Reports Server (NTRS)

Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

1993-01-01

The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

Phylogenetic position of parabasalid symbionts from the termite Calotermes flavicollis based on small subunit rRNA sequences.

PubMed

Gerbod, D; Edgcomb, V P; Noël, C; Delgado-Viscogliosi, P; Viscogliosi, E

2000-09-01

Small subunit rDNA genes were amplified by polymerase chain reaction using specific primers from mixed-population DNA obtained from the whole hindgut of the termite Calotermes flavicollis. Comparative sequence analysis of the clones revealed two kinds of sequences that were both from parabasalid symbionts. In a molecular tree inferred by distance, parsimony and likelihood methods, and including 27 parabasalid sequences retrieved from the data bases, the sequences of the group II (clones Cf5 and Cf6) were closely related to the Devescovinidae/Calonymphidae species and thus were assigned to the Devescovinidae Foaina. The sequence of the group I (clone Cf1) emerged within the Trichomonadinae and strongly clustered with Tetratrichomonas gallinarum. On the basis of morphological data, the Monocercomonadidae Hexamastix termitis might be the most likely origin of this sequence.

Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes.

PubMed

Milbury, Coren A; Lee, Jung C; Cannone, Jamie J; Gaffney, Patrick M; Gutell, Robin R

2010-09-02

Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA) genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

Metagenomics uncovers gaps in amplicon-based detection of microbial diversity

DOE PAGES

Eloe-Fadrosh, Emiley A.; Ivanova, Natalia N.; Woyke, Tanja; ...

2016-02-01

Our view of microbial diversity has expanded greatly over the past 40 years, primarily through the wide application of PCR-based surveys of the small-subunit ribosomal RNA (SSU rRNA) gene. Yet significant gaps in knowledge remain due to well-recognized limitations of this method. Here in this paper, we systematically survey primer fidelity in SSU rRNA gene sequences recovered from over 6,000 assembled metagenomes sampled globally. Our findings show that approximately 10% of environmental microbial sequences might be missed from classical PCR-based SSU rRNA gene surveys, mostly members of the Candidate Phyla Radiation (CPR) and as yet uncharacterized Archaea. In conclusion, thesemore » results underscore the extent of uncharacterized microbial diversity and provide fruitful avenues for describing additional phylogenetic lineages.« less

A New Primer Set to Amplify the Mitochondrial Cytochrome C Oxidase Subunit I (COI) Gene in the DHA-Rich Microalgae, the Genus Aurantiochytrium.

PubMed

Nishitani, Goh; Yoshida, Masaki

2018-06-01

This study was performed in order to develop a primer set for mitochondrial cytochrome c oxidase subunit I (COI) in the DHA-rich microalgae of the genus Aurantiochytrium. The performance of the primer set was tested using 12 Aurantiochytrium strains and other thraustochytrid species. There were no genetic polymorphisms in the mitochondrial sequences from the Aurantiochytrium strains, in contrast to the nuclear 18S rRNA gene sequence. This newly developed primer set amplified sequences from Aurantiochytrium and closely related genera, and may be useful for species identification and clarifying the genetic diversity of Aurantiochytrium in the field.

MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

PubMed Central

Zhou, Quan

2017-01-01

An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

Cryptococcus fildesensis sp. nov., a psychrophilic basidiomycetous yeast isolated from Antarctic moss.

PubMed

Zhang, Tao; Zhang, Yu-Qin; Liu, Hong-Yu; Su, Jing; Zhao, Li-Xun; Yu, Li-Yan

2014-02-01

Two yeast strains isolated from the moss Chorisodontium aciphyllum from the Fildes Region, King George Island, maritime Antarctica, were classified as members of the genus Cryptococcus based on sequence analyses of the D1/D2 domains of the large subunit rRNA gene and the internal transcribed spacer (ITS) regions. The rRNA gene sequence analyses indicated that the two strains represented a novel species of the genus Cryptococcus, for which the name Cryptococcus fildesensis sp. nov. is proposed (type strain: CPCC 300017(T) = DSM 26442(T) = CBS 12705(T)). The MycoBank number of the novel species is MB 805542.

Genetic differences in internal transcribed spacer 1 between Dermanyssus gallinae from wild birds and domestic chickens.

PubMed

Brännström, S; Morrison, D A; Mattsson, J G; Chirico, J

2008-06-01

We investigated the presence of the poultry red mite or the chicken mite, Dermanyssus gallinae De Geer, Acari: Dermanyssidae, in wild bird populations in four different geographical regions of Sweden. The mites identified as D. gallinae were compared genetically with D. gallinae from egg-producing poultry farms in the same regions. The small subunit (SSU) gene, the 5.8S ribosomal RNA (rRNA) gene and the two internal transcribed spacers (ITS) of the rRNA genes were used in the genetic analysis. All D. gallinae mites had identical SSU rRNA, 5.8S rRNA and ITS2 sequences independent of their origin. By contrast, we identified significant differences in the ITS1 sequences. Based on the differences in the ITS1 sequences, the mites could be divided into two genotypes, of wild and domesticated origin, with no variation within the groups. These results imply that wild bird populations are of low importance, if any, as natural reservoirs of D. gallinae in these four geographical regions of Sweden.

Tetrahymena australis (Protozoa, Ciliophora): A Well-Known But "Non-Existing" Taxon - Consideration of Its Identification, Definition and Systematic Position.

PubMed

Liu, Mingjian; Fan, Xinpeng; Gao, Feng; Gao, Shan; Yu, Yuhe; Warren, Alan; Huang, Jie

2016-11-01

A cryptic species of the Tetrahymena pyriformis complex, Tetrahymena australis, has been known for a long time but never properly diagnosed based on taxonomic methods. The species name is thus invalid according to the International Code of Zoological Nomenclature. Recently, a population isolated from a freshwater lake in Wuhan, China was investigated using live observations, silver staining methods and gene sequence data. This organism can be separated from other described species of the T. pyriformis complex by its relatively small body size, the number of somatic kineties and differences in sequences of two genes, namely the small subunit ribosomal RNA (SSU rRNA) and the mitochondrial cytochrome c oxidase subunit I (cox1). We compared the SSU rRNA gene sequences of all available Tetrahymena species to reveal the nucleotide differences within this genus. The sequence of the Wuhan population is identical to two sequences of a previously isolated strain of T. australis (ATCC #30831). Phylogenetic analyses indicate that these three sequences (X56167, M98015, KT334373) cluster with Tetrahymena shanghaiensis (EF070256) in a polytomy. However, sequence divergence of the cox1 gene between the Wuhan population and another strain of T. australis (ATCC #30271) is 1.4%, suggesting that these may represent different subspecies. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

hUTP24 is essential for processing of the human rRNA precursor at site A1, but not at site A0

PubMed Central

Tomecki, Rafal; Labno, Anna; Drazkowska, Karolina; Cysewski, Dominik; Dziembowski, Andrzej

2015-01-01

Production of ribosomes relies on more than 200 accessory factors to ensure the proper sequence of steps and faultless assembly of ribonucleoprotein machinery. Among trans-acting factors are numerous enzymes, including ribonucleases responsible for processing the large rRNA precursor synthesized by RNA polymerase I that encompasses sequences corresponding to mature 18S, 5.8S, and 25/28S rRNA. In humans, the identity of most enzymes responsible for individual processing steps, including endoribonucleases that cleave pre-rRNA at specific sites within regions flanking and separating mature rRNA, remains largely unknown. Here, we investigated the role of hUTP24 in rRNA maturation in human cells. hUTP24 is a human homolog of the Saccharomyces cerevisiae putative PIN domain-containing endoribonuclease Utp24 (yUtp24), which was suggested to participate in the U3 snoRNA-dependent processing of yeast pre-rRNA at sites A0, A1, and A2. We demonstrate that hUTP24 interacts to some extent with proteins homologous to the components of the yeast small subunit (SSU) processome. Moreover, mutation in the putative catalytic site of hUTP24 results in slowed growth of cells and reduced metabolic activity. These effects are associated with a defect in biogenesis of the 40S ribosomal subunit, which results from decreased amounts of 18S rRNA as a consequence of inaccurate pre-rRNA processing at the 5′-end of the 18S rRNA segment (site A1). Interestingly, and in contrast to yeast, site A0 located upstream of A1 is efficiently processed upon UTP24 dysfunction. Finally, hUTP24 inactivation leads to aberrant processing of 18S rRNA 2 nucleotides downstream of the normal A1 cleavage site. PMID:26237581

Accurate and Practical Identification of 20 Fusarium Species by Seven-Locus Sequence Analysis and Reverse Line Blot Hybridization, and an In Vitro Antifungal Susceptibility Study▿†

PubMed Central

Wang, He; Xiao, Meng; Kong, Fanrong; Chen, Sharon; Dou, Hong-Tao; Sorrell, Tania; Li, Ruo-Yu; Xu, Ying-Chun

2011-01-01

Eleven reference and 25 clinical isolates of Fusarium were subject to multilocus DNA sequence analysis to determine the species and haplotypes of the fusarial isolates from Beijing and Shandong, China. Seven loci were analyzed: the translation elongation factor 1 alpha gene (EF-1α); the nuclear rRNA internal transcribed spacer (ITS), large subunit (LSU), and intergenic spacer (IGS) regions; the second largest subunit of the RNA polymerase gene (RPB2); the calmodulin gene (CAM); and the mitochondrial small subunit (mtSSU) rRNA gene. We also evaluated an IGS-targeted PCR/reverse line blot (RLB) assay for species/haplotype identification of Fusarium. Twenty Fusarium species and seven species complexes were identified. Of 25 clinical isolates (10 species), the Gibberella (Fusarium) fujikuroi species complex was the commonest (40%) and was followed by the Fusarium solani species complex (FSSC) (36%) and the F. incarnatum-F. equiseti species complex (12%). Six FSSC isolates were identified to the species level as FSSC-3+4, and three as FSSC-5. Twenty-nine IGS, 27 EF-1α, 26 RPB2, 24 CAM, 18 ITS, 19 LSU, and 18 mtSSU haplotypes were identified; 29 were unique, and haplotypes for 24 clinical strains were novel. By parsimony informative character analysis, the IGS locus was the most phylogenetically informative, and the rRNA gene regions were the least. Results by RLB were concordant with multilocus sequence analysis for all isolates. Amphotericin B was the most active drug against all species. Voriconazole MICs were high (>8 μg/ml) for 15 (42%) isolates, including FSSC. Analysis of larger numbers of isolates is required to determine the clinical utility of the seven-locus sequence analysis and RLB assay in species classification of fusaria. PMID:21389150

Description of Kuraishia piskuri f.a., sp. nov., a new methanol assimilating yeast and transfer of phylogenetically related Candida species to the genera Kuraishia and Nakazawaea as new combinations.

PubMed

Kurtzman, Cletus P; Robnett, Christie J

2014-11-01

The new anamorphic yeast Kuraishia piskuri, f.a., sp. nov. is described for three strains that were isolated from insect frass from trees growing in Florida, USA (type strain, NRRL YB-2544, CBS 13714). Species placement was based on phylogenetic analysis of nuclear gene sequences for the D1/D2 domains of large subunit rRNA, small subunit rRNA, translation elongation factor-1α, and subunits B1 and B2 of RNA polymerase II B. From this analysis, the anamorphic species Candida borneana, Candida cidri, Candida floccosa, Candida hungarica, and Candida ogatae were transferred to the genus Kuraishia as new combinations and Candida anatomiae, Candida ernobii, Candida ishiwadae, Candida laoshanensis, Candida molendini-olei, Candida peltata, Candida pomicola, Candida populi, Candida wickerhamii, and Candida wyomingensis were transferred to the genus Nakazawaea. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

Structural insights into cell cycle control by essential GTPase Era.

PubMed

Ji, Xinhua

Era (Escherichia coli Ras-like protein), essential for bacterial cell viability, is composed of an N-terminal GTPase domain and a C-terminal KH domain. In bacteria, it is required for the processing of 16S ribosomal RNA (rRNA) and maturation of 30S (small) ribosomal subunit. Era recognizes 10 nucleotides ( 1530 GAUCACCUCC 1539 ) near the 3' end of 16S rRNA and interacts with helix 45 (h45, nucleotides 1506-1529). GTP binding enables Era to bind RNA, RNA binding stimulates Era's GTP-hydrolyzing activity, and GTP hydrolysis releases Era from matured 30S ribosomal subunit. As such, Era controls cell growth rate via regulating the maturation of the 30S ribosomal subunit. Ribosomes manufacture proteins in all living organisms. The GAUCA sequence and h45 are highly conserved in all three kingdoms of life. Homologues of Era are present in eukaryotic cells. Hence, the mechanism of bacterial Era action also sheds light on the cell cycle control of eukaryotes.

Relationships among genera of the Saccharomycotina (Ascomycota) from multigene phylogenetic analysis of type species

USDA-ARS?s Scientific Manuscript database

Phylogenetic relatedness among ascomycetous yeast genera (subphylum Saccharomycotina, phylum Ascomycota) has been uncertain. In the present study, type species of 70 currently recognized genera are compared from divergence in the nearly entire nuclear gene sequences for large subunit rRNA, small sub...

Pneumocystis jirovecii multilocus genotyping profiles in patients from Portugal and Spain.

PubMed

Esteves, F; Montes-Cano, M A; de la Horra, C; Costa, M C; Calderón, E J; Antunes, F; Matos, O

2008-04-01

Pneumonia caused by the opportunistic organism Pneumocystis jirovecii is a clinically important infection affecting AIDS and other immunocompromised patients. The present study aimed to compare and characterise the frequency pattern of DNA sequences from the P. jirovecii mitochondrial large-subunit rRNA (mtLSU rRNA) gene, the dihydropteroate synthase (DHPS) gene and the internal transcribed spacer (ITS) regions of the nuclear rRNA operon in specimens from Lisbon (Portugal) and Seville (Spain). Total DNA was extracted and used for specific molecular sequence analysis of the three loci. In both populations, mtLSU rRNA gene analysis revealed an overall prevalence of genotype 1. In the Portuguese population, genotype 2 was the second most common, followed by genotype 3. Inversely, in the Spanish population, genotype 3 was the second most common, followed by genotype 2. The DHPS wild-type sequence was the genotype observed most frequently in both populations, and the DHPS genotype frequency pattern was identical to distribution patterns revealed in other European studies. ITS types showed a significant diversity in both populations because of the high sequence variability in these genomic regions. The most prevalent ITS type in the Portuguese population was Eg, followed by Cg. In contrast to other European studies, Bi was the most common ITS type in the Spanish samples, followed by Eg. A statistically significant association between mtLSU rRNA genotype 1 and ITS type Eg was revealed.

Lactobacillus cypricasei Lawson et al. 2001 is a later heterotypic synonym of Lactobacillus acidipiscis Tanasupawat et al. 2000.

PubMed

Naser, Sabri M; Vancanneyt, Marc; Hoste, Bart; Snauwaert, Cindy; Swings, Jean

2006-07-01

The applicability of a multilocus sequence analysis (MLSA)-based identification system for lactobacilli was evaluated. Two housekeeping genes that code for the phenylalanyl-tRNA synthase alpha-subunit (pheS) and RNA polymerase alpha-subunit (rpoA) were sequenced and analysed for members of the Lactobacillus salivarius species group. The type strains of Lactobacillus acidipiscis and Lactobacillus cypricasei were investigated further using a third gene that encodes the alpha-subunit of ATP synthase (atpA). The MLSA data revealed close relatedness between L. acidipiscis and L. cypricasei, with 99.8-100 % pheS, rpoA and atpA gene sequence similarities. Comparison of the 16S rRNA gene sequences of the type strains of the two species confirmed the close relatedness (99.8 % gene sequence similarity) between the two taxa. Similar phenotypes and high DNA-DNA binding values in the range of 84 to 97.5 % confirmed that L. acidipiscis and L. cypricasei are synonymous species. On the basis of the present study, it is proposed that Lactobacillus cypricasei is a later heterotypic synonym of Lactobacillus acidipiscis.

Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III.

PubMed

Matsutani, Sachiko

2004-08-09

In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.

Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

NASA Technical Reports Server (NTRS)

Gutell, R. R.; Larsen, N.; Woese, C. R.

1994-01-01

The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical modification (in the isolated rRNA), which suggests that considerable higher-order structure remains to be found (although all of it may not involve base-base interactions and so may not be detectable by comparative analysis). The agreement between the higher-order structure of the small-subunit rRNA and protection against chemical modification is not perfect, however; some bases shown to covary canonically are accessible to chemical modification (45).(ABSTRACT TRUNCATED AT 400 WORDS).

The Fragmented Mitochondrial Ribosomal RNAs of Plasmodium falciparum

PubMed Central

Feagin, Jean E.; Harrell, Maria Isabel; Lee, Jung C.; Coe, Kevin J.; Sands, Bryan H.; Cannone, Jamie J.; Tami, Germaine; Schnare, Murray N.; Gutell, Robin R.

2012-01-01

Background The mitochondrial genome in the human malaria parasite Plasmodium falciparum is most unusual. Over half the genome is composed of the genes for three classic mitochondrial proteins: cytochrome oxidase subunits I and III and apocytochrome b. The remainder encodes numerous small RNAs, ranging in size from 23 to 190 nt. Previous analysis revealed that some of these transcripts have significant sequence identity with highly conserved regions of large and small subunit rRNAs, and can form the expected secondary structures. However, these rRNA fragments are not encoded in linear order; instead, they are intermixed with one another and the protein coding genes, and are coded on both strands of the genome. This unorthodox arrangement hindered the identification of transcripts corresponding to other regions of rRNA that are highly conserved and/or are known to participate directly in protein synthesis. Principal Findings The identification of 14 additional small mitochondrial transcripts from P. falcipaurm and the assignment of 27 small RNAs (12 SSU RNAs totaling 804 nt, 15 LSU RNAs totaling 1233 nt) to specific regions of rRNA are supported by multiple lines of evidence. The regions now represented are highly similar to those of the small but contiguous mitochondrial rRNAs of Caenorhabditis elegans. The P. falciparum rRNA fragments cluster on the interfaces of the two ribosomal subunits in the three-dimensional structure of the ribosome. Significance All of the rRNA fragments are now presumed to have been identified with experimental methods, and nearly all of these have been mapped onto the SSU and LSU rRNAs. Conversely, all regions of the rRNAs that are known to be directly associated with protein synthesis have been identified in the P. falciparum mitochondrial genome and RNA transcripts. The fragmentation of the rRNA in the P. falciparum mitochondrion is the most extreme example of any rRNA fragmentation discovered. PMID:22761677

DNA barcoding of Clarias gariepinus, Coptodon zillii and Sarotherodon melanotheron from Southwestern Nigeria

PubMed Central

Falade, Mofolusho O.; Opene, Anthony J.; Benson, Otarigho

2016-01-01

DNA barcoding has been adopted as a gold standard rapid, precise and unifying identification system for animal species and provides a database of genetic sequences that can be used as a tool for universal species identification. In this study, we employed mitochondrial genes 16S rRNA (16S) and cytochrome oxidase subunit I (COI) for the identification of some Nigerian freshwater catfish and Tilapia species. Approximately 655 bp were amplified from the 5′ region of the mitochondrial cytochrome C oxidase subunit I (COI) gene whereas 570 bp were amplified for the 16S rRNA gene. Nucleotide divergences among sequences were estimated based on Kimura 2-parameter distances and the genetic relationships were assessed by constructing phylogenetic trees using the neighbour-joining (NJ) and maximum likelihood (ML) methods. Analyses of consensus barcode sequences for each species, and alignment of individual sequences from within a given species revealed highly consistent barcodes (99% similarity on average), which could be compared with deposited sequences in public databases. The nucleotide distance between species belonging to different genera based on COI ranged from 0.17% between Sarotherodon melanotheron and Coptodon zillii to 0.49% between Clarias gariepinus and C. zillii, indicating that S. melanotheron and C. zillii are closely related. Based on the data obtained, the utility of COI gene was confirmed in accurate identification of three fish species from Southwest Nigeria. PMID:27990256

Genotypic variation of Pneumocystis jirovecii isolates in India based on sequence diversity at mitochondrial large subunit rRNA.

PubMed

Gupta, Rashmi; Mirdha, Bijay Ranjan; Guleria, Randeep; Agarwal, Sanjay Kumar; Samantaray, Jyotish Chandra; Kumar, Lalit; Kabra, Sushil Kumar; Luthra, Kalpana; Sreenivas, Vishnubhatla; Iyer, Venkateswaran K

2011-03-01

Pneumocystis pneumonia (PCP), a common and serious opportunistic infection in immunocompromised patients, is caused by Pneumocystis jirovecii (formerly known as Pneumocystis carinii f. sp. hominis). The aim of the present study was to describe the prevalence and distribution of genotypes of P. jirovecii based on sequence polymorphisms at mitochondrial large subunit ribosomal RNA (mt LSU rRNA) region in both HIV and non-HIV immunocompromised individuals with a positive PCR result for PCP in a tertiary health care centre in northern India. From January 2005 to October 2008, 50 patients [22 HIV-seropositive individuals, 10 post-renal transplant (PRT) recipients, 3 cancer patients, and 15 patients with various other kinds of immunosuppression] were found to be positive for P. jirovecii using PCR at the mt LSU rRNA gene. Genotyping of the positive samples was performed at the mt LSU rRNA locus. Genotype 2 was the most common accounting for 42% of total types. This was followed by the genotypes 3 (24%), 1 (20%), and 4 (8%). Mixed infection was observed in 3 cases (6%). The rates of genotype distribution were similar in HIV-seropositive individuals, cancer patients, and in patients with other kinds of immunosuppression. In the PRT recipients, genotype 1 was the most prevalent type (80%). This is the first study describing the prevalence of genotypes in HIV-infected and HIV-uninfected, immunocompromised patients based on the mt LSU rRNA gene from the Indian subcontinent. The most prevalent genotype observed was type 2 in contrast to many studies from other parts of the world where genotype 1 was the most prevalent type, suggesting geographical variation. Copyright © 2010 Elsevier GmbH. All rights reserved.

Phylogenetic position of the genus Perkinsus (Protista, Apicomplexa) based on small subunit ribosomal RNA.

PubMed

Goggin, C L; Barker, S C

1993-07-01

Parasites of the genus Perkinsus destroy marine molluscs worldwide. Their phylogenetic position within the kingdom Protista is controversial. Nucleotide sequence data (1792 bp) from the small subunit rRNA gene of Perkinsus sp. from Anadara trapezia (Mollusca: Bivalvia) from Moreton Bay, Queensland, was used to examine the phylogenetic affinities of this enigmatic genus. These data were aligned with nucleotide sequences from 6 apicomplexans, 3 ciliates, 3 flagellates, a dinoflagellate, 3 fungi, maize and human. Phylogenetic trees were constructed after analysis with maximum parsimony and distance matrix methods. Our analyses indicate that Perkinsus is phylogenetically closer to dinoflagellates and to coccidean and piroplasm apicomplexans than to fungi or flagellates.

A comparative study of COI and 16 S rRNA genes for DNA barcoding of cultivable carps in India.

PubMed

Mohanty, Mausumee; Jayasankar, Pallipuram; Sahoo, Lakshman; Das, Paramananda

2015-02-01

The 5' region of the mitochondrial DNA gene cytochrome c oxidase subunit I (COI) is the standard marker for DNA barcoding. However, 16 S rRNA has also been advocated for DNA barcoding in many animal species. Herein, we directly compare the usefulness of COI and 16 S rRNA in discriminating six cultivable carp species: Labeo rohita, Catla catla, Cirrhinus mrigala, Labeo fimbriatus, Labeo bata and Cirrhinus reba from India. Analysis of partial sequences of these two gene fragments from 171 individuals indicated close genetic relationship between Catla catla and Labeo rohita. The results of the present study indicated COI to be more useful than 16 S rRNA for DNA barcoding of Indian carps.

Phylogenetic Analysis of Theileria annulata Infected Cell Line S15 Iran Vaccine Strain.

PubMed

Habibi, Gh

2012-01-01

Bovine theileriosis results from infection with obligate intracellular protozoa of the genus Theileria. The phylogenetic relationships between two isolates of Theileria annulata, and 36 Theileria spp., as well as 6 outgroup including Babesia spp. and coccidian protozoa were analyzed using the 18S rRNA gene sequence. The target DNA segment was amplified by PCR. The PCR product was used for direct sequencing. The length of the 18S rRNA gene of all Theileria spp. involved in this study was around 1,400 bp. A phylogenetic tree was inferred based on the 18S rRNA gene sequence of the Iran and Iraq isolates, and other species of Theileria available in GenBank. In the constructed tree, Theileria annulata (Iran vaccine strain) was closely related to other T. annulata from Europe, Asia, as well as T. lestoquardi, T. parva and T. taurotragi all in one clade. Phylogenetic analyses based on small subunit ribosomal RNA gene suggested that the percent identity of the sequence of Iran vaccine strain was completely the same as Iraq sequence (100% identical), but the similarity of Iran vaccine strain with other T. annulata reported from China, Spain and Italy determined the 97.9 to 99.9% identity.

Evolutionary relationships among pathogenic Candida species and relatives.

PubMed Central

Barns, S M; Lane, D J; Sogin, M L; Bibeau, C; Weisburg, W G

1991-01-01

Small subunit rRNA sequences have been determined for 10 of the most clinically important pathogenic species of the yeast genus Candida (including Torulopsis [Candida] glabrata and Yarrowia [Candida] lipolytica) and for Hansenula polymorpha. Phylogenetic analyses of these sequences and those of Saccharomyces cerevisiae, Kluyveromyces marxianus var. lactis, and Aspergillus fumigatus indicate that Candida albicans, C. tropicalis, C. parapsilosis, and C. viswanathii form a subgroup within the genus. The remaining significant pathogen, T. glabrata, falls into a second, distinct subgroup and is specifically related to S. cerevisiae and more distantly related to C. kefyr (psuedotropicalis) and K. marxianus var. lactis. The 18S rRNA sequence of Y. lipolytica has evolved rapidly in relation to the other Candida sequences examined and appears to be only distantly related to them. As anticipated, species of several other genera appear to bear specific relationships to members of the genus Candida. PMID:2007550

Utility of COX1 phylogenetics to differentiate between locally acquired and imported Plasmodium knowlesi infections in Singapore

PubMed Central

Loh, Jin Phang; Gao, Qiu Han Christine; Lee, Vernon J; Tetteh, Kevin; Drakeley, Chris

2016-01-01

INTRODUCTION Although there have been several phylogenetic studies on Plasmodium knowlesi (P. knowlesi), only cytochrome c oxidase subunit 1 (COX1) gene analysis has shown some geographical differentiation between the isolates of different countries. METHODS Phylogenetic analysis of locally acquired P. knowlesi infections, based on circumsporozoite, small subunit ribosomal ribonucleic acid (SSU rRNA), merozoite surface protein 1 and COX1 gene targets, was performed. The results were compared with the published sequences of regional isolates from Malaysia and Thailand. RESULTS Phylogenetic analysis of the circumsporozoite, SSU rRNA and merozoite surface protein 1 gene sequences for regional P. knowlesi isolates showed no obvious differentiation that could be attributed to their geographical origin. However, COX1 gene analysis showed that it was possible to differentiate between Singapore-acquired P. knowlesi infections and P. knowlesi infections from Peninsular Malaysia and Sarawak, Borneo, Malaysia. CONCLUSION The ability to differentiate between locally acquired P. knowlesi infections and imported P. knowlesi infections has important utility for the monitoring of P. knowlesi malaria control programmes in Singapore. PMID:26805667

Utility of COX1 phylogenetics to differentiate between locally acquired and imported Plasmodium knowlesi infections in Singapore.

PubMed

Loh, Jin Phang; Gao, Qiu Han Christine; Lee, Vernon J; Tetteh, Kevin; Drakeley, Chris

2016-12-01

Although there have been several phylogenetic studies on Plasmodium knowlesi (P. knowlesi), only cytochrome c oxidase subunit 1 (COX1) gene analysis has shown some geographical differentiation between the isolates of different countries. Phylogenetic analysis of locally acquired P. knowlesi infections, based on circumsporozoite, small subunit ribosomal ribonucleic acid (SSU rRNA), merozoite surface protein 1 and COX1 gene targets, was performed. The results were compared with the published sequences of regional isolates from Malaysia and Thailand. Phylogenetic analysis of the circumsporozoite, SSU rRNA and merozoite surface protein 1 gene sequences for regional P. knowlesi isolates showed no obvious differentiation that could be attributed to their geographical origin. However, COX1 gene analysis showed that it was possible to differentiate between Singapore-acquired P. knowlesi infections and P. knowlesi infections from Peninsular Malaysia and Sarawak, Borneo, Malaysia. The ability to differentiate between locally acquired P. knowlesi infections and imported P. knowlesi infections has important utility for the monitoring of P. knowlesi malaria control programmes in Singapore. Copyright: © Singapore Medical Association

Accurate, Rapid Taxonomic Classification of Fungal Large-Subunit rRNA Genes

PubMed Central

Liu, Kuan-Liang; Porras-Alfaro, Andrea; Eichorst, Stephanie A.

2012-01-01

Taxonomic and phylogenetic fingerprinting based on sequence analysis of gene fragments from the large-subunit rRNA (LSU) gene or the internal transcribed spacer (ITS) region is becoming an integral part of fungal classification. The lack of an accurate and robust classification tool trained by a validated sequence database for taxonomic placement of fungal LSU genes is a severe limitation in taxonomic analysis of fungal isolates or large data sets obtained from environmental surveys. Using a hand-curated set of 8,506 fungal LSU gene fragments, we determined the performance characteristics of a naïve Bayesian classifier across multiple taxonomic levels and compared the classifier performance to that of a sequence similarity-based (BLASTN) approach. The naïve Bayesian classifier was computationally more rapid (>460-fold with our system) than the BLASTN approach, and it provided equal or superior classification accuracy. Classifier accuracies were compared using sequence fragments of 100 bp and 400 bp and two different PCR primer anchor points to mimic sequence read lengths commonly obtained using current high-throughput sequencing technologies. Accuracy was higher with 400-bp sequence reads than with 100-bp reads. It was also significantly affected by sequence location across the 1,400-bp test region. The highest accuracy was obtained across either the D1 or D2 variable region. The naïve Bayesian classifier provides an effective and rapid means to classify fungal LSU sequences from large environmental surveys. The training set and tool are publicly available through the Ribosomal Database Project (http://rdp.cme.msu.edu/classifier/classifier.jsp). PMID:22194300

Phylogenetic stratigraphy in the Guerrero Negro hypersaline microbial mat.

PubMed

Harris, J Kirk; Caporaso, J Gregory; Walker, Jeffrey J; Spear, John R; Gold, Nicholas J; Robertson, Charles E; Hugenholtz, Philip; Goodrich, Julia; McDonald, Daniel; Knights, Dan; Marshall, Paul; Tufo, Henry; Knight, Rob; Pace, Norman R

2013-01-01

The microbial mats of Guerrero Negro (GN), Baja California Sur, Mexico historically were considered a simple environment, dominated by cyanobacteria and sulfate-reducing bacteria. Culture-independent rRNA community profiling instead revealed these microbial mats as among the most phylogenetically diverse environments known. A preliminary molecular survey of the GN mat based on only ∼1500 small subunit rRNA gene sequences discovered several new phylum-level groups in the bacterial phylogenetic domain and many previously undetected lower-level taxa. We determined an additional ∼119,000 nearly full-length sequences and 28,000 >200 nucleotide 454 reads from a 10-layer depth profile of the GN mat. With this unprecedented coverage of long sequences from one environment, we confirm the mat is phylogenetically stratified, presumably corresponding to light and geochemical gradients throughout the depth of the mat. Previous shotgun metagenomic data from the same depth profile show the same stratified pattern and suggest that metagenome properties may be predictable from rRNA gene sequences. We verify previously identified novel lineages and identify new phylogenetic diversity at lower taxonomic levels, for example, thousands of operational taxonomic units at the family-genus levels differ considerably from known sequences. The new sequences populate parts of the bacterial phylogenetic tree that previously were poorly described, but indicate that any comprehensive survey of GN diversity has only begun. Finally, we show that taxonomic conclusions are generally congruent between Sanger and 454 sequencing technologies, with the taxonomic resolution achieved dependent on the abundance of reference sequences in the relevant region of the rRNA tree of life.

rRNA fragmentation induced by a yeast killer toxin.

PubMed

Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

2014-02-01

Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. © 2013 John Wiley & Sons Ltd.

Small subunit ribosomal RNA genes of tabanids and hippoboscids (Diptera: Brachycera): evolutionary relationships and comparison with other Diptera.

PubMed

Carreno, R A; Barta, J R

1998-11-01

The small subunit ribosomal RNA (SSU rRNA) genes of hippoboscid (Ornithoica vicina Walker) and tabanid (Chrysops niger Macquart) Diptera were sequenced to determine their phylogenetic position within the order and to determine whether or not extensive hypervariable regions in this gene are widespread in the Diptera. A parsimony analysis of an alignment containing 8 dipteran sequences produced a single most parsimonious tree that placed O. vicina as sister group to Drosophila melanogaster Meigen. The tabanid Chrysops niger was sister group to the asilomorphan taxa, and the sister group to the Brachycera was a Tipula sp. although this relationship was not supported by bootstrap analysis. The hippoboscid and tabanid sequences contain extensive hypervariable regions in the V2, V4, V6, and V7 regions as do other Diptera. When these regions of the alignment were excluded from the phylogenetic analysis, a single most parsimonious tree was found. This tree had an identical overall topology to the tree obtained from the total data set. The hypervariable regions in parts of the dipteran SSU rRNA genes were more extensive in the nematocerous dipteran sequences used in this study than in the other dipteran representatives; these hypervariable regions may be of more utility in inferring relationship among species and subspecies than at the suprageneric level.

Pseudopropionibacterium sp. nov., a novel red-pigmented species isolated from human gingival sulcus.

PubMed

Saito, Masanori; Shinozaki-Kuwahara, Noriko; Tsudukibashi, Osamu; Hashizume-Takizawa, Tomomi; Kobayashi, Ryoki; Kurita-Ochiai, Tomoko

2018-04-24

Strain SK-1 T is a novel Gram stain-positive, pleomorphic, rod-shaped, non-spore forming, and non-motile organism, designated SK-1 T , isolated from human gingival sulcus that produces acetic acid, propionic acid, lactic acid, and succinic acid as end products of glucose fermentation. Strain SK-1 T had the closest relatedness to Pseudopropionibacterium (Propionibacterium) propionicum with sequence homologies of the 16S rRNA and RNA polymerase β subunit (rpoB) genes of 96.6% and 93.1%, respectively. The genomic DNA G + C content of the isolate was 61.8 mol%. Based on the sequence data of the 16S rRNA and housekeeping (rpoB) genes, we propose a novel taxon, Pseudopropionibacterium rubrum sp. nov. (type strain SK-1 T = JCM 31317T= DSM 100122T). The 16S rRNA and rpoB gene sequences of strain SK-1 T were deposited to the DNA Data Bank of Japan under the accession numbers LC002971 and LC102236, respectively. © 2018 The Societies and John Wiley & Sons Australia, Ltd.

Analysis of the gut microbiome in beef cattle and its association with feed intake, growth, and efficiency

USDA-ARS?s Scientific Manuscript database

Next-generation sequencing has taken a central role in studies of microbial ecology, especially with regard to culture-independent methods based on molecular phylogenies of the small-subunit ribosomal RNA gene (16S rRNA gene). The ability to relate trends at the species or genus level to host/envir...

Problem-Based Test: Functional Analysis of Mutant 16S rRNAs

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2010-01-01

Terms to be familiar with before you start to solve the test: ribosome, ribosomal subunits, antibiotics, point mutation, 16S, 5S, and 23S rRNA, Shine-Dalgarno sequence, mRNA, tRNA, palindrome, hairpin, restriction endonuclease, fMet-tRNA, peptidyl transferase, initiation, elongation, termination of translation, expression plasmid, transformation,…

Phylogenetic Relationships of Yessotoxin-Producing Dinoflagellates, Based on the Large Subunit and Internal Transcribed Spacer Ribosomal DNA Domains▿

PubMed Central

Howard, Meredith D. A.; Smith, G. Jason; Kudela, Raphael M.

2009-01-01

Yessotoxin (YTX) is a globally distributed marine toxin produced by some isolates of the dinoflagellate species Protoceratium reticulatum, Lingulodinium polyedrum, and Gonyaulax spinifera within the order Gonyaulacales. The process of isolating cells and testing each isolate individually for YTX production during toxic blooms are labor intensive, and this impedes our ability to respond quickly to toxic blooms. In this study, we used molecular sequences from the large subunit and internal transcribed spacer genomic regions in the ribosomal operon of known YTX-producing dinoflagellates to determine if genetic differences exist among geographically distinct populations or between toxic and nontoxic isolates within species. In all analyses, all three YTX-producing species fell within the Gonyaulacales order in agreement with morphological taxonomy. Phylogenetic analyses of available rRNA gene sequences indicate that the capacity for YTX production appears to be confined to the order Gonyaulacales. These findings indicate that Gonyaulacoloid dinoflagellate species are the most likely to produce YTX and thus should be prioritized for YTX screening during events. Dinoflagellate species that fall outside of the Gonyaulacales order are unlikely to produce YTX. Although the rRNA operon offers multiple sequence domains to resolve species level diversification within this dinoflagellate order, these domains are not sufficiently variable to provide robust markers for YTX toxicity. PMID:19011074

Evolution of nuclear ribosomal RNAs in kinetoplastid protozoa: perspectives on the age and origins of parasitism.

PubMed Central

Fernandes, A P; Nelson, K; Beverley, S M

1993-01-01

Molecular evolutionary relationships within the protozoan order Kinetoplastida were deduced from comparisons of the nuclear small and large subunit ribosomal RNA (rRNA) gene sequences. These studies show that relationships among the trypanosomatid protozoans differ from those previously proposed from studies of organismal characteristics or mitochondrial rRNAs. The genera Leishmania, Endotrypanum, Leptomonas, and Crithidia form a closely related group, which shows progressively more distant relationships to Phytomonas and Blastocrithidia, Trypanosoma cruzi, and lastly Trypanosoma brucei. The rooting of the trypanosomatid tree was accomplished by using Bodo caudatus (family Bodonidae) as an outgroup, a status confirmed by molecular comparisons with other eukaryotes. The nuclear rRNA tree agrees well with data obtained from comparisons of other nuclear genes. Differences with the proposed mitochondrial rRNA tree probably reflect the lack of a suitable outgroup for this tree, as the topologies are otherwise similar. Small subunit rRNA divergences within the trypanosomatids are large, approaching those among plants and animals, which underscores the evolutionary antiquity of the group. Analysis of the distribution of different parasitic life-styles of these species in conjunction with a probable timing of evolutionary divergences suggests that vertebrate parasitism arose multiple times in the trypanosomatids. PMID:8265597

Comparison of sequencing the D2 region of the large subunit ribosomal RNA gene (MicroSEQ®) versus the internal transcribed spacer (ITS) regions using two public databases for identification of common and uncommon clinically relevant fungal species.

PubMed

Arbefeville, S; Harris, A; Ferrieri, P

2017-09-01

Fungal infections cause considerable morbidity and mortality in immunocompromised patients. Rapid and accurate identification of fungi is essential to guide accurately targeted antifungal therapy. With the advent of molecular methods, clinical laboratories can use new technologies to supplement traditional phenotypic identification of fungi. The aims of the study were to evaluate the sole commercially available MicroSEQ® D2 LSU rDNA Fungal Identification Kit compared to the in-house developed internal transcribed spacer (ITS) regions assay in identifying moulds, using two well-known online public databases to analyze sequenced data. 85 common and uncommon clinically relevant fungi isolated from clinical specimens were sequenced for the D2 region of the large subunit (LSU) of ribosomal RNA (rRNA) gene with the MicroSEQ® Kit and the ITS regions with the in house developed assay. The generated sequenced data were analyzed with the online GenBank and MycoBank public databases. The D2 region of the LSU rRNA gene identified 89.4% or 92.9% of the 85 isolates to the genus level and the full ITS region (f-ITS) 96.5% or 100%, using GenBank or MycoBank, respectively, when compared to the consensus ID. When comparing species-level designations to the consensus ID, D2 region of the LSU rRNA gene aligned with 44.7% (38/85) or 52.9% (45/85) of these isolates in GenBank or MycoBank, respectively. By comparison, f-ITS possessed greater specificity, followed by ITS1, then ITS2 regions using GenBank or MycoBank. Using GenBank or MycoBank, D2 region of the LSU rRNA gene outperformed phenotypic based ID at the genus level. Comparing rates of ID between D2 region of the LSU rRNA gene and the ITS regions in GenBank or MycoBank at the species level against the consensus ID, f-ITS and ITS2 exceeded performance of the D2 region of the LSU rRNA gene, but ITS1 had similar performance to the D2 region of the LSU rRNA gene using MycoBank. Our results indicated that the MicroSEQ® D2 LSU rDNA Fungal Identification Kit was equivalent to the in-house developed ITS regions assay to identify fungi at the genus level. The MycoBank database gave a better curated database and thus allowed a better genus and species identification for both D2 region of the LSU rRNA gene and ITS regions. Copyright © 2017 Elsevier B.V. All rights reserved.

DNAJC21 Mutations Link a Cancer-Prone Bone Marrow Failure Syndrome to Corruption in 60S Ribosome Subunit Maturation.

PubMed

Tummala, Hemanth; Walne, Amanda J; Williams, Mike; Bockett, Nicholas; Collopy, Laura; Cardoso, Shirleny; Ellison, Alicia; Wynn, Rob; Leblanc, Thierry; Fitzgibbon, Jude; Kelsell, David P; van Heel, David A; Payne, Elspeth; Plagnol, Vincent; Dokal, Inderjeet; Vulliamy, Tom

2016-07-07

A substantial number of individuals with bone marrow failure (BMF) present with one or more extra-hematopoietic abnormality. This suggests a constitutional or inherited basis, and yet many of them do not fit the diagnostic criteria of the known BMF syndromes. Through exome sequencing, we have now identified a subgroup of these individuals, defined by germline biallelic mutations in DNAJC21 (DNAJ homolog subfamily C member 21). They present with global BMF, and one individual developed a hematological cancer (acute myeloid leukemia) in childhood. We show that the encoded protein associates with rRNA and plays a highly conserved role in the maturation of the 60S ribosomal subunit. Lymphoblastoid cells obtained from an affected individual exhibit increased sensitivity to the transcriptional inhibitor actinomycin D and reduced amounts of rRNA. Characterization of mutations revealed impairment in interactions with cofactors (PA2G4, HSPA8, and ZNF622) involved in 60S maturation. DNAJC21 deficiency resulted in cytoplasmic accumulation of the 60S nuclear export factor PA2G4, aberrant ribosome profiles, and increased cell death. Collectively, these findings demonstrate that mutations in DNAJC21 cause a cancer-prone BMF syndrome due to corruption of early nuclear rRNA biogenesis and late cytoplasmic maturation of the 60S subunit. Copyright © 2016. Published by Elsevier Inc.

Complete genome sequence of Dehalogenimonas lykanthroporepellens type strain (BL-DC-9T) and comparison to Dehalococcoides strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siddaramappa, Shivakumara; Delano, Susana; Green, Lance D.

2012-01-01

Dehalogenimonas lykanthroporepellens is the type species of the genus Dehalogenimonas, which belongs to a deeply branching lineage within the phylum Chloroflexi. This strictly anaerobic, mesophilic, non spore forming, Gram negative staining bacterium was first isolated from chlorinated solvent contaminated groundwater at a Superfund site located near Baton Rouge, Louisiana, USA. D. lykanthroporepellens was of interest for genome sequencing for two reasons: (a) its unusual ability to couple growth with reductive dechlorination of environmentally important polychlorinated aliphatic alkanes and (b) its phylogenetic position distant from previously sequenced bacteria. The 1,686,510 bp circular chromosome of strain BL-DC-9{sup T} contains 1,720 predicted proteinmore » coding genes, 47 tRNA genes, a single large subunit rRNA (23S-5S) locus, and a single, orphan, small unit rRNA (16S) locus.« less

Streptococcus oricebi sp. nov., isolated from the oral cavity of tufted capuchin.

PubMed

Saito, M; Shinozaki-Kuwahara, N; Hirasawa, M; Takada, K

2016-02-01

A Gram-stain-positive, catalase-negative, coccus-shaped organism was isolated from the oral cavity of tufted capuchin (Cebus apella). Comparative 16S rRNA gene sequence analysis suggested classification of the organism within the genus Streptococcus. Strain M8T was related most closely to Streptococcus oralis ATCC 35037T (96.17 % similarity) followed by Streptococcus massiliensis CCUG 49690T (95.90 %) based on the 16S rRNA gene. Strain M8T was related most closely to S. massiliensis CCUG 49690T (86.58 %) based on the RNA polymerase β subunit-encoding gene (rpoB), and to Streptococcus tigurinus AZ_3aT (81.26 %) followed by S. massiliensis CCUG 49690T (80.45 %) based on the 60 kDa heat-shock protein gene (groEL). The phylogenetic trees of 16S rRNA, rpoB and groEL gene sequences showed that strain M8T was most closely related to S. massiliensis. Based on phenotypic characterization as well as 16S rRNA gene and housekeeping gene (rpoB and groEL) sequence data, a novel taxon, Streptococcus oricebi sp. nov. (type strain M8T = JCM 30719T = DSM 100101T), is proposed.

Uncommonly isolated clinical Pseudomonas: identification and phylogenetic assignation.

PubMed

Mulet, M; Gomila, M; Ramírez, A; Cardew, S; Moore, E R B; Lalucat, J; García-Valdés, E

2017-02-01

Fifty-two Pseudomonas strains that were difficult to identify at the species level in the phenotypic routine characterizations employed by clinical microbiology laboratories were selected for genotypic-based analysis. Species level identifications were done initially by partial sequencing of the DNA dependent RNA polymerase sub-unit D gene (rpoD). Two other gene sequences, for the small sub-unit ribosonal RNA (16S rRNA) and for DNA gyrase sub-unit B (gyrB) were added in a multilocus sequence analysis (MLSA) study to confirm the species identifications. These sequences were analyzed with a collection of reference sequences from the type strains of 161 Pseudomonas species within an in-house multi-locus sequence analysis database. Whole-cell matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) analyses of these strains complemented the DNA sequenced-based phylogenetic analyses and were observed to be in accordance with the results of the sequence data. Twenty-three out of 52 strains were assigned to 12 recognized species not commonly detected in clinical specimens and 29 (56 %) were considered representatives of at least ten putative new species. Most strains were distributed within the P. fluorescens and P. aeruginosa lineages. The value of rpoD sequences in species-level identifications for Pseudomonas is emphasized. The correct species identifications of clinical strains is essential for establishing the intrinsic antibiotic resistance patterns and improved treatment plans.

Phenotypic and phylogenetic characterization of ruminal tannin-tolerant bacteria.

PubMed

Nelson, K E; Thonney, M L; Woolston, T K; Zinder, S H; Pell, A N

1998-10-01

The 16S rRNA sequences and selected phenotypic characteristics were determined for six recently isolated bacteria that can tolerate high levels of hydrolyzable and condensed tannins. Bacteria were isolated from the ruminal contents of animals in different geographic locations, including Sardinian sheep (Ovis aries), Honduran and Colombian goats (Capra hircus), white-tail deer (Odocoileus virginianus) from upstate New York, and Rocky Mountain elk (Cervus elaphus nelsoni) from Oregon. Nearly complete sequences of the small-subunit rRNA genes, which were obtained by PCR amplification, cloning, and sequencing, were used for phylogenetic characterization. Comparisons of the 16S rRNA of the six isolates showed that four of the isolates were members of the genus Streptococcus and were most closely related to ruminal strains of Streptococcus bovis and the recently described organism Streptococcus gallolyticus. One of the other isolates, a gram-positive rod, clustered with the clostridia in the low-G+C-content group of gram-positive bacteria. The sixth isolate, a gram-negative rod, was a member of the family Enterobacteriaceae in the gamma subdivision of the class Proteobacteria. None of the 16S rRNA sequences of the tannin-tolerant bacteria examined was identical to the sequence of any previously described microorganism or to the sequence of any of the other organisms examined in this study. Three phylogenetically distinct groups of ruminal bacteria were isolated from four species of ruminants in Europe, North America, and South America. The presence of tannin-tolerant bacteria is not restricted by climate, geography, or host animal, although attempts to isolate tannin-tolerant bacteria from cows on low-tannin diets failed.

Phenotypic and Phylogenetic Characterization of Ruminal Tannin-Tolerant Bacteria

PubMed Central

Nelson, Karen E.; Thonney, Michael L.; Woolston, Tina K.; Zinder, Stephen H.; Pell, Alice N.

1998-01-01

The 16S rRNA sequences and selected phenotypic characteristics were determined for six recently isolated bacteria that can tolerate high levels of hydrolyzable and condensed tannins. Bacteria were isolated from the ruminal contents of animals in different geographic locations, including Sardinian sheep (Ovis aries), Honduran and Colombian goats (Capra hircus), white-tail deer (Odocoileus virginianus) from upstate New York, and Rocky Mountain elk (Cervus elaphus nelsoni) from Oregon. Nearly complete sequences of the small-subunit rRNA genes, which were obtained by PCR amplification, cloning, and sequencing, were used for phylogenetic characterization. Comparisons of the 16S rRNA of the six isolates showed that four of the isolates were members of the genus Streptococcus and were most closely related to ruminal strains of Streptococcus bovis and the recently described organism Streptococcus gallolyticus. One of the other isolates, a gram-positive rod, clustered with the clostridia in the low-G+C-content group of gram-positive bacteria. The sixth isolate, a gram-negative rod, was a member of the family Enterobacteriaceae in the gamma subdivision of the class Proteobacteria. None of the 16S rRNA sequences of the tannin-tolerant bacteria examined was identical to the sequence of any previously described microorganism or to the sequence of any of the other organisms examined in this study. Three phylogenetically distinct groups of ruminal bacteria were isolated from four species of ruminants in Europe, North America, and South America. The presence of tannin-tolerant bacteria is not restricted by climate, geography, or host animal, although attempts to isolate tannin-tolerant bacteria from cows on low-tannin diets failed. PMID:9758806

High-Throughput Amplicon Sequencing Reveals Distinct Communities within a Corroding Concrete Sewer System

PubMed Central

Dennis, Paul G.; Keller, Jurg; Tyson, Gene W.

2012-01-01

Microbially induced concrete corrosion (MICC) is an important problem in sewers. Here, small-subunit (SSU) rRNA gene amplicon pyrosequencing was used to characterize MICC communities. Microbial community composition differed between wall- and ceiling-associated MICC layers. Acidithiobacillus spp. were present at low abundances, and the communities were dominated by other sulfur-oxidizing-associated lineages. PMID:22843532

Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

PubMed

Viscogliosi, E; Edgcomb, V P; Gerbod, D; Noël, C; Delgado-Viscogliosi, P

1999-12-01

The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

NASA Technical Reports Server (NTRS)

Viscogliosi, E.; Edgcomb, V. P.; Gerbod, D.; Noel, C.; Delgado-Viscogliosi, P.; Sogin, M. L. (Principal Investigator)

1999-01-01

The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

The conserved mitochondrial gene distribution in relatives of Turritopsis nutricula, an immortal jellyfish.

PubMed

Devarapalli, Pratap; Kumavath, Ranjith N; Barh, Debmalya; Azevedo, Vasco

2014-01-01

Turritopsis nutricula (T. nutricula) is the one of the known reported organisms that can revert its life cycle to the polyp stage even after becoming sexually mature, defining itself as the only immortal organism in the animal kingdom. Therefore, the animal is having prime importance in basic biological, aging, and biomedical researches. However, till date, the genome of this organism has not been sequenced and even there is no molecular phylogenetic study to reveal its close relatives. Here, using phylogenetic analysis based on available 16s rRNA gene and protein sequences of Cytochrome oxidase subunit-I (COI or COX1) of T. nutricula, we have predicted the closest relatives of the organism. While we found Nemopsis bachei could be closest organism based on COX1 gene sequence; T. dohrnii may be designated as the closest taxon to T. nutricula based on rRNA. Moreover, we have figured out four species that showed similar root distance based on COX1 protein sequence.

Regulation of Plasmodium yoelii oocyst development by strain- and stage-specific small-subunit rRNA.

PubMed

Qi, Yanwei; Zhu, Feng; Eastman, Richard T; Fu, Young; Zilversmit, Martine; Pattaradilokrat, Sittiporn; Hong, Lingxian; Liu, Shengfa; McCutchan, Thomas F; Pan, Weiqing; Xu, Wenyue; Li, Jian; Huang, Fusheng; Su, Xin-zhuan

2015-03-10

One unique feature of malaria parasites is the differential transcription of structurally distinct rRNA (rRNA) genes at different developmental stages: the A-type genes are transcribed mainly in asexual stages, whereas the S-type genes are expressed mostly in sexual or mosquito stages. Conclusive functional evidence of different rRNAs in regulating stage-specific parasite development, however, is still absent. Here we performed genetic crosses of Plasmodium yoelii parasites with one parent having an oocyst development defect (ODD) phenotype and another producing normal oocysts to identify the gene(s) contributing to the ODD. The parent with ODD--characterized as having small oocysts and lacking infective sporozoites--was obtained after introduction of a plasmid with a green fluorescent protein gene into the parasite genome and subsequent passages in mice. Quantitative trait locus analysis of genome-wide microsatellite genotypes of 48 progeny from the crosses linked an ~200-kb segment on chromosome 6 containing one of the S-type genes (D-type small subunit rRNA gene [D-ssu]) to the ODD. Fine mapping of the plasmid integration site, gene expression pattern, and gene knockout experiments demonstrated that disruption of the D-ssu gene caused the ODD phenotype. Interestingly, introduction of the D-ssu gene into the same parasite strain (self), but not into a different subspecies, significantly affected or completely ablated oocyst development, suggesting a stage- and subspecies (strain)-specific regulation of oocyst development by D-ssu. This study demonstrates that P. yoelii D-ssu is essential for normal oocyst and sporozoite development and that variation in the D-ssu sequence can have dramatic effects on parasite development. Malaria parasites are the only known organisms that express structurally distinct rRNA genes at different developmental stages. The differential expression of these genes suggests that they play unique roles during the complex life cycle of the parasites. Conclusive functional proof of different rRNAs in regulating parasite development, however, is still absent or controversial. Here we functionally demonstrate for the first time that a stage-specifically expressed D-type small-subunit rRNA gene (D-ssu) is essential for oocyst development of the malaria parasite Plasmodium yoelii in the mosquito. This study also shows that variations in D-ssu sequence and/or the timing of transcription may have profound effects on parasite oocyst development. The results show that in addition to protein translation, rRNAs of malaria parasites also regulate parasite development and differentiation in a strain-specific manner, which can be explored for controlling parasite transmission. Copyright © 2015 Qi et al.

Low DNA Sequence Diversity of the Intergenic Spacer 1 Region in the Human Skin Commensal Fungi Malassezia sympodialis and M. dermatis Isolated from Patients with Malassezia-Associated Skin Diseases and Healthy Subjects.

PubMed

Cho, Otomi; Sugita, Takashi

2016-12-01

As DNA sequences of the intergenic spacer (IGS) region in the rRNA gene show remarkable intraspecies diversity compared with the small subunit, large subunit, and internal transcribed spacer region, the IGS region has been used as an epidemiological tool in studies on Malassezia globosa and M. restricta, which are responsible for the exacerbation of atopic dermatitis (AD) and seborrheic dermatitis (SD). However, the IGS regions of M. sympodialis and M. dermatis obtained from the skin of patients with AD and SD, as well as healthy subjects, lacked sequence diversity. Of the 105 M. sympodialis strains and the 40 M. dermatis strains, the sequences of 103 (98.1 %) and 39 (97.5 %), respectively, were identical. Thus, given the lack of intraspecies diversity in the IGS regions of M. sympodialis and M. dermatis, studies of the diversity of these species should be performed using appropriate genes and not the IGS.

Molecular epidemiological characterization of poultry red mite, Dermanyssus gallinae, in Japan

PubMed Central

CHU, Thi Thanh Huong; MURANO, Takako; UNO, Yukiko; USUI, Tatsufumi; YAMAGUCHI, Tsuyoshi

2015-01-01

Dermanyssus gallinae, the poultry red mite, is an obligatory blood-sucking ectoparasite. The genetic diversity of D. gallinae has been examined in some countries, but so far not in Asian countries. Here, we sequenced a part of the mitochondrial cytochrome oxidase subunit I (COI) and16S rRNA genes and nuclear internal transcribed spacers (ITS) region in 239 mite samples collected from 40 prefectures throughout Japan. The COI and 16S rRNA nucleotide sequences were classified into 28 and 26 haplotypes, respectively. In phylogenetic trees, the haplotypes clustered into 2 haplogroups corresponding to haplogroups A and B, which were previously reported. Haplogroups A and B were further subdivided into sub-haplogroups AJ1 and AJ2, and BJ1 and BJ2, respectively. In both trees, the sequences of haplotypes in AJ1 and BJ2 were relatively distant from those reported in other countries, while some sequences in AJ2 and BJ1 were identical to those in Europe. In addition, the ITS sequences were classified into two sequences, and both sequences were closely related to the sequences found in European countries. These findings indicate a possibility of international oversea transmission of D. gallinae. PMID:26074251

Molecular epidemiological characterization of poultry red mite, Dermanyssus gallinae, in Japan.

PubMed

Chu, Thi Thanh Huong; Murano, Takako; Uno, Yukiko; Usui, Tatsufumi; Yamaguchi, Tsuyoshi

2015-11-01

Dermanyssus gallinae, the poultry red mite, is an obligatory blood-sucking ectoparasite. The genetic diversity of D. gallinae has been examined in some countries, but so far not in Asian countries. Here, we sequenced a part of the mitochondrial cytochrome oxidase subunit I (COI) and16S rRNA genes and nuclear internal transcribed spacers (ITS) region in 239 mite samples collected from 40 prefectures throughout Japan. The COI and 16S rRNA nucleotide sequences were classified into 28 and 26 haplotypes, respectively. In phylogenetic trees, the haplotypes clustered into 2 haplogroups corresponding to haplogroups A and B, which were previously reported. Haplogroups A and B were further subdivided into sub-haplogroups AJ1 and AJ2, and BJ1 and BJ2, respectively. In both trees, the sequences of haplotypes in AJ1 and BJ2 were relatively distant from those reported in other countries, while some sequences in AJ2 and BJ1 were identical to those in Europe. In addition, the ITS sequences were classified into two sequences, and both sequences were closely related to the sequences found in European countries. These findings indicate a possibility of international oversea transmission of D. gallinae.

Post-transcriptional modifications in the small subunit ribosomal RNA from Thermotoga maritima, including presence of a novel modified cytidine

PubMed Central

Guymon, Rebecca; Pomerantz, Steven C.; Ison, J. Nicholas; Crain, Pamela F.; McCloskey, James A.

2007-01-01

Post-transcriptional modifications of RNA are nearly ubiquitous in the principal RNAs involved in translation. However, in the case of rRNA the functional roles of modification are far less established than for tRNA, and are subject to less knowledge in terms of specific nucleoside identities and their sequence locations. Post-transcriptional modifications have been studied in the SSU rRNA from Thermotoga maritima (optimal growth 80°C), one of the most deeply branched organisms in the Eubacterial phylogenetic tree. A total of 10 different modified nucleosides were found, the greatest number reported for bacterial SSU rRNA, occupying a net of ∼14 sequence sites, compared with a similar number of sites recently reported for Thermus thermophilus and 11 for Escherichia coli. The relatively large number of modifications in Thermotoga offers modest support for the notion that thermophile rRNAs are more extensively modified than those from mesophiles. Seven of the Thermotoga modified sites are identical (location and identity) to those in E. coli. An unusual derivative of cytidine was found, designated N-330 (M r 330.117), and was sequenced to position 1404 in the decoding region of the rRNA. It was unexpectedly found to be identical to an earlier reported nucleoside of unknown structure at the same location in the SSU RNA of the archaeal mesophile Haloferax volcanii. PMID:17255199

Cryo-EM structure of the large subunit of the spinach chloroplast ribosome

PubMed Central

Ahmed, Tofayel; Yin, Zhan; Bhushan, Shashi

2016-01-01

Protein synthesis in the chloroplast is mediated by the chloroplast ribosome (chloro-ribosome). Overall architecture of the chloro-ribosome is considerably similar to the Escherichia coli (E. coli) ribosome but certain differences are evident. The chloro-ribosome proteins are generally larger because of the presence of chloroplast-specific extensions in their N- and C-termini. The chloro-ribosome harbours six plastid-specific ribosomal proteins (PSRPs); four in the small subunit and two in the large subunit. Deletions and insertions occur throughout the rRNA sequence of the chloro-ribosome (except for the conserved peptidyl transferase center region) but the overall length of the rRNAs do not change significantly, compared to the E. coli. Although, recent advancements in cryo-electron microscopy (cryo-EM) have provided detailed high-resolution structures of ribosomes from many different sources, a high-resolution structure of the chloro-ribosome is still lacking. Here, we present a cryo-EM structure of the large subunit of the chloro-ribosome from spinach (Spinacia oleracea) at an average resolution of 3.5 Å. High-resolution map enabled us to localize and model chloro-ribosome proteins, chloroplast-specific protein extensions, two PSRPs (PSRP5 and 6) and three rRNA molecules present in the chloro-ribosome. Although comparable to E. coli, the polypeptide tunnel and the tunnel exit site show chloroplast-specific features. PMID:27762343

Modified RNA-seq method for microbial community and diversity analysis using rRNA in different types of environmental samples

PubMed Central

Yan, Yong-Wei; Zou, Bin; Zhu, Ting; Hozzein, Wael N.

2017-01-01

RNA-seq-based SSU (small subunit) rRNA (ribosomal RNA) analysis has provided a better understanding of potentially active microbial community within environments. However, for RNA-seq library construction, high quantities of purified RNA are typically required. We propose a modified RNA-seq method for SSU rRNA-based microbial community analysis that depends on the direct ligation of a 5’ adaptor to RNA before reverse-transcription. The method requires only a low-input quantity of RNA (10–100 ng) and does not require a DNA removal step. The method was initially tested on three mock communities synthesized with enriched SSU rRNA of archaeal, bacterial and fungal isolates at different ratios, and was subsequently used for environmental samples of high or low biomass. For high-biomass salt-marsh sediments, enriched SSU rRNA and total nucleic acid-derived RNA-seq datasets revealed highly consistent community compositions for all of the SSU rRNA sequences, and as much as 46.4%-59.5% of 16S rRNA sequences were suitable for OTU (operational taxonomic unit)-based community and diversity analyses with complete coverage of V1-V2 regions. OTU-based community structures for the two datasets were also highly consistent with those determined by all of the 16S rRNA reads. For low-biomass samples, total nucleic acid-derived RNA-seq datasets were analyzed, and highly active bacterial taxa were also identified by the OTU-based method, notably including members of the previously underestimated genus Nitrospira and phylum Acidobacteria in tap water, members of the phylum Actinobacteria on a shower curtain, and members of the phylum Cyanobacteria on leaf surfaces. More than half of the bacterial 16S rRNA sequences covered the complete region of primer 8F, and non-coverage rates as high as 38.7% were obtained for phylum-unclassified sequences, providing many opportunities to identify novel bacterial taxa. This modified RNA-seq method will provide a better snapshot of diverse microbial communities, most notably by OTU-based analysis, even communities with low-biomass samples. PMID:29016661

Novel mitochondrial gene content and gene arrangement indicate illegitimate inter-mtDNA recombination in the chigger mite, Leptotrombidium pallidum.

PubMed

Shao, Renfu; Mitani, Harumi; Barker, Stephen C; Takahashi, Mamoru; Fukunaga, Masahito

2005-06-01

To better understand the evolution of mitochondrial (mt) genomes in the Acari (mites and ticks), we sequenced the mt genome of the chigger mite, Leptotrombidium pallidum (Arthropoda: Acari: Acariformes). This genome is highly rearranged relative to that of the hypothetical ancestor of the arthropods and the other species of Acari studied. The mt genome of L. pallidum has two genes for large subunit rRNA, a pseudogene for small subunit rRNA, and four nearly identical large noncoding regions. Nineteen of the 22 tRNAs encoded by this genome apparently lack either a T-arm or a D-arm. Further, the mt genome of L. pallidum has two distantly separated sections with identical sequences but opposite orientations of transcription. This arrangement cannot be accounted for by homologous recombination or by previously known mechanisms of mt gene rearrangement. The most plausible explanation for the origin of this arrangement is illegitimate inter-mtDNA recombination, which has not been reported previously in animals. In light of the evidence from previous experiments on recombination in nuclear and mt genomes of animals, we propose a model of illegitimate inter-mtDNA recombination to account for the novel gene content and gene arrangement in the mt genome of L. pallidum.

The complete mitochondrial genomes of five Eimeria species infecting domestic rabbits.

PubMed

Liu, Guo-Hua; Tian, Si-Qin; Cui, Ping; Fang, Su-Fang; Wang, Chun-Ren; Zhu, Xing-Quan

2015-12-01

Rabbit coccidiosis caused by members of the genus Eimeria can cause enormous economic impact worldwide, but the genetics, epidemiology and biology of these parasites remain poorly understood. In the present study, we sequenced and annotated the complete mitochondrial (mt) genomes of five Eimeria species that commonly infect the domestic rabbits. The complete mt genomes of Eimeria intestinalis, Eimeria flavescens, Eimeria media, Eimeria vejdovskyi and Eimeria irresidua were 6261bp, 6258bp, 6168bp, 6254bp, 6259bp in length, respectively. All of the mt genomes consist of 3 genes for proteins (cytb, cox1, and cox3), 14 gene fragments for the large subunit (LSU) rRNA and 11 gene fragments for the small subunit (SSU) rRNA, but no transfer RNA (tRNA) genes. The gene order of the mt genomes is similar to that of Plasmodium, but distinct from Haemosporida and Theileria. Phylogenetic analyses based on full nucleotide sequences using Bayesian analysis revealed that the monophyly of the Eimeria of rabbits was strongly statistically supported with a Bayesian posterior probabilities. These data provide novel mtDNA markers for studying the population genetics and molecular epidemiology of the Eimeria species, and should have implications for the molecular diagnosis, prevention and control of coccidiosis in rabbits. Copyright © 2015 Elsevier Inc. All rights reserved.

Two New Genera of Planktonic Ciliates and Insights into the Evolution of the Family Strombidiidae (Protista, Ciliophora, Oligotrichia).

PubMed

Liu, Weiwei; Yi, Zhenzhen; Xu, Dapeng; Clamp, John C; Li, Jiqiu; Lin, Xiaofeng; Song, Weibo

2015-01-01

Oligotrich ciliates are common marine microplankters, but their biodiversity and evolutionary relationships have not been well-documented. Morphological descriptions and small subunit rRNA gene sequences of two new species representing two new strombidiid genera, Sinistrostrombidium cupiformum gen. nov., sp. nov. and Antestrombidium agathae gen. nov., sp. nov. are presented, and their taxonomy and molecular phylogeny are analyzed. Sinistrostrombidium gen. nov. is characterized by a sinistrally spiraled girdle kinety and a longitudinal ventral kinety. Antestrombidium gen. nov. is distinguished by tripartite somatic kineties (circular and ventral kineties plus dextrally spiraled girdle kinety). Sinistrostrombidium and Antestrombidium branched separately from one another in phylogenetic trees, clustering with different clades of strombidiids. The new genera added to the diversities of ciliary patterns and small subunit rRNA gene sequences in strombidiids leads to presentation of a new hypothesis about evolution of the 12 known strombidiid genera, based on ciliary pattern and partly supported by molecular evidence. In addition, our new morphological and molecular analyses support establishment of a new order Lynnellida ord. nov., characterized by an open adoral zone of membranelles without differentiation of anterior and ventral membranelles, for Lynnella, but we remain unable to assign the genus to a subclass with confidence.

Two New Genera of Planktonic Ciliates and Insights into the Evolution of the Family Strombidiidae (Protista, Ciliophora, Oligotrichia)

PubMed Central

Xu, Dapeng; Clamp, John C.; Li, Jiqiu; Lin, Xiaofeng; Song, Weibo

2015-01-01

Oligotrich ciliates are common marine microplankters, but their biodiversity and evolutionary relationships have not been well-documented. Morphological descriptions and small subunit rRNA gene sequences of two new species representing two new strombidiid genera, Sinistrostrombidium cupiformum gen. nov., sp. nov. and Antestrombidium agathae gen. nov., sp. nov. are presented, and their taxonomy and molecular phylogeny are analyzed. Sinistrostrombidium gen. nov. is characterized by a sinistrally spiraled girdle kinety and a longitudinal ventral kinety. Antestrombidium gen. nov. is distinguished by tripartite somatic kineties (circular and ventral kineties plus dextrally spiraled girdle kinety). Sinistrostrombidium and Antestrombidium branched separately from one another in phylogenetic trees, clustering with different clades of strombidiids. The new genera added to the diversities of ciliary patterns and small subunit rRNA gene sequences in strombidiids leads to presentation of a new hypothesis about evolution of the 12 known strombidiid genera, based on ciliary pattern and partly supported by molecular evidence. In addition, our new morphological and molecular analyses support establishment of a new order Lynnellida ord. nov., characterized by an open adoral zone of membranelles without differentiation of anterior and ventral membranelles, for Lynnella, but we remain unable to assign the genus to a subclass with confidence. PMID:26121340

Enterococcus Xinjiangensis sp. nov., Isolated from Yogurt of Xinjiang, China.

