Apollo contributes to G overhang maintenance and protects leading-end telomeres.
Wu, Peng; van Overbeek, Megan; Rooney, Sean; de Lange, Titia
2010-08-27
Mammalian telomeres contain a single-stranded 3' overhang that is thought to mediate telomere protection. Here we identify the TRF2-interacting factor Apollo as a nuclease that contributes to the generation/maintenance of this overhang. The function of mouse Apollo was determined using Cre-mediated gene deletion, complementation with Apollo mutants, and the TRF2-F120A mutant that cannot bind Apollo. Cells lacking Apollo activated the ATM kinase at their telomeres in S phase and showed leading-end telomere fusions. These telomere dysfunction phenotypes were accompanied by a reduction in the telomeric overhang signal. The telomeric functions of Apollo required its TRF2-interaction and nuclease motifs. Thus, TRF2 recruits the Apollo nuclease to process telomere ends synthesized by leading-strand DNA synthesis, thereby creating a terminal structure that avoids ATM activation and resists end-joining. These data establish that the telomeric overhang is required for the protection of telomeres from the DNA damage response. Copyright (c) 2010 Elsevier Inc. All rights reserved.
Roof Overhangs for Solar Houses
NASA Technical Reports Server (NTRS)
Gracey, W.
1985-01-01
Convenient graphical method determines both width and vertical position of overhangs for standard wall section having "typical" window arrangement. Overhangs for this wall section determined for two extremes of latitude in United States.
E-Area Low-Level Waste Facility Cover Overhang Analysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hang, T.; Flach, G. P.
2016-05-18
PORFLOW related analyses were performed with a focus on Slit and Engineered Trenches to evaluate the minimum required cover overhang size that would prevent any adverse impact on the ELLWF overall performance. Cover overhang is defined as the lateral distance that a low-infiltration cover extends beyond the edge of the trench unit in any direction. Analyses were carried out for H-3 (short half-life), I-129 (very long half-life), and Sr-90 (moderate half-life with intermediate K d) at different overhang sizes (5ft, 10ft, 20ft, 50ft, and infinite), cover timing (0yr, 10yr, 20yr, and 30yr), and scenarios (Intact and a limited Dynamic Compactionmore » Case). H-3, I-129 and Sr-90 are representative of nuclides that typically drive the sum-of-fractions for a trench disposal unit.« less
Structural optimization under overhang constraints imposed by additive manufacturing technologies
NASA Astrophysics Data System (ADS)
Allaire, G.; Dapogny, C.; Estevez, R.; Faure, A.; Michailidis, G.
2017-12-01
This article addresses one of the major constraints imposed by additive manufacturing processes on shape optimization problems - that of overhangs, i.e. large regions hanging over void without sufficient support from the lower structure. After revisiting the 'classical' geometric criteria used in the literature, based on the angle between the structural boundary and the build direction, we propose a new mechanical constraint functional, which mimics the layer by layer construction process featured by additive manufacturing technologies, and thereby appeals to the physical origin of the difficulties caused by overhangs. This constraint, as well as some variants, is precisely defined; their shape derivatives are computed in the sense of Hadamard's method, and numerical strategies are extensively discussed, in two and three space dimensions, to efficiently deal with the appearance of overhang features in the course of shape optimization processes.
Novel Overhang Support Designs for Powder-Based Electron Beam Additive Manufacturing (EBAM)
NASA Technical Reports Server (NTRS)
Nabors, Sammy A.
2014-01-01
NASA Marshall Space Flight Center, in collaboration with the University of Alabama, has developed a contact-free support structure used to fabricate overhang-type geometries via EBAM. The support structure is used for 3-D metal-printed components for the aerospace, automotive, biomedical and other industries. Current techniques use support structures to address deformation challenges inherent in 3-D metal printing. However, these structures (overhangs) are bonded to the component and need to be removed in post-processing using a mechanical tool. This new technology improves the overhang support structure design for components by eliminating associated geometric defects and post-processing requirements.
Human RTEL1 stabilizes long G-overhangs allowing telomerase-dependent over-extension.
Porreca, Rosa M; Glousker, Galina; Awad, Aya; Matilla Fernandez, Maria I; Gibaud, Anne; Naucke, Christian; Cohen, Scott B; Bryan, Tracy M; Tzfati, Yehuda; Draskovic, Irena; Londoño-Vallejo, Arturo
2018-05-18
Telomere maintenance protects the cell against genome instability and senescence. Accelerated telomere attrition is a characteristic of premature aging syndromes including Dyskeratosis congenita (DC). Mutations in hRTEL1 are associated with a severe form of DC called Hoyeraal-Hreidarsson syndrome (HHS). HHS patients carry short telomeres and HHS cells display telomere damage. Here we investigated how hRTEL1 contributes to telomere maintenance in human primary as well as tumor cells. Transient depletion of hRTEL1 resulted in rapid telomere shortening only in the context of telomerase-positive cells with very long telomeres and high levels of telomerase. The effect of hRTEL1 on telomere length is telomerase dependent without impacting telomerase biogenesis or targeting of the enzyme to telomeres. Instead, RTEL1 depletion led to a decrease in both G-overhang content and POT1 association with telomeres with limited telomere uncapping. Strikingly, overexpression of POT1 restored telomere length but not the overhang, demonstrating that G-overhang loss is the primary defect caused by RTEL1 depletion. We propose that hRTEL1 contributes to the maintenance of long telomeres by preserving long G-overhangs, thereby facilitating POT1 binding and elongation by telomerase.
Tensile strength of 67P/Churyumov-Gerasimenko nucleus material from overhangs
NASA Astrophysics Data System (ADS)
Attree, N.; Groussin, O.; Jorda, L.; Nébouy, D.; Thomas, N.; Brouet, Y.; Kührt, E.; Preusker, F.; Scholten, F.; Knollenberg, J.; Hartogh, P.; Sierks, H.; Barbieri, C.; Lamy, P.; Rodrigo, R.; Koschny, D.; Rickman, H.; Keller, H. U.; A'Hearn, M. F.; Auger, A.-T.; Barucci, M. A.; Bertaux, J.-L.; Bertini, I.; Bodewits, D.; Boudreault, S.; Cremonese, G.; Da Deppo, V.; Davidsson, B.; Debei, S.; De Cecco, M.; Deller, J.; El-Maarry, M. R.; Fornasier, S.; Fulle, M.; Gutiérrez, P. J.; Güttler, C.; Hviid, S.; Ip, W.-H.; Kovacs, G.; Kramm, J. R.; Küppers, M.; Lara, L. M.; Lazzarin, M.; Lopez Moreno, J. J.; Lowry, S.; Marchi, S.; Marzari, F.; Mottola, S.; Naletto, G.; Oklay, N.; Pajola, M.; Toth, I.; Tubiana, C.; Vincent, J.-B.; Shi, X.
2018-03-01
We directly measured twenty overhanging cliffs on the surface of comet 67P/Churyumov-Gerasimenko extracted from the latest shape model and estimated the minimum tensile strengths needed to support them against collapse under the comet's gravity. We find extremely low strengths of around 1 Pa or less (1 to 5 Pa, when scaled to a metre length). The presence of eroded material at the base of most overhangs, as well as the observed collapse of two features andthe implied previous collapse of another, suggests that they are prone to failure and that the true material strengths are close to these lower limits (although we only consider static stresses and not dynamic stress from, for example, cometary activity). Thus, a tensile strength of a few pascals is a good approximation for the tensile strength of the 67P nucleus material, which is in agreement with previous work. We find no particular trends in overhang properties either with size over the 10-100 m range studied here or location on the nucleus. There are no obvious differences, in terms of strength, height or evidence of collapse, between the populations of overhangs on the two cometary lobes, suggesting that 67P is relatively homogenous in terms of tensile strength. Low material strengths are supportive of cometary formation as a primordial rubble pile or by collisional fragmentation of a small body (tens of km).
Human RTEL1 stabilizes long G-overhangs allowing telomerase-dependent over-extension
Porreca, Rosa M; Glousker, Galina; Awad, Aya; Matilla Fernandez, Maria I; Gibaud, Anne; Naucke, Christian; Cohen, Scott B; Bryan, Tracy M; Tzfati, Yehuda; Draskovic, Irena; Londoño-Vallejo, Arturo
2018-01-01
Abstract Telomere maintenance protects the cell against genome instability and senescence. Accelerated telomere attrition is a characteristic of premature aging syndromes including Dyskeratosis congenita (DC). Mutations in hRTEL1 are associated with a severe form of DC called Hoyeraal-Hreidarsson syndrome (HHS). HHS patients carry short telomeres and HHS cells display telomere damage. Here we investigated how hRTEL1 contributes to telomere maintenance in human primary as well as tumor cells. Transient depletion of hRTEL1 resulted in rapid telomere shortening only in the context of telomerase-positive cells with very long telomeres and high levels of telomerase. The effect of hRTEL1 on telomere length is telomerase dependent without impacting telomerase biogenesis or targeting of the enzyme to telomeres. Instead, RTEL1 depletion led to a decrease in both G-overhang content and POT1 association with telomeres with limited telomere uncapping. Strikingly, overexpression of POT1 restored telomere length but not the overhang, demonstrating that G-overhang loss is the primary defect caused by RTEL1 depletion. We propose that hRTEL1 contributes to the maintenance of long telomeres by preserving long G-overhangs, thereby facilitating POT1 binding and elongation by telomerase. PMID:29522136
Telomeric 3' overhangs derive from resection by Exo1 and Apollo and fill-in by POT1b-associated CST.
Wu, Peng; Takai, Hiroyuki; de Lange, Titia
2012-07-06
A 3' overhang is critical for the protection and maintenance of mammalian telomeres, but its synthesis must be regulated to avoid excessive resection of the 5' end, which could cause telomere shortening. How this balance is achieved in mammals has not been resolved. Here, we determine the mechanism for 3' overhang synthesis in mouse cells by evaluating changes in telomeric overhangs throughout the cell cycle and at leading- and lagging-end telomeres. Apollo, a nuclease bound to the shelterin subunit TRF2, initiates formation of the 3' overhang at leading-, but not lagging-end telomeres. Hyperresection by Apollo is blocked at both ends by the shelterin protein POT1b. Exo1 extensively resects both telomere ends, generating transient long 3' overhangs in S/G2. CST/AAF, a DNA polα.primase accessory factor, binds POT1b and shortens the extended overhangs produced by Exo1, likely through fill-in synthesis. 3' overhang formation is thus a multistep, shelterin-controlled process, ensuring functional telomeric overhangs at chromosome ends. Copyright © 2012 Elsevier Inc. All rights reserved.
Failure Analysis of Overhanging Blocks in the Walls of a Gas Storage Salt Cavern: A Case Study
NASA Astrophysics Data System (ADS)
Wang, Tongtao; Yang, Chunhe; Li, Jianjun; Li, Jinlong; Shi, Xilin; Ma, Hongling
2017-01-01
Most of the rock salt of China is bedded, in which non-salt layers and rock salt layers alternate. Due to the poor solubility of the non-salt layers, many blocks overhang on the walls of the caverns used for gas storage, constructed by water leaching. These overhanging blocks may collapse at any time, which may damage the tubing and casing string, and even cause instability of the cavern. They are one of the main factors threatening the safety of caverns excavated in bedded rock salt formations. In this paper, a geomechanical model of the JJKK-D salt cavern, located in Jintan salt district, Jintan city, Jiangsu province, China, is established to evaluate the stability of the overhanging blocks on its walls. The characters of the target formation, property parameters of the rock mass, and actual working conditions are considered in the geomechanical model. An index system composed of stress, displacement, plastic zone, safety factor, and equivalent strain is used to predict the collapse length of the overhanging blocks, the moment the collapse will take place, and the main factors causing the collapse. The sonar survey data of the JJKK-D salt cavern are used to verify the reliability and accuracy of the proposed geomechanical model. The results show that the proposed geomechanical model has a good reliability and accuracy, and can be used for the collapse prediction of the overhanging blocks on the wall of the JJKK-D salt cavern. The collapse length of the overhanging block is about 8 m. We conclude that the collapse takes place during the debrining. The reason behind the collapse is the sudden decrease of the fluid density, leading to the increase of the self-weight of the overhanging blocks. This study provides a basis for the collapse prediction method of the overhanging blocks of Jintan salt cavern gas storage, and can also serve as a reference for salt cavern gas storage with similar conditions to deal with overhanging blocks.
Transverse vibration of a simply supported beam with symmetric overhang of arbitrary length
J. F. Murphy
1997-01-01
The numerical solution to the frequency equation for the transverse vibration of a simple beam with symmetric overhang is found. The numerical results converge to the analytical solutions for the two limiting cases of a beam with no overhang and a beam with no span and agree with the case in which the supports are at the nodal points of a freely vibrating beam. An...
Telomeric 3′ overhangs derive from resection by Exo1 and Apollo and fill-in by POT1b-associated CST
Wu, Peng; Takai, Hiroyuki; de Lange, Titia
2012-01-01
SUMMARY A 3′ overhang is critical for the protection and maintenance of mammalian telomeres. How these overhangs are generated and whether different processing steps modify telomeres synthesized by leading- and lagging-strand DNA replication was not known. Here we evaluate changes in the telomeric overhangs through the cell cycle and at leading- and lagging-end telomeres in mouse cells lacking relevant genes. Apollo, a nuclease bound to the shelterin subunit TRF2, initiated formation of the 3′ overhang at leading-, but not lagging-end telomeres. Hyper-resection by Apollo was blocked at both ends by the shelterin protein POT1b. Exo1 extensively resected both telomere ends, generating long 3′ overhangs that transiently occurred in S/G2. CST/AAF, a DNA polymeraseα. primase accessory factor related to yeast CST, bound POT1b and shortened the extended overhangs produced by Exo1, most likely through fill-in synthesis. The results establish 3′ overhang formation as a multi-step, shelterin-controlled process that ensures functional telomeric overhangs at all chromosome ends. PMID:22748632
Development of precast bridge deck overhang system : technical report.
DOT National Transportation Integrated Search
2011-07-01
The implementation of full-depth, precast overhang panel systems has the potential to improve constructability, : productivity, and make bridges more economical. Initial testing and analyses reported in the 0-6100-2 report resulted in : a design that...
Lee, Hui Sun; Lee, Soo Nam; Joo, Chul Hyun; Lee, Heuiran; Lee, Han Saem; Yoon, Seung Yong; Kim, Yoo Kyum; Choe, Han
2007-03-01
RNA interference (RNAi) is a 'knock-down' reaction to reduce expression of a specific gene through highly regulated, enzyme-mediated processes. Small interfering RNAs (siRNAs) are RNA molecules that play an effector role in RNAi and can bind the PAZ domains present in Dicer and RISC. We investigated the interaction between the PAZ domain and the siRNA-like duplexes through dissociation molecular dynamics (DMD) simulations. Specifically, we focused on the response of the PAZ domain to various 3'-overhang structures of the siRNA-like duplexes. We found that the siRNA-like duplex with the 3' UU-overhang made relatively more stable complex with the PAZ domain compared to those with 3' CC-, AA-, and GG-overhangs. The siRNA-like duplex with UU-overhang was easily dissociated from the PAZ domain once the structural stability of the complex is impaired. Interestingly, the 3' UU-overhang spent the least time at the periphery region of the binding pocket during the dissociation process, which can be mainly attributable to UU-overhang's smallest number of hydrogen bonds.
14. DETAIL OF ENTRANCE OVERHANG, WEST SIDE OF NORTH PORTION. ...
14. DETAIL OF ENTRANCE OVERHANG, WEST SIDE OF NORTH PORTION. SAME FEATURE AS A-13. - Chollas Heights Naval Radio Transmitting Facility, Transmitter Building, 6410 Zero Road, San Diego, San Diego County, CA
1. GENERAL VIEW. OVERHANG, PAINTED RED, HAS VERTICAL SIDING AND ...
1. GENERAL VIEW. OVERHANG, PAINTED RED, HAS VERTICAL SIDING AND FADED PAINTINGS OF FARM ANIMALS: COW, DONKEYS AND HORSE. - De Turck House, Barn, State Route 662 vicinity, Oley Township, Oley, Berks County, PA
O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.
2006-01-01
Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533
Effects of dark brooders and overhangs on free-range use and behaviour of slow-growing broilers.
Stadig, L M; Rodenburg, T B; Reubens, B; Ampe, B; Tuyttens, F A M
2017-12-04
Broiler chickens often make limited use of the free-range area. Range use is influenced by type of shelter available. Range use may possibly be improved by a more gradual transition from the house to the range and by using dark brooders (secluded warm, dark areas in the home pen) that mimic aspects of a broody hen and possibly reduce fearfulness. The aim of this study was to assess effects of dark brooders on fearfulness, free-range use and behaviour later in life. Another aim was to test the chickens' preference for shelter type and the effects of overhangs outside of the pop holes to provide a gradual transition to the range. Three production rounds, each with 440 Sasso broiler chickens (110/group), were completed. Chicks were housed indoors from days 0 to 25; per round, two groups had access to a dark brooder, whereas the other two groups had conventional IR lamps. Fearfulness was assessed by the open field (OF) and tonic immobility (TI) tests on days 22 to 24 on 25 chicks/group per round. Birds were then moved to four mobile houses from which they could access both grassland with artificial shelter (AS) and short rotation coppice (SRC). Two of the houses had overhangs extending from the pop holes; these were switched between the four houses weekly. Free-range use and behaviour were observed three times daily from Monday to Friday. Dark brooders did not affect results from the OF or TI test, except for jumps in the OF test which tended to occur less often in brooded chicks. Neither dark brooders (34.9% without v. 31.7% with brooder) nor overhangs (32.5% without v. 34.1% with overhangs) influenced the percentage of chickens outside. Chickens showed a clear preference for SRC, range use increased over time in SRC, and more birds ranged farther from the house in SRC. Behaviours of chickens observed outside were mainly influenced by shelter type, age of the birds and distance from the house. Locomotion tended to occur more in the presence of overhangs. Overall
NASA Technical Reports Server (NTRS)
Cooper, Kenneth (Inventor); Chou, Yuag-Shan (Inventor)
2017-01-01
Systems and methods are provided for designing and fabricating contact-free support structures for overhang geometries of parts fabricated using electron beam additive manufacturing. One or more layers of un-melted metallic powder are disposed in an elongate gap between an upper horizontal surface of the support structure and a lower surface of the overhang geometry. The powder conducts heat from the overhang geometry to the support structure. The support structure acts as a heat sink to enhance heat transfer and reduce the temperature and severe thermal gradients due to poor thermal conductivity of metallic powders underneath the overhang. Because the support structure is not connected to the part, the support structure can be removed freely without any post-processing step.
Comparing 2-nt 3' overhangs against blunt-ended siRNAs: a systems biology based study.
Ghosh, Preetam; Dullea, Robert; Fischer, James E; Turi, Tom G; Sarver, Ronald W; Zhang, Chaoyang; Basu, Kalyan; Das, Sajal K; Poland, Bradley W
2009-07-07
In this study, we formulate a computational reaction model following a chemical kinetic theory approach to predict the binding rate constant for the siRNA-RISC complex formation reaction. The model allowed us to study the potency difference between 2-nt 3' overhangs against blunt-ended siRNA molecules in an RNA interference (RNAi) system. The rate constant predicted by this model was fed into a stochastic simulation of the RNAi system (using the Gillespie stochastic simulator) to study the overall potency effect. We observed that the stochasticity in the transcription/translation machinery has no observable effects in the RNAi pathway. Sustained gene silencing using siRNAs can be achieved only if there is a way to replenish the dsRNA molecules in the cell. Initial findings show about 1.5 times more blunt-ended molecules will be required to keep the mRNA at the same reduced level compared to the 2-nt overhang siRNAs. However, the mRNA levels jump back to saturation after a longer time when blunt-ended siRNAs are used. We found that the siRNA-RISC complex formation reaction rate was 2 times slower when blunt-ended molecules were used pointing to the fact that the presence of the 2-nt overhangs has a greater effect on the reaction in which the bound RISC complex cleaves the mRNA.
Comparing 2-nt 3' overhangs against blunt-ended siRNAs: a systems biology based study
Ghosh, Preetam; Dullea, Robert; Fischer, James E; Turi, Tom G; Sarver, Ronald W; Zhang, Chaoyang; Basu, Kalyan; Das, Sajal K; Poland, Bradley W
2009-01-01
In this study, we formulate a computational reaction model following a chemical kinetic theory approach to predict the binding rate constant for the siRNA-RISC complex formation reaction. The model allowed us to study the potency difference between 2-nt 3' overhangs against blunt-ended siRNA molecules in an RNA interference (RNAi) system. The rate constant predicted by this model was fed into a stochastic simulation of the RNAi system (using the Gillespie stochastic simulator) to study the overall potency effect. We observed that the stochasticity in the transcription/translation machinery has no observable effects in the RNAi pathway. Sustained gene silencing using siRNAs can be achieved only if there is a way to replenish the dsRNA molecules in the cell. Initial findings show about 1.5 times more blunt-ended molecules will be required to keep the mRNA at the same reduced level compared to the 2-nt overhang siRNAs. However, the mRNA levels jump back to saturation after a longer time when blunt-ended siRNAs are used. We found that the siRNA-RISC complex formation reaction rate was 2 times slower when blunt-ended molecules were used pointing to the fact that the presence of the 2-nt overhangs has a greater effect on the reaction in which the bound RISC complex cleaves the mRNA. PMID:19594876
Xu, Lexing; Wang, Xin; He, Hongwei; Zhou, Jinming; Li, Xiaoyu; Ma, Hongtao; Li, Zelin; Zeng, Yi; Shao, Rongguang; Cen, Shan; Wang, Yucheng
2015-02-10
Short interfering RNAs (siRNAs) are broadly used to manipulate gene expression in mammalian cells. Although chemical modification is useful for increasing the potency of siRNAs in vivo, rational optimization of siRNA performance through chemical modification is still a challenge. In this work, we designed and synthesized a set of siRNAs containing modified two-nucleotide 3'-overhangs with the aim of strengthening the interaction between the 3'-end of the siRNA strand and the PAZ domain of Ago2. Their efficiency of binding to the PAZ domain was calculated using a computer modeling program, followed by measurement of RNA-Ago2 interaction in a surface plasmon resonance biochemical assay. The results suggest that increasing the level of binding of the 3'-end of the guiding strand with the PAZ domain, and/or reducing the level of binding of the sense strand through modifying the two-nucleotide 3'-overhangs, affects preferential strand selection and improves siRNA activity, while we cannot exclude the possibility that the modifications at the 3'-end of the sense strand may also affect the recognition of the 5'-end of the guiding strand by the MID domain. Taken together, our work presents a strategy for optimizing siRNA performance through asymmetric chemical modification of 3'-overhangs and also helps to develop the computer modeling method for rational siRNA design.
Pandita, Raj K.; Chow, Tracy T.; Udayakumar, Durga; Bain, Amanda L.; Cubeddu, Liza; Hunt, Clayton R.; Shi, Wei; Horikoshi, Nobuo; Zhao, Yong; Wright, Woodring E.; Khanna, Kum Kum; Shay, Jerry W.; Pandita, Tej K.
2015-01-01
Proliferating mammalian stem and cancer cells express telomerase (TERT) in an effort to extend chromosomal G-overhangs and maintain telomere ends. Telomerase-expressing cells also have higher levels of the single-stranded DNA binding protein SSB1, which has a critical role in DNA double-strand break repair. Here we report that SSB1 binds specifically to G-strand telomeric DNA in vitro and associates with telomeres in vivo. SSB1 interacted with the TERT catalytic subunit and regulates its interaction with telomeres. Deletion of SSB1 reduced TERT interaction with telomeres and lead to G-overhang loss. While SSB1 was recruited to DSB sites, we found no corresponding change in TERT levels at these sites, implying that SSB1-TERT interaction relied upon a specific chromatin structure or context. Our findings offer an explanation for how telomerase is recruited to telomeres to facilitate G-strand DNA extension, a critical step in maintaining telomere ends and cell viability in all cancer cells. PMID:25589350
Sabbah, Mahmoud; Kadota, Kazushige; Fuku, Yasushi; Mitsudo, Kazuaki
2015-01-01
Stent malapposition and overhanging stent struts in front of the side branch (SB) ostium are not uncommon following bifurcation stenting that might lead to stent thrombosis. We herein present 2 cases, in which optical frequency domain imaging and intravascular ultrasound effectively revealed stent malapposition and overhanging struts inside the ostium of the SB following left main coronary artery stenting. Therefore, we introduced a novel technique for rectification of these incidental findings by selective SB re-wiring through the most distal stent cell with the adjunctive help of a double lumen microcatheter. PMID:27122906
Pandita, Raj K; Chow, Tracy T; Udayakumar, Durga; Bain, Amanda L; Cubeddu, Liza; Hunt, Clayton R; Shi, Wei; Horikoshi, Nobuo; Zhao, Yong; Wright, Woodring E; Khanna, Kum Kum; Shay, Jerry W; Pandita, Tej K
2015-03-01
Proliferating mammalian stem and cancer cells express telomerase [telomerase reverse transcriptase (TERT)] in an effort to extend chromosomal G-overhangs and maintain telomere ends. Telomerase-expressing cells also have higher levels of the single-stranded DNA-binding protein SSB1, which has a critical role in DNA double-strand break (DSB) repair. Here, we report that SSB1 binds specifically to G-strand telomeric DNA in vitro and associates with telomeres in vivo. SSB1 interacts with the TERT catalytic subunit and regulates its interaction with telomeres. Deletion of SSB1 reduces TERT interaction with telomeres and leads to G-overhang loss. Although SSB1 is recruited to DSB sites, we found no corresponding change in TERT levels at these sites, implying that SSB1-TERT interaction relies upon a specific chromatin structure or context. Our findings offer an explanation for how telomerase is recruited to telomeres to facilitate G-strand DNA extension, a critical step in maintaining telomere ends and cell viability in all cancer cells. Cancer Res; 75(5); 858-69. ©2015 AACR. ©2015 American Association for Cancer Research.
Le Gac, Stéphane; Najjari, Btissam; Dorcet, Vincent; Roisnel, Thierry; Fusaro, Luca; Luhmer, Michel; Furet, Eric; Halet, Jean-François; Boitrel, Bernard
2013-08-12
Overhanging carboxylic acid porphyrins have revealed promising ditopic ligands offering a new entry in the field of supramolecular coordination chemistry of porphyrinoids. Notably, the adjunction of a so-called hanging-atop (HAT) Pb(II) cation to regular Pb(II) porphyrin complexes allowed a stereoselective incorporation of the N-core bound cation, and an allosterically controlled Newton's cradle-like motion of the two Pb(II) ions also emerged from such bimetallic complexes. In this contribution, we have extended this work to other ligands and metal ions, aiming at understanding the parameters that control the HAT Pb(II) coordination. The nature of the N-core bound metal ion (Zn(II), Cd(II)), the influence of the deprotonation state of the overhanging COOH group and the presence of a neutral ligand on the opposite side (exogenous or intramolecular), have been examined through (1)H NMR spectroscopic experiments with the help of radiocrystallographic structures and DFT calculations. Single and bis-strap ligands have been considered. They all incorporate a COOH group hung over the N-core on one side. For the bis-strap ligands, either an ester or an amide group has been introduced on the other side. In the presence of a base, the mononuclear Zn(II) or Cd(II) complexes incorporate the carbonyl of the overhanging carboxylate as apical ligand, decreasing its availability for the binding of a HAT Pb(II). An allosteric effector (e.g., 4-dimethylaminopyridine (DMAP), in the case of a single-strap ligand) or an intramolecular ligand (e.g., an amide group), strong enough to compete with the carbonyl of the hung COO(-), is required to switch the N-core bound cation to the opposite side with concomitant release of the COO(-), thereby allowing HAT Pb(II) complexation. In the absence of a base, Zn(II) or Cd(II) binds preferentially the carbonyl of the intramolecular ester or amide groups in apical position rather than that of the COOH. This better preorganization, with the
Creating world-class supply chains.
Katzorke, M; Lee, W B
2000-08-01
This article will share knowledge in two areas: The elements of world-class supply chains and the linking processes from customers' customers to suppliers' suppliers and the management approaches needed to engage the people and the organization in an effective implementation process to achieve world-class status.
Reconstructing Buildings with Discontinuities and Roof Overhangs from Oblique Aerial Imagery
NASA Astrophysics Data System (ADS)
Frommholz, D.; Linkiewicz, M.; Meissner, H.; Dahlke, D.
2017-05-01
This paper proposes a two-stage method for the reconstruction of city buildings with discontinuities and roof overhangs from oriented nadir and oblique aerial images. To model the structures the input data is transformed into a dense point cloud, segmented and filtered with a modified marching cubes algorithm to reduce the positional noise. Assuming a monolithic building the remaining vertices are initially projected onto a 2D grid and passed to RANSAC-based regression and topology analysis to geometrically determine finite wall, ground and roof planes. If this should fail due to the presence of discontinuities the regression will be repeated on a 3D level by traversing voxels within the regularly subdivided bounding box of the building point set. For each cube a planar piece of the current surface is approximated and expanded. The resulting segments get mutually intersected yielding both topological and geometrical nodes and edges. These entities will be eliminated if their distance-based affiliation to the defining point sets is violated leaving a consistent building hull including its structural breaks. To add the roof overhangs the computed polygonal meshes are projected onto the digital surface model derived from the point cloud. Their shapes are offset equally along the edge normals with subpixel accuracy by detecting the zero-crossings of the second-order directional derivative in the gradient direction of the height bitmap and translated back into world space to become a component of the building. As soon as the reconstructed objects are finished the aerial images are further used to generate a compact texture atlas for visualization purposes. An optimized atlas bitmap is generated that allows perspectivecorrect multi-source texture mapping without prior rectification involving a partially parallel placement algorithm. Moreover, the texture atlases undergo object-based image analysis (OBIA) to detect window areas which get reintegrated into the building
Only adding stationary storage to vaccine supply chains may create and worsen transport bottlenecks.
Haidari, Leila A; Connor, Diana L; Wateska, Angela R; Brown, Shawn T; Mueller, Leslie E; Norman, Bryan A; Schmitz, Michelle M; Paul, Proma; Rajgopal, Jayant; Welling, Joel S; Leonard, Jim; Claypool, Erin G; Weng, Yu-Ting; Chen, Sheng-I; Lee, Bruce Y
2013-01-01
Although vaccine supply chains in many countries require additional stationary storage and transport capacity to meet current and future needs, international donors tend to donate stationary storage devices far more often than transport equipment. To investigate the impact of only adding stationary storage equipment on the capacity requirements of transport devices and vehicles, we used HERMES (Highly Extensible Resource for Modeling Supply Chains) to construct a discrete event simulation model of the Niger vaccine supply chain. We measured the transport capacity requirement for each mode of transport used in the Niger vaccine cold chain, both before and after adding cold rooms and refrigerators to relieve all stationary storage constraints in the system. With the addition of necessary stationary storage, the average transport capacity requirement increased from 88% to 144% for cold trucks, from 101% to 197% for pickup trucks, and from 366% to 420% for vaccine carriers. Therefore, adding stationary storage alone may worsen or create new transport bottlenecks as more vaccines flow through the system, preventing many vaccines from reaching their target populations. Dynamic modeling can reveal such relationships between stationary storage capacity and transport constraints.
Only Adding Stationary Storage to Vaccine Supply Chains May Create and Worsen Transport Bottlenecks
Haidari, Leila A.; Connor, Diana L.; Wateska, Angela R.; Brown, Shawn T.; Mueller, Leslie E.; Norman, Bryan A.; Schmitz, Michelle M.; Paul, Proma; Rajgopal, Jayant; Welling, Joel S.; Leonard, Jim; Claypool, Erin G.; Weng, Yu-Ting; Chen, Sheng-I; Lee, Bruce Y.
2015-01-01
Although vaccine supply chains in many countries require additional stationary storage and transport capacity to meet current and future needs, international donors tend to donate stationary storage devices far more often than transport equipment. To investigate the impact of only adding stationary storage equipment on the capacity requirements of transport devices and vehicles, we used HERMES (Highly Extensible Resource for Modeling Supply Chains) to construct a discrete event simulation model of the Niger vaccine supply chain. We measured the transport capacity requirement for each mode of transport used in the Niger vaccine cold chain, both before and after adding cold rooms and refrigerators to relieve all stationary storage constraints in the system. With the addition of necessary stationary storage, the average transport capacity requirement increased from 88% to 144% for cold trucks, from 101% to 197% for pickup trucks, and from 366% to 420% for vaccine carriers. Therefore, adding stationary storage alone may worsen or create new transport bottlenecks as more vaccines flow through the system, preventing many vaccines from reaching their target populations. Dynamic modeling can reveal such relationships between stationary storage capacity and transport constraints. PMID:23903398
Xia, Xiaodong; Hao, Yuanqiang; Hu, Shengqiang; Wang, Jianxiu
2014-01-15
A facile strategy for the assay of target miRNA using fluorescent silver nanoclusters (AgNCs) has been described. Due to the preferable interaction between cytosine residues and Ag(+), a short cytosine-rich oligonucleotide (ODN) with only six bases 5'-TCCCCC-3' served as an efficient scaffold for the creation of the AgNCs. The AgNCs displayed a bright red emission when excited at 545nm. Such ODN base-stabilized AgNCs have been exploited for miRNA sensing. Overhangs of TCC at the 5' end (5'-TCC) and CCC at the 3' end (CCC-3') (denoted as 5'-TCC/CCC-3') appended to the hairpin ODN probe which also contains recognition sequences for target miRNA were included. Interestingly, the AgNCs/hairpin ODN probe showed similar spectral properties as that templated by 5'-TCCCCC-3'. The formation of the hairpin ODN probe/miRNA duplex separated the 5'-TCC/CCC-3' overhangs, thus disturbing the optical property or structure of the AgNCs. As a result, fluorescence quenching of the AgNCs/hairpin ODN probe was obtained, which allows for facile determination of target miRNA. The proposed method is simple and cost-effective, holding great promise for clinical applications. Copyright © 2013 Elsevier B.V. All rights reserved.
Guo, Chenglin; Liu, Chengwu; Lin, Feng; Liu, Lunxu
2016-01-01
Single-port video-assisted thoracoscopic lobectomy is still difficult for most thoracic surgeons. Placement of an endo-stapler is one of the key issues when handling the bronchus or pulmonary vessels through one incision, especially if it would interfere with the traction belt. Therefore, we developed a novel method with an intrathoracic vertical overhanging approach to make the placement of the endo-stapler easier during single-port video-assisted thoracoscopic surgery lobectomy, and share our experience in this paper. © The Author 2015. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.
NASA Astrophysics Data System (ADS)
Yavorovsky, Y. V.; Malenkov, A. S.; Zhigulina, Y. V.; Romanov, D. O.; Kurzanov, S. Y.
2017-11-01
This paper deals with the variant of modernization of the heat point within urban heat supply network in order to create the system of heat and cold supply on its basis, providing the suppliers with heat in cold months and with heat and cold in warm months. However, in cold months in the course of heating system operation, the reverse delivery water temperature is maintained below 40 °C. The analysis of heat and power indicators of the heat and cold supply system under different operating conditions throughout the year was conducted. The possibility to use the existing heat networks for the cold supply needs was estimated. The advantages of the system over the traditional heat supply systems that use Combined Heat and Power (CHP) plant as a heat source as exemplified by heat supply system from CHP with ST-80 turbine were demonstrated.
NASA Technical Reports Server (NTRS)
Knight, Montgomery; Noyes, Richard W
1929-01-01
This preliminary report furnishes information on the changes in the forces on each wing of a biplane cellule when the decalage, dihedral, sweepback and overhang are separately varied. The data were obtained from pressure distribution tests made in the Atmospheric Wind Tunnel of the Langley Memorial Aeronautical Laboratory. Since each test was carried up to 90 degree angle of attack, the results may be used in the study of stalled flight and of spinning and in the structural design of biplane wings.
NASA Astrophysics Data System (ADS)
Singh, Abhishek Kumar
2018-06-01
Three-dimensional platinum and tungsten overhanging nanogap (∼70 nm) electrodes are fabricated on a glass substrate using focused ion beam milling and chemical vapour deposition processes. Current-voltage (I-V) characteristics of the devices measured at a pressure of ∼10-6 mbar shows space-charge emission followed by the Fowler-Nordheim (F-N) field emission. After the F-N emission, the system enters into an explosive emission process, at a higher voltage generating a huge current. We observe a sharp and abrupt rise in the emission current which marks the transition from the F-N emission to the explosive emission state. The explosive emission process is destructive in nature and yields micro-/nano-size spherical metal particles. The chemical compositions and the size-distribution of such particles are performed.
Lee, Hau L
2004-10-01
Building a strong supply chain is essential for business success. But when it comes to improving their supply chains, few companies take the right approach. Many businesses work to make their chains faster or more cost-effective, assuming that those steps are the keys to competitive advantage. To the contrary: Supply chains that focus on speed and costs tend to deteriorate over time. The author has spent 15 years studying more than 60 companies to gain insight into this and other supply chain dilemmas. His conclusion: Only companies that build supply chains that are agile, adaptable, and aligned get ahead of their rivals. All three components are essential; without any one of them, supply chains break down. Great companies create supply chains that respond to abrupt changes in markets. Agility is critical because in most industries, both demand and supply fluctuate rapidly and widely. Supply chains typically cope by playing speed against costs, but agile ones respond both quickly and cost-efficiently. Great companies also adapt their supply networks when markets or strategies change. The best supply chains allow managers to identify structural shifts early by recording the latest data, filtering out noise, and tracking key patterns. Finally, great companies align the interests of the partners in their supply chains with their own. That's important because every firm is concerned solely with its own interests. If its goals are out of alignment with those of other partners in the supply chain, performance will suffer. When companies hear about the triple-A supply chain, they assume that building one will require increased technology and investment. But most firms already have the infrastructure in place to create one. A fresh attitude alone can go a long way toward making it happen.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 25 Indians 1 2011-04-01 2011-04-01 false Water supply. 137.1 Section 137.1 Indians BUREAU OF... CARLOS INDIAN IRRIGATION PROJECT, ARIZONA § 137.1 Water supply. The engineering report dealt with in... capacity of the San Carlos reservoir created by the Coolidge Dam and the water supply therefor over a...
Code of Federal Regulations, 2010 CFR
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Water supply. 137.1 Section 137.1 Indians BUREAU OF... CARLOS INDIAN IRRIGATION PROJECT, ARIZONA § 137.1 Water supply. The engineering report dealt with in... capacity of the San Carlos reservoir created by the Coolidge Dam and the water supply therefor over a...
Code of Federal Regulations, 2013 CFR
2013-04-01
... 25 Indians 1 2013-04-01 2013-04-01 false Water supply. 137.1 Section 137.1 Indians BUREAU OF... CARLOS INDIAN IRRIGATION PROJECT, ARIZONA § 137.1 Water supply. The engineering report dealt with in... capacity of the San Carlos reservoir created by the Coolidge Dam and the water supply therefor over a...
Code of Federal Regulations, 2014 CFR
2014-04-01
... 25 Indians 1 2014-04-01 2014-04-01 false Water supply. 137.1 Section 137.1 Indians BUREAU OF... CARLOS INDIAN IRRIGATION PROJECT, ARIZONA § 137.1 Water supply. The engineering report dealt with in... capacity of the San Carlos reservoir created by the Coolidge Dam and the water supply therefor over a...
Code of Federal Regulations, 2012 CFR
2012-04-01
... 25 Indians 1 2012-04-01 2011-04-01 true Water supply. 137.1 Section 137.1 Indians BUREAU OF INDIAN... INDIAN IRRIGATION PROJECT, ARIZONA § 137.1 Water supply. The engineering report dealt with in section 1... of the San Carlos reservoir created by the Coolidge Dam and the water supply therefor over a period...
Extending the "Knowledge Advantage": Creating Learning Chains
ERIC Educational Resources Information Center
Maqsood, Tayyab; Walker, Derek; Finegan, Andrew
2007-01-01
Purpose: The purpose of this paper is to develop a synergy between the approaches of knowledge management in a learning organisation and supply chain management so that learning chains can be created in order to unleash innovation and creativity by managing knowledge in supply chains. Design/methodology/approach: Through extensive literature…
NASA Astrophysics Data System (ADS)
Pawlak, Urszula; Pawlak, Marcin
2017-10-01
The article presents the material type from which the conductors of the overhead power lines are produced influences on the size of the overhang and the tension. The aim of the calculations was to present the benefits of the mechanics of the cable resulting from the type of cable used. The analysis was performed for two types of cables: aluminium with steel core and aluminium with composite core, twice span power line section. 10 different conductor-to-strand coil, wind, icing, and temperature variations were included in the calculations. The string description was made by means of a chain curve, while the horizontal component H of the tension force was determined using the bisection method. The loads were collected in accordance with applicable Eurocode.
Developing a model for agile supply: an empirical study from Iranian pharmaceutical supply chain.
Rajabzadeh Ghatari, Ali; Mehralian, Gholamhossein; Zarenezhad, Forouzandeh; Rasekh, Hamid Reza
2013-01-01
Agility is the fundamental characteristic of a supply chain needed for survival in turbulent markets, where environmental forces create additional uncertainty resulting in higher risk in the supply chain management. In addition, agility helps providing the right product, at the right time to the consumer. The main goal of this research is therefore to promote supplier selection in pharmaceutical industry according to the formative basic factors. Moreover, this paper can configure its supply network to achieve the agile supply chain. The present article analyzes the supply part of supply chain based on SCOR model, used to assess agile supply chains by highlighting their specific characteristics and applicability in providing the active pharmaceutical ingredient (API). This methodology provides an analytical modeling; the model enables potential suppliers to be assessed against the multiple criteria using both quantitative and qualitative measures. In addition, for making priority of critical factors, TOPSIS algorithm has been used as a common technique of MADM model. Finally, several factors such as delivery speed, planning and reorder segmentation, trust development and material quantity adjustment are identified and prioritized as critical factors for being agile in supply of API.