PubMed

Ren, Xiaopu; Li, Mingyang; Guo, Dongqi

2016-09-01

A Gram-strain-positive bacterial strain 48(T) was isolated from traditional yogurt in Xinjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, polymerase α subunit (rpoA) gene sequence analysis, determination of DNA G+C content, DNA-DNA hybridization with the type strain of Enterococcus ratti and analysis of phenotypic features. Strain 48(T) accounted for 96.1, 95.8, 95.8, and 95.7 % with Enterococcus faecium CGMCC 1.2136(T), Enterococcus hirae ATCC 9790(T), Enterococcus durans CECT 411(T), and E. ratti ATCC 700914(T) in the 16S rRNA gene sequence similarities, respectively. The sequence of rpoA gene showed similarities of 99.0, 96.0, 96.0, and 96 % with that of E. faecium ATCC 19434(T), Enterococcus villorum LMG12287, E. hirae ATCC 9790(T), and E. durans ATCC 19432(T), respectively. Based upon of polyphasic characterization data obtained in the study, a novel species, Enterococcus xinjiangensis sp. nov., was proposed and the type strain was 48(T)(=CCTCC AB 2014041(T) = JCM 30200(T)).

Microbial Diversity in Deep-sea Methane Seep Sediments Presented by SSU rRNA Gene Tag Sequencing

PubMed Central

Nunoura, Takuro; Takaki, Yoshihiro; Kazama, Hiromi; Hirai, Miho; Ashi, Juichiro; Imachi, Hiroyuki; Takai, Ken

2012-01-01

Microbial community structures in methane seep sediments in the Nankai Trough were analyzed by tag-sequencing analysis for the small subunit (SSU) rRNA gene using a newly developed primer set. The dominant members of Archaea were Deep-sea Hydrothermal Vent Euryarchaeotic Group 6 (DHVEG 6), Marine Group I (MGI) and Deep Sea Archaeal Group (DSAG), and those in Bacteria were Alpha-, Gamma-, Delta- and Epsilonproteobacteria, Chloroflexi, Bacteroidetes, Planctomycetes and Acidobacteria. Diversity and richness were examined by 8,709 and 7,690 tag-sequences from sediments at 5 and 25 cm below the seafloor (cmbsf), respectively. The estimated diversity and richness in the methane seep sediment are as high as those in soil and deep-sea hydrothermal environments, although the tag-sequences obtained in this study were not sufficient to show whole microbial diversity in this analysis. We also compared the diversity and richness of each taxon/division between the sediments from the two depths, and found that the diversity and richness of some taxa/divisions varied significantly along with the depth. PMID:22510646

Wickerhamomyces mori sp. nov., an anamorphic yeast species found in the guts of wood-boring insect larvae.

PubMed

Hui, Feng-Li; Chen, Liang; Chu, Xue-Ying; Niu, Qiu-Hong; Ke, Tao

2013-03-01

A novel anamorphic yeast species is described to accommodate three isolates recovered from the guts of three different wood-boring insect larvae collected in Henan, central China. On the basis of sequence analyses of the D1/D2 domains of the large-subunit rRNA gene and the internal transcribed spacer regions, the three strains are assigned to a novel species of the genus Wickerhamomyces, although the formation of ascospores was not observed. These strains also exhibited a number of distinct morphological and physiological characteristics that clearly differentiated them from Wickerhamomyces mucosus, Candida odintsovae and Wickerhamomyces rabaulensis, the most closely related species. In view of the phenotypic differences and unique rRNA gene sequences, we consider that these three isolates represent a novel species of the genus Wickerhamomyces, Wickerhamomyces mori sp. nov. The type strain is NYNU 1216(T) ( = CICC 1983(T)  = CBS 12678(T)).

Directed hydroxyl radical probing of the rRNA neighborhood of ribosomal protein S13 using tethered Fe(II).

PubMed Central

Heilek, G M; Noller, H F

1996-01-01

Directed hydroxyl radical probing was used to probe the rRNA neighborhood around protein S13 in the 30S ribosomal subunit. The unique cysteine at position 84 of S13 served as a tethering site for attachment of Fe(II)-1-(p-bromoacetamidobenzyl)-EDTA. Derivatized S13 (Fe-C84-S13) was then assembled into 30S ribosomal subunits by in vitro reconstitution with 16S rRNA and a mixture of the remaining 30S subunit proteins. Hydroxyl radicals generated from the tethered Fe(II) resulted in cleavage of the RNA backbone in two localized regions of the 3' major domain of 16S rRNA. One region spans nt 1308-1333 and is close to a site previously crosslinked to S13. A second set of cleavages is found in the 950/1230 helix. Both regions have been implicated in binding of S13 by previous chemical footprinting studies using base-specific chemical probes and solution-based hydroxyl radical probing. These results place both regions of 16S rRNA in proximity to position C84 of S13 in the three-dimensional structure of the 30S ribosomal subunit. PMID:8718688

Sequence and Secondary Structure of the Mitochondrial Small-Subunit rRNA V4, V6, and V9 Domains Reveal Highly Species-Specific Variations within the Genus Agrocybe

PubMed Central

Gonzalez, Patrice; Labarère, Jacques

1998-01-01

A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota. PMID:9797259

Sequence and secondary structure of the mitochondrial small-subunit rRNA V4, V6, and V9 domains reveal highly species-specific variations within the genus Agrocybe.

PubMed

Gonzalez, P; Labarère, J

1998-11-01

A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota.

Molecular characterization and phylogenetic relationships among microsporidian isolates infecting silkworm, Bombyx mori using small subunit rRNA (SSU-rRNA) gene sequence analysis.

PubMed

Nath, B Surendra; Gupta, S K; Bajpai, A K

2012-12-01

The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect.

Use of rpoB gene analysis for identification of nitrogen-fixing Paenibacillus species as an alternative to the 16S rRNA gene.

PubMed

da Mota, F F; Gomes, E A; Paiva, E; Rosado, A S; Seldin, L

2004-01-01

To avoid the limitations of 16S rRNA-based phylogenetic analysis for Paenibacillus species, the usefulness of the RNA polymerase beta-subunit encoding gene (rpoB) was investigated as an alternative to the 16S rRNA gene for taxonomic studies. Partial rpoB sequences were generated for the type strains of eight nitrogen-fixing Paenibacillus species. The presence of only one copy of rpoB in the genome of P. graminis strain RSA19(T) was demonstrated by denaturing gradient gel electrophoresis and hybridization assays. A comparative analysis of the sequences of the 16S rRNA and rpoB genes was performed and the eight species showed between 91.6-99.1% (16S rRNA) and 77.9-97.3% (rpoB) similarity, allowing a more accurate discrimination between the different species using the rpoB gene. Finally, 24 isolates from the rhizosphere of different cultivars of maize previously identified as Paenibacillus spp. were assigned correctly to one of the nitrogen-fixing species. The data obtained in this study indicate that rpoB is a powerful identification tool, which can be used for the correct discrimination of the nitrogen-fixing species of agricultural and industrial importance within the genus Paenibacillus.

Candida phyllophila sp. nov. and Candida vitiphila sp. nov., two novel yeast species from grape phylloplane in Thailand.

PubMed

Limtong, Savitree; Kaewwichian, Rungluk

2013-01-01

Three strains (K59(T), K60 and K70 (T)) representing two novel yeast species were isolated from the external surface of leaves of different wine grape (Vitis vinifera) plants, which were collected from the Kanchanaburi Research Station (N14°07'15.1″ E099°19'05.6″), Wang Dong Sub-district, Mueang District, Kanchanaburi Province, Thailand, by an enrichment technique. The sequences of the D1/D2 domain of the large subunit (LSU) rRNA gene of two strains (K59(T) and K60) were identical and differed from that of strain K70(T). In terms of pairwise sequence similarity of the D1/D2 domain, the closest species to the three strains was Candida asparagi but with 2.3% nucleotide substitutions for strains K59(T) and K60, and 2.1% nucleotide substitutions for strain K70(T). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics and the sequence analysis of the D1/D2 domain of the large subunit (LSU) rRNA gene, the three strains were assigned to be two novel Candida species. Two strains (K59(T) and K60) were assigned as Candida phyllophila sp. nov. (type strain K59(T)=BCC 42662(T)=NBRC 107776(T)=CBS 12671(T)). Candida vitiphila sp. nov. is proposed for strain K70(T) (=BCC 42663(T)=NBRC 107777(T)=CBS 12672(T)).

Interactions of 2’-O-methyl oligoribonucleotides with the RNA models of the 30S subunit A-site

PubMed Central

Jasiński, Maciej; Kulik, Marta; Wojciechowska, Monika; Stolarski, Ryszard

2018-01-01

Synthetic oligonucleotides targeting functional regions of the prokaryotic rRNA could be promising antimicrobial agents. Indeed, such oligonucleotides were proven to inhibit bacterial growth. 2’-O-methylated (2’-O-Me) oligoribonucleotides with a sequence complementary to the decoding site in 16S rRNA were reported as inhibitors of bacterial translation. However, the binding mode and structures of the formed complexes, as well as the level of selectivity of the oligonucleotides between the prokaryotic and eukaryotic target, were not determined. We have analyzed three 2’-O-Me oligoribonucleotides designed to hybridize with the models of the prokaryotic rRNA containing two neighboring aminoglycoside binding pockets. One pocket is the paromomycin/kanamycin binding site corresponding to the decoding site in the small ribosomal subunit and the other one is the close-by hygromycin B binding site whose dynamics has not been previously reported. Molecular dynamics (MD) simulations, as well as isothermal titration calorimetry, gel electrophoresis and spectroscopic studies have shown that the eukaryotic rRNA model is less conformationally stable (in terms of hydrogen bonds and stacking interactions) than the corresponding prokaryotic one. In MD simulations of the eukaryotic construct, the nucleotide U1498, which plays an important role in correct positioning of mRNA during translation, is flexible and spontaneously flips out into the solvent. In solution studies, the 2’-O-Me oligoribonucleotides did not interact with the double stranded rRNA models but all formed stable complexes with the single-stranded prokaryotic target. 2’-O-Me oligoribonucleotides with one and two mismatches bound less tightly to the eukaryotic target. This shows that at least three mismatches between the 2’-O-Me oligoribonucleotide and eukaryotic rRNA are required to ensure target selectivity. The results also suggest that, in the ribosome environment, the strand invasion is the preferred binding mode of 2’-O-Me oligoribonucleotides targeting the aminoglycoside binding sites in 16S rRNA. PMID:29351348

Phylogenetic analysis of phenotypically characterized Cryptococcus laurentii isolates reveals high frequency of cryptic species.

PubMed

Ferreira-Paim, Kennio; Ferreira, Thatiana Bragine; Andrade-Silva, Leonardo; Mora, Delio Jose; Springer, Deborah J; Heitman, Joseph; Fonseca, Fernanda Machado; Matos, Dulcilena; Melhem, Márcia Souza Carvalho; Silva-Vergara, Mario León

2014-01-01

Although Cryptococcus laurentii has been considered saprophytic and its taxonomy is still being described, several cases of human infections have already reported. This study aimed to evaluate molecular aspects of C. laurentii isolates from Brazil, Botswana, Canada, and the United States. In this study, 100 phenotypically identified C. laurentii isolates were evaluated by sequencing the 18S nuclear ribosomal small subunit rRNA gene (18S-SSU), D1/D2 region of 28S nuclear ribosomal large subunit rRNA gene (28S-LSU), and the internal transcribed spacer (ITS) of the ribosomal region. BLAST searches using 550-bp, 650-bp, and 550-bp sequenced amplicons obtained from the 18S-SSU, 28S-LSU, and the ITS region led to the identification of 75 C. laurentii strains that shared 99-100% identity with C. laurentii CBS 139. A total of nine isolates shared 99% identity with both Bullera sp. VY-68 and C. laurentii RY1. One isolate shared 99% identity with Cryptococcus rajasthanensis CBS 10406, and eight isolates shared 100% identity with Cryptococcus sp. APSS 862 according to the 28S-LSU and ITS regions and designated as Cryptococcus aspenensis sp. nov. (CBS 13867). While 16 isolates shared 99% identity with Cryptococcus flavescens CBS 942 according to the 18S-SSU sequence, only six were confirmed using the 28S-LSU and ITS region sequences. The remaining 10 shared 99% identity with Cryptococcus terrestris CBS 10810, which was recently described in Brazil. Through concatenated sequence analyses, seven sequence types in C. laurentii, three in C. flavescens, one in C. terrestris, and one in the C. aspenensis sp. nov. were identified. Sequencing permitted the characterization of 75% of the environmental C. laurentii isolates from different geographical areas and the identification of seven haplotypes of this species. Among sequenced regions, the increased variability of the ITS region in comparison to the 18S-SSU and 28S-LSU regions reinforces its applicability as a DNA barcode.

Characterization of hydrocortisone bioconversion and 16S RNA gene in Synechococcus nidulans cultures.

PubMed

Rasoul-Amini, S; Ghasemi, Y; Morowvat, M H; Ghoshoon, M B; Raee, M J; Mosavi-Azam, S B; Montazeri-Najafabady, N; Nouri, F; Parvizi, R; Negintaji, N; Khoubani, S

2010-01-01

A unicellular cyanobacterium, Synechococcus nidulans (Pringsheim) Komárek, was isolated from paddy-fields and applied in the biotransformation experiment of hydrocortisone (1). This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25 degrees C for 14 days of incubation. The obtained products were chromatographically purified followed by their characterization using spectroscopic methods. 11beta,17beta-dihydroxyandrost-4-en-3-one (2), 11beta-hydroxyandrost-4-en-3,17-dione (3), and androst-4-ene-3,17-dione (4) were the main bioproducts in the hydrocortisone bioconversion. The observed bioreaction characteristics were the side chain degradation of the substrate to prepare compounds (2) and (3) following the 11beta-dehydroxylation for accumulation of the compound (4). Time course study showed the accumulation of the product (2) from the second day of the fermentation and compounds (3) and (4) from the third day. All the metabolites reached their maximum concentration in seven days. Cyanobacterial 16S rRNA gene was also amplified by PCR. Sequences were amplified using the universal prokaryotic primers which amplify a approximately 400-bp region of the 16S rRNA gene. PCR products were sequenced to confirm their authenticity as 16S rRNA gene of cyanobacteria. The result of PCR blasted with other sequenced cyanobacteria in NCBI showed 99% identity to the 16S small subunit rRNA of seven Synechococcus species.

Starmerella reginensis f.a., sp. nov. and Starmerella kourouensis f.a., sp. nov., isolated from flowers in French Guiana.

PubMed

Amoikon, Tiemele Laurent Simon; Grondin, Cécile; Djéni, Théodore N'Dédé; Jacques, Noémie; Casaregola, Serge

2018-05-21

Analysis of yeasts isolated from various biotopes in French Guiana led to the identification of two strains isolated from flowers and designated CLIB 1634 T and CLIB 1707 T . Comparison of the D1/D2 domain of the large subunit (LSU D1/D2) rRNA gene sequences of CLIB 1634 T and CLIB 1707 T to those in the GenBank database revealed that these strains belong to the Starmerella clade. Strain CLIB 1634 T was shown to diverge from the closely related Starmerella apicola type strain CBS 2868 T with a sequence divergence of 1.34 and 1.30 %, in the LSU D1/D2 rRNA gene and internal transcribed spacer (ITS) sequences respectively. Strain CLIB 1634 T and Candida apicola CBS 2868 T diverged by 3.81 and 14.96 % at the level of the protein-coding gene partial sequences EF-1α and RPB2, respectively. CLIB 1707 T was found to have sequence divergence of 3.88 and 9.16 % in the LSU D1/D2 rRNA gene and ITS, respectively, from that of the most closely related species Starmerella ratchasimensis type strain CBS 10611 T . The species Starmerella reginensis f.a., sp. nov. and Starmerella kourouensis f.a., sp. nov. are proposed to accommodate strains CLIB 1634 T (=CBS 15247 T ) and CLIB 1707 T (=CBS 15257 T ), respectively.

RNA processing in Neurospora crassa mitochondria: use of transfer RNA sequences as signals.

PubMed Central

Breitenberger, C A; Browning, K S; Alzner-DeWeerd, B; RajBhandary, U L

1985-01-01

We have used RNA gel transfer hybridization, S1 nuclease mapping and primer extension to analyze transcripts derived from several genes in Neurospora crassa mitochondria. The transcripts studied include those for cytochrome oxidase subunit III, 17S rRNA and an unidentified open reading frame. In all three cases, initial transcripts are long, include tRNA sequences, and are subsequently processed to generate the mature RNAs. We find that endpoints of the most abundant transcripts generally coincide with those of tRNA sequences. We therefore conclude that tRNA sequences in long transcripts act as primary signals for RNA processing in N. crassa mitochondria. The situation is somewhat analogous to that observed in mammalian mitochondrial systems. The difference, however, is that in mammalian mitochondria, noncoding spacers between tRNA, rRNA and protein genes are very short and in many cases non-existent, allowing no room for intergenic RNA processing signals whereas, in N. crassa mtDNA, intergenic non-coding sequences are usually several hundred nucleotides long and contain highly conserved GC-rich palindromic sequences. Since these GC-rich palindromic sequences are retained in the processed mature RNAs, we conclude that they do not serve as signals for RNA processing. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:2990893

Metaxa: a software tool for automated detection and discrimination among ribosomal small subunit (12S/16S/18S) sequences of archaea, bacteria, eukaryotes, mitochondria, and chloroplasts in metagenomes and environmental sequencing datasets.

PubMed

Bengtsson, Johan; Eriksson, K Martin; Hartmann, Martin; Wang, Zheng; Shenoy, Belle Damodara; Grelet, Gwen-Aëlle; Abarenkov, Kessy; Petri, Anna; Rosenblad, Magnus Alm; Nilsson, R Henrik

2011-10-01

The ribosomal small subunit (SSU) rRNA gene has emerged as an important genetic marker for taxonomic identification in environmental sequencing datasets. In addition to being present in the nucleus of eukaryotes and the core genome of prokaryotes, the gene is also found in the mitochondria of eukaryotes and in the chloroplasts of photosynthetic eukaryotes. These three sets of genes are conceptually paralogous and should in most situations not be aligned and analyzed jointly. To identify the origin of SSU sequences in complex sequence datasets has hitherto been a time-consuming and largely manual undertaking. However, the present study introduces Metaxa ( http://microbiology.se/software/metaxa/ ), an automated software tool to extract full-length and partial SSU sequences from larger sequence datasets and assign them to an archaeal, bacterial, nuclear eukaryote, mitochondrial, or chloroplast origin. Using data from reference databases and from full-length organelle and organism genomes, we show that Metaxa detects and scores SSU sequences for origin with very low proportions of false positives and negatives. We believe that this tool will be useful in microbial and evolutionary ecology as well as in metagenomics.

Caryotricha minuta (Xu et al., 2008) nov. comb., a unique marine ciliate (Protista, Ciliophora, Spirotrichea), with phylogenetic analysis of the ambiguous genus Caryotricha inferred from the small-subunit rRNA gene sequence.

PubMed

Miao, Miao; Shao, Chen; Jiang, Jiamei; Li, Liqiong; Stoeck, Thorsten; Song, Weibo

2009-02-01

A population of Kiitricha minuta Xu et al., 2008, a small kiitrichid ciliate, was isolated from a brackish water sample in Jiaozhou Bay, Qingdao, northern China. After comparison of its morphology and infraciliature, it is believed that this morphotype should be assigned to the genus Caryotricha; hence, a new combination is suggested, Caryotricha minuta (Xu et al., 2008) nov. comb. The small-subunit (SSU) rRNA gene sequence was determined in order to elucidate the phylogenetic position of this poorly known, ambiguous genus. The organism can be clearly separated from its congener, Caryotricha convexa Kahl, 1932, by the extremely shortened ventral cirral rows in the posterior ends. Based on the data available, an improved diagnosis is given for the genus: marine Kiitrichidae with prominent buccal field; two highly developed undulating membranes; non-grouped, uniform cirral rows on both ventral and dorsal sides; enlarged transverse cirri present, which are the only differentiated cirri; marginal cirri not present; one short migratory row located posterior to buccal field; structure of dorsal kineties generally in Kiitricha pattern. The sequence of the SSU rRNA gene of C. minuta differs by 13 % from that of Kiitricha marina. Molecular phylogenetic analyses (Bayesian inference, least squares, neighbour joining, maximum parsimony) indicate that Caryotricha, together with Kiitricha, diverges at a deep level from all other spirotrichs. Its branching position is between Phacodiniidia and Licnophoridia. The results strongly support the distinct separation of the Kiitricha-Caryotricha clade, which always branches basal to the Stichotrichia-Hypotrichia-Oligotrichia-Choreotrichia assemblage. These results also confirm the previous hypothesis that the Kiitricha-Caryotricha group, long assumed to be a close relation to the euplotids, represents a taxon at subclass level within the spirotrichs.

New anamorphic yeast species: Candida infanticola sp. nov., Candida polysorbophila sp. nov., Candida transvaalensis sp. nov. and Trigonopsis californica sp. nov.

PubMed

Kurtzman, Cletus P

2007-08-01

Three new species of Candida and a new species of Trigonopsis are described based on their recognition from phylogenetic analysis of gene sequences from large subunit ribosomal RNA, ITS1/ITS2 rRNA, mitochondrial small subunit rRNA and cytochrome oxidase II. Candida infanticola sp. nov. (type strain NRRL Y-17858, CBS 7922) was isolated from the ear of an infant in Germany and is closely related to Candida sorbophila. Candida polysorbophila sp. nov. (type strain NRRL Y-27161, CBS 7317) is a member of the Zygoascus clade and was isolated in South Africa as a contaminant from an emulsion of white oil and polysorbate. Candida transvaalensis sp. nov. (type strain NRRL Y-27140, CBS 6663) was obtained from forest litter, the Transvaal, South Africa, and forms an isolated clade with Candida santjacobensis. Trigonopsis californica sp. nov. (type strain NRRL Y-27307, CBS 10351) represents a contaminant from wine in California, and forms a well-supported clade with Trigonopsis cantarellii, Trigonopsis variabilis and Trigonopsis vinaria.

Phylogenetic comparison of the methanogenic communities from an acidic, oligotrophic fen and an anaerobic digester treating municipal wastewater sludge.

PubMed

Steinberg, Lisa M; Regan, John M

2008-11-01

Methanogens play a critical role in the decomposition of organics under anaerobic conditions. The methanogenic consortia in saturated wetland soils are often subjected to large temperature fluctuations and acidic conditions, imposing a selective pressure for psychro- and acidotolerant community members; however, methanogenic communities in engineered digesters are frequently maintained within a narrow range of mesophilic and circumneutral conditions to retain system stability. To investigate the hypothesis that these two disparate environments have distinct methanogenic communities, the methanogens in an oligotrophic acidic fen and a mesophilic anaerobic digester treating municipal wastewater sludge were characterized by creating clone libraries for the 16S rRNA and methyl coenzyme M reductase alpha subunit (mcrA) genes. A quantitative framework was developed to assess the differences between these two communities by calculating the average sequence similarity for 16S rRNA genes and mcrA within a genus and family using sequences of isolated and characterized methanogens within the approved methanogen taxonomy. The average sequence similarities for 16S rRNA genes within a genus and family were 96.0 and 93.5%, respectively, and the average sequence similarities for mcrA within a genus and family were 88.9 and 79%, respectively. The clone libraries of the bog and digester environments showed no overlap at the species level and almost no overlap at the family level. Both libraries were dominated by clones related to uncultured methanogen groups within the Methanomicrobiales, although members of the Methanosarcinales and Methanobacteriales were also found in both libraries. Diversity indices for the 16S rRNA gene library of the bog and both mcrA libraries were similar, but these indices indicated much lower diversity in the 16S digester library than in the other three libraries.

Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

PubMed

Douzery, E; Catzeflis, F M

1995-11-01

The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced, but the relationships between Artiodactyla, Cetacea, and Perissodactyla remained unresolved. Nevertheless, we found no support for a Perissodactyla + Hyracoidea clade, neither with distance approach, nor with parsimony reconstruction. The 12S rRNA was useful to solve intraordinal relationships among Ungulata, but it seemed to harbor too few informative positions to decipher the bushlike radiation of some Ungulata orders, an event which has most probably occurred in a short span of time between 55 and 70 MYA.

Phylogeny of Anophelinae (Diptera: Culicidae) Based on Nuclear Ribosomal and Mitochondrial DNA Sequences

DTIC Science & Technology

2002-01-01

numerous animal clades, including arthropods (Giribet & Ribera , 1998, 2000). The mitochondrial cytochrome oxidase subunits I and II have proven useful as...16S and 28S, D2 rRNA. Insect Molecular Biology, 6, 273-284. Giribet, G. & Ribera , C. (1998) The position of arthropods in animal kingdom: a search...for a reliable outgroup for internal arthropod phylogeny. Molecular Phylogenetics and Evolution, 9, 481-488. Giribet, G. & Ribera , C. (2000) A review

Description of Eurystomatella sinica n. gen., n. sp., with establishment of a new family Eurystomatellidae n. fam. (Protista, Ciliophora, Scuticociliatia) and analyses of its phylogeny inferred from sequences of the small-subunit rRNA gene.

PubMed

Miao, Miao; Wang, Yangang; Song, Weibo; Clamp, John C; Al-Rasheid, Khaled A S

2010-02-01

Recently, an undescribed marine ciliate was isolated from China. Investigation of its morphology and infraciliature revealed it as an undescribed species representing a new genus, Eurystomatella n. gen., the type of the new family Eurystomatellidae n. fam. The new family is defined by close-set, apically positioned oral membranelles and a dominant buccal field that is surrounded by an almost completely circular paroral membrane. The new genus is defined by having a small oral membranelle 1 (M1), bipartite M2 and well-developed M3, a body surface faintly sculptured with a silverline system in a quadrangular, reticulate pattern and a cytostome located at the anterior third of a large buccal field. The type species of the new genus, Eurystomatella sinica n. sp., is a morphologically unique form that is defined mainly by the combination of a conspicuously flattened body, several caudal cilia, extremely long cilia associated with the buccal apparatus and a contractile vacuole located subcaudally. According to phylogenetic analyses of small-subunit (SSU) rRNA gene sequences, Eurystomatella clusters with the genus Cyclidium, as a sister group to the family Pleuronematidae. The great divergence in both buccal and somatic ciliature between Eurystomatella and all other known scuticociliates supports the establishment of a new family for Eurystomatella.

How many novel eukaryotic 'kingdoms'? Pitfalls and limitations of environmental DNA surveys

PubMed Central

Berney, Cédric; Fahrni, José; Pawlowski, Jan

2004-01-01

Background Over the past few years, the use of molecular techniques to detect cultivation-independent, eukaryotic diversity has proven to be a powerful approach. Based on small-subunit ribosomal RNA (SSU rRNA) gene analyses, these studies have revealed the existence of an unexpected variety of new phylotypes. Some of them represent novel diversity in known eukaryotic groups, mainly stramenopiles and alveolates. Others do not seem to be related to any molecularly described lineage, and have been proposed to represent novel eukaryotic kingdoms. In order to review the evolutionary importance of this novel high-level eukaryotic diversity critically, and to test the potential technical and analytical pitfalls and limitations of eukaryotic environmental DNA surveys (EES), we analysed 484 environmental SSU rRNA gene sequences, including 81 new sequences from sediments of the small river, the Seymaz (Geneva, Switzerland). Results Based on a detailed screening of an exhaustive alignment of eukaryotic SSU rRNA gene sequences and the phylogenetic re-analysis of previously published environmental sequences using Bayesian methods, our results suggest that the number of novel higher-level taxa revealed by previously published EES was overestimated. Three main sources of errors are responsible for this situation: (1) the presence of undetected chimeric sequences; (2) the misplacement of several fast-evolving sequences; and (3) the incomplete sampling of described, but yet unsequenced eukaryotes. Additionally, EES give a biased view of the diversity present in a given biotope because of the difficult amplification of SSU rRNA genes in some taxonomic groups. Conclusions Environmental DNA surveys undoubtedly contribute to reveal many novel eukaryotic lineages, but there is no clear evidence for a spectacular increase of the diversity at the kingdom level. After re-analysis of previously published data, we found only five candidate lineages of possible novel high-level eukaryotic taxa, two of which comprise several phylotypes that were found independently in different studies. To ascertain their taxonomic status, however, the organisms themselves have now to be identified. PMID:15176975

Genetic characterization of UCS region of Pneumocystis jirovecii and construction of allelic profiles of Indian isolates based on sequence typing at three regions.

PubMed

Gupta, Rashmi; Mirdha, Bijay Ranjan; Guleria, Randeep; Kumar, Lalit; Luthra, Kalpana; Agarwal, Sanjay Kumar; Sreenivas, Vishnubhatla

2013-01-01

Pneumocystis jirovecii is an opportunistic pathogen that causes severe pneumonia in immunocompromised patients. To study the genetic diversity of P. jirovecii in India the upstream conserved sequence (UCS) region of Pneumocystis genome was amplified, sequenced and genotyped from a set of respiratory specimens obtained from 50 patients with a positive result for nested mitochondrial large subunit ribosomal RNA (mtLSU rRNA) PCR during the years 2005-2008. Of these 50 cases, 45 showed a positive PCR for UCS region. Variations in the tandem repeats in UCS region were characterized by sequencing all the positive cases. Of the 45 cases, one case showed five repeats, 11 cases showed four repeats, 29 cases showed three repeats and four cases showed two repeats. By running amplified DNA from all these cases on a high-resolution gel, mixed infection was observed in 12 cases (26.7%, 12/45). Forty three of 45 cases included in this study had previously been typed at mtLSU rRNA and internal transcribed spacer (ITS) region by our group. In the present study, the genotypes at those two regions were combined with UCS repeat patterns to construct allelic profiles of 43 cases. A total of 36 allelic profiles were observed in 43 isolates indicating high genetic variability. A statistically significant association was observed between mtLSU rRNA genotype 1, ITS type Ea and UCS repeat pattern 4. Copyright © 2012 Elsevier B.V. All rights reserved.

Emergence of new types of Theileria orientalis in Australian cattle and possible cause of theileriosis outbreaks

PubMed Central

2011-01-01

Theileria parasites cause a benign infection of cattle in parts of Australia where they are endemic, but have, in recent years, been suspected of being responsible for a number of outbreaks of disease in cattle near the coast of New South Wales. The objective of this study was to identify and characterize the species of Theileria in cattle on six farms in New South Wales where disease outbreaks have occurred, and compare with Theileria from three disease-free farms in Queensland that is endemic for Theileria. Special reference was made to sub-typing of T. orientalis by type-specific PCR and sequencing of the small subunit (SSU) rRNA gene, and sequence analysis of the gene encoding a polymorphic merozoite/piroplasm surface protein (MPSP) that may be under immune selection. Nucleotide sequencing of SSU rRNA and MPSP genes revealed the presence of four Theileria genotypes: T. orientalis (buffeli), T. orientalis (ikeda), T. orientalis (chitose) and T. orientalis type 4 (MPSP) or type C (SSU rRNA). The majority of animals showed mixed infections while a few showed single infection. When MPSP nucleotide sequences were translated into amino acids, base transition did not change amino acid composition of the protein product, suggesting possible silent polymorphism. The occurrence of ikeda and type 4 (type C) previously not reported to occur and silent mutation is thought to have enhanced parasite evasion of the host immune response causing the outbreak. PMID:21338493

Characterization of hydrocortisone biometabolites and 18S rRNA gene in Chlamydomonas reinhardtii cultures.

PubMed

Ghasemi, Younes; Rasoul-Amini, Sara; Morowvat, Mohammad Hossein; Raee, Mohammad Javad; Ghoshoon, Mohammad Bagher; Nouri, Fatemeh; Negintaji, Narges; Parvizi, Rezvan; Mosavi-Azam, Seyed Bagher

2008-10-31

A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1). This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25 degrees C for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17 beta-Dihydroxyandrost-4-en-3-one (2), 11 beta-hydroxyandrost-4-en-3,17-dione (3), 11 beta,17 alpha,20 beta,21-tetrahydroxypregn-4-en-3-one (4) and prednisolone (5) were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

Characterization of bacterial consortia capable of degrading 4-chlorobenzoate and 4-bromobenzoate under denitrifying conditions.

PubMed

Song, Bongkeun; Kerkhof, Lee J; Häggblom, Max M

2002-08-06

4-Chlorobenzoate and 4-bromobenzoate were readily degraded in denitrifying enrichment cultures established with river sediment, estuarine sediment or agricultural soil as inoculum. Stable denitrifying consortia were obtained and maintained by serial dilution and repeated feeding of substrates. Microbial community analyses were performed to characterize the 4-chlorobenzoate and 4-bromobenzoate degrading consortia with terminal restriction fragment length polymorphism (T-RFLP) and cloning of 16S rRNA genes from the cultures. Interestingly, two major terminal restriction fragments (T-RFs) in the 4-chlorobenzoate degrading consortia and one T-RF in the 4-bromobenzoate utilizing consortium were observed from T-RFLP analysis regardless of their geographical and ecological origins. The two T-RFs (clones 4CB1 and 4CB2) in 4-chlorobenzoate degrading consortia were identified as members of the beta-subunit of the Proteobacteria on the basis of 16S rRNA sequencing analysis. Phylogenetic analysis of 16S rRNA genes showed that clone 4CB1 was closely related to Thauera aromatica while clone 4CB2 was distantly related to the genera Limnobacter and Ralstonia. The 4-bromobenzoate utilizing consortium mainly consisted of one T-RF, which was identical to clone 4CB2 in spite of different enrichment substrate. This suggests that degradation of 4-chlorobenzoate and 4-bromobenzoate under denitrifying conditions was mediated by bacteria belonging to the beta-subunit of the Proteobacteria.

Ribosomal small subunit domains radiate from a central core

NASA Astrophysics Data System (ADS)

Gulen, Burak; Petrov, Anton S.; Okafor, C. Denise; Vander Wood, Drew; O'Neill, Eric B.; Hud, Nicholas V.; Williams, Loren Dean

2016-02-01

The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2‧OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit.

Theileria sp. Infections Associated with Bovine Fatalities in the United States Confirmed by Small-Subunit rRNA Gene Analyses of Blood and Tick Samples

PubMed Central

Chae, Joon-seok; Levy, Michael; Hunt, John; Schlater, Jack; Snider, Glen; Waghela, Suryakant D.; Holman, Patricia J.; Wagner, G. Gale

1999-01-01

Theileria sp.-specific small subunit (SSU) rRNA gene amplification confirmed the presence of the organism in cattle and in Amblyomma americanum and Dermacentor variabilis ticks collected from a cattle herd in Missouri. Blood from the index animal had type A and type D Theileria SSU rRNA genes. The type D gene was also found in blood from two cohort cattle and tick tissues. The type A SSU rRNA gene was previously reported from bovine Theileria isolates from Texas and North Carolina; the type D gene was reported from a Texas cow with theileriosis. PMID:10449501

Characterization of a new myxozoan species (Myxozoa: Myxobolidae: Myxosporea) in largescale stonerollers (Campostoma oligolepis) from the Mobile River Basin (Alabama).

PubMed

Iwanowicz, D D; Iwanowicz, L R; Howerth, E W; Schill, W B; Blazer, V S; Johnson, R L

2013-02-01

Myxobolus stanlii sp. n. was described from largescale stonerollers ( Campostoma oligolepis ) from the Mobile River Basin in Alabama. The parasite was described using critical identifying morphological features, and the 18S small subunit ribosomal RNA (SSU rRNA) gene sequence. The spore body was ovoid, 10.03 ± 0.7 (7.5-11.0) μm long and 8.8 ± 1.5 (6.3-11.3) μm wide in frontal view. Spore thickness was 6.3 ± 2.7 (6.2-8.6) μm in sutural view. Polar capsules were pyriform, of equal size, and oriented in plane with the sutural ridge. Polar capsules were 2.45 ± 1.5 (range 2.1-4.3) μm in width and 4.6 ± 2.7 (range 4.5-6.9) μm in length. Based on the SSU rRNA gene sequence of Myxobolus stanlii sp. n. is most closely related to M. pseudodispar.

Widespread and Persistent Populations of a Major New Marine Actinomycete Taxon in Ocean Sediments

PubMed Central

Mincer, Tracy J.; Jensen, Paul R.; Kauffman, Christopher A.; Fenical, William

2002-01-01

A major taxon of obligate marine bacteria within the order Actinomycetales has been discovered from ocean sediments. Populations of these bacteria (designated MAR 1) are persistent and widespread, spanning at least three distinct ocean systems. In this study, 212 actinomycete isolates possessing MAR 1 morphologies were examined and all but two displayed an obligate requirement of seawater for growth. Forty-five of these isolates, representing all observed seawater-requiring morphotypes, were partially sequenced and found to share characteristic small-subunit rRNA signature nucleotides between positions 207 and 468 (Escherichia coli numbering). Phylogenetic characterization of seven representative isolates based on almost complete sequences of genes encoding 16S rRNA (16S ribosomal DNA) yielded a monophyletic clade within the family Micromonosporaceae and suggests novelty at the genus level. This is the first evidence for the existence of widespread populations of obligate marine actinomycetes. Organic extracts from cultured members of this new group exhibit remarkable biological activity, suggesting that they represent a prolific resource for biotechnological applications. PMID:12324350

A detailed phylogeny for the Methanomicrobiales

NASA Technical Reports Server (NTRS)

Rouviere, P.; Mandelco, L.; Winker, S.; Woese, C. R.

1992-01-01

The small subunit rRNA sequence of twenty archaea, members of the Methanomicrobiales, permits a detailed phylogenetic tree to be inferred for the group. The tree confirms earlier studies, based on far fewer sequences, in showing the group to be divided into two major clusters, temporarily designated the "methanosarcina" group and the "methanogenium" group. The tree also defines phylogenetic relationships within these two groups, which in some cases do not agree with the phylogenetic relationships implied by current taxonomic names--a problem most acute for the genus Methanogenium and its relatives. The present phylogenetic characterization provides the basis for a consistent taxonomic restructuring of this major methanogenic taxon.

Community Composition and Density of Methanogens in the Foregut of the Tammar Wallaby (Macropus eugenii)▿

PubMed Central

Evans, Paul N.; Hinds, Lyn A.; Sly, Lindsay I.; McSweeney, Christopher S.; Morrison, Mark; Wright, André-Denis G.

2009-01-01

The composition of the methanogenic archaeal community in the foregut contents of Tammar wallabies (Macropus eugenii) was studied using 16S rRNA and methyl coenzyme reductase subunit A (mcrA) gene clone libraries. Methanogens belonging to the Methanobacteriales and a well-supported cluster of uncultivated archaeon sequences previously observed in the ovine and bovine rumens were found. Methanogen densities ranged from 7.0 × 105 and 3.9 × 106 cells per gram of wet weight. PMID:19218421

Development of PCR primers specific for the amplification and direct sequencing of gyrB genes from microbacteria, order Actinomycetales.

PubMed

Richert, Kathrin; Brambilla, Evelyne; Stackebrandt, Erko

2005-01-01

PCR primer sets were developed for the specific amplification and sequence analyses encoding the gyrase subunit B (gyrB) of members of the family Microbacteriaceae, class Actinobacteria. The family contains species highly related by 16S rRNA gene sequence analyses. In order to test if the gene sequence analysis of gyrB is appropriate to discriminate between closely related species, we evaluate the 16S rRNA gene phylogeny of its members. As the published universal primer set for gyrB failed to amplify the responding gene of the majority of the 80 type strains of the family, three new primer sets were identified that generated fragments with a composite sequence length of about 900 nt. However, the amplification of all three fragments was successful only in 25% of the 80 type strains. In this study, the substitution frequencies in genes encoding gyrase and 16S rDNA were compared for 10 strains of nine genera. The frequency of gyrB nucleotide substitution is significantly higher than that of the 16S rDNA, and no linear correlation exists between the similarities of both molecules among members of the Microbacteriaceae. The phylogenetic analyses using the gyrB sequences provide higher resolution than using 16S rDNA sequences and seem able to discriminate between closely related species.

Genetic diversity among Babesia rossi detected in naturally infected dogs in Abeokuta, Nigeria, based on 18S rRNA gene sequences.

PubMed

Takeet, Michael I; Oyewusi, Adeoye J; Abakpa, Simon A V; Daramola, Olukayode O; Peters, Sunday O

2017-03-01

Adequate knowledge of the genetic diversity among Babesia species infecting dogs is necessary for a better understanding of the epidemiology and control of canine babesiosis. Hence, this study determined the genetic diversity among the Babesia rossi detected in dogs presented for routine examination in Veterinary Hospitals in Abeokuta, Nigeria. Blood were randomly collected from 209 dogs. Field-stained thin smears were made and DNA extracted from the blood. Partial region of the 18S small subunit ribosomal RNA (rRNA) gene was amplified, sequenced and analysed. Babesia species was detected in 16 (7.7%) of the dogs by microscopy. Electrophoresed PCR products from 39 (18.66%) dogs revealed band size of 450 bp and 2 (0.95%) dogs had band size of 430 bp. The sequences obtained from 450 bp amplicon displayed homology of 99.74% (387/388) with partial sequences of 18S rRNA gene of Babesia rossi in the GeneBank. Of the two sequences that had 430 bp amplicon, one was identified as T. annulata and second as T. ovis. A significantly (p<0.05) higher prevalence of B. rossi was detected by PCR compared to microscopy. The mean PCV of Babesia infected dogs was significantly (p<0.05) lower than non-infected dogs. Phylogenetic analysis revealed minimal diversity among B. rossi with the exception of one sequence that was greatly divergent from the others. This study suggests that more than one genotype of B. rossi may be in circulation among the dog population in the study area and this may have potential implication on clinical outcome of canine babesiosis.

New data on epizootiology and genetics of piroplasms based on sequences of small ribosomal subunit and cytochrome b genes.

PubMed

Criado, A; Martinez, J; Buling, A; Barba, J C; Merino, S; Jefferies, R; Irwin, P J

2006-12-20

As a continuation of our studies on molecular epizootiology of piroplasmosis in Spain and other countries, we present in this contribution the finding of new hosts for some piroplasms, as well as information on their 18S rRNA gene sequences. Genetic data were complemented with sequences of apocytochrome b gene (whenever possible). The following conclusions were drawn from these molecular studies: Theileria annulata is capable of infecting dogs, since it was diagnosed in a symptomatic animal. According to cytochrome b sequences, isolates from cows and dog present slight differences. The same isolates showed, however, identical sequence in the 18S rRNA gene. This exemplifies well the usefulness of the mitochondrial gene for examining infra-specific variation. Babesia bovis is an occasional parasite of equines, since it was detected in two symptomatic horses. We found evidence of genetic polymorphism occurring in the 18S rRNA gene of Spanish T. equi-like and B. ovis isolates. B. bennetti from Spanish seagull is loosely related to B. ovis, and might represent a genetically distinct branch of babesids. A partial sequence of a cytochrome b pseudogene was obtained for the first time in Babesia canis rossi from South Africa. The pseudogene is distantly related to B. bigemina cytochrome b gene. These new findings confirm the ability of some piroplasms to infect multiple hosts, as well as the existence of a relatively wide genetic polymorphisms with respect to the cytochrome b gene. On the other hand, the existence of mtDNA-like pseudogenes of possible nuclear location in piroplasms is interesting due to their possible impact on molecular phylogeny studies.

Ribosomal RNA gene detection and targeted culture of novel nitrogen-responsive fungal taxa from temperate pine forest soil.

PubMed

Hesse, Cedar N; Torres-Cruz, Terry J; Tobias, Terri Billingsley; Al-Matruk, Maryam; Porras-Alfaro, Andrea; Kuske, Cheryl R

Soil fungal communities are responsible for carbon and nitrogen (N) cycling. The high complexity of the soil fungal community and the high proportion of taxonomically unidentifiable sequences confound ecological interpretations in field studies because physiological information is lacking for many organisms known only by their rRNA sequences. This situation forces experimental comparisons to be made at broader taxonomic racks where functions become difficult to infer. The objective of this study was to determine OTU (operational taxonomic units) level responses of the soil fungal community to N enrichment in a temperate pine forest experiment and to use the sequencing data to guide culture efforts of novel N-responsive fungal taxa. Replicate samples from four soil horizons (up to 10 cm depth) were obtained from ambient, enriched CO 2 and N-fertilization plots. Through a fungal large subunit rRNA gene (LSU) sequencing survey, we identified two novel fungal clades that were abundant in our soil sampling (representing up to 27% of the sequences in some samples) and responsive to changes in soil N. The two N-responsive taxa with no predicted taxonomic association were targeted for isolation and culturing from specific soil samples where their sequences were abundant. Representatives of both OTUs were successfully cultured using a filtration approach. One taxon (OTU6) was most closely related to Saccharomycotina; the second taxon (OTU69) was most closely related to Mucoromycotina. Both taxa likely represent novel species. This study shows how observation of specific OTUs level responses to altered N status in a large rRNA gene field survey provided the impetus to design targeted culture approaches for isolation of novel N-responsive fungal taxa.

Genetic relationships between blowflies (Calliphoridae) of forensic importance.

PubMed

Stevens, J; Wall, R

2001-08-15

Phylogenetic relationships among blowfly (Calliphoridae) species of forensic importance are explored using DNA sequence data from the large sub-unit (lsu, 28S) ribosomal RNA (rRNA) gene, the study includes representatives of a range of calliphorid species commonly encountered in forensic analysis in Britain and Europe. The data presented provide a basis to define molecular markers, including the identification of highly informative intra-sequence regions, which may be of use in the identification of larvae for forensic entomology. Phylogenetic analysis of the sequences also provides new insights into the different evolutionary patterns apparent within the family Calliphoridae which, additionally, can provide a measure of the degree of genetic variation likely to be encountered within taxonomic groups of differing forensic utility.

Plastid–Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae

PubMed Central

Weng, Mao-Lun; Ruhlman, Tracey A.; Jansen, Robert K.

2016-01-01

Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid–nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. PMID:27190001

Structure and variation of the mitochondrial genome of fishes.

PubMed

Satoh, Takashi P; Miya, Masaki; Mabuchi, Kohji; Nishida, Mutsumi

2016-09-07

The mitochondrial (mt) genome has been used as an effective tool for phylogenetic and population genetic analyses in vertebrates. However, the structure and variability of the vertebrate mt genome are not well understood. A potential strategy for improving our understanding is to conduct a comprehensive comparative study of large mt genome data. The aim of this study was to characterize the structure and variability of the fish mt genome through comparative analysis of large datasets. An analysis of the secondary structure of proteins for 250 fish species (248 ray-finned and 2 cartilaginous fishes) illustrated that cytochrome c oxidase subunits (COI, COII, and COIII) and a cytochrome bc1 complex subunit (Cyt b) had substantial amino acid conservation. Among the four proteins, COI was the most conserved, as more than half of all amino acid sites were invariable among the 250 species. Our models identified 43 and 58 stems within 12S rRNA and 16S rRNA, respectively, with larger numbers than proposed previously for vertebrates. The models also identified 149 and 319 invariable sites in 12S rRNA and 16S rRNA, respectively, in all fishes. In particular, the present result verified that a region corresponding to the peptidyl transferase center in prokaryotic 23S rRNA, which is homologous to mt 16S rRNA, is also conserved in fish mt 16S rRNA. Concerning the gene order, we found 35 variations (in 32 families) that deviated from the common gene order in vertebrates. These gene rearrangements were mostly observed in the area spanning the ND5 gene to the control region as well as two tRNA gene cluster regions (IQM and WANCY regions). Although many of such gene rearrangements were unique to a specific taxon, some were shared polyphyletically between distantly related species. Through a large-scale comparative analysis of 250 fish species mt genomes, we elucidated various structural aspects of the fish mt genome and the encoded genes. The present results will be important for understanding functions of the mt genome and developing programs for nucleotide sequence analysis. This study demonstrated the significance of extensive comparisons for understanding the structure of the mt genome.

Candida adriatica sp. nov. and Candida molendinolei sp. nov., two yeast species isolated from olive oil and its by-products.

PubMed

Čadež, Neža; Raspor, Peter; Turchetti, Benedetta; Cardinali, Gianluigi; Ciafardini, Gino; Veneziani, Gianluca; Péter, Gábor

2012-09-01

Thirteen strains isolated from virgin olive oil or its by-products in several Mediterranean countries were found to be phenotypically and genetically divergent from currently recognized yeast species. Sequence analysis of the large subunit (LSU) rDNA D1/D2 domain and internal transcribed spacer regions/5.8S rDNA revealed that the strains represented two novel species described as Candida adriatica sp. nov. (type strain ZIM 2334(T) = CBS 12504(T) = NCAIM Y.02001(T)) and Candida molendinolei sp. nov. (type strain DBVPG 5508(T) = CBS 12508(T) = NCAIM Y.02000(T)). Phylogenetic analysis based on concatenated sequences of the small subunit rRNA gene, the D1/D2 region of the LSU rDNA and the translation elongation factor-1α gene suggested that C. adriatica sp. nov. and C. molendinolei sp. nov. should be placed within the Lindnera and Nakazawaea clades, respectively.

Sequence analysis of chloroplast chlB gene of medicinal Ephedra species and its application to authentication of Ephedra Herb.

PubMed

Guo, Yahong; Tsuruga, Ayako; Yamaguchi, Shigeharu; Oba, Koji; Iwai, Kasumi; Sekita, Setsuko; Mizukami, Hajime

2006-06-01

Chloroplast chlB gene encoding subunit B of light-independent protochlorophyllide reductase was amplified from herbarium and crude drug specimens of Ephedra sinica, E. intermedia, E. equisetina, and E. przewalskii. Sequence comparison of the chlB gene indicated that all the E. sinica specimens have the same sequence type (Type S) distinctive from other species, while there are two sequence types (Type E1 and Type E2) in E. equisetina. E. intermedia and E. prezewalskii revealed an identical sequence type (Type IP). E. sinica was also identified by digesting the chlB fragment with Bcl I. A novel method for DNA authentication of Ephedra Herb based on the sequences of the chloroplast chlB gene and internal transcribed spacer of nuclear rRNA genes was developed and successfully applied for identification of the crude drugs obtained in the Chinese market.

Phylogenetic Analysis of Phenotypically Characterized Cryptococcus laurentii Isolates Reveals High Frequency of Cryptic Species

PubMed Central

Ferreira-Paim, Kennio; Ferreira, Thatiana Bragine; Andrade-Silva, Leonardo; Mora, Delio Jose; Springer, Deborah J.; Heitman, Joseph; Fonseca, Fernanda Machado; Matos, Dulcilena; Melhem, Márcia Souza Carvalho; Silva-Vergara, Mario León

2014-01-01

Background Although Cryptococcus laurentii has been considered saprophytic and its taxonomy is still being described, several cases of human infections have already reported. This study aimed to evaluate molecular aspects of C. laurentii isolates from Brazil, Botswana, Canada, and the United States. Methods In this study, 100 phenotypically identified C. laurentii isolates were evaluated by sequencing the 18S nuclear ribosomal small subunit rRNA gene (18S-SSU), D1/D2 region of 28S nuclear ribosomal large subunit rRNA gene (28S-LSU), and the internal transcribed spacer (ITS) of the ribosomal region. Results BLAST searches using 550-bp, 650-bp, and 550-bp sequenced amplicons obtained from the 18S-SSU, 28S-LSU, and the ITS region led to the identification of 75 C. laurentii strains that shared 99–100% identity with C. laurentii CBS 139. A total of nine isolates shared 99% identity with both Bullera sp. VY-68 and C. laurentii RY1. One isolate shared 99% identity with Cryptococcus rajasthanensis CBS 10406, and eight isolates shared 100% identity with Cryptococcus sp. APSS 862 according to the 28S-LSU and ITS regions and designated as Cryptococcus aspenensis sp. nov. (CBS 13867). While 16 isolates shared 99% identity with Cryptococcus flavescens CBS 942 according to the 18S-SSU sequence, only six were confirmed using the 28S-LSU and ITS region sequences. The remaining 10 shared 99% identity with Cryptococcus terrestris CBS 10810, which was recently described in Brazil. Through concatenated sequence analyses, seven sequence types in C. laurentii, three in C. flavescens, one in C. terrestris, and one in the C. aspenensis sp. nov. were identified. Conclusions Sequencing permitted the characterization of 75% of the environmental C. laurentii isolates from different geographical areas and the identification of seven haplotypes of this species. Among sequenced regions, the increased variability of the ITS region in comparison to the 18S-SSU and 28S-LSU regions reinforces its applicability as a DNA barcode. PMID:25251413

Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA.

PubMed

Medina, M; Collins, A G; Silberman, J D; Sogin, M L

2001-08-14

We studied the evolutionary relationships among basal metazoan lineages by using complete large subunit (LSU) and small subunit (SSU) ribosomal RNA sequences for 23 taxa. After identifying competing hypotheses, we performed maximum likelihood searches for trees conforming to each hypothesis. Kishino-Hasegawa tests were used to determine whether the data (LSU, SSU, and combined) reject any of the competing hypotheses. We also conducted unconstrained tree searches, compared the resulting topologies, and calculated bootstrap indices. Shimodaira-Hasegawa tests were applied to determine whether the data reject any of the topologies resulting from the constrained and unconstrained tree searches. LSU, SSU, and the combined data strongly contradict two assertions pertaining to sponge phylogeny. Hexactinellid sponges are not likely to be the basal lineage of a monophyletic Porifera or the sister group to all other animals. Instead, Hexactinellida and Demospongia form a well-supported clade of siliceous sponges, Silicea. It remains unclear, on the basis of these data alone, whether the calcarean sponges are more closely related to Silicea or to nonsponge animals. The SSU and combined data reject the hypothesis that Bilateria is more closely related to Ctenophora than it is to Cnidaria, whereas LSU data alone do not refute either hypothesis. LSU and SSU data agree in supporting the monophyly of Bilateria, Cnidaria, Ctenophora, and Metazoa. LSU sequence data reveal phylogenetic structure in a data set with limited taxon sampling. Continued accumulation of LSU sequences should increase our understanding of animal phylogeny.

Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Medina, Monica; Collins, Allen G.; Silberman, Jeffrey

2001-06-21

We studied the evolutionary relationships among basal metazoan lineages by using complete large subunit (LSU) and small subunit (SSU) ribosomal RNA sequences for 23 taxa. After identifying competing hypotheses, we performed maximum likelihood searches for trees conforming to each hypothesis. Kishino-Hasegawa tests were used to determine whether the data (LSU, SSU, and combined) reject any of the competing hypotheses. We also conducted unconstrained tree searches, compared the resulting topologies, and calculated bootstrap indices. Shimodaira-Hasegawa tests were applied to determine whether the data reject any of the topologies resulting from the constrained and unconstrained tree searches. LSU, SSU, and the combinedmore » data strongly contradict two assertions pertaining to sponge phylogeny. Hexactinellid sponges are not likely to be the basal lineage of amonophyletic Porifera or the sister group to all other animals. Instead, Hexactinellida and Demospongia form a well-supported clade of siliceous sponges, Silicea. It remains unclear, on the basis of these data alone, whether the calcarean sponges are more closely related to Silicea or to nonsponge animals. The SSU and combined data reject the hypothesis that Bilateria is more closely related to Ctenophora than it is to Cnidaria, whereas LSU data alone do not refute either hypothesis. LSU and SSU data agree in supporting the monophyly of Bilateria, Cnidaria, Ctenophora, and Metazoa. LSU sequence data reveal phylogenetic structure in a data set with limited taxon sampling. Continued accumulation of LSU sequences should increase our understanding of animal phylogeny.« less

Assessing the diversity of AM fungi in arid gypsophilous plant communities.

PubMed

Alguacil, M M; Roldán, A; Torres, M P

2009-10-01

In the present study, we used PCR-Single-Stranded Conformation Polymorphism (SSCP) techniques to analyse arbuscular mycorrhizal fungi (AMF) communities in four sites within a 10 km(2) gypsum area in Southern Spain. Four common plant species from these ecosystems were selected. The AM fungal small-subunit (SSU) rRNA genes were subjected to PCR, cloning, SSCP analysis, sequencing and phylogenetic analyses. A total of 1443 SSU rRNA sequences were analysed, for 21 AM fungal types: 19 belonged to the genus Glomus, 1 to the genus Diversispora and 1 to the Scutellospora. Four sequence groups were identified, which showed high similarity to sequences of known glomalean species or isolates: Glo G18 to Glomus constrictum, Glo G1 to Glomus intraradices, Glo G16 to Glomus clarum, Scut to Scutellospora dipurpurescens and Div to one new genus in the family Diversisporaceae identified recently as Otospora bareai. There were three sequence groups that received strong support in the phylogenetic analysis, and did not seem to be related to any sequences of AM fungi in culture or previously found in the database; thus, they could be novel taxa within the genus Glomus: Glo G4, Glo G2 and Glo G14. We have detected the presence of both generalist and potential specialist AMF in gypsum ecosystems. The AMF communities were different in the plant studied suggesting some degree of preference in the interactions between these symbionts.

Unique phylogenetic position of Diplomonadida based on the complete small subunit ribosomal RNA sequence of Giardia ardeae, G. muris, G. duodenalis and Hexamita sp.

PubMed

van Keulen, H; Gutell, R R; Gates, M A; Campbell, S R; Erlandsen, S L; Jarroll, E L; Kulda, J; Meyer, E A

1993-01-01

Complete small-subunit rRNA (SSU-rRNA) coding region sequences were determined for two species of the intestinal parasite Giardia: G. ardeae and G. muris, both belonging to the order Diplomonadida, and a free-living member of this order, Hexamita sp. These sequences were compared to published SSU-rDNA sequences from a third member of the genus Giardia, G. duodenalis (often called G. intestinalis or G. lamblia) and various representative organisms from other taxa. Of the three Giardia sequences analyzed, the SSU-rRNA from G. muris is the smallest (1432 bases as compared to 1435 and 1453 for G. ardeae and G. duodenalis, respectively) and has the lowest G+C content (58.9%). The Hexamita SSU-rRNA is the largest in this group, containing 1550 bases. Because the sizes of the SSU-rRNA are prokaryotic rather than typically eukaryotic, the secondary structures of the SSU-rRNAs were constructed. These structures show a number of typically eukaryotic signature sequences. Sequence alignments based on constraints imposed by secondary structure were used for construction of a phylogenetic tree for these four taxa. The results show that of the four diplomonads represented, the Giardia species form a distinct group. The other diplomonad Hexamita and the microsporidium Vairimorpha necatrix appear to be distinct from Giardia.

Nop9 is a PUF-like protein that prevents premature cleavage to correctly process pre-18S rRNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Jun; McCann, Kathleen L.; Qiu, Chen

Numerous factors direct eukaryotic ribosome biogenesis, and defects in a single ribosome assembly factor may be lethal or produce tissue-specific human ribosomopathies. Pre-ribosomal RNAs (pre-rRNAs) must be processed stepwise and at the correct subcellular locations to produce the mature rRNAs. Nop9 is a conserved small ribosomal subunit biogenesis factor, essential in yeast. Here we report a 2.1-Å crystal structure of Nop9 and a small-angle X-ray-scattering model of a Nop9:RNA complex that reveals a ‘C’-shaped fold formed from 11 Pumilio repeats. We show that Nop9 recognizes sequence and structural features of the 20S pre-rRNA near the cleavage site of the nuclease,more » Nob1. We further demonstrate that Nop9 inhibits Nob1 cleavage, the final processing step to produce mature small ribosomal subunit 18S rRNA. Together, our results suggest that Nop9 is critical for timely cleavage of the 20S pre-rRNA. Moreover, the Nop9 structure exemplifies a new class of Pumilio repeat proteins.« less

Candida andamanensis sp. nov., Candida laemsonensis sp. nov. and Candida ranongensis sp. nov., anamorphic yeast species isolated from estuarine waters in a Thai mangrove forest.

PubMed

Am-In, Somjit; Limtong, Savitree; Yongmanitchai, Wichien; Jindamorakot, Sasitorn

2011-02-01

Five strains (RV5(T), RV140, R31(T), RS17 and RS28(T)) representing three novel anamorphic ascomycetous yeast species were isolated by membrane filtration from estuarine waters collected from a mangrove forest in Laem Son National Park, Ranong Province, Thailand, on different occasions. On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, sequence analysis of the D1/D2 domain of the large-subunit rRNA gene and the internal transcribed spacer region and phylogenetic analysis, three strains were found to represent two novel Candida species. Two strains (RV5(T) and RV140) represented a single novel species, for which the name Candida laemsonensis sp. nov. is proposed. The type strain is RV5(T) (=BCC 35154(T) =NBRC 105873(T) =CBS 11419(T)). Strain R31(T) was assigned to a novel species that was named Candida andamanensis sp. nov. (type strain R31(T) =BCC 25965(T) =NBRC 103862(T) =CBS 10859(T)). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, sequence analysis of the D1/D2 domain of the large-subunit rRNA gene and phylogenetic analysis, strains RS17 and RS28(T) represented another novel species of Candida, for which the name Candida ranongensis sp. nov. is proposed. The type strain is RS28(T) (=BCC 25964(T) =NBRC 103861(T) =CBS 10861(T)).

Population structure of Pneumocystis jirovecii isolated from immunodeficiency virus-positive patients.

PubMed

Esteves, Francisco; Gaspar, Jorge; Tavares, Adélcia; Moser, Inês; Antunes, Francisco; Mansinho, Kamal; Matos, Olga

2010-03-01

Pneumocystis jirovecii pneumonia (PcP) is an important opportunistic infection among immunocompromised patients. Genetic characterization of P. jirovecii isolated from HIV-positive patients, based on identification of multiple nucleotide sequences at eight distinct loci, was achieved by using PCR with DNA sequencing and RFLP. The present study showed that the mitochondrial large-subunit rRNA (mtLSU rRNA), the cytochrome b (CYB), the superoxide dismutase (SOD), the beta-tubulin (beta-tub), the dihydrofolate reductase (DHFR) and the dihydropteroate synthase (DHPS) loci sequences were more variable and therefore giving additional information than the thioredoxin reductase (Trr1) and the thymidylate synthase (TS) genes. Genotyping at those six most informative loci enabled the identification of 48 different P. jirovecii multilocus genotypes (MLGs). Significant statistical associations between infecting P. jirovecii genotypes and patients' age groups or PcP clinical status were found. Also, mtLSU rRNA sequences and specific genotypes from other three loci (CYB, SOD, and DHFR) were statistically associated. The results suggested large recombination between most P. jirovecii MLGs. However, one MLG occurred at a higher frequency than would be expected according to panmictic expectations, suggesting linkage disequilibrium and clonal propagation. The persistence of this specific MLG may be a consequence of clonal reproduction of this successful genotypic array in a P. jirovecii population with epidemic structure. The present study provided the description of multiple genomic regions of P. jirovecii, improving the understanding of genetic variability and frequency distribution of polymorphic genotypes, and exploring the criteria of clonality by testing over-representation of MLGs.

Identification of a microsporidian isolate from Cnaphalocrocis Medinalis and its pathogenicity to Bombyx mori.

PubMed

Huang, Xuhua; Qi, Guangjun; Pan, Zhixin; Zhu, Fangrong; Huang, Yuanjiao; Wu, Yonghu

2014-11-01

A microsporidian, CmM2, was isolated from Cnaphalocrocis medinalis. The biological characters, molecular analysis and pathogenicity of CmM2 were studied. The spore of CmM2 is long oval in shape and 3.45 ± 0.25 × 1.68 ± 0.18 µm in size, the life cycle includes meronts, sporonts, sporoblasts, and spores, with typical diplokaryon in each stage, propagated in binary fission. There is positive coagulation reaction between CmM2 and the polyclonal antibody of Nosema bombycis (N.b.). CmM2 spores is binuclear, and has 10-12 polar filament coils. The small subunit ribosomal RNA (SSU rRNA) gene sequence of CmM2 was obtained by PCR amplification and sequencing, the phylogenetic tree based on SSU rRNA sequences had been constructed, and the similarity and genetic distance of SSU rRNA sequences were analyzed, showed that CmM2 was grouped in the Nosema clade. The 50% infectious concentration of CmM2 to Bombyx mori is 4.72 × 10(4)  spores ml(-1) , and the germinative infection rate is 12.33%. The results showed that CmM2 is classified into genus Nosema, as Nosema sp. CmM2, and has a heavy infectivity to B. mori. The result indicated as well that it is valuable taxonomic determination for microsporidian isolates based on both biological characters and molecular evidence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Archaeoglobus infectus sp. nov., a novel thermophilic, chemolithoheterotrophic archaeon isolated from a deep-sea rock collected at Suiyo Seamount, Izu-Bonin Arc, western Pacific Ocean.

PubMed

Mori, Koji; Maruyama, Akihiko; Urabe, Tetsuro; Suzuki, Ken-Ichiro; Hanada, Satoshi

2008-04-01

A novel thermophilic, strictly anaerobic archaeon, designated strain Arc51T, was isolated from a rock sample collected from a deep-sea hydrothermal field in Suiyo Seamount, Izu-Bonin Arc, western Pacific Ocean. Cells of the isolate were irregular cocci with single flagella and exhibited blue-green fluorescence at 436 nm. The optimum temperature, pH and NaCl concentration for growth were 70 degrees C, pH 6.5 and 3 % (w/v), respectively. Strain Arc51T could grow on thiosulfate or sulfite as an electron acceptor in the presence of hydrogen. This strain required acetate as a carbon source for its growth, suggesting that the reductive acetyl CoA pathway for CO2 fixation was incomplete. In addition, coenzyme M (2-mercaptoethanesulfonic acid), which is a known methyl carrier in methanogenesis, was also a requirement for growth of the strain. Analysis of the 16S rRNA gene sequence revealed that the isolate was similar to members of the genus Archaeoglobus, with sequence similarities of 93.6-97.2 %; the closest relative was Archaeoglobus veneficus. Phylogenetic analyses of the dsrAB and apsA genes, encoding the alpha and beta subunits of dissimilatory sulfite reductase and the alpha subunit of adenosine-5'-phosphosulfate reductase, respectively, produced results similar to those inferred from comparisons based on the 16S rRNA gene sequence. On the basis of phenotypic and phylogenetic data, strain Arc51T represents a novel species of the genus Archaeoglobus, for which the name Archaeoglobus infectus sp. nov. is proposed. The type strain is Arc51T (=NBRC 100649T=DSM 18877T).

From genus to phylum: large-subunit and internal transcribed spacer rRNA operon regions show similar classification accuracies influenced by database composition.

PubMed

Porras-Alfaro, Andrea; Liu, Kuan-Liang; Kuske, Cheryl R; Xie, Gary

2014-02-01

We compared the classification accuracy of two sections of the fungal internal transcribed spacer (ITS) region, individually and combined, and the 5' section (about 600 bp) of the large-subunit rRNA (LSU), using a naive Bayesian classifier and BLASTN. A hand-curated ITS-LSU training set of 1,091 sequences and a larger training set of 8,967 ITS region sequences were used. Of the factors evaluated, database composition and quality had the largest effect on classification accuracy, followed by fragment size and use of a bootstrap cutoff to improve classification confidence. The naive Bayesian classifier and BLASTN gave similar results at higher taxonomic levels, but the classifier was faster and more accurate at the genus level when a bootstrap cutoff was used. All of the ITS and LSU sections performed well (>97.7% accuracy) at higher taxonomic ranks from kingdom to family, and differences between them were small at the genus level (within 0.66 to 1.23%). When full-length sequence sections were used, the LSU outperformed the ITS1 and ITS2 fragments at the genus level, but the ITS1 and ITS2 showed higher accuracy when smaller fragment sizes of the same length and a 50% bootstrap cutoff were used. In a comparison using the larger ITS training set, ITS1 and ITS2 had very similar accuracy classification for fragments between 100 and 200 bp. Collectively, the results show that any of the ITS or LSU sections we tested provided comparable classification accuracy to the genus level and underscore the need for larger and more diverse classification training sets.

From Genus to Phylum: Large-Subunit and Internal Transcribed Spacer rRNA Operon Regions Show Similar Classification Accuracies Influenced by Database Composition

PubMed Central

Liu, Kuan-Liang; Kuske, Cheryl R.

2014-01-01

We compared the classification accuracy of two sections of the fungal internal transcribed spacer (ITS) region, individually and combined, and the 5′ section (about 600 bp) of the large-subunit rRNA (LSU), using a naive Bayesian classifier and BLASTN. A hand-curated ITS-LSU training set of 1,091 sequences and a larger training set of 8,967 ITS region sequences were used. Of the factors evaluated, database composition and quality had the largest effect on classification accuracy, followed by fragment size and use of a bootstrap cutoff to improve classification confidence. The naive Bayesian classifier and BLASTN gave similar results at higher taxonomic levels, but the classifier was faster and more accurate at the genus level when a bootstrap cutoff was used. All of the ITS and LSU sections performed well (>97.7% accuracy) at higher taxonomic ranks from kingdom to family, and differences between them were small at the genus level (within 0.66 to 1.23%). When full-length sequence sections were used, the LSU outperformed the ITS1 and ITS2 fragments at the genus level, but the ITS1 and ITS2 showed higher accuracy when smaller fragment sizes of the same length and a 50% bootstrap cutoff were used. In a comparison using the larger ITS training set, ITS1 and ITS2 had very similar accuracy classification for fragments between 100 and 200 bp. Collectively, the results show that any of the ITS or LSU sections we tested provided comparable classification accuracy to the genus level and underscore the need for larger and more diverse classification training sets. PMID:24242255

Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

PubMed Central

Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

2006-01-01

As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome, we expect our report eventually to shed light on the evolution of the hymenopteran genome within higher insects, particularly regarding the relative maintenance of conserved rDNA genes, related variable spacer regions and retrotransposable elements. PMID:17069639

The Complete Mitochondrial DNA Sequence of Scenedesmus obliquus Reflects an Intermediate Stage in the Evolution of the Green Algal Mitochondrial Genome

PubMed Central

Nedelcu, Aurora M.; Lee, Robert W.; Lemieux, Claude; Gray, Michael W.; Burger, Gertraud

2000-01-01

Two distinct mitochondrial genome types have been described among the green algal lineages investigated to date: a reduced–derived, Chlamydomonas-like type and an ancestral, Prototheca-like type. To determine if this unexpected dichotomy is real or is due to insufficient or biased sampling and to define trends in the evolution of the green algal mitochondrial genome, we sequenced and analyzed the mitochondrial DNA (mtDNA) of Scenedesmus obliquus. This genome is 42,919 bp in size and encodes 42 conserved genes (i.e., large and small subunit rRNA genes, 27 tRNA and 13 respiratory protein-coding genes), four additional free-standing open reading frames with no known homologs, and an intronic reading frame with endonuclease/maturase similarity. No 5S rRNA or ribosomal protein-coding genes have been identified in Scenedesmus mtDNA. The standard protein-coding genes feature a deviant genetic code characterized by the use of UAG (normally a stop codon) to specify leucine, and the unprecedented use of UCA (normally a serine codon) as a signal for termination of translation. The mitochondrial genome of Scenedesmus combines features of both green algal mitochondrial genome types: the presence of a more complex set of protein-coding and tRNA genes is shared with the ancestral type, whereas the lack of 5S rRNA and ribosomal protein-coding genes as well as the presence of fragmented and scrambled rRNA genes are shared with the reduced–derived type of mitochondrial genome organization. Furthermore, the gene content and the fragmentation pattern of the rRNA genes suggest that this genome represents an intermediate stage in the evolutionary process of mitochondrial genome streamlining in green algae. [The sequence data described in this paper have been submitted to the GenBank data library under accession no. AF204057.] PMID:10854413

Diversity surveys and evolutionary relationships of aoxB genes in aerobic arsenite-oxidizing bacteria.