Developing a Model for Agile Supply: an Empirical Study from Iranian Pharmaceutical Supply Chain
Rajabzadeh Ghatari, Ali; Mehralian, Gholamhossein; Zarenezhad, Forouzandeh; Rasekh, Hamid Reza
2013-01-01
Agility is the fundamental characteristic of a supply chain needed for survival in turbulent markets, where environmental forces create additional uncertainty resulting in higher risk in the supply chain management. In addition, agility helps providing the right product, at the right time to the consumer. The main goal of this research is therefore to promote supplier selection in pharmaceutical industry according to the formative basic factors. Moreover, this paper can configure its supply network to achieve the agile supply chain. The present article analyzes the supply part of supply chain based on SCOR model, used to assess agile supply chains by highlighting their specific characteristics and applicability in providing the active pharmaceutical ingredient (API). This methodology provides an analytical modeling; the model enables potential suppliers to be assessed against the multiple criteria using both quantitative and qualitative measures. In addition, for making priority of critical factors, TOPSIS algorithm has been used as a common technique of MADM model. Finally, several factors such as delivery speed, planning and reorder segmentation, trust development and material quantity adjustment are identified and prioritized as critical factors for being agile in supply of API. PMID:24250689
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Yeo, Hyun Koo; Lee, Jae Young
2010-05-01
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
E-commerce for healthcare supply procurement.
Arbietman, D; Lirov, E; Lirov, R; Lirov, Y
2001-01-01
The total investment of the more than fifty e-commerce startups that entered healthcare supply chain management in the past three years has surpassed $500 million. However, none of these early entrants has delivered on the initial promise of restructuring the entire supply chain, replacing the traditional intermediaries, or at least achieving substantial revenue. This article offers a new business-to-business (B2B) e-commerce solution classification paradigm and uses it to analyze the functional requirements for an effective and, efficient healthcare supply chain marketplace. The analysis exposes several fundamental B2B market complexities that prevent the early entrants from creating a solid customer base and reaching desired liquidity goals. It also identifies several technological solutions to the problems mentioned. These new technologies create a comprehensive and symmetric order-matching engine that is capable of aggregating buy orders, requesting quotes from multiple vendors simultaneously, and negotiating along multiple criteria.
Hart, Edward J.; Leeman, James E.; MacDougall, Hugh R.; Marron, John J.; Smith, Calvin C.
1976-01-01
An electric power supply employs a striking means to initiate ferroelectric elements which provide electrical energy output which subsequently initiates an explosive charge which initiates a second ferroelectric current generator to deliver current to the coil of a magnetic field current generator, creating a magnetic field around the coil. Continued detonation effects compression of the magnetic field and subsequent generation and delivery of a large output current to appropriate output loads.
Matasci, Battista; Stock, Greg M.; Jaboyedoff, Michael; Carrea, Dario; Collins, Brian D.; Guérin, Antoine; Matasci, G.; Ravanel, L.
2018-01-01
Rockfalls strongly influence the evolution of steep rocky landscapes and represent a significant hazard in mountainous areas. Defining the most probable future rockfall source areas is of primary importance for both geomorphological investigations and hazard assessment. Thus, a need exists to understand which areas of a steep cliff are more likely to be affected by a rockfall. An important analytical gap exists between regional rockfall susceptibility studies and block-specific geomechanical calculations. Here we present methods for quantifying rockfall susceptibility at the cliff scale, which is suitable for sub-regional hazard assessment (hundreds to thousands of square meters). Our methods use three-dimensional point clouds acquired by terrestrial laser scanning to quantify the fracture patterns and compute failure mechanisms for planar, wedge, and toppling failures on vertical and overhanging rock walls. As a part of this work, we developed a rockfall susceptibility index for each type of failure mechanism according to the interaction between the discontinuities and the local cliff orientation. The susceptibility for slope parallel exfoliation-type failures, which are generally hard to identify, is partly captured by planar and toppling susceptibility indexes. We tested the methods for detecting the most susceptible rockfall source areas on two famously steep landscapes, Yosemite Valley (California, USA) and the Drus in the Mont-Blanc massif (France). Our rockfall susceptibility models show good correspondence with active rockfall sources. The methods offer new tools for investigating rockfall hazard and improving our understanding of rockfall processes.
Information flow in the pharmaceutical supply chain.
Yousefi, Nazila; Alibabaei, Ahmad
2015-01-01
Managing the supply chain plays an important role in creating competitive advantages for companies. Adequate information flow in supply chain is one of the most important issues in SCM. Therefore, using certain Information Systems can have a significant role in managing and integrating data and information within the supply chain. Pharmaceutical supply chain is more complex than many other supply chains, in the sense that it can affect social and political perspectives. On the other hand, managing the pharmaceutical supply chain is difficult because of its complexity and also government regulations in this field. Although, Iran has progressed a lot in pharmaceutical manufacturing, still there are many unsolved issues in managing the information flow in the pharmaceutical supply chain. In this study, we reviewed the benefits of using different levels of an integrated information system in the supply chain and the possible challenges ahead.
Information flow in the pharmaceutical supply chain
Yousefi, Nazila; Alibabaei, Ahmad
2015-01-01
Managing the supply chain plays an important role in creating competitive advantages for companies. Adequate information flow in supply chain is one of the most important issues in SCM. Therefore, using certain Information Systems can have a significant role in managing and integrating data and information within the supply chain. Pharmaceutical supply chain is more complex than many other supply chains, in the sense that it can affect social and political perspectives. On the other hand, managing the pharmaceutical supply chain is difficult because of its complexity and also government regulations in this field. Although, Iran has progressed a lot in pharmaceutical manufacturing, still there are many unsolved issues in managing the information flow in the pharmaceutical supply chain. In this study, we reviewed the benefits of using different levels of an integrated information system in the supply chain and the possible challenges ahead. PMID:26664401
Supply chain optimization for pediatric perioperative departments.
Davis, Janice L; Doyle, Robert
2011-09-01
Economic challenges compel pediatric perioperative departments to reduce nonlabor supply costs while maintaining the quality of patient care. Optimization of the supply chain introduces a framework for decision making that drives fiscally responsible decisions. The cost-effective supply chain is driven by implementing a value analysis process for product selection, being mindful of product sourcing decisions to reduce supply expense, creating logistical efficiency that will eliminate redundant processes, and managing inventory to ensure product availability. The value analysis approach is an analytical methodology for product selection that involves product evaluation and recommendation based on consideration of clinical benefit, overall financial impact, and revenue implications. Copyright © 2011 AORN, Inc. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Buffington, Jack; Peterson, Ray
2013-08-01
The purpose of this study is to conduct a supply chain material flow analysis (MFA) for the U.S. aluminum can market, consistent with studies conducted for the overall worldwide aluminum industry. A technical definition of the use of alloys 5182 and 3104 is conducted by metallurgists for use in the "aluminum can" MFA. Four propositions are created: technical, economic, and supply chain factors are as important to secondary aluminum recycling in an aluminum can as higher recycling rates (P1); the development of a unialloy aluminum can will increase reuse rates, but recycling rates must increase for this to happen (P2); a closed-loop aluminum can supply chain is not able to be fully realized in today's environment but is very useful for understanding improvement through both supply and demand (P3); and UBC supply can improve through a "voluntary deposit-refund system" approach (P4).
Reinforcement learning in supply chains.
Valluri, Annapurna; North, Michael J; Macal, Charles M
2009-10-01
Effective management of supply chains creates value and can strategically position companies. In practice, human beings have been found to be both surprisingly successful and disappointingly inept at managing supply chains. The related fields of cognitive psychology and artificial intelligence have postulated a variety of potential mechanisms to explain this behavior. One of the leading candidates is reinforcement learning. This paper applies agent-based modeling to investigate the comparative behavioral consequences of three simple reinforcement learning algorithms in a multi-stage supply chain. For the first time, our findings show that the specific algorithm that is employed can have dramatic effects on the results obtained. Reinforcement learning is found to be valuable in multi-stage supply chains with several learning agents, as independent agents can learn to coordinate their behavior. However, learning in multi-stage supply chains using these postulated approaches from cognitive psychology and artificial intelligence take extremely long time periods to achieve stability which raises questions about their ability to explain behavior in real supply chains. The fact that it takes thousands of periods for agents to learn in this simple multi-agent setting provides new evidence that real world decision makers are unlikely to be using strict reinforcement learning in practice.
Creating a National Skills Corporation. Policy Report.
ERIC Educational Resources Information Center
Atkinson, Rob
To address the skills shortages stemming from the transition to a more technological and skills-intensive economy, Congress established a program whereby funds from H-1B visa fees would provide seed funds for private companies, labor, and government to join together in creating training alliances focused on skills in short supply. Unfortunately,…
Applied magnetism: A supply-driven materials challenge
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rios, Orlando; McCall, Scott K.
Permanent magnets are important in many green energy technologies including wind turbine generators and hybrid-electric vehicle motors. For these applications, volume and weight are important factors driving the overall design, and therefore a high energy density, or energy product, is an important figure of merit. This quantity defines the magnetic energy contained in a given volume of material, and so higher energy density magnets enable smaller, lighter applications. Currently, the most powerful magnets suitable for commercial purposes contain rare earth elements (REE), usually neodymium and dysprosium in the neodymium-iron-boride class of magnets. However, for select applications, often requiring high temperatures,more » samarium cobalt is the alloy of choice. These magnets have energy densities several times greater than their nearest non-REE-based competitor, which for some applications is the defining factor in creating a viable device. The global supply of these REE is overwhelmingly produced in China, which in 2015 mined more than ten times as much as the next largest producer (Australia). Such market domination effectively creates a single source of supply, leaving industries which rely on REE consumption susceptible to price shocks and supply disruptions of these critical materials. Furthermore, this supply sensitivity may act as a drag on the adaptation rate of green energy technologies, particularly for large-scale users.« less
Applied magnetism: A supply-driven materials challenge
Rios, Orlando; McCall, Scott K.
2016-05-27
Permanent magnets are important in many green energy technologies including wind turbine generators and hybrid-electric vehicle motors. For these applications, volume and weight are important factors driving the overall design, and therefore a high energy density, or energy product, is an important figure of merit. This quantity defines the magnetic energy contained in a given volume of material, and so higher energy density magnets enable smaller, lighter applications. Currently, the most powerful magnets suitable for commercial purposes contain rare earth elements (REE), usually neodymium and dysprosium in the neodymium-iron-boride class of magnets. However, for select applications, often requiring high temperatures,more » samarium cobalt is the alloy of choice. These magnets have energy densities several times greater than their nearest non-REE-based competitor, which for some applications is the defining factor in creating a viable device. The global supply of these REE is overwhelmingly produced in China, which in 2015 mined more than ten times as much as the next largest producer (Australia). Such market domination effectively creates a single source of supply, leaving industries which rely on REE consumption susceptible to price shocks and supply disruptions of these critical materials. Furthermore, this supply sensitivity may act as a drag on the adaptation rate of green energy technologies, particularly for large-scale users.« less
Sustainable Supply Chain Management Programs in the 21st Century
ERIC Educational Resources Information Center
Neureuther, Brian D.; O'Neill, Kevin
2011-01-01
One of the most difficult challenges for an undergraduate supply chain management program at smaller universities is to create an environment of sustainability. Supply chain management is not at the tip of tongue for many graduating high school students and few undergraduate curriculums require a course in the content area. This research addresses…
Larkin, Howard
2006-03-01
Hurricane Katrina was expected to provoke major hikes in the prices that hospitals pay for supplies and commodities. But other forces--global demand for raw materials and for access to shipping, in particular--are having an even bigger impact on everything from heating oil to synthetic gloves. Hospitals are using old strategies and creating new ones to try to manage risk and blunt the effect of this inflationary spiral.
Ergonomics and sustainability--challenges from global supply chains.
Hasle, Peter; Jensen, Per Langaa
2012-01-01
The development of globalised supply chains is a major challenge for sustainability. For several years, there has been discussion within the profession whether and how ergonomics and human factors can play a role. Based on our research, we have identified five major challenges from global supply chains especially related to the social aspects of sustainability: (1) criteria for social sustainability, (2) the role of key performance indicators in the management of supply chains, (3) the constant changes in supply chains, (4) the challenge in establishing participation, and (5) the development of agency and regulatory mechanisms. There are obviously no clear and simple solutions to these challenges. One possible avenue for progress might lie in acquiring a greater understanding of the challenges from global supply chains and developing a strategy which combines social and long-term business sustainability. Starting from such a basis, the next step would be to find ways for the ergonomics and human factors community to create international collaboration which can impact specific global supply chains.
2011-12-01
supplies are checked for expiration dates and inspected to ensure the packaging is not damaged, wet, or soiled . The type and quantity of items is...creating value in a global business enviroment . (9th ed.). New York, NY: McGraw-Hill/Irwin. Nathan, J., & Trinkaus, J. (1996). Improving health care
ERIC Educational Resources Information Center
Cargille, Brian; Branvold, Dwight
2000-01-01
Explains how Hewlett-Packard creates supply chain management innovations and effectively diffuses new technologies. Outlines how performance technologists help accelerate the diffusion and adoption of innovations by modifying innovations, define the client adoption path, create resources to lead clients through adoption, and improve the diffusion…
Making Supply Chains Resilient to Floods Using a Bayesian Network
NASA Astrophysics Data System (ADS)
Haraguchi, M.
2015-12-01
Natural hazards distress the global economy by disrupting the interconnected supply chain networks. Manufacturing companies have created cost-efficient supply chains by reducing inventories, streamlining logistics and limiting the number of suppliers. As a result, today's supply chains are profoundly susceptible to systemic risks. In Thailand, for example, the GDP growth rate declined by 76 % in 2011 due to prolonged flooding. Thailand incurred economic damage including the loss of USD 46.5 billion, approximately 70% of which was caused by major supply chain disruptions in the manufacturing sector. Similar problems occurred after the Great East Japan Earthquake and Tsunami in 2011, the Mississippi River floods and droughts during 2011 - 2013, and Hurricane Sandy in 2012. This study proposes a methodology for modeling supply chain disruptions using a Bayesian network analysis (BNA) to estimate expected values of countermeasures of floods, such as inventory management, supplier management and hard infrastructure management. We first performed a spatio-temporal correlation analysis between floods and extreme precipitation data for the last 100 years at a global scale. Then we used a BNA to create synthetic networks that include variables associated with the magnitude and duration of floods, major components of supply chains and market demands. We also included decision variables of countermeasures that would mitigate potential losses caused by supply chain disruptions. Finally, we conducted a cost-benefit analysis by estimating the expected values of these potential countermeasures while conducting a sensitivity analysis. The methodology was applied to supply chain disruptions caused by the 2011 Thailand floods. Our study demonstrates desirable typical data requirements for the analysis, such as anonymized supplier network data (i.e. critical dependencies, vulnerability information of suppliers) and sourcing data(i.e. locations of suppliers, and production rates and
Marq, Jean-Baptiste; Hausmann, Stéphane; Veillard, Nicolas; Kolakofsky, Daniel; Garcin, Dominique
2011-02-25
Arenavirus RNA genomes are initiated by a "prime and realign" mechanism, such that the initiating GTP is found as a single unpaired (overhanging) nucleotide when the complementary genome ends anneal to form double-stranded (ds) RNA panhandle structures. dsRNAs modeled on these structures do not induce interferon (IFN), as opposed to blunt-ended (5' ppp)dsRNA. This study examines whether these viral structures can also act as decoys, by trapping RIG-I in inactive dsRNA complexes. We examined the ability of various dsRNAs to activate the RIG-I ATPase (presumably a measure of helicase translocation on dsRNA) relative to their ability to induce IFN. We found that there is no simple relationship between these two properties, as if RIG-I can translocate on short dsRNAs without inducing IFN. Moreover, we found that (5' ppp)dsRNAs with a single unpaired 5' ppp-nucleotide can in fact competitively inhibit the ability of blunt-ended (5' ppp)dsRNAs to induce IFN when co-transfected into cells and that this inhibition is strongly dependent on the presence of the 5' ppp. In contrast, (5' ppp)dsRNAs with a single unpaired 5' ppp-nucleotide does not inhibit poly(I-C)-induced IFN activation, which is independent of the presence of a 5' ppp group.
Endlein, Thomas; Ji, Aihong; Samuel, Diana; Yao, Ning; Wang, Zhongyuan; Barnes, W. Jon P.; Federle, Walter; Kappl, Michael; Dai, Zhendong
2013-01-01
To live and clamber about in an arboreal habitat, tree frogs have evolved adhesive pads on their toes. In addition, they often have long and slender legs to facilitate not only long jumps, but also to bridge gaps between leaves when climbing. Both adhesive pads and long limbs are used in conjunction, as we will show in this study. Previous research has shown that tree frogs change from a crouched posture (where the limbs are close to the body) to a sprawled posture with extended limbs when clinging on to steeper inclines such as vertical or overhanging slopes. We investigated this change in posture in White's tree frogs (Litoria caerulea) by challenging the frogs to cling onto a tiltable platform. The platform consisted of an array of 24 three-dimensional force transducers, which allowed us to measure the ground reaction forces of the frogs during a tilt. Starting from a crouched resting position, the normal forces on the forelimbs changed sign and became increasingly negative with increasing slope angle of the platform. At about 106°±12°, tilt of the platform the frogs reacted by extending one or two of their limbs outwards. At a steeper angle (131°±11°), the frogs spread out all their limbs sideways, with the hindlimbs stretched out to their maximum reach. Although the extension was strongest in the lateral direction, limbs were significantly extended in the fore–aft direction as well. With the extension of the limbs, the lateral forces increased relative to the normal forces. The large contribution of the in-plane forces helped to keep the angle between the force vector and the platform small. The Kendall theory for the peeling of adhesive tape predicts that smaller peel angles lead to higher attachment forces. We compare our data with the predictions of the Kendall model and discuss possible implications of the sliding of the pads on the surface. The forces were indeed much larger for smaller angles and thus can be explained by peeling theory. PMID
ERIC Educational Resources Information Center
Ellinger, Alexander E.; Ellinger, Andrea D.
2014-01-01
Purpose: There is an ongoing shortage of talented supply chain managers with the necessary skills and business-related competencies to manage increasingly complex and strategically important supply chain processes. The purpose of this paper is to propose that organizations can create and maintain competitive advantage by leveraging the expertise…
Operating room waste: disposable supply utilization in neurointerventional procedures.
Rigante, Luigi; Moudrous, Walid; de Vries, Joost; Grotenhuis, André J; Boogaarts, Hieronymus D
2017-12-01
Operating rooms account for 70% of hospital waste, increasing healthcare costs and creating environmental hazards. Endovascular treatment of cerebrovascular pathologies has become prominent, and associated products highly impact the total cost of care. We investigated the costs of endovascular surgical waste at our institution. Data from 53 consecutive endovascular procedures at the Radboud UMC Nijmegen from May to December 2016 were collected. "Unused disposable supply" was defined as one-time use items opened but not used during the procedure. Two observers cataloged the unused disposable supply for each case. The cost of each item was determined from the center supply catalog, and these costs were summed to determine the total cost of unused supply per case. Thirteen diagnostic cerebral digital subtraction angiographies (DSA) (24.5%) and 40 endovascular procedures (75.5%) were analyzed. Total interventional waste was 27,299.53 € (mean 515.09 € per procedure). While total costs of unused disposable supply were almost irrelevant for DSAs, they were consistent for interventional procedures (mean 676.49 € per case). Aneurysm standard coiling had the highest impact on total interventional waste (mean 1061.55 €). Disposable interventional products had a very high impact on the surgical waste costs in the series of the neurointerventional procedures (95% of total waste). This study shows the impact of neurointerventional waste on the total care costs for cerebrovascular patients. This might reflect the tendency to anticipate needs and emergencies in neurointervention. Responsible use of disposable material can be achieved by educating operators and nurses and creating operator preference cards.
The NASA Human Space Flight Supply Chain, Current and Future
NASA Technical Reports Server (NTRS)
Zapata, Edgar
2007-01-01
The current NASA Human Space Flight transportation system, the Space Shuttle, is scheduled for final flight in 2010. The Exploration initiative will create a new capability with a combination of existing systems and new flight and ground elements. To fully understand and act on the implications of such change it is necessary to understand what, how, when and where such changes occur and more importantly, how all these interact. This paper presents Human Space Flight, with an emphasis on KSC Launch and Landing, as a Supply Chain of both information and materials. A supply chain methodology for understanding the flow of information and materials is presented. Further, modeling and simulation projects funded by the Exploration initiative to understand the NASA Exploration Supply Chain are explained. Key concepts and their purpose, including the Enterprise, Locations, Physical and Organizational Functional Units, Products, and Resources, are explained. It is shown that the art, science and perspective of Supply Chain Management is not only applicable to such a government & contractor operation, it is also an invaluable approach for understanding, focusing improvement and growth. It is shown that such commercial practice applies to Human Space Flight and is invaluable towards one day creating routine, affordable access to and from space.
Natural Hazards and Supply Chain Disruptions
NASA Astrophysics Data System (ADS)
Haraguchi, M.
2016-12-01
Natural hazards distress the global economy through disruptions in supply chain networks. Moreover, despite increasing investment to infrastructure for disaster risk management, economic damages and losses caused by natural hazards are increasing. Manufacturing companies today have reduced inventories and streamlined logistics in order to maximize economic competitiveness. As a result, today's supply chains are profoundly susceptible to systemic risks, which are the risk of collapse of an entire network caused by a few node of the network. For instance, the prolonged floods in Thailand in 2011 caused supply chain disruptions in their primary industries, i.e. electronic and automotive industries, harming not only the Thai economy but also the global economy. Similar problems occurred after the Great East Japan Earthquake and Tsunami in 2011, the Mississippi River floods and droughts during 2011 - 2013, and the Earthquake in Kumamoto Japan in 2016. This study attempts to discover what kind of effective measures are available for private companies to manage supply chain disruptions caused by floods. It also proposes a method to estimate potential risks using a Bayesian network. The study uses a Bayesian network to create synthetic networks that include variables associated with the magnitude and duration of floods, major components of supply chains such as logistics, multiple layers of suppliers, warehouses, and consumer markets. Considering situations across different times, our study shows desirable data requirements for the analysis and effective measures to improve Value at Risk (VaR) for private enterprises and supply chains.
Metropolitan Washington Area Water Supply Study. Appendix G. Non-Structural Studies.
1983-09-01
should minimize any impacts to the surrounding areas. The effects of land application systems on the socio -economic aspects of a community include... conflict this outfall might create with respect to the Washington Aqueduct Emergency Estuary Pumping Station. The operation of this intake, designed for...PB 214 970). " Socio -Economic Impact Study of Alternative Water Supply Systems," Annex D, Volume II, Washington Metropolitan Area Water Supply Study
ERIC Educational Resources Information Center
Jeong, Bong-Keun
2010-01-01
Digital piracy and the emergence of new distribution channels have changed the dynamics of supply chain coordination and created many interesting problems. There has been increased attention to understanding the phenomenon of consumer piracy behavior and its impact on supply chain profitability. The purpose of this dissertation is to better…
Kumar, Sameer; Honkanen, Erik J; Karl, Chad C
2009-01-01
This study examines the idea of developing a global health diplomacy supply chain as an important foreign policy approach with the aim of improving the lives of vulnerable populations and serving the best interests of the United States. The study was based on the review of academic literature, news events, and military communiques, and historical writings were studied to determine the feasibility of the idea and the extent of costs and benefits of such an endeavor. An integrated strategic business model, supported by a medical care delivery process, was developed to create a framework for a feasible global health diplomacy supply chain. The findings indicate that extremism can be contained by creating and efficiently executing an effective supply chain to get medical care units to those that need them. The limitations are the potential exit strategies required, the tactical abilities, and diplomatic techniques needed in order to create positive diplomatic change in aid distribution. Managers must consider how supply chains will affect other organizations giving aid and the potential public response. Moreover, determining the level of care necessary to achieve the greatest positive health diplomacy continues to require vigilant scrutiny over the potential cost/benefit analysis. The analysis is valuable to policymakers considering the impacts of health diplomacy by utilizing supply chain management.
Vulnerability of supply basins to demand from multiple cities
NASA Astrophysics Data System (ADS)
Padowski, J. C.; Gorelick, S.
2013-12-01
Humans have appropriated more than half of the world's available water resources, and continued population growth and climate change threaten to put increasing pressure on remaining supplies. Many cities have constructed infrastructure to collect, transport from and store water at distant locations. Supply basins can become vulnerable if there are multiple users depending on the same supply system or network. Basin vulnerability assessments often only report the impacts of local demands on system health, but rarely account future stress from multi-urban demands. This study presents a global assessment of urban impacts on supply basins. Specifically, hydrologic and regulatory information are used to quantify the level of supply basin stress created by demand from multiple cities. The aim is to identify at-risk basins. This study focuses on large urban areas (generally over 1 million people) that use surface water (n=412). The stress on supply water basins by urban demand was based on three parameters: 1) the number of cities using a basin for water supply, 2) the number of alternative urban sources (e.g. lakes, reservoirs, rivers) within the supply basin, and 3) the percent of available surface water in each basin that is required to meet the total of urban and environmental demands. The degree of management within each basin is assessed using information on federal water policies and local basin management plans.
Supply chain challenges. building relationships.
Beth, Scott; Burt, David N; Copacino, William; Gopal, Chris; Lee, Hau L; Lynch, Robert Porter; Morris, Sandra
2003-07-01
Supply chain management is all about software and systems, right? Put in the best technology, sit back, and watch as your processes run smoothly and the savings roll in? Apparently not. When HBR convened a panel of leading thinkers in the field of supply chain management, technology was not top of mind. People and relationships were the dominant issues of the day. The opportunities and problems created by globalization, for example, are requiring companies to establish relationships with new types of suppliers. The ever-present pressure for speed and cost containment is making it even more important to break down stubbornly high internal barriers and establish more effective cross-functional relationships. The costs of failure have never been higher. The leading supply chain performers are applying new technology, new innovations, and process thinking to far greater advantage than the laggards, reaping tremendous gains in all the variables that affect shareholder value: cost, customer service, asset productivity, and revenue generation. And the gap between the leaders and the losers is growing in almost every industry. This roundtable gathered many of the leading thinkers and doers in the field of supply chain management, including practitioners Scott Beth of Intuit, Sandra Morris of Intel, and Chris Gopal of Unisys. David Burt of the University of San Diego and Stanford's Hau Lee bring the latest research from academia. Accenture's William Copacino and the Warren Company's Robert Porter Lynch offer the consultant's perspectives. Together, they take a wide-ranging view of such topics as developing talent, the role of the chief executive, and the latest technologies, exploring both the tactical and the strategic in the current state of supply chain management.
Geolocation Support for Water Supply and Sewerage Projects in Azerbaijan
NASA Astrophysics Data System (ADS)
Qocamanov, M. H.; Gurbanov, Ch. Z.
2016-10-01
Drinking water supply and sewerage system designing and reconstruction projects are being extensively conducted in Azerbaijan Republic. During implementation of such projects, collecting large amount of information about the area and detailed investigations are crucial. Joint use of the aerospace monitoring and GIS play an essential role for the studies of the impact of environmental factors, development of the analytical information systems and others, while achieving the reliable performance of the existing and designed major water supply pipelines, as well as construction and exploitation of the technical installations. With our participation the GIS has been created in "Azersu" OJSC that includes systematic database of the drinking water supply and sewerage system, and rain water networks to carry out necessary geo information analysis. GIScreated based on "Microstation" platform and aerospace data. Should be mentioned that, in the country, specifically in large cities (i.e. Baku, Ganja, Sumqait, etc.,) drinking water supply pipelines cross regions with different physico-geographical conditions, geo-morphological compositions and seismotectonics.Mains water supply lines in many accidents occur during the operation, it also creates problems with drinking water consumers. In some cases the damage is caused by large-scale accidents. Long-term experience gives reason to say that the elimination of the consequences of accidents is a major cost. Therefore, to avoid such events and to prevent their exploitation and geodetic monitoring system to improve the rules on key issues. Therefore, constant control of the plan-height positioning, geodetic measurements for the detailed examination of the dynamics, repetition of the geodetic measurements for certain time intervals, or in other words regular monitoring is very important. During geodetic monitoring using the GIS has special significance. Given that, collecting geodetic monitoring measurements of the main pipelines
Economic drivers of mineral supply
Wagner, Lorie A.; Sullivan, Daniel E.; Sznopek, John L.
2003-01-01
The debate over the adequacy of future supplies of mineral resources continues in light of the growing use of mineral-based materials in the United States. According to the U.S. Geological Survey, the quantity of new materials utilized each year has dramatically increased from 161 million tons2 in 1900 to 3.2 billion tons in 2000. Of all the materials used during the 20th century in the United States, more than half were used in the last 25 years. With the Earth?s endowment of natural resources remaining constant, and increased demand for resources, economic theory states that as depletion approaches, prices rise. This study shows that many economic drivers (conditions that create an economic incentive for producers to act in a particular way) such as the impact of globalization, technological improvements, productivity increases, and efficient materials usage are at work simultaneously to impact minerals markets and supply. As a result of these economic drivers, the historical price trend of mineral prices3 in constant dollars has declined as demand has risen. When price is measured by the cost in human effort, the price trend also has been almost steadily downward. Although the United States economy continues its increasing mineral consumption trend, the supply of minerals has been able to keep pace. This study shows that in general supply has grown faster than demand, causing a declining trend in mineral prices.
Supply chain value creation methodology under BSC approach
NASA Astrophysics Data System (ADS)
Golrizgashti, Seyedehfatemeh
2014-06-01
The objective of this paper is proposing a developed balanced scorecard approach to measure supply chain performance with the aim of creating more value in manufacturing and business operations. The most important metrics have been selected based on experts' opinion acquired by in-depth interviews focused on creating more value for stakeholders. Using factor analysis method, a survey research has been used to categorize selected metrics into balanced scorecard perspectives. The result identifies the intensity of correlation between perspectives and cause-and-effect chains among them using statistical method based on a real case study in home appliance manufacturing industries.
A Framework of Multi Objectives Negotiation for Dynamic Supply Chain Model
NASA Astrophysics Data System (ADS)
Chai, Jia Yee; Sakaguchi, Tatsuhiko; Shirase, Keiichi
Trends of globalization and advances in Information Technology (IT) have created opportunity in collaborative manufacturing across national borders. A dynamic supply chain utilizes these advances to enable more flexibility in business cooperation. This research proposes a concurrent decision making framework for a three echelons dynamic supply chain model. The dynamic supply chain is formed by autonomous negotiation among agents based on multi agents approach. Instead of generating negotiation aspects (such as amount, price and due date) arbitrary, this framework proposes to utilize the information available at operational level of an organization in order to generate realistic negotiation aspect. The effectiveness of the proposed model is demonstrated by various case studies.
Method for replicating an array of nucleic acid probes
Cantor, Charles R.; Przetakiewicz, Marek; Smith, Cassandra L.; Sano, Takeshi
1998-01-01
The invention relates to the replication of probe arrays and methods for replicating arrays of probes which are useful for the large scale manufacture of diagnostic aids used to screen biological samples for specific target sequences. Arrays created using PCR technology may comprise probes with 5'- and/or 3'-overhangs.
Creating a High-Skills Society during Recession: Issues for Policy Makers
ERIC Educational Resources Information Center
Panagiotakopoulos, Antonios
2015-01-01
The present study looks at the skill formation policies adopted by policy makers in Greece in order to create a high-skills society. It examines empirically the demand side of the skill creation process within 300 small enterprises in order to understand how far supply-side measures have influenced the demand for well-trained staff within small…
Sheng, Xi
2012-07-01
The thesis aims to study the automation replenishment algorithm in hospital on medical supplies supplying chain. The mathematical model and algorithm of medical supplies automation replenishment are designed through referring to practical data form hospital on the basis of applying inventory theory, greedy algorithm and partition algorithm. The automation replenishment algorithm is proved to realize automatic calculation of the medical supplies distribution amount and optimize medical supplies distribution scheme. A conclusion could be arrived that the model and algorithm of inventory theory, if applied in medical supplies circulation field, could provide theoretical and technological support for realizing medical supplies automation replenishment of hospital on medical supplies supplying chain.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sokhansanj, Shahabaddine; Mani, Sudhagar; Togore, Sam
2010-01-01
Supply of corn stover to produce heat and power for a typical 170 dam3 dry mill ethanol plant is proposed. The corn ethanol plant requires 5.6 MW of electricity and 52.3 MW of process heat, which creates the annual stover demand of as much as 140 Gg. The corn stover supply system consists of collection, preprocessing, transportation and on-site fuel storage and preparation to produce heat and power for the ethanol plant. Economics of the entire supply system was conducted using the Integrated Biomass Supply Analysis and Logistics (IBSAL) simulation model. Corn stover was delivered in three formats (square bales,more » dry chops and pellets) to the combined heat and power plant. Delivered cost of biomass ready to be burned was calculated at 73 $ Mg-1 for bales, 86 $ Mg-1 for pellets and 84 $ Mg-1 for field chopped biomass. Among the three formats of stover supply systems, delivered cost of pelleted biomass was the highest due to high pelleting cost. Bulk transport of biomass in the form of chops and pellets can provide a promising future biomass supply logistic system in the US, if the costs of pelleting and transport are minimized.« less
Identifying and Managing Acquisition and Sustainment Supply Chain Risks
2015-01-01
production, cited by 40 percent • natural disasters, including earthquakes, floods, hurricanes, tornados, tsunamis, and volcanic eruptions , cited by... volcanic eruption in Iceland, which are peripherally connected to the global supply network, can also create disruptions that require management...reduced Volcanic eruptions Flight cancellations Floods Capacities of high-tech and automotive industries reduced Labor unrest Chinese factory riots
Method for replicating an array of nucleic acid probes
Cantor, C.R.; Przetakiewicz, M.; Smith, C.L.; Sano, T.
1998-08-18
The invention relates to the replication of probe arrays and methods for replicating arrays of probes which are useful for the large scale manufacture of diagnostic aids used to screen biological samples for specific target sequences. Arrays created using PCR technology may comprise probes with 5{prime}- and/or 3{prime}-overhangs. 16 figs.
Glucose supply and insulin demand dynamics of antidiabetic agents.
Monte, Scott V; Schentag, Jerome J; Adelman, Martin H; Paladino, Joseph A
2010-03-01
For microvascular outcomes, there is compelling historical and contemporary evidence for intensive blood glucose reduction in patients with either type 1 diabetes mellitus (T1DM) or type 2 diabetes mellitus (T2DM). There is also strong evidence to support macrovascular benefit with intensive blood glucose reduction in T1DM. Similar evidence remains elusive for T2DM. Because cardiovascular outcome trials utilizing conventional algorithms to attain intensive blood glucose reduction have not demonstrated superiority to less aggressive blood glucose reduction (Action to Control Cardiovascular Risk in Diabetes; Action in Diabetes and Vascular Disease: Preterax and Diamicron Modified Release Controlled Evaluation; and Veterans Affairs Diabetes Trial), it should be considered that the means by which the blood glucose is reduced may be as important as the actual blood glucose. By identifying quantitative differences between antidiabetic agents on carbohydrate exposure (CE), hepatic glucose uptake (HGU), hepatic gluconeogenesis (GNG), insulin resistance (IR), peripheral glucose uptake (PGU), and peripheral insulin exposure (PIE), we created a pharmacokinetic/pharmacodynamic model to characterize the effect of the agents on the glucose supply and insulin demand dynamic. Glucose supply was defined as the cumulative percentage decrease in CE, increase in HGU, decrease in GNG, and decrease in IR, while insulin demand was defined as the cumulative percentage increase in PIE and PGU. With the glucose supply and insulin demand effects of each antidiabetic agent summated, the glucose supply (numerator) was divided by the insulin demand (denominator) to create a value representative of the glucose supply and insulin demand dynamic (SD ratio). Alpha-glucosidase inhibitors (1.25), metformin (2.20), and thiazolidinediones (TZDs; 1.25-1.32) demonstrate a greater effect on glucose supply (SD ratio >1), while secretagogues (0.69-0.81), basal insulins (0.77-0.79), and bolus insulins (0
Yang, Ya-Ting; Iqbal, Usman; Chen, Ya-Mei; Su, Shyi; Chang, Yao-Mao; Handa, Yujiro; Lin, Neng-Pai; Hsu, Yi-Hsin Elsa
2016-09-01
With global population aging, great business opportunities are driven by the various needs that the elderly face in everyday living. Internet development makes information spread faster, also allows elderly and their caregivers to more easily access information and actively participate in value co-creation in the services. This study aims to investigate the designs of value co-creation by the supply and demand sides of the senior industry. This study investigated senior industry in Taiwan and analyzed bussiness models of 33 selected successful senior enterprises in 2013. We adopted series field observation, reviews of documentations, analysis of meeting records and in-depth interviews with 65 CEOs and managers. Thirty-three quality enterprises in senior industry. Sixty-five CEOs and managers in 33 senior enterprises. None. Value co-creation design, value co-creating process. We constructed a conceptual model that comprehensively describes essential aspects of value co-creation and categorized the value co-creation designs into four types applying for different business models: (i) interaction in experience spaces co-creation design, (ii) on-site interacting co-creation design, (iii) social networking platform co-creation design and (iv) empowering customers co-creation design. Through value co-creation platform design, the senior enterprises have converted the originally passive roles of the elderly and caregivers into active participants in the value co-creation process. The new paradigm of value co-creation designs not only promote innovative development during the interactive process, lead enterprises reveal and meet customers' needs but also increase markets and profits. © The Author 2016. Published by Oxford University Press in association with the International Society for Quality in Health Care. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Hawkes, Corinna
2009-07-01
The mapping and analysis of supply chains is a technique increasingly used to address problems in the food system. Yet such supply chain management has not yet been applied as a means of encouraging healthier diets. Moreover, most policies recommended to promote healthy eating focus on the consumer end of the chain. This article proposes a consumption-oriented food supply chain analysis to identify the changes needed in the food supply chain to create a healthier food environment, measured in terms of food availability, prices, and marketing. Along with established forms of supply chain analysis, the method is informed by a historical overview of how food supply chains have changed over time. The method posits that the actors and actions in the chain are affected by organizational, financial, technological, and policy incentives and disincentives, which can in turn be levered for change. It presents a preliminary example of the supply of Coca-Cola beverages into school vending machines and identifies further potential applications. These include fruit and vegetable supply chains, local food chains, supply chains for health-promoting versions of food products, and identifying financial incentives in supply chains for healthier eating.
Hawkes, Corinna
2009-01-01
The mapping and analysis of supply chains is a technique increasingly used to address problems in the food system. Yet such supply chain management has not yet been applied as a means of encouraging healthier diets. Moreover, most policies recommended to promote healthy eating focus on the consumer end of the chain. This article proposes a consumption-oriented food supply chain analysis to identify the changes needed in the food supply chain to create a healthier food environment, measured in terms of food availability, prices, and marketing. Along with established forms of supply chain analysis, the method is informed by a historical overview of how food supply chains have changed over time. The method posits that the actors and actions in the chain are affected by organizational, financial, technological, and policy incentives and disincentives, which can in turn be levered for change. It presents a preliminary example of the supply of Coca-Cola beverages into school vending machines and identifies further potential applications. These include fruit and vegetable supply chains, local food chains, supply chains for health-promoting versions of food products, and identifying financial incentives in supply chains for healthier eating. PMID:23144674
Expert systems for space power supply - Design, analysis, and evaluation
NASA Technical Reports Server (NTRS)
Cooper, Ralph S.; Thomson, M. Kemer; Hoshor, Alan
1987-01-01
The feasibility of applying expert systems to the conceptual design, analysis, and evaluation of space power supplies in particular, and complex systems in general is evaluated. To do this, the space power supply design process and its associated knowledge base were analyzed and characterized in a form suitable for computer emulation of a human expert. The existing expert system tools and the results achieved with them were evaluated to assess their applicability to power system design. Some new concepts for combining program architectures (modular expert systems and algorithms) with information about the domain were applied to create a 'deep' system for handling the complex design problem. NOVICE, a code to solve a simplified version of a scoping study of a wide variety of power supply types for a broad range of missions, has been developed, programmed, and tested as a concrete feasibility demonstration.
Governance on the Drug Supply Chain via Gcoin Blockchain.
Tseng, Jen-Hung; Liao, Yen-Chih; Chong, Bin; Liao, Shih-Wei
2018-05-23
As a trust machine, blockchain was recently introduced to the public to provide an immutable, consensus based and transparent system in the Fintech field. However, there are ongoing efforts to apply blockchain to other fields where trust and value are essential. In this paper, we suggest Gcoin blockchain as the base of the data flow of drugs to create transparent drug transaction data. Additionally, the regulation model of the drug supply chain could be altered from the inspection and examination only model to the surveillance net model, and every unit that is involved in the drug supply chain would be able to participate simultaneously to prevent counterfeit drugs and to protect public health, including patients.
Coronado Mondragon, Adrian E; Coronado Mondragon, Christian E; Coronado, Etienne S
2015-01-01
Flexibility and innovation at creating shapes, adapting processes, and modifying materials characterize composites materials, a "high-tech" industry. However, the absence of standard manufacturing processes and the selection of materials with defined properties hinder the configuration of the composites materials supply chain. An interesting alternative for a "high-tech" industry such as composite materials would be to review supply chain lessons and practices in "low-tech" industries such as food. The main motivation of this study is to identify lessons and practices that comprise innovations in the supply chain of a firm in a perceived "low-tech" industry that can be used to provide guidelines in the design of the supply chain of a "high-tech" industry, in this case composite materials. This work uses the case study/site visit with analogy methodology to collect data from a Spanish leading producer of fresh fruit juice which is sold in major European markets and makes use of a cold chain. The study highlights supply base management and visibility/traceability as two elements of the supply chain in a "low-tech" industry that can provide guidelines that can be used in the configuration of the supply chain of the composite materials industry.