PubMed

Quéméneur, Marianne; Heinrich-Salmeron, Audrey; Muller, Daniel; Lièvremont, Didier; Jauzein, Michel; Bertin, Philippe N; Garrido, Francis; Joulian, Catherine

2008-07-01

A new primer set was designed to specifically amplify ca. 1,100 bp of aoxB genes encoding the As(III) oxidase catalytic subunit from taxonomically diverse aerobic As(III)-oxidizing bacteria. Comparative analysis of AoxB protein sequences showed variable conservation levels and highlighted the conservation of essential amino acids and structural motifs. AoxB phylogeny of pure strains showed well-discriminated taxonomic groups and was similar to 16S rRNA phylogeny. Alphaproteobacteria-, Betaproteobacteria-, and Gammaproteobacteria-related sequences were retrieved from environmental surveys, demonstrating their prevalence in mesophilic As-contaminated soils. Our study underlines the usefulness of the aoxB gene as a functional marker of aerobic As(III) oxidizers.

Ultrastructure and molecular diagnosis of Spironucleus salmonis (Diplomonadida) from rainbow trout Oncorhynchus mykiss in Germany.

PubMed

Fard, M Reza Saghari; Jørgensen, Anders; Sterud, Erik; Bleiss, Wilfrid; Poynton, Sarah L

2007-03-29

Diplomonad flagellates infect a wide range of fish hosts in aquaculture and in the wild in North America, Asia and Europe. Intestinal diplomonad infection in juvenile farmed trout can be associated with morbidity and mortality, and in Germany, diplomonads in trout are commonly reported, and yet are poorly characterised. We therefore undertook a comprehensive study of diplomonads from German rainbow trout Oncorhynchus mykiss, using scanning and transmission electron microscopy, and sequencing of the small subunit (ssu) rRNA gene. The diplomonad was identified as Spironucleus salmonis, formerly reported from Germany as Hexamita salmonis. Our new surface morphology studies showed that the cell surface was unadorned and a caudal projection was present. Transmission electron microscopy facilitated new observations of functional morphology, including vacuoles discharging from the body surface, and multi-lobed apices of the nuclei. We suggest the lobes form, via hydrostatic pressure on the nucleoplasm, in response to the beat of the anterior-medial flagella. The lobes serve to intertwine the nuclei, providing stability in the region of the cell exposed to internal mechanical stress. The ssu rRNA gene sequence clearly distinguished S. salmonis from S. barkhanus, S. salmonicida, and S. vortens from fish, and can be used for identification purposes. A 1405 bp sequence of the ssu rRNA gene from S. salmonis was obtained and included in a phylogenetic analysis of a selection of closely related diplomonads, showing that S. salmonis was recovered as sister taxon to S. vortens.

The 28S–18S rDNA intergenic spacer from Crithidia fasciculata: repeated sequences, length heterogeneity, putative processing sites and potential interactions between U3 small nucleolar RNA and the ribosomal RNA precursor

PubMed Central

Schnare, Murray N.; Collings, James C.; Spencer, David F.; Gray, Michael W.

2000-01-01

In Crithidia fasciculata, the ribosomal RNA (rRNA) gene repeats range in size from ∼11 to 12 kb. This length heterogeneity is localized to a region of the intergenic spacer (IGS) that contains tandemly repeated copies of a 19mer sequence. The IGS also contains four copies of an ∼55 nt repeat that has an internal inverted repeat and is also present in the IGS of Leishmania species. We have mapped the C.fasciculata transcription initiation site as well as two other reverse transcriptase stop sites that may be analogous to the A0 and A′ pre-rRNA processing sites within the 5′ external transcribed spacer (ETS) of other eukaryotes. Features that could influence processing at these sites include two stretches of conserved primary sequence and three secondary structure elements present in the 5′ ETS. We also characterized the C.fasciculata U3 snoRNA, which has the potential for base-pairing with pre-rRNA sequences. Finally, we demonstrate that biosynthesis of large subunit rRNA in both C.fasciculata and Trypanosoma brucei involves 3′-terminal addition of three A residues that are not present in the corresponding DNA sequences. PMID:10982863

Candida ruelliae sp. nov., a novel yeast species isolated from flowers of Ruellia sp. (Acanthaceae).

PubMed

Saluja, Puja; Prasad, Gandham S

2008-06-01

Two novel yeast strains designated as 16Q1 and 16Q3 were isolated from flowers of the Ruellia species of the Acanthaceae family. The D1/D2 domain and ITS sequences of these two strains were identical. Sequence analysis of the D1/D2 domain of large-subunit rRNA gene indicated their relationship to species of the Candida haemulonii cluster. However, they differ from C. haemulonii by 14% nucleotide sequence divergence, from Candida pseudohaemulonii by 16.1% and from C. haemulonii type II by 16.5%. These strains also differ in 18 physiological tests from the type strain of C. haemulonii, and 12 and 16 tests, respectively, from C. pseudohaemulonii and C. haemulonii type II. They also differ from C. haemulonii and other related species by more than 13% sequence divergence in the internal transcribed spacer region. In the SSU rRNA gene sequences, strain 16Q1 differs by 1.7% nucleotide divergence from C. haemulonii. Sporulation was not observed in pure or mixed cultures on several media examined. All these data support the assignment of these strains to a novel species; we have named them as Candida ruelliae sp. nov., and designate strain 16Q1(T)=MTCC 7739(T)=CBS10815(T) as type strain of the novel species.

Genotypic variations in field isolates of Theileria species infecting giraffes (Giraffa camelopardalis tippelskirchi and Giraffa camelopardalis reticulata) in Kenya.

PubMed

Githaka, Naftaly; Konnai, Satoru; Skilton, Robert; Kariuki, Edward; Kanduma, Esther; Murata, Shiro; Ohashi, Kazuhiko

2013-10-01

Recently, mortalities among giraffes, attributed to infection with unique species of piroplasms were reported in South Africa. Although haemoparasites are known to occur in giraffes of Kenya, the prevalence, genetic diversity and pathogenicity of these parasites have not been investigated. In this study, blood samples from 13 giraffes in Kenya were investigated microscopically and genomic DNA extracted. PCR amplicons of the hyper-variable region 4 (V4) of Theileria spp. small subunit ribosomal RNA (18S rRNA) gene were hybridized to a panel of genus- and species-specific oligonucleotide probes by reverse line blot (RLB). Two newly designed oligonucleotide probes specific for previously identified Theileria spp. of giraffes found single infections in eight of the specimens and mixed infections in the remaining five samples. Partial 18S rRNA genes were successfully amplified from 9 samples and the PCR amplicons were cloned. A total of 28 plasmid clones representing the Kenyan isolates were analyzed in the present study and compared with those of closely-related organisms retrieved from GenBank. In agreement with RLB results, the nucleotide sequence alignment indicated the presence of mixed infections in the giraffes. In addition, sequence alignment with the obtained 18S rRNA gene sequences revealed extensive microheterogeneities within and between isolates, characterized by indels in the V4 regions and point mutations outside this region. Phylogeny with 18S rRNA gene sequences from the detected parasites and those of related organisms places Theileria of giraffes into two major groups, within which are numerous clades that include the isolates reported in South Africa. Collectively, these data suggest the existence of at least two distinct Theileria species among giraffes, and extensive genetic diversity within the two parasite groups. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Plastid-Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae.

PubMed

Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

2016-06-27

Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid-nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Gene copy number variation and its significance in cyanobacterial phylogeny

PubMed Central

2012-01-01

Background In eukaryotes, variation in gene copy numbers is often associated with deleterious effects, but may also have positive effects. For prokaryotes, studies on gene copy number variation are rare. Previous studies have suggested that high numbers of rRNA gene copies can be advantageous in environments with changing resource availability, but further association of gene copies and phenotypic traits are not documented. We used one of the morphologically most diverse prokaryotic phyla to test whether numbers of gene copies are associated with levels of cell differentiation. Results We implemented a search algorithm that identified 44 genes with highly conserved copies across 22 fully sequenced cyanobacterial taxa. For two very basal cyanobacterial species, Gloeobacter violaceus and a thermophilic Synechococcus species, distinct phylogenetic positions previously found were supported by identical protein coding gene copy numbers. Furthermore, we found that increased ribosomal gene copy numbers showed a strong correlation to cyanobacteria capable of terminal cell differentiation. Additionally, we detected extremely low variation of 16S rRNA sequence copies within the cyanobacteria. We compared our results for 16S rRNA to three other eubacterial phyla (Chroroflexi, Spirochaetes and Bacteroidetes). Based on Bayesian phylogenetic inference and the comparisons of genetic distances, we could confirm that cyanobacterial 16S rRNA paralogs and orthologs show significantly stronger conservation than found in other eubacterial phyla. Conclusions A higher number of ribosomal operons could potentially provide an advantage to terminally differentiated cyanobacteria. Furthermore, we suggest that 16S rRNA gene copies in cyanobacteria are homogenized by both concerted evolution and purifying selection. In addition, the small ribosomal subunit in cyanobacteria appears to evolve at extraordinary slow evolutionary rates, an observation that has been made previously for morphological characteristics of cyanobacteria. PMID:22894826

The Complete Plastome Sequence of an Antarctic Bryophyte Sanionia uncinata (Hedw.) Loeske

PubMed Central

Park, Mira; Park, Hyun; Lee, Hyoungseok; Lee, Byeong-ha

2018-01-01

Organellar genomes of bryophytes are poorly represented with chloroplast genomes of only four mosses, four liverworts and two hornworts having been sequenced and annotated. Moreover, while Antarctic vegetation is dominated by the bryophytes, there are few reports on the plastid genomes for the Antarctic bryophytes. Sanionia uncinata (Hedw.) Loeske is one of the most dominant moss species in the maritime Antarctic. It has been researched as an important marker for ecological studies and as an extremophile plant for studies on stress tolerance. Here, we report the complete plastome sequence of S. uncinata, which can be exploited in comparative studies to identify the lineage-specific divergence across different species. The complete plastome of S. uncinata is 124,374 bp in length with a typical quadripartite structure of 114 unique genes including 82 unique protein-coding genes, 37 tRNA genes and four rRNA genes. However, two genes encoding the α subunit of RNA polymerase (rpoA) and encoding the cytochrome b6/f complex subunit VIII (petN) were absent. We could identify nuclear genes homologous to those genes, which suggests that rpoA and petN might have been relocated from the chloroplast genome to the nuclear genome. PMID:29494552

Chloroplast and nuclear gene sequences indicate late Pennsylvanian time for the last common ancestor of extant seed plants.

PubMed Central

Savard, L; Li, P; Strauss, S H; Chase, M W; Michaud, M; Bousquet, J

1994-01-01

We have estimated the time for the last common ancestor of extant seed plants by using molecular clocks constructed from the sequences of the chloroplastic gene coding for the large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (rbcL) and the nuclear gene coding for the small subunit of rRNA (Rrn18). Phylogenetic analyses of nucleotide sequences indicated that the earliest divergence of extant seed plants is likely represented by a split between conifer-cycad and angiosperm lineages. Relative-rate tests were used to assess homogeneity of substitution rates among lineages, and annual angiosperms were found to evolve at a faster rate than other taxa for rbcL and, thus, these sequences were excluded from construction of molecular clocks. Five distinct molecular clocks were calibrated using substitution rates for the two genes and four divergence times based on fossil and published molecular clock estimates. The five estimated times for the last common ancestor of extant seed plants were in agreement with one another, with an average of 285 million years and a range of 275-290 million years. This implies a substantially more recent ancestor of all extant seed plants than suggested by some theories of plant evolution. PMID:8197201

Changes in microbial community structure in the wake of Hurricanes Katrina and Rita.

PubMed

Amaral-Zettler, Linda A; Rocca, Jennifer D; Lamontagne, Michael G; Dennett, Mark R; Gast, Rebecca J

2008-12-15

Hurricanes have the potential to alter the structures of coastal ecosystems and generate pathogen-laden floodwaters thatthreaten public health. To examine the impact of hurricanes on urban systems, we compared microbial community structures in samples collected after Hurricane Katrina and before and after Hurricane Rita. We extracted environmental DNA and sequenced small-subunit rRNA (SSU rRNA) gene clone libraries to survey microbial communities in floodwater, water, and sediment samples collected from Lake Charles, Lake Pontchartrain, the 17th Street and Industrial Canals in New Orleans, and raw sewage. Correspondence analysis showed that microbial communities associated with sediments formed one cluster while communities associated with lake and Industrial Canal water formed a second. Communities associated with water from the 17th Street Canal and floodwaters collected in New Orleans showed similarity to communities in raw sewage and contained a number of sequences associated with possible pathogenic microbes. This suggests that a distinct microbial community developed in floodwaters following Hurricane Katrina and that microbial community structures as a whole might be sensitive indicators of ecosystem health and serve as "sentinels" of water quality in the environment.

Multigene Phylogeography of Bactrocera caudata (Insecta: Tephritidae): Distinct Genetic Lineages in Northern and Southern Hemispheres

PubMed Central

Yong, Hoi-Sen; Lim, Phaik-Eem; Tan, Ji; Song, Sze-Looi; Suana, I Wayan; Eamsobhana, Praphathip

2015-01-01

Bactrocera caudata is a pest of pumpkin flower. Specimens of B. caudata from the northern hemisphere (mainland Asia) and southern hemisphere (Indonesia) were analysed using the partial DNA sequences of the nuclear 28S rRNA and internal transcribed spacer region 2 (ITS-2) genes, and the mitochondrial cytochrome c oxidase subunit I (COI), cytochrome c oxidase subunit II (COII) and 16S rRNA genes. The COI, COII, 16S rDNA and concatenated COI+COII+16S and COI+COII+16S+28S+ITS-2 nucleotide sequences revealed that B. caudata from the northern hemisphere (Peninsular Malaysia, East Malaysia, Thailand) was distinctly different from the southern hemisphere (Indonesia: Java, Bali and Lombok), without common haplotype between them. Phylogenetic analysis revealed two distinct clades (northern and southern hemispheres), indicating distinct genetic lineage. The uncorrected ‘p’ distance for the concatenated COI+COII+16S nucleotide sequences between the taxa from the northern and southern hemispheres (‘p’ = 4.46-4.94%) was several folds higher than the ‘p’ distance for the taxa in the northern hemisphere (‘p’ = 0.00-0.77%) and the southern hemisphere (‘p’ = 0.00%). This distinct difference was also reflected by concatenated COI+COII+16S+28S+ITS-2 nucleotide sequences with an uncorrected 'p' distance of 2.34-2.69% between the taxa of northern and southern hemispheres. In accordance with the type locality the Indonesian taxa belong to the nominal species. Thus the taxa from the northern hemisphere, if they were to constitute a cryptic species of the B. caudata species complex based on molecular data, need to be formally described as a new species. The Thailand and Malaysian B. caudata populations in the northern hemisphere showed distinct genetic structure and phylogeographic pattern. PMID:26090853

Ribosome Biogenesis in African Trypanosomes Requires Conserved and Trypanosome-Specific Factors

PubMed Central

Umaer, Khan; Ciganda, Martin

2014-01-01

Large ribosomal subunit protein L5 is responsible for the stability and trafficking of 5S rRNA to the site of eukaryotic ribosomal assembly. In Trypanosoma brucei, in addition to L5, trypanosome-specific proteins P34 and P37 also participate in this process. These two essential proteins form a novel preribosomal particle through interactions with both the ribosomal protein L5 and 5S rRNA. We have generated a procyclic L5 RNA interference cell line and found that L5 itself is a protein essential for trypanosome growth, despite the presence of other 5S rRNA binding proteins. Loss of L5 decreases the levels of all large-subunit rRNAs, 25/28S, 5.8S, and 5S rRNAs, but does not alter small-subunit 18S rRNA. Depletion of L5 specifically reduced the levels of the other large ribosomal proteins, L3 and L11, whereas the steady-state levels of the mRNA for these proteins were increased. L5-knockdown cells showed an increase in the 40S ribosomal subunit and a loss of the 60S ribosomal subunits, 80S monosomes, and polysomes. In addition, L5 was involved in the processing and maturation of precursor rRNAs. Analysis of polysomal fractions revealed that unprocessed rRNA intermediates accumulate in the ribosome when L5 is depleted. Although we previously found that the loss of P34 and P37 does not result in a change in the levels of L5, the loss of L5 resulted in an increase of P34 and P37 proteins, suggesting the presence of a compensatory feedback loop. This study demonstrates that ribosomal protein L5 has conserved functions, in addition to nonconserved trypanosome-specific features, which could be targeted for drug intervention. PMID:24706018

Mitochondrial gene sequences alone or combined with ITS region sequences provide firm molecular criteria for the classification of Lecanicillium species.

PubMed

Kouvelis, Vassili N; Sialakouma, Aphrodite; Typas, Milton A

2008-07-01

The recent revision of Verticillium sect. Prostrata led to the introduction of the genus Lecanicillium, which comprises the majority of the entomopathogenic strains. Sixty-five strains previously classified as Verticillium lecanii or Verticillium sp. from different geographical regions and hosts were examined and their phylogenetic relationships were determined using sequences from three mitochondrial (mt) genes [the small rRNA subunit (rns), the NADH dehydrogenase subunits 1 (nad1) and 3 (nad3)] and the ITS region. In general, single gene phylogenetic trees differentiated and placed the strains examined in well-supported (by BS analysis) groups of L. lecanii, L. longisporum, L. muscarium, and L. nodulosum, although in some cases a few uncertainties still remained. nad1 was the most informative single gene in phylogenetic analyses and was also found to contain group I introns with putative open reading frames (ORFs) encoding for GIY-YIG endonucleases. The combined use of mt gene sequences resolved taxonomic uncertainties arisen from ITS analysis and, alone or in combination with ITS sequences, helped in placing uncharacterised Verticillium lecanii and Verticillium sp. firmly into Lecanicillium species. Combined gene data from all the mt genes and all the mt genes and the ITS region together, were very similar. Furthermore, a relaxed correlation with host specificity -- at least for Homoptera -- was indicated for the rns and the combined mt gene sequences. Thus, the usefulness of mt gene sequences as a convenient molecular tool in phylogenetic studies of entomopathogenic fungi was demonstrated.

Isolation of Onchocerca lupi in Dogs and Black Flies, California, USA

PubMed Central

Hassan, Hassan K.; Bolcen, Shanna; Kubofcik, Joseph; Nutman, Thomas B.; Eberhard, Mark L.; Middleton, Kelly; Wekesa, Joseph Wakoli; Ruedas, Gimena; Nelson, Kimberly J.; Dubielzig, Richard; De Lombaert, Melissa; Silverman, Bruce; Schorling, Jamie J.; Adler, Peter H.; Beeler, Emily S.

2015-01-01

In southern California, ocular infections caused by Onchocerca lupi were diagnosed in 3 dogs (1 in 2006, 2 in 2012). The infectious agent was confirmed through morphologic analysis of fixed parasites in tissues and by PCR and sequencing of amplicons derived from 2 mitochondrially encoded genes and 1 nuclear-encoded gene. A nested PCR based on the sequence of the cytochrome oxidase subunit 1 gene of the parasite was developed and used to screen Simulium black flies collected from southern California for O. lupi DNA. Six (2.8%; 95% CI 0.6%–5.0%) of 213 black flies contained O. lupi DNA. Partial mitochondrial16S rRNA gene sequences from the infected flies matched sequences derived from black fly larvae cytotaxonomically identified as Simulium tribulatum. These data implicate S. tribulatum flies as a putative vector for O. lupi in southern California. PMID:25897954

The internal transcribed spacer of ribosomal RNA genes in plant trypanosomes (Phytomonas spp.) resolves 10 groups.

PubMed

Dollet, Michel; Sturm, Nancy R; Campbell, David A

2012-03-01

The distinction between plant trypanosomatids and opportunistic monoxenous insect trypanosomatids has not been demarcated clearly due to the mass placement of all trypanosomatids isolated from plants into the arbitrary genus Phytomonas spp. The advent of molecular markers has been useful in distinguishing plant trypanosomatids from the rest of the Trypanosomatidae family. Here we have examined the internal transcribed spacer (ITS) region of the ribosomal RNA (rRNA) locus for classification purposes. This region contains two distinct ITSs flanked by the small subunit and large subunit of ribosomal RNA genes and separated by the 5.8S ribosomal RNA gene. Sequences within the 5.8S ribosomal RNA gene and in the ITS sequences can serve as specific markers for several of the Phytomonas groups. Microsatellite sequences were identified in Phytomonas spp. in both ITS regions. Several classes of microsatellites were seen, with inter-isolate variation that has potential for future use. Maximum Likelihood analysis of the ITS sequences of 20 Phytomonas isolates representing the eight defined groups and a few unclassified isolates revealed a total of 10 distinct subgroups within our collection, of which two are new. The ITS region, which includes the 5.8S sequence, is a robust marker for the subdivisions within the genus Phytomonas spp. Copyright © 2011 Elsevier B.V. All rights reserved.

Molecular analysis of 16S rRNA genes identifies potentially periodontal pathogenic bacteria and archaea in the plaque of partially erupted third molars.

PubMed

Mansfield, J M; Campbell, J H; Bhandari, A R; Jesionowski, A M; Vickerman, M M

2012-07-01

Small subunit rRNA sequencing and phylogenetic analysis were used to identify cultivable and uncultivable microorganisms present in the dental plaque of symptomatic and asymptomatic partially erupted third molars to determine the prevalence of putative periodontal pathogens in pericoronal sites. Template DNA prepared from subgingival plaque collected from partially erupted symptomatic and asymptomatic mandibular third molars and healthy incisors was used in polymerase chain reaction with broad-range oligonucleotide primers to amplify 16S rRNA bacterial and archaeal genes. Amplicons were cloned, sequenced, and compared with known nucleotide sequences in online databases to identify the microorganisms present. Two thousand three hundred two clones from the plaque of 12 patients carried bacterial sequences from 63 genera belonging to 11 phyla, including members of the uncultivable TM7, SR1, and Chloroflexi, and difficult-to-cultivate Synergistetes and Spirochaetes. Dialister invisus, Filifactor alocis, Fusobacterium nucleatum, Porphyromonas endodontalis, Prevotella denticola, Tannerella forsythia, and Treponema denticola, which have been associated with periodontal disease, were found in significantly greater abundance in pericoronal compared with incisor sites. Dialister invisus and F nucleatum were found in greater abundance in sites exhibiting clinical symptoms. The archaeal species, Methanobrevibacter oralis, which has been associated with severe periodontitis, was found in 3 symptomatic patients. These findings have provided new insights into the complex microbiota of pericoronitis. Several bacterial and archaeal species implicated in periodontal disease were recovered in greater incidence and abundance from the plaque of partially erupted third molars compared with incisors, supporting the hypothesis that the pericoronal region may provide a favored niche for periodontal pathogens in otherwise healthy mouths. Copyright © 2012 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Characterization of the methanogen community in a household anaerobic digester fed with swine manure in China.

PubMed

Qin, Huibin; Lang, Huihua; Yang, Hongjiang

2013-09-01

Household anaerobic digesters have been installed across rural China for biogas production, but information on methanogen community structure in these small biogas units is sparsely available. By creating clone libraries for 16S rRNA and methyl coenzyme M reductase alpha subunit (mcrA) genes, we investigated the methanogenic consortia in a household biogas digester treating swine manure. Operational taxonomic units (OTUs) were defined by comparative sequence analysis, seven OTUs were identified in the 16S rRNA gene library, and ten OTUs were identified in the mcrA gene library. Both libraries were dominated by clones highly related to the type strain Methanocorpusculum labreanum Z, 64.0 % for 16S rRNA gene clones and 64.3 % for mcrA gene clones. Additionally, gas chromatography assays showed that formic acid was 84.54 % of the total volatile fatty acids and methane was 57.20 % of the biogas composition. Our results may help further isolation and characterization of methanogenic starter strains for industrial biogas production.

Cryphodera sinensis n. sp. (Nematoda: Heteroderidae), a non-cyst-forming parasitic nematode from the root of ramie Boehmeria nivea in China.

PubMed

Zhuo, K; Wang, H H; Ye, W; Peng, D L; Liao, J L

2014-12-01

Cryphodera sinensis n. sp. is described from ramie (Boehmeria nivea) based on the morphology and molecular analyses of rRNA small subunit (SSU), D2D3 expansion domains of large subunit (LSU D2D3) and internal transcribed spacer (ITS). This new species is characterized by oval females with a distinct subcrystalline layer and pronounced and protruding vulval lip, distinctly concave vulva-anus profile and a vulva-anus distance of 29.5-35.8 μm. Males possess two annuli in the lip region, a stylet 27-32.5 μm in length with round knobs sloping slightly posteriorly, lateral fields with three lines, spicules 20-28 μm long and the presence of a short cloacal tube. Second-stage juveniles possess three lip annuli, a stylet 28-31 μm in length with well-developed knobs projected anteriorly and three lines along the lateral field. The pointed tail, 52-65 μm long, possesses a mucro-like tip and a hyaline region, 24.5-35 μm long. Large phasmids with a lens-like structure are located 2-6 annuli posterior to the anus. Phylogenetic analysis shows that the species has unique SSU, LSU D2D3 and ITS rRNA sequences. Phylogenetic relationships of the three rDNA sequences of C. sinensis n. sp. and other cystoid/cyst nematodes are analysed together with a comparison of other species within the genus Cryphodera.

Phylogenetic analysis of Haemaphysalis erinacei Pavesi, 1884 (Acari: Ixodidae) from China, Turkey, Italy and Romania.

PubMed

Hornok, Sándor; Wang, Yuanzhi; Otranto, Domenico; Keskin, Adem; Lia, Riccardo Paolo; Kontschán, Jenő; Takács, Nóra; Farkas, Róbert; Sándor, Attila D

2016-12-15

Haemaphysalis erinacei is one of the few ixodid tick species for which valid names of subspecies exist. Despite their disputed taxonomic status in the literature, these subspecies have not yet been compared with molecular methods. The aim of the present study was to investigate the phylogenetic relationships of H. erinacei subspecies, in the context of the first finding of this tick species in Romania. After morphological identification, DNA was extracted from five adults of H. e. taurica (from Romania and Turkey), four adults of H. e. erinacei (from Italy) and 17 adults of H. e. turanica (from China). From these samples fragments of the cytochrome c oxidase subunit 1 (cox1) and 16S rRNA genes were amplified via PCR and sequenced. Results showed that cox1 and 16S rRNA gene sequence divergences between H. e. taurica from Romania and H. e. erinacei from Italy were below 2%. However, the sequence divergences between H. e. taurica from Romania and H. e. turanica from China were high (up to 7.3% difference for the 16S rRNA gene), exceeding the reported level of sequence divergence between closely related tick species. At the same time, two adults of H. e. taurica from Turkey had higher 16S rRNA gene similarity to H. e. turanica from China (up to 97.5%) than to H. e. taurica from Romania (96.3%), but phylogenetically clustered more closely to H. e. taurica than to H. e. turanica. This is the first finding of H. erinacei in Romania, and the first (although preliminary) phylogenetic comparison of H. erinacei subspecies. Phylogenetic analyses did not support that the three H. erinacei subspecies evaluated here are of equal taxonomic rank, because the genetic divergence between H. e. turanica from China and H. e. taurica from Romania exceeded the usual level of sequence divergence between closely related tick species, suggesting that they might represent different species. Therefore, the taxonomic status of the subspecies of H. erinacei needs to be revised based on a larger number of specimens collected throughout its geographical range.

Volcanic Soils as Sources of Novel CO-Oxidizing Paraburkholderia and Burkholderia: Paraburkholderia hiiakae sp. nov., Paraburkholderia metrosideri sp. nov., Paraburkholderia paradisi sp. nov., Paraburkholderia peleae sp. nov., and Burkholderia alpina sp. nov. a Member of the Burkholderia cepacia Complex

PubMed Central

Weber, Carolyn F.; King, Gary M.

2017-01-01

Previous studies showed that members of the Burkholderiales were important in the succession of aerobic, molybdenum-dependent CO oxidizing-bacteria on volcanic soils. During these studies, four isolates were obtained from Kilauea Volcano (Hawai‘i, USA); one strain was isolated from Pico de Orizaba (Mexico) during a separate study. Based on 16S rRNA gene sequence similarities, the Pico de Orizaba isolate and the isolates from Kilauea Volcano were provisionally assigned to the genera Burkholderia and Paraburkholderia, respectively. Each of the isolates possessed a form I coxL gene that encoded the catalytic subunit of carbon monoxide dehydrogenase (CODH); none of the most closely related type strains possessed coxL or oxidized CO. Genome sequences for Paraburkholderia type strains facilitated an analysis of 16S rRNA gene sequence similarities and average nucleotide identities (ANI). ANI did not exceed 95% (the recommended cutoff for species differentiation) for any of the pairwise comparisons among 27 reference strains related to the new isolates. However, since the highest 16S rRNA gene sequence similarity among this set of reference strains was 98.93%, DNA-DNA hybridizations (DDH) were performed for two isolates whose 16S rRNA gene sequence similarities with their nearest phylogenetic neighbors were 98.96 and 99.11%. In both cases DDH values were <16%. Based on multiple variables, four of the isolates represent novel species within the Paraburkholderia: Paraburkholderia hiiakae sp. nov. (type strain I2T = DSM 28029T = LMG 27952T); Paraburkholderia paradisi sp. nov. (type strain WAT = DSM 28027T = LMG 27949T); Paraburkholderia peleae sp. nov. (type strain PP52-1T = DSM 28028T = LMG 27950T); and Paraburkholderia metrosideri sp. nov. (type strain DNBP6-1T = DSM 28030T = LMG 28140T). The remaining isolate represents the first CO-oxidizing member of the Burkholderia cepacia complex: Burkholderia alpina sp. nov. (type strain PO-04-17-38T = DSM 28031T = LMG 28138T). PMID:28270796

Volcanic Soils as Sources of Novel CO-Oxidizing Paraburkholderia and Burkholderia: Paraburkholderia hiiakae sp. nov., Paraburkholderia metrosideri sp. nov., Paraburkholderia paradisi sp. nov., Paraburkholderia peleae sp. nov., and Burkholderia alpina sp. nov. a Member of the Burkholderia cepacia Complex.

PubMed

Weber, Carolyn F; King, Gary M

2017-01-01

Previous studies showed that members of the Burkholderiales were important in the succession of aerobic, molybdenum-dependent CO oxidizing-bacteria on volcanic soils. During these studies, four isolates were obtained from Kilauea Volcano (Hawai'i, USA); one strain was isolated from Pico de Orizaba (Mexico) during a separate study. Based on 16S rRNA gene sequence similarities, the Pico de Orizaba isolate and the isolates from Kilauea Volcano were provisionally assigned to the genera Burkholderia and Paraburkholderia , respectively. Each of the isolates possessed a form I coxL gene that encoded the catalytic subunit of carbon monoxide dehydrogenase (CODH); none of the most closely related type strains possessed coxL or oxidized CO. Genome sequences for Paraburkholderia type strains facilitated an analysis of 16S rRNA gene sequence similarities and average nucleotide identities (ANI). ANI did not exceed 95% (the recommended cutoff for species differentiation) for any of the pairwise comparisons among 27 reference strains related to the new isolates. However, since the highest 16S rRNA gene sequence similarity among this set of reference strains was 98.93%, DNA-DNA hybridizations (DDH) were performed for two isolates whose 16S rRNA gene sequence similarities with their nearest phylogenetic neighbors were 98.96 and 99.11%. In both cases DDH values were <16%. Based on multiple variables, four of the isolates represent novel species within the Paraburkholderia : Paraburkholderia hiiakae sp. nov. (type strain I2 T = DSM 28029 T = LMG 27952 T ); Paraburkholderia paradisi sp. nov. (type strain WA T = DSM 28027 T = LMG 27949 T ); Paraburkholderia peleae sp. nov. (type strain PP52-1 T = DSM 28028 T = LMG 27950 T ); and Paraburkholderia metrosideri sp. nov. (type strain DNBP6-1 T = DSM 28030 T = LMG 28140 T ). The remaining isolate represents the first CO-oxidizing member of the Burkholderia cepacia complex: Burkholderia alpina sp. nov. (type strain PO-04-17-38 T = DSM 28031 T = LMG 28138 T ).

New record of Apoholosticha sinica (Ciliophora, Urostylida) from the UK: morphology, 18S rRNA gene phylogeny and notes on morphogenesis.

PubMed

Hu, Xiaozhong; Fan, Yangbo; Warren, Alan

2015-08-01

The benthic urostylid ciliate Apoholosticha sinicaFan et al., 2014 was isolated from a salt marsh at Blakeney, UK, and reinvestigated using light microscopy and small-subunit rRNA gene sequencing. Morphologically, it corresponds well with the original description. Several stages of divisional morphogenesis and physiological reorganization were also observed from which the following could be deduced: (i) the oral apparatus is completely newly built in the proter; (ii) frontal-ventral-transverse cirral anlage II does not produce a buccal cirrus; (iii) each of the posteriormost three or four anlagen contributes one transverse cirrus at its posterior end; (iv) a row of frontoterminal cirri originates from the rearmost frontal-ventral-transverse cirral anlage; (v) the last midventral row is formed from the penultimate frontal-ventral-transverse cirral anlage. Based on new data, two diagnostic features were added to the genus definition: (i) the midventral complex is composed of midventral pairs and midventral row and (ii) pretransverse ventral cirri are absent. Based on a combination of morphological and morphogenetic data, the genus Apoholosticha is assigned to the recently erected subfamily Nothoholostichinae Paiva et al., 2014, which is consistent with sequence comparison and phylogenetic analyses based on SSU rRNA gene data. It is also concluded that this benthic species, previously reported only from China, is not an endemic form.

Mapping of chloroplast mutations conferring resistance to antibiotics in Chlamydomonas: evidence for a novel site of streptomycin resistance in the small subunit rRNA.

PubMed

Gauthier, A; Turmel, M; Lemieux, C

1988-10-01

A major obstacle to our understanding of the mechanisms governing the inheritance, recombination and segregation of chloroplast genes in Chlamydomonas is that the majority of antibiotic resistance mutations that have been used to gain insights into such mechanisms have not been physically localized on the chloroplast genome. We report here the physical mapping of two chloroplast antibiotic resistance mutations: one conferring cross-resistance to erythromycin and spiramycin in Chlamydomonas moewusii (er-nM1) and the other conferring resistance to streptomycin in the interfertile species C. eugametos (sr-2). The er-nM1 mutation results from a C to G transversion at a well-known site of macrolide resistance within the peptidyl transferase loop region of the large subunit rRNA gene. This locus, designated rib-2 in yeast mitochondrial DNA, corresponds to residue C-2611 in the 23 S rRNA of Escherichia coli. The sr-2 locus maps within the small subunit (SSU) rRNA gene at a site that has not been described previously. The mutation results from an A to C transversion at a position equivalent to residue A-523 in the E. coli 16 S rRNA. Although this region of the E. coli SSU rRNA has no binding affinity for streptomycin, it binds to ribosomal protein S4, a protein that has long been associated with the response of bacterial cells to this antibiotic. We propose that the sr-2 mutation indirectly affects the nearest streptomycin binding site through an altered interaction between a ribosomal protein and the SSU rRNA.

Complete sequence and gene organization of the mitochondrial genome of Asio flammeus (Strigiformes, strigidae).

PubMed

Zhang, Yanan; Song, Tao; Pan, Tao; Sun, Xiaonan; Sun, Zhonglou; Qian, Lifu; Zhang, Baowei

2016-07-01

The complete sequence of the mitochondrial genome was determined for Asio flammeus, which is distributed widely in geography. The length of the complete mitochondrial genome was 18,966 bp, containing 2 rRNA genes, 22 tRNA genes, 13 protein-coding genes (PCGs), and 1 non-coding region (D-loop). All the genes were distributed on the H-strand, except for the ND6 subunit gene and eight tRNA genes which were encoded on the L-strand. The D-loop of A. flammeus contained many tandem repeats of varying lengths and repeat numbers. The molecular-based phylogeny showed that our species acted as the sister group to A. capensis and the supported Asio was the monophyletic group.

Diversity Surveys and Evolutionary Relationships of aoxB Genes in Aerobic Arsenite-Oxidizing Bacteria▿ †

PubMed Central

Quéméneur, Marianne; Heinrich-Salmeron, Audrey; Muller, Daniel; Lièvremont, Didier; Jauzein, Michel; Bertin, Philippe N.; Garrido, Francis; Joulian, Catherine

2008-01-01

A new primer set was designed to specifically amplify ca. 1,100 bp of aoxB genes encoding the As(III) oxidase catalytic subunit from taxonomically diverse aerobic As(III)-oxidizing bacteria. Comparative analysis of AoxB protein sequences showed variable conservation levels and highlighted the conservation of essential amino acids and structural motifs. AoxB phylogeny of pure strains showed well-discriminated taxonomic groups and was similar to 16S rRNA phylogeny. Alphaproteobacteria-, Betaproteobacteria-, and Gammaproteobacteria-related sequences were retrieved from environmental surveys, demonstrating their prevalence in mesophilic As-contaminated soils. Our study underlines the usefulness of the aoxB gene as a functional marker of aerobic As(III) oxidizers. PMID:18502920

Molecular survey of hard ticks in endemic areas of tick-borne diseases in China.

PubMed

Lu, Xin; Lin, Xian-Dan; Wang, Jian-Bo; Qin, Xin-Cheng; Tian, Jun-Hua; Guo, Wen-Ping; Fan, Fei-Neng; Shao, Renfu; Xu, Jianguo; Zhang, Yong-Zhen

2013-06-01

Over the past several years, there was a substantial increase in the number of cases of known and novel tick-borne infections in humans in China. To better understand the ticks associated with these infections, we collected hard ticks from animals or around livestock shelters in 29 localities in 5 provinces (Beijing, Henan, Hubei, Inner Mongolia, and Zhejiang) where cases of tick-borne illness were reported. We collected 2950 hard ticks representing 7 species of 4 genera (Dermacentor sinicus, Haemaphysalis flava, Haemaphysalis longicornis, Ixodes granulatus, Ixodes persulcatus, Rhipicephalus microplus, and Rhipicephalus sanguineus). These ticks were identified to species using morphological characters initially. We then sequenced the mitochondrial small subunit rRNA (12S rRNA) gene, cytochrome oxidase subunit 1 (COI) gene, and the second internal transcribed spacer (ITS2) gene of these ticks, and conducted phylogenetic analyses. Our analyses showed that the molecular and morphological data are consistent in the identification of the 7 tick species. Furthermore, all these 7 tick species from China were genetically closely related to the same species or related species found outside China. Rapid and accurate identification and long-term monitoring of these ticks will be of significance to the prevention and control of tick-borne diseases in China. Copyright © 2013 Elsevier GmbH. All rights reserved.

Genetic identification of eggs from four species of Ophichthidae and Congridae (Anguilliformes) in the northern East China Sea

PubMed Central

Choi, Hae-young; Oh, Jina

2018-01-01

We report the first genetic identification of eggs of four species of Anguilliformes caught in the northern East China Sea during August 2016, where leptocephali and adults have been collected. The species were Ophisurus macrorhynchos and Echelus uropterus belonging to the Ophichthidae, and Ariosoma majus and Gnathophis heterognathos belonging to the Congridae. The eggs were identified using three molecular genetic markers (mitochondrial 12S rRNA, 16S rRNA, and cytochrome c oxidase subunit 1), sequences obtained from local adult specimens, and geographical distribution data. All eggs were in the early or middle developmental stages. For all species except A. majus, the eggs were found near the range of small leptocephali in the East China Sea and the southern Korean Peninsula, which indicates these species had spawned along the continental near these areas during the summer. PMID:29621326

Detection and molecular identification of Cryptosporidium species in laboratory rats (Rattus norvegicus) in Ibadan, Nigeria

PubMed

Ayinmode, Adekunle Bamidele; Ogbonna, Nkeiruka Fortunate; Widmer, Giovanni

To study the occurrence of Cryptosporidium infection in laboratory rats (Rattus norvegicus) raised for experimental usage, 134 faecal samples were obtained from two rearing houses in Ibadan and examined for the presence of Cryptosporidium oocyst using the modified acid fast staining technique. Cryptosporidium species in 2 samples positive for microscopy were further characterized by a nested polymerase chain reaction (PCR) amplifying the 18S rRNA gene. Two of 134 samples were positive for the Cryptosporidium oocysts. Sequencing of the small-subunit rRNA amplicons identified the species in the two PCR positive samples as Cryptosporidium andersoni and Cryptosporidium rat genotype. These findings showed that laboratory rat is a potential reservoir for diverse Cryptosporidium species and suggests that laboratory rats should be screened for Cryptosporidium infection prior to experiments, especially where pathogen free animals are not available. This the first report to identify Cryptosporidium species infecting laboratory rats in Nigeria.

Phylogenetic relationships of Sarcocystis neurona of horses and opossums to other cyst-forming coccidia deduced from SSU rRNA gene sequences.

PubMed

Elsheikha, Hany M; Lacher, David W; Mansfield, Linda S

2005-11-01

Phylogenetic analyses based on sequences of the nuclear-encoded small subunit rRNA (ssurRNA) gene were performed to examine the origin, phylogeny, and biogeographic relationships of Sarcocystis neurona isolates from opossums and horses from the State of Michigan, USA, in relation to other cyst-forming coccidia. A total of 31 taxa representing all recognized subfamilies and genera of Sarcocystidae were included in the analyses with clonal isolates of two opossum and two horse S. neurona. Phylogenies obtained by the four tree-building methods were consistent with the classical taxonomy based on morphological criteria. The "isosporid" coccidia Neospora, Toxoplasma, Besnoitia, Isospora lacking stieda bodies, and Hyaloklossia formed a sister group to the Sarcocystis spp. Sarcocystis species were divided into three main lineages; S. neurona isolates were located in the second lineage and clustered with S. mucosa, S. dispersa, S. lacertae, S. rodentifelis, S. muris, and Frenkelia spp. Alignment of S. neurona SSU rRNA gene sequences of Michigan opossum isolates (MIOP5, MIOP20) and a S. neurona Michigan horse isolate (MIH8) showed 100% identity. These Michigan isolates differed in 2/1085 bp (0.2%) from a Kentucky S. neurona horse isolate (SN5). Additionally, S. neurona isolates from horses and opossums were identical based on the ultrastructural features and PCR-RFLP analyses thus forming a phylogenetically indistinct group in these regions. These findings revealed the concordance between the morphological and molecular data and confirmed that S. neurona from opossums and horses originated from the same phylogenetic origin.

Molecular gene organisation and secondary structure of the mitochondrial large subunit ribosomal RNA from the cultivated Basidiomycota Agrocybe aegerita: a 13 kb gene possessing six unusual nucleotide extensions and eight introns.

PubMed

Gonzalez, P; Barroso, G; Labarère, J

1999-04-01

The complete gene sequence and secondary structure of the mitochondrial LSU rRNA from the cultivated Basidiomycota Agrocybe aegerita was derived by chromosome walking. The A.aegerita LSU rRNA gene (13 526 nt) represents, to date, the longest described, due to the highest number of introns (eight) and the occurrence of six long nucleotidic extensions. Seven introns belong to group I, while the intronic sequence i5 constitutes the first typical group II intron reported in a fungal mitochondrial LSU rDNA. As with most fungal LSU rDNA introns reported to date, four introns (i5-i8) are distributed in domain V associated with the peptidyl-transferase activity. One intron (i1) is located in domain I, and three (i2-i4) in domain II. The introns i2-i8 possess homologies with other fungal, algal or protozoan introns located at the same position in LSU rDNAs. One of them (i6) is located at the same insertion site as most Ascomycota or algae LSU introns, suggesting a possible inheritance from a common ancestor. On the contrary, intron i1 is located at a so-far unreported insertion site. Among the six unusual nucleotide extensions, five are located in domain I and one in domain V. This is the first report of a mitochondrial LSU rRNA gene sequence and secondary structure for the whole Basidiomycota division.

Dryland biological soil crust cyanobacteria show unexpected decreases in abundance under long-term elevated CO2.

PubMed

Steven, Blaire; Gallegos-Graves, La Verne; Yeager, Chris M; Belnap, Jayne; Evans, R David; Kuske, Cheryl R

2012-12-01

Biological soil crusts (biocrusts) cover soil surfaces in many drylands globally. The impacts of 10 years of elevated atmospheric CO2 on the cyanobacteria in biocrusts of an arid shrubland were examined at a large manipulated experiment in Nevada, USA. Cyanobacteria-specific quantitative PCR surveys of cyanobacteria small-subunit (SSU) rRNA genes suggested a reduction in biocrust cyanobacterial biomass in the elevated CO2 treatment relative to the ambient controls. Additionally, SSU rRNA gene libraries and shotgun metagenomes showed reduced representation of cyanobacteria in the total microbial community. Taxonomic composition of the cyanobacteria was similar under ambient and elevated CO2 conditions, indicating the decline was manifest across multiple cyanobacterial lineages. Recruitment of cyanobacteria sequences from replicate shotgun metagenomes to cyanobacterial genomes representing major biocrust orders also suggested decreased abundance of cyanobacteria sequences across the majority of genomes tested. Functional assignment of cyanobacteria-related shotgun metagenome sequences indicated that four subsystem categories, three related to oxidative stress, were differentially abundant in relation to the elevated CO2 treatment. Taken together, these results suggest that elevated CO2 affected a generalized decrease in cyanobacteria in the biocrusts and may have favoured cyanobacteria with altered gene inventories for coping with oxidative stress. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

Dryland biological soil crust cyanobacteria show unexpected decreases in abundance under long-term elevated CO2

USGS Publications Warehouse

Steven, Blaire; Gallegos-Graves, La Verne; Yeager, Chris M.; Belnap, Jayne; Evans, R. David; Kuske, Cheryl R.

2012-01-01

Biological soil crusts (biocrusts) cover soil surfaces in many drylands globally. The impacts of 10 years of elevated atmospheric CO2 on the cyanobacteria in biocrusts of an arid shrubland were examined at a large manipulated experiment in Nevada, USA. Cyanobacteria-specific quantitative PCR surveys of cyanobacteria small-subunit (SSU) rRNA genes suggested a reduction in biocrust cyanobacterial biomass in the elevated CO2 treatment relative to the ambient controls. Additionally, SSU rRNA gene libraries and shotgun metagenomes showed reduced representation of cyanobacteria in the total microbial community. Taxonomic composition of the cyanobacteria was similar under ambient and elevated CO2 conditions, indicating the decline was manifest across multiple cyanobacterial lineages. Recruitment of cyanobacteria sequences from replicate shotgun metagenomes to cyanobacterial genomes representing major biocrust orders also suggested decreased abundance of cyanobacteria sequences across the majority of genomes tested. Functional assignment of cyanobacteria-related shotgun metagenome sequences indicated that four subsystem categories, three related to oxidative stress, were differentially abundant in relation to the elevated CO2 treatment. Taken together, these results suggest that elevated CO2 affected a generalized decrease in cyanobacteria in the biocrusts and may have favoured cyanobacteria with altered gene inventories for coping with oxidative stress.

A morphogenetic survey on ciliate plankton from a mountain lake pinpoints the necessity of lineage-specific barcode markers in microbial ecology.

PubMed

Stoeck, Thorsten; Breiner, Hans-Werner; Filker, Sabine; Ostermaier, Veronika; Kammerlander, Barbara; Sonntag, Bettina

2014-02-01

Analyses of high-throughput environmental sequencing data have become the 'gold-standard' to address fundamental questions of microbial diversity, ecology and biogeography. Findings that emerged from sequencing are, e.g. the discovery of the extensive 'rare microbial biosphere' and its potential function as a seed-bank. Even though applied since several years, results from high-throughput environmental sequencing have hardly been validated. We assessed how well pyrosequenced amplicons [the hypervariable eukaryotic V4 region of the small subunit ribosomal RNA (SSU rRNA) gene] reflected morphotype ciliate plankton. Moreover, we assessed if amplicon sequencing had the potential to detect the annual ciliate plankton stock. In both cases, we identified significant quantitative and qualitative differences. Our study makes evident that taxon abundance distributions inferred from amplicon data are highly biased and do not mirror actual morphotype abundances at all. Potential reasons included cell losses after fixation, cryptic morphotypes, resting stages, insufficient sequence data availability of morphologically described species and the unsatisfying resolution of the V4 SSU rRNA fragment for accurate taxonomic assignments. The latter two underline the necessity of barcoding initiatives for eukaryotic microbes to better and fully exploit environmental amplicon data sets, which then will also allow studying the potential of seed-bank taxa as a buffer for environmental changes. © 2013 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

A new moss salamander, genus Nototriton (Caudata: Plethodontidae), from the Cordillera de Talamanca, in the Costa Rica-Panama border region.

PubMed

Arias, Erick; Kubicki, Brian

2018-01-07

A new salamander belonging to the genus Nototriton, subgenus Nototriton, is described from the Caribbean slopes of the southeastern Cordillera de Talamanca in Costa Rica, within Parque Internacional La Amistad, at an elevation ca. 1500 m a.s.l. This new taxon is distinguished from its congeners by its morphological characteristics and by its differentiation in DNA sequences of the 16S rRNA, cytochrome oxidase subunit I (COI), and cytochrome b mitochondrial genes. This new species represents the southernmost extension known for the genus Nototriton.

Ancient Mitochondrial DNA Analyses of Ascaris Eggs Discovered in Coprolites from Joseon Tomb

PubMed Central

Oh, Chang Seok; Seo, Min; Hong, Jong Ha; Chai, Jong-Yil; Oh, Seung Whan; Park, Jun Bum; Shin, Dong Hoon

2015-01-01

Analysis of ancient DNA (aDNA) extracted from Ascaris is very important for understanding the phylogenetic lineage of the parasite species. When aDNAs obtained from a Joseon tomb (SN2-19-1) coprolite in which Ascaris eggs were identified were amplified with primers for cytochrome b (cyt b) and 18S small subunit ribosomal RNA (18S rRNA) gene, the outcome exhibited Ascaris specific amplicon bands. By cloning, sequencing, and analysis of the amplified DNA, we obtained information valuable for comprehending genetic lineage of Ascaris prevalent among pre-modern Joseon peoples. PMID:25925186

Diversity and population structure of Marine Group A bacteria in the Northeast subarctic Pacific Ocean.

PubMed

Allers, Elke; Wright, Jody J; Konwar, Kishori M; Howes, Charles G; Beneze, Erica; Hallam, Steven J; Sullivan, Matthew B

2013-02-01

Marine Group A (MGA) is a candidate phylum of Bacteria that is ubiquitous and abundant in the ocean. Despite being prevalent, the structural and functional properties of MGA populations remain poorly constrained. Here, we quantified MGA diversity and population structure in relation to nutrients and O(2) concentrations in the oxygen minimum zone (OMZ) of the Northeast subarctic Pacific Ocean using a combination of catalyzed reporter deposition fluorescence in situ hybridization (CARD-FISH) and 16S small subunit ribosomal RNA (16S rRNA) gene sequencing (clone libraries and 454-pyrotags). Estimates of MGA abundance as a proportion of total bacteria were similar across all three methods although estimates based on CARD-FISH were consistently lower in the OMZ (5.6%±1.9%) than estimates based on 16S rRNA gene clone libraries (11.0%±3.9%) or pyrotags (9.9%±1.8%). Five previously defined MGA subgroups were recovered in 16S rRNA gene clone libraries and five novel subgroups were defined (HF770D10, P262000D03, P41300E03, P262000N21 and A714018). Rarefaction analysis of pyrotag data indicated that the ultimate richness of MGA was very nearly sampled. Spearman's rank analysis of MGA abundances by CARD-FISH and O(2) concentrations resulted in significant correlation. Analyzed in more detail by 16S rRNA pyrotag sequencing, MGA operational taxonomic units affiliated with subgroups Arctic95A-2 and A714018 comprised 0.3-2.4% of total bacterial sequences and displayed strong correlations with decreasing O(2) concentration. This study is the first comprehensive description of MGA diversity using complementary techniques. These results provide a phylogenetic framework for interpreting future studies on ecotype selection among MGA subgroups, and suggest a potentially important role for MGA in the ecology and biogeochemistry of OMZs.

Toward fish and seafood traceability: anchovy species determination in fish products by molecular markers and support through a public domain database.

PubMed

Jérôme, Marc; Martinsohn, Jann Thorsten; Ortega, Delphine; Carreau, Philippe; Verrez-Bagnis, Véronique; Mouchel, Olivier

2008-05-28

Traceability in the fish food sector plays an increasingly important role for consumer protection and confidence building. This is reflected by the introduction of legislation and rules covering traceability on national and international levels. Although traceability through labeling is well established and supported by respective regulations, monitoring and enforcement of these rules are still hampered by the lack of efficient diagnostic tools. We describe protocols using a direct sequencing method based on 212-274-bp diagnostic sequences derived from species-specific mitochondria DNA cytochrome b, 16S rRNA, and cytochrome oxidase subunit I sequences which can efficiently be applied to unambiguously determine even closely related fish species in processed food products labeled "anchovy". Traceability of anchovy-labeled products is supported by the public online database AnchovyID ( http://anchovyid.jrc.ec.europa.eu), which provided data obtained during our study and tools for analytical purposes.

Sequence analysis of RNase MRP RNA reveals its origination from eukaryotic RNase P RNA

PubMed Central

Zhu, Yanglong; Stribinskis, Vilius; Ramos, Kenneth S.; Li, Yong

2006-01-01

RNase MRP is a eukaryote-specific endoribonuclease that generates RNA primers for mitochondrial DNA replication and processes precursor rRNA. RNase P is a ubiquitous endoribonuclease that cleaves precursor tRNA transcripts to produce their mature 5′ termini. We found extensive sequence homology of catalytic domains and specificity domains between their RNA subunits in many organisms. In Candida glabrata, the internal loop of helix P3 is 100% conserved between MRP and P RNAs. The helix P8 of MRP RNA from microsporidia Encephalitozoon cuniculi is identical to that of P RNA. Sequence homology can be widely spread over the whole molecule of MRP RNA and P RNA, such as those from Dictyostelium discoideum. These conserved nucleotides between the MRP and P RNAs strongly support the hypothesis that the MRP RNA is derived from the P RNA molecule in early eukaryote evolution. PMID:16540690

Molecular identification of Giardia and Cryptosporidium from dogs and cats

PubMed Central

Sotiriadou, Isaia; Pantchev, Nikola; Gassmann, Doreen; Karanis, Panagiotis

2013-01-01

The aim of the present study was to diagnose the presence of Giardia cysts and Cryptosporidium oocysts in household animals using nested polymerase chain reaction (PCR) and sequence analysis. One hundred faecal samples obtained from 81 dogs and 19 cats were investigated. The Cryptosporidium genotypes were determined by sequencing a fragment of the small subunit (SSU) rRNA gene, while the Giardia Assemblages were determined through analysis of the glutamate dehydrogenase (GDH) locus. Isolates from five dogs and two cats were positive by PCR for the presence of Giardia, and their sequences matched the zoonotic Assemblage A of Giardia. Cryptosporidium spp. isolated from one dog and one cat were both found to be C. parvum. One dog isolate harboured a mixed infection of C. parvum and Giardia Assemblage A. These findings support the growing evidence that household animals are potential reservoirs of the zoonotic pathogens Giardia spp. and Cryptosporidium spp. for infections in humans. PMID:23477297

Genotyping and subtyping of Giardia and Cryptosporidium isolates from commensal rodents in China.

PubMed

Zhao, Z; Wang, R; Zhao, W; Qi, M; Zhao, J; Zhang, L; Li, J; Liu, A

2015-05-01

Cryptosporidium and Giardia are two important zoonotic intestinal parasites responsible for diarrhoea in humans and other animals worldwide. Rodents, as reservoirs or carriers of Cryptosporidium and Giardia, are abundant and globally widespread. In the present study, we collected 232 fecal specimens from commensal rodents captured in animal farms and farm neighbourhoods in China. We collected 33 Asian house rats, 168 brown rats and 31 house mice. 6.0% (14/232) and 8.2% (19/232) of these rodents were microscopy-positive for Giardia cysts and Cryptosporidium oocysts, respectively. All 14 Giardia isolates were identified as Giardia duodenalis assemblage G at a minimum of one or maximum of three gene loci (tpi, gdh and bg). By small subunit rRNA (SSU rRNA) gene sequencing, Cryptosporidium parvum (n = 12) and Cryptosporidium muris (n = 7) were identified. The gp60 gene encoding the 60-kDa glycoprotein was successfully amplified and sequenced in nine C. parvum isolates, all of which belonged to the IIdA15G1 subtype. Observation of the same IIdA15G1 subtype in humans (previously) and in rodents (here) suggests that rodents infected with Cryptosporidium have the potential to transmit cryptosporidiosis to humans.

Morphology and small-subunit rRNA gene sequences of two novel marine ciliates, Metanophrys orientalis spec. nov. and Uronemella sinensis spec. nov. (Protista, Ciliophora, Scuticociliatia), with an improved diagnosis of the genus Uronemella.

PubMed

Pan, Xuming; Zhu, Mingzhuang; Ma, Honggang; Al-Rasheid, Khaled A S; Hu, Xiaozhong

2013-09-01

The morphology and infraciliature of two novel marine scuticociliates, Metanophrys orientalis spec. nov. and Uronemella sinensis spec. nov., collected from sandy beaches at Qingdao, China, were investigated using live observation and protargol-staining methods. Metanophrys orientalis spec. nov. is distinguished by the following characteristics: marine habitat and a slender to elongate oval body with pointed anterior end and rounded caudal end, in vivo about 25-50 µm long; buccal field about a quarter to a third of body length; nine or ten somatic kineties with dikinetids approximately in anterior half of body, monokinetids in posterior half; membranelles 1 and 2 almost equal in length and composed of two and three longitudinal rows of kinetids respectively; paroral membrane with zigzag structure extending anteriorly to middle portion of membranelle 2; contractile vacuole pore located at posterior end of somatic kinety 1. The genus Uronemella is redefined as follows: marine form with an elongate-elliptical or inverted pear-shaped body; apical plate conspicuous; buccal field about two-thirds of body length, cytostome subequatorially located; oral apparatus Uronema-like; somatic kineties comprising a mixture of dikinetids and monokinetids. Uronemella sinensis spec. nov. is recognized by having an elongate-elliptical body with truncated apical frontal plate, size in vivo about 25-35 × 15-20 µm, nine or ten somatic kineties, membranelle 1 consisting of two or three basal bodies, contractile vacuole pore at posterior end of somatic kinety 1. This study also compared the small-subunit rRNA gene sequences of these two species with other closely related species to show the sequence divergence, which ranged from 3.53 to 9.60%. Phylogenetic analyses support the contention that the genus Uronemella is monophyletic, while Metanophrys is non-monophyletic.

Prevalence and molecular characterization of Cryptosporidium spp. and Giardia duodenalis in deer in Henan and Jilin, China.

PubMed

Huang, Jianying; Zhang, Zhenjie; Zhang, Yiqi; Yang, Yong; Zhao, Jinfeng; Wang, Rongjun; Jian, Fuchun; Ning, Changshen; Zhang, Wanyu; Zhang, Longxian

2018-04-12

Little is known about the prevalence and zoonotic potential of Cryptosporidium spp. and Giardia duodenalis in deer in China. In this study, 662 fecal samples were collected from 11 farms in Henan and Jilin Provinces between July 2013 and August 2014, and were screened for the presence of Cryptosporidium and G. duodenalis with genotyping and subtyping methods. Cryptosporidium spp. and G. duodenalis were detected in 6.80% (45/662) and 1.21% (5/662) of samples, respectively. Six Cryptosporidium species/genotypes were identified based on the small subunit ribosomal ribonucleic acid (SSU rRNA) gene: C. parvum (n = 11); C. andersoni (n = 5); C. ubiquitum (n = 3); C. muris (n = 1); C. suis-like (n = 1); and Cryptosporidium deer genotype (n = 24). When five of the 11 C. parvum isolates were subtyped by sequencing the 60 kDa glycoprotein (gp60) gene, zoonotic subtypes IIaA15G2R2 (n = 4) and IIdA19G1 (n = 1) were found. According to a subtype analysis, three C. ubiquitum isolates belonged to XIIa subtype 2. In contrast, only assemblage E was detected in the five Giardia-positive samples with small subunit ribosomal ribonucleic acid (SSU rRNA) gene sequencing. To our knowledge, this is the first study to report C. andersoni, as well as C. parvum zoonotic subtypes IIaA15G2R2 and IIdA19G1 in cervids. These data, though limited, suggest that cervids may be a source of zoonotic Cryptosporidium and Giardia. Cervids in the present study are likely to be of low zoonotic potential to humans, and more molecular epidemiological studies are required to clarify the prevalence and public health significance of Cryptosporidium and G. duodenalis in cervids throughout China.

Microbial Analysis of Bite Marks by Sequence Comparison of Streptococcal DNA

PubMed Central

Kennedy, Darnell M.; Stanton, Jo-Ann L.; García, José A.; Mason, Chris; Rand, Christy J.; Kieser, Jules A.; Tompkins, Geoffrey R.

2012-01-01

Bite mark injuries often feature in violent crimes. Conventional morphometric methods for the forensic analysis of bite marks involve elements of subjective interpretation that threaten the credibility of this field. Human DNA recovered from bite marks has the highest evidentiary value, however recovery can be compromised by salivary components. This study assessed the feasibility of matching bacterial DNA sequences amplified from experimental bite marks to those obtained from the teeth responsible, with the aim of evaluating the capability of three genomic regions of streptococcal DNA to discriminate between participant samples. Bite mark and teeth swabs were collected from 16 participants. Bacterial DNA was extracted to provide the template for PCR primers specific for streptococcal 16S ribosomal RNA (16S rRNA) gene, 16S–23S intergenic spacer (ITS) and RNA polymerase beta subunit (rpoB). High throughput sequencing (GS FLX 454), followed by stringent quality filtering, generated reads from bite marks for comparison to those generated from teeth samples. For all three regions, the greatest overlaps of identical reads were between bite mark samples and the corresponding teeth samples. The average proportions of reads identical between bite mark and corresponding teeth samples were 0.31, 0.41 and 0.31, and for non-corresponding samples were 0.11, 0.20 and 0.016, for 16S rRNA, ITS and rpoB, respectively. The probabilities of correctly distinguishing matching and non-matching teeth samples were 0.92 for ITS, 0.99 for 16S rRNA and 1.0 for rpoB. These findings strongly support the tenet that bacterial DNA amplified from bite marks and teeth can provide corroborating information in the identification of assailants. PMID:23284761

Hannaella phyllophila sp. nov., a basidiomycetous yeast species associated with plants in Thailand and Taiwan.

PubMed

Surussawadee, Janjira; Jindamorakot, Sasitorn; Nakase, Takashi; Lee, Ching-Fu; Limtong, Savitree

2015-07-01

Five strains representing one novel anamorphic yeast species were isolated from plant leaves collected in Thailand (strains DMKU-SP186(T), ST-111 and ST-201) and Taiwan (strains FN20L02 and SM13L16). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics and sequence analysis of the D1/D2 region of the large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS) region, they were assigned to a single novel species of the genus Hannaella. The sequences of the D1/D2 regions of the LSU rRNA genes of four of the strains (DMKU-SP186(T), ST-111, FN20L02 and SM13L16) were identical, while differing from strain ST-201 by 2 substitutions and 2 gaps. The nucleotide sequence of the ITS regions of the five strains differed from each other by between 0 and 3 nucleotide substitutions. The novel species was most closely related to Hannaella luteola, but showed 1.0-1.3% nucleotide substitutions (between 6 substitutions out of 568-606 nt and 8 substitutions, and 2 gaps out of 597 nt) in the D1/D2 region of the LSU rRNA gene and 1.4-2.0% nucleotide substitutions (6-9 substitutions out of 435 nt) in the ITS region. Ballistospores were produced by three of the strains on cornmeal agar at 15 and 20 °C after 4 weeks, while H. luteola did not produce ballistospores. The name Hannaella phyllophila sp. nov. is proposed. The type strain is DMKU-SP186(T) ( = BCC 69500(T) = NBRC 110428(T) = CBS 13921(T)).

Comparison of potential diatom 'barcode' genes (the 18S rRNA gene and ITS, COI, rbcL) and their effectiveness in discriminating and determining species taxonomy in the Bacillariophyta.

PubMed

Guo, Liliang; Sui, Zhenghong; Zhang, Shu; Ren, Yuanyuan; Liu, Yuan

2015-04-01

Diatoms form an enormous group of photoautotrophic micro-eukaryotes and play a crucial role in marine ecology. In this study, we evaluated typical genes to determine whether they were effective at different levels of diatom clustering analysis to assess the potential of these regions for barcoding taxa. Our test genes included nuclear rRNA genes (the nuclear small-subunit rRNA gene and the 5.8S rRNA gene+ITS-2), a mitochondrial gene (cytochrome c-oxidase subunit 1, COI), a chloroplast gene [ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL)] and the universal plastid amplicon (UPA). Calculated genetic divergence was highest for the internal transcribed spacer (ITS; 5.8S+ITS-2) (p-distance of 1.569, 85.84% parsimony-informative sites) and COI (6.084, 82.14%), followed by the 18S rRNA gene (0.139, 57.69%), rbcL (0.120, 42.01%) and UPA (0.050, 14.97%), which indicated that ITS and COI were highly divergent compared with the other tested genes, and that their nucleotide compositions were variable within the whole group of diatoms. Bayesian inference (BI) analysis showed that the phylogenetic trees generated from each gene clustered diatoms at different phylogenetic levels. The 18S rRNA gene was better than the other genes in clustering higher diatom taxa, and both the 18S rRNA gene and rbcL performed well in clustering some lower taxa. The COI region was able to barcode species of some genera within the Bacillariophyceae. ITS was a potential marker for DNA based-taxonomy and DNA barcoding of Thalassiosirales, while species of Cyclotella, Skeletonema and Stephanodiscus gathered in separate clades, and were paraphyletic with those of Thalassiosira. Finally, UPA was too conserved to serve as a diatom barcode. © 2015 IUMS.

Analysis of 16S rRNA and mxaF genes revealing insights into Methylobacterium niche-specific plant association

PubMed Central

Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz

2012-01-01

The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant. PMID:22481887

Analysis of 16S rRNA and mxaF genes revealing insights into Methylobacterium niche-specific plant association.

PubMed

Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz

2012-01-01

The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant.

Microbial diversity in the floral nectar of seven Epipactis (Orchidaceae) species

PubMed Central

Jacquemyn, Hans; Lenaerts, Marijke; Tyteca, Daniel; Lievens, Bart

2013-01-01

Abstract Floral nectar of animal-pollinated plants is commonly infested with microorganisms, yet little is known about the microorganisms inhabiting the floral nectar of orchids. In this study, we investigated microbial communities occurring in the floral nectar of seven Epipactis (Orchidaceae) species. Culturable bacteria and yeasts were isolated and identified by partially sequencing the small subunit (SSU) ribosomal RNA (rRNA) gene and the D1/D2 domains of the large subunit (LSU) rRNA gene, respectively. Using three different culture media, we found that bacteria were common inhabitants of the floral nectar of Epipactis. The most widely distributed bacterial operational taxonomic units (OTUs) in nectar of Epipactis were representatives of the family of Enterobacteriaceae, with an unspecified Enterobacteriaceae bacterium as the most common. In contrast to previous studies investigating microbial communities in floral nectar, very few yeast species (mainly of the genus Cryptococcus) were observed, and most of them occurred in very low densities. Total OTU richness (i.e., the number of bacterial and yeast OTUs per orchid species) varied between 4 and 20. Cluster analysis revealed that microbial communities of allogamous species differed from those of autogamous and facultatively autogamous species. This study extends previous efforts to identify microbial communities in floral nectar and indicates that the floral nectar of the orchids investigated mainly contained bacterial communities with moderate phylogenetic diversity. PMID:23836678

In vitro propagation of the microsporidian pathogen Brachiola algerae and studies of its chromosome and ribosomal DNA organization in the context of the complete genome sequencing project.