Getting Help From Others: The Effects of Demand and Supply
2014-01-01
Objectives. This article investigates whether the help with care needs that is received from others depends on the potential supply of family helpers. Methods. Data from the first round of survey data collected in the National Health and Aging Trends Study are used to create measures of whether help is received, the number of helpers, and the hours of help received. Regression analysis is used to relate these outcomes to indicators of the demand for and supply of helpers. Results. Analyses suggest limited evidence that the receipt of help is a supply-driven phenomenon. Although the measures of child–caregiver supply are not associated with a binary indicator of help received, caregiver-supply factors are associated with the number of helpers and the total hours of help received. Discussion. Findings on the total number of helpers and total hours of care have implications for the division of care labor within families and between families and nonfamily members. Foreseeable trends in the demand for and the supply of help suggest further evolution in patterns of elders’ receipt of help with care needs. Even if those with needs for care continue to have their needs addressed by one or more helpers, the number of helpers, and the aggregate amount of help they provide, is likely to undergo adjustment in response to changing family patterns. PMID:25342824
Estimating the magma supply rate at Kilauea volcano, Hawaii
NASA Astrophysics Data System (ADS)
Wright, T. L.; Klein, F. W.
2006-12-01
A frequent question is whether the magma supply rate to Kilauea is constant. Before seaward spreading of the south flank of Kilauea was demonstrated by the slip on a basal decollement that accompanied the M7.2 1975 south flank earthquake, the magma supply rate was equated to the identical eruption rates for three long-lived eruptions (3). Later, a continuous tilt record at Kilauea's summit was used to derive the volume of magma transported during deflations associated with rift eruptions (2), concluding that over a 30-year period about 38% of Kilauea's magma supply was left underground, but agreeing with the equivalency of overall magma supply and sustained eruption rates. Recent modeling of geodetic data gathered during Kilauea's current eruption (1) estimated a supply rate to accommodate spreading at 1.5 times the eruption rate. We approach the problem of magma supply, making two assumptions: 1. Eruption rates are controlled by the capacity of the underground transport paths to deliver magma to the surface. 2. Spreading of Kilauea's south flank is magma-driven and all space created during spreading is filled with new magma. On these premises, and in consideration of the physical properties of magma, eruption rates would have to be less than the supply rate; equivalence would imply a rigid edifice in which an open channel could deliver magma as if it were water. We are working to establish a third indicator of magma supply, the occurrence of seismic swarms in the stressed south flank. Many such swarms have been previously identified in association with documented eruptions and intrusions, but other swarms occur independently and may be associated with passive intrusion filling the room created during spreading. We contrast the seismic and geodetic data gathered during Kilauea's two longest monitored eruptions, Mauna Ulu (1969-1974) and Pu'u `O'o-Kupaianaha (1983-ongoing). For episodic high-fountaining episodes we calculate eruption efficiency as the ratio of
Animal health and price transmission along livestock supply chains.
Aragrande, M; Canali, M
2017-04-01
Animal health diseases can severely affect the food supply chain by causing variations in prices and market demand. Price transmission analysis reveals in what ways price variations are transmitted along the supply chain, and how supply chains of substitute products and different regional markets are also affected. In perfect markets, a price variation would be completely and instantaneously transmitted across the different levels of the supply chain: producers, the processing industry, retailers and consumers. However, empirical studies show that food markets are often imperfect, with anomalies or asymmetries in price transmission and distortions in the distribution of market benefits. This means, for instance, that a price increase at the consumer level may not be transmitted from retailers to processors and producers; yet, on the other hand, price falls may rapidly affect the upstream supply chain. Market concentration and the consequent exertion of market power in key segments of the supply chain can explain price transmission asymmetries and their distributional effects, but other factors may also be involved, such as transaction costs, scale economies, and imperfect information. During the bovine spongiform encephalopathy (BSE) crisis, asymmetric price transmission in the beef supply chain and related meat markets determined distributional effects among sectors. After the spread of the BSE food scare, the fall in demand marginally affected the price paid to retailers, but producers and wholesalers suffered much more, in both price reductions and the time needed to recover to precrisis demand. Price transmission analysis investigates how animal health crises create different economic burdens for various types of stakeholder, and provides useful socioeconomic insights when used with other tools.
Coronado Mondragon, Adrian E.; Coronado, Etienne S.
2015-01-01
Flexibility and innovation at creating shapes, adapting processes, and modifying materials characterize composites materials, a “high-tech” industry. However, the absence of standard manufacturing processes and the selection of materials with defined properties hinder the configuration of the composites materials supply chain. An interesting alternative for a “high-tech” industry such as composite materials would be to review supply chain lessons and practices in “low-tech” industries such as food. The main motivation of this study is to identify lessons and practices that comprise innovations in the supply chain of a firm in a perceived “low-tech” industry that can be used to provide guidelines in the design of the supply chain of a “high-tech” industry, in this case composite materials. This work uses the case study/site visit with analogy methodology to collect data from a Spanish leading producer of fresh fruit juice which is sold in major European markets and makes use of a cold chain. The study highlights supply base management and visibility/traceability as two elements of the supply chain in a “low-tech” industry that can provide guidelines that can be used in the configuration of the supply chain of the composite materials industry. PMID:25821848
Medicines counterfeiting is a complex problem: a review of key challenges across the supply chain.
Tremblay, Michael
2013-02-01
The paper begins by asking why there is a market for counterfeit medicines, which in effect creates the problem of counterfeiting itself. Contributing factors include supply chain complexity and the lack of whole-systems thinking. These two underpin the author's view that counterfeiting is a complex (i.e. wicked) problem, and that corporate, public policy and regulatory actions need to be mindful of how their actions may be causal. The paper offers a problem-based review of key components of this complexity, viz., the knowledge end-users/consumers have of medicines; whether restrictive information policies may hamper information provision to patients; the internet's direct access to consumers; internet-enabled distribution of unsafe and counterfeit medicines; whether the internet is a parallel and competitive supply chain to legitimate routes; organised crime as an emerging medicines manufacturer and supplier and whether substandard medicines is really the bigger problem. Solutions respect the perceived complexity of the supply chain challenges. The paper identifies the need to avoid technologically-driven solutions, calling for 'technological agnosticism'. Both regulation and public policy need to reflect the dynamic nature of the problem and avoid creating perverse incentives; it may be, for instance, that medicines pricing and reimbursement policies, which affect consumer/patient access may act as market signals to counterfeiters, since this creates a cash market in cheaper drugs.
Not All Parts Are Created Equal: The Impact Of Counterfeit Parts In The Air Force Supply Chain
2017-04-06
Government implemented a whole of government approach to tackle this issue. This issue affects both DOD, defense contractors by increasing costs...and oversight to reduce Supply Chain Risk”.2 In other words, the issue has not been resolved. This issue affects both DOD, defense contractors by...U.S. parts distributors that sprang up virtually overnight after Congress did away with requiring primary government contractors to certify all
Architecture Study for a Fuel Depot Supplied from Lunar Resources
NASA Technical Reports Server (NTRS)
Perrin, Thomas M.
2016-01-01
Heretofore, discussions of space fuel depots assumed the depots would be supplied from Earth. However, the confirmation of deposits of water ice at the lunar poles in 2009 suggests the possibility of supplying a space depot with liquid hydrogen/liquid oxygen produced from lunar ice. This architecture study sought to determine the optimum architecture for a fuel depot supplied from lunar resources. Four factors - the location of propellant processing (on the Moon or on the depot), the location of the depot (on the Moon or in cislunar space), and if in cislunar space, where (LEO, GEO, or Earth-Moon L1), and the method of propellant transfer (bulk fuel or canister exchange) were combined to identify 18 potential architectures. Two design reference missions (DRMs) - a satellite servicing mission and a cargo mission to Mars - were used to create demand for propellants, while a third DRM - a propellant delivery mission - was used to examine supply issues. The architectures were depicted graphically in a network diagram with individual segments representing the movement of propellant from the Moon to the depot, and from the depot to the customer
Architecture Study for a Fuel Depot Supplied from Lunar Resources
NASA Technical Reports Server (NTRS)
Perrin, Thomas M.
2016-01-01
Heretofore, discussions of space fuel depots assumed the depots would be supplied from Earth. However, the confirmation of deposits of water ice at the lunar poles in 2009 suggests the possibility of supplying a space depot with liquid hydrogen/liquid oxygen produced from lunar ice. This architecture study sought to determine the optimum architecture for a fuel depot supplied from lunar resources. Four factors - the location of propellant processing (on the Moon or on the depot), the location of the depot (on the Moon, or at L1, GEO, or LEO), the location of propellant transfer (L1, GEO, or LEO), and the method of propellant transfer (bulk fuel or canister exchange) were combined to identify 18 potential architectures. Two design reference missions (DRMs) - a satellite servicing mission and a cargo mission to Mars - were used to create demand for propellants, while a third DRM - a propellant delivery mission - was used to examine supply issues. The architectures were depicted graphically in a network diagram with individual segments representing the movement of propellant from the Moon to the depot, and from the depot to the customer.
Agency and market area factors affecting home health agency supply changes.
Porell, Frank W; Liu, Korbin; Brungo, David P
2006-10-01
To use the natural experiment created by the Medicare interim payment system (IPS) to study supply change behavior of home health agencies (HHAs) in local market areas. One hundred percent Medicare home health claims for 1996 and 1999, linked with Medicare Provider of Service and Denominator files, and the Area Resource File. Medicare home health care (HHC) claims data were used to distinguish HHAs that changed the local market supply of Medicare HHC by their market exit or by significant expansion or contraction of their geographic service area between 1996 and 1999 from other HHAs. Multinomial logit models were estimated to analyze how characteristics of agencies and the market areas in which they served were associated with these different agency-level supply changes. Changes in local HHA supply stemming from geographic service area expansions and contractions rivaled those owing to agency closures and market entries. Agencies at greater risk of closure and service area contraction tended to be smaller, newer, freestanding agencies, operating with more visit-intensive practice styles in markets with more competitor agencies. Except for having much less visit-intensive practice styles, similar attributes characterized agencies that increased local supply through service area expansion. Supply changes by HHAs largely reflected rational market responses by agencies to significant changes in financial incentives associated with the Medicare IPS. Recently certified agencies were among the most dynamic providers. Supply changes were more likely among agencies operating in more competitive market environments.
A Multi-Objective, Hub-and-Spoke Supply Chain Design Model For Densified Biomass
DOE Office of Scientific and Technical Information (OSTI.GOV)
Md S. Roni; Sandra Eksioglu; Kara G. Cafferty
In this paper we propose a model to design the supply chain for densified biomass. Rail is typically used for long-haul, high-volume shipment of densified biomass. This is the reason why a hub-and-spoke network structure is used to model this supply chain. The model is formulated as a multi-objective, mixed-integer programing problem under economic, environmental, and social criteria. The goal is to identify the feasibility of meeting the Renewable Fuel Standard (RFS) by using biomass for production of cellulosic ethanol. The focus in not just on the costs associated with meeting these standards, but also exploring the social and environmentalmore » benefits that biomass production and processing offers by creating new jobs and reducing greenhouse gas (GHG) emissions. We develop an augmented ?-constraint method to find the exact Pareto solution to this optimization problem. We develop a case study using data from the Mid-West. The model identifies the number, capacity and location of biorefineries needed to make use of the biomass available in the region. The model estimates the delivery cost of cellulosic ethanol under different scenario, the number new jobs created and the GHG emission reductions in the supply chain.« less
A Multi-Objective, Hub-and-Spoke Supply Chain Design Model for Densified Biomass
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jacob J. Jacobson; Md. S. Roni; Kara G. Cafferty
In this paper we propose a model to design the supply chain for densified biomass. Rail is typically used for longhaul, high-volume shipment of densified biomass. This is the reason why a hub-and-spoke network structure is used to model this supply chain. The model is formulated as a multi-objective, mixed-integer programing problem under economic, environmental, and social criteria. The goal is to identify the feasibility of meeting the Renewable Fuel Standard (RFS) by using biomass for production of cellulosic ethanol. The focus is not just on the costs associated with meeting these standards, but also exploring the social and environmentalmore » benefits that biomass production and processing offers by creating new jobs and reducing greenhouse gas (GHG) emissions. We develop an augmented ?-constraint method to find the exact Pareto solution to this optimization problem. We develop a case study using data from the Mid-West. The model identifies the number, capacity and location of biorefineries needed to make use of the biomass available in the region. The model estimates the delivery cost of cellulosic ethanol under different scenario, the number new jobs created and the GHG emission reductions in the supply chain.« less
Bradley, Cathy J; Neumark, David; Luo, Zhehui; Bednarek, Heather L
2007-07-01
We examine the effects of employment-contingent health insurance (ECHI) on married women's labor supply following a health shock. First, we develop a theoretical framework that examines the effects of ECHI on the labor supply response to a health shock, which suggests that women with ECHI are less likely to reduce their labor supply in response to a health shock, relative to women with health insurance through their spouse's employer. Second, we empirically examine this relationship based on labor supply responses to breast cancer. We find that health shocks decrease labor supply to a greater extent among women insured by their spouse's policy than among women with health insurance through their own employer, suggesting that ECHI creates incentives to remain working when faced with a serious illness. Copyright (c) 2006 John Wiley & Sons, Ltd.
Potential effects of landscape change on water supplies in the presence of reservoir storage
NASA Astrophysics Data System (ADS)
Guswa, Andrew J.; Hamel, Perrine; Dennedy-Frank, P. James
2017-04-01
This work presents a set of methods to evaluate the potential effects of landscape changes on water supplies. Potential impacts are a function of the seasonality of precipitation, losses of water to evapotranspiration and deep recharge, the flow-regulating ability of watersheds, and the availability of reservoir storage. For a given reservoir capacity, simple reservoir simulations with daily precipitation and streamflow enable the determination of the maximum steady supply of water for both the existing watershed and a hypothetical counter-factual that has neither flow-regulating benefits nor any losses. These two supply values, representing land use end-members, create an envelope that defines the water-supply service and bounds the effect of landscape change on water supply. These bounds can be used to discriminate between water supplies that may be vulnerable to landscape change and those that are unlikely to be affected. Two indices of the water-supply service exhibit substantial variability across 593 watersheds in the continental United States. Rcross, the reservoir capacity at which landscape change is unlikely to have any detrimental effect on water supply has an interquartile range of 0.14-4% of mean-annual-streamflow. Steep, forested watersheds with seasonal climates tend to have greater service values, and the indices of water-supply service are positively correlated with runoff ratios during the months with lowest flows.
Super-resolution optical microscopy study of telomere structure.
Phipps, Mary Lisa; Goodwin, Peter M; Martinez, Jennifer S; Goodwin, Edwin H
2016-09-01
Chromosome ends are shielded from exonucleolytic attack and inappropriate end-joining by terminal structures called telomeres; these structures are potential targets for anticancer drugs. Telomeres are composed of a simple DNA sequence (5?-TTAGGG-3? in humans) repeated more than a thousand times, a short 3? single-stranded overhang, and numerous proteins. Electron microscopy has shown that the 3? overhang pairs with the complementary strand at an internal site creating a small displacement loop and a large double-stranded “t-loop.” Our goal is to determine whether all telomeres adopt the t-loop configuration, or whether there are two or more distinct configurations. Progress in optimizing super-resolution (SR) microscopy for this ongoing investigation is reported here. Results suggest that under certain conditions sample preparation procedures may disrupt chromatin by causing loss of nucleosomes. This finding may limit the use of SR microscopy in telomere studies.
Super-resolution optical microscopy study of telomere structure
NASA Astrophysics Data System (ADS)
Phipps, Mary Lisa; Goodwin, Peter M.; Martinez, Jennifer S.; Goodwin, Edwin H.
2016-09-01
Chromosome ends are shielded from exonucleolytic attack and inappropriate end-joining by terminal structures called telomeres; these structures are potential targets for anticancer drugs. Telomeres are composed of a simple DNA sequence (5‧-TTAGGG-3‧ in humans) repeated more than a thousand times, a short 3‧ single-stranded overhang, and numerous proteins. Electron microscopy has shown that the 3‧ overhang pairs with the complementary strand at an internal site creating a small displacement loop and a large double-stranded "t-loop." Our goal is to determine whether all telomeres adopt the t-loop configuration, or whether there are two or more distinct configurations. Progress in optimizing super-resolution (SR) microscopy for this ongoing investigation is reported here. Results suggest that under certain conditions sample preparation procedures may disrupt chromatin by causing loss of nucleosomes. This finding may limit the use of SR microscopy in telomere studies.
Agency and Market Area Factors Affecting Home Health Agency Supply Changes
Porell, Frank W; Liu, Korbin; Brungo, David P
2006-01-01
Objective To use the natural experiment created by the Medicare interim payment system (IPS) to study supply change behavior of home health agencies (HHAs) in local market areas. Data Sources One hundred percent Medicare home health claims for 1996 and 1999, linked with Medicare Provider of Service and Denominator files, and the Area Resource File. Study Design Medicare home health care (HHC) claims data were used to distinguish HHAs that changed the local market supply of Medicare HHC by their market exit or by significant expansion or contraction of their geographic service area between 1996 and 1999 from other HHAs. Multinomial logit models were estimated to analyze how characteristics of agencies and the market areas in which they served were associated with these different agency-level supply changes. Principal Findings Changes in local HHA supply stemming from geographic service area expansions and contractions rivaled those owing to agency closures and market entries. Agencies at greater risk of closure and service area contraction tended to be smaller, newer, freestanding agencies, operating with more visit-intensive practice styles in markets with more competitor agencies. Except for having much less visit-intensive practice styles, similar attributes characterized agencies that increased local supply through service area expansion. Conclusions Supply changes by HHAs largely reflected rational market responses by agencies to significant changes in financial incentives associated with the Medicare IPS. Recently certified agencies were among the most dynamic providers. Supply changes were more likely among agencies operating in more competitive market environments. PMID:16987305
Risk management abilities in multimodal maritime supply chains: Visibility and control perspectives.
Vilko, Jyri; Ritala, Paavo; Hallikas, Jukka
2016-11-29
Supply chain complexity and disintegration lead to increased uncertainty from a stakeholders' perspective, which is emerging as one of the major challenges of risk management. The ability to identify risks has weakened, as the responsibility of supply chain risk management is handed over to outside service providers. Regardless, the risks, their visibility and their impact depend on the position of the companies in the supply chain. The actors in the chain must therefore collaborate to create effective risk management conditions. This challenging situation is especially pronounced in multimodal maritime supply chains, where the risks and actor focality are high. This paper contributes to current risk management literature by providing a holistic and systemic view of risk visibility and control in maritime supply chains. The study employs broad-based, qualitative interview data collected from actors operating in southern Finland and the Gulf of Finland as well as an expert-panel assessment of the related risk management abilities. The results show a high level of variance in the level of risk identification and visibility between the actors in question. This further suggests that collaboration in supply chain risk management is essential, as an awareness of the risks and their control mechanisms do not necessarily reside in the same company. Copyright © 2016 Elsevier Ltd. All rights reserved.
Tracing global supply chains to air pollution hotspots
NASA Astrophysics Data System (ADS)
Moran, Daniel; Kanemoto, Keiichiro
2016-09-01
While high-income countries have made significant strides since the 1970s in improving air quality, air pollution continues to rise in many developing countries and the world as a whole. A significant share of the pollution burden in developing countries can be attributed to production for export to consumers in high-income nations. However, it remains a challenge to quantify individual actors’ share of responsibility for pollution, and to involve parties other than primary emitters in cleanup efforts. Here we present a new spatially explicit modeling approach to link SO2, NO x , and PM10 severe emissions hotspots to final consumers via global supply chains. These maps show developed countries reducing their emissions domestically but driving new pollution hotspots in developing countries. This is also the first time a spatially explicit footprint inventory has been established. Linking consumers and supply chains to emissions hotspots creates opportunities for other parties to participate alongside primary emitters and local regulators in pollution abatement efforts.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-10-01
... transportation of farm supplies from the local farm retailer to the ultimate consumer within a 100 air-mile... wholesalers located at port or terminal facilities to either local farm retailers or farms. (See Question 33...] commodities.'' The exemption created by the Act applies to two types of transportation. The first type is...