PubMed

Belkorchia, Abdel; Biderre, Corinne; Militon, Cécile; Polonais, Valérie; Wincker, Patrick; Jubin, Claire; Delbac, Frédéric; Peyretaillade, Eric; Peyret, Pierre

2008-03-01

Brachiola algerae has a broad host spectrum from human to mosquitoes. The successful infection of two mosquito cell lines (Mos55: embryonic cells and Sua 4.0: hemocyte-like cells) and a human cell line (HFF) highlights the efficient adaptive capacity of this microsporidian pathogen. The molecular karyotype of this microsporidian species was determined in the context of the B. algerae genome sequencing project, showing that its haploid genome consists of 30 chromosomal-sized DNAs ranging from 160 to 2240 kbp giving an estimated genome size of 23 Mbp. A contig of 12,269 bp including the DNA sequence of the B. algerae ribosomal transcription unit has been built from initial genomic sequences and the secondary structure of the large subunit rRNA constructed. The data obtained indicate that B. algerae should be an excellent parasitic model to understand genome evolution in relation to infectious capacity.

Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.

PubMed

Lee, Jaikoo; Lee, Sangsun; Young, J Peter W

2008-08-01

A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.

Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

PubMed Central

Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

2015-01-01

Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

Molecular characterization of Blastocystis isolates from children and rhesus monkeys in Kathmandu, Nepal.

PubMed

Yoshikawa, Hisao; Wu, Zhiliang; Pandey, Kishor; Pandey, Basu Dev; Sherchand, Jeevan Bahadur; Yanagi, Tetsuo; Kanbara, Hiroji

2009-03-23

To investigate the possible transmission of Blastocystis organisms between local rhesus monkeys and children in Kathmandu, Nepal, we compared the subtype (ST) and sequence of Blastocystis isolates from children with gastrointestinal symptoms and local rhesus monkeys. Twenty and 10 Blastocystis isolates were established from 82 and 10 fecal samples obtained from children and monkeys, respectively. Subtype analysis with seven sequence-tagged site (STS) primers indicated that the prevalence of Blastocystis sp. ST1, ST2 and ST3 was 20%, 20% and 60% in the child isolates, respectively. In contrast to human isolates, ST3 was not found in monkey isolates and the prevalence of ST1 and ST2 was 50% and 70%, respectively, including three mixed STs1 and 2 and one isolate not amplified by any STS primers, respectively. Since Blastocystis sp. ST2 has been reported as the most dominant genotype in the survey of Blastocystis infection among the various monkey species, sequence comparison of the 150bp variable region of the small subunit rRNA (SSU rRNA) gene was conducted among ST2 isolates of humans and monkeys. Sequence alignment of 24 clones developed from ST2 isolates of 4 humans and 4 monkeys showed three distinct subgroups, defined as ST2A, ST2B and ST2C. These three subgroups were shared between the child and monkey isolates. These results suggest that the local rhesus monkeys are a possible source of Blastocystis sp. ST2 infection of humans in Kathmandu.

Neighborhood of 16S rRNA nucleotides U788/U789 in the 30S ribosomal subunit determined by site-directed crosslinking.

PubMed

Mundus, D; Wollenzien, P

1998-11-01

Site-specific photo crosslinking has been used to investigate the RNA neighborhood of 16S rRNA positions U788/ U789 in Escherichia coli 30S subunits. For these studies, site-specific psoralen (SSP) which contains a sulfhydryl group on a 17 A side chain was first added to nucleotides U788/U789 using a complementary guide DNA by annealing and phototransfer. Modified RNA was purified from the DNA and unmodified RNA. For some experiments, the SSP, which normally crosslinks at an 8 A distance, was derivitized with azidophenacylbromide (APAB) resulting in the photoreactive azido moiety at a maximum of 25 A from the 4' position on psoralen (SSP25APA). 16S rRNA containing SSP, SSP25APA or control 16S rRNA were reconstituted and 30S particles were isolated. The reconstituted subunits containing SSP or SSP25APA had normal protein composition, were active in tRNA binding and had the usual pattern of chemical reactivity except for increased kethoxal reactivity at G791 and modest changes in four other regions. Irradiation of the derivatized 30S subunits in activation buffer produced several intramolecular RNA crosslinks that were visualized and separated by gel electrophoresis and characterized by primer extension. Four major crosslink sites made by the SSP reagent were identified at positions U561/U562, U920/U921, C866 and U723; a fifth major crosslink at G693 was identified when the SSP25APA reagent was used. A number of additional crosslinks of lower frequency were seen, particularly with the APA reagent. These data indicate a central location close to the decoding region and central pseudoknot for nucleotides U788/U789 in the activated 30S subunit.

Further consideration of the phylogeny of some "traditional" heterotrichs (Protista, Ciliophora) of uncertain affinities, based on new sequences of the small subunit rRNA gene.

PubMed

Miao, Miao; Song, Weibo; Clamp, John C; Al-Rasheid, Khaled A S; Al-Khedhairy, Abdulaziz A; Al-Arifi, Saud

2009-01-01

The systematic relationships and taxonomic positions of the traditional heterotrich genera Condylostentor, Climacostomum, Fabrea, Folliculina, Peritromus, and Condylostoma, as well as the licnophorid genus Licnophora, were re-examined using new data from sequences of the gene coding for small subunit ribosomal RNA. Trees constructed using distance-matrix, Bayesian inference, and maximum-parsimony methods all showed the following relationships: (1) the "traditional" heterotrichs consist of several paraphyletic groups, including the current classes Heterotrichea, Armophorea and part of the Spirotrichea; (2) the class Heterotrichea was confirmed as a monophyletic assemblage based on our analyses of 31 taxa, and the genus Peritromus was demonstrated to be a peripheral group; (3) the genus Licnophora occupied an isolated branch on one side of the deepest divergence in the subphylum Intramacronucleata and was closely affiliated with spirotrichs, armophoreans, and clevelandellids; (4) Condylostentor, a recently defined genus with several truly unique morphological features, is more closely related to Condylostoma than to Stentor; (5) Folliculina, Eufolliculina, and Maristentor always clustered together with high bootstrap support; and (6) Climacostomum occupied a paraphyletic position distant from Fabrea, showing a close relationship with Condylostomatidae and Chattonidiidae despite of modest support.

RAPHIDOPHYCEAE [CHADEFAUD EX SILVA] SYSTEMATICS AND RAPID IDENTIFICATION: SEQUENCE ANALYSES AND REAL-TIME PCR ASSAYS

PubMed Central

Bowers, Holly A.; Tomas, Carmelo; Tengs, Torstein; Kempton, Jason W.; Lewitus, Alan J.; Oldach, David W.

2010-01-01

Species within the class Raphidophyceae were associated with fish kill events in Japanese, European, Canadian, and U.S. coastal waters. Fish mortality was attributable to gill damage with exposure to reactive oxygen species (peroxide, superoxide, and hydroxide radicals), neurotoxins, physical clogging, and hemolytic substances. Morphological identification of these organisms in environmental water samples is difficult, particularly when fixatives are used. Because of this difficulty and the continued global emergence of these species in coastal estuarine waters, we initiated the development and validation of a suite of real-time polymerase chain reaction (PCR) assays. Sequencing was used to generate complete data sets for nuclear encoded small-subunit ribosomal RNA (SSU rRNA; 18S); internal transcribed spacers 1 and 2, 5.8S; and plastid encoded SSU rRNA (16S) for confirmed raphidophyte cultures from various geographic locations. Sequences for several Chattonella species (C. antiqua, C. marina, C. ovata, C. subsalsa, and C. verruculosa), Heterosigma akashiwo, and Fibrocapsa japonica were generated and used to design rapid and specific PCR assays for several species including C. verruculosa Hara et Chihara, C. subsalsa Biecheler, the complex comprised of C. marina Hara et Chihara, C. antiqua Ono and C. ovata, H. akashiwo Ono, and F. japonica Toriumi et Takano using appropriate loci. With this comprehensive data set, we were also able to perform phylogenetic analyses to determine the relationship between these species. PMID:20411032

Remarkable archaeal diversity detected in a Yellowstone National Park hot spring environment.

PubMed Central

Barns, S M; Fundyga, R E; Jeffries, M W; Pace, N R

1994-01-01

Of the three primary phylogenetic domains--Archaea (archaebacteria), Bacteria (eubacteria), and Eucarya (eukaryotes)--Archaea is the least understood in terms of its diversity, physiologies, and ecological panorama. Although many species of Crenarchaeota (one of the two recognized archaeal kingdoms sensu Woese [Woese, C. R., Kandler, O. & Wheelis, M. L. (1990) Proc. Natl. Acad. Sci. USA 87, 4576-4579]) have been isolated, they constitute a relatively tight-knit cluster of lineages in phylogenetic analyses of rRNA sequences. It seemed possible that this limited diversity is merely apparent and reflects only a failure to culture organisms, not their absence. We report here phylogenetic characterization of many archaeal small subunit rRNA gene sequences obtained by polymerase chain reaction amplification of mixed population DNA extracted directly from sediment of a hot spring in Yellowstone National Park. This approach obviates the need for cultivation to identify organisms. The analyses document the existence not only of species belonging to well-characterized crenarchaeal genera or families but also of crenarchaeal species for which no close relatives have so far been found. The large number of distinct archaeal sequence types retrieved from this single hot spring was unexpected and demonstrates that Crenarchaeota is a much more diverse group than was previously suspected. The results have impact on our concepts of the phylogenetic organization of Archaea. PMID:7510403

DNA barcode reference data for the Korean herpetofauna and their applications.

PubMed

Jeong, Tae Jin; Jun, Jumin; Han, Sanghoon; Kim, Hyun Tae; Oh, Kyunghee; Kwak, Myounghai

2013-11-01

Recently, amphibians and reptiles have drawn attention because of declines in species and populations caused mainly by habitat loss, overexploitation and climate change. This study constructed a DNA barcode database for the Korean herpetofauna, including all the recorded amphibians and 68% of the recorded reptiles, to provide a useful, standardized tool for species identification in monitoring and management. A total of 103 individuals from 18 amphibian and 17 reptile species were used to generate barcode sequences using partial sequences of the mitochondrial cytochrome c oxidase subunit I (COI) gene and to compare it with other suggested barcode loci. Comparing 16S rRNA, cytochrome b (Cytb) and COI for amphibians and 12S rRNA, Cytb and COI for reptiles, our results revealed that COI is better than the other markers in terms of a high level of sequence variation without length variation and moderate amplification success. Although the COI marker had no clear barcoding gap because of the high level of intraspecific variation, all of the analysed individuals from the same species clustered together in a neighbour-joining tree. High intraspecific variation suggests the possibility of cryptic species. Finally, using this database, confiscated snakes were identified as Elaphe schrenckii, designated as endangered in Korea and a food contaminant was identified as the lizard Takydromus amurensis. © 2013 John Wiley & Sons Ltd.

Molecular Identification of Unusual Pathogenic Yeast Isolates by Large Ribosomal Subunit Gene Sequencing: 2 Years of Experience at the United Kingdom Mycology Reference Laboratory▿

PubMed Central

Linton, Christopher J.; Borman, Andrew M.; Cheung, Grace; Holmes, Ann D.; Szekely, Adrien; Palmer, Michael D.; Bridge, Paul D.; Campbell, Colin K.; Johnson, Elizabeth M.

2007-01-01

Rapid identification of yeast isolates from clinical samples is particularly important given their innately variable antifungal susceptibility profiles. We present here an analysis of the utility of PCR amplification and sequence analysis of the hypervariable D1/D2 region of the 26S rRNA gene for the identification of yeast species submitted to the United Kingdom Mycology Reference Laboratory over a 2-year period. A total of 3,033 clinical isolates were received from 2004 to 2006 encompassing 50 different yeast species. While more than 90% of the isolates, corresponding to the most common Candida species, could be identified by using the AUXACOLOR2 yeast identification kit, 153 isolates (5%), comprised of 47 species, could not be identified by using this system and were subjected to molecular identification via 26S rRNA gene sequencing. These isolates included some common species that exhibited atypical biochemical and phenotypic profiles and also many rarer yeast species that are infrequently encountered in the clinical setting. All 47 species requiring molecular identification were unambiguously identified on the basis of D1/D2 sequences, and the molecular identities correlated well with the observed biochemical profiles of the various organisms. Together, our data underscore the utility of molecular techniques as a reference adjunct to conventional methods of yeast identification. Further, we show that PCR amplification and sequencing of the D1/D2 region reliably identifies more than 45 species of clinically significant yeasts and can also potentially identify new pathogenic yeast species. PMID:17251397

Candida amazonensis sp. nov., an ascomycetous yeast isolated from rotting wood in the Amazonian forest.

PubMed

Cadete, Raquel M; Melo, Monaliza A; Lopes, Mariana R; Pereira, Gilmara M D; Zilli, Jerri E; Vital, Marcos J S; Gomes, Fátima C O; Lachance, Marc-André; Rosa, Carlos A

2012-06-01

Five strains of a novel yeast species were isolated from rotting wood samples collected in an Amazonian forest site in the state of Roraima, northern Brazil. The sequences of the D1/D2 domains of the large subunit of the rRNA gene showed that this species belongs to the Scheffersomyces clade and is related to Candida coipomoensis, Candida lignicola and Candida queiroziae. The novel species Candida amazonensis sp. nov. is proposed to accommodate these isolates. The type strain of C. amazonensis sp. nov. is UFMG-HMD-26.3(T) ( = CBS 12363(T) = NRRL Y-48762(T)).

Candida wangnamkhiaoensis sp. nov., an anamorphic yeast species in the Hyphopichia clade isolated in Thailand.

PubMed

Limtong, Savitree; Kaewwichian, Rungluk; Jindamorakot, Sasitorn; Yongmanitchai, Wichien; Nakase, Takashi

2012-06-01

Two strains representing a single novel yeast species were isolated from a flower of Calycoopteris floribunda Lame (SK170(T)) and insect frass (ST-122) collected in Thailand. On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, and the sequence analysis of the D1/D2 domain of the large subunit rRNA gene and the internal transcribed spacer region, the two strains were assigned as a single novel Candida species in the Hyphopichia clade for which the name Candida wangnamkhiaoensis sp. nov. is proposed. The type strain is SK170(T)=BCC 39604(T)=NBRC 106724(T)=CBS 11695(T)).

A Fatal Case of Candida auris and Candida tropicalis Candidemia in Neutropenic Patient.

PubMed

Mohd Tap, Ratna; Lim, Teck Choon; Kamarudin, Nur Amalina; Ginsapu, Stephanie Jane; Abd Razak, Mohd Fuat; Ahmad, Norazah; Amran, Fairuz

2018-06-01

We report a fatal case of Candida auris that was involved in mixed candidemia with Candida tropicalis, isolated from the blood of a neutropenic patient. Identification of both isolates was confirmed by amplification and sequencing of internal transcribed spacer and D1/D2 domain of large subunit in rRNA gene. Antifungal susceptibility test by E-test method revealed that C. auris was resistant to amphotericin B, anidulafungin, caspofungin, fluconazole, itraconazole and voriconazole. On the other hand, C. tropicalis was sensitive to all antifungal tested. The use of chromogenic agar as isolation media is vital in detecting mixed candidemia.

Genetic diversity of Trichomonas vaginalis clinical isolates from Henan province in central China.

PubMed

Mao, Meng; Liu, Hui Li

2015-07-01

Trichomonas vaginalis is a flagellated protozoan parasite that infects the human urogenital tract, causing the most common non-viral, sexually transmitted disease worldwide. In this study, genetic variants of T. vaginalis were identified in Henan Province, China. Fragments of the small subunit of nuclear ribosomal RNA (18S rRNA) were amplified from 32 T. vaginalis isolates obtained from seven regions of Henan Province. Overall, 18 haplotypes were determined from the 18S rRNA sequences. Each sampled population and the total population displayed high haplotype diversity (Hd), accompanied by very low nucleotide diversity (Pi). In these molecular genetic variants, 91.58% genetic variation was derived from intra-regions. Phylogenetic analysis revealed no correlation between phylogeny and geographic distribution. Demographic analysis supported population expansion of T. vaginalis isolates from central China. Our findings showing moderate-to-high genetic variations in the 32 isolates of T. vaginalis provide useful knowledge for monitoring changes in parasite populations for the development of future control strategies.

Communities of archaea and bacteria in a subsurface radioactive thermal spring in the Austrian Central Alps, and evidence of ammonia-oxidizing Crenarchaeota.

PubMed

Weidler, Gerhard W; Dornmayr-Pfaffenhuemer, Marion; Gerbl, Friedrich W; Heinen, Wolfgang; Stan-Lotter, Helga

2007-01-01

Scanning electron microscopy revealed great morphological diversity in biofilms from several largely unexplored subterranean thermal Alpine springs, which contain radium 226 and radon 222. A culture-independent molecular analysis of microbial communities on rocks and in the water of one spring, the "Franz-Josef-Quelle" in Bad Gastein, Austria, was performed. Four hundred fifteen clones were analyzed. One hundred thirty-two sequences were affiliated with 14 bacterial operational taxonomic units (OTUs) and 283 with four archaeal OTUs. Rarefaction analysis indicated a high diversity of bacterial sequences, while archaeal sequences were less diverse. The majority of the cloned archaeal 16S rRNA gene sequences belonged to the soil-freshwater-subsurface (1.1b) crenarchaeotic group; other representatives belonged to the freshwater-wastewater-soil (1.3b) group, except one clone, which was related to a group of uncultivated Euryarchaeota. These findings support recent reports that Crenarchaeota are not restricted to high-temperature environments. Most of the bacterial sequences were related to the Proteobacteria (alpha, beta, gamma, and delta), Bacteroidetes, and Planctomycetes. One OTU was allied with Nitrospina sp. (delta-Proteobacteria) and three others grouped with Nitrospira. Statistical analyses suggested high diversity based on 16S rRNA gene analyses; the rarefaction plot of archaeal clones showed a plateau. Since Crenarchaeota have been implicated recently in the nitrogen cycle, the spring environment was probed for the presence of the ammonia monooxygenase subunit A (amoA) gene. Sequences were obtained which were related to crenarchaeotic amoA genes from marine and soil habitats. The data suggested that nitrification processes are occurring in the subterranean environment and that ammonia may possibly be an energy source for the resident communities.

Identification of Blastocystis Subtype 1 Variants in the Home for Girls, Bangkok, Thailand

PubMed Central

Thathaisong, Umaporn; Siripattanapipong, Suradej; Mungthin, Mathirut; Pipatsatitpong, Duangnate; Tan-ariya, Peerapan; Naaglor, Tawee; Leelayoova, Saovanee

2013-01-01

A cross-sectional study of Blastocystis infection was conducted to evaluate the prevalence, risk factors, and subtypes of Blastocystis at the Home for Girls, Bangkok, Thailand in November 2008. Of 370 stool samples, 118 (31.9%) were infected with Blastocystis. Genotypic characterization of Blastocystis was performed by polymerase chain reaction and sequence analysis of the partial small subunit ribosomal RNA (SSU rRNA) gene. Subtype 1 was the most predominant (94.8%), followed by subtype 6 (3.5%) and subtype 2 (1.7%). Sequence analyses revealed nucleotide polymorphisms for Blastocystis subtype 1, which were described as subtype 1/variant 1, subtype 1/variant 2. Blastocystis subtype 1/variant 1 was the most predominant infection occurring in almost every house. The results showed that subtype analysis of Blastocystis was useful for molecular epidemiological study. PMID:23166199

Phylogeny and evolution of the auks (subfamily Alcinae) based on mitochondrial DNA sequences

USGS Publications Warehouse

Moum, Truls; Johansen, Steinar; Erikstad, Kjell Einar; Piatt, John F.

1994-01-01

The genetic divergence and phylogeny of the auks was assessed by mitochondrial DNA sequence comparisons in a study using 19 of the 22 auk species and two outgroup representatives. We compared more than 500 nucleotides from each of two mitochondrial genes encoding 12S rRNA and the NADH dehydrogenase subunit 6. Divergence times were estimated from transversional substitutions. The dovekie (Alle alle) is related to the razorbill (Alca torda) and the murres (Uria spp). Furthermore, the Xantus's murrelet (Synthliboramphus hypoleucus) and the ancient (Synthliboramphus antiquus) and Japanese murrelets (Synthliboramphus wumizusume) are genetically distinct members of the same main lineage, whereas brachyramphine and synthliboramphine murrelets are not closely related. An early adaptive radiation of six main species groups of auks seems to trace back to Middle Miocene. Later speciation probably involved ecological differentiations and geographical isolations.

New data on Neodiplostomum americanum Chandler and Rausch, 1947 (Digenea: Diplostomidae), in the Great Horned Owl Bubo virginianus Gmelin, 1788 and the Eastern Screech Owl Megascops asio Linnaeus, 1758 in Mississippi, USA.

PubMed

Woodyard, Ethan T; Rosser, Thomas G; Griffin, Matt J

2017-08-01

Neodiplostomum americanum Chandler and Rausch, 1947 has been reported from six species of owls in North America. At present, there are no molecular data for this species and gene sequence data from Neodiplostomum Railliet, 1919 are limited. A freshly deceased specimen of the Great Horned Owl Bubo virginianus Gmelin, 1788 and a freshly deceased specimen of the Eastern Screech Owl Megascops asio Linnaeus, 1758 were collected in Oktibbeha County, Mississippi in 2014 and 2016, respectively. Neodiplostomum americanum were recovered from both hosts. Herein, updated morphological descriptions are supplemented with gene sequence data from conserved (18S, ITS1-5.8S, ITS2, and 28S rRNA) and fast-evolving (cytochrome c oxidase subunit 1 mtDNA) regions. Preliminary phylogenetic analysis of the genus based on cytochrome c oxidase subunit 1 gene sequence data supports the placement of N. americanum within a discrete phylogroup of the family Diplostomidae. The life history of N. americanum is unknown and currently limited to the description of the adult stage in avian hosts. The molecular data generated in this study offer insight into the phylogenetic placement of N. americanum within the Diplostomatidae and will aid in identifying different life stages in putative intermediate hosts.

5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

NASA Technical Reports Server (NTRS)

Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

1989-01-01

The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

DMR1 (CCM1/YGR150C) of Saccharomyces cerevisiae encodes an RNA-binding protein from the pentatricopeptide repeat family required for the maintenance of the mitochondrial 15S ribosomal RNA.

PubMed

Puchta, Olga; Lubas, Michal; Lipinski, Kamil A; Piatkowski, Jakub; Malecki, Michal; Golik, Pawel

2010-04-01

Pentatricopeptide repeat (PPR) proteins form the largest known RNA-binding protein family and are found in all eukaryotes, being particularly abundant in higher plants. PPR proteins localize mostly in mitochondria and chloroplasts, where they modulate organellar genome expression on the post-transcriptional level. The Saccharomyces cerevisiae DMR1 (CCM1, YGR150C) encodes a PPR protein that localizes to mitochondria. Deletion of DMR1 results in a complete and irreversible loss of respiratory capacity and loss of wild-type mtDNA by conversion to rho(-)/rho(0) petites, regardless of the presence of introns in mtDNA. The phenotype of the dmr1Delta mitochondria is characterized by fragmentation of the small subunit mitochondrial rRNA (15S rRNA), that can be reversed by wild-type Dmr1p. Other mitochondrial transcripts, including the large subunit mitochondrial rRNA (21S rRNA), are not affected by the lack of Dmr1p. The purified Dmr1 protein specifically binds to different regions of 15S rRNA in vitro, consistent with the deletion phenotype. Dmr1p is therefore the first yeast PPR protein, which has an rRNA target and is probably involved in the biogenesis of mitochondrial ribosomes and translation.

The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript.

PubMed Central

Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J

1981-01-01

We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619

Microbial community analysis of the hypersaline water of the Dead Sea using high-throughput amplicon sequencing.

PubMed

Jacob, Jacob H; Hussein, Emad I; Shakhatreh, Muhamad Ali K; Cornelison, Christopher T

2017-10-01

Amplicon sequencing using next-generation technology (bTEFAP ® ) has been utilized in describing the diversity of Dead Sea microbiota. The investigated area is a well-known salt lake in the western part of Jordan found in the lowest geographical location in the world (more than 420 m below sea level) and characterized by extreme salinity (approximately, 34%) in addition to other extreme conditions (low pH, unique ionic composition different from sea water). DNA was extracted from Dead Sea water. A total of 314,310 small subunit RNA (SSU rRNA) sequences were parsed, and 288,452 sequences were then clustered. For alpha diversity analysis, sample was rarefied to 3,000 sequences. The Shannon-Wiener index curve plot reached a plateau at approximately 3,000 sequences indicating that sequencing depth was sufficient to capture the full scope of microbial diversity. Archaea was found to be dominating the sequences (52%), whereas Bacteria constitute 45% of the sequences. Altogether, prokaryotic sequences (which constitute 97% of all sequences) were found to predominate. The findings expand on previous studies by using high-throughput amplicon sequencing to describe the microbial community in an environment which in recent years has been shown to hide some interesting diversity. © 2017 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Candida dajiaensis sp. nov., Candida yuanshanicus sp. nov., Candida jianshihensis sp. nov., and Candida sanyiensis sp. nov., four anamorphic, ascomycetous yeast species isolated from soil in Taiwan.

PubMed

Liu, Chun-Hao; Young, Shuh-Sen; Chang, Tsung-Chain; Lee, Ching-Fu

2008-08-01

Nine anamorphic, ascomycetous yeast strains belonging to the Pichia anomala clade were recovered from forest soil in 2006 in Taiwan. The nine yeast strains represent four novel yeast species based on the sequences of their D1/D2 domain of the large subunit (LSU) rRNA gene and their physiological characteristics. The scientific names of Candida dajiaensis sp. nov., Candida yuanshanicus sp. nov., Candida jianshihensis sp. nov., and Candida sanyiensis sp. nov. are proposed for these novel yeast species. The type strains are C. dajiaensis SM11S03(T) (=CBS 10590(T)=BCRC 23099(T)), C. yuanshanicus SY3S02(T) (=CBS 10589(T)=BCRC 23100(T)), C. jianshihensis SM8S04(T) (=CBS 10591(T)=BCRC 23096(T)), and C. sanyiensis SA1S06(T) (=CBS 10592(T)=BCRC 23094(T)). Sequence analysis of the D1/D2 of the LSU rRNA gene revealed that the three species, C. dajiaensis, C. yuanshanicus and Pichia onychis, shared a separate branch in the phylogenetic tree, C. jianshihensis is phylogenetically related to Candida ulmi and Pichia alni, and the phylogenetically closest relative of C. sanyiensis is Pichia populi.

rpoB-Based Identification of Nonpigmented and Late-Pigmenting Rapidly Growing Mycobacteria

PubMed Central

Adékambi, Toïdi; Colson, Philippe; Drancourt, Michel

2003-01-01

Nonpigmented and late-pigmenting rapidly growing mycobacteria (RGM) are increasingly isolated in clinical microbiology laboratories. Their accurate identification remains problematic because classification is labor intensive work and because new taxa are not often incorporated into classification databases. Also, 16S rRNA gene sequence analysis underestimates RGM diversity and does not distinguish between all taxa. We determined the complete nucleotide sequence of the rpoB gene, which encodes the bacterial β subunit of the RNA polymerase, for 20 RGM type strains. After using in-house software which analyzes and graphically represents variability stretches of 60 bp along the nucleotide sequence, our analysis focused on a 723-bp variable region exhibiting 83.9 to 97% interspecies similarity and 0 to 1.7% intraspecific divergence. Primer pair Myco-F-Myco-R was designed as a tool for both PCR amplification and sequencing of this region for molecular identification of RGM. This tool was used for identification of 63 RGM clinical isolates previously identified at the species level on the basis of phenotypic characteristics and by 16S rRNA gene sequence analysis. Of 63 clinical isolates, 59 (94%) exhibited <2% partial rpoB gene sequence divergence from 1 of 20 species under study and were regarded as correctly identified at the species level. Mycobacterium abscessus and Mycobacterium mucogenicum isolates were clearly distinguished from Mycobacterium chelonae; Mycobacterium mageritense isolates were clearly distinguished from “Mycobacterium houstonense.” Four isolates were not identified at the species level because they exhibited >3% partial rpoB gene sequence divergence from the corresponding type strain; they belonged to three taxa related to M. mucogenicum, Mycobacterium smegmatis, and Mycobacterium porcinum. For M. abscessus and M. mucogenicum, this partial sequence yielded a high genetic heterogeneity within the clinical isolates. We conclude that molecular identification by analysis of the 723-bp rpoB sequence is a rapid and accurate tool for identification of RGM. PMID:14662964

Molecular Identification of Sibling Species of Sclerodermus (Hymenoptera: Bethylidae) That Parasitize Buprestid and Cerambycid Beetles by Using Partial Sequences of Mitochondrial DNA Cytochrome Oxidase Subunit 1 and 28S Ribosomal RNA Gene

PubMed Central

Jiang, Yuan; Yang, Zhongqi; Wang, Xiaoyi; Hou, Yuxia

2015-01-01

The species belonging to Sclerodermus (Hymenoptera: Bethylidae) are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI) and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1–5). A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances) between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5) averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ) tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1–4) clustered together and only Sclerodermus sp. (No. 5) clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5) might be a new species of Sclerodermus. PMID:25782000

Metataxonomics reveal vultures as a reservoir for Clostridium perfringens.

PubMed

Meng, Xiangli; Lu, Shan; Yang, Jing; Jin, Dong; Wang, Xiaohong; Bai, Xiangning; Wen, Yumeng; Wang, Yiting; Niu, Lina; Ye, Changyun; Rosselló-Móra, Ramon; Xu, Jianguo

2017-02-22

The Old World vulture may carry and spread pathogens for emerging infections since they feed on the carcasses of dead animals and participate in the sky burials of humans, some of whom have died from communicable diseases. Therefore, we studied the precise fecal microbiome of the Old World vulture with metataxonomics, integrating the high-throughput sequencing of almost full-length small subunit ribosomal RNA (16S rRNA) gene amplicons in tandem with the operational phylogenetic unit (OPU) analysis strategy. Nine vultures of three species were sampled using rectal swabs on the Qinghai-Tibet Plateau, China. Using the Pacific Biosciences sequencing platform, we obtained 54 135 high-quality reads of 16S rRNA amplicons with an average of 1442±6.9 bp in length and 6015±1058 reads per vulture. Those sequences were classified into 314 OPUs, including 102 known species, 50 yet to be described species and 161 unknown new lineages of uncultured representatives. Forty-five species have been reported to be responsible for human outbreaks or infections, and 23 yet to be described species belong to genera that include pathogenic species. Only six species were common to all vultures. Clostridium perfringens was the most abundant and present in all vultures, accounting for 30.8% of the total reads. Therefore, using the new technology, we found that vultures are an important reservoir for C. perfringens as evidenced by the isolation of 107 strains encoding for virulence genes, representing 45 sequence types. Our study suggests that the soil-related C. perfringens and other pathogens could have a reservoir in vultures and other animals.

Metataxonomics reveal vultures as a reservoir for Clostridium perfringens

PubMed Central

Meng, Xiangli; Lu, Shan; Yang, Jing; Jin, Dong; Wang, Xiaohong; Bai, Xiangning; Wen, Yumeng; Wang, Yiting; Niu, Lina; Ye, Changyun; Rosselló-Móra, Ramon; Xu, Jianguo

2017-01-01

The Old World vulture may carry and spread pathogens for emerging infections since they feed on the carcasses of dead animals and participate in the sky burials of humans, some of whom have died from communicable diseases. Therefore, we studied the precise fecal microbiome of the Old World vulture with metataxonomics, integrating the high-throughput sequencing of almost full-length small subunit ribosomal RNA (16S rRNA) gene amplicons in tandem with the operational phylogenetic unit (OPU) analysis strategy. Nine vultures of three species were sampled using rectal swabs on the Qinghai-Tibet Plateau, China. Using the Pacific Biosciences sequencing platform, we obtained 54 135 high-quality reads of 16S rRNA amplicons with an average of 1442±6.9 bp in length and 6015±1058 reads per vulture. Those sequences were classified into 314 OPUs, including 102 known species, 50 yet to be described species and 161 unknown new lineages of uncultured representatives. Forty-five species have been reported to be responsible for human outbreaks or infections, and 23 yet to be described species belong to genera that include pathogenic species. Only six species were common to all vultures. Clostridium perfringens was the most abundant and present in all vultures, accounting for 30.8% of the total reads. Therefore, using the new technology, we found that vultures are an important reservoir for C. perfringens as evidenced by the isolation of 107 strains encoding for virulence genes, representing 45 sequence types. Our study suggests that the soil-related C. perfringens and other pathogens could have a reservoir in vultures and other animals. PMID:28223683

Methanobacterium aarhusense sp. nov., a novel methanogen isolated from a marine sediment (Aarhus Bay, Denmark).

PubMed

Shlimon, Adris Georgis; Friedrich, Michael W; Niemann, Helge; Ramsing, Niels Birger; Finster, Kai

2004-05-01

Strain H2-LR(T), a 5-18 micro m long and 0.7 micro m wide filamentous, mesophilic, moderately halophilic, non-motile hydrogenotrophic methanogen, was isolated from marine sediment of Aarhus Bay, Denmark, 1.7 m below the sediment surface. On the basis of 16S rRNA gene comparison with sequences of known methanogens, strain H2-LR(T) could be affiliated to the genus Methanobacterium. The strain forms a distinct line of descent within this genus, with Methanobacterium oryzae (95.9 % sequence identity) and Methanobacterium bryantii (95.7 % sequence identity) as its closest relatives. The 16S rRNA-based affiliation was supported by comparison of the mcrA gene, which encodes the alpha-subunit of methyl-coenzyme M reductase. Strain H2-LR(T) grew only on H(2)/CO(2). The DNA G+C content is 34.9 mol%. Optimum growth temperature was 45 degrees C. The strain grew equally well at pH 7.5 and 8. No growth or methane production was observed below pH 5 or above pH 9. Strain H2-LR(T) grew well within an NaCl concentration range of 100 and 900 mM. No growth or methane production was observed at 1 M NaCl. At 50 mM NaCl, growth and methane production were reduced. Based on 16S rRNA gene sequence analysis, the isolate is proposed to represent a novel taxon within the genus Methanobacterium, namely Methanobacterium aarhusense sp. nov. The type strain is H2-LR(T) (=DSM 15219(T)=ATCC BAA-828(T)).

Culture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System

PubMed Central

Robertson, Charles E.; Baumgartner, Laura K.; Harris, J. Kirk; Peterson, Kristen L.; Stevens, Mark J.; Frank, Daniel N.

2013-01-01

The goal of this study was to determine the composition and diversity of microorganisms associated with bioaerosols in a heavily trafficked metropolitan subway environment. We collected bioaerosols by fluid impingement on several New York City subway platforms and associated sites in three sampling sessions over a 1.5-year period. The types and quantities of aerosolized microorganisms were determined by culture-independent phylogenetic analysis of small-subunit rRNA gene sequences by using both Sanger (universal) and pyrosequencing (bacterial) technologies. Overall, the subway bacterial composition was relatively simple; only 26 taxonomic families made up ∼75% of the sequences determined. The microbiology was more or less similar throughout the system and with time and was most similar to outdoor air, consistent with highly efficient air mixing in the system. Identifiable bacterial sequences indicated that the subway aerosol assemblage was composed of a mixture of genera and species characteristic of soil, environmental water, and human skin commensal bacteria. Eukaryotic diversity was mainly fungal, dominated by organisms of types associated with wood rot. Human skin bacterial species (at 99% rRNA sequence identity) included the Staphylococcus spp. Staphylococcus epidermidis (the most abundant and prevalent commensal of the human integument), S. hominis, S. cohnii, S. caprae, and S. haemolyticus, all well-documented human commensal bacteria. We encountered no organisms of public health concern. This study is the most extensive culture-independent survey of subway microbiota so far and puts in place pre-event information required for any bioterrorism surveillance activities or monitoring of the microbiological impact of recent subway flooding events. PMID:23542619

Culture-independent analysis of aerosol microbiology in a metropolitan subway system.

PubMed

Robertson, Charles E; Baumgartner, Laura K; Harris, J Kirk; Peterson, Kristen L; Stevens, Mark J; Frank, Daniel N; Pace, Norman R

2013-06-01

The goal of this study was to determine the composition and diversity of microorganisms associated with bioaerosols in a heavily trafficked metropolitan subway environment. We collected bioaerosols by fluid impingement on several New York City subway platforms and associated sites in three sampling sessions over a 1.5-year period. The types and quantities of aerosolized microorganisms were determined by culture-independent phylogenetic analysis of small-subunit rRNA gene sequences by using both Sanger (universal) and pyrosequencing (bacterial) technologies. Overall, the subway bacterial composition was relatively simple; only 26 taxonomic families made up ~75% of the sequences determined. The microbiology was more or less similar throughout the system and with time and was most similar to outdoor air, consistent with highly efficient air mixing in the system. Identifiable bacterial sequences indicated that the subway aerosol assemblage was composed of a mixture of genera and species characteristic of soil, environmental water, and human skin commensal bacteria. Eukaryotic diversity was mainly fungal, dominated by organisms of types associated with wood rot. Human skin bacterial species (at 99% rRNA sequence identity) included the Staphylococcus spp. Staphylococcus epidermidis (the most abundant and prevalent commensal of the human integument), S. hominis, S. cohnii, S. caprae, and S. haemolyticus, all well-documented human commensal bacteria. We encountered no organisms of public health concern. This study is the most extensive culture-independent survey of subway microbiota so far and puts in place pre-event information required for any bioterrorism surveillance activities or monitoring of the microbiological impact of recent subway flooding events.

A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

PubMed

Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

2012-08-01

Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

Detection and quantification of Plasmodium falciparum in blood samples using quantitative nucleic acid sequence-based amplification.

PubMed

Schoone, G J; Oskam, L; Kroon, N C; Schallig, H D; Omar, S A

2000-11-01

A quantitative nucleic acid sequence-based amplification (QT-NASBA) assay for the detection of Plasmodium parasites has been developed. Primers and probes were selected on the basis of the sequence of the small-subunit rRNA gene. Quantification was achieved by coamplification of the RNA in the sample with one modified in vitro RNA as a competitor in a single-tube NASBA reaction. Parasite densities ranging from 10 to 10(8) Plasmodium falciparum parasites per ml could be demonstrated and quantified in whole blood. This is approximately 1,000 times more sensitive than conventional microscopy analysis of thick blood smears. Comparison of the parasite densities obtained by microscopy and QT-NASBA with 120 blood samples from Kenyan patients with clinical malaria revealed that for 112 of 120 (93%) of the samples results were within a 1-log difference. QT-NASBA may be especially useful for the detection of low parasite levels in patients with early-stage malaria and for the monitoring of the efficacy of drug treatment.

Functional base-pairing interaction between highly conserved elements of U3 small nucleolar RNA and the small ribosomal subunit RNA.

PubMed

Hughes, J M

1996-06-21

The U3 nucleolar RNA has a remarkably wide phyletic distribution extending from the Eukarya to the Archaea. It functions in maturation of the small subunit (SSU) rRNA through a mechanism which is as yet unknown but which involves base-pairing with pre-rRNA. The most conserved part of U3 is within 30 nucleotides of the 5' end, but as yet no function for this domain has been proposed. Elements within this domain are complementary to highly conserved sequences in the SSU rRNA which, in the mature form, fold into a universally conserved pseudoknot. The nature of the complementarity suggests a novel mechanism for U3 function whereby U3 facilitates correct folding of the pseudoknot. Wide phylogenetic comparison provides compelling evidence in support of the interaction in that significant complementary changes have taken place, particularly in the archaeon Sulfolobus, which maintain the base-pairing. Base-substitution mutations in yeast U3 designed to disrupt the base-pairing indicate that the interaction is probably essential. These include cold-sensitivity mutations which exhibit phenotypes similar to U3-depletion, but without impairment of the AO processing step, which occurs within the 5' ETS. These phenotypes are consistent with the destabilization of SSU precursors and partial impairment of the processing steps A1, at the 5' ETS/18 S boundary, and A2, within the ITS1.

Seed plant phylogeny inferred from all three plant genomes: monophyly of extant gymnosperms and origin of Gnetales from conifers.

PubMed

Chaw, S M; Parkinson, C L; Cheng, Y; Vincent, T M; Palmer, J D

2000-04-11

Phylogenetic relationships among the five groups of extant seed plants are presently quite unclear. For example, morphological studies consistently identify the Gnetales as the extant sister group to angiosperms (the so-called "anthophyte" hypothesis), whereas a number of molecular studies recover gymnosperm monophyly, and few agree with the morphology-based placement of Gnetales. To better resolve these and other unsettled issues, we have generated a new molecular data set of mitochondrial small subunit rRNA sequences, and have analyzed these data together with comparable data sets for the nuclear small subunit rRNA gene and the chloroplast rbcL gene. All nuclear analyses strongly ally Gnetales with a monophyletic conifers, whereas all mitochondrial analyses and those chloroplast analyses that take into account saturation of third-codon position transitions actually place Gnetales within conifers, as the sister group to the Pinaceae. Combined analyses of all three genes strongly support this latter relationship, which to our knowledge has never been suggested before. The combined analyses also strongly support monophyly of extant gymnosperms, with cycads identified as the basal-most group of gymnosperms, Ginkgo as the next basal, and all conifers except for Pinaceae as sister to the Gnetales + Pinaceae clade. According to these findings, the Gnetales may be viewed as extremely divergent conifers, and the many morphological similarities between angiosperms and Gnetales (e.g., double fertilization and flower-like reproductive structures) arose independently.

Seed plant phylogeny inferred from all three plant genomes: Monophyly of extant gymnosperms and origin of Gnetales from conifers

PubMed Central

Chaw, Shu-Miaw; Parkinson, Christopher L.; Cheng, Yuchang; Vincent, Thomas M.; Palmer, Jeffrey D.

2000-01-01

Phylogenetic relationships among the five groups of extant seed plants are presently quite unclear. For example, morphological studies consistently identify the Gnetales as the extant sister group to angiosperms (the so-called “anthophyte” hypothesis), whereas a number of molecular studies recover gymnosperm monophyly, and few agree with the morphology-based placement of Gnetales. To better resolve these and other unsettled issues, we have generated a new molecular data set of mitochondrial small subunit rRNA sequences, and have analyzed these data together with comparable data sets for the nuclear small subunit rRNA gene and the chloroplast rbcL gene. All nuclear analyses strongly ally Gnetales with a monophyletic conifers, whereas all mitochondrial analyses and those chloroplast analyses that take into account saturation of third-codon position transitions actually place Gnetales within conifers, as the sister group to the Pinaceae. Combined analyses of all three genes strongly support this latter relationship, which to our knowledge has never been suggested before. The combined analyses also strongly support monophyly of extant gymnosperms, with cycads identified as the basal-most group of gymnosperms, Ginkgo as the next basal, and all conifers except for Pinaceae as sister to the Gnetales + Pinaceae clade. According to these findings, the Gnetales may be viewed as extremely divergent conifers, and the many morphological similarities between angiosperms and Gnetales (e.g., double fertilization and flower-like reproductive structures) arose independently. PMID:10760277

Two new anamorphic yeasts species, Cyberlindnera samutprakarnensis sp. nov. and Candida thasaenensis sp. nov., isolated from industrial wastes in Thailand.

PubMed

Poomtien, Jamroonsri; Jindamorakot, Sasitorn; Limtong, Savitree; Pinphanichakarn, Pairoh; Thaniyavarn, Jiraporn

2013-01-01

Three yeast strains were isolated from industrial wastes in Thailand. Based on the phylogenetic sequence analysis of the D1/D2 region of the large subunit rRNA gene, the internal transcribed spacer (ITS1-5.8S rRNA gene-ITS2; ITS1-2) region, and their physiological characteristics, the three strains were found to represent two novel species of the ascomycetous anamorphic yeast. Strain JP52(T) represent a novel species which was named Cyberlindnera samutprakarnensis sp. nov. (type strain JP52(T); = BCC 46825(T) = JCM 17816(T) = CBS 12528(T), MycoBank no. MB800879), which was differentiated from the closely related species Cyberlindnera mengyuniae CBS 10845(T) by 2.9 % sequence divergence in the D1/D2 region and 4.4 % sequence divergence in the ITS1-2. Strain JP59(T) and JP60 were identical in their D1/D2 and ITS1-2 regions, which were closely related to those of Scheffersomyces spartinae CBS 6059(T) by 0.9 and 1.0 % sequence divergence, respectively. In addition, supportive evidence of actin gene and translational elongation factor gene by sequence divergence of 6.5 % each confirmed their distinct status. Furthermore, JP59(T) and JP60 differentiated from the closely related species in some biochemical and physiological characteristics. These two strains were assigned as a single novel species which was named Candida thasaenensis sp. nov. (type JP59(T) = BCC 46828(T) = JCM 17817(T) = CBS 12529(T), MycoBank no. MB800880).

Ammonia-Oxidizing β-Proteobacteria from the Oxygen Minimum Zone off Northern Chile▿

PubMed Central

Molina, Verónica; Ulloa, Osvaldo; Farías, Laura; Urrutia, Homero; Ramírez, Salvador; Junier, Pilar; Witzel, Karl-Paul

2007-01-01

The composition of ammonia-oxidizing bacteria from the β-Proteobacteria subclass (βAOB) was studied in the surface and upper-oxycline oxic waters (2- to 50-m depth, ∼200 to 44 μM O2) and within the oxygen minimum zone (OMZ) suboxic waters (50- to 400-m depth, ≤10 μM O2) of the eastern South Pacific off northern Chile. This study was carried out through cloning and sequencing of genes coding for 16S rRNA and the ammonia monooxygenase enzyme active subunit (amoA). Sequences affiliated with Nitrosospira-like cluster 1 dominated the 16S rRNA gene clone libraries constructed from both oxic and suboxic waters. Cluster 1 consists exclusively of yet-uncultivated βAOB from marine environments. However, a single clone, out of 224 obtained from the OMZ, was found to belong to Nitrosospira lineage cluster 0. To our knowledge, cluster 0 sequences have been derived from βAOB isolated only from sand, soil, and freshwater environments. Sequences in clone libraries of the amoA gene from the surface and upper oxycline could be grouped in a marine subcluster, also containing no cultured representatives. In contrast, all 74 amoA sequences originating from the OMZ were either closely affiliated with cultured Nitrosospira spp. from clusters 0 and 2 or with other yet-uncultured βAOB from soil and an aerated-anoxic Orbal process waste treatment plant. Our results reveal the presence of Nitrosospira-like βAOB in both oxic and suboxic waters associated with the OMZ but with a clear community shift at the functional level (amoA) along the strong oxygen gradient. PMID:17416686

Ammonia-oxidizing beta-proteobacteria from the oxygen minimum zone off northern Chile.

PubMed

Molina, Verónica; Ulloa, Osvaldo; Farías, Laura; Urrutia, Homero; Ramírez, Salvador; Junier, Pilar; Witzel, Karl-Paul

2007-06-01

The composition of ammonia-oxidizing bacteria from the beta-Proteobacteria subclass (betaAOB) was studied in the surface and upper-oxycline oxic waters (2- to 50-m depth, approximately 200 to 44 microM O(2)) and within the oxygen minimum zone (OMZ) suboxic waters (50- to 400-m depth, < or =10 microM O(2)) of the eastern South Pacific off northern Chile. This study was carried out through cloning and sequencing of genes coding for 16S rRNA and the ammonia monooxygenase enzyme active subunit (amoA). Sequences affiliated with Nitrosospira-like cluster 1 dominated the 16S rRNA gene clone libraries constructed from both oxic and suboxic waters. Cluster 1 consists exclusively of yet-uncultivated betaAOB from marine environments. However, a single clone, out of 224 obtained from the OMZ, was found to belong to Nitrosospira lineage cluster 0. To our knowledge, cluster 0 sequences have been derived from betaAOB isolated only from sand, soil, and freshwater environments. Sequences in clone libraries of the amoA gene from the surface and upper oxycline could be grouped in a marine subcluster, also containing no cultured representatives. In contrast, all 74 amoA sequences originating from the OMZ were either closely affiliated with cultured Nitrosospira spp. from clusters 0 and 2 or with other yet-uncultured betaAOB from soil and an aerated-anoxic Orbal process waste treatment plant. Our results reveal the presence of Nitrosospira-like betaAOB in both oxic and suboxic waters associated with the OMZ but with a clear community shift at the functional level (amoA) along the strong oxygen gradient.

Phylogenetic positions of four hypotrichous ciliates (Protista, Ciliophora) based on SSU rRNA gene, with notes on their morphological characters.

PubMed

Yang, Caiting; Liu, An; Xu, Yusen; Xu, Yuan; Fan, Xinpeng; Al-Farraj, Saleh A; Ni, Bing; Gu, Fukang

2015-08-18

 The morphology and infraciliature of the four hypotrichous ciliates; Rigidohymena inquieta (Stokes, 1887) Berger, 2011, Pattersoniella vitiphila Foissner, 1987, Notohymena australis Foissner & O' Donoghue, 1990, and Cyrtohymena (Cyrtohymenides) australis (Foissner, 1995) Foissner, 2004, collected from east China, were investigated by using live observation and protargol impregnation method. An improved diagnosis for R. inquieta was supplied based on descriptions of present and previous populations. New morphology and morphogenesis information based on Chinese populations of another three hypotrichids were also supplemented. The Small-subunit rRNA (SSU rRNA) gene sequences of the four species were characterized and their phylogenetic positions were revealed by means of Bayesian inference and Maximum-likelihood analysis. The analyses shows that R. inquieta clusters with other members of the subfamily Stylonychinae, which confirms the monophyly of the subfamily and verified R. inquieta as a separated species from R. candens though it differs from others mainly by body size. C. (C.) australis occupying the basal position of the clade which contains cyrtohymenids and some other groups, declines the idea of separating Cyrtohymena into two subgenus. Notohymena australis and China population of Pattersoniella vitiphila respectively clustering with their congeners correspond well with the systematics revealed by morphological similarities.

Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

PubMed Central

Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

1996-01-01

Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

Aulonastus similis n. sp., a new quill mite species (Syringophilidae) parasitising passeriform birds (Tyrannidae and Cardinalidae) in Mexico.

PubMed

Broda, Lukasz; Dabert, Miroslawa; Glowska, Eliza

2016-09-01

A new quill mite species, Aulonastus similis n. sp. (Acariformes: Syringophilidae), parasitising Myiozetetes similis (Spix) (Tyrannidae) and Habia fuscicauda (Cabanis) (Cardinalidae) in Mexico is described and DNA barcode sequences of the mitochondrial cytochrome c oxidase subunit I (cox1) and D1-D3 region of the nuclear 28S rRNA gene are provided. Morphologically, females of A. similis are close to A. euphagus Skoracki, Hendricks & Spicer, 2010 but differ from this species in the length ratios of the idiosomal setae: ve:si (2-2.3:1 vs 1:1) and f2:f1 (4.7-6.3:1 vs 3.3:1).

Phylogenetic relationships of Sonoran Desert cactus beetles in the tribe Hololeptini (Coleoptera: Histeridae: Histerinae), with comments on the taxonomic status of Iliotona beyeri.

PubMed

Pfeiler, Edward; Vergara-Quintanar, Joel E; Castrezana, Sergio; Caterino, Michael S; Markow, Therese A

2010-07-01

Nucleotide sequences from 16S rRNA and cytochrome c oxidase subunit I (COI) were used to examine phylogenetic relationships and evolution of beetles from the tribe Hololeptini (Coleoptera: Histeridae: Histerinae) that inhabit necrotic tissue of columnar cacti in the Sonoran Desert. Phylogenetic and morphological analyses revealed the presence of seven separate lineages, three representing species in the genus Iliotona, including I. beyeri stat. nov., and four species belonging to the genus Hololepta (sensu lato). The possible roles of historical vicariance and host plant associations on the evolution of the Hololeptini from the Sonoran Desert are discussed. Copyright 2010 Elsevier Inc. All rights reserved.

Primer selection impacts specific population abundances but not community dynamics in a monthly time-series 16S rRNA gene amplicon analysis of coastal marine bacterioplankton.

PubMed

Wear, Emma K; Wilbanks, Elizabeth G; Nelson, Craig E; Carlson, Craig A

2018-03-09

Primers targeting the 16S small subunit ribosomal RNA marker gene, used to characterize bacterial and archaeal communities, have recently been re-evaluated for marine planktonic habitats. To investigate whether primer selection affects the ecological interpretation of bacterioplankton populations and community dynamics, amplicon sequencing with four primer sets targeting several hypervariable regions of the 16S rRNA gene was conducted on both mock communities constructed from cloned 16S rRNA genes and a time-series of DNA samples from the temperate coastal Santa Barbara Channel. Ecological interpretations of community structure (delineation of depth and seasonality, correlations with environmental factors) were similar across primer sets, while population dynamics varied. We observed substantial differences in relative abundances of taxa known to be poorly resolved by some primer sets, such as Thaumarchaeota and SAR11, and unexpected taxa including Roseobacter clades. Though the magnitude of relative abundances of common OTUs differed between primer sets, the relative abundances of the OTUs were nonetheless strongly correlated. We do not endorse one primer set but rather enumerate strengths and weaknesses to facilitate selection appropriate to a system or experimental goal. While 16S rRNA gene primer bias suggests caution in assessing quantitative population dynamics, community dynamics appear robust across studies using different primers. © 2018 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

Common and distinguishing features of the bacterial and fungal communities in biological soil crusts and shrub root zone soils

USGS Publications Warehouse

Steven, Blaire; Gallegos-Graves, La Verne; Yeager, Chris; Belnap, Jayne; Kuske, Cheryl R.

2013-01-01

Soil microbial communities in dryland ecosystems play important roles as root associates of the widely spaced plants and as the dominant members of biological soil crusts (biocrusts) colonizing the plant interspaces. We employed rRNA gene sequencing (bacterial 16S/fungal large subunit) and shotgun metagenomic sequencing to compare the microbial communities inhabiting the root zones of the dominant shrub, Larrea tridentata (creosote bush), and the interspace biocrusts in a Mojave desert shrubland within the Nevada Free Air CO2 Enrichment (FACE) experiment. Most of the numerically abundant bacteria and fungi were present in both the biocrusts and root zones, although the proportional abundance of those members differed significantly between habitats. Biocrust bacteria were predominantly Cyanobacteria while root zones harbored significantly more Actinobacteria and Proteobacteria. Pezizomycetes fungi dominated the biocrusts while Dothideomycetes were highest in root zones. Functional gene abundances in metagenome sequence datasets reflected the taxonomic differences noted in the 16S rRNA datasets. For example, functional categories related to photosynthesis, circadian clock proteins, and heterocyst-associated genes were enriched in the biocrusts, where populations of Cyanobacteria were larger. Genes related to potassium metabolism were also more abundant in the biocrusts, suggesting differences in nutrient cycling between biocrusts and root zones. Finally, ten years of elevated atmospheric CO2 did not result in large shifts in taxonomic composition of the bacterial or fungal communities or the functional gene inventories in the shotgun metagenomes.

Metagenetic Sequencing of Zooplankton Communities in the High-Diversity Central North Pacific

NASA Astrophysics Data System (ADS)

Matthews, S. A.; van Woudenberg, L.; Iacchei, M.; Lenz, P. H.; Goetze, E.

2016-02-01

Marine zooplankton are important intermediate trophic level consumers in the ocean, and the subtropical North Pacific holds global maxima in species diversity for these communities. Zooplankton assemblages in this region include several species complexes, with many understudied and morphologically cryptic species. We used metagenetic sequencing to characterize zooplankton community composition across depth (0-1500m) at an open ocean time series site in the central North Pacific (Station ALOHA), using depth-stratified 1m2 MOCNESS samples that were size fractionated into 5 size classes (0.2-0.5 mm, 0.5-1 mm, 1-2 mm, 2-5 mm, >5 mm). Our goals were to quantify the fraction of the community that is currently undescribed, identify taxonomic groups that contain large numbers of undescribed species and may be important to biogeochemical cycling in the ocean, and establish a metagenetic method that can be used to effectively characterize the species richness of epipelagic and mesopelagic communities in this region. Amplicons from several DNA loci, including mitochondrial cytochrome c oxidase subunit I and 12S rRNA, and nuclear 18S and 28S rRNA genes were sequenced on the MiSeq Illumina platform to characterize community composition. We evaluate species composition across metagenetic marker regions, pelagic depth zones, day and night-time MOCNESS tows, and compare our findings with prior species lists from the region. Our results are an important contribution to establishing standardized metagenetic methods for marine zooplankton communities.

Molecular Approach to the Identification of Fish in the South China Sea

PubMed Central

Zhang, Junbin; Hanner, Robert

2012-01-01

Background DNA barcoding is one means of establishing a rapid, accurate, and cost-effective system for the identification of species. It involves the use of short, standard gene targets to create sequence profiles of known species against sequences of unknowns that can be matched and subsequently identified. The Fish Barcode of Life (FISH-BOL) campaign has the primary goal of gathering DNA barcode records for all the world's fish species. As a contribution to FISH-BOL, we examined the degree to which DNA barcoding can discriminate marine fishes from the South China Sea. Methodology/Principal Findings DNA barcodes of cytochrome oxidase subunit I (COI) were characterized using 1336 specimens that belong to 242 species fishes from the South China Sea. All specimen provenance data (including digital specimen images and geospatial coordinates of collection localities) and collateral sequence information were assembled using Barcode of Life Data System (BOLD; www.barcodinglife.org). Small intraspecific and large interspecific differences create distinct genetic boundaries among most species. In addition, the efficiency of two mitochondrial genes, 16S rRNA (16S) and cytochrome b (cytb), and one nuclear ribosomal gene, 18S rRNA (18S), was also evaluated for a few select groups of species. Conclusions/Significance The present study provides evidence for the effectiveness of DNA barcoding as a tool for monitoring marine biodiversity. Open access data of fishes from the South China Sea can benefit relative applications in ecology and taxonomy. PMID:22363454

Molecular identification of unusual Mycetoma agents isolated from patients in Venezuela.

PubMed

Rojas, Olga C; León-Cachón, Rafael B R; Moreno-Treviño, Maria; González, Gloria M

2017-02-01

Mycetoma is a chronic granulomatous, subcutaneous disease endemic in tropical and subtropical countries. It is currently a health problem in rural areas of Africa, Asia and South America. Nine cases of mycetoma were analysed in a retrospective study. All isolates were identified by morphological features. The level of species identification was reached by molecular tools. Definitive identification of fungi was performed using sequence analysis of the ITS of the ribosomal DNA region and the ribosomal large-subunit D1/D2. Identification of actinomycetes was accomplished by the 16S rRNA gene sequence. Six unusual clinical isolates were identified: Aspergillus ustus, Cyphellophora oxyspora, Exophiala oligosperma, Madurella pseudomycetomatis, Nocardia farcinica and Nocardia wallacei. The prevalence of mycetoma in Venezuela remains unknown. This study represents the first report in the literature of mycetoma caused by unusual pathogens identified by molecular techniques. © 2016 Blackwell Verlag GmbH.

Occurrence and molecular characterization of Cryptosporidium spp. in mammals and reptiles at the Lisbon Zoo.

PubMed

Alves, Margarida; Xiao, Lihua; Lemos, Vanessa; Zhou, Ling; Cama, Vitaliano; da Cunha, Margarida Barão; Matos, Olga; Antunes, Francisco

2005-09-01

The presence of Cryptosporidium parasites in mammals and reptiles kept at the Lisbon Zoo was investigated. A total of 274 stool samples were collected from 100 mammals and 29 reptiles. The species and genotype of the isolates identified by light microscopy were determined by nested PCR and sequence analysis of a fragment of the small subunit rRNA gene. Cryptosporidium oocysts were found in one black wildebeest (Connochaetes gnou), one Prairie bison (Bison bison bison) and in one Indian star tortoise (Geochelone elegans). The PCR and sequence analysis of these three isolates showed that those excreted by the Prairie bison were Cryptosporidium mouse genotype, those from the black wildebeest were from a new Cryptosporidium genotype and those infecting the Indian star tortoise were Cryptosporidium tortoise genotype. The present work reports a new Cryptosporidium genotype in a black wildebeest and the first finding of the Cryptosporidium mouse genotype in a ruminant.

Genetic Diversity of Cryptosporidium spp. in Captive Reptiles

PubMed Central

Xiao, Lihua; Ryan, Una M.; Graczyk, Thaddeus K.; Limor, Josef; Li, Lixia; Kombert, Mark; Junge, Randy; Sulaiman, Irshad M.; Zhou, Ling; Arrowood, Michael J.; Koudela, Břetislav; Modrý, David; Lal, Altaf A.

2004-01-01

The genetic diversity of Cryptosporidium in reptiles was analyzed by PCR-restriction fragment length polymorphism and sequence analysis of the small subunit rRNA gene. A total of 123 samples were analyzed, of which 48 snake samples, 24 lizard samples, and 3 tortoise samples were positive for Cryptosporidium. Nine different types of Cryptosporidium were found, including Cryptosporidium serpentis, Cryptosporidium desert monitor genotype, Cryptosporidium muris, Cryptosporidium parvum bovine and mouse genotypes, one C. serpentis-like parasite in a lizard, two new Cryptosporidium spp. in snakes, and one new Cryptosporidium sp. in tortoises. C. serpentis and the desert monitor genotype were the most common parasites and were found in both snakes and lizards, whereas the C. muris and C. parvum parasites detected were probably the result of ingestion of infected rodents. Sequence and biologic characterizations indicated that the desert monitor genotype was Cryptosporidium saurophilum. Two host-adapted C. serpentis genotypes were found in snakes and lizards. PMID:14766569

Coastal bacterioplankton community diversity along a latitudinal gradient in Latin America by means of V6 tag pyrosequencing.

PubMed

Thompson, Fabiano L; Bruce, Thiago; Gonzalez, Alessandra; Cardoso, Alexander; Clementino, Maysa; Costagliola, Marcela; Hozbor, Constanza; Otero, Ernesto; Piccini, Claudia; Peressutti, Silvia; Schmieder, Robert; Edwards, Robert; Smith, Mathew; Takiyama, Luis Roberto; Vieira, Ricardo; Paranhos, Rodolfo; Artigas, Luis Felipe

2011-02-01

The bacterioplankton diversity of coastal waters along a latitudinal gradient between Puerto Rico and Argentina was analyzed using a total of 134,197 high-quality sequences from the V6 hypervariable region of the small-subunit ribosomal RNA gene (16S rRNA) (mean length of 60 nt). Most of the OTUs were identified into Proteobacteria, Bacteriodetes, Cyanobacteria, and Actinobacteria, corresponding to approx. 80% of the total number of sequences. The number of OTUs corresponding to species varied between 937 and 1946 in the seven locations. Proteobacteria appeared at high frequency in the seven locations. An enrichment of Cyanobacteria was observed in Puerto Rico, whereas an enrichment of Bacteroidetes was detected in the Argentinian shelf and Uruguayan coastal lagoons. The highest number of sequences of Actinobacteria and Acidobacteria were obtained in the Amazon estuary mouth. The rarefaction curves and Good coverage estimator for species diversity suggested a significant coverage, with values ranging between 92 and 97% for Good coverage. Conserved taxa corresponded to aprox. 52% of all sequences. This study suggests that human-contaminated environments may influence bacterioplankton diversity.

RNA polymerase beta-subunit gene (rpoB) sequence analysis for the identification of Bacteroides spp.

PubMed

Ko, K S; Kuwahara, T; Haehwa, L; Yoon, Y-J; Kim, B-J; Lee, K-H; Ohnishi, Y; Kook, Y-H

2007-01-01

Partial rpoB sequences (317 bp) of 11 species of Bacteroides, two Porphyromonas spp. and two Prevotella spp. were compared to delineate the genetic relationships among Bacteroides and closely related anaerobic species. The high level of inter-species sequence dissimilarities (7.6-20.8%) allowed the various Bacteroides spp. to be distinguished. The position of the Bacteroides distasonis and Bacteriodes merdae cluster in the rpoB tree was different from the position in the 16S rRNA gene tree. Based on rpoB sequence similarity and clustering in the rpoB tree, it was possible to correctly re-identify 80 clinical isolates of Bacteroides. In addition to two subgroups, cfiA-negative (division I) and cfiA-positive (division II), of Bacteroides fragilis isolates, two distinct subgroups were also found among Bacteroides ovatus and Bacteroides thetaiotaomicron isolates. Bacteroides genus-specific rpoB PCR and B. fragilis species-specific rpoB PCR allowed Bacteroides spp. to be differentiated from Porphyromonas and Prevotella spp., and also allowed B. fragilis to be differentiated from other non-fragilisBacteroides spp. included in the present study.

International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

PubMed Central

Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

2015-01-01

This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

PubMed

Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

2018-03-19

To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

Diversity of mitochondrial large subunit rDNA haplotypes of Glomus intraradices in two agricultural field experiments and two semi-natural grasslands.

PubMed

Börstler, Boris; Thiéry, Odile; Sýkorová, Zuzana; Berner, Alfred; Redecker, Dirk

2010-04-01

Glomus intraradices, an arbuscular mycorrhizal fungus (AMF), is frequently found in a surprisingly wide range of ecosystems all over the world. It is used as model organism for AMF and its genome is being sequenced. Despite the ecological importance of AMF, little has been known about their population structure, because no adequate molecular markers have been available. In the present study we analyse for the first time the intraspecific genetic structure of an AMF directly from colonized roots in the field. A recently developed PCR-RFLP approach for the mitochondrial rRNA large subunit gene (mtLSU) of these obligate symbionts was used and complemented by sequencing and primers specific for a particularly frequent mtLSU haplotype. We analysed root samples from two agricultural field experiments in Switzerland and two semi-natural grasslands in France and Switzerland. RFLP type composition of G. intraradices (phylogroup GLOM A-1) differed strongly between agricultural and semi-natural sites and the G. intraradices populations of the two agricultural sites were significantly differentiated. RFLP type richness was higher in the agricultural sites compared with the grasslands. Detailed sequence analyses which resolved multiple sequence haplotypes within some RFLP types even revealed that there was no overlap of haplotypes among any of the study sites except between the two grasslands. Our results demonstrate a surprisingly high differentiation among semi-natural and agricultural field sites for G. intraradices. These findings will have major implications on our views of processes of adaptation and specialization in these plant/fungus associations.

Suitability of partial 16S ribosomal RNA gene sequence analysis for the identification of dangerous bacterial pathogens.

PubMed

Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F

2007-03-01

In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.

Distribution of Blastocystis subtypes isolated from humans from an urban community in Rio de Janeiro, Brazil.

PubMed

Valença Barbosa, Carolina; de Jesus Batista, Rosemary; Pereira Igreja, Ricardo; d'Avila Levy, Claudia Masini; Werneck de Macedo, Heloisa; Carneiro Santos, Helena Lúcia

2017-10-25

Blastocystis is a cosmopolitan protist parasite found in the human gastrointestinal tract and is highly prevalent in developing countries. Recent molecular studies have revealed extensive genetic diversity, which has been classified into different subtypes (STs) based on sequence analysis of small subunit ribosomal RNA gene. Blastocystis is one of the most common fecal parasites in Brazil, but the diversity of subtypes remains unknown in the country. This study aimed to determine the distribution of Blastocystis STs in an urban community in Duque de Caxias, Rio de Janeiro, Brazil. A total of 64 stool samples positive for Blastocystis in Pavlova's medium were subtyped by PCR and sequenced using primers targeting the small subunit rRNA gene, in addition to phylogenetic analysis and subtype-specific PCR using sequence-tagged-site (STS) primers. Endolimax nana (14%), Entamoeba complex (10.5%), Taenia sp. (0.6%), Trichuris trichiura (1.3%) and Enterobius vermicularis (1.3%) were detected in Blastocystis-positive samples. Of the 64 samples tested by PCR/DNA sequencing, 55 were identified as ST1 (42%), ST3 (49%), ST2 (7%) and ST4 (2%), and the presence of mixed ST (ST1 + ST3) infection was detected in nine samples (14%). DNA sequencing and phylogenetic analysis of Brazilian Blastocystis isolates identified four different subtypes. To our knowledge, this study provided the first genetic characterization of Blastocystis subtypes in an urban area of Rio de Janeiro, Brazil. We also identified ST4 for the first time in Brazil. Further studies are necessary to determine the distribution of STs across human populations in Rio de Janeiro.

Diversity Analysis of Dairy and Nondairy Lactococcus lactis Isolates, Using a Novel Multilocus Sequence Analysis Scheme and (GTG)5-PCR Fingerprinting▿

PubMed Central

Rademaker, Jan L. W.; Herbet, Hélène; Starrenburg, Marjo J. C.; Naser, Sabri M.; Gevers, Dirk; Kelly, William J.; Hugenholtz, Jeroen; Swings, Jean; van Hylckama Vlieg, Johan E. T.

2007-01-01

The diversity of a collection of 102 lactococcus isolates including 91 Lactococcus lactis isolates of dairy and nondairy origin was explored using partial small subunit rRNA gene sequence analysis and limited phenotypic analyses. A subset of 89 strains of L. lactis subsp. cremoris and L. lactis subsp. lactis isolates was further analyzed by (GTG)5-PCR fingerprinting and a novel multilocus sequence analysis (MLSA) scheme. Two major genomic lineages within L. lactis were found. The L. lactis subsp. cremoris type-strain-like genotype lineage included both L. lactis subsp. cremoris and L. lactis subsp. lactis isolates. The other major lineage, with a L. lactis subsp. lactis type-strain-like genotype, comprised L. lactis subsp. lactis isolates only. A novel third genomic lineage represented two L. lactis subsp. lactis isolates of nondairy origin. The genomic lineages deviate from the subspecific classification of L. lactis that is based on a few phenotypic traits only. MLSA of six partial genes (atpA, encoding ATP synthase alpha subunit; pheS, encoding phenylalanine tRNA synthetase; rpoA, encoding RNA polymerase alpha chain; bcaT, encoding branched chain amino acid aminotransferase; pepN, encoding aminopeptidase N; and pepX, encoding X-prolyl dipeptidyl peptidase) revealed 363 polymorphic sites (total length, 1,970 bases) among 89 L. lactis subsp. cremoris and L. lactis subsp. lactis isolates with unique sequence types for most isolates. This allowed high-resolution cluster analysis in which dairy isolates form subclusters of limited diversity within the genomic lineages. The pheS DNA sequence analysis yielded two genetic groups dissimilar to the other genotyping analysis-based lineages, indicating a disparate acquisition route for this gene. PMID:17890345

Diversity analysis of dairy and nondairy Lactococcus lactis isolates, using a novel multilocus sequence analysis scheme and (GTG)5-PCR fingerprinting.