NASA Astrophysics Data System (ADS)
Fobair, Richard C., II
This research presents a model for forecasting the numbers of jobs created in the energy efficiency retrofit (EER) supply chain resulting from an investment in upgrading residential buildings in Florida. This investigation examined material supply chains stretching from mining to project installation for three product types: insulation, windows/doors, and heating, ventilating, and air conditioning (HVAC) systems. Outputs from the model are provided for the project, sales, manufacturing, and mining level. The model utilizes reverse-estimation to forecast the numbers of jobs that result from an investment. Reverse-estimation is a process that deconstructs a total investment into its constituent parts. In this research, an investment is deconstructed into profit, overhead, and hard costs for each level of the supply chain and over multiple iterations of inter-industry exchanges. The model processes an investment amount, the type of work and method of contracting into a prediction of the number of jobs created. The deconstruction process utilizes data from the U.S. Economic Census. At each supply chain level, the cost of labor is reconfigured into full-time equivalent (FTE) jobs (i.e. equivalent to 40 hours per week for 52 weeks) utilizing loaded labor rates and a typical employee mix. The model is sensitive to adjustable variables, such as percentage of work performed per type of product, allocation of worker time per skill level, annual hours for FTE calculations, wage rate, and benefits. This research provides several new insights into job creation. First, it provides definitions that can be used for future research on jobs in supply chains related to energy efficiency. Second, it provides a methodology for future investigators to calculate jobs in a supply chain resulting from an investment in energy efficiency upgrades to a building. The methodology used in this research is unique because it examines gross employment at the sub-industry level for specific
Shittu, Ekundayo; Harnly, Melissa; Whitaker, Shanta; Miller, Roger
2016-02-01
One of the major problems facing Nigeria's vaccine supply chain is the lack of adequate vaccine storage facilities. Despite the introduction of solar-powered refrigerators and the use of new tools to monitor supply levels, this problem persists. Using data on vaccine supply for 2011-14 from Nigeria's National Primary Health Care Development Agency, we created a simulation model to explore the effects of variance in supply and demand on storage capacity requirements. We focused on the segment of the supply chain that moves vaccines inside Nigeria. Our findings suggest that 55 percent more vaccine storage capacity is needed than is currently available. We found that reorganizing the supply chain as proposed by the National Primary Health Care Development Agency could reduce that need to 30 percent more storage. Storage requirements varied by region of the country and vaccine type. The Nigerian government may want to consider the differences in storage requirements by region and vaccine type in its proposed reorganization efforts. Project HOPE—The People-to-People Health Foundation, Inc.
Controlling supply expenses through capitated supply contracting.
Kowalski, J C
1997-07-01
Some providers dealing with the financial challenges of managed care are attempting to control supply expenses through capitated supply contracting and similar risk/reward sharing arrangements. Under such arrangements, a supplier sells products and services to a provider for a fixed, prospective price in exchange for the provider's exclusive business. If expenses exceed the prospectively established amount, the supplier and provider share the loss. Conversely, if expenses are less than the fixed amount, they share the savings. For a capitated supply arrangement to be successful, providers must be able to identify and track supply expense drivers, such as clinical pathways, technology utilization, and product selection and utilization. Sophisticated information systems are needed to capture data, such as total and per-transaction product usage/volume; unit price per item; average and cost per item; average and total cost per transaction; and total cost per outcome. Providers also will need to establish mutually cooperative relationships with the suppliers with whom they contract.
SCOR based key success factors in cooking oil supply chain buyers perspective in Padang City
NASA Astrophysics Data System (ADS)
Zahara, Fatimah; Hadiguna, Rika Ampuh
2017-11-01
Supply chain of cooking oil is a network of companies from palm oil as raw material to retailers which work to create the value and deliver products into the end consumers. This paper is aimed to study key success factors based on consumer's perspective as the last stage in the supply chain. Consumers who are examined in this study are restaurants management or owners. Restaurant is the biggest consumption of cooking oil. The factors is studied based on Supply Chain Operation Reference (SCOR) version 10.0. Factors used are formulated based on the third-level metrics of SCOR Model. Factors are analyzed using factors analysis. This study found factors which become key success factors in managing supply chain of cooking oil encompass reliability, responsiveness and agility. Key success factors can be applied by governments as policy making and cooking oil companies as formulation of the distribution strategies.
Water quality effects of intermittent water supply in Arraiján, Panama.
Erickson, John J; Smith, Charlotte D; Goodridge, Amador; Nelson, Kara L
2017-05-01
Intermittent drinking water supply is common in low- and middle-income countries throughout the world and can cause water quality to degrade in the distribution system. In this study, we characterized water quality in one study zone with continuous supply and three zones with intermittent supply in the drinking water distribution network in Arraiján, Panama. Low or zero pressures occurred in all zones, and negative pressures occurred in the continuous zone and two of the intermittent zones. Despite hydraulic conditions that created risks for backflow and contaminant intrusion, only four of 423 (0.9%) grab samples collected at random times were positive for total coliform bacteria and only one was positive for E. coli. Only nine of 496 (1.8%) samples had turbidity >1.0 NTU and all samples had ≥0.2 mg/L free chlorine residual. In contrast, water quality was often degraded during the first-flush period (when supply first returned after an outage). Still, routine and first-flush water quality under intermittent supply was much better in Arraiján than that reported in a previous study conducted in India. Better water quality in Arraiján could be due to better water quality leaving the treatment plant, shorter supply outages, higher supply pressures, a more consistent and higher chlorine residual, and fewer contaminant sources near pipes. The results illustrate that intermittent supply and its effects on water quality can vary greatly between and within distribution networks. The study also demonstrated that monitoring techniques designed specifically for intermittent supply, such as continuous pressure monitoring and sampling the first flush, can detect water quality threats and degradation that would not likely be detected with conventional monitoring. Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Laksono, Pringgo Widyo; Kusumawardani, Christina Ayu
2017-11-01
Continuous improvement is needed by every manufacturing company to optimize their production. One way to reach that goal is eliminating waste that occurs in company. In PT. Akebono Brake Astra Indonesia - Jakarta (AAIJ), there are seven "muda" (waste) that always strived to remove, such as muda transportation that occurs in the cardboard supply system made by the non-value movement of PIC in packing area to take cardboard from warehouse. This research use Kaizen theory to get rid of muda transportation by changing the cardboard supply system that were previously done manually by PIC of packing area become taken over by a towing operator and apply Kanban system to improving the cardboard supply system information by creating set up of Kanban system that produce Material and Information Chart (MIFC), Standardized Work Chart (SWC), calculation of Kanban population, and Work Instruction (WI). This research lead to improvement of cardboard supply process, clearer and more cyclic information flow in cardboard supply system, and reduction of cost due to saving of manpower.
Hmi1p from Saccharomyces cerevisiae mitochondria is a structure-specific DNA helicase.
Kuusk, Silja; Sedman, Tiina; Jõers, Priit; Sedman, Juhan
2005-07-01
Hmi1p is a Saccharomyces cerevisiae mitochondrial DNA helicase that is essential for the maintenance of functional mitochondrial DNA. Hmi1p belongs to the superfamily 1 of helicases and is a close homologue of bacterial PcrA and Rep helicases. We have overexpressed and purified recombinant Hmi1p from Escherichia coli and describe here the biochemical characteristics of its DNA helicase activities. Among nucleotide cofactors, the DNA unwinding by Hmi1p was found to occur efficiently only in the presence of ATP and dATP. Hmi1p could unwind only the DNA substrates with a 3'-single-stranded overhang. The length of the 3'-overhang needed for efficient targeting of the helicase to the substrate depended on the substrate structure. For substrates consisting of duplex DNA with a 3'-single-stranded DNA overhang, at least a 19-nt 3'-overhang was needed. In the case of forked substrates with both 3'- and 5'-overhangs, a 9-nt 3'-overhang was sufficient provided that the 5'-overhang was also 9 nt in length. In flap-structured substrates mimicking the chain displacement structures in DNA recombination process, only a 5-nt 3'-single-stranded DNA tail was required for efficient unwinding by Hmi1p. These data indicate that Hmi1p may be targeted to a specific 3'-flap structure, suggesting its possible role in DNA recombination.
ERIC Educational Resources Information Center
Long, Suzanna; Moos, J. Chris; Radic, Anne Bartel
2012-01-01
The authors examined the skills achieved through a multicultural, virtual student project environment among 3 supply chain management courses. The partnership included 2 universities in the United States and 1 in France and created virtual teams of students across university lines and is presented as a case study. The case includes detailed…
High Precision Metal Thin Film Liftoff Technique
NASA Technical Reports Server (NTRS)
Brown, Ari D. (Inventor); Patel, Amil A. (Inventor)
2015-01-01
A metal film liftoff process includes applying a polymer layer onto a silicon substrate, applying a germanium layer over the polymer layer to create a bilayer lift off mask, applying a patterned photoresist layer over the germanium layer, removing an exposed portion of the germanium layer, removing the photoresist layer and a portion of the polymer layer to expose a portion of the substrate and create an overhanging structure of the germanium layer, depositing a metal film over the exposed portion of the substrate and the germanium layer, and removing the polymer and germanium layers along with the overlaying metal film.
Analysis of trends in the development of cities' heat supply systems
NASA Astrophysics Data System (ADS)
Stennikov, V. A.; Mednikova, E. E.
2016-09-01
New challenges—including the modern urban development policy, formation of the market of energy efficient technologies and different types of equipment of a broad power capacity range, tightening requirements to reliability, quality, and economic accessibility of heat supply—enhance the competitiveness of decentralized heat supply. In addition, its spontaneous growth and not always reasonable implementation lead to unjustified expenses, low efficiency, and ecological inconsistency. This proves the relevance of solving the problems of dividing an urban territory into zones of centralized heating (CH) and decentralized heating (DCH) along with their planning and justification, as well as determining a reasonable level of heat supply centralization and concentration of heat sources' power capacity. Solving these problems using the suggested method will allow optimizing the application areas for various types of heat supply and heat sources, justifying the degree of heat power capacity concentration and the extent of the systems as early as at the phase of a detailed urban planning project and then refining them during the design of urban heat supply systems. This will dramatically improve the reasonability of the decisions made and will simplify the procedure of their implementation. For criteria of limiting the extent (radius) of heat supply systems and defining their type, we suggest using standard values—the density of heat load per unit length of the pipeline and per unit area of urban territory. Standard values must be differentiated across the territory of Russia taking into account regional climatic and economic conditions and unique characteristics of heat supply development in cities and towns. The present article continues and develops the statements made in the previous articles created within the framework of the Theory of Hydraulic Circuits and takes into account the current situation and emerging trends in heat supply.
Fuel supply device for supplying fuel to an engine combustor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lindsay, M.H.; Kerr, W.B.
1990-05-29
This patent describes a variable flow rate fuel supply device for supplying fuel to an engine combustor. It comprises: fuel metering means having a fuel valve means for controlling the flow rate of fuel to the combustor; piston means for dividing a first cooling fluid chamber from a second cooling fluid chamber; coupling means for coupling the piston means to the fuel valve means; and cooling fluid supply means in communication with the first and second cooling fluid chamber for producing a first pressure differential across the piston means for actuating the fuel valve means in a first direction, andmore » for producing a second pressure differential across the piston means for actuating the valve means in a second direction opposite the first direction, to control the flow rate of the fuel through the fuel metering means and into the engine combustor; and means for positioning the fuel metering means within the second cooling air chamber enabling the cooling air supply means to both cool the fuel metering means and control the fuel supply rate of fuel supplied by the fuel metering means to the combustor.« less
Xu, Zhitao; Elomri, Adel; Pokharel, Shaligram; Zhang, Qin; Ming, X G; Liu, Wenjie
2017-06-01
The emergence of concerns over environmental protection, resource conservation as well as the development of logistics operations and manufacturing technology has led several countries to implement formal collection and recycling systems of solid waste. Such recycling system has the benefits of reducing environmental pollution, boosting the economy by creating new jobs, and generating income from trading the recyclable materials. This leads to the formation of a global reverse supply chain (GRSC) of solid waste. In this paper, we investigate the design of such a GRSC with a special emphasis on three aspects; (1) uncertainty of waste collection levels, (2) associated carbon emissions, and (3) challenges posed by the supply chain's global aspect, particularly the maritime transportation costs and currency exchange rates. To the best of our knowledge, this paper is the first attempt to integrate the three above-mentioned important aspects in the design of a GRSC. We have used mixed integer-linear programming method along with robust optimization to develop the model which is validated using a sample case study of e-waste management. Our results show that using a robust model by taking the complex interactions characterizing global reverse supply chain networks into account, we can create a better GRSC. The effect of uncertainties and carbon constraints on decisions to reduce costs and emissions are also shown. Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Boron, Sergiusz
2017-06-01
Operational safety of electrical machines and equipment depends, inter alia, on the hazards resulting from their use and on the scope of applied protective measures. The use of insufficient protection against existing hazards leads to reduced operational safety, particularly under fault conditions. On the other hand, excessive (in relation to existing hazards) level of protection may compromise the reliability of power supply. This paper analyses the explosion hazard created by earth faults in longwall power supply systems and evaluates existing protection equipment from the viewpoint of its protective performance, particularly in the context of explosion hazards, and also assesses its effect on the reliability of power supply.
Creating the 2020 Tokyo Olympic Medals from Electronic Scrap: Sustainability Analysis
NASA Astrophysics Data System (ADS)
Leader, Alexandra M.; Wang, Xue; Gaustad, Gabrielle
2017-09-01
For the upcoming 2020 Olympic Games, which are to be held in Tokyo, Japan, it has been proposed that recycled metal from electronic waste should be used to create the gold, silver, and bronze medals that will be awarded to athletes from around the world. This work is aimed at exploring the feasibility of this goal, quantifying the required electronic waste, identifying the limiting material constraints, and addressing a selection of sustainability metrics. The results show that 2.5-13.8% of Japan's available electronic waste would be required to create the medals, depending on the composition of the collected electronics and the processing yields. The environmental benefits from this venture are identified as being a savings of approximately 4.5-5.1 TJ of energy, which is equivalent to CO2 emissions reductions of approximately 420 metric tons. Additionally, qualitative potential benefits to environment, human health, economic recovery of valuable materials, and supply stability are considered.
Supply-demand 3D dynamic model in water resources evaluation: taking Lebanon as an example
NASA Astrophysics Data System (ADS)
Fang, Hong; Hou, Zhimin
2017-05-01
In this paper, supply-demand 3D dynamic model is adopted to create a measurement of a region’s capacity to provide available water to meet the needs of its population. First of all, we draw a diagram between supply and demand. Then taking the main dynamic factors into account, we establish an index to evaluate the balance of supply and demand. The three dimension vector reflects the scarcity of industrial, agricultural and residential water. Lebanon is chosen as the object of case study, and we do quantitative analysis of its current situation. After data collecting and processing, we calculate the 3D vector in 2012, which reveals that agriculture is susceptible to water scarcity. Water resources of Lebanon are “physical rich” but “economic scarcity” according to the correlation chart and other statistical analysis.
CREATE-IP and CREATE-V: Data and Services Update
NASA Astrophysics Data System (ADS)
Carriere, L.; Potter, G. L.; Hertz, J.; Peters, J.; Maxwell, T. P.; Strong, S.; Shute, J.; Shen, Y.; Duffy, D.
2017-12-01
The NASA Center for Climate Simulation (NCCS) at the Goddard Space Flight Center and the Earth System Grid Federation (ESGF) are working together to build a uniform environment for the comparative study and use of a group of reanalysis datasets of particular importance to the research community. This effort is called the Collaborative REAnalysis Technical Environment (CREATE) and it contains two components: the CREATE-Intercomparison Project (CREATE-IP) and CREATE-V. This year's efforts included generating and publishing an atmospheric reanalysis ensemble mean and spread and improving the analytics available through CREATE-V. Related activities included adding access to subsets of the reanalysis data through ArcGIS and expanding the visualization tool to GMAO forecast data. This poster will present the access mechanisms to this data and use cases including example Jupyter Notebook code. The reanalysis ensemble was generated using two methods, first using standard Python tools for regridding, extracting levels and creating the ensemble mean and spread on a virtual server in the NCCS environment. The second was using a new analytics software suite, the Earth Data Analytics Services (EDAS), coupled with a high-performance Data Analytics and Storage System (DASS) developed at the NCCS. Results were compared to validate the EDAS methodologies, and the results, including time to process, will be presented. The ensemble includes selected 6 hourly and monthly variables, regridded to 1.25 degrees, with 24 common levels used for the 3D variables. Use cases for the new data and services will be presented, including the use of EDAS for the backend analytics on CREATE-V, the use of the GMAO forecast aerosol and cloud data in CREATE-V, and the ability to connect CREATE-V data to NCCS ArcGIS services.
Feature based Weld-Deposition for Additive Manufacturing of Complex Shapes
NASA Astrophysics Data System (ADS)
Panchagnula, Jayaprakash Sharma; Simhambhatla, Suryakumar
2018-06-01
Fabricating functional metal parts using Additive Manufacturing (AM) is a leading trend. However, realizing overhanging features has been a challenge due to the lack of support mechanism for metals. Powder-bed fusion techniques like, Selective Laser Sintering (SLS) employ easily-breakable-scaffolds made of the same material to realize the overhangs. However, the same approach is not extendible to deposition processes like laser or arc based direct energy deposition processes. Although it is possible to realize small overhangs by exploiting the inherent overhanging capability of the process or by blinding some small features like holes, the same cannot be extended for more complex geometries. The current work presents a novel approach for realizing complex overhanging features without the need of support structures. This is possible by using higher order kinematics and suitably aligning the overhang with the deposition direction. Feature based non-uniform slicing and non-uniform area-filling are some vital concepts required in realizing the same and are briefly discussed here. This method can be used to fabricate and/or repair fully dense and functional components for various engineering applications. Although this approach has been implemented for weld-deposition based system, the same can be extended to any other direct energy deposition processes also.
Supply-Chain Optimization Template
NASA Technical Reports Server (NTRS)
Quiett, William F.; Sealing, Scott L.
2009-01-01
The Supply-Chain Optimization Template (SCOT) is an instructional guide for identifying, evaluating, and optimizing (including re-engineering) aerospace- oriented supply chains. The SCOT was derived from the Supply Chain Council s Supply-Chain Operations Reference (SCC SCOR) Model, which is more generic and more oriented toward achieving a competitive advantage in business.
The Coalition for Sustainable Egg Supply project: An introduction.
Swanson, J C; Mench, J A; Karcher, D
2015-03-01
In the United States, empirical information on the sustainability of commercial-scale egg production is lacking. The passage of state regulations specific to hen housing created urgency to better understand the effects of different housing systems on the sustainability of the egg supply, and stimulated the formation of a coalition, the Coalition for a Sustainable Egg Supply (CSES), to conduct research on this topic. The CSES is a multi-stakeholder group with 27 members, including food manufacturers, research institutions, scientists, restaurants, food service, retail food companies, egg suppliers, and nongovernmental organizations. A commercial-scale study was developed to better understand the effect of 3 housing systems (conventional cage, enriched colony, and cage-free aviary) on 5 areas related to a sustainable egg supply. These 5 sustainability areas represent effects on people, animals, and the environment: animal health and well-being, environment, food safety, worker health and safety, and food affordability. Five teams of scientists, each associated with a sustainability area, conducted an integrated field study at a commercial site in the upper Midwest through 2 flock cycles in 3 housing systems. This paper provides a brief overview of the CSES project to serve as an introduction for the papers that follow in this volume of Poultry Science. © The Author 2015. Published by Oxford University Press on behalf of Poultry Science Association.
AORN Ergonomic Tool 6: lifting and carrying supplies and equipment in the perioperative setting.
Waters, Thomas; Baptiste, Andrea; Short, Manon; Plante-Mallon, Lori; Nelson, Audrey
2011-08-01
Perioperative team members often are required to lift and carry heavy supplies and equipment into and around the OR; this includes lifting equipment such as hand tables, fluoroscopy boards, stirrups, Wilson frames, irrigation containers for lithotripsy, and heavy instrument pans. Lifting heavy objects creates considerable risk for musculoskeletal injuries to the back and shoulders. AORN Ergonomic Tool 6: Lifting and Carrying Supplies and Equipment in the Perioperative Setting can help caregivers evaluate lifting and carrying tasks and take measures to protect themselves from injury. Caregivers can use the revised National Institute for Occupational Safety and Health lifting equation to assess whether a specific lifting task can be performed safely. Published by Elsevier Inc.
The Growing Demand for Hospice and Palliative Medicine Physicians: Will the Supply Keep Up?
Lupu, Dale; Quigley, Leo; Mehfoud, Nicholas; Salsberg, Edward S
2018-04-01
The need for hospice and palliative care is growing rapidly as the population increases and ages and as both hospice and palliative care become more accepted. Hospice and palliative medicine (HPM) is a relatively new physician specialty, currently training 325 new fellows annually. Given the time needed to increase the supply of specialty-trained physicians, it is important to assess future needs to guide planning for future training capacity. We modeled the need for and supply of specialist HPM physicians through the year 2040 to determine whether training capacity should continue growing. To create a benchmark for need, we used a population-based approach to look at the current geographic distribution of the HPM physician supply. To model future supply, we calculated the annual change in current supply by adding newly trained physicians and subtracting physicians leaving the labor force. The current U.S. supply of HPM specialists is 13.35 per 100,000 adults 65 and older. This ratio varies greatly across the country. Using alternate assumptions for future supply and demand, we project that need in 2040 will range from 10,640 to almost 24,000 HPM specialist physicians. Supply will range from 8100 to 19,000. Current training capacity is insufficient to keep up with population growth and demand for services. HPM fellowships would need to grow from the current 325 graduates annually to between 500 and 600 per year by 2030 to assure sufficient physician workforce for hospice and palliative care services given current service provision patterns. Copyright © 2018 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.
Health supply chain management.
Zimmerman, Rolf; Gallagher, Pat
2010-01-01
This chapter gives an educational overview of: * The actual application of supply chain practice and disciplines required for service delivery improvement within the current health environment. * A rationale for the application of Supply Chain Management (SCM) approaches to the Health sector. * The tools and methods available for supply chain analysis and benchmarking. * Key supply chain success factors.
Zygourakis, Corinna C; Valencia, Victoria; Boscardin, Christy; Nayak, Rahul U; Moriates, Christopher; Gonzales, Ralph; Theodosopoulos, Philip; Lawton, Michael T
2016-12-01
There is high variability in neurosurgical costs, and surgical supplies constitute a significant portion of cost. Anecdotally, surgeons use different supplies for various reasons, but there is little understanding of how supply choices affect outcomes. Our goal is to evaluate the effect of patient, procedural, and provider factors on supply cost and to determine if supply cost is associated with patient outcomes. We obtained patient information (age, gender, payor, case mix index [CMI], body mass index, admission source), procedural data (procedure type, length, date), provider information (name, case volume), and total surgical supply cost for all inpatient neurosurgical procedures from 2013 to 2014 at our institution (n = 4904). We created mixed-effect models to examine the effect of each factor on surgical supply cost, 30-day readmission, and 30-day mortality. There was significant variation in surgical supply cost between and within procedure types. Older age, female gender, higher CMI, routine/elective admission, longer procedure, and larger surgeon volume were associated with higher surgical supply costs (P < 0.05). Routine/elective admission and higher surgeon volume were associated with lower readmission rates (odds ratio, 0.707, 0.998; P < 0.01). Only patient factors of older age, male gender, private insurance, higher CMI, and emergency admission were associated with higher mortality (odds ratio, 1.029, 1.700, 1.692, 1.080, 2.809). There was no association between surgical supply cost and readmission or mortality (P = 0.307, 0.548). A combination of patient, procedural, and provider factors underlie the significant variation in neurosurgical supply costs at our institution. Surgical supply costs are not correlated with 30-day readmission or mortality. Copyright © 2016 Elsevier Inc. All rights reserved.
The Virtual Hospital: experiences in creating and sustaining a digital library.
D'Alessandro, M P; Galvin, J R; Erkonen, W E; Choi, T A; Lacey, D L; Colbert, S I
1998-01-01
A university and its faculty encompass a wealth of content, which is often freely supplied to commercial publishers who profit from it. Emerging digital library technology holds promise for allowing the creation of digital libraries and digital presses that can allow faculty and universities to bypass commercial publishers, retain control of their content, and distribute it directly to users, allowing the university and faculty to better serve their constituencies. The purpose of this paper is to show how this can be done. A methodology for overcoming the technical, social, political, and economic barriers involved in creating, distributing and organizing a digital library was developed, implemented, and refined over seven years. Over the seven years, 120 textbooks and booklets were placed in the Virtual Hospital digital library, from 159 authors in twenty-nine departments and four colleges at The University of Iowa. The digital library received extensive use by individuals around the world. A new paradigm for academic publishing was created, involving a university and faculty owned peer reviewed digital press implemented using digital library technology. The concept has been embraced by The University of Iowa, and it has pledged to sustain the digital press in order to allow. The University of Iowa to fulfill its mission of creating, organizing, and disseminating information better. PMID:9803300
Sediment supply controls equilibrium channel geometry in gravel rivers
Finnegan, Noah J.; Willenbring, Jane K.
2017-01-01
In many gravel-bedded rivers, floods that fill the channel banks create just enough shear stress to move the median-sized gravel particles on the bed surface (D50). Because this observation is common and is supported by theory, the coincidence of bankfull flow and the incipient motion of D50 has become a commonly used assumption. However, not all natural gravel channels actually conform to this simple relationship; some channels maintain bankfull stresses far in excess of the critical stress required to initiate sediment transport. We use a database of >300 gravel-bedded rivers and >600 10Be-derived erosion rates from across North America to explore the hypothesis that sediment supply drives the magnitude of bankfull shear stress relative to the critical stress required to mobilize the median bed surface grain size (τbf*/τc*). We find that τbf*/τc* is significantly higher in West Coast river reaches (2.35, n = 96) than in river reaches elsewhere on the continent (1.03, n = 245). This pattern parallels patterns in erosion rates (and hence sediment supplies). Supporting our hypothesis, we find a significant correlation between upstream erosion rate and local τbf*/τc* at sites where this comparison is possible. Our analysis reveals a decrease in bed surface armoring with increasing τbf*/τc*, suggesting channels accommodate changes in sediment supply through adjustments in bed surface grain size, as also shown through numerical modeling. Our findings demonstrate that sediment supply is encoded in the bankfull hydraulic geometry of gravel bedded channels through its control on bed surface grain size. PMID:28289212
2003-01-01
online, www.customs.ustreas.gov/xp/cgov/import/commercial_enforcement/ ctpat /fact_sheet.xm, March 24, 2003. [42] John M. Patterson, “Supply Chain... ctpat /fast/fast_info, March 24, 2003. [45] Our concept of the maturity scale is borrowed from Kevin P. McCormack and Wiliam C. Johnson, “Supply
[Lung transplantation: supply and demand in France].
Stern, M; Souilamas, R; Tixier, D; Mal, H
2008-10-01
For a decade lung transplantation has suffered from a lack of donor organs which aroused a national debate and led to planned action in collaboration with The French National Agency for Transplantation. Analysis of the stages of the process from potential donor to lung transplantation identified lung procurement as the main priority. An increase in the number of potential lung donors and revision of the acceptance criteria led to a doubling of the annual rate of lung transplantation in less than two years. In the near future we may solve the problem of donor family refusals and establish scientifically based criteria for lung acceptance to increase the rate of lung transplantation. Transplantation from non heart-beating donors and the reconditioning of ex vivo non acceptable lungs might supply additional organs to fulfill demand in the long term. The rate of lung transplantation activity in France doubled as the result of a dramatic increase of donor lung proposals. The current improvement in the results of lung transplantation might create new demands and generate future difficulties in the supply of donor lungs. New approaches, such as transplantation from non heart-beating donors and reconditioning ex vivo non acceptable lungs, should be examined in the near future.
The commercial performance of cellulosic ethanol supply-chains in Europe
Slade, Raphael; Bauen, Ausilio; Shah, Nilay
2009-01-01
Background The production of fuel-grade ethanol from lignocellulosic biomass resources has the potential to increase biofuel production capacity whilst minimising the negative environmental impacts. These benefits will only be realised if lignocellulosic ethanol production can compete on price with conventional fossil fuels and if it can be produced commercially at scale. This paper focuses on lignocellulosic ethanol production in Europe. The hypothesis is that the eventual cost of production will be determined not only by the performance of the conversion process but by the performance of the entire supply-chain from feedstock production to consumption. To test this, a model for supply-chain cost comparison is developed, the components of representative ethanol supply-chains are described, the factors that are most important in determining the cost and profitability of ethanol production are identified, and a detailed sensitivity analysis is conducted. Results The most important cost determinants are the cost of feedstocks, primarily determined by location and existing markets, and the value obtained for ethanol, primarily determined by the oil price and policy incentives. Both of these factors are highly uncertain. The best performing chains (ethanol produced from softwood and sold as a low percentage blend with gasoline) could ultimately be cost competitive with gasoline without requiring subsidy, but production from straw would generally be less competitive. Conclusion Supply-chain design will play a critical role in determining commercial viability. The importance of feedstock supply highlights the need for location-specific assessments of feedstock availability and price. Similarly, the role of subsidies and policy incentives in creating and sustaining the ethanol market highlights the importance of political engagement and the need to include political risks in investment appraisal. For the supply-chains described here, and with the cost and market
NASA Astrophysics Data System (ADS)
Li, Ling
2012-02-01
Supply chain collaboration has received increasing attention from scholars and practitioners in recent years. However, our understanding of how enterprise information technology facilitates supply chain collaboration is still very limited, especially with regard to Chinese enterprise ownerships such as state-owned firms, joint-venture firms and local village-owned firms. This paper extends the theory established in enterprise information technology (IT) and supply chain collaboration literature and relates it with coordination in China-linked supply chain. Drawing upon an empirical study from 177 Chinese companies, we provide three major findings: (i) uncovered the importance of leveraging enterprise IT through supply chain collaboration; (ii) identified the relationship between enterprise ownership and enterprise technology use and supply chain collaboration in China-linked supply chain and (iii) illustrated effects of supply chain collaborative activities on operational and market performance.
Public-supply water use and self-supplied industrial water use in Tennessee, 2010
Robinson, John A.
2018-04-26
The U.S. Geological Survey (USGS), in cooperation with the Tennessee Department of Environment and Conservation, Division of Water Resources, prepared this report and displayed and analyzed water use by self-supplied industrial and public-supply water systems in Tennessee for 2010. Public-supply water systems in Tennessee provide water for domestic, industrial, and commercial uses and for municipal services. In 2010, 474 public-supply water systems distributed 917 million gallons per day (Mgal/d) of surface water (67 percent, 617 Mgal/d) and groundwater (33 percent, 300 Mgal/d) to a population of 5.7 million in Tennessee. Gross per capita water use in Tennessee during 2010 was 162 gallons per day.Since 1950, water withdrawals by public-supply water systems in Tennessee have increased from 160 Mgal/d to 917 Mgal/d in 2010. Each of the 95 counties in Tennessee was served by at least 1 public-supply water system in 2010. Tennessee public-supply water systems withdraw less groundwater than surface water, and surface-water use has increased at a faster rate than groundwater use. Since 2005, surface-water withdrawals have increased by 26 Mgal/d, and groundwater withdrawals have decreased by 29 Mgal/d, which is the first decrease in groundwater withdrawals since 1950; however, 29 systems reported increased groundwater withdrawals during 2010, and 12 of these 29 systems reported increases of 1 Mgal/d or more. Davidson County had the largest surface-water withdrawal rate (136 Mgal/d) in 2010. The largest groundwater withdrawal rate (151 Mgal/d) by a single public-supply water system was reported by Memphis Light, Gas and Water, which served more than 669,000 people in Shelby County in 2010.Self-supplied industrial water use includes water for such purposes as fabrication, processing, washing, diluting, cooling, or transporting a product; incorporating water into a product; or for sanitation needs in facilities that manufacture various products. Water withdrawals for self-supplied
Cleaning supplies and equipment
... gov/ency/patientinstructions/000443.htm Cleaning supplies and equipment To use the sharing features on this page, ... to clean supplies and equipment. Disinfecting Supplies and Equipment Start by wearing the right personal protective equipment ( ...
Understanding your supply chain to reduce the risk of supply chain disruption.
Wildgoose, Nick; Brennan, Patrick; Thompson, Simon
2012-01-01
Supply chains are at the heart of the way in which organisations operate and compete today; they also play a critical role in overall organisation performance. In the context of increasingly complex and global supply chains, the actions taken to drive down costs are likely to drive risk into the supply chain. The frequency of supply chain disruptions is high and this paper offers practical advice to help reduce the frequency and cost associated with these. There is advice to help with the understanding of how to identify critical suppliers. The reader is guided through comprehensive risk assessment and mitigation approaches and a selection of practical risk solutions and tools that you can use is described. There is a section on the 'dos and don'ts' relating to supplier due diligence. For those organisations facing the challenge of drawing up a business case relating to investment in improving supply chain resiliency, there is also a section outlining some of the business benefits of improving supply chain resiliency.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Otobe, Y.; Chikamatsu, M.
1988-03-08
A method of controlling the fuel supply to an internal combustion engine is described, wherein a quantity of fuel for supply to the engine is determined by correcting a basic value of the quantity of fuel determined as a function of at least one operating parameter of the engine by correction values dependent upon operating conditions of the engine and the determined quantity of fuel is supplied to the engine. The method comprises the steps of: (1) detecting a value of at least one predetermined operating parameter of the engine; (2) manually adjusting a single voltage creating means to setmore » an output voltage therefrom to such a desired value as to compensate for deviation of the air/fuel ratio of a mixture supplied to the engine due to variations in operating characteristics of engines between different production lots or aging changes; (3) determining a value of the predetermined one correction value corresponding to the set desired value of output voltage of the single voltage creating means, and then modifying the thus determined value in response to the detected value of the predetermined at least one operating parameter of the engine during engine operation; and (4) correcting the basic value of the quantity of fuel by the value of the predetermined one correction value having the thus modified value, and the other correction values.« less
Code of Federal Regulations, 2010 CFR
2010-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Supplies. 21.210 Section... REHABILITATION AND EDUCATION Vocational Rehabilitation and Employment Under 38 U.S.C. Chapter 31 Supplies § 21.210 Supplies. (a) Purpose of furnishing supplies. Supplies are furnished to enable a veteran to pursue...
Code of Federal Regulations, 2010 CFR
2010-01-01
... unused supplies. If the inventory of unused supplies exceeds $5,000 in total aggregate value and the... 10 Energy 4 2010-01-01 2010-01-01 false Supplies. 600.324 Section 600.324 Energy DEPARTMENT OF... Supplies. (a) Title vests in the recipient upon acquisition of supplies acquired with Federal funds under...
Code of Federal Regulations, 2010 CFR
2010-07-01
... shall retain any unused supplies. If the inventory of unused supplies exceeds $5,000 in total aggregate... 32 National Defense 1 2010-07-01 2010-07-01 false Supplies. 34.24 Section 34.24 National Defense... § 34.24 Supplies. (a) Title shall vest in the recipient upon acquisition for supplies acquired with...
A novel method for creating custom shaped ballistic gelatin trainers using plaster molds.
Doctor, Michael; Katz, Anne; McNamara, Shannon O; Leifer, Jessica H; Bambrick-Santoyo, Gabriela; Saul, Turandot; Rose, Keith M
2018-03-01
Simulation based procedural training is an effective and frequently used method for teaching vascular access techniques which often require commercial trainers. These can be prohibitively expensive, which allows for homemade trainers made of gelatin to be a more cost-effective and attractive option. Previously described trainers are often rectangular with a flat surface that is dissimilar to human anatomy. We describe a novel method to create a more anatomically realistic trainer using ballistic gelatin, household items, and supplies commonly found in an emergency department such as the plaster wrap typically used to make splints.
Equipment, supplies, and pharmaceuticals: how much might it cost to achieve basic surge capacity?
Hanfling, Dan
2006-11-01
The ability to deliver optimal medical care in the setting of a disaster event, regardless of its cause, will in large part be contingent on an immediately available supply of key medical equipment, supplies, and pharmaceuticals. Although the Department of Health and Human Services Strategic National Stockpile program makes these available through its 12-hour "push packs" and vendor-managed inventory, every local community should be funded to create a local cache for these items. This report explores the funding requirements for this suggested approach. Furthermore, the response to a surge in demand for care will be contingent on keeping available staff close to the hospitals for a sustained period. A proposal for accomplishing this, with associated costs, is discussed as well.
Cost of Oil and Biomass Supply Shocks under Different Biofuel Supply Chain Configurations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Uria Martinez, Rocio; Leiby, Paul Newsome; Brown, Maxwell L.
This analysis estimates the cost of selected oil and biomass supply shocks for producers and consumers in the light-duty vehicle fuel market under various supply chain configurations using a mathematical programing model, BioTrans. The supply chain configurations differ by whether they include selected flexibility levers: multi-feedstock biorefineries; advanced biomass logistics; and the ability to adjust ethanol content of low-ethanol fuel blends, from E10 to E15 or E05. The simulated scenarios explore market responses to supply shocks including substitution between gasoline and ethanol, substitution between different sources of ethanol supply, biorefinery capacity additions or idling, and price adjustments. Welfare effects formore » the various market participants represented in BioTrans are summarized into a net shock cost measure. As oil accounts for a larger fraction of fuel by volume, its supply shocks are costlier than biomass supply shocks. Corn availability and the high cost of adding biorefinery capacity limit increases in ethanol use during gasoline price spikes. During shocks that imply sudden decreases in the price of gasoline, the renewable fuel standard (RFS) biofuel blending mandate limits the extent to which flexibility can be exercised to reduce ethanol use. The selected flexibility levers are most useful in response to cellulosic biomass supply shocks.« less
Bazuin, Doug; Martinez, Jessica; Harper, Kathy; Okland, Kathy; Bergquist, Patricia; Kumar, Shilpi
2015-01-01
The purpose of this study was to gain insight into the use and storage of supplies in the neonatal intensive care and women's health units of Parkland Hospital in Dallas, Texas. Construction of a new Parkland Hospital is underway, with completion of the 862-bed, 2.5-million square feet hospital in 2014. Leaders from the hospital and representatives from one of its major vendors collaborated on a research study to evaluate the hospital's current supply management system and develop criteria to create an improved system to be implemented at the new hospital. Approach includes qualitative and quantitative methods, that is, written survey, researcher observations, focus groups, and evaluation of hospital supply reports. Approaching the ideal location of supplies can be best approached by defining a nurse's activity at the point of care. Determining an optimal supply management system must be approached by understanding the "what" of caregivers' activities and then determining the "where" of the supplies that support those activities. An ideal supply management system locates supplies as close as possible to the point of use, is organized by activity, and is standardized within and across units. © The Author(s) 2015.
Power supply conditioning circuit
NASA Technical Reports Server (NTRS)
Primas, L. E.; Loveland, R.
1987-01-01
A power supply conditioning circuit that can reduce Periodic and Random Deviations (PARD) on the output voltages of dc power supplies to -150 dBV from dc to several KHz with no measurable periodic deviations is described. The PARD for a typical commercial low noise power supply is -74 dBV for frequencies above 20 Hz and is often much worse at frequencies below 20 Hz. The power supply conditioning circuit described here relies on the large differences in the dynamic impedances of a constant current diode and a zener diode to establish a dc voltage with low PARD. Power supplies with low PARD are especially important in circuitry involving ultrastable frequencies for the Deep Space Network.
Alternative supply specifications and estimates of regional supply and demand for stumpage.
Kent P. Connaughton; David H. Jackson; Gerard A. Majerus
1988-01-01
Four plausible sets of stumpage supply and demand equations were developed and estimated; the demand equation was the same for each set, although the supply equation differed. The supply specifications varied from the model of regional excess demand in which National Forest harvest levels were assumed fixed to a more realistic model in which the harvest on the National...
Irregular water supply, household usage and dengue: a bio-social study in the Brazilian Northeast.
Caprara, Andrea; Lima, José Wellington de Oliveira; Marinho, Alice Correia Pequeno; Calvasina, Paola Gondim; Landim, Lucyla Paes; Sommerfeld, Johannes
2009-01-01
Despite increased vector control efforts, dengue fever remains endemic in Fortaleza, Northeast Brazil, where sporadic epidemic outbreaks have occurred since 1986. Multiple factors affect vector ecology such as social policy, migration, urbanization, city water supply, garbage disposal and housing conditions, as well as community level understanding of the disease and related practices. This descriptive study used a multi-disciplinary approach that bridged anthropology and entomology. A multiple case study design was adopted to include research in six study areas, defined as blocks. The water supply is irregular in households from both under-privileged and privileged areas, however, clear differences exist. In the more privileged blocks, several homes are not connected to the public water system, but have a well and pump system and therefore irregularity of supply does not affect them. In households from under-privileged blocks, where the water supply is irregular, the frequent use of water containers such as water tanks, cisterns, barrels and pots, creates environmental conditions with a greater number of breeding areas. In under-privileged homes, there are more possible breeding areas and environmental conditions that may improve the chances of Aedes aegypti survival.
Performance analysis of Supply Chain Management with Supply Chain Operation reference model
NASA Astrophysics Data System (ADS)
Hasibuan, Abdurrozzaq; Arfah, Mahrani; Parinduri, Luthfi; Hernawati, Tri; Suliawati; Harahap, Bonar; Rahmah Sibuea, Siti; Krianto Sulaiman, Oris; purwadi, Adi
2018-04-01
This research was conducted at PT. Shamrock Manufacturing Corpora, the company is required to think creatively to implement competition strategy by producing goods/services that are more qualified, cheaper. Therefore, it is necessary to measure the performance of Supply Chain Management in order to improve the competitiveness. Therefore, the company is required to optimize its production output to meet the export quality standard. This research begins with the creation of initial dimensions based on Supply Chain Management process, ie Plan, Source, Make, Delivery, and Return with hierarchy based on Supply Chain Reference Operation that is Reliability, Responsiveness, Agility, Cost, and Asset. Key Performance Indicator identification becomes a benchmark in performance measurement whereas Snorm De Boer normalization serves to equalize Key Performance Indicator value. Analiytical Hierarchy Process is done to assist in determining priority criteria. Measurement of Supply Chain Management performance at PT. Shamrock Manufacturing Corpora produces SC. Responsiveness (0.649) has higher weight (priority) than other alternatives. The result of performance analysis using Supply Chain Reference Operation model of Supply Chain Management performance at PT. Shamrock Manufacturing Corpora looks good because its monitoring system between 50-100 is good.