PubMed

Rademaker, Jan L W; Herbet, Hélène; Starrenburg, Marjo J C; Naser, Sabri M; Gevers, Dirk; Kelly, William J; Hugenholtz, Jeroen; Swings, Jean; van Hylckama Vlieg, Johan E T

2007-11-01

The diversity of a collection of 102 lactococcus isolates including 91 Lactococcus lactis isolates of dairy and nondairy origin was explored using partial small subunit rRNA gene sequence analysis and limited phenotypic analyses. A subset of 89 strains of L. lactis subsp. cremoris and L. lactis subsp. lactis isolates was further analyzed by (GTG)(5)-PCR fingerprinting and a novel multilocus sequence analysis (MLSA) scheme. Two major genomic lineages within L. lactis were found. The L. lactis subsp. cremoris type-strain-like genotype lineage included both L. lactis subsp. cremoris and L. lactis subsp. lactis isolates. The other major lineage, with a L. lactis subsp. lactis type-strain-like genotype, comprised L. lactis subsp. lactis isolates only. A novel third genomic lineage represented two L. lactis subsp. lactis isolates of nondairy origin. The genomic lineages deviate from the subspecific classification of L. lactis that is based on a few phenotypic traits only. MLSA of six partial genes (atpA, encoding ATP synthase alpha subunit; pheS, encoding phenylalanine tRNA synthetase; rpoA, encoding RNA polymerase alpha chain; bcaT, encoding branched chain amino acid aminotransferase; pepN, encoding aminopeptidase N; and pepX, encoding X-prolyl dipeptidyl peptidase) revealed 363 polymorphic sites (total length, 1,970 bases) among 89 L. lactis subsp. cremoris and L. lactis subsp. lactis isolates with unique sequence types for most isolates. This allowed high-resolution cluster analysis in which dairy isolates form subclusters of limited diversity within the genomic lineages. The pheS DNA sequence analysis yielded two genetic groups dissimilar to the other genotyping analysis-based lineages, indicating a disparate acquisition route for this gene.

Comparison of 16S rRNA sequencing with biochemical testing for species-level identification of clinical isolates of Neisseria spp.

PubMed

Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia

2014-08-01

We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.

The Expansion Segments of 28S Ribosomal RNA Extensively Match Human Messenger RNAs

PubMed Central

Parker, Michael S.; Balasubramaniam, Ambikaipakan; Sallee, Floyd R.; Parker, Steven L.

2018-01-01

Eukaryote ribosomal RNAs (rRNAs) have expanded in the course of phylogeny by addition of nucleotides in specific insertion areas, the expansion segments. These number about 40 in the larger (25–28S) rRNA (up to 2,400 nucleotides), and about 12 in the smaller (18S) rRNA (<700 nucleotides). Expansion of the larger rRNA shows a clear phylogenetic increase, with a dramatic rise in mammals and especially in hominids. Substantial portions of expansion segments in this RNA are not bound to ribosomal proteins, and may engage extraneous interactants, including messenger RNAs (mRNAs). Studies on the ribosome-mRNA interaction have focused on proteins of the smaller ribosomal subunit, with some examination of 18S rRNA. However, the expansion segments of human 28S rRNA show much higher density and numbers of mRNA matches than those of 18S rRNA, and also a higher density and match numbers than its own core parts. We have studied that with frequent and potentially stable matches containing 7–15 nucleotides. The expansion segments of 28S rRNA average more than 50 matches per mRNA even assuming only 5% of their sequence as available for such interaction. Large expansion segments 7, 15, and 27 of 28S rRNA also have copious long (≥10-nucleotide) matches to most human mRNAs, with frequencies much higher than in other 28S rRNA parts. Expansion segments 7 and 27 and especially segment 15 of 28S rRNA show large size increase in mammals compared to other metazoans, which could reflect a gain of function related to interaction with non-ribosomal partners. The 28S rRNA expansion segment 15 shows very high increments in size, guanosine, and cytidine nucleotide content and mRNA matching in mammals, and especially in hominids. With these segments (but not with other 28S rRNA or any 18S rRNA expansion segments) the density and number of matches are much higher in 5′-terminal than in 3′-terminal untranslated mRNA regions, which may relate to mRNA mobilization via 5′ termini. Matches in the expansion segments 7, 15, and 27 of human 28S rRNA appear as candidates for general interaction with mRNAs, especially those associated with intracellular matrices such as the endoplasmic reticulum. PMID:29563925

Phylogenetically Structured Differences in rRNA Gene Sequence Variation among Species of Arbuscular Mycorrhizal Fungi and Their Implications for Sequence Clustering

PubMed Central

Ekanayake, Saliya; Ruan, Yang; Schütte, Ursel M. E.; Kaonongbua, Wittaya; Fox, Geoffrey; Ye, Yuzhen; Bever, James D.

2016-01-01

ABSTRACT Arbuscular mycorrhizal (AM) fungi form mutualisms with plant roots that increase plant growth and shape plant communities. Each AM fungal cell contains a large amount of genetic diversity, but it is unclear if this diversity varies across evolutionary lineages. We found that sequence variation in the nuclear large-subunit (LSU) rRNA gene from 29 isolates representing 21 AM fungal species generally assorted into genus- and species-level clades, with the exception of species of the genera Claroideoglomus and Entrophospora. However, there were significant differences in the levels of sequence variation across the phylogeny and between genera, indicating that it is an evolutionarily constrained trait in AM fungi. These consistent patterns of sequence variation across both phylogenetic and taxonomic groups pose challenges to interpreting operational taxonomic units (OTUs) as approximations of species-level groups of AM fungi. We demonstrate that the OTUs produced by five sequence clustering methods using 97% or equivalent sequence similarity thresholds failed to match the expected species of AM fungi, although OTUs from AbundantOTU, CD-HIT-OTU, and CROP corresponded better to species than did OTUs from mothur or UPARSE. This lack of OTU-to-species correspondence resulted both from sequences of one species being split into multiple OTUs and from sequences of multiple species being lumped into the same OTU. The OTU richness therefore will not reliably correspond to the AM fungal species richness in environmental samples. Conservatively, this error can overestimate species richness by 4-fold or underestimate richness by one-half, and the direction of this error will depend on the genera represented in the sample. IMPORTANCE Arbuscular mycorrhizal (AM) fungi form important mutualisms with the roots of most plant species. Individual AM fungi are genetically diverse, but it is unclear whether the level of this diversity differs among evolutionary lineages. We found that the amount of sequence variation in an rRNA gene that is commonly used to identify AM fungal species varied significantly between evolutionary groups that correspond to different genera, with the exception of two genera that are genetically indistinguishable from each other. When we clustered groups of similar sequences into operational taxonomic units (OTUs) using five different clustering methods, these patterns of sequence variation caused the number of OTUs to either over- or underestimate the actual number of AM fungal species, depending on the genus. Our results indicate that OTU-based inferences about AM fungal species composition from environmental sequences can be improved if they take these taxonomically structured patterns of sequence variation into account. PMID:27260357

Prevotella jejuni sp. nov., isolated from the small intestine of a child with coeliac disease.

PubMed

Hedberg, Maria E; Israelsson, Anne; Moore, Edward R B; Svensson-Stadler, Liselott; Wai, Sun Nyunt; Pietz, Grzegorz; Sandström, Olof; Hernell, Olle; Hammarström, Marie-Louise; Hammarström, Sten

2013-11-01

Five obligately anaerobic, Gram-stain-negative, saccharolytic and proteolytic, non-spore-forming bacilli (strains CD3 : 27, CD3 : 28(T), CD3 : 33, CD3 : 32 and CD3 : 34) are described. All five strains were isolated from the small intestine of a female child with coeliac disease. Cells of the five strains were short rods or coccoid cells with longer filamentous forms seen sporadically. The organisms produced acetic acid and succinic acid as major metabolic end products. Phylogenetic analysis based on comparative 16S rRNA gene sequence analysis revealed close relationships between CD3 : 27, CD3 : 28(T) and CD3 : 33, between CD3 : 32 and Prevotella histicola CCUG 55407(T), and between CD3 : 34 and Prevotella melaninogenica CCUG 4944B(T). Strains CD3 : 27, CD3 : 28(T) and CD3 : 33 were clearly different from all recognized species within the genus Prevotella and related most closely to but distinct from P. melaninogenica. Based on 16S rRNA, RNA polymerase β-subunit (rpoB) and 60 kDa chaperonin protein subunit (cpn60) gene sequencing, and phenotypic, chemical and biochemical properties, strains CD3 : 27, CD3 : 28(T) and CD3 : 33 are considered to represent a novel species within the genus Prevotella, for which the name Prevotella jejuni sp. nov. is proposed. Strain CD3 : 28(T) ( = CCUG 60371(T) = DSM 26989(T)) is the type strain of the proposed novel species. All five strains were able to form homologous aggregates, in which tube-like structures were connecting individual bacteria cells. The five strains were able to bind to human intestinal carcinoma cell lines at 37 °C.

Prevotella jejuni sp. nov., isolated from the small intestine of a child with coeliac disease

PubMed Central

Israelsson, Anne; Moore, Edward R. B.; Svensson-Stadler, Liselott; Wai, Sun Nyunt; Pietz, Grzegorz; Sandström, Olof; Hernell, Olle; Hammarström, Marie-Louise

2013-01-01

Five obligately anaerobic, Gram-stain-negative, saccharolytic and proteolytic, non-spore-forming bacilli (strains CD3 : 27, CD3 : 28T, CD3 : 33, CD3 : 32 and CD3 : 34) are described. All five strains were isolated from the small intestine of a female child with coeliac disease. Cells of the five strains were short rods or coccoid cells with longer filamentous forms seen sporadically. The organisms produced acetic acid and succinic acid as major metabolic end products. Phylogenetic analysis based on comparative 16S rRNA gene sequence analysis revealed close relationships between CD3 : 27, CD3 : 28T and CD3 : 33, between CD3 : 32 and Prevotella histicola CCUG 55407T, and between CD3 : 34 and Prevotella melaninogenica CCUG 4944BT. Strains CD3 : 27, CD3 : 28T and CD3 : 33 were clearly different from all recognized species within the genus Prevotella and related most closely to but distinct from P. melaninogenica. Based on 16S rRNA, RNA polymerase β-subunit (rpoB) and 60 kDa chaperonin protein subunit (cpn60) gene sequencing, and phenotypic, chemical and biochemical properties, strains CD3 : 27, CD3 : 28T and CD3 : 33 are considered to represent a novel species within the genus Prevotella, for which the name Prevotella jejuni sp. nov. is proposed. Strain CD3 : 28T ( = CCUG 60371T = DSM 26989T) is the type strain of the proposed novel species. All five strains were able to form homologous aggregates, in which tube-like structures were connecting individual bacteria cells. The five strains were able to bind to human intestinal carcinoma cell lines at 37 °C. PMID:23793857

Complete Mitochondrial Genome Sequences of Chinese Indigenous Sheep with Different Tail Types and an Analysis of Phylogenetic Evolution in Domestic Sheep.

PubMed

Fan, Hongying; Zhao, Fuping; Zhu, Caiye; Li, Fadi; Liu, Jidong; Zhang, Li; Wei, Caihong; Du, Lixin

2016-05-01

China has a long history of sheep (Ovis aries [O. aries]) breeding and an abundance of sheep genetic resources. Knowledge of the complete O. aries mitogenome should facilitate the study of the evolutionary history of the species. Therefore, the complete mitogenome of O. aries was sequenced and annotated. In order to characterize the mitogenomes of 3 Chinese sheep breeds (Altay sheep [AL], Shandong large-tailed sheep [SD], and small-tailed Hulun Buir sheep [sHL]), 19 sets of primers were employed to amplify contiguous, overlapping segments of the complete mitochondrial DNA (mtDNA) sequence of each breed. The sizes of the complete mitochondrial genomes of the sHL, AL, and SD breeds were 16,617 bp, 16,613 bp, and 16,613 bp, respectively. The mitochondrial genomes were deposited in the GenBank database with accession numbers KP702285 (AL sheep), KP981378 (SD sheep), and KP981380 (sHL sheep) respectively. The organization of the 3 analyzed sheep mitochondrial genomes was similar, with each consisting of 22 tRNA genes, 2 rRNA genes (12S rRNA and 16S rRNA), 13 protein-coding genes, and 1 control region (D-loop). The NADH dehydrogenase subunit 6 (ND6) and 8 tRNA genes were encoded on the light strand, whereas the rest of the mitochondrial genes were encoded on the heavy strand. The nucleotide skewness of the coding strands of the 3 analyzed mitogenomes was biased toward A and T. We constructed a phylogenetic tree using the complete mitogenomes of each type of sheep to allow us to understand the genetic relationships between Chinese breeds of O. aries and those developed and utilized in other countries. Our findings provide important information regarding the O. aries mitogenome and the evolutionary history of O. aries inside and outside China. In addition, our results provide a foundation for further exploration of the taxonomic status of O. aries.

Microbial community stratification linked to utilization of carbohydrates and phosphorus limitation in a boreal peatland at Marcell Experimental Forest, Minnesota, USA.

PubMed

Lin, Xueju; Tfaily, Malak M; Steinweg, J Megan; Chanton, Patrick; Esson, Kaitlin; Yang, Zamin K; Chanton, Jeffrey P; Cooper, William; Schadt, Christopher W; Kostka, Joel E

2014-06-01

This study investigated the abundance, distribution, and composition of microbial communities at the watershed scale in a boreal peatland within the Marcell Experimental Forest (MEF), Minnesota, USA. Through a close coupling of next-generation sequencing, biogeochemistry, and advanced analytical chemistry, a biogeochemical hot spot was revealed in the mesotelm (30- to 50-cm depth) as a pronounced shift in microbial community composition in parallel with elevated peat decomposition. The relative abundance of Acidobacteria and the Syntrophobacteraceae, including known hydrocarbon-utilizing genera, was positively correlated with carbohydrate and organic acid content, showing a maximum in the mesotelm. The abundance of Archaea (primarily crenarchaeal groups 1.1c and 1.3) increased with depth, reaching up to 60% of total small-subunit (SSU) rRNA gene sequences in the deep peat below the 75-cm depth. Stable isotope geochemistry and potential rates of methane production paralleled vertical changes in methanogen community composition to indicate a predominance of acetoclastic methanogenesis mediated by the Methanosarcinales in the mesotelm, while hydrogen-utilizing methanogens predominated in the deeper catotelm. RNA-derived pyrosequence libraries corroborated DNA sequence data to indicate that the above-mentioned microbial groups are metabolically active in the mid-depth zone. Fungi showed a maximum in rRNA gene abundance above the 30-cm depth, which comprised only an average of 0.1% of total bacterial and archaeal rRNA gene abundance, indicating prokaryotic dominance. Ratios of C to P enzyme activities approached 0.5 at the acrotelm and catotelm, indicating phosphorus limitation. In contrast, P limitation pressure appeared to be relieved in the mesotelm, likely due to P solubilization by microbial production of organic acids and C-P lyases. Based on path analysis and the modeling of community spatial turnover, we hypothesize that P limitation outweighs N limitation at MEF, and microbial communities are structured by the dominant shrub, Chamaedaphne calyculata, which may act as a carbon source for major consumers in the peatland.

Complete Mitochondrial Genome Sequences of Chinese Indigenous Sheep with Different Tail Types and an Analysis of Phylogenetic Evolution in Domestic Sheep

PubMed Central

Fan, Hongying; Zhao, Fuping; Zhu, Caiye; Li, Fadi; Liu, Jidong; Zhang, Li; Wei, Caihong; Du, Lixin

2016-01-01

China has a long history of sheep (Ovis aries [O. aries]) breeding and an abundance of sheep genetic resources. Knowledge of the complete O. aries mitogenome should facilitate the study of the evolutionary history of the species. Therefore, the complete mitogenome of O. aries was sequenced and annotated. In order to characterize the mitogenomes of 3 Chinese sheep breeds (Altay sheep [AL], Shandong large-tailed sheep [SD], and small-tailed Hulun Buir sheep [sHL]), 19 sets of primers were employed to amplify contiguous, overlapping segments of the complete mitochondrial DNA (mtDNA) sequence of each breed. The sizes of the complete mitochondrial genomes of the sHL, AL, and SD breeds were 16,617 bp, 16,613 bp, and 16,613 bp, respectively. The mitochondrial genomes were deposited in the GenBank database with accession numbers KP702285 (AL sheep), KP981378 (SD sheep), and KP981380 (sHL sheep) respectively. The organization of the 3 analyzed sheep mitochondrial genomes was similar, with each consisting of 22 tRNA genes, 2 rRNA genes (12S rRNA and 16S rRNA), 13 protein-coding genes, and 1 control region (D-loop). The NADH dehydrogenase subunit 6 (ND6) and 8 tRNA genes were encoded on the light strand, whereas the rest of the mitochondrial genes were encoded on the heavy strand. The nucleotide skewness of the coding strands of the 3 analyzed mitogenomes was biased toward A and T. We constructed a phylogenetic tree using the complete mitogenomes of each type of sheep to allow us to understand the genetic relationships between Chinese breeds of O. aries and those developed and utilized in other countries. Our findings provide important information regarding the O. aries mitogenome and the evolutionary history of O. aries inside and outside China. In addition, our results provide a foundation for further exploration of the taxonomic status of O. aries. PMID:26954183

Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae) and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene

PubMed Central

Yong, Hoi-Sen; Lim, Phaik-Eem; Eamsobhana, Praphathip

2017-01-01

The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes—PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship. PMID:29216281

Nearly complete 28S rRNA gene sequences confirm new hypotheses of sponge evolution.

PubMed

Thacker, Robert W; Hill, April L; Hill, Malcolm S; Redmond, Niamh E; Collins, Allen G; Morrow, Christine C; Spicer, Lori; Carmack, Cheryl A; Zappe, Megan E; Pohlmann, Deborah; Hall, Chelsea; Diaz, Maria C; Bangalore, Purushotham V

2013-09-01

The highly collaborative research sponsored by the NSF-funded Assembling the Porifera Tree of Life (PorToL) project is providing insights into some of the most difficult questions in metazoan systematics. Our understanding of phylogenetic relationships within the phylum Porifera has changed considerably with increased taxon sampling and data from additional molecular markers. PorToL researchers have falsified earlier phylogenetic hypotheses, discovered novel phylogenetic alliances, found phylogenetic homes for enigmatic taxa, and provided a more precise understanding of the evolution of skeletal features, secondary metabolites, body organization, and symbioses. Some of these exciting new discoveries are shared in the papers that form this issue of Integrative and Comparative Biology. Our analyses of over 300 nearly complete 28S ribosomal subunit gene sequences provide specific case studies that illustrate how our dataset confirms new hypotheses of sponge evolution. We recovered monophyletic clades for all 4 classes of sponges, as well as the 4 major clades of Demospongiae (Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha), but our phylogeny differs in several aspects from traditional classifications. In most major clades of sponges, families within orders appear to be paraphyletic. Although additional sampling of genes and taxa are needed to establish whether this pattern results from a lack of phylogenetic resolution or from a paraphyletic classification system, many of our results are congruent with those obtained from 18S ribosomal subunit gene sequences and complete mitochondrial genomes. These data provide further support for a revision of the traditional classification of sponges.

Nearly Complete 28S rRNA Gene Sequences Confirm New Hypotheses of Sponge Evolution

PubMed Central

Thacker, Robert W.; Hill, April L.; Hill, Malcolm S.; Redmond, Niamh E.; Collins, Allen G.; Morrow, Christine C.; Spicer, Lori; Carmack, Cheryl A.; Zappe, Megan E.; Pohlmann, Deborah; Hall, Chelsea; Diaz, Maria C.; Bangalore, Purushotham V.

2013-01-01

The highly collaborative research sponsored by the NSF-funded Assembling the Porifera Tree of Life (PorToL) project is providing insights into some of the most difficult questions in metazoan systematics. Our understanding of phylogenetic relationships within the phylum Porifera has changed considerably with increased taxon sampling and data from additional molecular markers. PorToL researchers have falsified earlier phylogenetic hypotheses, discovered novel phylogenetic alliances, found phylogenetic homes for enigmatic taxa, and provided a more precise understanding of the evolution of skeletal features, secondary metabolites, body organization, and symbioses. Some of these exciting new discoveries are shared in the papers that form this issue of Integrative and Comparative Biology. Our analyses of over 300 nearly complete 28S ribosomal subunit gene sequences provide specific case studies that illustrate how our dataset confirms new hypotheses of sponge evolution. We recovered monophyletic clades for all 4 classes of sponges, as well as the 4 major clades of Demospongiae (Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha), but our phylogeny differs in several aspects from traditional classifications. In most major clades of sponges, families within orders appear to be paraphyletic. Although additional sampling of genes and taxa are needed to establish whether this pattern results from a lack of phylogenetic resolution or from a paraphyletic classification system, many of our results are congruent with those obtained from 18S ribosomal subunit gene sequences and complete mitochondrial genomes. These data provide further support for a revision of the traditional classification of sponges. PMID:23748742

Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

NASA Astrophysics Data System (ADS)

Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

2011-10-01

Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

The Era GTPase recognizes the GAUCACCUCC sequence and binds helix 45 near the 3; end of 16S rRNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tu, Chao; Zhou, Xiaomei; Tarasov, Sergey G.

2012-03-26

Era, composed of a GTPase domain and a K homology domain, is essential for bacterial cell viability. It is required for the maturation of 16S rRNA and assembly of the 30S ribosomal subunit. We showed previously that the protein recognizes nine nucleotides (1531{sup AUCACCUCC}1539) near the 3{prime} end of 16S rRNA, and that this recognition stimulates GTP-hydrolyzing activity of Era. In all three kingdoms of life, the 1530{sup GAUCA}1534 sequence and helix 45 (h45) (nucleotides 1506-1529) are highly conserved. It has been shown that the 1530{sup GA}1531 to 1530{sup AG}1531 double mutation severely affects the viability of bacteria. However, whethermore » Era interacts with G1530 and/or h45 and whether such interactions (if any) contribute to the stimulation of Era's GTPase activity were not known. Here, we report two RNA structures that contain nucleotides 1506-1542 (RNA301), one in complex with Era and GDPNP (GNP), a nonhydrolysable GTP-analogue, and the other in complex with Era, GNP, and the KsgA methyltransferase. The structures show that Era recognizes 10 nucleotides, including G1530, and that Era also binds h45. Moreover, GTPase assay experiments show that G1530 does not stimulate Era's GTPase activity. Rather, A1531 and A1534 are most important for stimulation and h45 further contributes to the stimulation. Although G1530 does not contribute to the intrinsic GTPase activity of Era, its interaction with Era is important for binding and is essential for the protein to function, leading to the discovery of a new cold-sensitive phenotype of Era.« less

Emergence of Cryptosporidium hominis Monkey Genotype II and Novel Subtype Family Ik in the Squirrel Monkey (Saimiri sciureus) in China.

PubMed

Liu, Xuehan; Xie, Na; Li, Wei; Zhou, Ziyao; Zhong, Zhijun; Shen, Liuhong; Cao, Suizhong; Yu, Xingming; Hu, Yanchuan; Chen, Weigang; Peng, Gangneng

2015-01-01

A single Cryptosporidium isolate from a squirrel monkey with no clinical symptoms was obtained from a zoo in Ya'an city, China, and was genotyped by PCR amplification and DNA sequencing of the small-subunit ribosomal RNA (SSU rRNA), 70-kDa heat shock protein (HSP70), Cryptosporidium oocyst wall protein, and actin genes. This multilocus genetic characterization determined that the isolate was Cryptosporidium hominis, but carried 2, 10, and 6 nucleotide differences in the SSU rRNA, HSP70, and actin loci, respectively, which is comparable to the variations at these loci between C. hominis and the previously reported monkey genotype (2, 3, and 3 nucleotide differences). Phylogenetic studies, based on neighbor-joining and maximum likelihood methods, showed that the isolate identified in the current study had a distinctly discordant taxonomic status, distinct from known C. hominis and also from the monkey genotype, with respect to the three loci. Restriction fragment length polymorphisms of the SSU rRNA gene obtained from this study were similar to those of known C. hominis but clearly differentiated from the monkey genotype. Further subtyping was performed by sequence analysis of the gene encoding the 60-kDa glycoprotein (gp60). Maximum homology of only 88.3% to C. hominis subtype IdA10G4 was observed for the current isolate, and phylogenetic analysis demonstrated that this particular isolate belonged to a novel C. hominis subtype family, IkA7G4. This study is the first to report C. hominis infection in the squirrel monkey and, based on the observed genetic characteristics, confirms a new C. hominis genotype, monkey genotype II. Thus, these results provide novel insights into genotypic variation in C. hominis.

A flexible and economical barcoding approach for highly multiplexed amplicon sequencing of diverse target genes

PubMed Central

Herbold, Craig W.; Pelikan, Claus; Kuzyk, Orest; Hausmann, Bela; Angel, Roey; Berry, David; Loy, Alexander

2015-01-01

High throughput sequencing of phylogenetic and functional gene amplicons provides tremendous insight into the structure and functional potential of complex microbial communities. Here, we introduce a highly adaptable and economical PCR approach to barcoding and pooling libraries of numerous target genes. In this approach, we replace gene- and sequencing platform-specific fusion primers with general, interchangeable barcoding primers, enabling nearly limitless customized barcode-primer combinations. Compared to barcoding with long fusion primers, our multiple-target gene approach is more economical because it overall requires lower number of primers and is based on short primers with generally lower synthesis and purification costs. To highlight our approach, we pooled over 900 different small-subunit rRNA and functional gene amplicon libraries obtained from various environmental or host-associated microbial community samples into a single, paired-end Illumina MiSeq run. Although the amplicon regions ranged in size from approximately 290 to 720 bp, we found no significant systematic sequencing bias related to amplicon length or gene target. Our results indicate that this flexible multiplexing approach produces large, diverse, and high quality sets of amplicon sequence data for modern studies in microbial ecology. PMID:26236305

Association of nonribosomal nucleolar proteins in ribonucleoprotein complexes during interphase and mitosis.

PubMed

Piñol-Roma, S

1999-01-01

rRNA precursors are bound throughout their length by specific proteins, as the pre-rRNAs emerge from the transcription machinery. The association of pre-rRNA with proteins as ribonucleoprotein (RNP) complexes persists during maturation of 18S, 5.8S, and 28S rRNA, and through assembly of ribosomal subunits in the nucleolus. Preribosomal RNP complexes contain, in addition to ribosomal proteins, an unknown number of nonribosomal nucleolar proteins, as well as small nucleolar RNA-ribonucleoproteins (sno-RNPs). This report describes the use of a specific, rapid, and mild immunopurification approach to isolate and analyze human RNP complexes that contain nonribosomal nucleolar proteins, as well as ribosomal proteins and rRNA. Complexes immunopurified with antibodies to nucleolin-a major nucleolar RNA-binding protein-contain several distinct specific polypeptides that include, in addition to nucleolin, the previously identified nucleolar proteins B23 and fibrillarin, proteins with electrophoretic mobilities characteristic of ribosomal proteins including ribosomal protein S6, and a number of additional unidentified proteins. The physical association of these proteins with one another is mediated largely by RNA, in that the complexes dissociate upon digestion with RNase. Complexes isolated from M-phase cells are similar in protein composition to those isolated from interphase cell nuclear extracts. Therefore, the predominant proteins that associate with nucleolin in interphase remain in RNP complexes during mitosis, despite the cessation of rRNA synthesis and processing in M-phase. In addition, precursor rRNA, as well as processed 18S and 28S rRNA and candidate rRNA processing intermediates, is found associated with the immunopurified complexes. The characteristics of the rRNP complexes described here, therefore, indicate that they represent bona fide precursors of mature cytoplasmic ribosomal subunits.

Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

PubMed

Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

2001-05-01

Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

PubMed Central

Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

2001-01-01

Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding. PMID:11350033

Metagenome Sequence Analysis of Filamentous Microbial Communities Obtained from Geochemically Distinct Geothermal Channels Reveals Specialization of Three Aquificales Lineages

PubMed Central

Takacs-Vesbach, Cristina; Inskeep, William P.; Jay, Zackary J.; Herrgard, Markus J.; Rusch, Douglas B.; Tringe, Susannah G.; Kozubal, Mark A.; Hamamura, Natsuko; Macur, Richard E.; Fouke, Bruce W.; Reysenbach, Anna-Louise; McDermott, Timothy R.; Jennings, Ryan deM.; Hengartner, Nicolas W.; Xie, Gary

2013-01-01

The Aquificales are thermophilic microorganisms that inhabit hydrothermal systems worldwide and are considered one of the earliest lineages of the domain Bacteria. We analyzed metagenome sequence obtained from six thermal “filamentous streamer” communities (∼40 Mbp per site), which targeted three different groups of Aquificales found in Yellowstone National Park (YNP). Unassembled metagenome sequence and PCR-amplified 16S rRNA gene libraries revealed that acidic, sulfidic sites were dominated by Hydrogenobaculum (Aquificaceae) populations, whereas the circum-neutral pH (6.5–7.8) sites containing dissolved sulfide were dominated by Sulfurihydrogenibium spp. (Hydrogenothermaceae). Thermocrinis (Aquificaceae) populations were found primarily in the circum-neutral sites with undetectable sulfide, and to a lesser extent in one sulfidic system at pH 8. Phylogenetic analysis of assembled sequence containing 16S rRNA genes as well as conserved protein-encoding genes revealed that the composition and function of these communities varied across geochemical conditions. Each Aquificales lineage contained genes for CO2 fixation by the reverse-TCA cycle, but only the Sulfurihydrogenibium populations perform citrate cleavage using ATP citrate lyase (Acl). The Aquificaceae populations use an alternative pathway catalyzed by two separate enzymes, citryl-CoA synthetase (Ccs), and citryl-CoA lyase (Ccl). All three Aquificales lineages contained evidence of aerobic respiration, albeit due to completely different types of heme Cu oxidases (subunit I) involved in oxygen reduction. The distribution of Aquificales populations and differences among functional genes involved in energy generation and electron transport is consistent with the hypothesis that geochemical parameters (e.g., pH, sulfide, H2, O2) have resulted in niche specialization among members of the Aquificales. PMID:23755042

Use of real-time qPCR to quantify members of the unculturable heterotrophic bacterial community in a deep sea marine sponge, Vetulina sp.

PubMed

Cassler, M; Peterson, C L; Ledger, A; Pomponi, S A; Wright, A E; Winegar, R; McCarthy, P J; Lopez, J V

2008-04-01

In this report, real-time quantitative PCR (TaqMan qPCR) of the small subunit (SSU) 16S-like rRNA molecule, a universal phylogenetic marker, was used to quantify the relative abundance of individual bacterial members of a diverse, yet mostly unculturable, microbial community from a marine sponge. Molecular phylogenetic analyses of bacterial communities derived from Caribbean Lithistid sponges have shown a wide diversity of microbes that included at least six major subdivisions; however, very little overlap was observed between the culturable and unculturable microbial communities. Based on sequence data of three culture-independent Lithistid-derived representative bacteria, we designed probe/primer sets for TaqMan qPCR to quantitatively characterize selected microbial residents in a Lithistid sponge, Vetulina, metagenome. TaqMan assays included specificity testing, DNA limit of detection analysis, and quantification of specific microbial rRNA sequences such as Nitrospira-like microbes and Actinobacteria up to 172 million copies per microgram per Lithistid sponge metagenome. By contrast, qPCR amplification with probes designed for common previously cultured sponge-associated bacteria in the genera Rheinheimera and Marinomonas and a representative of the CFB group resulted in only minimal detection of the Rheiheimera in total DNA extracted from the sponge. These data verify that a large portion of the microbial community within Lithistid sponges may consist of currently unculturable microorganisms.

Biodiversity and Emerging Biogeography of the Neutrophilic Iron-Oxidizing Zetaproteobacteria ▿ †

PubMed Central

McAllister, Sean M.; Davis, Richard E.; McBeth, Joyce M.; Tebo, Bradley M.; Emerson, David; Moyer, Craig L.

2011-01-01

Members of the neutrophilic iron-oxidizing candidate class Zetaproteobacteria have predominantly been found at sites of microbially mediated iron oxidation in marine environments around the Pacific Ocean. Eighty-four full-length (>1,400-bp) and 48 partial-length Zetaproteobacteria small-subunit (SSU) rRNA gene sequences from five novel clone libraries, one novel Zetaproteobacteria isolate, and the GenBank database were analyzed to assess the biodiversity of this burgeoning class of the Proteobacteria and to investigate its biogeography between three major sampling regions in the Pacific Ocean: Loihi Seamount, the Southern Mariana Trough, and the Tonga Arc. Sequences were grouped into operational taxonomic units (OTUs) on the basis of a 97% minimum similarity. Of the 28 OTUs detected, 13 were found to be endemic to one of the three main sampling regions and 2 were ubiquitous throughout the Pacific Ocean. Additionally, two deeply rooted OTUs that potentially dominate communities of iron oxidizers originating in the deep subsurface were identified. Spatial autocorrelation analysis and analysis of molecular variance (AMOVA) showed that geographic distance played a significant role in the distribution of Zetaproteobacteria biodiversity, whereas environmental parameters, such as temperature, pH, or total Fe concentration, did not have a significant effect. These results, detected using the coarse resolution of the SSU rRNA gene, indicate that the Zetaproteobacteria have a strong biogeographic signal. PMID:21666021

Heterodera guangdongensis n. sp. (Nematoda: Heteroderinae) from bamboo in Guangdong Province, China--a new cyst nematode in the Cyperi group.

PubMed

Zhuo, Kan; Wang, Honghong; Zhang, Hongling; Liao, Jinling

2014-11-07

Heterodera guangdongensis n. sp. is described from bamboo (Phyllostachys pubescens Mazel) based on morphology and molecular analyses of rRNA D2D3 expansion domains of large subunit (LSU D2D3) and internal transcribed spacer (ITS) sequences. This new species can be classified in the Cyperi group. Cysts are characterized by a prominent, ambifenestrate vulval cone with weak underbridge, a vulva-anus distance of 28.9-35.9 μm and a vulval slit of 31.1-41.0 μm, but without bullae. Females are characterized by a 25.1-27.6 μm stylet with rounded knobs sloping slightly posteriorly. Males are characterized by a 21.5-23.0 μm stylet with knobs slightly projecting or flat anteriorly, lateral field with four lines, and a 22.0-26.0 μm spicule with bifurcate tip. Second-stage juveniles are characterized by a 19.3-21.3 stylet with slightly projecting or anteriorly flattened knobs, lateral field with three lines, a 41.7-61.3 μm tail with finely rounded terminus and hyaline portion forming 43.0-57.1% of the tail length. Molecular analyses show that the species has unique D2D3 and ITS rRNA sequences and RFLP-ITS-rRNA profiles.

Prevalence of filarioid nematodes and trypanosomes in American robins and house sparrows, Chicago USA.

PubMed

Hamer, Gabriel L; Anderson, Tavis K; Berry, Garrett E; Makohon-Moore, Alvin P; Crafton, Jeffrey C; Brawn, Jeffrey D; Dolinski, Amanda C; Krebs, Bethany L; Ruiz, Marilyn O; Muzzall, Patrick M; Goldberg, Tony L; Walker, Edward D

2013-12-01

Hosts are commonly infected with a suite of parasites, and interactions among these parasites can affect the size, structure, and behavior of host-parasite communities. As an important step to understanding the significance of co-circulating parasites, we describe prevalence of co-circulating hemoparasites in two important avian amplification hosts for West Nile virus (WNV), the American robin (Turdus migratorius) and house sparrow (Passer domesticus), during the 2010-2011 in Chicago, Illinois, USA. Rates of nematode microfilariemia were 1.5% of the robins (n = 70) and 4.2% of the house sparrows (n = 72) collected during the day and 11.1% of the roosting robins (n = 63) and 0% of the house sparrows (n = 11) collected at night. Phylogenetic analysis of nucleotide sequences of the 18S rRNA and cytochrome oxidase subunit I (COI) genes from these parasites resolved two clades of filarioid nematodes. Microscopy revealed that 18.0% of American robins (n = 133) and 16.9% of house sparrows (n = 83) hosted trypanosomes in the blood. Phylogenetic analysis of nucleotide sequences from the 18s rRNA gene revealed that the trypanosomes fall within previously described avian trypanosome clades. These results document hemoparasites in the blood of WNV hosts in a center of endemic WNV transmission, suggesting a potential for direct or indirect interactions with the virus.

Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

NASA Technical Reports Server (NTRS)

Fox, G. E.

1985-01-01

Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries.

PubMed

Wickersheim, Michelle L; Blumenstiel, Justin P

2013-11-01

A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.

Natural infection of Cryptosporidium muris (Apicomplexa: Cryptosporiidae) in Siberian chipmunks.

PubMed

Hůrková, Lada; Hajdusek, Ondrej; Modrý, David

2003-04-01

Coprologic examination of nine Siberian chipmunks (Eutamias sibiricus) imported from Southeast Asia revealed infection with Cryptosporidium sp. Experimental inoculation of BALB/c mice proved their susceptibility to the infection. Infected mice shed oocysts 14-35 days postinfection. Oocyst morphology was similar to that reported for C. muris in previous studies, oocysts were 8.1 (7.0-9.0) x 5.9 (5.0-6.5) microns. Clinical signs were absent in naturally infected chipmunks and experimental mice. Histologic examinations of mice revealed numerous developmental stages of C. muris in the glandular stomach. Analysis of partial small subunit rRNA gene sequences confirmed identity of these isolates as C. muris. Our results represent the first report of C. muris in members of the family Sciuridae.

Natural infection of the sand fly Phlebotomus kazeruni by Trypanosoma species in Pakistan

PubMed Central

2010-01-01

The natural infection of phlebotomine sand flies by Leishmania parasites was surveyed in a desert area of Pakistan where cutaneous leishmaniasis is endemic. Out of 220 female sand flies dissected, one sand fly, Phlebotomus kazeruni, was positive for flagellates in the hindgut. Analyses of cytochrome b (cyt b), glycosomal glyceraldehyde phosphate dehydrogenase (gGAPDH) and small subunit ribosomal RNA (SSU rRNA) gene sequences identified the parasite as a Trypanosoma species of probably a reptile or amphibian. This is the first report of phlebotomine sand flies naturally infected with a Trypanosoma species in Pakistan. The possible infection of sand flies with Trypanosoma species should be taken into consideration in epidemiological studies of vector species in areas where leishmaniasis is endemic. PMID:20184773

Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

USDA-ARS?s Scientific Manuscript database

This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

NASA Technical Reports Server (NTRS)

Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

1992-01-01

16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

PubMed Central

Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

2005-01-01

5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

Pseudomonas sp. strain CA5 (a selenite-reducing bacterium) 16S rRNA gene complete sequence. National Institute of Health, National Center for Biotechnology Information, GenBank sequence. Accession FJ422810.1.

USDA-ARS?s Scientific Manuscript database

This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...

Nuclear counterparts of the cytoplasmic mitochondrial 12S rRNA gene: a problem of ancient DNA and molecular phylogenies.

PubMed

van der Kuyl, A C; Kuiken, C L; Dekker, J T; Perizonius, W R; Goudsmit, J

1995-06-01

Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S rRNA gene. Sequences aligning with the 12S rRNA gene were recovered but were only distantly related to contemporary monkey mitochondrial 12S rRNA sequences. However, many of these sequences were identical or closely related to human nuclear DNA sequences resembling mitochondrial 12S rRNA (isolated from a cell line depleted in mitochondria) and therefore have to be considered contamination. Subsequently in a separate study we were able to recover genuine mitochondrial 12S rRNA sequences from many extant species of nonhuman Old World primates and sequences closely resembling the human nuclear integrations. Analysis of all sequences by the neighbor-joining (NJ) method indicated that mitochondrial DNA sequences and their nuclear counterparts can be divided into two distinct clusters. One cluster contained all temporary cytoplasmic mitochondrial DNA sequences and approximately half of the monkey nuclear mitochondriallike sequences. A second cluster contained most human nuclear sequences and the other half of monkey nuclear sequences with a separate branch leading to human and gorilla mitochondrial and nuclear sequences. Sequences recovered from ancient materials were equally divided between the two clusters. These results constitute a warning for when working with ancient DNA or performing phylogenetic analysis using mitochondrial DNA as a target sequence: Nuclear counterparts of mitochondrial genes may lead to faulty interpretation of results.

Streptococcus loxodontisalivarius sp. nov. and Streptococcus saliviloxodontae sp. nov., isolated from oral cavities of elephants.

PubMed

Saito, Masanori; Shinozaki-Kuwahara, Noriko; Hirasawa, Masatomo; Takada, Kazuko

2014-09-01

Four Gram-stain-positive, catalase-negative, coccoid-shaped organisms were isolated from elephant oral cavities. The isolates were tentatively identified as streptococcal species based on the results of biochemical tests. Comparative 16S rRNA gene sequencing studies confirmed the organisms to be members of the genus Streptococcus. Two isolates (NUM 6304(T) and NUM 6312) were related most closely to Streptococcus salivarius with 96.8 % and 93.1 % similarity based on the 16S rRNA gene and the RNA polymerase β subunit encoding gene (rpoB), respectively, and to Streptococcus vestibularis with 83.7 % similarity based on the 60 kDa heat-shock protein gene (groEL). The other two isolates (NUM 6306(T) and NUM 6318) were related most closely to S. vestibularis with 97.0 % and 82.9 % similarity based on the 16S rRNA and groEL genes, respectively, and to S. salivarius with 93.5 % similarity based on the rpoB gene. Based on phylogenetic and phenotypic evidence, these isolates are suggested to represent novel species of the genus Streptococcus, for which the names Streptococcus loxodontisalivarius sp. nov. (type strain NUM 6304(T) = JCM 19287(T) = DSM 27382(T)) and Streptococcus saliviloxodontae sp. nov. (type strain NUM 6306(T) = JCM 19288(T) = DSM 27513(T)) are proposed. © 2014 IUMS.

Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

PubMed

Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

2014-01-01

A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.

Analysis of the function of E. coli 23S rRNA helix-loop 69 by mutagenesis

PubMed Central

Liiv, Aivar; Karitkina, Diana; Maiväli, Ülo; Remme, Jaanus

2005-01-01

Background The ribosome is a two-subunit enzyme known to exhibit structural dynamism during protein synthesis. The intersubunit bridges have been proposed to play important roles in decoding, translocation, and the peptidyl transferase reaction; yet the physical nature of their contributions is ill understood. An intriguing intersubunit bridge, B2a, which contains 23S rRNA helix 69 as a major component, has been implicated by proximity in a number of catalytically important regions. In addition to contacting the small ribosomal subunit, helix 69 contacts both the A and P site tRNAs and several translation factors. Results We scanned the loop of helix 69 by mutagenesis and analyzed the mutant ribosomes using a plasmid-borne IPTG-inducible expression system. We assayed the effects of 23S rRNA mutations on cell growth, contribution of mutant ribosomes to cellular polysome pools and the ability of mutant ribosomes to function in cell-free translation. Mutations A1912G, and A1919G have very strong growth phenotypes, are inactive during in vitro protein synthesis, and under-represented in the polysomes. Mutation Ψ1917C has a very strong growth phenotype and leads to a general depletion of the cellular polysome pool. Mutation A1916G, having a modest growth phenotype, is apparently defective in the assembly of the 70S ribosome. Conclusion Mutations A1912G, A1919G, and Ψ1917C of 23S rRNA strongly inhibit translation. Mutation A1916G causes a defect in the 50S subunit or 70S formation. Mutations Ψ1911C, A1913G, C1914A, Ψ1915C, and A1918G lack clear phenotypes. PMID:16053518

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

Tandem repeats of the 5' non-transcribed spacer of Tetrahymena rDNA function as high copy number autonomous replicons in the macronucleus but do not prevent rRNA gene dosage regulation.

PubMed Central

Pan, W J; Blackburn, E H

1995-01-01

The rRNA genes in the somatic macronucleus of Tetrahymena thermophila are normally on 21 kb linear palindromic molecules (rDNA). We examined the effect on rRNA gene dosage of transforming T.thermophila macronuclei with plasmid constructs containing a pair of tandemly repeated rDNA replication origin regions unlinked to the rRNA gene. A significant proportion of the plasmid sequences were maintained as high copy circular molecules, eventually consisting solely of tandem arrays of origin regions. As reported previously for cells transformed by a construct in which the same tandem rDNA origins were linked to the rRNA gene [Yu, G.-L. and Blackburn, E. H. (1990) Mol. Cell. Biol., 10, 2070-2080], origin sequences recombined to form linear molecules bearing several tandem repeats of the origin region, as well as rRNA genes. The total number of rDNA origin sequences eventually exceeded rRNA gene copies by approximately 20- to 40-fold and the number of circular replicons carrying only rDNA origin sequences exceeded rRNA gene copies by 2- to 3-fold. However, the rRNA gene dosage was unchanged. Hence, simply monitoring the total number of rDNA origin regions is not sufficient to regulate rRNA gene copy number. Images PMID:7784211

Multilocus sequence analysis of Echinococcus granulosus strains isolated from humans and animals in Iran.

PubMed

Nikmanesh, Bahram; Mirhendi, Hossein; Mahmoudi, Shahram; Rokni, Mohammad Bagher

2017-12-01

Echinococcus granulosus is now considered a complex consisting of at least four species and ten genotypes. Different molecular targets have been described for molecular characterization of E. granulosus; however, in almost all studies only one or two of the targets have been used, and only limited data is available on the utilization of multiple loci. Therefore, we investigated the genetic diversity among 64 strains isolated from 138 cyst specimens of human and animal isolates, using a set of nuclear and mitochondrial genes; i.e., cytochrome c oxidase subunit 1 (cox1), NADH dehydrogenase subunit 1 (nad1), ATPase subunit 6 (atp6), 12S rRNA (12S), and Actin II (act II). In comparison to the use of molecular reference targets (nad1 + cox1), using singular target (act II or 12S or atp6) yielded lower discriminatory power. Act II and 12S genes could accurately discriminate the G6 genotype, but they were not able to differentiate between G1 and G3 genotypes. As the G1 and G3 genotypes belong to the E. granulosus sensu stricto, low intra-species variation was observed for act II and 12S. The atp6 gene could identify the G3 genotype but could not differentiate G6 and G1 genotypes. Using concatenated sequence of five genes (cox1 + nad1 + atp6 + 12S + act II), genotypes were identified accurately, and markedly higher resolution was obtained in comparison with the use of reference markers (nad1 + cox1) only. Application of multilocus sequence analysis (MLSA) to large-scale studies could provide valuable epidemiological data to make efficient control and management measures for cystic echinococcosis. Copyright © 2017 Elsevier Inc. All rights reserved.

Amino acid sequence of the human fibronectin receptor

PubMed Central

1987-01-01

The amino acid sequence deduced from cDNA of the human placental fibronectin receptor is reported. The receptor is composed of two subunits: an alpha subunit of 1,008 amino acids which is processed into two polypeptides disulfide bonded to one another, and a beta subunit of 778 amino acids. Each subunit has near its COOH terminus a hydrophobic segment. This and other sequence features suggest a structure for the receptor in which the hydrophobic segments serve as transmembrane domains anchoring each subunit to the membrane and dividing each into a large ectodomain and a short cytoplasmic domain. The alpha subunit ectodomain has five sequence elements homologous to consensus Ca2+- binding sites of several calcium-binding proteins, and the beta subunit contains a fourfold repeat strikingly rich in cysteine. The alpha subunit sequence is 46% homologous to the alpha subunit of the vitronectin receptor. The beta subunit is 44% homologous to the human platelet adhesion receptor subunit IIIa and 47% homologous to a leukocyte adhesion receptor beta subunit. The high degree of homology (85%) of the beta subunit with one of the polypeptides of a chicken adhesion receptor complex referred to as integrin complex strongly suggests that the latter polypeptide is the chicken homologue of the fibronectin receptor beta subunit. These receptor subunit homologies define a superfamily of adhesion receptors. The availability of the entire protein sequence for the fibronectin receptor will facilitate studies on the functions of these receptors. PMID:2958481

First detection and molecular characterization of Echinococcus equinus in a mule in Turkey.

PubMed

Simsek, Sami; Cevik, Aydin

2014-10-01

Cystic echinococcosis is a zoonotic disease with a cosmopolital distribution. It is caused by the larval stages (metacestodes) of the parasite Echinococcus granulosus which infects different animal species. In this report, we present a case of E. granulosus infection in a mule and molecular characterization of the cyst. For this purpose parasite material was collected from the liver of a necropsied mule. DNA was isolated and PCR amplification of mitochondrial 12S rRNA as well as partial sequencing of mitochondrial cytochrome c oxidase subunit 1 (mt-CO1) genes were performed. Six unilocular cysts, filled with clear fluid were found in the liver and spleen. All cysts were found to be fertile. The 12S rRNA-PCR did not yield any band while mt-CO1-PCR yielded a 446 bp sized amplification product. Sequence corresponding to mt-CO1 gene was identical to a sequence reported for E. equinus (formerly G4) (Genbank accession number: KC953029). This is the first record of E. equinus as a cause of cystic echinococcosis in a mule in Turkey.

Subtype analysis of Blastocystis sp. isolates from asymptomatic individuals in an urban community in the Philippines

PubMed

Adao, Davin Edric V.; Dela Serna, Ace O.; Belleza, Maria Luz B.; Bolo, Nicole R.; Rivera, Windell L.

2016-10-01

Blastocystis sp. is a commonly reported enteric protistan parasite in faecal specimens with a worldwide distribution afflicting both humans and a wide range of animals. The aim of this study is to characterize the subtypes (STs) of Blastocystis sp. isolates from asymptomatic individuals in an urban community in Pateros, Metro Manila, Philippines. The 600-bp small subunit ribosomal RNA (SSU rRNA) barcoding region of Blastocystis sp. isolates was amplified and sequenced using the primers RD5 and BhRDr. Subtypes were identified by uploading the sequences onto the Basic Local Alignment and Search Tool (BLAST) websites, the Blastocystis Subtype (18S) and Sequence Typing (MLST) Database and by construction of a phylogenetic tree. Twenty-nine (29) out of 35 individuals were detected positive for Blastocystis sp. ST3 is the most common among the three STs detected (65.5%), followed by ST1 (31.0%) and ST4 (3.44%). This study showed that DNA barcoding can serve as a helpful tool to investigate the diversity of Blastocystis sp. in the Philippines.

The mitochondrial genome of the arbuscular mycorrhizal fungus Gigaspora margarita reveals two unsuspected trans-splicing events of group I introns.

PubMed

Pelin, Adrian; Pombert, Jean-François; Salvioli, Alessandra; Bonen, Linda; Bonfante, Paola; Corradi, Nicolas

2012-05-01

• Arbuscular mycorrhizal fungi (AMF) are ubiquitous organisms that benefit ecosystems through the establishment of an association with the roots of most plants: the mycorrhizal symbiosis. Despite their ecological importance, however, these fungi have been poorly studied at the genome level. • In this study, total DNA from the AMF Gigaspora margarita was subjected to a combination of 454 and Illumina sequencing, and the resulting reads were used to assemble its mitochondrial genome de novo. This genome was annotated and compared with those of other relatives to better comprehend the evolution of the AMF lineage. • The mitochondrial genome of G. margarita is unique in many ways, exhibiting a large size (97 kbp) and elevated GC content (45%). This genome also harbors molecular events that were previously unknown to occur in fungal mitochondrial genomes, including trans-splicing of group I introns from two different genes coding for the first subunit of the cytochrome oxidase and for the small subunit of the rRNA. • This study reports the second published genome from an AMF organelle, resulting in relevant DNA sequence information from this poorly studied fungal group, and providing new insights into the frequency, origin and evolution of trans-spliced group I introns found across the mitochondrial genomes of distantly related organisms. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

Isolation of high-quality total RNA from rumen anaerobic bacteria and fungi, and subsequent detection of glycoside hydrolases.

PubMed

Wang, Pan; Qi, Meng; Barboza, Perry; Leigh, Mary Beth; Ungerfeld, Emilio; Selinger, L Brent; McAllister, Tim A; Forster, Robert J

2011-07-01

The rumen is one of the most powerful fibrolytic fermentation systems known. Gene expression analyses, such as reverse transcription PCR (RT-PCR), microarrays, and metatranscriptomics, are techniques that could significantly expand our understanding of this ecosystem. The ability to isolate and stabilize representative RNA samples is critical to obtaining reliable results with these procedures. In this study, we successfully isolated high-quality total RNA from the solid phase of ruminal contents by using an improved RNA extraction method. This method is based on liquid nitrogen grinding of whole ruminal solids without microbial detachment and acid guanidinium - phenol - chloroform extraction combined with column purification. Yields of total RNA were as high as 150 µg per g of fresh ruminal content. The typical large subunit/small subunit rRNA ratio ranged from 1.8 to 2.0 with an RNA integrity number (Agilent Technologies) greater than 8.5. By eliminating the detachment step, the resulting RNA was more representative of the complete ecosystem. Our improved method removed a major barrier limiting analysis of rumen microbial function from a gene expression perspective. The polyA-tailed eukaryotic mRNAs obtained have successfully been applied to next-generation sequencing, and metatranscriptomic analysis of the solid fraction of rumen contents revealed abundant sequences related to rumen fungi.

Sequence analysis of dolphin ferritin H and L subunits and possible iron-dependent translational control of dolphin ferritin gene

PubMed Central

Takaesu, Azusa; Watanabe, Kiyotaka; Takai, Shinji; Sasaki, Yukako; Orino, Koichi

2008-01-01

Background Iron-storage protein, ferritin plays a central role in iron metabolism. Ferritin has dual function to store iron and segregate iron for protection of iron-catalyzed reactive oxygen species. Tissue ferritin is composed of two kinds of subunits (H: heavy chain or heart-type subunit; L: light chain or liver-type subunit). Ferritin gene expression is controlled at translational level in iron-dependent manner or at transcriptional level in iron-independent manner. However, sequencing analysis of marine mammalian ferritin subunits has not yet been performed fully. The purpose of this study is to reveal cDNA-derived amino acid sequences of cetacean ferritin H and L subunits, and demonstrate the possibility of expression of these subunits, especially H subunit, by iron. Methods Sequence analyses of cetacean ferritin H and L subunits were performed by direct sequencing of polymerase chain reaction (PCR) fragments from cDNAs generated via reverse transcription-PCR of leukocyte total RNA prepared from blood samples of six different dolphin species (Pseudorca crassidens, Lagenorhynchus obliquidens, Grampus griseus, Globicephala macrorhynchus, Tursiops truncatus, and Delphinapterus leucas). The putative iron-responsive element sequence in the 5'-untranslated region of the six different dolphin species was revealed by direct sequencing of PCR fragments obtained using leukocyte genomic DNA. Results Dolphin H and L subunits consist of 182 and 174 amino acids, respectively, and amino acid sequence identities of ferritin subunits among these dolphins are highly conserved (H: 99–100%, (99→98) ; L: 98–100%). The conserved 28 bp IRE sequence was located -144 bp upstream from the initiation codon in the six different dolphin species. Conclusion These results indicate that six different dolphin species have conserved ferritin sequences, and suggest that these genes are iron-dependently expressed. PMID:18954429

Zygosaccharomyces favi sp. nov., an obligate osmophilic yeast species from bee bread and honey.

PubMed

Čadež, Neža; Fülöp, László; Dlauchy, Dénes; Péter, Gábor

2015-03-01

Five yeast strains representing a hitherto undescribed yeast species were isolated from bee bread and honey in Hungary. They are obligate osmophilic, i.e. they are unable to grow in/on high water activity culture media. Following isogamous conjugation, they form 1-4 spheroid or subspheroid ascospores in persistent asci. The analysis of the sequences of their large subunit rRNA gene D1/D2 domain placed the new species in the Zygosaccharomyces clade. In terms of pairwise sequence similarity, Zygosaccharomyces gambellarensis is the most closely related species. Comparisons of D1/D2, internal transcribed spacer and translation elongation factor-1α (EF-1α) gene sequences of the five strains with that of the type strain of Z. gambellarensis revealed that they represent a new yeast species. The name Zygosaccharomyces favi sp. nov. (type strain: NCAIM Y.01994(T) = CBS 13653(T) = NRRL Y-63719(T) = ZIM 2551(T)) is proposed for this new yeast species, which based on phenotype can be distinguished from related Zygosaccharomyces species by its obligate osmophilic nature. Some intragenomic sequence variability, mainly indels, was detected among the ITS copies of the strains of the new species.

Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

PubMed

Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

2016-12-01

Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

Reconsideration of systematic relationships within the order Euplotida (Protista, Ciliophora) using new sequences of the gene coding for small-subunit rRNA and testing the use of combined data sets to construct phylogenies of the Diophrys-complex.

PubMed

Yi, Zhenzhen; Song, Weibo; Clamp, John C; Chen, Zigui; Gao, Shan; Zhang, Qianqian

2009-03-01

Comprehensive molecular analyses of phylogenetic relationships within euplotid ciliates are relatively rare, and the relationships among some families remain questionable. We performed phylogenetic analyses of the order Euplotida based on new sequences of the gene coding for small-subunit RNA (SSrRNA) from a variety of taxa across the entire order as well as sequences from some of these taxa of other genes (ITS1-5.8S-ITS2 region and histone H4) that have not been included in previous analyses. Phylogenetic trees based on SSrRNA gene sequences constructed with four different methods had a consistent branching pattern that included the following features: (1) the "typical" euplotids comprised a paraphyletic assemblage composed of two divergent clades (family Uronychiidae and families Euplotidae-Certesiidae-Aspidiscidae-Gastrocirrhidae), (2) in the family Uronychiidae, the genera Uronychia and Paradiophrys formed a clearly outlined, well-supported clade that seemed to be rather divergent from Diophrys and Diophryopsis, suggesting that the Diophrys-complex may have had a longer and more separate evolutionary history than previously supposed, (3) inclusion of 12 new SSrRNA sequences in analyses of Euplotidae revealed two new clades of species within the family and cast additional doubt on the present classification of genera within the family, and (4) the intraspecific divergence among five species of Aspidisca was far greater than those of closely related genera. The ITS1-5.8S-ITS2 coding regions and partial histone H4 genes of six morphospecies in the Diophrys-complex were sequenced along with their SSrRNA genes and used to compare phylogenies constructed from single data sets to those constructed from combined sets. Results indicated that combined analyses could be used to construct more reliable, less ambiguous phylogenies of complex groups like the order Euplotida, because they provide a greater amount and diversity of information.

Microbial Composition of Near-Boiling Silica-Depositing Thermal Springs throughout Yellowstone National Park

PubMed Central

Blank, Carrine E.; Cady, Sherry L.; Pace, Norman R.

2002-01-01

The extent of hyperthermophilic microbial diversity associated with siliceous sinter (geyserite) was characterized in seven near-boiling silica-depositing springs throughout Yellowstone National Park using environmental PCR amplification of small-subunit rRNA genes (SSU rDNA), large-subunit rDNA, and the internal transcribed spacer (ITS). We found that Thermocrinis ruber, a member of the order Aquificales, is ubiquitous, an indication that primary production in these springs is driven by hydrogen oxidation. Several other lineages with no known close relatives were identified that branch among the hyperthermophilic bacteria. Although they all branch deep in the bacterial tree, the precise phylogenetic placement of many of these lineages is unresolved at this time. While some springs contained a fair amount of phylogenetic diversity, others did not. Within the same spring, communities in the subaqueous environment were not appreciably different than those in the splash zone at the edge of the pool, although a greater number of phylotypes was found along the pool's edge. Also, microbial community composition appeared to have little correlation with the type of sinter morphology. The number of cell morphotypes identified by fluorescence in situ hybridization and scanning electron microscopy was greater than the number of phylotypes in SSU clone libraries. Despite little variation in Thermocrinis ruber SSU sequences, abundant variation was found in the hypervariable ITS region. The distribution of ITS sequence types appeared to be correlated with distinct morphotypes of Thermocrinis ruber in different pools. Therefore, species- or subspecies-level divergences are present but not detectable in highly conserved SSU sequences. PMID:12324363

Lactobacillus herbarum sp. nov., a species related to Lactobacillus plantarum.

PubMed

Mao, Yuejian; Chen, Meng; Horvath, Philippe

2015-12-01

Strain TCF032-E4 was isolated from a traditional Chinese fermented radish. It shares >99% 16S rRNA sequence identity with L. plantarum, L. pentosus and L. paraplantarum. This strain can ferment ribose, galactose, glucose, fructose, mannose, mannitol, N-acetylglucosamine, amygdalin, arbutin, salicin, cellobiose, maltose, lactose, melibiose, trehalose and gentiobiose. It cannot ferment sucrose, which can be used by L. pentosus, L. paraplantarum, L. fabifermentans, L. xiangfangensis and L. mudanjiangensis, as well as most of the L. plantarum strains (88.7%). TCF032-E4 cannot grow at temperature above 32 °C. This strain shares 78.2-83.6% pheS (phenylalanyl-tRNA synthetase alpha subunit) and 89.5-94.9% rpoA (RNA polymerase alpha subunit) sequence identity with L. plantarum, L. pentosus, L. paraplantarum, L. fabifermentans, L. xiangfangensis and L. mudanjiangensis. These results indicate that TCF032-E4 represents a distinct species. This hypothesis was further confirmed by whole-genome sequencing and comparison with available genomes of related species. The draft genome size of TCF032-E4 is approximately 2.9 Mb, with a DNA G+C content of 43.5 mol%. The average nucleotide identity (ANI) between TCF032-E4 and related species ranges from 79.0 to 81.1%, the highest ANI value being observed with L. plantarum subsp. plantarum ATCC 14917T. A novel species, Lactobacillus herbarum sp. nov., is proposed with TCF032-E4T ( = CCTCC AB2015090T = DSM 100358T) as the type strain.

[Phylogenetic analysis of closely related Leuconostoc citreum species based on partial housekeeping genes].

PubMed

Lv, Qiang; Chen, Ming; Xu, Haiyan; Song, Yuqin; Sun, Zhihong; Dan, Tong; Sun, Tiansong

2013-07-04

Using the 16S rRNA, dnaA, murC and pyrG gene sequences, we identified the phylogenetic relationship among closely related Leuconostoc citreum species. Seven Leu. citreum strains originally isolated from sourdough were characterized by PCR methods to amplify the dnaA, murC and pyrG gene sequences, which were determined to assess the suitability as phylogenetic markers. Then, we estimated the genetic distance and constructed the phylogenetic trees including 16S rRNA and above mentioned three housekeeping genes combining with published corresponding sequences. By comparing the phylogenetic trees, the topology of three housekeeping genes trees were consistent with that of 16S rRNA gene. The homology of closely related Leu. citreum species among dnaA, murC, pyrG and 16S rRNA gene sequences were different, ranged from75.5% to 97.2%, 50.2% to 99.7%, 65.0% to 99.8% and 98.5% 100%, respectively. The phylogenetic relationship of three housekeeping genes sequences were highly consistent with the results of 16S rRNA gene sequence, while the genetic distance of these housekeeping genes were extremely high than 16S rRNA gene. Consequently, the dnaA, murC and pyrG gene are suitable for classification and identification closely related Leu. citreum species.

Common 5S rRNA variants are likely to be accepted in many sequence contexts

NASA Technical Reports Server (NTRS)

Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

2003-01-01

Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The results demonstrate that changes that occur multiple times in a local region of RNA sequence space in fact usually will be accepted in any sequence context in that same local region.

Candida sanyaensis sp. nov., an ascomycetous yeast species isolated from soil.

PubMed

Hui, Feng-Li; Niu, Qiu-Hong; Ke, Tao; Li, Ying-Xia; Lee, Ching-Fu

2013-01-01

Strains representing a novel ascomycetous yeast species, Candida sanyaensis, were isolated from soil samples collected on Hainan Island and Taiwan Island in China. Analysis of the D1/D2 domains of the large subunit (LUS) rRNA gene and internal transcribed spacer (ITS) regions of these strains showed that this species was related to Candida tropicalis and Candida sojae, their closest relatives. C. sanyaensis differed by three substitutions and one gap from C. tropicalis, and by four substitutions and one gap from C. sojae, in the D1/D2 domain sequences. However, the ITS sequences of C. sanyaensis were quite divergent from the latter two species, showing that it is a genetically separate species. The novel strains were also found to have very similar PCR-fingerprinting profiles which were quite distinct from those of C. tropicalis and C. sojae strains. The type strain of C. sanyaensis is HN-26(T) (= CICC 1979(T) = CBS 12637(T)).

Candida ecuadorensis sp. nov., an ascomycetous yeast species found in two separate regions of Ecuador.

PubMed

James, Stephen A; Carvajal Barriga, Enrique Javier; Barahona, Patricia Portero; Cross, Kathryn; Bond, Christopher J; Roberts, Ian N

2013-01-01

In the course of an on-going study aimed at cataloguing the natural yeast biodiversity found in Ecuador, two strains (CLQCA 13-025 and CLQCA 20-004(T)) were isolated from samples of cow manure and rotten wood collected in two separate provinces of the country (Orellana and Bolívar). These strains were found to represent a novel yeast species based on the sequences of their D1/D2 domain of the large-subunit (LSU) rRNA gene and their physiological characteristics. Phylogenetic analysis based on LSU D1/D2 sequences revealed this novel species to belong to the Metschnikowia clade and to be most closely related to Candida suratensis, a species recently discovered in a mangrove forest in Thailand. The species name of Candida ecuadorensis sp. nov. is proposed to accommodate these strains, with strain CLQCA 20-004(T) (=CBS 12653(T) = NCYC 3782(T)) designated as the type strain.

Candida ficus sp. nov., a novel yeast species from the gut of Apriona germari larvae.

PubMed

Hui, Feng-Li; Niu, Qiu-Hong; Ke, Tao; Liu, Zheng

2012-11-01

A novel yeast species is described based on three strains from the gut of wood-boring larvae collected in a tree trunk of Ficus carica cultivated in parks near Nanyang, central China. Phylogenetic analysis based on sequences of the D1/D2 domains of the large subunit rRNA gene showed that these strains occurred in a separate clade that was genetically distinct from all known ascomycetous yeasts. In terms of pairwise sequence divergence, the novel strains differed by 15.3% divergence from the type strain of Pichia terricola, and by 15.8% divergence from the type strains of Pichia exigua and Candida rugopelliculosa in the D1/D2 domains. All three are ascomycetous yeasts in the Pichia clade. Unlike P. terricola, P. exigua and C. rugopelliculosa, the novel isolates did not ferment glucose. The name Candida ficus sp. nov. is proposed to accommodate these highly divergent organisms, with STN-8(T) (=CICC 1980(T)=CBS 12638(T)) as the type strain.

Pond Crash Forensics: Presumptive identification of pond crash agents by next generation sequencing in replicate raceway mass cultures of Nannochloropsis salina

DOE PAGES

Carney, Laura T.; Wilkenfeld, Joshua S.; Lane, Pam D.; ...

2016-06-02

Productivity of algal mass culture can be severely reduced by contaminating organisms. It is, therefore, important to identify contaminants, determine their effect on productivity and, ultimately, develop countermeasures against such contamination. In this paper, we utilized microbiome analysis by second-generation sequencing of small subunit rRNA genes to characterize the predator and pathogen burden of open raceway cultures of Nannochloropsis salina. Samples were analyzed from replicate raceways before and after crashes. In one culture cycle, we identified two algivorous species, the rotifer Brachionus and gastrotrich Chaetonotus, the presence of which may have contributed to the loss of algal biomass. In themore » second culture cycle, the raceways were treated with hypochlorite in an unsuccessful attempt to interdict the crash. Finally, our analyses were shown to be an effective strategy for the identification of the biological contaminants and the characterization of intervention strategies.« less

Three novel ascomycetous yeast species of the Kazachstania clade, Kazachstania saulgeensis sp. nov., Kazachstaniaserrabonitensis sp. nov. and Kazachstania australis sp. nov. Reassignment of Candida humilis to Kazachstania humilis f.a. comb. nov. and Candida pseudohumilis to Kazachstania pseudohumilis f.a. comb. nov.

PubMed

Jacques, Noémie; Sarilar, Véronique; Urien, Charlotte; Lopes, Mariana R; Morais, Camila G; Uetanabaro, Ana Paula T; Tinsley, Colin R; Rosa, Carlos A; Sicard, Delphine; Casaregola, Serge

2016-12-01

Five ascosporogenous yeast strains related to the genus Kazachstania were isolated. Two strains (CLIB 1764T and CLIB 1780) were isolated from French sourdoughs; three others (UFMG-CM-Y273T, UFMG-CM-Y451 and UFMG-CM-Y452) were from rotting wood in Brazil. The sequences of the French and Brazilian strains differed by one and three substitutions, respectively, in the D1/D2 large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS). The D1/D2 LSU rRNA sequence of these strains differed by 0.5 and 0.7 % from Kazachstania exigua, but their ITS sequences diverged by 8.1 and 8.3 %, respectively, from that of the closest described species Kazachstania barnettii. Analysis of protein coding sequences of RPB1, RPB2 and EF-1α distinguished the French from the Brazilian strains, with respectively 3.3, 6 and 11.7 % substitutions. Two novel species are described to accommodate these newly isolated strains: Kazachstania saulgeensis sp. nov. (type strain CLIB 1764T=CBS 14374T) and Kazachstania serrabonitensis sp. nov. (type strain UFMG-CM-Y273T=CLIB 1783T=CBS 14236T). Further analysis of culture collections revealed a strain previously assigned to the K. exigua species, but having 3.8 % difference (22 substitutions and 2 indels) in its ITS with respect to K. exigua. Hence, we describe a new taxon, Kazachstania australis sp. nov. (type strain CLIB 162T=CBS 2141T), to accommodate this strain. Finally, Candida humilis and Candida pseudohumilis are reassigned to the genus Kazachstania as new combinations. On the basis of sequence analysis, we also propose that Candida milleri and Kazachstania humilis comb. nov. are conspecific.

Horizontal Transfer of Segments of the 16S rRNA Genes between Species of the Streptococcus anginosus Group

PubMed Central

Schouls, Leo M.; Schot, Corrie S.; Jacobs, Jan A.

2003-01-01

The nature in variation of the 16S rRNA gene of members of the Streptococcus anginosus group was investigated by hybridization and DNA sequencing. A collection of 708 strains was analyzed by reverse line blot hybridization. This revealed the presence of distinct reaction patterns representing 11 different hybridization groups. The 16S rRNA genes of two strains of each hybridization group were sequenced to near-completion, and the sequence data confirmed the reverse line blot hybridization results. Closer inspection of the sequences revealed mosaic-like structures, strongly suggesting horizontal transfer of segments of the 16S rRNA gene between different species belonging to the Streptococcus anginosus group. Southern blot hybridization further showed that within a single strain all copies of the 16S rRNA gene had the same composition, indicating that the apparent mosaic structures were not PCR-induced artifacts. These findings indicate that the highly conserved rRNA genes are also subject to recombination and that these events may be fixed in the population. Such recombination may lead to the construction of incorrect phylogenetic trees based on the 16S rRNA genes. PMID:14645285

An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

PubMed

Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M

2009-10-19

Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

NASA Technical Reports Server (NTRS)

Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

1976-01-01

Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

Large-scale parallel 454 sequencing reveals host ecological group specificity of arbuscular mycorrhizal fungi in a boreonemoral forest.

PubMed

Opik, M; Metsis, M; Daniell, T J; Zobel, M; Moora, M

2009-10-01

* Knowledge of the diversity of arbuscular mycorrhizal fungi (AMF) in natural ecosystems is a major bottleneck in mycorrhizal ecology. Here, we aimed to apply 454 sequencing--providing a new level of descriptive power--to assess the AMF diversity in a boreonemoral forest. * 454 sequencing reads of the small subunit ribosomal RNA (SSU rRNA) gene of Glomeromycota were assigned to sequence groups by blast searches against a custom-made annotated sequence database. * We detected 47 AMF taxa in the roots of 10 plant species in a 10 x 10 m plot, which is almost the same as the number of plant species in the whole studied forest. There was a significant difference between AMF communities in the roots of forest specialist plant species and in the roots of habitat generalist plant species. Forest plant species hosted 22 specialist AMF taxa, and the generalist plants shared all but one AMF taxon with forest plants, including globally distributed generalist fungi. These AMF taxa that have been globally recorded only in forest ecosystems were significantly over-represented in the roots of forest plant species. * Our findings suggest that partner specificity in AM symbiosis may occur at the level of ecological groups, rather than at the species level, of both plant and fungal partners.

Evaluation of 16S Rrna amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

USDA-ARS?s Scientific Manuscript database

Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

USDA-ARS?s Scientific Manuscript database

Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

Secondary structure prediction for complete rDNA sequences (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, and comparison of divergent domains structures across Acari.

PubMed

Zhao, Ya-E; Wang, Zheng-Hang; Xu, Yang; Wu, Li-Ping; Hu, Li

2013-10-01

According to base pairing, the rRNA folds into corresponding secondary structures, which contain additional phylogenetic information. On the basis of sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2 and 28S rDNA) of Demodex, we predicted the secondary structure of the complete rDNA sequence (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, which was in concordance with that of the main arthropod lineages in past studies. And together with the sequence data from GenBank, we also predicted the secondary structures of divergent domains in SSU rRNA of 51 species and in LSU rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea and Ixodoidea). The multiple alignment among the four superfamilies in Acari showed that, insertions from Tetranychoidea SSU rRNA formed two newly proposed helixes, and helix c3-2b of LSU rRNA was absent in Demodex (Cheyletoidea) taxa. Generally speaking, LSU rRNA presented more remarkable differences than SSU rRNA did, mainly in D2, D3, D5, D7a, D7b, D8 and D10. Copyright © 2013 Elsevier Inc. All rights reserved.

Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

PubMed

Tan, M K

1991-08-01

A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

Microbial and functional diversity of a subterrestrial high pH groundwater associated to serpentinization.

PubMed

Tiago, Igor; Veríssimo, António

2013-06-01

Microbial and functional diversity were assessed, from a serpentinization-driven subterrestrial alkaline aquifer - Cabeço de Vide Aquifer (CVA) in Portugal. DGGE analyses revealed the presence of a stable microbial community. By 16S rRNA gene libraries and pyrosequencing analyses, a diverse bacterial composition was determined, contrasting with low archaeal diversity. Within Bacteria the majority of the populations were related to organisms or sequences affiliated to class Clostridia, but members of classes Acidobacteria, Actinobacteria, Alphaproteobacteria, Betaproteobacteria, Deinococci, Gammaproteobacteria and of the phyla Bacteroidetes, Chloroflexi and Nitrospira were also detected. Domain Archaea encompassed mainly sequences affiliated to Euryarchaeota. Only form I RuBisCO - cbbL was detected. Autotrophic carbon fixation via the rTCA, 3-HP and 3-HP/4H-B cycles could not be confirmed. The detected APS reductase alpha subunit - aprA sequences were phylogenetically related to sequences of sulfate-reducing bacteria belonging to Clostridia, and also to sequences of chemolithoautothrophic sulfur-oxidizing bacteria belonging to Betaproteobacteria. Sequences of methyl coenzyme M reductase - mcrA were phylogenetically affiliated to sequences belonging to Anaerobic Methanotroph group 1 (ANME-1). The populations found and the functional key markers detected in CVA suggest that metabolisms related to H2 , methane and/or sulfur may be the major driving forces in this environment. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

[Tracing investigation and diagnosis of one transfusion-transmitted malaria case in Zhejiang Province].

PubMed

Ruan, Wei; Lei, Yong-Liang; Yao, Li-Nong; Zhang, Ling-Ling; Liu, Xiao-Hong; Xiang, Xiao-Qing; Mei, Jian-Hua; Zhu, Hai-Bo; Yu, Yang; Zeng, Chang-You

2014-02-01

To identify the sources of infection and the mode of transmission of a malaria case with unknown origin. Clinical data of the case were collected and the epidemiological investigation was conducted. The blood samples of the patient and the suspected infection source (blood donor) were detected by microscopy, rapid diagnostic test strip (RDT) and nested PCR. The patient did not visited malaria endemic areas. After a blood transfusion, the patient had chills and fever, and was confirmed as falciparum malaria by microscopy with bone marrow and peripheral blood smears and RDT. The blood donor was a worker returned from Africa. Before blood donation she was sick like malaria carrier, and took anti-malarial drug. She was then confirmed as falciparum malaria by RDT and microscopy. The blood samples from the patient and the blood donor were diagnosed as falciparum malaria by nested PCR, and the similarity of the small subunit rRNA (SSU rRNA) sequence was 100%, showing they were mix-infected with K1 and MAD20 genotypes of Plasmodium falciparum. This patient is confirmed P. falciparum infection via blood transfusion from a donor who returned from Africa.

Morphological and molecular characterization of Eurytrema cladorchis parasitizing cattle (Bos indicus) in Bangladesh.

PubMed

Mohanta, Uday Kumar; Ichikawa-Seki, Madoka; Hayashi, Kei; Itagaki, Tadashi

2015-06-01

There is always controversy regarding identification of different species in the genus Eurytrema. Identification has been based mainly on morphology, which can be misleading and subject to differing interpretation among the scientists. Therefore, the aim of this study was to identify Eurytrema flukes both by morphology and molecular properties on the basis of 18-subunit ribosomal RNA (18S rRNA) gene as well as internal transcribed spacer 2 (ITS2) to clarify their phylogenetic status. Among six different agroecological areas of Bangladesh, 22 Eurytrema flukes were recovered from the bile ducts of 22 cattle in Bandarban, a hill district. The flukes were identified as Eurytrema cladorchis through morphometric and morphological studies. Phylogenetic analyses were conducted by neighbor-joining phylogram inferred from both 18S rRNA (1784 bp) gene and ITS2 (229 bp) sequences. A monophyletic clade was constructed by the E. cladorchis from Bangladesh; however, the clade was distinct from those formed by Eurytrema pancreaticum and Eurytrema coelomaticum. This study first described the existence of E. cladorchis from Bangladesh and may provide useful information for both morphological and molecular properties that may further help to clarify phylogenetic relationships within the genus Eurytrema and also for other digeneans.

Developing an Apicomplexan DNA Barcoding System to Detect Blood Parasites of Small Coral Reef Fishes.

PubMed

Renoux, Lance P; Dolan, Maureen C; Cook, Courtney A; Smit, Nico J; Sikkel, Paul C

2017-08-01

Apicomplexan parasites are obligate parasites of many species of vertebrates. To date, there is very limited understanding of these parasites in the most-diverse group of vertebrates, actinopterygian fishes. While DNA barcoding targeting the eukaryotic 18S small subunit rRNA gene sequence has been useful in identifying apicomplexans in tetrapods, identification of apicomplexans infecting fishes has relied solely on morphological identification by microscopy. In this study, a DNA barcoding method was developed that targets the 18S rRNA gene primers for identifying apicomplexans parasitizing certain actinopterygian fishes. A lead primer set was selected showing no cross-reactivity to the overwhelming abundant host DNA and successfully confirmed 37 of the 41 (90.2%) microscopically verified parasitized fish blood samples analyzed in this study. Furthermore, this DNA barcoding method identified 4 additional samples that screened negative for parasitemia, suggesting this molecular method may provide improved sensitivity over morphological characterization by microscopy. In addition, this PCR screening method for fish apicomplexans, using Whatman FTA preserved DNA, was tested in efforts leading to a more simplified field collection, transport, and sample storage method as well as a streamlining sample processing important for DNA barcoding of large sample sets.

The Centipede Genus Scolopendra in Mainland Southeast Asia: Molecular Phylogenetics, Geometric Morphometrics and External Morphology as Tools for Species Delimitation

PubMed Central

Siriwut, Warut; Edgecombe, Gregory D.; Sutcharit, Chirasak; Panha, Somsak

2015-01-01

Seven Scolopendra species from the Southeast Asian mainland delimited based on standard external morphological characters represent monophyletic groups in phylogenetic trees inferred from concatenated sequences of three gene fragments (cytochrome c oxidase subunit 1, 16S rRNA and 28S rRNA) using Maximum likelihood and Bayesian inference. Geometric morphometric description of shape variation in the cephalic plate, forcipular coxosternite, and tergite of the ultimate leg-bearing segment provides additional criteria for distinguishing species. Colouration patterns in some Scolopendra species show a high degree of fit to phylogenetic trees at the population level. The most densely sampled species, Scolopendra dehaani Brandt, 1840, has three subclades with allopatric distributions in mainland SE Asia. The molecular phylogeny of S. pinguis Pocock, 1891, indicated ontogenetic colour variation among its populations. The taxonomic validation of S. dawydoffi Kronmüller, 2012, S. japonica Koch, 1878, and S. dehaani Brandt, 1840, each a former subspecies of S. subspinipes Leach, 1814 sensu Lewis, 2010, as full species was supported by molecular information and additional morphological data. Species delimitation in these taxonomically challenging animals is facilitated by an integrative approach that draws on both morphology and molecular phylogeny. PMID:26270342

Microbial life in Champagne Pool, a geothermal spring in Waiotapu, New Zealand.

PubMed

Hetzer, Adrian; Morgan, Hugh W; McDonald, Ian R; Daughney, Christopher J

2007-07-01

Surveys of Champagne Pool, one of New Zealand's largest terrestrial hot springs and rich in arsenic ions and compounds, have been restricted to geological and geochemical descriptions, and a few microbiological studies applying culture-independent methods. In the current investigation, a combination of culture and culture-independent approaches were chosen to determine microbial density and diversity in Champagne Pool. Recovered total DNA and adenosine 5'-triphosphate (ATP) content of spring water revealed relatively low values compared to other geothermal springs within New Zealand and are in good agreement with low cell numbers of 5.6 +/- 0.5 x 10(6) cells/ml obtained for Champagne Pool water samples by 4',6-diamidino-2-phenylindole (DAPI) staining. Denaturing Gradient Gel Electrophoresis (DGGE) and 16S rRNA (small-subunit ribosomal nucleic acid) gene clone library analyses of environmental DNA indicated the abundance of Sulfurihydrogenibium, Sulfolobus, and Thermofilum-like populations in Champagne Pool. From these results, media were selected to target the enrichment of hydrogen-oxidizing and sulfur-dependent microorganisms. Three isolates were successfully obtained having 16S rRNA gene sequences with similarities of approximately 98% to Thermoanaerobacter tengcongensis, 94% to Sulfurihydrogenibium azorense, and 99% to Thermococcus waiotapuensis, respectively.

Distribution of cultivated and uncultivated cyanobacteria and Chloroflexus-like bacteria in hot spring microbial mats

NASA Technical Reports Server (NTRS)

Ruff-Roberts, A. L.; Kuenen, J. G.; Ward, D. M.

1994-01-01

Oligodeoxynucleotide hybridization probes were developed to complement specific regions of the small subunit (SSU) rRNA sequences of cultivated and uncultivated cyanobacteria and Chloroflexus-like bacteria, which inhabit hot spring microbial mats. The probes were used to investigate the natural distribution of SSU rRNAs from these species in mats of Yellowstone hot springs of different temperatures and pHs as well as changes in SSU rRNA distribution resulting from 1-week in situ shifts in temperature, pH, and light intensity. Synechococcus lividus Y-7c-s SSU rRNA was detected only in the mat of a slightly acid spring, from which it may have been initially isolated, or when samples from a more alkaline spring were incubated in the more acid spring. Chloroflexus aurantiacus Y-400-fl SSU rRNA was detected only in a high-temperature mat sample from the alkaline Octopus Spring or when lower-temperature samples from this mat were incubated at the high-temperature site. SSU rRNAs of uncultivated species were more widely distributed. Temperature distributions and responses to in situ temperature shifts suggested that some of the uncultivated cyanobacteria might be adapted to high-, moderate-, and low-temperature ranges whereas an uncultivated Chloroflexus-like bacterium appears to have broad temperature tolerance. SSU rRNAs of all uncultivated species inhabiting a 48 to 51 degrees C Octopus Spring mat site were most abundant in the upper 1 mm and were not detected below a 2.5-to 3.5-mm depth, a finding consistent with their possible phototrophic nature. However, the effects of light intensity reduction on these SSU rRNAs were variable, indicating the difficulty of demonstrating a phototrophic phenotype in light reduction experiments.

Quantitative Detection of the nosZ Gene, Encoding Nitrous Oxide Reductase, and Comparison of the Abundances of 16S rRNA, narG, nirK, and nosZ Genes in Soils

PubMed Central

Henry, S.; Bru, D.; Stres, B.; Hallet, S.; Philippot, L.

2006-01-01

Nitrous oxide (N2O) is an important greenhouse gas in the troposphere controlling ozone concentration in the stratosphere through nitric oxide production. In order to quantify bacteria capable of N2O reduction, we developed a SYBR green quantitative real-time PCR assay targeting the nosZ gene encoding the catalytic subunit of the nitrous oxide reductase. Two independent sets of nosZ primers flanking the nosZ fragment previously used in diversity studies were designed and tested (K. Kloos, A. Mergel, C. Rösch, and H. Bothe, Aust. J. Plant Physiol. 28:991-998, 2001). The utility of these real-time PCR assays was demonstrated by quantifying the nosZ gene present in six different soils. Detection limits were between 101 and 102 target molecules per reaction for all assays. Sequence analysis of 128 cloned quantitative PCR products confirmed the specificity of the designed primers. The abundance of nosZ genes ranged from 105 to 107 target copies g−1 of dry soil, whereas genes for 16S rRNA were found at 108 to 109 target copies g−1 of dry soil. The abundance of narG and nirK genes was within the upper and lower limits of the 16S rRNA and nosZ gene copy numbers. The two sets of nosZ primers gave similar gene copy numbers for all tested soils. The maximum abundance of nosZ and nirK relative to 16S rRNA was 5 to 6%, confirming the low proportion of denitrifiers to total bacteria in soils. PMID:16885263

FunGene: the functional gene pipeline and repository.

PubMed

Fish, Jordan A; Chai, Benli; Wang, Qiong; Sun, Yanni; Brown, C Titus; Tiedje, James M; Cole, James R

2013-01-01

Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer. While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/) offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.

Candida uthaithanina sp. nov., an anamorphic yeast species in Nakaseomyces clade isolated in Thailand.

PubMed

Limtong, Savitree; Jindamorakot, Sasitorn; Am-In, Somjit; Kaewwichian, Rungluk; Nitiyon, Sukanya; Yongmanitchai, Wichien; Nakase, Takashi

2011-05-01

Three yeast stains were isolated from two unknown fruits (strains DD2-22-1(T) and SK44) and moss (strain ST-449) in Thailand. Analysis of the D1/D2 domain of the large subunit (LSU) rRNA gene sequences of the three strains revealed that they belonged to the same species. In terms of pairwise sequence similarity, Candida cf. glabrata UWO(PS) 98-110.4 and Candida nivariensis were the closest undescribed and recognized taxa, but the levels of nucleotide substitutions were 1.7-1.9% and 2.0-2.2%, respectively. The levels of nucleotide substitutions were sufficient to justify the description of a separate species of Candida. In the phylogenetic tree based on the D1/D2 domain of the LSU rRNA gene the three strains were placed in a separate branch in the Nakaseomyces clade with C. cf. glabrata UWO(PS)98-110.4, C. nivariensis, Candida glabrata, Candida bracarensis, Candida kungkrabaensis and Nakaseomyces delphensis. Phenotypic characteristics of the three strains were similar which included proliferation by multilateral budding, absence of ascospores, arthrospores or ballistospores; negative for Diazonium blue B and urease tests. The major ubiquinone was Q-6. On the basis of the above findings, the three strains were assigned to a single novel species of Candida, for which the name Candida uthaithanina sp. nov is proposed. The type strain is DD2-22-1(T) (= BCC 29899(T) = NBRC 104876(T) = CBS 10932(T)).

Candida kantuleensis sp. nov., a d-xylose-fermenting yeast species isolated from peat in a tropical peat swamp forest.

PubMed

Nitiyon, Sukanya; Khunnamwong, Pannida; Lertwattanasakul, Noppon; Limtong, Savitree

2018-05-24

Three strains (DMKU-XE11 T , DMKU-XE15 and DMKU-XE20) representing a single novel anamorphic and d-xylose-fermenting yeast species were obtained from three peat samples collected from Khan Thulee peat swamp forest in Surat Thani province, Thailand. The strains differed from each other by one to two nucleotide substitutions in the sequences of the D1/D2 region of the large subunit (LSU) rRNA gene and zero to one nucleotide substitution in the internal transcribed spacer (ITS) region. Phylogenetic analysis based on the combined sequences of the ITS and the D1/D2 regions showed that the three strains represented a single Candida species that was distinct from the other related species in the Lodderomyces/Candida albicans clade. The three strains form a subclade with the other Candida species including Candida sanyaensis, Candida tropicalis and Candida sojae. C. sanyaensis was the most closely related species, with 2.1-2.4 % nucleotide substitutions in the D1/D2 region of the LSU rRNA gene, and 3.8-4.0 % nucleotide substitutions in the ITS region. The three strains (DMKU-XE11 T , DMKU-XE15 and DMKU-XE20) were assigned as a single novel species, which was named Candida kantuleensis sp. nov. The type strain is DMKU-XE11 T (=CBS 15219 T =TBRC 7764 T ). The MycoBank number for C. kantuleensis sp. nov. is MB 824179.

Prevalence of filarioid nematodes and trypanosomes in American robins and house sparrows, Chicago USA☆

PubMed Central

Hamer, Gabriel L.; Anderson, Tavis K.; Berry, Garrett E.; Makohon-Moore, Alvin P.; Crafton, Jeffrey C.; Brawn, Jeffrey D.; Dolinski, Amanda C.; Krebs, Bethany L.; Ruiz, Marilyn O.; Muzzall, Patrick M.; Goldberg, Tony L.; Walker, Edward D.

2012-01-01

Hosts are commonly infected with a suite of parasites, and interactions among these parasites can affect the size, structure, and behavior of host–parasite communities. As an important step to understanding the significance of co-circulating parasites, we describe prevalence of co-circulating hemoparasites in two important avian amplification hosts for West Nile virus (WNV), the American robin (Turdus migratorius) and house sparrow (Passer domesticus), during the 2010–2011 in Chicago, Illinois, USA. Rates of nematode microfilariemia were 1.5% of the robins (n = 70) and 4.2% of the house sparrows (n = 72) collected during the day and 11.1% of the roosting robins (n = 63) and 0% of the house sparrows (n = 11) collected at night. Phylogenetic analysis of nucleotide sequences of the 18S rRNA and cytochrome oxidase subunit I (COI) genes from these parasites resolved two clades of filarioid nematodes. Microscopy revealed that 18.0% of American robins (n = 133) and 16.9% of house sparrows (n = 83) hosted trypanosomes in the blood. Phylogenetic analysis of nucleotide sequences from the 18s rRNA gene revealed that the trypanosomes fall within previously described avian trypanosome clades. These results document hemoparasites in the blood of WNV hosts in a center of endemic WNV transmission, suggesting a potential for direct or indirect interactions with the virus. PMID:24533314

Characterization of Airborne Microbial Communities at a High-Elevation Site and Their Potential To Act as Atmospheric Ice Nuclei▿

PubMed Central

Bowers, Robert M.; Lauber, Christian L.; Wiedinmyer, Christine; Hamady, Micah; Hallar, Anna G.; Fall, Ray; Knight, Rob; Fierer, Noah

2009-01-01

Bacteria and fungi are ubiquitous in the atmosphere. The diversity and abundance of airborne microbes may be strongly influenced by atmospheric conditions or even influence atmospheric conditions themselves by acting as ice nucleators. However, few comprehensive studies have described the diversity and dynamics of airborne bacteria and fungi based on culture-independent techniques. We document atmospheric microbial abundance, community composition, and ice nucleation at a high-elevation site in northwestern Colorado. We used a standard small-subunit rRNA gene Sanger sequencing approach for total microbial community analysis and a bacteria-specific 16S rRNA bar-coded pyrosequencing approach (4,864 sequences total). During the 2-week collection period, total microbial abundances were relatively constant, ranging from 9.6 × 105 to 6.6 × 106 cells m−3 of air, and the diversity and composition of the airborne microbial communities were also relatively static. Bacteria and fungi were nearly equivalent, and members of the proteobacterial groups Burkholderiales and Moraxellaceae (particularly the genus Psychrobacter) were dominant. These taxa were not always the most abundant in freshly fallen snow samples collected at this site. Although there was minimal variability in microbial abundances and composition within the atmosphere, the number of biological ice nuclei increased significantly during periods of high relative humidity. However, these changes in ice nuclei numbers were not associated with changes in the relative abundances of the most commonly studied ice-nucleating bacteria. PMID:19502432

Inhabitancy of active Nitrosopumilus-like ammonia-oxidizing archaea and Nitrospira nitrite-oxidizing bacteria in the sponge Theonella swinhoei

PubMed Central

Feng, Guofang; Sun, Wei; Zhang, Fengli; Karthik, Loganathan; Li, Zhiyong

2016-01-01

Nitrification directly contributes to the ammonia removal in sponges, and it plays an indispensable role in sponge-mediated nitrogen cycle. Previous studies have demonstrated genomic evidences of nitrifying lineages in the sponge Theonella swinhoei. However, little is known about the transcriptional activity of nitrifying community in this sponge. In this study, combined DNA- and transcript-based analyses were performed to reveal the composition and transcriptional activity of the nitrifiers in T. swinhoei from the South China Sea. Transcriptional activity of ammonia-oxidizing archaea (AOA) and nitrite-oxidizing bacteria (NOB) in this sponge were confirmed by targeting their nitrifying genes,16S rRNA genes and their transcripts. Phylogenetic analysis coupled with RDP rRNA classification indicated that archaeal 16S rRNA genes, amoA (the subunit of ammonia monooxygenase) genes and their transcripts were closely related to Nitrosopumilus-like AOA; whereas nitrifying bacterial 16S rRNA genes, nxrB (the subunit of nitrite oxidoreductase) genes and their transcripts were closely related to Nitrospira NOB. Quantitative assessment demonstrated relative higher abundances of nitrifying genes and transcripts of Nitrosopumilus-like AOA than those of Nitrospira NOB in this sponge. This study illustrated the transcriptional potentials of Nitrosopumilus-like archaea and Nitrospira bacteria that would predominantly contribute to the nitrification functionality in the South China Sea T. swinhoei. PMID:27113140

Metabolism of ribosomal proteins microinjected into the oocytes of Xenopus laevis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsurugi, K.; Motizuki, M.; Mitsui, K.

1988-01-01

When the total proteins from Xenopus laevis 60 S ribosomal subunits (TP60) were /sup 3/H-labeled in vitro and injected back into X. laevis oocytes, most /sup 3/H-TP60 are integrated into the cytoplasmic 60 S subunits via the nucleus during 16 h of incubation. In the oocytes whose rRNA synthesis is inhibited, /sup 3/H-TP60 are rapidly degraded with a half-life of 2-3 h. This degradation ceased as soon as rRNA synthesis was resumed, suggesting that ribosomal proteins unassociated with nascent rRNA are unstable in the oocytes. The degradation of /sup 3/H-TP60 in the absence of RNA synthesis was inhibited by iodoacetamide,more » a cysteine protease inhibitor, resulting in the accumulation of /sup 3/H-TP60 in the nucleus reaching about a threefold concentration in the cytoplasm. Considering the results with enucleated oocytes, we suggest that the X. laevis nucleus has a limited capacity to accumulate ribosomal proteins in an active manner but that those ribosomal proteins accumulated in excess over rRNA synthesis are degraded by a cysteine protease in the nucleus. By contrast, ribosomal proteins from Escherichia coli only equilibrate between the nucleus and the cytoplasm and are degraded by serine protease(s) in the cytoplasm without being integrated in the form of ribosomes in the nucleus.« less

Multi-Gene Analysis Reveals a Lack of Genetic Divergence between Calanus agulhensis and C. sinicus (Copepoda; Calanoida)

PubMed Central

Kozol, Robert; Blanco-Bercial, Leocadio; Bucklin, Ann

2012-01-01

The discrimination and taxonomic identification of marine species continues to pose a challenge despite the growing number of diagnostic metrics and approaches. This study examined the genetic relationship between two sibling species of the genus Calanus (Crustacea; Copepoda; Calanidae), C. agulhensis and C. sinicus, using a multi-gene analysis. DNA sequences were determined for portions of the mitochondrial cytochrome c oxidase I (mtCOI); nuclear citrate synthase (CS), and large subunit (28S) rRNA genes for specimens collected from the Sea of Japan and North East (NE) Pacific Ocean for C. sinicus and from the Benguela Current and Agulhas Bank, off South Africa, for C. agulhensis. For mtCOI, C. sinicus and C. agulhensis showed similar levels of haplotype diversity (Hd = 0.695 and 0.660, respectively) and nucleotide diversity (π = 0.003 and 0.002, respectively). Pairwise FST distances for mtCOI were significant only between C. agulhensis collected from the Agulhas and two C. sinicus populations: the Sea of Japan (FST = 0.152, p<0.01) and NE Pacific (FST = 0.228, p<0.005). Between the species, FST distances were low for both mtCOI (FST = 0.083, p = 0.003) and CS (FST = 0.050, p = 0.021). Large subunit (28S) rRNA showed no variation between the species. Our results provide evidence of the lack of genetic distinction of C. sinicus and C. agulhensis, raise questions of whether C. agulhensis warrants status as a distinct species, and indicate the clear need for more intensive and extensive ecological and genetic analysis. PMID:23118849

Phytoplasma phylogenetics based on analysis of secA and 23S rRNA gene sequences for improved resolution of candidate species of 'Candidatus Phytoplasma'.

PubMed

Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Harrison, Nigel; Dickinson, Matthew

2008-08-01

Phytoplasma phylogenetics has focused primarily on sequences of the non-coding 16S rRNA gene and the 16S-23S rRNA intergenic spacer region (16-23S ISR), and primers that enable amplification of these regions from all phytoplasmas by PCR are well established. In this study, primers based on the secA gene have been developed into a semi-nested PCR assay that results in a sequence of the expected size (about 480 bp) from all 34 phytoplasmas examined, including strains representative of 12 16Sr groups. Phylogenetic analysis of secA gene sequences showed similar clustering of phytoplasmas when compared with clusters resolved by similar sequence analyses of a 16-23S ISR-23S rRNA gene contig or of the 16S rRNA gene alone. The main differences between trees were in the branch lengths, which were elongated in the 16-23S ISR-23S rRNA gene tree when compared with the 16S rRNA gene tree and elongated still further in the secA gene tree, despite this being a shorter sequence. The improved resolution in the secA gene-derived phylogenetic tree resulted in the 16SrII group splitting into two distinct clusters, while phytoplasmas associated with coconut lethal yellowing-type diseases split into three distinct groups, thereby supporting past proposals that they represent different candidate species within 'Candidatus Phytoplasma'. The ability to differentiate 16Sr groups and subgroups by virtual RFLP analysis of secA gene sequences suggests that this gene may provide an informative alternative molecular marker for pathogen identification and diagnosis of phytoplasma diseases.

Isolation and identification of multidrug-resistant Staphylococcus haemolyticus from a laboratory-breeding mouse.

PubMed

Huang, Fengying; Meng, Qiuping; Tan, Guanghong; Huang, Yonghao; Wang, Hua; Mei, Wenli; Dai, Haofu

2011-06-01

To analysis and identify a bacterium strain isolated from laboratory breeding mouse far away from a hospital. Phenotype of the isolate was investigated by conventional microbiological methods, including Gram-staining, colony morphology, tests for haemolysis, catalase, coagulase, and antimicrobial susceptibility test. The mecA and 16S rRNA genes were amplified by the polymerase chain reaction (PCR) and sequenced. The base sequence of the PCR product was compared with known 16S rRNA gene sequences in the GenBank database by phylogenetic analysis and multiple sequence alignment. The isolate in this study was a gram positive, coagulase negative, and catalase positive coccus. The isolate was resistant to oxacillin, methicillin, penicillin, ampicillin, cefazolin, ciprofloxacin erythromycin, et al. PCR results indicated that the isolate was mecA gene positive and its 16S rRNA was 1 465 bp. Phylogenetic analysis of the resultant 16S rRNA indicated the isolate belonged to genus Saphylococcus, and multiple sequence alignment showed that the isolate was Saphylococcus haemolyticus with only one base difference from the corresponding 16S rRNA deposited in the GenBank. 16S rRNA gene sequencing is a suitable technique for non-specialist researchers. Laboratory animals are possible sources of lethal pathogens, and researchers must adapt protective measures when they manipulate animals. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

Integrative taxonomy helps to reveal the mask of the genus Gynandropaa (Amphibia: Anura: Dicroglossidae).

PubMed

Huang, Yan; Hu, Junhua; Wang, Bin; Song, Zhaobin; Zhou, Caiquan; Jiang, Jianping

2016-03-01

Species of the genus Gynandropaa within the family Dicroglossidae are typical spiny frogs whose taxonomic status has long been in doubt. We used integrative methods, involving morphological and molecular analyses, to elucidate the phylogenetic relationships, and to determine identities and the geographic distribution of each valid species. We obtained DNA sequence data of 5 species of Gynandropaa (complete sequences of the mitochondrial NADH dehydrogenase subunit 2 [ND2] gene, and 890 bp of 12S rRNA and 16S rRNA partial sequences) from 37 localities (including the topotypes of 5 described species) and constructed Bayesian and maximum-likelihood trees to examine the patterns of phylogeography. A total of 28 morphological variables were taken on 624 specimens. Three clades with clear geographic patterns were recognized: clade C (from south-western Sichuan Province and central Yunnan Province), clade E (western Guizhou Province and eastern to central Yunnan Province) and clade W (western to southern Yunnan Province). Integrating morphological characteristics and distribution information, the clades W, E and C represent Gynandropaa yunnanensis, G. phrynoides and G. sichuanensis, respectively. We draw the following conclusions: (i) the taxon G. phrynoides, formerly evaluated as a junior synonym of G. yunnanensis, is revalidated herein at the rank of species; (ii) G. liui is a junior synonym of G. sichuanensis; and (iii) G. yunnanensis is a valid species while G. bourreti is probably a subspecies of G. yunnanensis, with the distribution range from Vietnam to southern Yunnan Province. This study clears up the taxonomic status of Gynandropaa and provides important information for understanding the evolution and conservation of these spiny frogs. © 2015 International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.

Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

PubMed

Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

2003-01-01

Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

Genome-wide gene order distances support clustering the gram-positive bacteria

PubMed Central

House, Christopher H.; Pellegrini, Matteo; Fitz-Gibbon, Sorel T.

2015-01-01

Initially using 143 genomes, we developed a method for calculating the pair-wise distance between prokaryotic genomes using a Monte Carlo method to estimate the conservation of gene order. The method was based on repeatedly selecting five or six non-adjacent random orthologs from each of two genomes and determining if the chosen orthologs were in the same order. The raw distances were then corrected for gene order convergence using an adaptation of the Jukes-Cantor model, as well as using the common distance correction D′ = −ln(1-D). First, we compared the distances found via the order of six orthologs to distances found based on ortholog gene content and small subunit rRNA sequences. The Jukes-Cantor gene order distances are reasonably well correlated with the divergence of rRNA (R2 = 0.24), especially at rRNA Jukes-Cantor distances of less than 0.2 (R2 = 0.52). Gene content is only weakly correlated with rRNA divergence (R2 = 0.04) over all distances, however, it is especially strongly correlated at rRNA Jukes-Cantor distances of less than 0.1 (R2 = 0.67). This initial work suggests that gene order may be useful in conjunction with other methods to help understand the relatedness of genomes. Using the gene order distances in 143 genomes, the relations of prokaryotes were studied using neighbor joining and agreement subtrees. We then repeated our study of the relations of prokaryotes using gene order in 172 complete genomes better representing a wider-diversity of prokaryotes. Consistently, our trees show the Actinobacteria as a sister group to the bulk of the Firmicutes. In fact, the robustness of gene order support was found to be considerably greater for uniting these two phyla than for uniting any of the proteobacterial classes together. The results are supportive of the idea that Actinobacteria and Firmicutes are closely related, which in turn implies a single origin for the gram-positive cell. PMID:25653643

Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

PubMed

Kamina, Anyango D; Williams, Noreen

2017-01-01

RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP)

PubMed Central

Kamina, Anyango D.; Williams, Noreen

2017-01-01

RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains’ interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP. PMID:28542332

Analysis of early bacterial communities on volcanic deposits on the island of Miyake (Miyake-jima), Japan: a 6-year study at a fixed site.

PubMed

Fujimura, Reiko; Sato, Yoshinori; Nishizawa, Tomoyasu; Nanba, Kenji; Oshima, Kenshiro; Hattori, Masahira; Kamijo, Takashi; Ohta, Hiroyuki

2012-01-01

Microbial colonization on new terrestrial substrates represents the initiation of new soil ecosystem formation. In this study, we analyzed early bacterial communities growing on volcanic ash deposits derived from the 2000 Mount Oyama eruption on the island of Miyake (Miyake-jima), Japan. A site was established in an unvegetated area near the summit and investigated over a 6-year period from 2003 to 2009. Collected samples were acidic (pH 3.0-3.6), did not utilize any organic substrates in ECO microplate assays (Biolog), and harbored around 106 cells (g dry weight)(-1) of autotrophic Fe(II) oxidizers by most-probable-number (MPN) counts. Acidithiobacillus ferrooxidans, Acidithiobacillus ferrivorans, and the Leptospirillum groups I, II and III were found to be abundant in the deposits by clone library analysis of bacterial 16S rRNA genes. The numerical dominance of Acidithiobacillus ferrooxidans was also supported by analysis of the gene coding for the large subunit of the form I ribulose 1,5-bisphosphate carboxylase/oxygenase (RubisCO). Comparing the 16S rRNA gene clone libraries from samples differing in age, shifts in Fe(II)-oxidizing populations seemed to occur with deposit aging. The detection of known 16S rRNA gene sequences from Fe(III)-reducing acidophiles promoted us to propose the acidity-driven iron cycle for the early microbial ecosystem on the deposit.

Analysis of Early Bacterial Communities on Volcanic Deposits on the Island of Miyake (Miyake-jima), Japan: a 6-year Study at a Fixed Site

PubMed Central

Fujimura, Reiko; Sato, Yoshinori; Nishizawa, Tomoyasu; Nanba, Kenji; Oshima, Kenshiro; Hattori, Masahira; Kamijo, Takashi; Ohta, Hiroyuki

2012-01-01

Microbial colonization on new terrestrial substrates represents the initiation of new soil ecosystem formation. In this study, we analyzed early bacterial communities growing on volcanic ash deposits derived from the 2000 Mount Oyama eruption on the island of Miyake (Miyake-jima), Japan. A site was established in an unvegetated area near the summit and investigated over a 6-year period from 2003 to 2009. Collected samples were acidic (pH 3.0–3.6), did not utilize any organic substrates in ECO microplate assays (Biolog), and harbored around 106 cells (g dry weight)−1 of autotrophic Fe(II) oxidizers by most-probable-number (MPN) counts. Acidithiobacillus ferrooxidans, Acidithiobacillus ferrivorans, and the Leptospirillum groups I, II and III were found to be abundant in the deposits by clone library analysis of bacterial 16S rRNA genes. The numerical dominance of Acidithiobacillus ferrooxidans was also supported by analysis of the gene coding for the large subunit of the form I ribulose 1,5-bisphosphate carboxylase/oxygenase (RubisCO). Comparing the 16S rRNA gene clone libraries from samples differing in age, shifts in Fe(II)-oxidizing populations seemed to occur with deposit aging. The detection of known 16S rRNA gene sequences from Fe(III)-reducing acidophiles promoted us to propose the acidity-driven iron cycle for the early microbial ecosystem on the deposit. PMID:22075623

Microbial Community Stratification Linked to Utilization of Carbohydrates and Phosphorus Limitation in a Boreal Peatland at Marcell Experimental Forest, Minnesota, USA

PubMed Central

Tfaily, Malak M.; Steinweg, J. Megan; Chanton, Patrick; Esson, Kaitlin; Yang, Zamin K.; Chanton, Jeffrey P.; Cooper, William; Schadt, Christopher W.

2014-01-01

This study investigated the abundance, distribution, and composition of microbial communities at the watershed scale in a boreal peatland within the Marcell Experimental Forest (MEF), Minnesota, USA. Through a close coupling of next-generation sequencing, biogeochemistry, and advanced analytical chemistry, a biogeochemical hot spot was revealed in the mesotelm (30- to 50-cm depth) as a pronounced shift in microbial community composition in parallel with elevated peat decomposition. The relative abundance of Acidobacteria and the Syntrophobacteraceae, including known hydrocarbon-utilizing genera, was positively correlated with carbohydrate and organic acid content, showing a maximum in the mesotelm. The abundance of Archaea (primarily crenarchaeal groups 1.1c and 1.3) increased with depth, reaching up to 60% of total small-subunit (SSU) rRNA gene sequences in the deep peat below the 75-cm depth. Stable isotope geochemistry and potential rates of methane production paralleled vertical changes in methanogen community composition to indicate a predominance of acetoclastic methanogenesis mediated by the Methanosarcinales in the mesotelm, while hydrogen-utilizing methanogens predominated in the deeper catotelm. RNA-derived pyrosequence libraries corroborated DNA sequence data to indicate that the above-mentioned microbial groups are metabolically active in the mid-depth zone. Fungi showed a maximum in rRNA gene abundance above the 30-cm depth, which comprised only an average of 0.1% of total bacterial and archaeal rRNA gene abundance, indicating prokaryotic dominance. Ratios of C to P enzyme activities approached 0.5 at the acrotelm and catotelm, indicating phosphorus limitation. In contrast, P limitation pressure appeared to be relieved in the mesotelm, likely due to P solubilization by microbial production of organic acids and C-P lyases. Based on path analysis and the modeling of community spatial turnover, we hypothesize that P limitation outweighs N limitation at MEF, and microbial communities are structured by the dominant shrub, Chamaedaphne calyculata, which may act as a carbon source for major consumers in the peatland. PMID:24682300

Metagenomic and near full-length 16S rRNA sequence data in support of the phylogenetic analysis of the rumen bacterial community in steers

USDA-ARS?s Scientific Manuscript database

Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

Comparative Single-Cell Genomics of Chloroflexi from the Okinawa Trough Deep-Subsurface Biosphere.

PubMed

Fullerton, Heather; Moyer, Craig L

2016-05-15

Chloroflexi small-subunit (SSU) rRNA gene sequences are frequently recovered from subseafloor environments, but the metabolic potential of the phylum is poorly understood. The phylum Chloroflexi is represented by isolates with diverse metabolic strategies, including anoxic phototrophy, fermentation, and reductive dehalogenation; therefore, function cannot be attributed to these organisms based solely on phylogeny. Single-cell genomics can provide metabolic insights into uncultured organisms, like the deep-subsurface Chloroflexi Nine SSU rRNA gene sequences were identified from single-cell sorts of whole-round core material collected from the Okinawa Trough at Iheya North hydrothermal field as part of Integrated Ocean Drilling Program (IODP) expedition 331 (Deep Hot Biosphere). Previous studies of subsurface Chloroflexi single amplified genomes (SAGs) suggested heterotrophic or lithotrophic metabolisms and provided no evidence for growth by reductive dehalogenation. Our nine Chloroflexi SAGs (seven of which are from the order Anaerolineales) indicate that, in addition to genes for the Wood-Ljungdahl pathway, exogenous carbon sources can be actively transported into cells. At least one subunit for pyruvate ferredoxin oxidoreductase was found in four of the Chloroflexi SAGs. This protein can provide a link between the Wood-Ljungdahl pathway and other carbon anabolic pathways. Finally, one of the seven Anaerolineales SAGs contains a distinct reductive dehalogenase homologous (rdhA) gene. Through the use of single amplified genomes (SAGs), we have extended the metabolic potential of an understudied group of subsurface microbes, the Chloroflexi These microbes are frequently detected in the subsurface biosphere, though their metabolic capabilities have remained elusive. In contrast to previously examined Chloroflexi SAGs, our genomes (several are from the order Anaerolineales) were recovered from a hydrothermally driven system and therefore provide a unique window into the metabolic potential of this type of habitat. In addition, a reductive dehalogenase gene (rdhA) has been directly linked to marine subsurface Chloroflexi, suggesting that reductive dehalogenation is not limited to the class Dehalococcoidia This discovery expands the nutrient-cycling and metabolic potential present within the deep subsurface and provides functional gene information relating to this enigmatic group. Copyright © 2016 Fullerton and Moyer.

rrndb: the Ribosomal RNA Operon Copy Number Database

PubMed Central

Klappenbach, Joel A.; Saxman, Paul R.; Cole, James R.; Schmidt, Thomas M.

2001-01-01

The Ribosomal RNA Operon Copy Number Database (rrndb) is an Internet-accessible database containing annotated information on rRNA operon copy number among prokaryotes. Gene redundancy is uncommon in prokaryotic genomes, yet the rRNA genes can vary from one to as many as 15 copies. Despite the widespread use of 16S rRNA gene sequences for identification of prokaryotes, information on the number and sequence of individual rRNA genes in a genome is not readily accessible. In an attempt to understand the evolutionary implications of rRNA operon redundancy, we have created a phylogenetically arranged report on rRNA gene copy number for a diverse collection of prokaryotic microorganisms. Each entry (organism) in the rrndb contains detailed information linked directly to external websites including the Ribosomal Database Project, GenBank, PubMed and several culture collections. Data contained in the rrndb will be valuable to researchers investigating microbial ecology and evolution using 16S rRNA gene sequences. The rrndb web site is directly accessible on the WWW at http://rrndb.cme.msu.edu. PMID:11125085

Cryo-EM structure of a late pre-40S ribosomal subunit from Saccharomyces cerevisiae

PubMed Central

Schmidt, Christian; Berninghausen, Otto; Becker, Thomas

2017-01-01

Mechanistic understanding of eukaryotic ribosome formation requires a detailed structural knowledge of the numerous assembly intermediates, generated along a complex pathway. Here, we present the structure of a late pre-40S particle at 3.6 Å resolution, revealing in molecular detail how assembly factors regulate the timely folding of pre-18S rRNA. The structure shows that, rather than sterically blocking 40S translational active sites, the associated assembly factors Tsr1, Enp1, Rio2 and Pno1 collectively preclude their final maturation, thereby preventing untimely tRNA and mRNA binding and error prone translation. Moreover, the structure explains how Pno1 coordinates the 3’end cleavage of the 18S rRNA by Nob1 and how the late factor’s removal in the cytoplasm ensures the structural integrity of the maturing 40S subunit. PMID:29155690

Nuclear export of the small ribosomal subunit requires the Ran–GTPase cycle and certain nucleoporins

PubMed Central

Moy, Terence I.; Silver, Pamela A.

1999-01-01

After their assembly in the nucleolus, ribosomal subunits are exported from the nucleus to the cytoplasm. After export, the 20S rRNA in the small ribosomal subunit is cleaved to yield 18S rRNA and the small 5′ ITS1 fragment. The 5′ ITS1 RNA is normally degraded by the cytoplasmic Xrn1 exonuclease, but in strains lacking XRN1, the 5′ ITS1 fragment accumulates in the cytoplasm. Using the cytoplasmic localization of the 5′ ITS1 fragment as an indicator for the export of the small ribosomal subunit, we have identified genes that are required for ribosome export. Ribosome export is dependent on the Ran–GTPase as mutations in Ran or its regulators caused 5′ ITS1 to accumulate in the nucleoplasm. Mutations in the genes encoding the nucleoporin Nup82 and in the NES exporter Xpo1/Crm1 also caused the nucleoplasmic accumulation of 5′ ITS1. Mutants in a subset of nucleoporins and in the nuclear transport factors Srp1, Kap95, Pse1, Cse1, and Mtr10 accumulate the 5′ ITS1 in the nucleolus and affect ribosome assembly. In contrast, we did not detect nuclear accumulation of 5′ ITS1 in 28 yeast strains that have mutations in other genes affecting nuclear trafficking. PMID:10465789

Identification of Cellulose-Responsive Bacterial and Fungal Communities in Geographically and Edaphically Different Soils by Using Stable Isotope Probing

PubMed Central

Eichorst, Stephanie A.

2012-01-01

Many bacteria and fungi are known to degrade cellulose in culture, but their combined response to cellulose in different soils is unknown. Replicate soil microcosms amended with [13C]cellulose were used to identify bacterial and fungal communities responsive to cellulose in five geographically and edaphically different soils. The diversity and composition of the cellulose-responsive communities were assessed by DNA-stable isotope probing combined with Sanger sequencing of small-subunit and large-subunit rRNA genes for the bacterial and fungal communities, respectively. In each soil, the 13C-enriched, cellulose-responsive communities were of distinct composition compared to the original soil community or 12C-nonenriched communities. The composition of cellulose-responsive taxa, as identified by sequence operational taxonomic unit (OTU) similarity, differed in each soil. When OTUs were grouped at the bacterial order level, we found that members of the Burkholderiales, Caulobacteriales, Rhizobiales, Sphingobacteriales, Xanthomonadales, and the subdivision 1 Acidobacteria were prevalent in the 13C-enriched DNA in at least three of the soils. The cellulose-responsive fungi were identified as members of the Trichocladium, Chaetomium, Dactylaria, and Arthrobotrys genera, along with two novel Ascomycota clusters, unique to one soil. Although similarities were identified in higher-level taxa among some soils, the composition of cellulose-responsive bacteria and fungi was generally unique to a certain soil type, suggesting a strong potential influence of multiple edaphic factors in shaping the community. PMID:22287013

Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

PubMed Central

Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

2011-01-01

Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis.

PubMed Central

Nübel, U; Engelen, B; Felske, A; Snaidr, J; Wieshuber, A; Amann, R I; Ludwig, W; Backhaus, H

1996-01-01

Sequence heterogeneities in 16S rRNA genes from individual strains of Paenibacillus polymyxa were detected by sequence-dependent separation of PCR products by temperature gradient gel electrophoresis (TGGE). A fragment of the 16S rRNA genes, comprising variable regions V6 to V8, was used as a target sequence for amplifications. PCR products from P. polymyxa (type strain) emerged as a well-defined pattern of bands in the gradient gel. Six plasmids with different inserts, individually demonstrating the migration characteristics of single bands of the pattern, were obtained by cloning the PCR products. Their sequences were analyzed as a representative sample of the total heterogeneity. An amount of 10 variant nucleotide positions in the fragment of 347 bp was observed, with all substitutions conserving the relevant secondary structures of the V6 and V8 regions in the RNA molecules. Hybridizations with specifically designed probes demonstrated different chromosomal locations of the respective rRNA genes. Amplifications of reverse-transcribed rRNA from ribosome preparations, as well as whole-cell hybridizations, revealed a predominant representation of particular sequences in ribosomes of exponentially growing laboratory cultures. Different strains of P. polymyxa showed not only remarkably differing patterns of PCR products in TGGE analysis but also discriminative whole-cell labeling with the designed oligonucleotide probes, indicating the different representation of individual sequences in active ribosomes. Our results demonstrate the usefulness of TGGE for the structural analysis of heterogeneous rRNA genes together with their expression, stress problems of the generation of meaningful data for 16S rRNA sequences and probe designs, and might have consequences for evolutionary concepts. PMID:8824607

Uncultivated Microbial Eukaryotic Diversity: A Method to Link ssu rRNA Gene Sequences with Morphology

PubMed Central

Hirst, Marissa B.; Kita, Kelley N.; Dawson, Scott C.

2011-01-01

Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA “phylotypes” from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages, identified in diverse environments. PMID:22174774

Stability of operational taxonomic units: an important but neglected property for analyzing microbial diversity.

PubMed

He, Yan; Caporaso, J Gregory; Jiang, Xiao-Tao; Sheng, Hua-Fang; Huse, Susan M; Rideout, Jai Ram; Edgar, Robert C; Kopylova, Evguenia; Walters, William A; Knight, Rob; Zhou, Hong-Wei

2015-01-01

The operational taxonomic unit (OTU) is widely used in microbial ecology. Reproducibility in microbial ecology research depends on the reliability of OTU-based 16S ribosomal subunit RNA (rRNA) analyses. Here, we report that many hierarchical and greedy clustering methods produce unstable OTUs, with membership that depends on the number of sequences clustered. If OTUs are regenerated with additional sequences or samples, sequences originally assigned to a given OTU can be split into different OTUs. Alternatively, sequences assigned to different OTUs can be merged into a single OTU. This OTU instability affects alpha-diversity analyses such as rarefaction curves, beta-diversity analyses such as distance-based ordination (for example, Principal Coordinate Analysis (PCoA)), and the identification of differentially represented OTUs. Our results show that the proportion of unstable OTUs varies for different clustering methods. We found that the closed-reference method is the only one that produces completely stable OTUs, with the caveat that sequences that do not match a pre-existing reference sequence collection are discarded. As a compromise to the factors listed above, we propose using an open-reference method to enhance OTU stability. This type of method clusters sequences against a database and includes unmatched sequences by clustering them via a relatively stable de novo clustering method. OTU stability is an important consideration when analyzing microbial diversity and is a feature that should be taken into account during the development of novel OTU clustering methods.

Cloning and sequence analysis of a cDNA encoding the alpha-subunit of mouse beta-N-acetylhexosaminidase and comparison with the human enzyme.

PubMed Central

Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L

1992-01-01

cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046

Environmental distribution, abundance and activity of the Miscellaneous Crenarchaeotal Group

NASA Astrophysics Data System (ADS)

Lloyd, K. G.; Biddle, J.; Teske, A.

2011-12-01

Many marine sedimentary microbes have only been identified by 16S rRNA sequences. Consequently, little is known about the types of metabolism, activity levels, or relative abundance of these groups in marine sediments. We found that one of these uncultured groups, called the Miscellaneous Crenarchaeotal Group (MCG), dominated clone libraries made from reverse transcribed 16S rRNA, and 454 pyrosequenced 16S rRNA genes, in the White Oak River estuary. Primers suitable for quantitative PCR were developed for MCG and used to show that 16S rRNA DNA copy numbers from MCG account for nearly all the archaeal 16S rRNA genes present. RT-qPCR shows much less MCG rRNA than total archaeal rRNA, but comparisons of different primers for each group suggest bias in the RNA-based work relative to the DNA-based work. There is no evidence of a population shift with depth below the sulfate-methane transition zone, suggesting that the metabolism of MCG may not be tied to sulfur or methane cycles. We classified 2,771 new sequences within the SSU Silva 106 database that, along with the classified sequences in the Silva database was used to make an MCG database of 4,646 sequences that allowed us to increase the named subgroups of MCG from 7 to 19. Percent terrestrial sequences in each subgroup is positively correlated with percent of the marine sequences that are nearshore, suggesting that membership in the different subgroups is not random, but dictated by environmental selective pressures. Given their high phylogenetic diversity, ubiquitous distribution in anoxic environments, and high DNA copy number relative to total archaea, members of MCG are most likely anaerobic heterotrophs who are integral to the post-depositional marine carbon cycle.

The rRNA methyltransferase Bud23 shows functional interaction with components of the SSU processome and RNase MRP.

PubMed

Sardana, Richa; White, Joshua P; Johnson, Arlen W

2013-06-01

Bud23 is responsible for the conserved methylation of G1575 of 18S rRNA, in the P-site of the small subunit of the ribosome. bud23Δ mutants have severely reduced small subunit levels and show a general failure in cleavage at site A2 during rRNA processing. Site A2 is the primary cleavage site for separating the precursors of 18S and 25S rRNAs. Here, we have taken a genetic approach to identify the functional environment of BUD23. We found mutations in UTP2 and UTP14, encoding components of the SSU processome, as spontaneous suppressors of a bud23Δ mutant. The suppressors improved growth and subunit balance and restored cleavage at site A2. In a directed screen of 50 ribosomal trans-acting factors, we identified strong positive and negative genetic interactions with components of the SSU processome and strong negative interactions with components of RNase MRP. RNase MRP is responsible for cleavage at site A3 in pre-rRNA, an alternative cleavage site for separating the precursor rRNAs. The strong negative genetic interaction between RNase MRP mutants and bud23Δ is likely due to the combined defects in cleavage at A2 and A3. Our results suggest that Bud23 plays a role at the time of A2 cleavage, earlier than previously thought. The genetic interaction with the SSU processome suggests that Bud23 could be involved in triggering disassembly of the SSU processome, or of particular subcomplexes of the processome.

Mitochondrial genome of the freshwater jellyfish Craspedacusta sowerbyi and phylogenetics of Medusozoa.

PubMed

Zou, Hong; Zhang, Jin; Li, Wenxiang; Wu, Shangong; Wang, Guitang

2012-01-01

The 17,922 base pairs (bp) nucleotide sequence of the linear mitochondrial DNA (mtDNA) molecule of the freshwater jellyfish Craspedacusta sowerbyi (Hydrozoa, Trachylina, Limnomedusae) has been determined. This sequence exhibits surprisingly low A+T content (57.1%), containing genes for 13 energy pathway proteins, a small and a large subunit rRNAs, and methionine and tryptophan tRNAs. Mitochondrial ancestral medusozoan gene order (AMGO) was found in the C. sowerbyi, as those found in Cubaia aphrodite (Hydrozoa, Trachylina, Limnomedusae), discomedusan Scyphozoa and Staurozoa. The genes of C. sowerbyi mtDNA are arranged in two clusters with opposite transcriptional polarities, whereby transcription proceeds toward the ends of the DNA molecule. Identical inverted terminal repeats (ITRs) flank the ends of the mitochondrial DNA molecule, a characteristic typical of medusozoans. In addition, two open reading frames (ORFs) of 354 and 1611 bp in length were found downstream of the large subunit rRNA gene, similar to the two ORFs of ORF314 and polB discovered in the linear mtDNA of C. aphrodite, discomedusan Scyphozoa and Staurozoa. Phylogenetic analyses of C. sowerbyi and other cnidarians were carried out based on both nucleotide and inferred amino acid sequences of the 13 mitochondrial energy pathway genes. Our working hypothesis supports the monophyletic Medusozoa being a sister group to Octocorallia (Cnidaria, Anthozoa). Within Medusozoa, the phylogenetic analysis suggests that Staurozoa may be the earliest diverging class and the sister group of all other medusozoans. Cubozoa and coronate Scyphozoa form a clade that is the sister group of Hydrozoa plus discomedusan Scyphozoa. Hydrozoa is the sister group of discomedusan Scyphozoa. Semaeostomeae is a paraphyletic clade with Rhizostomeae, while Limnomedusae (Trachylina) is the sister group of hydroidolinans and may be the earliest diverging lineage among Hydrozoa.

Mitochondrial Genome of the Freshwater Jellyfish Craspedacusta sowerbyi and Phylogenetics of Medusozoa

PubMed Central

Zou, Hong; Zhang, Jin; Li, Wenxiang; Wu, Shangong; Wang, Guitang

2012-01-01

The 17,922 base pairs (bp) nucleotide sequence of the linear mitochondrial DNA (mtDNA) molecule of the freshwater jellyfish Craspedacusta sowerbyi (Hydrozoa,Trachylina, Limnomedusae) has been determined. This sequence exhibits surprisingly low A+T content (57.1%), containing genes for 13 energy pathway proteins, a small and a large subunit rRNAs, and methionine and tryptophan tRNAs. Mitochondrial ancestral medusozoan gene order (AMGO) was found in the C. sowerbyi, as those found in Cubaia aphrodite (Hydrozoa, Trachylina, Limnomedusae), discomedusan Scyphozoa and Staurozoa. The genes of C. sowerbyi mtDNA are arranged in two clusters with opposite transcriptional polarities, whereby transcription proceeds toward the ends of the DNA molecule. Identical inverted terminal repeats (ITRs) flank the ends of the mitochondrial DNA molecule, a characteristic typical of medusozoans. In addition, two open reading frames (ORFs) of 354 and 1611 bp in length were found downstream of the large subunit rRNA gene, similar to the two ORFs of ORF314 and polB discovered in the linear mtDNA of C. aphrodite, discomedusan Scyphozoa and Staurozoa. Phylogenetic analyses of C. sowerbyi and other cnidarians were carried out based on both nucleotide and inferred amino acid sequences of the 13 mitochondrial energy pathway genes. Our working hypothesis supports the monophyletic Medusozoa being a sister group to Octocorallia (Cnidaria, Anthozoa). Within Medusozoa, the phylogenetic analysis suggests that Staurozoa may be the earliest diverging class and the sister group of all other medusozoans. Cubozoa and coronate Scyphozoa form a clade that is the sister group of Hydrozoa plus discomedusan Scyphozoa. Hydrozoa is the sister group of discomedusan Scyphozoa. Semaeostomeae is a paraphyletic clade with Rhizostomeae, while Limnomedusae (Trachylina) is the sister group of hydroidolinans and may be the earliest diverging lineage among Hydrozoa. PMID:23240028

Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association.

PubMed

Pulk, Arto; Maiväli, Ulo; Remme, Jaanus

2006-05-01

The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts.

Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association

PubMed Central

Pulk, Arto; Maiväli, Ülo; Remme, Jaanus

2006-01-01

The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts. PMID:16556933

Cloning and sequencing of the allophycocyanin genes from Spirulina maxima (Cyanophyta)

NASA Astrophysics Data System (ADS)

Qin, Song; Hiroyuki, Kojima; Yoshikazu, Kawata; Shin-Ichi, Yano; Zeng, Cheng-Kui

1998-03-01

The genes coding for the α-and β-subunit of allophycocyanin ( apcA and apcB) from the cyanophyte Spirulina maxima were cloned and sequenced. The results revealed 44.4% of nucleotide sequence similarity and 30.4% of similarity of deduced amino acid sequence between them. The amino acid sequence identities between S. maxima and S. platensis are 99.4% for α subunit and 100% for β subunit.

Divergent Cryptosporidium parvum subtype and Enterocytozoon bieneusi genotypes in dromedary camels in Algeria.

PubMed

Baroudi, Djamel; Zhang, Hongwei; Amer, Said; Khelef, Djamel; Roellig, Dawn M; Wang, Yuanfei; Feng, Yaoyu; Xiao, Lihua

2018-03-01

Little information is available on the occurrence of the zoonotic protists Cryptosporidium spp. and none on Enterocytozoon bieneusi in camels. This preliminary study was conducted to examine the identity of Cryptosporidium subtypes and E. bieneusi genotypes in dromedary camels in Algeria. A total of 39 fecal specimens were collected from young camels. PCR-sequence analysis of the small subunit rRNA was used to detect and genotype Cryptosporidium spp. Cryptosporidium parvum present was further subtyped by sequence analysis of the 60 kDa glycoprotein gene. PCR-sequence analysis of the ribosomal internal transcribed spacer gene was used to detect and genotype E. bieneusi. Altogether, two and eight of the specimens analyzed were positive for C. parvum and E. bieneusi, respectively. The former was identified as a new subtype that is genetically related to the C. hominis If subtype family, whereas the latter was identified as two related genotypes (Macaque1 and a novel genotype) in the newly assigned E. bieneusi genotype group 8. Although they are not known hosts for C. parvum and E. bieneusi, camels are apparently infected with genetically distinct variants of these pathogens.

Phylogenetic position of the giant anuran trypanosomes Trypanosoma chattoni, Trypanosoma fallisi, Trypanosoma mega, Trypanosoma neveulemairei, and Trypanosoma ranarum inferred from 18S rRNA gene sequences.

PubMed

Martin, Donald S; Wright, André-Denis G; Barta, John R; Desser, Sherwin S

2002-06-01

Phylogenetic relationships within the kinetoplastid flagellates were inferred from comparisons of small-subunit ribosomal RNA gene sequences. These included 5 new gene sequences, Trypanosoma fallisi (2,239 bp), Trypanosoma chattoni (2,180 bp), Trypanosoma mega (2,211 bp), Trypanosoma neveulemairei (2,197 bp), and Trypanosoma ranarum (2,203 bp). Trees produced using maximum-parsimony and distance-matrix methods (least-squares, neighbor-joining, and maximum-likelihood), supported by strong bootstrap and quartet-puzzle analyses, indicated that the trypanosomes are a monophyletic group that divides into 2 major lineages, the salivarian trypanosomes and the nonsalivarian trypanosomes. The nonsalivarian trypanosomes further divide into 2 lineages, 1 containing trypanosomes of birds, mammals, and reptiles and the other containing trypanosomes of fish, reptiles, and anurans. Among the giant trypanosomes, T. chattoni is clearly shown to be distantly related to all the other anuran trypanosome species. Trypanosoma mega is closely associated with T. fallisi and T. ranarum, whereas T. neveulemairei and Trypanosoma rotatorium are sister taxa. The branching order of the anuran trypanosomes suggests that some toad trypanosomes may have evolved by host switching from frogs to toads.

Identification of Bacillus Probiotics Isolated from Soil Rhizosphere Using 16S rRNA, recA, rpoB Gene Sequencing and RAPD-PCR.

PubMed

Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes

2016-03-01

Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.

Introducing W.A.T.E.R.S.: a workflow for the alignment, taxonomy, and ecology of ribosomal sequences.

PubMed

Hartman, Amber L; Riddle, Sean; McPhillips, Timothy; Ludäscher, Bertram; Eisen, Jonathan A

2010-06-12

For more than two decades microbiologists have used a highly conserved microbial gene as a phylogenetic marker for bacteria and archaea. The small-subunit ribosomal RNA gene, also known as 16 S rRNA, is encoded by ribosomal DNA, 16 S rDNA, and has provided a powerful comparative tool to microbial ecologists. Over time, the microbial ecology field has matured from small-scale studies in a select number of environments to massive collections of sequence data that are paired with dozens of corresponding collection variables. As the complexity of data and tool sets have grown, the need for flexible automation and maintenance of the core processes of 16 S rDNA sequence analysis has increased correspondingly. We present WATERS, an integrated approach for 16 S rDNA analysis that bundles a suite of publicly available 16 S rDNA analysis software tools into a single software package. The "toolkit" includes sequence alignment, chimera removal, OTU determination, taxonomy assignment, phylogentic tree construction as well as a host of ecological analysis and visualization tools. WATERS employs a flexible, collection-oriented 'workflow' approach using the open-source Kepler system as a platform. By packaging available software tools into a single automated workflow, WATERS simplifies 16 S rDNA analyses, especially for those without specialized bioinformatics, programming expertise. In addition, WATERS, like some of the newer comprehensive rRNA analysis tools, allows researchers to minimize the time dedicated to carrying out tedious informatics steps and to focus their attention instead on the biological interpretation of the results. One advantage of WATERS over other comprehensive tools is that the use of the Kepler workflow system facilitates result interpretation and reproducibility via a data provenance sub-system. Furthermore, new "actors" can be added to the workflow as desired and we see WATERS as an initial seed for a sizeable and growing repository of interoperable, easy-to-combine tools for asking increasingly complex microbial ecology questions.

Rubrobacter-related bacteria associated with rosy discolouration of masonry and lime wall paintings.

PubMed

Schabereiter-Gurtner, C; Piñar, G; Vybiral, D; Lubitz, W; Rölleke, S

2001-11-01

A molecular approach was chosen to analyse the correlation between bacterial colonisation and rosy discolouration of masonry and lime wall paintings of two historically important buildings in Austria and Germany. The applied molecular method included PCR amplification of genes encoding the small subunit rRNA of bacteria (16S rDNA), genetic fingerprinting by denaturing gradient gel electrophoresis (DGGE), construction of 16S rDNA clone libraries, and comparative phylogenetic sequence analyses. The bacterial community of one red-pigmented biofilm sampled in Herberstein (Austria) contained bacteria phylogenetically related to the genera Saccharopolyspora, Nocardioides, Pseudonocardia, Rubrobacter, and to a Kineococcus-like bacterium. The bacterial community of the second red-pigmented biofilm sampled in Herberstein contained bacteria related to Arthrobacter, Comamonas, and to Rubrobacter. Rubrobacter-related 16S rDNA sequences were the most abundant. In the red-pigmented biofilm sampled in Burggen (Germany), only Rubrobacter-related bacteria were identified. No Rubrobacter-related bacteria were detected in non-rosy biofilms. The majority of sequences (70%) obtained from the bacterial communities of the three investigated rosy biofilms were related to sequences of the genus Rubrobacter (red-pigmented bacteria), demonstrating a correlation between Rubrobacter-related bacteria and the phenomenon of rosy discolouration of masonry and lime wall paintings.

The assessment of epiphytic yeast diversity in sugarcane phyllosphere in Thailand by culture-independent method.

PubMed

Nasanit, Rujikan; Tangwong-O-Thai, Apirat; Tantirungkij, Manee; Limtong, Savitree

2015-12-01

The diversity of epiphytic yeasts from sugarcane (Saccharum officinarum Linn.) phyllospheres in Thailand was investigated by culture-independent method based on the analysis of the D1/D2 domains of the large subunit rRNA gene sequences. Forty-five samples of sugarcane leaf were collected randomly from ten provinces in Thailand. A total of 1342 clones were obtained from 45 clone libraries. 426 clones (31.7 %) were closely related to yeast strains in the GenBank database, and they were clustered into 31 operational taxonomic units (OTUs) with a similarity threshold of 99 %. All OTU sequences were classified in phylum Basidiomycota which were closely related to 11 yeast species in seven genera including Cryptococcus flavus, Hannaella coprosmaensis, Rhodotorula taiwanensis, Jaminaea angkoreiensis, Malassezia restricta, Pseudozyma antarctica, Pseudozyma aphidis, Pseudozyma hubeiensis, Pseudozyma prolifica, Pseudozyma shanxiensis, and Sporobolomyces vermiculatus. The most predominant yeasts detected belonged to Ustilaginales with 89.4 % relative frequency and the prevalent yeast genus was Pseudozyma. However, the majority were unable to be identified as known yeast species and these sequences may represent the sequences of new yeast taxa. In addition, The OTU that closely related to P. prolifica was commonly detected in sugarcane phyllosphere. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

The Role of 16S rRNA Gene Sequencing in Identification of Microorganisms Misidentified by Conventional Methods

PubMed Central

Petti, C. A.; Polage, C. R.; Schreckenberger, P.

2005-01-01

Traditional methods for microbial identification require the recognition of differences in morphology, growth, enzymatic activity, and metabolism to define genera and species. Full and partial 16S rRNA gene sequencing methods have emerged as useful tools for identifying phenotypically aberrant microorganisms. We report on three bacterial blood isolates from three different College of American Pathologists-certified laboratories that were referred to ARUP Laboratories for definitive identification. Because phenotypic identification suggested unusual organisms not typically associated with the submitted clinical diagnosis, consultation with the Medical Director was sought and further testing was performed including partial 16S rRNA gene sequencing. All three patients had endocarditis, and conventional methods identified isolates from patients A, B, and C as a Facklamia sp., Eubacterium tenue, and a Bifidobacterium sp. 16S rRNA gene sequencing identified the isolates as Enterococcus faecalis, Cardiobacterium valvarum, and Streptococcus mutans, respectively. We conclude that the initial identifications of these three isolates were erroneous, may have misled clinicians, and potentially impacted patient care. 16S rRNA gene sequencing is a more objective identification tool, unaffected by phenotypic variation or technologist bias, and has the potential to reduce laboratory errors. PMID:16333109

Influence of Molecular Resolution on Sequence-Based Discovery of Ecological Diversity among Synechococcus Populations in an Alkaline Siliceous Hot Spring Microbial Mat ▿ †

PubMed Central

Melendrez, Melanie C.; Lange, Rachel K.; Cohan, Frederick M.; Ward, David M.

2011-01-01

Previous research has shown that sequences of 16S rRNA genes and 16S-23S rRNA internal transcribed spacer regions may not have enough genetic resolution to define all ecologically distinct Synechococcus populations (ecotypes) inhabiting alkaline, siliceous hot spring microbial mats. To achieve higher molecular resolution, we studied sequence variation in three protein-encoding loci sampled by PCR from 60°C and 65°C sites in the Mushroom Spring mat (Yellowstone National Park, WY). Sequences were analyzed using the ecotype simulation (ES) and AdaptML algorithms to identify putative ecotypes. Between 4 and 14 times more putative ecotypes were predicted from variation in protein-encoding locus sequences than from variation in 16S rRNA and 16S-23S rRNA internal transcribed spacer sequences. The number of putative ecotypes predicted depended on the number of sequences sampled and the molecular resolution of the locus. Chao estimates of diversity indicated that few rare ecotypes were missed. Many ecotypes hypothesized by sequence analyses were different in their habitat specificities, suggesting different adaptations to temperature or other parameters that vary along the flow channel. PMID:21169433

Wickerhamomyces queroliae sp. nov. and Candida jalapaonensis sp. nov., two yeast species isolated from Cerrado ecosystem in North Brazil.

PubMed

Rosa, Carlos A; Morais, Paula B; Lachance, Marc-André; Santos, Renata O; Melo, Weilan G P; Viana, Rodney H O; Bragança, Marcos A L; Pimenta, Raphael S

2009-05-01

Two novel yeast species, Wickerhamomyces queroliae sp. nov. and Candida jalapaonensis sp. nov., were isolated, respectively, from larvae of Anastrepha mucronata (Diptera: Tephritidae) collected from ripe fruit of Peritassa campestris ('Bacupari', Hippocrateaceae) and from flowers of Centropogon cornutus (Campanulaceae) in the Cerrado ecosystem of the state of Tocantins, Brazil. Analysis of the D1/D2 large-subunit rRNA gene sequences placed W. queroliae in the Wickerhamomyces clade near Wickerhamomyces ciferri and Candida silvicultrix. Candida jalapaonensis belongs to the Wickerhamiella clade and is related to Candida drosophilae. The type strain of Wickerhamomyces queroliae is UFMG-05-T200.1(T) (=CBS 10936(T)=NRRL Y-48478(T)) and the type strain of Candida jalapaonensis is UFMG-03-T210(T) (=CBS 10935(T)=NRRL Y-48477(T)).

Description and phylogeny of a new prostomatid, Metacystis similis nov. spec. (Protista, Ciliophora) from the East China Sea.

PubMed

Zhang, Xiumei; Ji, Daode; Zhang, Qianqian; Li, Chenghua

2015-10-27

The living morphology and infraciliature of a new marine prostomatid, Metacystis similis nov. spec., have been observed and investigated. Based on both morphological and molecular biological data, several closely-related and easily confused taxa were compared. The diagnosis for this new taxon: cylindrical marine Metacystis with a slightly blunt anterior end, in vivo 50-70 x 18-23 μm; body not loricate, uniformly cinctured by 16-18 transverse rings of cilia, which are also arranged in 32-36 longitudinal kineties; oral apparatus consisting of one circumoral dikinety and six girdles of densely packed monokinetids; single spherical macronucleus located in the center of the body; caudal region possessing one transparent, protruding hemicycle terminal vacuole. Information concerning the small-subunit rRNA gene sequence of the new species was also provided.

It isn't always caviar

PubMed Central

Flammer Anikpeh, Yvonne; Grimm, Felix; Lindenblatt, Nicole; Zinkernagel, Annelies

2014-01-01

A 47-year-old HIV-positive woman presented with fever and a painful swollen right forearm. Clinical presentation and MRI were suggestive for a necrotising fasciitis. Surgical exploration revealed small transparent cystic bodies resembling white caviar, which were identified by their typical morphological features as larval stages (cysticerci) of Taenia crassiceps. Molecular methods, using sequence analysis of the small subunit rRNA gene, definitively confirmed T crassiceps. T crassiceps (Cestodea: Taeniidae) is a tapeworm found in the intestines of red foxes and dogs in the Northern Hemisphere. Human infections are rare and appear to depend on the host's immunocompetence. The eight published cases could not clarify the mode of infection but discuss ingestion of teniid eggs or penetration through a cutaneous wound. The optimal treatment remains unclear. We describe a detailed and successful treatment strategy including extensive surgical interventions, prolonged anthelmintic and antiretroviral treatment. PMID:24692370

It isn't always caviar.

PubMed

Flammer Anikpeh, Yvonne; Grimm, Felix; Lindenblatt, Nicole; Zinkernagel, Annelies

2014-04-01

A 47-year-old HIV-positive woman presented with fever and a painful swollen right forearm. Clinical presentation and MRI were suggestive for a necrotising fasciitis. Surgical exploration revealed small transparent cystic bodies resembling white caviar, which were identified by their typical morphological features as larval stages (cysticerci) of Taenia crassiceps. Molecular methods, using sequence analysis of the small subunit rRNA gene, definitively confirmed T crassiceps. T crassiceps (Cestodea: Taeniidae) is a tapeworm found in the intestines of red foxes and dogs in the Northern Hemisphere. Human infections are rare and appear to depend on the host's immunocompetence. The eight published cases could not clarify the mode of infection but discuss ingestion of teniid eggs or penetration through a cutaneous wound. The optimal treatment remains unclear. We describe a detailed and successful treatment strategy including extensive surgical interventions, prolonged anthelmintic and antiretroviral treatment.

Skin Microbiome Surveys Are Strongly Influenced by Experimental Design.

PubMed

Meisel, Jacquelyn S; Hannigan, Geoffrey D; Tyldsley, Amanda S; SanMiguel, Adam J; Hodkinson, Brendan P; Zheng, Qi; Grice, Elizabeth A

2016-05-01

Culture-independent studies to characterize skin microbiota are increasingly common, due in part to affordable and accessible sequencing and analysis platforms. Compared to culture-based techniques, DNA sequencing of the bacterial 16S ribosomal RNA (rRNA) gene or whole metagenome shotgun (WMS) sequencing provides more precise microbial community characterizations. Most widely used protocols were developed to characterize microbiota of other habitats (i.e., gastrointestinal) and have not been systematically compared for their utility in skin microbiome surveys. Here we establish a resource for the cutaneous research community to guide experimental design in characterizing skin microbiota. We compare two widely sequenced regions of the 16S rRNA gene to WMS sequencing for recapitulating skin microbiome community composition, diversity, and genetic functional enrichment. We show that WMS sequencing most accurately recapitulates microbial communities, but sequencing of hypervariable regions 1-3 of the 16S rRNA gene provides highly similar results. Sequencing of hypervariable region 4 poorly captures skin commensal microbiota, especially Propionibacterium. WMS sequencing, which is resource and cost intensive, provides evidence of a community's functional potential; however, metagenome predictions based on 16S rRNA sequence tags closely approximate WMS genetic functional profiles. This study highlights the importance of experimental design for downstream results in skin microbiome surveys. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Skin microbiome surveys are strongly influenced by experimental design

PubMed Central

Meisel, Jacquelyn S.; Hannigan, Geoffrey D.; Tyldsley, Amanda S.; SanMiguel, Adam J.; Hodkinson, Brendan P.; Zheng, Qi; Grice, Elizabeth A.

2016-01-01

Culture-independent studies to characterize skin microbiota are increasingly common, due in part to affordable and accessible sequencing and analysis platforms. Compared to culture-based techniques, DNA sequencing of the bacterial 16S ribosomal RNA (rRNA) gene or whole metagenome shotgun (WMS) sequencing provide more precise microbial community characterizations. Most widely used protocols were developed to characterize microbiota of other habitats (i.e. gastrointestinal), and have not been systematically compared for their utility in skin microbiome surveys. Here we establish a resource for the cutaneous research community to guide experimental design in characterizing skin microbiota. We compare two widely sequenced regions of the 16S rRNA gene to WMS sequencing for recapitulating skin microbiome community composition, diversity, and genetic functional enrichment. We show that WMS sequencing most accurately recapitulates microbial communities, but sequencing of hypervariable regions 1-3 of the 16S rRNA gene provides highly similar results. Sequencing of hypervariable region 4 poorly captures skin commensal microbiota, especially Propionibacterium. WMS sequencing, which is resource- and cost-intensive, provides evidence of a community’s functional potential; however, metagenome predictions based on 16S rRNA sequence tags closely approximate WMS genetic functional profiles. This work highlights the importance of experimental design for downstream results in skin microbiome surveys. PMID:26829039

Lack of WDR36 leads to preimplantation embryonic lethality in mice and delays the formation of small subunit ribosomal RNA in human cells in vitro.

PubMed

Gallenberger, Martin; Meinel, Dominik M; Kroeber, Markus; Wegner, Michael; Milkereit, Philipp; Bösl, Michael R; Tamm, Ernst R

2011-02-01

Mutations in WD repeat domain 36 gene (WDR36) play a causative role in some forms of primary open-angle glaucoma, a leading cause of blindness worldwide. WDR36 is characterized by the presence of multiple WD40 repeats and shows homology to Utp21, an essential protein component of the yeast small subunit (SSU) processome required for maturation of 18S rRNA. To clarify the functional role of WDR36 in the mammalian organism, we generated and investigated mutant mice with a targeted deletion of Wdr36. In parallel experiments, we used RNA interference to deplete WDR36 mRNA in mouse embryos and cultured human trabecular meshwork (HTM-N) cells. Deletion of Wdr36 in the mouse caused preimplantation embryonic lethality, and essentially similar effects were observed when WDR36 mRNA was depleted in mouse embryos by RNA interference. Depletion of WDR36 mRNA in HTM-N cells caused apoptotic cell death and upregulation of mRNA for BAX, TP53 and CDKN1A. By immunocytochemistry, staining for WDR36 was observed in the nucleolus of cells, which co-localized with that of nucleolar proteins such as nucleophosmin and PWP2. In addition, recombinant and epitope-tagged WDR36 localized to the nucleolus of HTM-N cells. By northern blot analysis, a substantial decrease in 21S rRNA, the precursor of 18S rRNA, was observed following knockdown of WDR36. In addition, metabolic-labeling experiments consistently showed a delay of 18S rRNA maturation in WDR36-depleted cells. Our results provide evidence that WDR36 is an essential protein in mammalian cells which is involved in the nucleolar processing of SSU 18S rRNA.

The avilamycin resistance determinants AviRa and AviRb methylate 23S rRNA at the guanosine 2535 base and the uridine 2479 ribose.

PubMed

Treede, Irina; Jakobsen, Lene; Kirpekar, Finn; Vester, Birte; Weitnauer, Gabriele; Bechthold, Andreas; Douthwaite, Stephen

2003-07-01

Avilamycin is an orthosomycin antibiotic that has shown considerable potential for clinical use, although it is presently used as a growth promoter in animal feed. Avilamycin inhibits bacterial protein synthesis by binding to the 50S ribosomal subunit. The ribosomes of the producer strain, Streptomyces viridochromogenes Tü57, are protected from the drug by the action of three resistance factors located in the avilamycin biosynthetic gene cluster. Two of the resistance factors, aviRa and aviRb, encode rRNA methyltransferases that specifically target 23S rRNA. Recombinant AviRa and AviRb proteins retain their activity after purification, and both specifically methylate in vitro transcripts of 23S rRNA domain V. Reverse transcriptase primer extension indicated that AviRa is an N-methyltransferase that targets G2535 within helix 91 of the rRNA, whereas AviRb modified the 2'-O-ribose position of nucleotide U2479 within helix 89. MALDI mass spectrometry confirmed the exact positions of each of these modifications, and additionally established that a single methyl group is added at each nucleotide. Neither of these two nucleotides have previously been described as a target for enzymatic methylation. Molecular models of the 50S subunit crystal structure show that the N-1 of the G2535 base and the 2'-hydroxyl of U2479 are separated by approximately 10 A, a distance that can be spanned by avilamycin. In addition to defining new resistance mechanisms, these data refine our understanding of the probable ribosome contacts made by orthosomycins and of how these antibiotics inhibit protein synthesis.

Recognition of Potentially Novel Human Disease-Associated Pathogens by Implementation of Systematic 16S rRNA Gene Sequencing in the Diagnostic Laboratory▿ †

PubMed Central

Keller, Peter M.; Rampini, Silvana K.; Büchler, Andrea C.; Eich, Gerhard; Wanner, Roger M.; Speck, Roberto F.; Böttger, Erik C.; Bloemberg, Guido V.

2010-01-01

Clinical isolates that are difficult to identify by conventional means form a valuable source of novel human pathogens. We report on a 5-year study based on systematic 16S rRNA gene sequence analysis. We found 60 previously unknown 16S rRNA sequences corresponding to potentially novel bacterial taxa. For 30 of 60 isolates, clinical relevance was evaluated; 18 of the 30 isolates analyzed were considered to be associated with human disease. PMID:20631113

Investigation of bacterial and archaeal communities: novel protocols using modern sequencing by Illumina MiSeq and traditional DGGE-cloning.

PubMed

Kraková, Lucia; Šoltys, Katarína; Budiš, Jaroslav; Grivalský, Tomáš; Ďuriš, František; Pangallo, Domenico; Szemes, Tomáš

2016-09-01

Different protocols based on Illumina high-throughput DNA sequencing and denaturing gradient gel electrophoresis (DGGE)-cloning were developed and applied for investigating hot spring related samples. The study was focused on three target genes: archaeal and bacterial 16S rRNA and mcrA of methanogenic microflora. Shorter read lengths of the currently most popular technology of sequencing by Illumina do not allow analysis of the complete 16S rRNA region, or of longer gene fragments, as was the case of Sanger sequencing. Here, we demonstrate that there is no need for special indexed or tailed primer sets dedicated to short variable regions of 16S rRNA since the presented approach allows the analysis of complete bacterial 16S rRNA amplicons (V1-V9) and longer archaeal 16S rRNA and mcrA sequences. Sample augmented with transposon is represented by a set of approximately 300 bp long fragments that can be easily sequenced by Illumina MiSeq. Furthermore, a low proportion of chimeric sequences was observed. DGGE-cloning based strategies were performed combining semi-nested PCR, DGGE and clone library construction. Comparing both investigation methods, a certain degree of complementarity was observed confirming that the DGGE-cloning approach is not obsolete. Novel protocols were created for several types of laboratories, utilizing the traditional DGGE technique or using the most modern Illumina sequencing.

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania.

PubMed

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-12-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved.

[Structure and function of eukaryotic nuclear DNA-dependent RNA polymerase I].

PubMed

Shematorova, E K; Shpakovskiĭ, G V

2002-01-01

In the eukaryotic cell, normal protein biosynthesis is sustained by several million ribosomes, which contain rRNA as an essential component. The high-molecular-weight precursor of large and 5.8S rRNAs is synthesized by DNA-dependent RNA polymerase I (Pol I) in the nucleolus. Data on DNA regulatory elements, protein factors involved in rDNA transcription by Pol I, subunit composition of Pol I, and on the interactions and possible functions of individual subunits are summarized.

Diversity and community composition of methanogenic archaea in the rumen of Scottish upland sheep assessed by different methods.

PubMed

Snelling, Timothy J; Genç, Buğra; McKain, Nest; Watson, Mick; Waters, Sinéad M; Creevey, Christopher J; Wallace, R John

2014-01-01

Ruminal archaeomes of two mature sheep grazing in the Scottish uplands were analysed by different sequencing and analysis methods in order to compare the apparent archaeal communities. All methods revealed that the majority of methanogens belonged to the Methanobacteriales order containing the Methanobrevibacter, Methanosphaera and Methanobacteria genera. Sanger sequenced 1.3 kb 16S rRNA gene amplicons identified the main species of Methanobrevibacter present to be a SGMT Clade member Mbb. millerae (≥ 91% of OTUs); Methanosphaera comprised the remainder of the OTUs. The primers did not amplify ruminal Thermoplasmatales-related 16S rRNA genes. Illumina sequenced V6-V8 16S rRNA gene amplicons identified similar Methanobrevibacter spp. and Methanosphaera clades and also identified the Thermoplasmatales-related order as 13% of total archaea. Unusually, both methods concluded that Mbb. ruminantium and relatives from the same clade (RO) were almost absent. Sequences mapping to rumen 16S rRNA and mcrA gene references were extracted from Illumina metagenome data. Mapping of the metagenome data to 16S rRNA gene references produced taxonomic identification to Order level including 2-3% Thermoplasmatales, but was unable to discriminate to species level. Mapping of the metagenome data to mcrA gene references resolved 69% to unclassified Methanobacteriales. Only 30% of sequences were assigned to species level clades: of the sequences assigned to Methanobrevibacter, most mapped to SGMT (16%) and RO (10%) clades. The Sanger 16S amplicon and Illumina metagenome mcrA analyses showed similar species richness (Chao1 Index 19-35), while Illumina metagenome and amplicon 16S rRNA analysis gave lower richness estimates (10-18). The values of the Shannon Index were low in all methods, indicating low richness and uneven species distribution. Thus, although much information may be extracted from the other methods, Illumina amplicon sequencing of the V6-V8 16S rRNA gene would be the method of choice for studying rumen archaeal communities.

High-resolution phylogenetic microbial community profiling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singer, Esther; Coleman-Derr, Devin; Bowman, Brett

2014-03-17

The representation of bacterial and archaeal genome sequences is strongly biased towards cultivated organisms, which belong to merely four phylogenetic groups. Functional information and inter-phylum level relationships are still largely underexplored for candidate phyla, which are often referred to as microbial dark matter. Furthermore, a large portion of the 16S rRNA gene records in the GenBank database are labeled as environmental samples and unclassified, which is in part due to low read accuracy, potential chimeric sequences produced during PCR amplifications and the low resolution of short amplicons. In order to improve the phylogenetic classification of novel species and advance ourmore » knowledge of the ecosystem function of uncultivated microorganisms, high-throughput full length 16S rRNA gene sequencing methodologies with reduced biases are needed. We evaluated the performance of PacBio single-molecule real-time (SMRT) sequencing in high-resolution phylogenetic microbial community profiling. For this purpose, we compared PacBio and Illumina metagenomic shotgun and 16S rRNA gene sequencing of a mock community as well as of an environmental sample from Sakinaw Lake, British Columbia. Sakinaw Lake is known to contain a large age of microbial species from candidate phyla. Sequencing results show that community structure based on PacBio shotgun and 16S rRNA gene sequences is highly similar in both the mock and the environmental communities. Resolution power and community representation accuracy from SMRT sequencing data appeared to be independent of GC content of microbial genomes and was higher when compared to Illumina-based metagenome shotgun and 16S rRNA gene (iTag) sequences, e.g. full-length sequencing resolved all 23 OTUs in the mock community, while iTags did not resolve closely related species. SMRT sequencing hence offers various potential benefits when characterizing uncharted microbial communities.« less

Cyclin-dependent Kinase 9 Links RNA Polymerase II Transcription to Processing of Ribosomal RNA*

PubMed Central

Burger, Kaspar; Mühl, Bastian; Rohrmoser, Michaela; Coordes, Britta; Heidemann, Martin; Kellner, Markus; Gruber-Eber, Anita; Heissmeyer, Vigo; Strässer, Katja; Eick, Dirk

2013-01-01

Ribosome biogenesis is a process required for cellular growth and proliferation. Processing of ribosomal RNA (rRNA) is highly sensitive to flavopiridol, a specific inhibitor of cyclin-dependent kinase 9 (Cdk9). Cdk9 has been characterized as the catalytic subunit of the positive transcription elongation factor b (P-TEFb) of RNA polymerase II (RNAPII). Here we studied the connection between RNAPII transcription and rRNA processing. We show that inhibition of RNAPII activity by α-amanitin specifically blocks processing of rRNA. The block is characterized by accumulation of 3′ extended unprocessed 47 S rRNAs and the entire inhibition of other 47 S rRNA-specific processing steps. The transcription rate of rRNA is moderately reduced after inhibition of Cdk9, suggesting that defective 3′ processing of rRNA negatively feeds back on RNAPI transcription. Knockdown of Cdk9 caused a strong reduction of the levels of RNAPII-transcribed U8 small nucleolar RNA, which is essential for 3′ rRNA processing in mammalian cells. Our data demonstrate a pivotal role of Cdk9 activity for coupling of RNAPII transcription with small nucleolar RNA production and rRNA processing. PMID:23744076

Comparison of ribosomal RNA removal methods for transcriptome sequencing workflows in teleost fish

USDA-ARS?s Scientific Manuscript database

RNA sequencing (RNA-Seq) is becoming the standard for transcriptome analysis. Removal of contaminating ribosomal RNA (rRNA) is a priority in the preparation of libraries suitable for sequencing. rRNAs are commonly removed from total RNA via either mRNA selection or rRNA depletion. These methods have...

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis

USDA-ARS?s Scientific Manuscript database

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T formed a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these ot...

Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation.

PubMed

Wang, R F; Cao, W W; Cerniglia, C E

1996-01-01

In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).

Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

PubMed Central

Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

2012-01-01

Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.

PubMed

Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A

2016-07-01

Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene. Copyright © 2016 Elsevier GmbH. All rights reserved.

Crotoxin: Structural Studies, Mechanism of Action and Cloning of Its Gene

DTIC Science & Technology

1987-03-01

other venoms and examine their toxin neutral- izing ability. The amino acid sequences of both crotoxin subunits were determined Is a prelude to cloning...be examined for their potential as anti-idiotype vaccines The complete amino acid sequence of the basic subunit and two of the three dic subunit chains...of crotoxin from the venom of C.d. terrificus has been de rmined. Sequence comparison data suggest that the non-toxic, acidic subunit was derived

Comparison of traditional phenotypic identification methods with partial 5' 16S rRNA gene sequencing for species-level identification of nonfermenting Gram-negative bacilli.

PubMed

Cloud, Joann L; Harmsen, Dag; Iwen, Peter C; Dunn, James J; Hall, Gerri; Lasala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L; Mellmann, Alexander

2010-04-01

Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5' 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB.

A new anaerobic fungus (Oontomyces anksri gen. nov., sp. nov.) from the digestive tract of the Indian camel (Camelus dromedarius).

PubMed

Dagar, Sumit S; Kumar, Sanjay; Griffith, Gareth W; Edwards, Joan E; Callaghan, Tony M; Singh, Rameshwar; Nagpal, Ashok K; Puniya, Anil K

2015-08-01

Two cultures of anaerobic fungi were isolated from the forestomach of an Indian camel (Camelus dromedarius). Phylogenetic analysis using both the internal transcribed spacer (ITS) and large-subunit (LSU) regions of the rRNA locus demonstrated that these isolates were identical and formed a distinct clade within the anaerobic fungi (phylum Neocallimastigomycota). Morphological examination showed that these fungi formed monocentric thalli with filamentous rhizoids and uniflagellate zoospores, broadly similar to members of the genus Piromyces. However, distinctive morphological features were observed, notably the pinching of the cytoplasm in the sporangiophore and the formation of intercalary rhizoidal swellings. Since genetic analyses demonstrated this fungus was only distantly related to Piromyces spp. and closer to the polycentric Anaeromyces clade, we have assigned it to a new genus and species Oontomyces anksri gen. nov., sp. nov. Interrogation of the GenBank database identified several closely related ITS sequences, which were all environmental sequences obtained from camels, raising the possibility that this fungus may be specific to camelids. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

PubMed Central

Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

1985-01-01

The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

Description of Diutina gen. nov., Diutina siamensis, f.a. sp. nov., and reassignment of Candida catenulata, Candida mesorugosa, Candida neorugosa, Candida pseudorugosa, Candida ranongensis, Candida rugosa and Candida scorzettiae to the genus Diutina.

PubMed

Khunnamwong, Pannida; Lertwattanasakul, Noppon; Jindamorakot, Sasitorn; Limtong, Savitree; Lachance, Marc-André

2015-12-01

Three strains (DMKU-RE28, DMKU-RE43T and DMKU-RE123) of a novel anamorphic yeast species were isolated from rice leaf tissue collected in Thailand. DNA sequence analysis demonstrated that the species forms a sister pair with Candida ranongensis CBS 10861T but differs by 24-30 substitutions in the LSU rRNA gene D1/D2 domains and 30-35 substitutions in the ITS region. A phylogenetic analysis based on both the small and the large rRNA gene subunits confirmed this connection and demonstrated the presence of a clade that also includes Candida catenulata, Candida mesorugosa, Candida neorugosa, Candida pseudorugosa, Candida rugosa and Candida scorzettiae. The clade is not closely affiliated to any known teleomorphic genus, and forms a well-separated lineage from currently recognized genera of the Saccharomycetales. Hence, the genus Diutina gen. nov. is proposed to accommodate members of the clade, including Diutina siamensis f.a. sp. nov. and the preceding seven Candida species. The type strain is DMKU-RE43T ( = CBS 13388T = BCC 61183T = NBRC 109695T).

Disseminated fungal infection in two species of captive sharks.

PubMed

Marancik, David P; Berliner, Aimee L; Cavin, Julie M; Clauss, Tonya M; Dove, Alistair D M; Sutton, Deanna A; Wickes, Brian L; Camus, Alvin C

2011-12-01

In this report, two cases of systemic mycosis in captive sharks are characterized. These cases were progressive and ultimately culminated in terminal disease. Paecilomyces lilacinus, an uncommon pathogen in human and veterinary medicine, was associated with areas of necrosis in the liver, heart, and gill in a great hammerhead shark (Sphyrna mokarran). Fungal growth was observed from samples of kidney, spleen, spinal fluid, and coelomic cavity swabs. Dual fungal infection by Exophiala pisciphila and Mucor circinelloides was diagnosed in a juvenile zebra shark (Stegostoma fasciatum). Both fungi were present in the liver, with more severe tissue destruction associated with E. pisciphila. E. pisciphila also produced significant necrosis in the spleen and gill, while M. circinelloides was associated with only minimal tissue changes in the heart. Fungal cultures from liver, kidney, and spleen were positive for both E. pisciphila and M. circinelloides. Identification of P. lilacinus and M. circinelloides was based on colonial and hyphal morphology. E. pisciphila was identified by sequence analysis of the 28S rRNA D1/D2 region and the internal transcribed spacer (ITS) region between the 18S and 28S rRNA subunit. These cases, and a lack of information in the literature, highlight the need for further research and diagnostic sampling to further characterize the host-pathogen interaction between elasmobranchs and fungi.

Isolation, molecular characterization, and in vitro schizogonic development of Sarcocystis sp. ex Accipiter cooperii from a naturally infected Cooper's hawk (Accipiter cooperii).

PubMed

Lindsay, David S; Verma, Shiv K; Scott, David; Dubey, Jitender P; von Dohlen, Alexa R

2017-04-01

Raptors serve as the definitive host for several Sarcocystis species. The complete life cycles of only a few of these Sarcocystis species that use birds of prey as definitive hosts have been described. In the present study, Sarcocystis species sporocysts were obtained from the intestine of a Cooper's hawk (Accipiter cooperii) and were used to infect cell cultures of African green monkey kidney cells to isolate a continuous culture and describe asexual stages of the parasite. Two clones of the parasite were obtained by limiting dilution. Asexual stages were used to obtain DNA for molecular classification and identification. PCR amplification and sequencing were done at three nuclear ribosomal DNA loci; 18S rRNA, 28S rRNA, and ITS-1, and the mitochondrial cytochrome c oxidase subunit 1 (cox1) locus. Examination of clonal isolates of the parasite indicated a single species related to S. columbae (termed Sarcocystis sp. ex Accipiter cooperii) was present in the Cooper's hawk. Our results document for the first time Sarcocystis sp. ex A. cooperii occurs naturally in an unknown intermediate host in North America and that Cooper's hawks (A. cooperii) are a natural definitive host. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Phylogenetic congruence and ecological coherence in terrestrial Thaumarchaeota.

PubMed

Oton, Eduard Vico; Quince, Christopher; Nicol, Graeme W; Prosser, James I; Gubry-Rangin, Cécile

2016-01-01

Thaumarchaeota form a ubiquitously distributed archaeal phylum, comprising both the ammonia-oxidising archaea (AOA) and other archaeal groups in which ammonia oxidation has not been demonstrated (including Group 1.1c and Group 1.3). The ecology of AOA in terrestrial environments has been extensively studied using either a functional gene, encoding ammonia monooxygenase subunit A (amoA) or 16S ribosomal RNA (rRNA) genes, which show phylogenetic coherence with respect to soil pH. To test phylogenetic congruence between these two markers and to determine ecological coherence in all Thaumarchaeota, we performed high-throughput sequencing of 16S rRNA and amoA genes in 46 UK soils presenting 29 available contextual soil characteristics. Adaptation to pH and organic matter content reflected strong ecological coherence at various levels of taxonomic resolution for Thaumarchaeota (AOA and non-AOA), whereas nitrogen, total mineralisable nitrogen and zinc concentration were also important factors associated with AOA thaumarchaeotal community distribution. Other significant associations with environmental factors were also detected for amoA and 16S rRNA genes, reflecting different diversity characteristics between these two markers. Nonetheless, there was significant statistical congruence between the markers at fine phylogenetic resolution, supporting the hypothesis of low horizontal gene transfer between Thaumarchaeota. Group 1.1c Thaumarchaeota were also widely distributed, with two clusters predominating, particularly in environments with higher moisture content and organic matter, whereas a similar ecological pattern was observed for Group 1.3 Thaumarchaeota. The ecological and phylogenetic congruence identified is fundamental to understand better the life strategies, evolutionary history and ecosystem function of the Thaumarchaeota.

Phylogenetic congruence and ecological coherence in terrestrial Thaumarchaeota

PubMed Central

Oton, Eduard Vico; Quince, Christopher; Nicol, Graeme W; Prosser, James I; Gubry-Rangin, Cécile

2016-01-01

Thaumarchaeota form a ubiquitously distributed archaeal phylum, comprising both the ammonia-oxidising archaea (AOA) and other archaeal groups in which ammonia oxidation has not been demonstrated (including Group 1.1c and Group 1.3). The ecology of AOA in terrestrial environments has been extensively studied using either a functional gene, encoding ammonia monooxygenase subunit A (amoA) or 16S ribosomal RNA (rRNA) genes, which show phylogenetic coherence with respect to soil pH. To test phylogenetic congruence between these two markers and to determine ecological coherence in all Thaumarchaeota, we performed high-throughput sequencing of 16S rRNA and amoA genes in 46 UK soils presenting 29 available contextual soil characteristics. Adaptation to pH and organic matter content reflected strong ecological coherence at various levels of taxonomic resolution for Thaumarchaeota (AOA and non-AOA), whereas nitrogen, total mineralisable nitrogen and zinc concentration were also important factors associated with AOA thaumarchaeotal community distribution. Other significant associations with environmental factors were also detected for amoA and 16S rRNA genes, reflecting different diversity characteristics between these two markers. Nonetheless, there was significant statistical congruence between the markers at fine phylogenetic resolution, supporting the hypothesis of low horizontal gene transfer between Thaumarchaeota. Group 1.1c Thaumarchaeota were also widely distributed, with two clusters predominating, particularly in environments with higher moisture content and organic matter, whereas a similar ecological pattern was observed for Group 1.3 Thaumarchaeota. The ecological and phylogenetic congruence identified is fundamental to understand better the life strategies, evolutionary history and ecosystem function of the Thaumarchaeota. PMID:26140533

In silico analysis of 16S ribosomal RNA gene sequencing‐based methods for identification of medically important anaerobic bacteria

PubMed Central

Woo, Patrick C Y; Chung, Liliane M W; Teng, Jade L L; Tse, Herman; Pang, Sherby S Y; Lau, Veronica Y T; Wong, Vanessa W K; Kam, Kwok‐ling; Lau, Susanna K P; Yuen, Kwok‐Yung

2007-01-01

This study is the first study that provides useful guidelines to clinical microbiologists and technicians on the usefulness of full 16S rRNA sequencing, 5′‐end 527‐bp 16S rRNA sequencing and the existing MicroSeq full and 500 16S rDNA bacterial identification system (MicroSeq, Perkin‐Elmer Applied Biosystems Division, Foster City, California, USA) databases for the identification of all existing medically important anaerobic bacteria. Full and 527‐bp 16S rRNA sequencing are able to identify 52–63% of 130 Gram‐positive anaerobic rods, 72–73% of 86 Gram‐negative anaerobic rods and 78% of 23 anaerobic cocci. The existing MicroSeq databases are able to identify only 19–25% of 130 Gram‐positive anaerobic rods, 38% of 86 Gram‐negative anaerobic rods and 39% of 23 anaerobic cocci. These represent only 45–46% of those that should be confidently identified by full and 527‐bp 16S rRNA sequencing. To improve the usefulness of MicroSeq, bacterial species that should be confidently identified by full and/or 527‐bp 16S rRNA sequencing but not included in the existing MicroSeq databases should be included. PMID:17046845

MetaMetaDB: a database and analytic system for investigating microbial habitability.

PubMed

Yang, Ching-chia; Iwasaki, Wataru

2014-01-01

MetaMetaDB (http://mmdb.aori.u-tokyo.ac.jp/) is a database and analytic system for investigating microbial habitability, i.e., how a prokaryotic group can inhabit different environments. The interaction between prokaryotes and the environment is a key issue in microbiology because distinct prokaryotic communities maintain distinct ecosystems. Because 16S ribosomal RNA (rRNA) sequences play pivotal roles in identifying prokaryotic species, a system that comprehensively links diverse environments to 16S rRNA sequences of the inhabitant prokaryotes is necessary for the systematic understanding of the microbial habitability. However, existing databases are biased to culturable prokaryotes and exhibit limitations in the comprehensiveness of the data because most prokaryotes are unculturable. Recently, metagenomic and 16S rRNA amplicon sequencing approaches have generated abundant 16S rRNA sequence data that encompass unculturable prokaryotes across diverse environments; however, these data are usually buried in large databases and are difficult to access. In this study, we developed MetaMetaDB (Meta-Metagenomic DataBase), which comprehensively and compactly covers 16S rRNA sequences retrieved from public datasets. Using MetaMetaDB, users can quickly generate hypotheses regarding the types of environments a prokaryotic group may be adapted to. We anticipate that MetaMetaDB will improve our understanding of the diversity and evolution of prokaryotes.

A novel approach for monitoring genetically engineered microorganisms by using artificial, stable RNAs

NASA Technical Reports Server (NTRS)

Pitulle, C.; Hedenstierna, K. O.; Fox, G. E.

1995-01-01

Further improvements in technology for efficient monitoring of genetically engineered microorganisms (GEMs) in the environment are needed. Technology for monitoring rRNA is well established but has not generally been applicable to GEMs because of the lack of unique rRNA target sequences. In the work described herein, it is demonstrated that a deletion mutant of a plasmid-borne Vibrio proteolyticus 5S rRNA gene continues to accumulate to high levels in Escherichia coli although it is no longer incorporated into 70S ribosomes. This deletion construct was subsequently modified by mutagenesis to create a unique recognition site for the restriction endonuclease BstEII, into which new sequences could be readily inserted. Finally, a novel 17-nucleotide identifier sequence from Pennisetum purpureum was embedded into the construct to create an RNA identification cassette. The artificial identifier RNA, expressed from this cassette in vivo, accumulated in E. coli to levels comparable to those of wild-type 5S rRNA without being seriously detrimental to cell survival in laboratory experiments and without entering the ribosomes. These results demonstrate that artificial, stable RNAs containing sequence segments remarkably different from those present in any known rRNA can be designed and that neither the deleted sequence segment nor ribosome incorporation is essential for accumulation of an RNA product.

Nearly complete rRNA genes assembled from across the metazoan animals: effects of more taxa, a structure-based alignment, and paired-sites evolutionary models on phylogeny reconstruction.

PubMed

Mallatt, Jon; Craig, Catherine Waggoner; Yoder, Matthew J

2010-04-01

This study (1) uses nearly complete rRNA-gene sequences from across Metazoa (197 taxa) to reconstruct animal phylogeny; (2) presents a highly annotated, manual alignment of these sequences with special reference to rRNA features including paired sites (http://purl.oclc.org/NET/rRNA/Metazoan_alignment) and (3) tests, after eliminating as few disruptive, rogue sequences as possible, if a likelihood framework can recover the main metazoan clades. We found that systematic elimination of approximately 6% of the sequences, including the divergent or unstably placed sequences of cephalopods, arrowworm, symphylan and pauropod myriapods, and of myzostomid and nemertodermatid worms, led to a tree that supported Ecdysozoa, Lophotrochozoa, Protostomia, and Bilateria. Deuterostomia, however, was never recovered, because the rRNA of urochordates goes (nonsignificantly) near the base of the Bilateria. Counterintuitively, when we modeled the evolution of the paired sites, phylogenetic resolution was not increased over traditional tree-building models that assume all sites in rRNA evolve independently. The rRNA genes of non-bilaterians contain a higher % AT than do those of most bilaterians. The rRNA genes of Acoela and Myzostomida were found to be secondarily shortened, AT-enriched, and highly modified, throwing some doubt on the location of these worms at the base of Bilateria in the rRNA tree--especially myzostomids, which other evidence suggests are annelids instead. Other findings are marsupial-with-placental mammals, arrowworms in Ecdysozoa (well supported here but contradicted by morphology), and Placozoa as sister to Cnidaria. Finally, despite the difficulties, the rRNA-gene trees are in strong concordance with trees derived from multiple protein-coding genes in supporting the new animal phylogeny. (c) 2009 Elsevier Inc. All rights reserved.

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

PubMed Central

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Geranyl diphosphate synthase large subunit, and methods of use

DOEpatents

Croteau, Rodney B.; Burke, Charles C.; Wildung, Mark R.

2001-10-16

A cDNA encoding geranyl diphosphate synthase large subunit from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase large subunit). In another aspect, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase large subunit. In yet another aspect, the present invention provides isolated, recombinant geranyl diphosphate synthase protein comprising an isolated, recombinant geranyl diphosphate synthase large subunit protein and an isolated, recombinant geranyl diphosphate synthase small subunit protein. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase.

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania

PubMed Central

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-01-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved. PMID:22767185

The Human Oral Microbiome Database: a web accessible resource for investigating oral microbe taxonomic and genomic information

PubMed Central

Chen, Tsute; Yu, Wen-Han; Izard, Jacques; Baranova, Oxana V.; Lakshmanan, Abirami; Dewhirst, Floyd E.

2010-01-01

The human oral microbiome is the most studied human microflora, but 53% of the species have not yet been validly named and 35% remain uncultivated. The uncultivated taxa are known primarily from 16S rRNA sequence information. Sequence information tied solely to obscure isolate or clone numbers, and usually lacking accurate phylogenetic placement, is a major impediment to working with human oral microbiome data. The goal of creating the Human Oral Microbiome Database (HOMD) is to provide the scientific community with a body site-specific comprehensive database for the more than 600 prokaryote species that are present in the human oral cavity based on a curated 16S rRNA gene-based provisional naming scheme. Currently, two primary types of information are provided in HOMD—taxonomic and genomic. Named oral species and taxa identified from 16S rRNA gene sequence analysis of oral isolates and cloning studies were placed into defined 16S rRNA phylotypes and each given unique Human Oral Taxon (HOT) number. The HOT interlinks phenotypic, phylogenetic, genomic, clinical and bibliographic information for each taxon. A BLAST search tool is provided to match user 16S rRNA gene sequences to a curated, full length, 16S rRNA gene reference data set. For genomic analysis, HOMD provides comprehensive set of analysis tools and maintains frequently updated annotations for all the human oral microbial genomes that have been sequenced and publicly released. Oral bacterial genome sequences, determined as part of the Human Microbiome Project, are being added to the HOMD as they become available. We provide HOMD as a conceptual model for the presentation of microbiome data for other human body sites. Database URL: http://www.homd.org PMID:20624719

How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?

PubMed

Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T

2018-03-15

The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA gene sequences at some threshold of nucleotide identity, typically 97% or 98.5%. Here, we explore how well this strategy reflects the more accurate whole-genome-based proxies and determine the frequency with which the high conservation of 16S rRNA sequences masks substantial species-level diversity. Copyright © 2018 American Society for Microbiology.

Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

PubMed

Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

2016-07-01

Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys

PubMed Central

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira, and Thalassolituus, as well as the Alphaproteobacterial genus Thalassospira. Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys. PMID:28567035

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys.

PubMed

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira , and Thalassolituus , as well as the Alphaproteobacterial genus Thalassospira . Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys.

Equally parsimonious pathways through an RNA sequence space are not equally likely

NASA Technical Reports Server (NTRS)

Lee, Y. H.; DSouza, L. M.; Fox, G. E.

1997-01-01

An experimental system for determining the potential ability of sequences resembling 5S ribosomal RNA (rRNA) to perform as functional 5S rRNAs in vivo in the Escherichia coli cellular environment was devised previously. Presumably, the only 5S rRNA sequences that would have been fixed by ancestral populations are ones that were functionally valid, and hence the actual historical paths taken through RNA sequence space during 5S rRNA evolution would have most likely utilized valid sequences. Herein, we examine the potential validity of all sequence intermediates along alternative equally parsimonious trajectories through RNA sequence space which connect two pairs of sequences that had previously been shown to behave as valid 5S rRNAs in E. coli. The first trajectory requires a total of four changes. The 14 sequence intermediates provide 24 apparently equally parsimonious paths by which the transition could occur. The second trajectory involves three changes, six intermediate sequences, and six potentially equally parsimonious paths. In total, only eight of the 20 sequence intermediates were found to be clearly invalid. As a consequence of the position of these invalid intermediates in the sequence space, seven of the 30 possible paths consisted of exclusively valid sequences. In several cases, the apparent validity/invalidity of the intermediate sequences could not be anticipated on the basis of current knowledge of the 5S rRNA structure. This suggests that the interdependencies in RNA sequence space may be more complex than currently appreciated. If ancestral sequences predicted by parsimony are to be regarded as actual historical sequences, then the present results would suggest that they should also satisfy a validity requirement and that, in at least limited cases, this conjecture can be tested experimentally.

Candida sirachaensis sp. nov. and Candida sakaeoensis sp. nov. two anamorphic yeast species from phylloplane in Thailand.

PubMed

Limtong, Savitree; Koowadjanakul, Nampueng; Jindamorakot, Sasitorn; Yongmanitchai, Wichien; Nakase, Takashi

2012-08-01

Three strains (LM008(T), LM068 and LM078(T)), representing two novel yeast species were isolated from the phylloplane of three plant species by an enrichment technique. On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, and the sequence analysis of the D1/D2 domain of the large subunit rRNA gene and the internal spacer region, the three strains were assigned as two novel Candida species. Strain LM008(T) was assigned to be Candida sirachaensis sp. nov. (type strain LM008(T) = BCC 47628(T) = NBRC 108605(T) CBS 12094(T)) in the Starmerella clade. Two strains (LM068 and LM078(T)) represent a single species in the Lodderomyces-Spathaspora clade for which the name Candida sakaeoensis sp. nov. is proposed with the type strain LM078(T) = BCC 47632(T) = NBRC 108895(T) = CBS 12318(T).

Wickerhamomyces xylosica sp. nov. and Candida phayaonensis sp. nov., two xylose-assimilating yeast species from soil.

PubMed

Limtong, Savitree; Nitiyon, Sukanya; Kaewwichian, Rungluk; Jindamorakot, Sasitorn; Am-In, Somjit; Yongmanitchai, Wichien

2012-11-01

Two strains (NT29(T) and NT31(T)) of xylose-assimilating yeasts were obtained from soils collected in northern Thailand. On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, and sequence analysis of the D1/D2 domain of the large subunit rRNA gene and the internal transcribed spacer region, the two strains were found to represent two novel ascomycete yeast species. Strain NT29(T) was assigned to the genus Candida belonging to the Pichia clade as a representative of Candida phayaonensis sp. nov.; the type strain is NT29(T) (=BCC 47634(T)=NBRC 108868(T)=CBS 12319(T)). Strain NT31(T) represented a novel Wickerhamomyces species, which was named Wickerhamomyces xylosica sp. nov.; the type strain is NT31(T) (=BCC 47635(T)=NBRC 108869(T)=CBS 12320(T)).

Stray cats are more frequently infected with zoonotic protists than pet cats.

PubMed

Kvac, Martin; Hofmannova, Lada; Ortega, Ynes; Holubova, Nikola; Horcickova, Michaela; Kicia, Marta; Hlaskova, Lenka; Kvetonova, Dana; Sak, Bohumil; McEvoy, John

2017-12-06

Faecal samples were collected from cats kept as pets (n = 120) and stray cats (n = 135) in Central Europe (Czech Republic, Poland and Slovakia) and screened for the presence of Cryptosporidium spp., Giardia intestinalis (Kunstler, 1882), Encephalitozoon spp. and Enterocytozoon bieneusi Desportes, Le Charpentier, Galian, Bernard, Cochand-Priollet, Lavergne, Ravisse et Modigliani, 1985 by PCR analysis of the small-subunit of rRNA (Cryptosporidium spp. and G. intestinalis) and ITS (microsporidia) genes. Sequence analysis of targeted genes revealed the presence of C. felis Iseki, 1979, G. intestinalis assemblage F, E. cuniculi Levaditi, Nicolau et Schoen, 1923 genotype II, and E. bieneusi genotype D. There was no correlation between the occurrence of detected parasites and sex, presence of diarrhoea or drug treatment (drug containing pyrantel and praziquantel). Compared to pet cats (7%), stray cats (30%) were statistically more frequently infected with protist parasites and overall may present a greater risk to human health.

The molecular epidemiology of cholera in Latin America.

PubMed

Wachsmuth, I K; Evins, G M; Fields, P I; Olsvik, O; Popovic, T; Bopp, C A; Wells, J G; Carrillo, C; Blake, P A

1993-03-01

To explain the sudden appearance and rapid spread of cholera in Latin America in January 1991, molecular techniques were used to define Vibrio cholerae O1 isolates from around the world. Restriction fragment length polymorphisms of rRNA and ctxA genes, DNA sequence of cholera toxin B subunit gene ctxB, and multilocus enzyme electrophoresis data were used to characterize 197 isolates. Worldwide, there are at least four distinct toxigenic El Tor V. cholerae O1 clones: the seventh pandemic (Eastern Hemisphere), US Gulf Coast, Australian, and Latin American. Nontoxigenic V. cholerae O1 previously isolated in Brazil, Mexico, and Peru are unlike current toxigenic isolates. The Latin American clone probably represents an extension of the seventh pandemic into the Western Hemisphere, while the US Gulf Coast clone most likely evolved separately. These data will be useful in monitoring the spread of cholera, determining the origin of outbreaks in both hemispheres, and implicating specific vehicles of transmission.

Diversity, Productivity, and Stability of an Industrial Microbial Ecosystem

PubMed Central

Tang, Pei-Zhong; Becker, Scott; Hoang, Tony; Bilgin, Damla; Lim, Yan Wei; Peterson, Todd C.; Mayfield, Stephen; Haerizadeh, Farzad; Shurin, Jonathan B.; Bafna, Vineet; McBride, Robert

2016-01-01

Managing ecosystems to maintain biodiversity may be one approach to ensuring their dynamic stability, productivity, and delivery of vital services. The applicability of this approach to industrial ecosystems that harness the metabolic activities of microbes has been proposed but has never been tested at relevant scales. We used a tag-sequencing approach with bacterial small subunit rRNA (16S) genes and eukaryotic internal transcribed spacer 2 (ITS2) to measuring the taxonomic composition and diversity of bacteria and eukaryotes in an open pond managed for bioenergy production by microalgae over a year. Periods of high eukaryotic diversity were associated with high and more-stable biomass productivity. In addition, bacterial diversity and eukaryotic diversity were inversely correlated over time, possibly due to their opposite responses to temperature. The results indicate that maintaining diverse communities may be essential to engineering stable and productive bioenergy ecosystems using microorganisms. PMID:26896141

Common occurrence of zoonotic pathogen Cryptosporidium meleagridis in broiler chickens and turkeys in Algeria.

PubMed

Baroudi, Djamel; Khelef, Djamel; Goucem, Rachid; Adjou, Karim T; Adamu, Haileeyesus; Zhang, Hongwei; Xiao, Lihua

2013-09-23

Only a small number of birds have been identified by molecular techniques as having Cryptosporidium meleagridis, the third most important species for human cryptosporidiosis. In this study, using PCR-RFLP analysis of the small subunit (SSU) rRNA gene, we examined the ileum of 90 dead chickens from 23 farms and 57 dead turkeys from 16 farms in Algeria for Cryptosporidium spp. C. meleagridis-positive specimens were subtyped by sequence analysis of the 60 kDa glycoprotein gene. Cryptosporidium infection rates were 34% and 44% in chickens and turkeys, respectively, with all positive turkeys (25) and most positive chickens (26/31) having C. meleagridis. All C. meleagridis specimens belonged to a new subtype family. The frequent occurrence of C. meleagridis in chickens and turkeys illustrates the potential for zoonotic transmission of cryptosporidiosis in Algeria. Published by Elsevier B.V.

Conserved and variable domains of RNase MRP RNA.

PubMed

Dávila López, Marcela; Rosenblad, Magnus Alm; Samuelsson, Tore

2009-01-01

Ribonuclease MRP is a eukaryotic ribonucleoprotein complex consisting of one RNA molecule and 7-10 protein subunits. One important function of MRP is to catalyze an endonucleolytic cleavage during processing of rRNA precursors. RNase MRP is evolutionary related to RNase P which is critical for tRNA processing. A large number of MRP RNA sequences that now are available have been used to identify conserved primary and secondary structure features of the molecule. MRP RNA has structural features in common with P RNA such as a conserved catalytic core, but it also has unique features and is characterized by a domain highly variable between species. Information regarding primary and secondary structure features is of interest not only in basic studies of the function of MRP RNA, but also because mutations in the RNA give rise to human genetic diseases such as cartilage-hair hypoplasia.

Diversity, Productivity, and Stability of an Industrial Microbial Ecosystem.

PubMed

Beyter, Doruk; Tang, Pei-Zhong; Becker, Scott; Hoang, Tony; Bilgin, Damla; Lim, Yan Wei; Peterson, Todd C; Mayfield, Stephen; Haerizadeh, Farzad; Shurin, Jonathan B; Bafna, Vineet; McBride, Robert

2016-04-01

Managing ecosystems to maintain biodiversity may be one approach to ensuring their dynamic stability, productivity, and delivery of vital services. The applicability of this approach to industrial ecosystems that harness the metabolic activities of microbes has been proposed but has never been tested at relevant scales. We used a tag-sequencing approach with bacterial small subunit rRNA (16S) genes and eukaryotic internal transcribed spacer 2 (ITS2) to measuring the taxonomic composition and diversity of bacteria and eukaryotes in an open pond managed for bioenergy production by microalgae over a year. Periods of high eukaryotic diversity were associated with high and more-stable biomass productivity. In addition, bacterial diversity and eukaryotic diversity were inversely correlated over time, possibly due to their opposite responses to temperature. The results indicate that maintaining diverse communities may be essential to engineering stable and productive bioenergy ecosystems using microorganisms. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Candida asparagi sp. nov., Candida diospyri sp. nov. and Candida qinlingensis sp. nov., novel anamorphic, ascomycetous yeast species.

PubMed

Lu, Hui-Zhong; Jia, Jian-Hua; Wang, Qi-Ming; Bai, Feng-Yan

2004-07-01

Among ascomycetous yeasts that were isolated from several nature reserve areas in China, three anamorphic strains isolated from soil (QL 5-5T) and fruit (QL 21-2T and SN 15-1T) were revealed, by conventional characterization and molecular phylogenetic analysis based on internal transcribed spacer and large subunit (26S) rRNA gene D1/D2 region sequencing, to represent three novel species in the genus Candida. Candida qinlingensis sp. nov. (type strain, QL 5-5T=AS 2.2524T=CBS 9768T) was related closely to a teleomorphic species, Williopsis pratensis. The close relatives of Candida diospyri sp. nov. (type strain, QL 21-2T=AS 2.2525T=CBS 9769T) are Candida friedrichii and Candida membranifaciens. Candida asparagi sp. nov. (type strain, SN 15-1T=AS 2.2526T=CBS 9770T) forms a clade with Candida fructus.

DNA barcode assessment of Ceramiales (Rhodophyta) in the intertidal zone of the northwestern Yellow Sea

NASA Astrophysics Data System (ADS)

Du, Guoying; Wu, Feifei; Guo, Hao; Xue, Hongfan; Mao, Yunxiang

2015-05-01

A total of 142 specimens of Ceramiales (Rhodophyta) were collected each month from October 2011 to November 2012 in the intertidal zone of the northwestern Yellow Sea. These specimens covered 21 species, 14 genera, and four families. Cluster analyses show that the specimens had a high diversity for the three DNA markers, namely, partial large subunit rRNA gene (LSU), universal plastid amplicon (UPA), and partial mitochondrial cytochrome c oxidase subunit I gene (COI). No intraspecific divergence was found in our collection for these markers, except for a 1-3 bp divergence in the COI of Ceramium kondoi, Symphyocladia latiuscula, and Neosiphonia japonica. Because short DNA markers were used, the phylogenetic relationships of higher taxonomic levels were hard to evaluate with poor branch support. More than half species of our collection failed to find their matched sequences owing to shortage information of DNA barcodes for macroalgae in GenBank or BOLD (Barcode of Life Data) Systems. Three specimens were presumed as Heterosiphonia crispella by cluster analyses on DNA barcodes assisted by morphological identification, which was the first record in the investigated area, implying that it might be a cryptic or invasive species in the coastal area of northwestern Yellow Sea. In the neighbor-joining trees of all three DNA markers, Heterosiphonia japonica converged with Dasya spp. and was distant from the other Heterosiphonia spp., implying that H. japonica had affinities to the genus Dasya. The LSU and UPA markers amplified and sequenced easier than the COI marker across the Ceramiales species, but the COI had a higher ability to discriminate between species.

Morphometric and molecular data on two mitochondrial genes of a newly discovered chimaeran fish ( Hydrolagus melanophasma, Chondrichthyes)

NASA Astrophysics Data System (ADS)

De La Cruz-Agüero, José; García-Rodríguez, Francisco Javier; Cota-Gómez, Víctor Manuel; Melo-Barrera, Felipe Neri; González-Armas, Rogelio

2012-06-01

Fresh and preserved (type material) specimens of the black ghost chimaera Hydrolagus melanophasma were compared for morphometric characteristics. A molecular comparison was also performed on two mitochondrial gene sequences (12S rRNA and 16S rRNA gene sequences). While significant differences in measurements were found, the differences were not attributable to sexual dimorphism or the quality of the specimens, but to the sample size and the type of statistical tests. The result of the genetic characterization showed that 12S rRNA and 16S rRNA genes represented robust molecular markers that characterized the species.

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

PubMed Central

Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

2017-01-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

A new microsporidian parasite, Potaspora morhaphis n. gen., n. sp. (Microsporidia) infecting the Teleostean fish, Potamorhaphis guianensis from the River Amazon. Morphological, ultrastructural and molecular characterization.

PubMed

Casal, G; Matos, E; Teles-Grilo, M L; Azevedo, C

2008-08-01

A fish-infecting Microsporidia Potaspora morhaphis n. gen., n. sp. found adherent to the wall of the coelomic cavity of the freshwater fish, Potamorhaphis guianensis, from lower Amazon River is described, based on light microscope and ultrastructural characteristics. This microsporidian forms whitish xenomas distinguished by the numerous filiform and anastomosed microvilli. The xenoma was completely filled by several developmental stages. In all of these stages, the nuclei are monokaryotic and develop in direct contact with host cell cytoplasm. The merogonial plasmodium divides by binary fission and the disporoblastic pyriform spores of sporont origin measure 2.8+/-0.3 x 1.5+/-0.2 microm. In mature spores the polar filament was arranged into 9-10 coils in 2 layers. The polaroplast had 2 distinct regions around the manubrium and an electron-dense globule was observed. The small subunit, intergenic space and partial large subunit rRNA gene were sequenced and maximum parsimony analysis placed the microsporidian described here in the clade that includes the genera Kabatana, Microgemma, Spraguea and Tetramicra. The ultrastructural morphology of the xenoma, and the developmental stages including the spores of this microsporidian parasite, as well as the phylogenetic analysis, suggest the erection of a new genus and species.

Proteomic analysis of carbon concentrating chemolithotrophic bacteria Serratia sp. for sequestration of carbon dioxide.

PubMed

Bharti, Randhir K; Srivastava, Shaili; Thakur, Indu Shekhar

2014-01-01

A chemolithotrophic bacterium enriched in the chemostat in presence of sodium bicarbonate as sole carbon source was identified as Serratia sp. by 16S rRNA sequencing. Carbon dioxide sequestering capacity of bacterium was detected by carbonic anhydrase enzyme and ribulose-1, 5- bisphosphate carboxylase/oxygenase (RuBisCO). The purified carbonic anhydrase showed molecular weight of 29 kDa. Molecular weight of RuBisCO was 550 kDa as determined by fast protein liquid chromatography (FPLC), however, sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) showed presence of two subunits whose molecular weights were 56 and 14 kDa. The Western blot analysis of the crude protein and purified sample cross reacted with RuBisCO large-subunit polypeptides antibodies showed strong band pattern at molecular weight around 56 kDa regions. Whole cell soluble proteins of Serratia sp. grown under autotrophic and heterotrophic conditions were resolved by two-dimensional gel electrophoresis and MALDI-TOF/MS for differential expression of proteins. In proteomic analysis of 63 protein spots, 48 spots were significantly up-regulated in the autotrophically grown cells; seven enzymes showed its utilization in autotrophic carbon fixation pathways and other metabolic activities of bacterium including lipid metabolisms indicated sequestration potency of carbon dioxide and production of biomaterials.

Proteomic Analysis of Carbon Concentrating Chemolithotrophic Bacteria Serratia sp. for Sequestration of Carbon Dioxide

PubMed Central

Bharti, Randhir K.; Srivastava, Shaili; Thakur, Indu Shekhar

2014-01-01

A chemolithotrophic bacterium enriched in the chemostat in presence of sodium bicarbonate as sole carbon source was identified as Serratia sp. by 16S rRNA sequencing. Carbon dioxide sequestering capacity of bacterium was detected by carbonic anhydrase enzyme and ribulose-1, 5- bisphosphate carboxylase/oxygenase (RuBisCO). The purified carbonic anhydrase showed molecular weight of 29 kDa. Molecular weight of RuBisCO was 550 kDa as determined by fast protein liquid chromatography (FPLC), however, sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) showed presence of two subunits whose molecular weights were 56 and 14 kDa. The Western blot analysis of the crude protein and purified sample cross reacted with RuBisCO large-subunit polypeptides antibodies showed strong band pattern at molecular weight around 56 kDa regions. Whole cell soluble proteins of Serratia sp. grown under autotrophic and heterotrophic conditions were resolved by two-dimensional gel electrophoresis and MALDI-TOF/MS for differential expression of proteins. In proteomic analysis of 63 protein spots, 48 spots were significantly up-regulated in the autotrophically grown cells; seven enzymes showed its utilization in autotrophic carbon fixation pathways and other metabolic activities of bacterium including lipid metabolisms indicated sequestration potency of carbon dioxide and production of biomaterials. PMID:24619032

The carboxyl-terminus directs TAF(I)48 to the nucleus and nucleolus and associates with multiple nuclear import receptors.

PubMed

Dynes, Joseph L; Xu, Shuping; Bothner, Sarah; Lahti, Jill M; Hori, Roderick T

2004-03-01

The protein complex Selectivity Factor 1, composed of TBP, TAF(I)48, TAF(I)63 and TAF(I)110, is required for rRNA transcription by RNA polymerase I in the nucleolus. The steps involved in targeting Selectivity Factor 1 will be dependent on the transport pathways that are used and the localization signals that direct this trafficking. In order to investigate these issues, we characterized human TAF(I)48, a subunit of Selectivity Factor 1. By domain analysis of TAF(I)48, the carboxyl-terminal 51 residues were found to be required for the localization of TAF(I)48, as well as sufficient to direct Green Fluorescent Protein to the nucleus and nucleolus. The carboxyl-terminus of TAF(I)48 also has the ability to associate with multiple members of the beta-karyopherin family of nuclear import receptors, including importin beta (karyopherin beta1), transportin (karyopherin beta2) and RanBP5 (karyopherin beta3), in a Ran-dependent manner. This property of interacting with multiple beta-karyopherins has been previously reported for the nuclear localization signals of some ribosomal proteins that are likewise directed to the nucleolus. This study identifies the first nuclear import sequence identified within the TBP-Associated Factor subunits of Selectivity Factor 1.

Characterization of the two intra-individual sequence variants in the 18S rRNA gene in the plant parasitic nematode, Rotylenchulus reniformis.

PubMed

Nyaku, Seloame T; Sripathi, Venkateswara R; Kantety, Ramesh V; Gu, Yong Q; Lawrence, Kathy; Sharma, Govind C

2013-01-01

The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene.

Characterization of the Two Intra-Individual Sequence Variants in the 18S rRNA Gene in the Plant Parasitic Nematode, Rotylenchulus reniformis

PubMed Central

Nyaku, Seloame T.; Sripathi, Venkateswara R.; Kantety, Ramesh V.; Gu, Yong Q.; Lawrence, Kathy; Sharma, Govind C.

2013-01-01

The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene. PMID:23593343

16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

PubMed

Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

2013-12-01

Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.

MetaMetaDB: A Database and Analytic System for Investigating Microbial Habitability

PubMed Central

Yang, Ching-chia; Iwasaki, Wataru

2014-01-01

MetaMetaDB (http://mmdb.aori.u-tokyo.ac.jp/) is a database and analytic system for investigating microbial habitability, i.e., how a prokaryotic group can inhabit different environments. The interaction between prokaryotes and the environment is a key issue in microbiology because distinct prokaryotic communities maintain distinct ecosystems. Because 16S ribosomal RNA (rRNA) sequences play pivotal roles in identifying prokaryotic species, a system that comprehensively links diverse environments to 16S rRNA sequences of the inhabitant prokaryotes is necessary for the systematic understanding of the microbial habitability. However, existing databases are biased to culturable prokaryotes and exhibit limitations in the comprehensiveness of the data because most prokaryotes are unculturable. Recently, metagenomic and 16S rRNA amplicon sequencing approaches have generated abundant 16S rRNA sequence data that encompass unculturable prokaryotes across diverse environments; however, these data are usually buried in large databases and are difficult to access. In this study, we developed MetaMetaDB (Meta-Metagenomic DataBase), which comprehensively and compactly covers 16S rRNA sequences retrieved from public datasets. Using MetaMetaDB, users can quickly generate hypotheses regarding the types of environments a prokaryotic group may be adapted to. We anticipate that MetaMetaDB will improve our understanding of the diversity and evolution of prokaryotes. PMID:24475242

Transformation of Chloroplast Ribosomal RNA Genes in Chlamydomonas: Molecular and Genetic Characterization of Integration Events

PubMed Central

Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.

1990-01-01

Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764

A framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates.

PubMed

Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin

2015-03-01

The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific micropollutants. This work is an important step towards developing tools to predict biotransformation rates in WWTPs based on taxonomic composition. Copyright © 2014 Elsevier Ltd. All rights reserved.

SSU rRNA gene sequence reveals two genotypes of Spironucleus barkhanus (Diplomonadida) from farmed and wild Arctic charr Salvelinus alpinus.

PubMed

Jørgensen, Anders; Sterud, Erik

2004-11-23

Spironucleus barkhanus isolated from the blood of Arctic charr Salvelinus alpinus from a marine fish farm were genetically compared with S. barkhanus isolated from the gall bladder of wild Arctic charr. The wild Arctic charr were caught in the lake used as the water source for the hatchery from which the farmed fish originated. Sequencing of the small subunit ribosomal RNA gene (SSU rDNA) from these 2 populations showed that the isolates obtained from farmed and wild Arctic charr were only 92.7 % similar. Based on the sequence differences between these isolates, it is concluded that the parasites isolated from the farmed fish have not been transmitted from wild Arctic charr in the hatchery's fresh water source. It is therefore most likely that the farmed fish were infected by S. barkhanus after they were transferred to seawater. S. barkhanus isolated from diseased farmed Arctic charr were 99.7% similar to the isolates obtained from diseased farmed Chinook (Canada) and Atlantic salmon (Norway). The high degree of sequence similarity between S. barkhanus from farmed Arctic charr, Chinook and Atlantic salmon indicates that systemic spironucleosis may be caused by specific strains/variants of this parasite. The genetic differences between the isolates of farmed and wild fish are of such magnitude that their conspecificity should be questioned.

The Microbial Genomes Atlas (MiGA) webserver: taxonomic and gene diversity analysis of Archaea and Bacteria at the whole genome level.

PubMed

Rodriguez-R, Luis M; Gunturu, Santosh; Harvey, William T; Rosselló-Mora, Ramon; Tiedje, James M; Cole, James R; Konstantinidis, Konstantinos T

2018-06-14

The small subunit ribosomal RNA gene (16S rRNA) has been successfully used to catalogue and study the diversity of prokaryotic species and communities but it offers limited resolution at the species and finer levels, and cannot represent the whole-genome diversity and fluidity. To overcome these limitations, we introduced the Microbial Genomes Atlas (MiGA), a webserver that allows the classification of an unknown query genomic sequence, complete or partial, against all taxonomically classified taxa with available genome sequences, as well as comparisons to other related genomes including uncultivated ones, based on the genome-aggregate Average Nucleotide and Amino Acid Identity (ANI/AAI) concepts. MiGA integrates best practices in sequence quality trimming and assembly and allows input to be raw reads or assemblies from isolate genomes, single-cell sequences, and metagenome-assembled genomes (MAGs). Further, MiGA can take as input hundreds of closely related genomes of the same or closely related species (a so-called 'Clade Project') to assess their gene content diversity and evolutionary relationships, and calculate important clade properties such as the pangenome and core gene sets. Therefore, MiGA is expected to facilitate a range of genome-based taxonomic and diversity studies, and quality assessment across environmental and clinical settings. MiGA is available at http://microbial-genomes.org/.

Molecular phylogeny of noctilucoid dinoflagellates (Noctilucales, Dinophyceae).

PubMed

Gómez, Fernando; Moreira, David; López-García, Purificación

2010-07-01

The order Noctilucales or class Noctiluciphyceae encompasses three families of aberrant dinoflagellates (Noctilucaceae, Leptodiscaceae and Kofoidiniaceae) that, at least in some life stages, lack typical dinoflagellate characters such as the ribbon-like transversal flagellum or condensed chromosomes. Noctiluca scintillans, the first dinoflagellate to be described, has been intensively investigated. However, its phylogenetic position based on the small subunit ribosomal DNA (SSU rDNA) sequence is unstable and controversial. Noctiluca has been placed either as an early diverging lineage that diverged after Oxyrrhis and before the dinokaryotes -core dinoflagellates- or as a recent lineage branching from unarmoured dino fl agellates in the order Gymnodiniales. So far, the lack of other noctilucoid sequences has hampered the elucidation of their phylogenetic relationships to other dino fl agellates. Furthermore, even the monophyly of the noctilucoids remained uncertain. We have determined SSU rRNA gene sequences for Kofoidiniaceae, those of the type Spatulodinium (=Gymnodinium) pseudonoctiluca and another Spatulodinium species, as well as of two species of Kofoidinium, and the first gene sequence of Leptodiscaceae, that of Abedinium (=Leptophyllus) dasypus. These taxa were collected from their type localities, the English Channel and the NW Mediterranean Sea, respectively. Phylogenetic analyses place the Noctilucales as a monophyletic group at a basal position close to parasites of the Marine Alveolate Group I (MAGI) and the Syndiniales (MAGII), before the core of dinokaryotic dinoflagellates, although with moderate support. 2010 Elsevier GmbH. All rights reserved.

Mitochondrial DNA Sequence Divergence among Meloidogyne incognita, Romanomermis culicivorax, Ascaris suum, and Caenorhabditis elegans

PubMed Central

Powers, T. O.; Harris, T. S.; Hyman, B. C.

1993-01-01

Mitochondrial DNA sequences were obtained from the NADH dehydrogenase subunit 3 (ND3), large rRNA, and cytochrome b genes from Meloidogyne incognita and Romanomermis culicivorax. Both species show considerable genetic distance within these same genes when compared with Caenorhabditis elegans or Ascaris suum, two species previously analyzed. Caenorhabditis, Ascaris, and Meloidogyne were selected as representatives of three subclasses in the nematode class Secernentea: Rhabditia, Spiruria, and Diplogasteria, respectively. Romanomermis served as a representative out-group of the class Adenophorea. The divergence between the phytoparasitic lineage (represented by Meloidogyne) and the three other species is so great that virtually every variable position in these genes appears to have accumulated multiple mutations, obscuring the phylogenetic information obtainable from these comparisons. The 39 and 42% amino acid similarity between the M. incognita and C. elegans ND3 and cytochrome b coding sequences, respectively, are approximately the same as those of C. elegans-mouse comparisons for the same genes (26 and 44%). This discovery calls into question the feasibility of employing cloned C. elegans probes as reagents to isolate phytoparasitic nematode genes. The genetic distance between the phytoparasitic nematode lineage and C. elegans markedly contrasts with the 79% amino acid similarity between C. elegans and A. suum for the same sequences. The molecular data suggest that Caenorhabditis and Ascaris belong to the same subclass. PMID:19279810

SSU rRNA-based phylogenetic position of the genera Amoeba and Chaos (Lobosea, Gymnamoebia): the origin of gymnamoebae revisited.

PubMed

Bolivar, I; Fahrni, J F; Smirnov, A; Pawlowski, J

2001-12-01

Naked lobose amoebae (gymnamoebae) are among the most abundant group of protists present in all aquatic and terrestrial biotopes. Yet, because of lack of informative morphological characters, the origin and evolutionary history of gymnamoebae are poorly known. The first molecular studies revealed multiple origins for the amoeboid lineages and an extraordinary diversity of amoebae species. Molecular data, however, exist only for a few species of the numerous taxa belonging to this group. Here, we present the small-subunit (SSU) rDNA sequences of four species of typical large gymnamoebae: Amoeba proteus, Amoeba leningradensis, Chaos nobile, and Chaos carolinense. Sequence analysis suggests that the four species are closely related to the species of genera Saccamoeba, Leptomyxa, Rhizamoeba, Paraflabellula, Hartmannella, and Echinamoeba. All of them form a relatively well-supported clade, which corresponds to the subclass Gymnamoebia, in agreement with morphology-based taxonomy. The other gymnamoebae cluster in small groups or branch separately. Their relationships change depending on the type of analysis and the model of nucleotide substitution. All gymnamoebae branch together in Neighbor-Joining analysis with corrections for among-site rate heterogeneity and proportion of invariable sites. This clade, however, is not statistically supported by SSU rRNA gene sequences and further analysis of protein sequence data will be necessary to test the monophyly of gymnamoebae.

Mitochondrial Genome Sequence of the Legume Vicia faba

PubMed Central

Negruk, Valentine

2013-01-01

The number of plant mitochondrial genomes sequenced exceeds two dozen. However, for a detailed comparative study of different phylogenetic branches more plant mitochondrial genomes should be sequenced. This article presents sequencing data and comparative analysis of mitochondrial DNA (mtDNA) of the legume Vicia faba. The size of the V. faba circular mitochondrial master chromosome of cultivar Broad Windsor was estimated as 588,000 bp with a genome complexity of 387,745 bp and 52 conservative mitochondrial genes; 32 of them encoding proteins, 3 rRNA, and 17 tRNA genes. Six tRNA genes were highly homologous to chloroplast genome sequences. In addition to the 52 conservative genes, 114 unique open reading frames (ORFs) were found, 36 without significant homology to any known proteins and 29 with homology to the Medicago truncatula nuclear genome and to other plant mitochondrial ORFs, 49 ORFs were not homologous to M. truncatula but possessed sequences with significant homology to other plant mitochondrial or nuclear ORFs. In general, the unique ORFs revealed very low homology to known closely related legumes, but several sequence homologies were found between V. faba, Beta vulgaris, Nicotiana tabacum, Vitis vinifera, and even the monocots Oryza sativa and Zea mays. Most likely these ORFs arose independently during angiosperm evolution (Kubo and Mikami, 2007; Kubo and Newton, 2008). Computational analysis revealed in total about 45% of V. faba mtDNA sequence being homologous to the Medicago truncatula nuclear genome (more than to any sequenced plant mitochondrial genome), and 35% of this homology ranging from a few dozen to 12,806 bp are located on chromosome 1. Apparently, mitochondrial rrn5, rrn18, rps10, ATP synthase subunit alpha, cox2, and tRNA sequences are part of transcribed nuclear mosaic ORFs. PMID:23675376

Bacterial diversity in the active stage of a bioremediation system for mineral oil hydrocarbon-contaminated soils.

PubMed

Popp, Nicole; Schlömann, Michael; Mau, Margit

2006-11-01

Soils contaminated with mineral oil hydrocarbons are often cleaned in off-site bioremediation systems. In order to find out which bacteria are active during the degradation phase in such systems, the diversity of the active microflora in a degrading soil remediation system was investigated by small-subunit (SSU) rRNA analysis. Two sequential RNA extracts from one soil sample were generated by a procedure incorporating bead beating. Both extracts were analysed separately by generating individual SSU rDNA clone libraries from cDNA of the two extracts. The sequencing results showed moderate diversity. The two clone libraries were dominated by Gammaproteobacteria, especially Pseudomonas spp. Alphaproteobacteria and Betaproteobacteria were two other large groups in the clone libraries. Actinobacteria, Firmicutes, Bacteroidetes and Epsilonproteobacteria were detected in lower numbers. The obtained sequences were predominantly related to genera for which cultivated representatives have been described, but were often clustered together in the phylogenetic tree, and the sequences that were most similar were originally obtained from soils and not from pure cultures. Most of the dominant genera in the clone libraries, e.g. Pseudomonas, Acinetobacter, Sphingomonas, Acidovorax and Thiobacillus, had already been detected in (mineral oil hydrocarbon) contaminated environmental samples. The occurrence of the genera Zymomonas and Rhodoferax was novel in mineral oil hydrocarbon-contaminated soil.

A dual PCR-based sequencing approach for the identification and discrimination of Echinococcus and Taenia taxa.

PubMed

Boubaker, Ghalia; Marinova, Irina; Gori, Francesca; Hizem, Amani; Müller, Norbert; Casulli, Adriano; Jerez Puebla, Luis Enrique; Babba, Hamouda; Gottstein, Bruno; Spiliotis, Markus

2016-08-01

Reliable and rapid molecular tools for the genetic identification and differentiation of Echinococcus species and/or genotypes are crucial for studying spatial and temporal transmission dynamics. Here, we describe a novel dual PCR targeting regions in the small (rrnS) and large (rrnL) subunits of mitochondrial ribosomal RNA (rRNA) genes, which enables (i) the specific identification of species and genotypes of Echinococcus (rrnS + L-PCR) and/or (ii) the identification of a range of taeniid cestodes, including different species of Echinococcus, Taenia and some others (17 species of diphyllidean helminths). This dual PCR approach was highly sensitive, with an analytical detection limit of 1 pg for genomic DNA of Echinococcus. Using concatenated sequence data derived from the two gene markers (1225 bp), we identified five unique and geographically informative single nucleotide polymorphisms (SNPs) that allowed genotypes (G1 and G3) of Echinococcus granulosus sensu stricto to be distinguished, and 25 SNPs that allowed differentiation within Echinococcus canadensis (G6/7/8/10). In conclusion, we propose that this dual PCR-based sequencing approach can be used for molecular epidemiological studies of Echinococcus and other taeniid cestodes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Specificity in diversity: single origin of a widespread ciliate-bacteria symbiosis

PubMed Central

Schwaha, Thomas; Volland, Jean-Marie; Huettel, Bruno; Dubilier, Nicole; Gruber-Vodicka, Harald R.

2017-01-01

Symbioses between eukaryotes and sulfur-oxidizing (thiotrophic) bacteria have convergently evolved multiple times. Although well described in at least eight classes of metazoan animals, almost nothing is known about the evolution of thiotrophic symbioses in microbial eukaryotes (protists). In this study, we characterized the symbioses between mouthless marine ciliates of the genus Kentrophoros, and their thiotrophic bacteria, using comparative sequence analysis and fluorescence in situ hybridization. Ciliate small-subunit rRNA sequences were obtained from 17 morphospecies collected in the Mediterranean and Caribbean, and symbiont sequences from 13 of these morphospecies. We discovered a new Kentrophoros morphotype where the symbiont-bearing surface is folded into pouch-like compartments, illustrating the variability of the basic body plan. Phylogenetic analyses revealed that all investigated Kentrophoros belonged to a single clade, despite the remarkable morphological diversity of these hosts. The symbionts were also monophyletic and belonged to a new clade within the Gammaproteobacteria, with no known cultured representatives. Each host morphospecies had a distinct symbiont phylotype, and statistical analyses revealed significant support for host–symbiont codiversification. Given that these symbioses were collected from two widely separated oceans, our results indicate that symbiotic associations in unicellular hosts can be highly specific and stable over long periods of evolutionary time. PMID:28701560

A Bayesian taxonomic classification method for 16S rRNA gene sequences with improved species-level accuracy.

PubMed

Gao, Xiang; Lin, Huaiying; Revanna, Kashi; Dong, Qunfeng

2017-05-10

Species-level classification for 16S rRNA gene sequences remains a serious challenge for microbiome researchers, because existing taxonomic classification tools for 16S rRNA gene sequences either do not provide species-level classification, or their classification results are unreliable. The unreliable results are due to the limitations in the existing methods which either lack solid probabilistic-based criteria to evaluate the confidence of their taxonomic assignments, or use nucleotide k-mer frequency as the proxy for sequence similarity measurement. We have developed a method that shows significantly improved species-level classification results over existing methods. Our method calculates true sequence similarity between query sequences and database hits using pairwise sequence alignment. Taxonomic classifications are assigned from the species to the phylum levels based on the lowest common ancestors of multiple database hits for each query sequence, and further classification reliabilities are evaluated by bootstrap confidence scores. The novelty of our method is that the contribution of each database hit to the taxonomic assignment of the query sequence is weighted by a Bayesian posterior probability based upon the degree of sequence similarity of the database hit to the query sequence. Our method does not need any training datasets specific for different taxonomic groups. Instead only a reference database is required for aligning to the query sequences, making our method easily applicable for different regions of the 16S rRNA gene or other phylogenetic marker genes. Reliable species-level classification for 16S rRNA or other phylogenetic marker genes is critical for microbiome research. Our software shows significantly higher classification accuracy than the existing tools and we provide probabilistic-based confidence scores to evaluate the reliability of our taxonomic classification assignments based on multiple database matches to query sequences. Despite its higher computational costs, our method is still suitable for analyzing large-scale microbiome datasets for practical purposes. Furthermore, our method can be applied for taxonomic classification of any phylogenetic marker gene sequences. Our software, called BLCA, is freely available at https://github.com/qunfengdong/BLCA .

Blastocystis phylogeny among various isolates from humans to insects.

PubMed

Yoshikawa, Hisao; Koyama, Yukiko; Tsuchiya, Erika; Takami, Kazutoshi

2016-12-01

Blastocystis is a common unicellular eukaryotic parasite found not only in humans, but also in various kinds of animal species worldwide. Since Blastocystis isolates are morphologically indistinguishable, many molecular biological approaches have been applied to classify these isolates. The complete or partial sequences of the small subunit rRNA gene (SSU rDNA) are mainly used for comparisons and phylogenetic analyses among Blastocystis isolates. However, various lengths of the partial SSU rDNA sequence have been used for phylogenetic inference among genetically different isolates. Based on the complete SSU rDNA sequences, consensus terminology of nine subtypes (STs) of Blastocystis sp. that were supported by phylogenetically monophyletic nine clades was proposed in 2007. Thereafter, eight additional kinds of STs comprising non-human mammalian Blastocystis isolates have been reported based on the phylogeny of SSU rDNA sequences, while STs 11 and 12 were only proposed on the base of partial sequences. Although many sequence data from mammalian and avian Blastocystis are registered in GenBank, only limited data on SSU rDNA are available for poikilotherm-derived Blastocystis isolates. Therefore, the phylogenetic positions of the reptilian/amphibian Blastocystis clades are unstable. The phylogenetic inference of various STs comprising mammalian and/or avian Blastocystis isolates was verified herein based on comparisons between partial and complete SSU rDNA sequences, and the phylogenetic positions of reptilian and amphibian Blastocystis isolates were also investigated using 14 new Blastocystis isolates from reptiles with all known isolates from other reptilians, amphibians, and insects registered in GenBank. Copyright © 2016. Published by Elsevier Ireland Ltd.

Dasytricha dominance in Surti buffalo rumen revealed by 18S rRNA sequences and real-time PCR assay.

PubMed

Singh, K M; Tripathi, A K; Pandya, P R; Rank, D N; Kothari, R K; Joshi, C G

2011-09-01

The genetic diversity of protozoa in Surti buffalo rumen was studied by amplified ribosomal DNA restriction analysis, 18S rDNA sequence homology and phylogenetic and Real-time PCR analysis methods. Three animals were fed diet comprised green fodder Napier bajra 21 (Pennisetum purpureum), mature pasture grass (Dicanthium annulatum) and concentrate mixture (20% crude protein, 65% total digestible nutrients). A protozoa-specific primer (P-SSU-342f) and a eukarya-specific primer (Medlin B) were used to amplify a 1,360 bp fragment of DNA encoding protozoal small subunit (SSU) ribosomal RNA from rumen fluid. A total of 91 clones were examined and identified 14 different 18S RNA sequences based on PCR-RFLP pattern. These 14 phylotypes were distributed into four genera-based 18S rDNA database sequences and identified as Dasytricha (57 clones), Isotricha (14 clones), Ostracodinium (11 clones) and Polyplastron (9 clones). Phylogenetic analyses were also used to infer the makeup of protozoa communities in the rumen of Surti buffalo. Out of 14 sequences, 8 sequences (69 clones) clustered with the Dasytricha ruminantium-like clone and 4 sequences (13 clones) were also phylogenetically placed with the Isotricha prostoma-like clone. Moreover, 2 phylotypes (9 clones) were related to Polyplastron multivesiculatum-like clone. In addition, the number of 18S rDNA gene copies of Dasytricha ruminantium (0.05% to ciliate protozoa) was higher than Entodinium sp. (2.0 × 10(5) vs. 1.3 × 10(4)) in per ml ruminal fluid.

Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

PubMed Central

Dron, M; Rahire, M; Rochaix, J D

1982-01-01

The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

DOEpatents

Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.

2007-12-04

The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

Natural-abundance stable carbon isotopes of small-subunit ribosomal RNA (SSU rRNA) from Guaymas Basin (Mexico)

NASA Astrophysics Data System (ADS)

MacGregor, B. J.; Mendlovitz, H.; Albert, D.; Teske, A. P.

2012-12-01

Small-subunit ribosomal RNA (SSU rRNA) is a phylogenetically informative molecule found in all species. Because it is poorly preserved in most environments, it is a useful marker for active microbial populations. We are using the natural-abundance stable carbon isotopic composition of specific microbial groups to help identify the carbon substrates contributing to microbial biomass in a variety of marine environments. At Guaymas Basin, hydrothermal fluids interact with abundant sedimentary organic carbon to produce natural gas and petroleum. Where this reaches the sediment surface, it can support dense patches of seafloor life, including Beggiatoa mats. We report here on the stable carbon isotopic composition of SSU rRNA from a Beggiatoa mat transect, a cold background site, a warm site with high oil concentration, and a second Beggiatoa mat. The central part of the transect mat overlay the steepest temperature gradient, and was visually dominated by orange Beggiatoa. This was fringed by white Beggiatoa mat and bare, but still warm, sediment. Methane concentrations were saturating beneath the orange and white mats and at the oily site, lower beneath bare sediment, and below detection at the background site. Our initial hypotheses were that rRNA isotopic composition would be strongly influenced by methane supply, and that archaeal rRNA might be lighter than bacterial due to contributions from methanogens and anaerobic methane oxidizers. We used biotin-labeled oligonucleotides to capture Bacterial and Archaeal SSU rRNA for isotopic determination. Background-site rRNA was isotopically heaviest, and bacterial RNA from below 2 cm at the oily site was lightest, consistent with control by methane. Within the transect mat, however, the pattern was more complicated; at some sediment depths, rRNA from the mat periphery was isotopically lightest. Part of this may be due to the spatially and temporally variable paths followed by hydrothermal fluid, which can include horizontal flow. There was no consistent isotopic difference between rRNAs captured by the two probes, although RNA recoveries were too low for isotopic determinations at depths where methanogens and methane oxidizers are expected. Our prediction that rRNA stable carbon isotopic composition would correlate with methane supply was borne out by the comparison between background and mat sediments, but may be an oversimplification for sites within hydrothermal features. Future work will include the isotopic characterization of other potential carbon substrates, such as acetate. We are also investigating cold-seep sediments and brine pools in the Gulf of Mexico, where methane is significantly more 13C-depleted than at Guaymas Basin and may therefore leave a stronger imprint on microbial biomass.table carbon isotopes of rRNA captured with Bacterial and Archaeal probes at mat transect and background sites.

The Mitochondrial Genome of the Prasinophyte Prasinoderma coloniale Reveals Two Trans-Spliced Group I Introns in the Large Subunit rRNA Gene

PubMed Central

Pombert, Jean-François; Otis, Christian; Turmel, Monique; Lemieux, Claude

2013-01-01

Organelle genes are often interrupted by group I and or group II introns. Splicing of these mobile genetic occurs at the RNA level via serial transesterification steps catalyzed by the introns'own tertiary structures and, sometimes, with the help of external factors. These catalytic ribozymes can be found in cis or trans configuration, and although trans-arrayed group II introns have been known for decades, trans-spliced group I introns have been reported only recently. In the course of sequencing the complete mitochondrial genome of the prasinophyte picoplanktonic green alga Prasinoderma coloniale CCMP 1220 (Prasinococcales, clade VI), we uncovered two additional cases of trans-spliced group I introns. Here, we describe these introns and compare the 54,546 bp-long mitochondrial genome of Prasinoderma with those of four other prasinophytes (clades II, III and V). This comparison underscores the highly variable mitochondrial genome architecture in these ancient chlorophyte lineages. Both Prasinoderma trans-spliced introns reside within the large subunit rRNA gene (rnl) at positions where cis-spliced relatives, often containing homing endonuclease genes, have been found in other organelles. In contrast, all previously reported trans-spliced group I introns occur in different mitochondrial genes (rns or coxI). Each Prasinoderma intron is fragmented into two pieces, forming at the RNA level a secondary structure that resembles those of its cis-spliced counterparts. As observed for other trans-spliced group I introns, the breakpoint of the first intron maps to the variable loop L8, whereas that of the second is uniquely located downstream of P9.1. The breakpoint In each Prasinoderma intron corresponds to the same region where the open reading frame (ORF) occurs when present in cis-spliced orthologs. This correlation between the intron breakpoint and the ORF location in cis-spliced orthologs also holds for other trans-spliced introns; we discuss the possible implications of this interesting observation for trans-splicing of group I introns. PMID:24386369

Clinical Relevance of Multiple Single-Nucleotide Polymorphisms in Pneumocystis jirovecii Pneumonia: Development of a Multiplex PCR-Single-Base-Extension Methodology▿

PubMed Central

Esteves, F.; Gaspar, J.; De Sousa, B.; Antunes, F.; Mansinho, K.; Matos, O.

2011-01-01

Pneumocystis jirovecii pneumonia (PcP) is a major cause of respiratory illness in patients with AIDS. The identification of multiple single-nucleotide polymorphisms (SNPs) at three distinct P. jirovecii loci encoding dihydrofolate reductase (DHFR), mitochondrial large-subunit rRNA (mtLSU rRNA), and superoxide dismutase (SOD) was achieved using multiplex-PCR (MPCR) followed by direct sequencing and two single-base extension (SBE) techniques. Four SNPs (DHFR312, mt85, SOD215, and SOD110), correlated previously with parameters of disease, were amplified and genotyped simultaneously. The concordance of results between the standard sequencing technique (direct sequencing) and SBE analysis was 96.9% for the acrylamide gel electrophoresis and 98.4% for the capillary electrophoresis. The cross-genetic analysis established several statistical associations among the SNPs studied: mt85C-SOD110T, SOD110T-SOD215C, and SOD110C-SOD215T. These results were confirmed by cluster analysis. Data showed that among the isolates with low to moderate parasite burden, the highest percentages of DHFR312C, mt85C, SOD110T, and SOD215C were detected, whereas for high parasite burden cases the highest frequencies were observed among isolates with DHFR312T, mt85T, SOD110C, and SOD215T. The polymorphisms studied were shown to be suitable genetic targets potentially correlated with PcP clinical data that can be used as predictors of outcome in further studies to help clinical decision-making in the management of PcP. The MPCR/SBE protocol described for the first time in the present study was shown to be a rapid, highly accurate method for genotyping P. jirovecii SNPs encoded by different loci that could be used for epidemiological studies and as an additional procedure for the prognostic classification and diagnosis of PcP. PMID:21389160

Clinical relevance of multiple single-nucleotide polymorphisms in Pneumocystis jirovecii Pneumonia: development of a multiplex PCR-single-base-extension methodology.

PubMed

Esteves, F; Gaspar, J; De Sousa, B; Antunes, F; Mansinho, K; Matos, O

2011-05-01

Pneumocystis jirovecii pneumonia (PcP) is a major cause of respiratory illness in patients with AIDS. The identification of multiple single-nucleotide polymorphisms (SNPs) at three distinct P. jirovecii loci encoding dihydrofolate reductase (DHFR), mitochondrial large-subunit rRNA (mtLSU rRNA), and superoxide dismutase (SOD) was achieved using multiplex-PCR (MPCR) followed by direct sequencing and two single-base extension (SBE) techniques. Four SNPs (DHFR312, mt85, SOD215, and SOD110), correlated previously with parameters of disease, were amplified and genotyped simultaneously. The concordance of results between the standard sequencing technique (direct sequencing) and SBE analysis was 96.9% for the acrylamide gel electrophoresis and 98.4% for the capillary electrophoresis. The cross-genetic analysis established several statistical associations among the SNPs studied: mt85C-SOD110T, SOD110T-SOD215C, and SOD110C-SOD215T. These results were confirmed by cluster analysis. Data showed that among the isolates with low to moderate parasite burden, the highest percentages of DHFR312C, mt85C, SOD110T, and SOD215C were detected, whereas for high parasite burden cases the highest frequencies were observed among isolates with DHFR312T, mt85T, SOD110C, and SOD215T. The polymorphisms studied were shown to be suitable genetic targets potentially correlated with PcP clinical data that can be used as predictors of outcome in further studies to help clinical decision-making in the management of PcP. The MPCR/SBE protocol described for the first time in the present study was shown to be a rapid, highly accurate method for genotyping P. jirovecii SNPs encoded by different loci that could be used for epidemiological studies and as an additional procedure for the prognostic classification and diagnosis of PcP.

Biogeographic and phylogenetic diversity of thermoacidophilic cyanidiales in Yellowstone National Park, Japan, and New Zealand.

PubMed

Toplin, J A; Norris, T B; Lehr, C R; McDermott, T R; Castenholz, R W

2008-05-01

Members of the rhodophytan order Cyanidiales are unique among phototrophs in their ability to live in extreme environments that combine low pH levels ( approximately 0.2 to 4.0) and moderately high temperatures of 40 to 56 degrees C. These unicellular algae occur in far-flung volcanic areas throughout the earth. Three genera (Cyanidium, Galdieria, and Cyanidioschyzon) are recognized. The phylogenetic diversity of culture isolates of the Cyanidiales from habitats throughout Yellowstone National Park (YNP), three areas in Japan, and seven regions in New Zealand was examined by using the chloroplast RuBisCO large subunit gene (rbcL) and the 18S rRNA gene. Based on the nucleotide sequences of both genes, the YNP isolates fall into two groups, one with high identity to Galdieria sulphuraria (type II) and another that is by far the most common and extensively distributed Yellowstone type (type IA). The latter is a spherical, walled cell that reproduces by internal divisions, with a subsequent release of smaller daughter cells. This type, nevertheless, shows a 99 to 100% identity to Cyanidioschyzon merolae (type IB), which lacks a wall, divides by "fission"-like cytokinesis into two daughter cells, and has less than 5% of the cell volume of type IA. The evolutionary and taxonomic ramifications of this disparity are discussed. Although the 18S rRNA and rbcL genes did not reveal diversity among the numerous isolates of type IA, chloroplast short sequence repeats did show some variation by location within YNP. In contrast, Japanese and New Zealand strains showed considerable diversity when we examined only the sequences of 18S and rbcL genes. Most exhibited identities closer to Galdieria maxima than to other strains, but these identities were commonly as low as 91 to 93%. Some of these Japanese and New Zealand strains probably represent undescribed species that diverged after long-term geographic isolation.

Rudaeicoccus suwonensis gen. nov., sp. nov., an actinobacterium isolated from the epidermal tissue of a root of a Phalaenopsis orchid.

PubMed

Kim, Soo-Jin; Jang, Yun-Hee; Ahn, Jae-Hyung; Weon, Hang-Yeon; Schumann, Peter; Chun, Se-Chul; Kwon, Soon-Wo; Kim, Wan-Gyu

2013-04-01

A bacterial strain, designated HOR6-4(T), was isolated from the epidermal tissue of a root of a Phalaenopsis orchid. Strain HOR6-4(T) was characterized using a polyphasic approach. The cells were aerobic, Gram-stain-positive, non-motile coccoids. Phylogenetic analysis of its 16S rRNA gene sequence revealed a clear affiliation with the family Dermacoccaceae. Strain HOR6-4(T) showed relatively low 16S rRNA gene sequence similarity (below 95.9 %) to type strains of species with validly published names, showing the highest sequence similarities to the type strains of Flexivirga alba (95.8 %) and Yimella lutea (95.5 %). The DNA G+C content of strain HOR6-4(T) was 64.7 mol%. Strain HOR6-4(T) had anteiso-C17 : 0 (19.3 %), 10-methyl C18 : 0 (tuberculostearic acid; 13.5 %) and 10-methyl C17 : 0 (11.7 %) as the major fatty acids and contained MK-8(H4) and MK-8(H6) as the predominant quinones. Polar lipids were diphosphatidylglycerol, phosphatidylinositol, three aminophospholipids, two phospholipids and an aminolipid. The peptidoglycan type was A4α, with an L-Lys-L-Thr-D-Glu interpeptide bridge with a glycine residue bound to the alpha-carboxyl group of D-Glu in position 2 of the peptide subunit. Mycolic acids were not present. On the basis of comparative analysis of phenotypic and phylogenetic traits, strain HOR6-4(T) is considered to represent a novel species in a new genus in the family Dermacoccaceae, for which the name Rudaeicoccus suwonensis gen. nov., sp. nov. is proposed. The type strain of Rudaeicoccus suwonensis is HOR6-4(T) ( = KACC 12637(T)  = DSM 19560(T)).

Phylogenetic relationships of some spirurine nematodes (Nematoda: Chromadorea: Rhabditida: Spirurina) parasitic in fishes inferred from SSU rRNA gene sequences.

PubMed

Cernotíková, Eva; Horák, Ales; Moravec, Frantisek

2011-06-01

Abstract: Small subunit rRNA sequences were obtained from 38 representatives mainly of the nematode orders Spirurida (Camallanidae, Cystidicolidae, Daniconematidae, Philometridae, Physalopteridae, Rhabdochonidae, Skrjabillanidae) and, in part, Ascaridida (Anisakidae, Cucullanidae, Quimperiidae). The examined nematodes are predominantly parasites of fishes. Their analyses provided well-supported trees allowing the study ofphylogenetic relationships among some spirurine nematodes. The present results support the placement of Cucullanidae at the base of the suborder Spirurina and, based on the position of the genus Philonema (subfamily Philoneminae) forming a sister group to Skrjabillanidae (thus Philoneminae should be elevated to Philonemidae), the paraphyly of the Philometridae. Comparison of a large number of sequences of representatives of the latter family supports the paraphyly of the genera Philometra, Philometroides and Dentiphilometra. The validity of the newly included genera Afrophilometra and Caranginema is not supported. These results indicate geographical isolation has not been the cause of speciation in this parasite group and no coevolution with fish hosts is apparent. On the contrary, the group of South-American species ofAlinema, Nilonema and Rumai is placed in an independent branch, thus markedly separated from other family members. Molecular data indicate that the skrjabillanid subfamily Esocineminae (represented by Esocinema bohemicum) should be either elevated to the rank of an independent family or Daniconematidae (Mexiconema africanum) should be decreased to Daniconematinae and transferred to the family Skrjabillanidae. Camallanid genera Camallanus and Procamallanus, as well as the subgenera Procamallanus and Spirocamallanus are confirmed to be paraphyletic. Paraphyly has also been found within Filarioidea, Habronematoidea and Thelazioidea and in Cystidicolidae, Physalopteridae and Thelaziidae. The results of the analyses also show that Neoascarophis, Spinitectus and Rhabdochona are monophyletic, in contrast to the paraphyletic genus Ascarophis. They further confirm the independence of two subgenera, Rhabdochona and Globochona, in the genus Rhabdochona. The necessity of further studies of fish-parasitizing representatives of additional nematode families not yet studied by molecular methods, such as Guyanemidae, Lucionematidae or Tetanonematidae, is underscored.

Reliable differentiation of Meyerozyma guilliermondii from Meyerozyma caribbica by internal transcribed spacer restriction fingerprinting.

PubMed

Romi, Wahengbam; Keisam, Santosh; Ahmed, Giasuddin; Jeyaram, Kumaraswamy

2014-02-28

Meyerozyma guilliermondii (anamorph Candida guilliermondii) and Meyerozyma caribbica (anamorph Candida fermentati) are closely related species of the genetically heterogenous M. guilliermondii complex. Conventional phenotypic methods frequently misidentify the species within this complex and also with other species of the Saccharomycotina CTG clade. Even the long-established sequencing of large subunit (LSU) rRNA gene remains ambiguous. We also faced similar problem during identification of yeast isolates of M. guilliermondii complex from indigenous bamboo shoot fermentation in North East India. There is a need for development of reliable and accurate identification methods for these closely related species because of their increasing importance as emerging infectious yeasts and associated biotechnological attributes. We targeted the highly variable internal transcribed spacer (ITS) region (ITS1-5.8S-ITS2) and identified seven restriction enzymes through in silico analysis for differentiating M. guilliermondii from M. caribbica. Fifty five isolates of M. guilliermondii complex which could not be delineated into species-specific taxonomic ranks by API 20 C AUX and LSU rRNA gene D1/D2 sequencing were subjected to ITS-restriction fragment length polymorphism (ITS-RFLP) analysis. TaqI ITS-RFLP distinctly differentiated the isolates into M. guilliermondii (47 isolates) and M. caribbica (08 isolates) with reproducible species-specific patterns similar to the in silico prediction. The reliability of this method was validated by ITS1-5.8S-ITS2 sequencing, mitochondrial DNA RFLP and electrophoretic karyotyping. We herein described a reliable ITS-RFLP method for distinct differentiation of frequently misidentified M. guilliermondii from M. caribbica. Even though in silico analysis differentiated other closely related species of M. guilliermondii complex from the above two species, it is yet to be confirmed by in vitro analysis using reference strains. This method can be used as a reliable tool for rapid and accurate identification of closely related species of M. guilliermondii complex and for differentiating emerging infectious yeasts of the Saccharomycotina CTG clade.

Molecular confirmation of Hepatozoon canis in Mauritius.

PubMed

Daskalaki, Aikaterini Alexandra; Ionică, Angela Monica; Jeetah, Keshav; Gherman, Călin Mircea; Mihalca, Andrei Daniel

2018-01-01

In this study, Hepatozoon species was molecularly identified and characterized for the first time on the Indian Ocean island of Mauritius. Partial sequences of the 18S rRNA gene of the Hepatozoon isolates were analysed from three naturally infected dogs. The sequences of H. canis were similar to the 18S rRNA partial sequences (JX112783, AB365071 99%) from dog blood samples from West Indies and Nigeria. Our sequences were deposited in the GenBank database. Copyright © 2017 Elsevier B.V. All rights reserved.

Pea chloroplast DNA encodes homologues of Escherichia coli ribosomal subunit S2 and the beta'-subunit of RNA polymerase.

PubMed Central

Cozens, A L; Walker, J E

1986-01-01

The nucleotide sequence has been determined of a segment of 4680 bases of the pea chloroplast genome. It adjoins a sequence described elsewhere that encodes subunits of the F0 membrane domain of the ATP-synthase complex. The sequence contains a potential gene encoding a protein which is strongly related to the S2 polypeptide of Escherichia coli ribosomes. It also encodes an incomplete protein which contains segments that are homologous to the beta'-subunit of E. coli RNA polymerase and to yeast RNA polymerases II and III. PMID:3530249

rpoB Gene Sequencing for Identification of Corynebacterium Species

PubMed Central

Khamis, Atieh; Raoult, Didier; La Scola, Bernard

2004-01-01

The genus Corynebacterium is a heterogeneous group of species comprising human and animal pathogens and environmental bacteria. It is defined on the basis of several phenotypic characters and the results of DNA-DNA relatedness and, more recently, 16S rRNA gene sequencing. However, the 16S rRNA gene is not polymorphic enough to ensure reliable phylogenetic studies and needs to be completely sequenced for accurate identification. The almost complete rpoB sequences of 56 Corynebacterium species were determined by both PCR and genome walking methods. In all cases the percent similarities between different species were lower than those observed by 16S rRNA gene sequencing, even for those species with degrees of high similarity. Several clusters supported by high bootstrap values were identified. In order to propose a method for strain identification which does not require sequencing of the complete rpoB sequence (approximately 3,500 bp), we identified an area with a high degree of polymorphism, bordered by conserved sequences that can be used as universal primers for PCR amplification and sequencing. The sequence of this fragment (434 to 452 bp) allows accurate species identification and may be used in the future for routine sequence-based identification of Corynebacterium species. PMID:15364970

Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA.

PubMed

Röder, Christoph; König, Helmut; Fröhlich, Jürgen

2007-09-01

Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.

IDENTIFICATION OF CRYPTOSPORIDIUM SPECIES AND SOURCES IN RAW WASTEWATER USING A SMALL SUBUNIT RRNA-BASED PCR-RFLP TOOL

EPA Science Inventory

The species composition and source of Cryptosporidium oocysts in wastewater have never been determined, even though it is widely assumed that these oocysts are from human sewage. Recent molecular characterizations of Cryptosporidium parasites make it possible to differentiate hum...

IDENTIFICATION OF SPECIES AND SOURCES OF CRYPTOSPORIDIUM OOCYSTS IN STORM WATERS BY A SMALL SUBUNIT RRNA-BASED DIAGNOSTIC AND GENOTYPING TOOL

EPA Science Inventory

The identification of Cryptosporidium oocysts in environmental samples is largely made by the use of immunofluorescent assay (IFA). because IFA detects oocysts from all Cryptosporidium parasites, the species distribution and source of Cryptosporidium parasites in environmental sa...

IDENTIFICATION OF CRYPTOSPORIDIUM SPECIES AND THE SOURCES IN RAW WASTEWATER USING A SMALL SUBUNIT RRNA-BASED PCR-RFLP TOOL

EPA Science Inventory

The species composition and source of Cryptosporidium oocysts in wastewater have never been determined, even though it is widely assumed that these oocysts are from human sewage. Recent molecular characterizations of Cryptosporidium parasites make it possible to differentiate hum...

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis and proposals to emend the description of Streptomyces albus and describe Streptomyces pathocidini sp. nov

USDA-ARS?s Scientific Manuscript database

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T forms a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these oth...

Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

PubMed Central

LaPolla, R J; Mayne, K M; Davidson, N

1984-01-01

A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

Phylogenetic relationships of Malassezia species based on multilocus sequence analysis.

PubMed

Castellá, Gemma; Coutinho, Selene Dall' Acqua; Cabañes, F Javier

2014-01-01

Members of the genus Malassezia are lipophilic basidiomycetous yeasts, which are part of the normal cutaneous microbiota of humans and other warm-blooded animals. Currently, this genus consists of 14 species that have been characterized by phenetic and molecular methods. Although several molecular methods have been used to identify and/or differentiate Malassezia species, the sequencing of the rRNA genes and the chitin synthase-2 gene (CHS2) are the most widely employed. There is little information about the β-tubulin gene in the genus Malassezia, a gene has been used for the analysis of complex species groups. The aim of the present study was to sequence a fragment of the β-tubulin gene of Malassezia species and analyze their phylogenetic relationship using a multilocus sequence approach based on two rRNA genes (ITS including 5.8S rRNA and D1/D2 region of 26S rRNA) together with two protein encoding genes (CHS2 and β-tubulin). The phylogenetic study of the partial β-tubulin gene sequences indicated that this molecular marker can be used to assess diversity and identify new species. The multilocus sequence analysis of the four loci provides robust support to delineate species at the terminal nodes and could help to estimate divergence times for the origin and diversification of Malassezia species.

Complete chloroplast genome and 45S nrDNA sequences of the medicinal plant species Glycyrrhiza glabra and Glycyrrhiza uralensis.

PubMed

Kang, Sang-Ho; Lee, Jeong-Hoon; Lee, Hyun Oh; Ahn, Byoung Ohg; Won, So Youn; Sohn, Seong-Han; Kim, Jung Sun

2017-10-06

Glycyrrhiza uralensis and G. glabra, members of the Fabaceae, are medicinally important species that are native to Asia and Europe. Extracts from these plants are widely used as natural sweeteners because of their much greater sweetness than sucrose. In this study, the three complete chloroplast genomes and five 45S nuclear ribosomal (nr)DNA sequences of these two licorice species and an interspecific hybrid are presented. The chloroplast genomes of G. glabra, G. uralensis and G. glabra × G. uralensis were 127,895 bp, 127,716 bp and 127,939 bp, respectively. The three chloroplast genomes harbored 110 annotated genes, including 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. The 45S nrDNA sequences were either 5,947 or 5,948 bp in length. Glycyrrhiza glabra and G. glabra × G. uralensis showed two types of nrDNA, while G. uralensis contained a single type. The complete 45S nrDNA sequence unit contains 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 26S rRNA. We identified simple sequence repeat and tandem repeat sequences. We also developed four reliable markers for analysis of Glycyrrhiza diversity authentication.

The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.

PubMed

Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R

As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.

IMNGS: A comprehensive open resource of processed 16S rRNA microbial profiles for ecology and diversity studies.

PubMed

Lagkouvardos, Ilias; Joseph, Divya; Kapfhammer, Martin; Giritli, Sabahattin; Horn, Matthias; Haller, Dirk; Clavel, Thomas

2016-09-23

The SRA (Sequence Read Archive) serves as primary depository for massive amounts of Next Generation Sequencing data, and currently host over 100,000 16S rRNA gene amplicon-based microbial profiles from various host habitats and environments. This number is increasing rapidly and there is a dire need for approaches to utilize this pool of knowledge. Here we created IMNGS (Integrated Microbial Next Generation Sequencing), an innovative platform that uniformly and systematically screens for and processes all prokaryotic 16S rRNA gene amplicon datasets available in SRA and uses them to build sample-specific sequence databases and OTU-based profiles. Via a web interface, this integrative sequence resource can easily be queried by users. We show examples of how the approach allows testing the ecological importance of specific microorganisms in different hosts or ecosystems, and performing targeted diversity studies for selected taxonomic groups. The platform also offers a complete workflow for de novo analysis of users' own raw 16S rRNA gene amplicon datasets for the sake of comparison with existing data. IMNGS can be accessed at www.imngs.org.

Phylogenetic Network Analysis Revealed the Occurrence of Horizontal Gene Transfer of 16S rRNA in the Genus Enterobacter

PubMed Central

Sato, Mitsuharu; Miyazaki, Kentaro

2017-01-01

Horizontal gene transfer (HGT) is a ubiquitous genetic event in bacterial evolution, but it seldom occurs for genes involved in highly complex supramolecules (or biosystems), which consist of many gene products. The ribosome is one such supramolecule, but several bacteria harbor dissimilar and/or chimeric 16S rRNAs in their genomes, suggesting the occurrence of HGT of this gene. However, we know little about whether the genes actually experience HGT and, if so, the frequency of such a transfer. This is primarily because the methods currently employed for phylogenetic analysis (e.g., neighbor-joining, maximum likelihood, and maximum parsimony) of 16S rRNA genes assume point mutation-driven tree-shape evolution as an evolutionary model, which is intrinsically inappropriate to decipher the evolutionary history for genes driven by recombination. To address this issue, we applied a phylogenetic network analysis, which has been used previously for detection of genetic recombination in homologous alleles, to the 16S rRNA gene. We focused on the genus Enterobacter, whose phylogenetic relationships inferred by multi-locus sequence alignment analysis and 16S rRNA sequences are incompatible. All 10 complete genomic sequences were retrieved from the NCBI database, in which 71 16S rRNA genes were included. Neighbor-joining analysis demonstrated that the genes residing in the same genomes clustered, indicating the occurrence of intragenomic recombination. However, as suggested by the low bootstrap values, evolutionary relationships between the clusters were uncertain. We then applied phylogenetic network analysis to representative sequences from each cluster. We found three ancestral 16S rRNA groups; the others were likely created through recursive recombination between the ancestors and chimeric descendants. Despite the large sequence changes caused by the recombination events, the RNA secondary structures were conserved. Successive intergenomic and intragenomic recombination thus shaped the evolution of 16S rRNA genes in the genus Enterobacter. PMID:29180992

The essential nature of YqfG, a YbeY homologue required for 3' maturation of Bacillus subtilis 16S ribosomal RNA is suppressed by deletion of RNase R.

PubMed

Baumgardt, Kathrin; Gilet, Laetitia; Figaro, Sabine; Condon, Ciarán

2018-06-05

Ribosomal RNAs are processed from primary transcripts containing 16S, 23S and 5S rRNAs in most bacteria. Maturation generally occurs in a two-step process, consisting of a first crude separation of the major species by RNase III during transcription, followed by precise trimming of 5' and 3' extensions on each species upon accurate completion of subunit assembly. The various endo- and exoribonucleases involved in the final processing reactions are strikingly different in Escherichia coli and Bacillus subtilis, the two best studied representatives of Gram-negative and Gram-positive bacteria, respectively. Here, we show that the one exception to this rule is the protein involved in the maturation of the 3' end of 16S rRNA. Cells depleted for the essential B. subtilis YqfG protein, a homologue of E. coli YbeY, specifically accumulate 16S rRNA precursors bearing 3' extensions. Remarkably, the essential nature of YqfG can be suppressed by deleting the ribosomal RNA degrading enzyme RNase R, i.e. a ΔyqfG Δrnr mutant is viable. Our data suggest that 70S ribosomes containing 30S subunits with 3' extensions of 16S rRNA are functional to a degree, but become substrates for degradation by RNase R and are eliminated.

Development and Application of Small-Subunit rRNA Probes for Assessment of Selected Thiobacillus Species and Members of the Genus Acidiphilium

PubMed Central

Peccia, Jordan; Marchand, Eric A.; Silverstein, Joann; Hernandez, Mark

2000-01-01

Culture-dependent studies have implicated sulfur-oxidizing bacteria as the causative agents of acid mine drainage and concrete corrosion in sewers. Thiobacillus species are considered the major representatives of the acid-producing bacteria in these environments. Small-subunit rRNA genes from all of the Thiobacillus and Acidiphilium species catalogued by the Ribosomal Database Project were identified and used to design oligonucleotide DNA probes. Two oligonucleotide probes were synthesized to complement variable regions of 16S rRNA in the following acidophilic bacteria: Thiobacillus ferrooxidans and T. thiooxidans (probe Thio820) and members of the genus Acidiphilium (probe Acdp821). Using 32P radiolabels, probe specificity was characterized by hybridization dissociation temperature (Td) with membrane-immobilized RNA extracted from a suite of 21 strains representing three groups of bacteria. Fluorochrome-conjugated probes were evaluated for use with fluorescent in situ hybridization (FISH) at the experimentally determined Tds. FISH was used to identify and enumerate bacteria in laboratory reactors and environmental samples. Probing of laboratory reactors inoculated with a mixed culture of acidophilic bacteria validated the ability of the oligonucleotide probes to track specific cell numbers with time. Additionally, probing of sediments from an active acid mine drainage site in Colorado demonstrated the ability to identify numbers of active bacteria in natural environments that contain high concentrations of metals, associated precipitates, and other mineral debris. PMID:10877807

Has1 regulates consecutive maturation and processing steps for assembly of 60S ribosomal subunits

PubMed Central

Dembowski, Jill A.; Kuo, Benjamin; Woolford, John L.

2013-01-01

Ribosome biogenesis requires ∼200 assembly factors in Saccharomyces cerevisiae. The pre-ribosomal RNA (rRNA) processing defects associated with depletion of most of these factors have been characterized. However, how assembly factors drive the construction of ribonucleoprotein neighborhoods and how structural rearrangements are coupled to pre-rRNA processing are not understood. Here, we reveal ATP-independent and ATP-dependent roles of the Has1 DEAD-box RNA helicase in consecutive pre-rRNA processing and maturation steps for construction of 60S ribosomal subunits. Has1 associates with pre-60S ribosomes in an ATP-independent manner. Has1 binding triggers exonucleolytic trimming of 27SA3 pre-rRNA to generate the 5′ end of 5.8S rRNA and drives incorporation of ribosomal protein L17 with domain I of 5.8S/25S rRNA. ATP-dependent activity of Has1 promotes stable association of additional domain I ribosomal proteins that surround the polypeptide exit tunnel, which are required for downstream processing of 27SB pre-rRNA. Furthermore, in the absence of Has1, aberrant 27S pre-rRNAs are targeted for irreversible turnover. Thus, our data support a model in which Has1 helps to establish domain I architecture to prevent pre-rRNA turnover and couples domain I folding with consecutive pre-rRNA processing steps. PMID:23788678

Structural basis for 16S ribosomal RNA cleavage by the cytotoxic domain of colicin E3.

PubMed

Ng, C Leong; Lang, Kathrin; Meenan, Nicola Ag; Sharma, Amit; Kelley, Ann C; Kleanthous, Colin; Ramakrishnan, V

2010-10-01

The toxin colicin E3 targets the 30S subunit of bacterial ribosomes and cleaves a phosphodiester bond in the decoding center. We present the crystal structure of the 70S ribosome in complex with the cytotoxic domain of colicin E3 (E3-rRNase). The structure reveals how the rRNase domain of colicin binds to the A site of the decoding center in the 70S ribosome and cleaves the 16S ribosomal RNA (rRNA) between A1493 and G1494. The cleavage mechanism involves the concerted action of conserved residues Glu62 and His58 of the cytotoxic domain of colicin E3. These residues activate the 16S rRNA for 2' OH-induced hydrolysis. Conformational changes observed for E3-rRNase, 16S rRNA and helix 69 of 23S rRNA suggest that a dynamic binding platform is required for colicin E3 binding and function.

Sphingobacterium alkalisoli sp. nov., isolated from a saline-alkaline soil.

PubMed

Xu, Lian; Sun, Ji-Quan; Wang, Li-Juan; Gao, Zhi-Wei; Sun, Li-Zhu; Wu, Xiao-Lei

2017-06-01

A Gram-staining-negative, non-motile, non-spore-forming bacterium designated Y3L14T was isolated from the saline-alkaline soil of a farmland, Inner Mongolia, northern China. Strain Y3L14T could grow at 10-40 °C (optimally at 30 °C), pH 6.0-10.0 (optimally at pH 8.0), and in the presence of 0-6.0 % (w/v) NaCl (optimally with 0-2.0 %). Phylogenetic analysis based on the 16S rRNA gene and DNA gyrase subunit B (gyrB) gene sequences revealed that strain Y3L14T clustered with strains belonging to the genus Sphingobacterium, sharing the highest 16S rRNA gene sequence similarity with Sphingobacterium lactis WCC 4512T (94.99 %). Its major cellular fatty acids contained iso-C15 : 0, C16 : 0, iso-C17 : 0 3-OH and summed feature 3 (iso-C15 : 0 2-OH and/or C16 : 1ω7c). Menaquinone-7 (MK-7) was the only isoprenoid quinone. Strain Y3L14T contained phosphatidylethanolamine, sphingophospholipid, two unknown phospholipids and three unknown lipids as the major polar lipids. The genomic DNA G+C content of strain Y3L14T was 36.0 mol%. Based on the phenotypic, phylogenetic and genotypic characteristics, strain Y3L14T represents a novel species within the genus Sphingobacterium, for which Sphingobacterium alkalisoli sp. nov. is proposed; the type strain is Y3L14T (=CGMCC 1.15782T=KCTC 52379T).

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

PubMed

Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

2017-04-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling

PubMed Central

França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.

2015-01-01

Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.

PubMed

França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S

2015-01-01

Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses.

PubMed

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were relatively low, ranging from 68.7-97.9%. The housekeeping genes rpoB and gyrB1 were demonstrated to be alternative classification markers to the species level based on intra- and inter-species comparisons, whereas based on phylogenetic tree rpoB proved to be reliable phylogenetic marker for the genus Prevotella.

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses

PubMed Central

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the inter-species similarities were relatively low, ranging from 68.7–97.9%. The housekeeping genes rpoB and gyrB1 were demonstrated to be alternative classification markers to the species level based on intra- and inter-species comparisons, whereas based on phylogenetic tree rpoB proved to be reliable phylogenetic marker for the genus Prevotella. PMID:26103050

16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

PubMed

Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

1990-01-01

16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

High Prevalence of Enterocytozoon bieneusi in Asymptomatic Pigs and Assessment of Zoonotic Risk at the Genotype Level

PubMed Central

Zhao, Wei; Zhang, Weizhe; Yang, Fengkun; Cao, Jianping; Liu, Hua; Yang, Dong; Shen, Yujuan

2014-01-01

Enterocytozoon bieneusi is an emerging and clinically significant enteric parasite infecting humans and animals and can cause life-threatening diarrhea in immunocompromised people. Pigs are considered to be one of the main reservoir hosts of E. bieneusi based on their high prevalence rates and zoonotic genotypes in pigs. As an opportunistic pathogen, E. bieneusi infection of pigs can be inapparent, which leads to neglect in detecting this parasite in pigs and assessing the epidemiological role of pigs in the transmission of human microsporidiosis. In the present study, 95 healthy pigs aged 2 or 3 months were randomly selected from three areas in Heilongjiang Province, China. E. bieneusi isolates were identified and genotyped based on the small-subunit (SSU) rRNA and internal transcribed spacer (ITS) regions of the rRNA gene by PCR and sequencing. A high prevalence of E. bieneusi was observed, 83.2% (79/95) at the SSU rRNA locus versus 89.5% (85/95) at the ITS locus. Ten ITS genotypes were obtained, comprising six known genotypes—EbpA (n = 30), D (n = 19), H (n = 18), O (n = 11), CS-1 (n = 1), and LW1 (n = 1)—and four novel genotypes named HLJ-I to HLJ-IV; 70.6% (60/85) of E. bieneusi genotypes were zoonotic (genotypes EbpA, D, and O). The findings of a high prevalence of E. bieneusi in pigs and a large percentage of zoonotic genotypes indicate that pigs may play a role in the transmission of E. bieneusi to humans and may become an important source of water contamination in our investigated areas. PMID:24727270

Molecular genotyping of Giardia duodenalis in children from Behbahan, southwestern Iran.

PubMed

Kasaei, Raziyeh; Carmena, David; Jelowdar, Ali; Beiromvand, Molouk

2018-05-01

Giardia duodenalis is an intestinal flagellated protozoan that infects humans and several animal species. Giardiasis causing more than 200 million symptomatic infections globally is one of the most common causes of diarrhea in developing countries. Based on molecular studies mainly targeting the small-subunit (SSU) rRNA gene locus of the parasite, eight assemblages (A to H) have been identified in humans and other animal species. The aim of the current study was to evaluate the frequency and molecular diversity of G. duodenalis in children from rural and urban day care centers from Behbahan, southwestern Iran. This cross-sectional study was based on a concentration method for the microscopic detection of G. duodenalis in stool samples of 450 children, aged 1-7 years, in Behbahan, southwestern Iran. The survey was conducted from December 2015 to May 2016. PCR methods targeting the SSU rRNA and triose phosphate isomerase (TPI) genes of G. duodenalis were used for the identification and genotyping of the parasite isolates. Based on sucrose flotation and microscopy techniques, 2.7% (12/450) of children were infected with G. duodenalis, of which six (50.0%) were males and the other six (50.0%) were females. Overall, 91.7% (11/12) of the infections were detected in children from rural areas. The SSU rRNA and TPI genes were amplified successfully in nine and eight, respectively, of the Giardia-positive samples at microscopy. Among the eight TPI sequences, assemblage A, sub-assemblage AII, was identified in five of the isolates. The sequences of the three remaining samples were untypable. Although no significantly statistical difference between genotype and clinical symptoms was found, five out of the eight isolates identified as assemblage A were obtained in asymptomatic children. Giardia duodenalis infections were more prevalent in children from rural day care schools, and the predominant assemblage was A, sub-assemblage AII. The higher prevalence of giardiasis in rural areas might be related to differences in personal hygiene habits, parents' education level, source of drinking water, and inadequate hygienic toilet facilities in rural areas.

Coupled transcription and processing of mouse ribosomal RNA in a cell-free system.

PubMed Central

Mishima, Y; Mitsuma, T; Ogata, K

1985-01-01

An in vitro processing system of mouse rRNA was achieved using an RNA polymerase I-specific transcription system, (S100) and recombinant plasmids consisting of mouse rRNA gene (rDNA) segments containing the transcription initiation and 5'-terminal region of 18S (or 41S) rRNA. Pulse-chase experiments showed that a specific processing occurred with transcripts of the plasmid DNAs when the direction of transcription was the correct orientation relative to the 18S rRNA coding sequence, but not with transcripts of the DNA templates in which this coding sequence was in the opposite orientation. From the S1 nuclease protection analyses, we concluded that there are several steps of endonucleolytic cleavage including one 105 nucleotides upstream from the 5' end of 18S rRNA. Intermediates cleaved at this site were identified in in vivo processing of rRNA. This result indicates that endonucleolytic cleavage takes place 105 nucleotides upstream from the 5' terminus of 18S rRNA prior to the formation of mature 18S rRNA. Trimming or cleavage of the 105 nucleotides may be involved in the formation of the 5' terminus of mature 18S rRNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3004977

Crotoxin: Structural Studies, Mechanism of Action and Cloning of its Gene

DTIC Science & Technology

1988-03-01

thirteen amino acids being acidic . Sequencing of the three peptides present in the acidic subunit, two of which are blocked by pyroglutamate ...the sequence determination of both the basic and acidic subunits of crotoxin- The acidic * subunit peptides were d!Tfficult, .sfi~n~e two of-ftflý...fluorescence spectroscopy. Results indicate a large conformational change occurs upon) ccmplex formation between the acidic and basic subunits of all four

The repeat organizer, a specialized insulator element within the intergenic spacer of the Xenopus rRNA genes.

PubMed Central

Robinett, C C; O'Connor, A; Dunaway, M

1997-01-01

We have identified a novel activity for the region of the intergenic spacer of the Xenopus laevis rRNA genes that contains the 35- and 100-bp repeats. We devised a new assay for this region by constructing DNA plasmids containing a tandem repeat of rRNA reporter genes that were separated by the 35- and 100-bp repeat region and a rRNA gene enhancer. When the 35- and 100-bp repeat region is present in its normal position and orientation at the 3' end of the rRNA reporter genes, the enhancer activates the adjacent downstream promoter but not the upstream rRNA promoter on the same plasmid. Because this element can restrict the range of an enhancer's activity in the context of tandem genes, we have named it the repeat organizer (RO). The ability to restrict enhancer action is a feature of insulator elements, but unlike previously described insulator elements the RO does not block enhancer action in a simple enhancer-blocking assay. Instead, the activity of the RO requires that it be in its normal position and orientation with respect to the other sequence elements of the rRNA genes. The enhancer-binding transcription factor xUBF also binds to the repetitive sequences of the RO in vitro, but these sequences do not activate transcription in vivo. We propose that the RO is a specialized insulator element that organizes the tandem array of rRNA genes into single-gene expression units by promoting activation of a promoter by its proximal enhancers. PMID:9111359

A Comparison of Structural and Evolutionary Attributes of Escherichia coli and Thermus thermophilus Small Ribosomal Subunits: Signatures of Thermal Adaptation

PubMed Central

Mallik, Saurav; Kundu, Sudip

2013-01-01

Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU). Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA) is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs) in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins) have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli) are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder) at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend. PMID:23940533

5SRNAdb: an information resource for 5S ribosomal RNAs.

PubMed

Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

2016-01-04

Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

NADH:ubiquinone oxidoreductase from bovine heart mitochondria. cDNA sequences of the import precursors of the nuclear-encoded 39 kDa and 42 kDa subunits.

PubMed Central

Fearnley, I M; Finel, M; Skehel, J M; Walker, J E

1991-01-01

The 39 kDa and 42 kDa subunits of NADH:ubiquinone oxidoreductase from bovine heart mitochondria are nuclear-coded components of the hydrophobic protein fraction of the enzyme. Their amino acid sequences have been deduced from the sequences of overlapping cDNA clones. These clones were amplified from total bovine heart cDNA by means of the polymerase chain reaction, with the use of complex mixtures of oligonucleotide primers based upon fragments of protein sequence determined at the N-terminals of the proteins and at internal sites. The protein sequences of the 39 kDa and 42 kDa subunits are 345 and 320 amino acid residues long respectively, and their calculated molecular masses are 39,115 Da and 36,693 Da. Both proteins are predominantly hydrophilic, but each contains one or two hydrophobic segments that could possibly be folded into transmembrane alpha-helices. The bovine 39 kDa protein sequence is related to that of a 40 kDa subunit from complex I from Neurospora crassa mitochondria; otherwise, it is not related significantly to any known sequence, including redox proteins and two polypeptides involved in import of proteins into mitochondria, known as the mitochondrial processing peptidase and the processing-enhancing protein. Therefore the functions of the 39 kDa and 42 kDa subunits of complex I are unknown. The mitochondrial gene product, ND4, a hydrophobic component of complex I with an apparent molecular mass of about 39 kDa, has been identified in preparations of the enzyme. This subunit stains faintly with Coomassie Blue dye, and in many gel systems it is not resolved from the nuclearcoded 36 kDa subunit. Images Fig. 1. PMID:1832859

Phylogeny of the Defined Murine Microbiota: Altered Schaedler Flora

PubMed Central

Dewhirst, Floyd E.; Chien, Chih-Ching; Paster, Bruce J.; Ericson, Rebecca L.; Orcutt, Roger P.; Schauer, David B.; Fox, James G.

1999-01-01

The “altered Schaedler flora” (ASF) was developed for colonizing germfree rodents with a standardized microbiota. The purpose of this study was to identify each of the eight ASF strains by 16S rRNA sequence analysis. Three strains were previously identified as Lactobacillus acidophilus (strain ASF 360), Lactobacillus salivarius (strain ASF 361), and Bacteroides distasonis (strain ASF 519) based on phenotypic criteria. 16S rRNA analysis indicated that each of the strains differed from its presumptive identity. The 16S rRNA sequence of strain ASF 361 is essentially identical to the 16S rRNA sequences of the type strains of Lactobacillus murinis and Lactobacillus animalis (both isolated from mice), and all of these strains probably belong to a single species. Strain ASF 360 is a novel lactobacillus that clusters with L. acidophilus and Lactobacillus lactis. Strain ASF 519 falls into an unnamed genus containing [Bacteroides] distasonis, [Bacteroides] merdae, [Bacteroides] forsythus, and CDC group DF-3. This unnamed genus is in the Cytophaga-Flavobacterium-Bacteroides phylum and is most closely related to the genus Porphyromonas. The spiral-shaped strain, strain ASF 457, is in the Flexistipes phylum and exhibits sequence identity with rodent isolates of Robertson. The remaining four ASF strains, which are extremely oxygen-sensitive fusiform bacteria, group phylogenetically with the low-G+C-content gram-positive bacteria (Firmicutes, Bacillus-Clostridium group). ASF 356, ASF 492, and ASF 502 fall into Clostridium cluster XIV of Collins et al. Morphologically, ASF 492 resembles members of this cluster, Roseburia cecicola, and Eubacterium plexicaudatum. The 16S rRNA sequence of ASF 492 is identical to that of E. plexicaudatum. Since the type strain and other viable original isolates of E. plexicaudatum have been lost, strain ASF 492 is a candidate for a neotype strain. Strain ASF 500 branches deeply in the low-G+C-content gram-positive phylogenetic tree but is not closely related to any organisms whose 16S rRNA sequences are currently in the GenBank database. The 16S rRNA sequence information determined in the present study should allow rapid identification of ASF strains and should permit detailed analysis of the interactions of ASF organisms during development of intestinal disease in mice that are coinfected with a variety of pathogenic microorganisms. PMID:10427008

Deep Characterization of the Microbiomes of Calophya spp. (Hemiptera: Calophyidae) Gall-Inducing Psyllids Reveals the Absence of Plant Pathogenic Bacteria and Three Dominant Endosymbionts.

PubMed

Overholt, Will A; Diaz, Rodrigo; Rosskopf, Erin; Green, Stefan J; Overholt, William A

2015-01-01

Bacteria associated with sap-feeding insect herbivores include not only symbionts that may increase their hosts' fitness but also harmful plant pathogens. Calophya spp. gall-inducing psyllids (Hemiptera: Calophyidae) are being investigated for their potential as biological control agents of the noxious weed, Brazilian peppertree (Schinus terebinthifolia), in Florida. Although there are no examples of plant pathogen transmission by members of the family Calophyidae, several insects in the superfamily Psylloidea are known to transmit pathogenic bacteria in the genera Candidatus Liberibacter and Candidatus Phytoplasma. To determine whether Calophya spp. harbor potentially harmful plant pathogenic bacteria, we sequenced small subunit (SSU) ribosomal RNA (rRNA) gene amplicons generated from individuals from four Calophya spp. populations: All microbial SSU gene sequences fell into the bacterial domain, with 98-99% belonging to the Proteobacteria. The Calophya microbiomes contained a relatively simple community, with 49-79 operational taxonomic units (OTUs; 97%) detected, and only 5-8 OTUs with greater than 1% abundance. Candidatus Carsonella showed the highest relative abundance, with OTUs from this candidate genus representing between 51-65% of all recovered sequences. The next most abundant clade observed was an unclassified Enterobacteriacae group closely related to bacteria from the genera Buchnera and Blochmannia that ranged from 20-31% in relative abundance. Wolbachia populations were the third most abundant group and represented 7-27% of the diversity in microbial OTUs. No SSU rRNA gene sequences from putative pathogenic bacteria from the genera Ca. Liberibacter or Ca. Phytoplasma were detected in the microbiomes of the four Calophya populations. The probability that infected psyllids were present in our colonies, but were not sampled, was extremley low (1.39 x 10(-10)). As far as we are aware, our study is the first to characterize the microbiome of a candidate biological control agent, and coupled with previous work demonstrating a high degree of host specificity and absence of plant viruses, suggests that releasing Calophya spp. in United States poses minimal risk to non-target plants.

Bacterial diversity in typical Italian salami at different ripening stages as revealed by high-throughput sequencing of 16S rRNA amplicons.

PubMed

Połka, Justyna; Rebecchi, Annalisa; Pisacane, Vincenza; Morelli, Lorenzo; Puglisi, Edoardo

2015-04-01

The bacterial diversity involved in food fermentations is one of the most important factors shaping the final characteristics of traditional foods. Knowledge about this diversity can be greatly improved by the application of high-throughput sequencing technologies (HTS) coupled to the PCR amplification of the 16S rRNA subunit. Here we investigated the bacterial diversity in batches of Salame Piacentino PDO (Protected Designation of Origin), a dry fermented sausage that is typical of a regional area of Northern Italy. Salami samples from 6 different local factories were analysed at 0, 21, 49 and 63 days of ripening; raw meat at time 0 and casing samples at 21 days of ripening where also analysed, and the effect of starter addition was included in the experimental set-up. Culture-based microbiological analyses and PCR-DGGE were carried out in order to be compared with HTS results. A total of 722,196 high quality sequences were obtained after trimming, paired-reads assembly and quality screening of raw reads obtained by Illumina MiSeq sequencing of the two bacterial 16S hypervariable regions V3 and V4; manual curation of 16S database allowed a correct taxonomical classification at the species for 99.5% of these reads. Results confirmed the presence of main bacterial species involved in the fermentation of salami as assessed by PCR-DGGE, but with a greater extent of resolution and quantitative assessments that are not possible by the mere analyses of gel banding patterns. Thirty-two different Staphylococcus and 33 Lactobacillus species where identified in the salami from different producers, while the whole data set obtained accounted for 13 main families and 98 rare ones, 23 of which were present in at least 10% of the investigated samples, with casings being the major sources of the observed diversity. Multivariate analyses also showed that batches from 6 local producers tend to cluster altogether after 21 days of ripening, thus indicating that HTS has the potential for fine scale differentiation of local fermented foods. Copyright © 2014 Elsevier Ltd. All rights reserved.

Calidifontibacter indicus gen. nov., sp. nov., a member of the family Dermacoccaceae isolated from a hot spring, and emended description of the family Dermacoccaceae.

PubMed

Ruckmani, Arunachalam; Kaur, Ishwinder; Schumann, Peter; Klenk, Hans-Peter; Mayilraj, Shanmugam

2011-10-01

During the course of a study on the bacterial diversity in Western Ghats, India, an actinobacterial strain, designated PC IW02(T), was isolated and characterized by a polyphasic taxonomic approach. Strain PC IW02(T) was a non-motile, Gram-positive, short rod that formed creamish white to yellow coloured colonies. 16S rRNA gene sequence analysis showed that the novel strain showed highest sequence similarity with type strains of members of the genus Dermacoccus: Dermacoccus barathri (96.6 %), Dermacoccus profundi (96.5 %), Dermacoccus abyssi (96.4 %) and Dermacoccus nishinomiyaensis (95.9 %). The phylogenetic tree suggested that strain PC IW02(T) could represent a member of a new genus of the family Dermacoccaceae with the genus Demetria as closest clade. Pairwise sequence alignment with Demetria terragena HKI 0089(T) and Kytococcus sedentarius DSM 20547(T) showed similarities of 94.2 and 93.7 %, respectively. Strain PC IW02(T) had MK-8(H(4)) as the major menaquinone. The major fatty acids were iso-C(16 : 0) (43.4 %), iso-C(16 : 1) H (17.2 %) and anteiso-C(17 : 0) (9.9 %). The diagnostic cell-wall amino acid at position 3 of the peptide subunit was lysine; the interpeptide bridge consisted of Gly-Ser-Asp. The polar lipids present were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol, phosphatidylinositol mannosides and phosphatidylserine, along with two unknown phospholipids. The genomic DNA G+C content of the isolate was 77 mol%. On the basis of phenotypic characteristics, including chemotaxonomic data, and 16S rRNA gene sequence similarities, strain PC IW02(T) represents a novel species in a new genus of the family Dermacoccaceae for which the name Calidifontibacter indicus gen. nov., sp. nov. is proposed. The type strain of Calidifontibacter indicus is PC IW02(T) ( = MTCC 8338(T) = DSM 22967(T) = JCM 16038(T)). An emended description of the family Dermacoccaceae is provided.

Deep Characterization of the Microbiomes of Calophya spp. (Hemiptera: Calophyidae) Gall-Inducing Psyllids Reveals the Absence of Plant Pathogenic Bacteria and Three Dominant Endosymbionts

PubMed Central

2015-01-01

Bacteria associated with sap-feeding insect herbivores include not only symbionts that may increase their hosts’ fitness but also harmful plant pathogens. Calophya spp. gall-inducing psyllids (Hemiptera: Calophyidae) are being investigated for their potential as biological control agents of the noxious weed, Brazilian peppertree (Schinus terebinthifolia), in Florida. Although there are no examples of plant pathogen transmission by members of the family Calophyidae, several insects in the superfamily Psylloidea are known to transmit pathogenic bacteria in the genera Candidatus Liberibacter and Candidatus Phytoplasma. To determine whether Calophya spp. harbor potentially harmful plant pathogenic bacteria, we sequenced small subunit (SSU) ribosomal RNA (rRNA) gene amplicons generated from individuals from four Calophya spp. populations. All microbial SSU gene sequences fell into the bacterial domain, with 98-99% belonging to the Proteobacteria. The Calophya microbiomes contained a relatively simple community, with 49-79 operational taxonomic units (OTUs; 97%) detected, and only 5-8 OTUs with greater than 1% abundance. Candidatus Carsonella showed the highest relative abundance, with OTUs from this candidate genus representing between 51 – 65% of all recovered sequences. The next most abundant clade observed was an unclassified Enterobacteriacae group closely related to bacteria from the genera Buchnera and Blochmannia that ranged from 20-31% in relative abundance. Wolbachia populations were the third most abundant group and represented 7-27% of the diversity in microbial OTUs. No SSU rRNA gene sequences from putative pathogenic bacteria from the genera Ca. Liberibacter or Ca. Phytoplasma were detected in the microbiomes of the four Calophya populations. The probability that infected psyllids were present in our colonies, but were not sampled, was extremley low (1.39 x 10-10). As far as we are aware, our study is the first to characterize the microbiome of a candidate biological control agent, and coupled with previous work demonstrating a high degree of host specificity and absence of plant viruses, suggests that releasing Calophya spp. in United States poses minimal risk to non-target plants. PMID:26161659

Phylogenetic and genomic analysis of Methanomassiliicoccales in wetlands and animal intestinal tracts reveals clade-specific habitat preferences.

PubMed

Söllinger, Andrea; Schwab, Clarissa; Weinmaier, Thomas; Loy, Alexander; Tveit, Alexander T; Schleper, Christa; Urich, Tim

2016-01-01

Methanogenic Thermoplasmata of the novel order Methanomassiliicoccales were recently discovered in human and animal gastro-intestinal tracts (GITs). However, their distribution in other methanogenic environments has not been addressed systematically. Here, we surveyed Methanomassiliicoccales presence in wetland soils, a globally important source of methane emissions to the atmosphere, and in the GITs of different animals by PCR targeting their 16S rRNA and methyl:coenzyme M reductase (α-subunit) genes. We detected Methanomassiliicoccales in all 16 peat soils investigated, indicating their wide distribution in these habitats. Additionally, we detected their genes in various animal faeces. Methanomassiliicoccales were subdivided in two broad phylogenetic clades designated 'environmental' and 'GIT' clades based on differential, although non-exclusive, habitat preferences of their members. A well-supported cluster within the environmental clade comprised more than 80% of all wetland 16S rRNA gene sequences. Metagenome assembly from bovine rumen fluid enrichments resulted in two almost complete genomes of both Methanomassiliicoccales clades. Comparative genomics revealed that members of the environmental clade contain larger genomes and a higher number of genes encoding anti-oxidative enzymes than animal GIT clade representatives. This study highlights the wide distribution of Methanomassiliicoccales in wetlands, which suggests that they contribute to methane emissions from these climate-relevant ecosystems. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Identification of characteristic oligonucleotides in the bacterial 16S ribosomal RNA sequence dataset

NASA Technical Reports Server (NTRS)

Zhang, Zhengdong; Willson, Richard C.; Fox, George E.

2002-01-01

MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

PubMed

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-12-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.