Coliform non-compliance nightmares in water-supply distribution systems
DOE Office of Scientific and Technical Information (OSTI.GOV)
Geldreich, E.E.
1988-01-01
Coliform occurrences in distribution systems have created a great concern for both utilities and water authorities because of the implied public-health implications and failure to meet Federal regulations. Many of the known cases involve systems in the east and midwest. The common denominator being systems that have significant amounts of pipe networks over 75 years old and all are treating surface waters. Origins for these contamination events can be found in source-water fluctuations, failures in treatment-barrier protection, or loss of pipe-network integrity. Once passage into the distribution network has been achieved, some of the coliforms (Klebsiella, Enterobacter, Citrobacter) and othermore » heterotrophic bacteria adapt to the pipe environment, finding protection and nutrient support in pipe sediments. Under conditions of seasonal warm waters (10 degC) and availability of assimilable organics in the pipe sediments and tubercles, colonization grows into biofilms that may slough-off into the water supply, creating a coliform non-compliance problem. Significance of these occurrences and control measures are part of a realistic action plan presented for guidance.« less
Supply chain planning classification
NASA Astrophysics Data System (ADS)
Hvolby, Hans-Henrik; Trienekens, Jacques; Bonde, Hans
2001-10-01
Industry experience a need to shift in focus from internal production planning towards planning in the supply network. In this respect customer oriented thinking becomes almost a common good amongst companies in the supply network. An increase in the use of information technology is needed to enable companies to better tune their production planning with customers and suppliers. Information technology opportunities and supply chain planning systems facilitate companies to monitor and control their supplier network. In spite if these developments, most links in today's supply chains make individual plans, because the real demand information is not available throughout the chain. The current systems and processes of the supply chains are not designed to meet the requirements now placed upon them. For long term relationships with suppliers and customers, an integrated decision-making process is needed in order to obtain a satisfactory result for all parties. Especially when customized production and short lead-time is in focus. An effective value chain makes inventory available and visible among the value chain members, minimizes response time and optimizes total inventory value held throughout the chain. In this paper a supply chain planning classification grid is presented based current manufacturing classifications and supply chain planning initiatives.
Closed-loop supply chain models with considering the environmental impact.
Mohajeri, Amir; Fallah, Mohammad
2014-01-01
Global warming and climate changes created by large scale emissions of greenhouse gases are a worldwide concern. Due to this, the issue of green supply chain management has received more attention in the last decade. In this study, a closed-loop logistic concept which serves the purposes of recycling, reuse, and recovery required in a green supply chain is applied to integrate the environmental issues into a traditional logistic system. Here, we formulate a comprehensive closed-loop model for the logistics planning considering profitability and ecological goals. In this way, we can achieve the ecological goal reducing the overall amount of CO2 emitted from journeys. Moreover, the profitability criterion can be supported in the cyclic network with the minimum costs and maximum service level. We apply three scenarios and develop problem formulations for each scenario corresponding to the specified regulations and investigate the effect of the regulation on the preferred transport mode and the emissions. To validate the models, some numerical experiments are worked out and a comparative analysis is investigated.
Closed-Loop Supply Chain Models with Considering the Environmental Impact
Fallah, Mohammad
2014-01-01
Global warming and climate changes created by large scale emissions of greenhouse gases are a worldwide concern. Due to this, the issue of green supply chain management has received more attention in the last decade. In this study, a closed-loop logistic concept which serves the purposes of recycling, reuse, and recovery required in a green supply chain is applied to integrate the environmental issues into a traditional logistic system. Here, we formulate a comprehensive closed-loop model for the logistics planning considering profitability and ecological goals. In this way, we can achieve the ecological goal reducing the overall amount of CO2 emitted from journeys. Moreover, the profitability criterion can be supported in the cyclic network with the minimum costs and maximum service level. We apply three scenarios and develop problem formulations for each scenario corresponding to the specified regulations and investigate the effect of the regulation on the preferred transport mode and the emissions. To validate the models, some numerical experiments are worked out and a comparative analysis is investigated. PMID:25309960
Piezoelectric transformer and modular connections for high power and high voltage power supplies
NASA Technical Reports Server (NTRS)
Vazquez Carazo, Alfredo (Inventor)
2006-01-01
A modular design for combining piezoelectric transformers is provided for high voltage and high power conversion applications. The input portions of individual piezoelectric transformers are driven for a single power supply. This created the vibration and the conversion of electrical to electrical energy from the input to the output of the transformers. The output portions of the single piezoelectric transformers are combining in series and/or parallel to provide multiple outputs having different rating of voltage and current.
Code of Federal Regulations, 2010 CFR
2010-10-01
... supplies exceeding $5,000 in total aggregate fair market value upon termination or completion of the award... 49 Transportation 1 2010-10-01 2010-10-01 false Supplies. 18.33 Section 18.33 Transportation... Supplies. (a) Title. Title to supplies acquired under a grant or subgrant will vest, upon acquisition, in...
Code of Federal Regulations, 2010 CFR
2010-10-01
... 45 Public Welfare 1 2010-10-01 2010-10-01 false Supplies. 74.35 Section 74.35 Public Welfare... COMMERCIAL ORGANIZATIONS Post-Award Requirements Property Standards § 74.35 Supplies. (a) Title to supplies shall vest in the recipient upon acquisition. If there is a residual inventory of unused supplies...
Code of Federal Regulations, 2010 CFR
2010-01-01
... residual inventory of unused supplies exceeding $5,000 in total aggregate fair market value upon... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Supplies. 1273.33 Section 1273.33..., Property, and Subawards § 1273.33 Supplies. (a) Title. Title to supplies acquired under a grant or subgrant...
Li, Jacqueline; Pan, Shu-Yuan; Kim, Hyunook; Linn, Jean H; Chiang, Pen-Chi
2015-10-01
As suggested by UNEP, the key to sustainable development is to create a "green economy" which should encapsulate all three sectors: the industry, the people, and the government. Therefore, there is an urgent need to develop and implement the green technologies into the existing facilities, especially in the developing countries. In this study, the role of green supply chains in eco-industrial parks (EIPs) towards a green economy was investigated. The strategies and effective evaluation procedures of the green economy were proposed by assessing the barriers from the perspective of institution, regulation, technology, and finance. In addition, three case studies from iron and steel-making, paper mill and pulping, and petrochemical industries were presented and illustrated for building the green supply chains. For example, in the case of Lin-Hai Industrial Park, a total of 15 efficient green supply chains using waste-to-resources technologies were established by 2012, resulting in an economic benefit of USD 100 million per year. It suggests that the green supply chains should be established to achieve both economic growth and environmental protection. With these successful experiences, building a green supply chain within industrial park should be extensively promoted to make traditional industries around the world being environmentally bearable, economic viable, and social equitable. Copyright © 2015 Elsevier Ltd. All rights reserved.
Code of Federal Regulations, 2010 CFR
2010-07-01
...) Disposition. If there is a residual inventory of unused supplies exceeding $5,000 in total aggregate fair... 32 National Defense 1 2010-07-01 2010-07-01 false Supplies. 33.33 Section 33.33 National Defense... Requirements Changes, Property, and Subawards § 33.33 Supplies. (a) Title. Title to supplies acquired under a...
Code of Federal Regulations, 2010 CFR
2010-01-01
... residual inventory of unused supplies exceeding $5,000 in total aggregate fair market value upon... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Supplies. 24.33 Section 24.33 Commerce..., and Subawards § 24.33 Supplies. (a) Title. Title to supplies acquired under a grant or subgrant will...
Code of Federal Regulations, 2010 CFR
2010-04-01
... supplies exceeding $5,000 in total aggregate fair market value upon termination or completion of the award... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Supplies. 135.33 Section 135.33 Foreign... Supplies. (a) Title. Title to supplies acquired under a grant or subgrant will vest, upon acquisition, in...
Code of Federal Regulations, 2010 CFR
2010-07-01
.... If there is a residual inventory of unused supplies exceeding $5,000 in total aggregate fair market... 29 Labor 4 2010-07-01 2010-07-01 false Supplies. 1470.33 Section 1470.33 Labor Regulations... Changes, Property, and Subawards § 1470.33 Supplies. (a) Title. Title to supplies acquired under a grant...
Code of Federal Regulations, 2010 CFR
2010-07-01
...) Disposition. If there is a residual inventory of unused supplies exceeding $5,000 in total aggregate fair... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Supplies. 43.33 Section... Requirements Changes, Property, and Subawards § 43.33 Supplies. (a) Title. Title to supplies acquired under a...
Code of Federal Regulations, 2010 CFR
2010-10-01
... residual inventory of unused supplies exceeding $5,000 in total aggregate fair market value upon... 45 Public Welfare 4 2010-10-01 2010-10-01 false Supplies. 2541.330 Section 2541.330 Public Welfare..., Property and Subawards § 2541.330 Supplies. (a) Title. Title to supplies acquired under a grant or subgrant...
Code of Federal Regulations, 2010 CFR
2010-07-01
...) Disposition. If there is a residual inventory of unused supplies exceeding $5,000 in total aggregate fair... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Supplies. 31.33 Section 31.33... Requirements Changes, Property, and Subawards § 31.33 Supplies. (a) Title. Title to supplies acquired under a...
Code of Federal Regulations, 2010 CFR
2010-01-01
... supplies exceeding $5,000 in total aggregate fair market value upon termination or completion of the award... 10 Energy 4 2010-01-01 2010-01-01 false Supplies. 600.233 Section 600.233 Energy DEPARTMENT OF... Supplies. (a) Title. Title to supplies acquired under a grant or subgrant will vest, upon acquisition, in...
Code of Federal Regulations, 2010 CFR
2010-01-01
... residual inventory of unused supplies exceeding $5,000 in total aggregate fair market value upon... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Supplies. 143.33 Section 143.33..., and Subawards § 143.33 Supplies. (a) Title. Title to supplies acquired under a grant or subgrant will...
Code of Federal Regulations, 2010 CFR
2010-10-01
... residual inventory of unused supplies exceeding $5,000 in total aggregate fair market value upon... 45 Public Welfare 1 2010-10-01 2010-10-01 false Supplies. 92.33 Section 92.33 Public Welfare..., Property, and Subawards § 92.33 Supplies. (a) Title. Title to supplies acquired under a grant or subgrant...
Code of Federal Regulations, 2010 CFR
2010-10-01
... supplies exceeding $5,000 in total aggregate fair market value upon termination or completion of the award... 45 Public Welfare 3 2010-10-01 2010-10-01 false Supplies. 1183.33 Section 1183.33 Public Welfare... Supplies. (a) Title. Title to supplies acquired under a grant or subgrant will vest, upon acquisition, in...
Detection of toxic industrial chemicals in water supplies using surface-enhanced Raman spectroscopy
NASA Astrophysics Data System (ADS)
Spencer, Kevin M.; Sylvia, James M.; Spencer, Sarah A.; Clauson, Susan L.
2010-04-01
An effective method to create fear in the populace is to endanger the water supply. Homeland Security places significant importance on ensuring drinking water integrity. Beyond terrorism, accidental supply contamination from a spill or chemical residual increases is a concern. A prominent class of toxic industrial chemicals (TICs) is pesticides, which are prevalent in agricultural use and can be very toxic in minute concentrations. Detection of TICs or warfare agents must be aggressive; the contaminant needs to be rapidly detected and identified to enable isolation and remediation of the contaminated water while continuing a clean water supply for the population. Awaiting laboratory analysis is unacceptable as delay in identification and remediation increases the likelihood of infection. Therefore, a portable or online water quality sensor is required that can produce rapid results. In this presentation, Surface-Enhanced Raman Spectroscopy (SERS) is discussed as a viable fieldable sensor that can be immersed directly into the water supply and can provide results in <5 minutes from the time the instrument is turned on until analysis is complete. The ability of SERS to detect several chemical warfare agent degradation products, simulants and toxic industrial chemicals in distilled water, tap water and untreated water will be shown. In addition, results for chemical warfare agent degradation products and simulants will be presented. Receiver operator characteristic (ROC) curves will also be presented.
Sakai-Bizmark, Rie; Goto, Rei; Hiragi, Shusuke; Tamura, Hiroshi
2018-03-27
Highly-competent patient care is paramount to medicine. Quality training and patient accessibility to physicians with a wide range of specializations is essential. Yet, poor quality of life for physicians cannot be ignored, being detrimental to patient care and leading to personnel leaving the medical profession. In 2004, the Japanese government reformed postgraduate training for medical graduates, adding a 2-year, hands-on rotation through different specialties before the specialization residency was begun. Residents could now choose practice location, but it sparked concerns that physician distribution disparities had been created. Japanese media reported that residents were choosing specialties deemed to offer a higher quality of life, like Ophthalmology or Dermatology, over underserved areas like Obstetrics or Cardiology. To explore the consequences of Japan's policy efforts, through the residency reform in 2004, to improve physician training, analyzing ophthalmologist supply and distribution in the context of providing the best possible patient care and access while maintaining physician quality of life. Using secondary data, we analyzed changes in ophthalmologist supply at the secondary tier of medical care (STM). We applied ordinary least-squares regression models to ophthalmologist density to reflect community factors such as residential quality and access to further professional development, to serve as predictors of ophthalmologist supply. Coefficient equality tests examined predictor differences before and after 2004. Similar analyses were conducted for all physicians excluding ophthalmologists (other physicians). Ophthalmologist coverage in top and bottom 10% of STMs revealed supply inequalities. Change in ophthalmologist supply was inversely associated with baseline ophthalmologist density before (P < .01) and after (P = .01) 2004. Changes in other physician supply were not associated with baseline other physician density before 2004 (P = 0
ERIC Educational Resources Information Center
Cargal, Joseph L.
2010-01-01
The purpose of this study was to examine information technology/systems strategy related factors in the automotive supply industry based on responses to the Strategic Planning and Business Performance Survey provided to automotive suppliers. This population produces supplies to the automotive industry with products valued at hundreds of billions…
NASA Astrophysics Data System (ADS)
Ying, Y.; Mursitama, T. N.; Sofi; Anggreani, L.
2018-03-01
The study discusses the effort of preparing human resources in mastering Mandarin for Taiwan industry as the anticipation of Southbound policy created by Taiwan government. In this point, the Southbound policy represents Taiwan’s government strategy in 2016-2020 which encourages multilateral and bilateral cooperation with ASEAN and South Asian countries. One of the most important elements in the program centers as the Internship Scholarship Program in Taiwan. Utilizing qualitative research methods, researchers collected secondary data from various available official resources. The publications, documents, books, and websites contain the policy and mechanism of the internship scholarship program. On the other hand, this study conducted interviews with senior high school and vocational high school stakeholders to create synergy in the program. This study offers a model of cooperation between junior high school/vocational school and the candidates of the employer in the Taiwan industry. The contribution of this research is to create a comprehensive cooperative model that includes preparing human resources before leaving for Taiwan, providing teachers and supplying training materials that are relevant to the needs of industry players in Taiwan eventually.
Future Water-Supply Scenarios, Cape May County, New Jersey, 2003-2050
Lacombe, Pierre J.; Carleton, Glen B.; Pope, Daryll A.; Rice, Donald E.
2009-01-01
Stewards of the water supply in New Jersey are interested in developing a plan to supply potable and non-potable water to residents and businesses of Cape May County until at least 2050. The ideal plan would meet projected demands and minimize adverse effects on currently used sources of potable, non-potable, and ecological water supplies. This report documents past and projected potable, non-potable, and ecological water-supply demands. Past and ongoing adverse effects to production and domestic wells caused by withdrawals include saltwater intrusion and water-level declines in the freshwater aquifers. Adverse effects on the ecological water supplies caused by groundwater withdrawals include premature drying of seasonal wetlands, delayed recovery of water levels in the water-table aquifer, and reduced streamflow. To predict the effects of future actions on the water supplies, three baseline and six future scenarios were created and simulated. Baseline Scenarios 1, 2, and 3 represent withdrawals using existing wells projected until 2050. Baseline Scenario 1 represents average 1998-2003 withdrawals, and Scenario 2 represents New Jersey Department of Environmental Protection (NJDEP) full allocation withdrawals. These withdrawals do not meet projected future water demands. Baseline Scenario 3 represents the estimated full build-out water demands. Results of simulations of the three baseline scenarios indicate that saltwater would intrude into the Cohansey aquifer as much as 7,100 feet (ft) to adversely affect production wells used by Lower Township and the Wildwoods, as well as some other near-shore domestic wells; water-level altitudes in the Atlantic City 800-foot sand would decline to -156 ft; base flow in streams would be depleted by 0 to 26 percent; and water levels in the water-table aquifer would decline as much as 0.7ft. [Specific water-level altitudes, land-surface altitudes, and present sea level when used in this report are referenced to the North American
Stolle, B
2001-02-01
The Internet was supposed to make it possible for anybody anywhere to get anything anytime. Instead, it's magnified suppliers' miscalculations into global shortages. But if the Net caused these supply chain woes, it's also the solution, says the CEO of a supply-chain software manufacturer.
Hartley, H
1999-03-01
A key debate over the nature of professional power centers on the maintenance of physician dominance within the system of professions in health care. The changes in health care delivery and financing brought by managed care present a new context for evaluating the physician dominance thesis. I propose that increases in the supply of certified nurse-midwives, a "contending" health care professional group, are related to the expansion of managed care and may signal a decline in physician dominance. I analyze state-level data compiled from governmental, health professional, and industry sources to determine the influence of managed care market penetration, physician supply, state policy context, and demographic factors on the state-level supply of nurse-midwives. Results indicate that, despite high physician supply, nurse-midwife supply is higher in states with higher managed care penetration, as well as in those with more favorable state policy environments and a more educated demographic base. Outcomes from a series of hypothesis tests support my assertion that the expansion of managed care is altering the jurisdictional boundaries in the system of professions in health care, eroding the dominance of physicians while creating new openings for nurse-midwives.
2017-06-09
USING CIVILIAN SUPPLY CHAIN MANAGEMENT BEST PRACTICES TO IMPROVE ARMY SUPPLY CHAIN MANAGEMENT PROCEDURES A thesis presented to......Army Supply Chain Management Procedures 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Chief Warrant
Creating organizational value by leveraging the multihospital pharmacy enterprise.
Schenkat, Dan; Rough, Steve; Hansen, Amanda; Chen, David; Knoer, Scott
2018-04-01
The results of a survey of multihospital pharmacy leaders are summarized, and a road map for creating organizational value with the pharmacy enterprise is presented. A survey was designed to evaluate the level of integration of pharmacy services across each system's multiple hospitals, determine the most commonly integrated services, determine whether value was quantified when services were integrated, collect common barriers for finding value through integration, and identify strategies for successfully overcoming these barriers. The comprehensive, 59-question survey was distributed electronically in September 2016 to the top pharmacy executive at approximately 160 multihospital systems located throughout the United States. Survey respondents indicated that health systems are taking a wide range of approaches to integrating services systemwide. Several themes emerged from the survey responses: (1) having a system-level pharmacy leader with solid-line reporting across the enterprise increased the likelihood of integrating pharmacy services effectively, (2) integration of pharmacy services across a multihospital system was unlikely to decrease the number of pharmacy full-time equivalents within the enterprise, and (3) significant opportunities exist for creating value for the multihospital health system with the pharmacy enterprise, particularly within 4 core areas: system-level drug formulary and clinical standardization initiatives, supply chain initiatives, electronic health record integration, and specialty and retail pharmacy services. Consistently demonstrating strong organizational leadership, entrepreneurialism, and the ability to create value for the organization will lead to the system-level pharmacy leader and the pharmacy enterprise being well-positioned to achieve positive outcomes for patients, payers, and the broader health system. Copyright © 2018 by the American Society of Health-System Pharmacists, Inc. All rights reserved.
Effectiveness of exterior beam rotation prevention systems for bridge deck construction.
DOT National Transportation Integrated Search
2016-06-01
Bridge decks often overhang past the exterior girders in order to increase the width of the deck while limiting the required : number of longitudinal girders. The overhanging portion of the deck results in unbalanced eccentric loads to the exterior g...
Torsional Analysis of exterior Girders
DOT National Transportation Integrated Search
Exterior girders of KDOT steel girder bridges are loaded with an eccentric load applied by cantilever overhang brackets. These brackets support the concrete overhang and the screed rail for the concrete finishing machine as well as the walkway for th...
Supply chain dynamics in healthcare services.
Samuel, Cherian; Gonapa, Kasiviswanadh; Chaudhary, P K; Mishra, Ananya
2010-01-01
The purpose of this paper is to analyse health service supply chain systems. A great deal of literature is available on supply chain management in finished goods inventory situations; however, little research exists on managing service capacity when finished goods inventories are absent. System dynamics models for a typical service-oriented supply chain such as healthcare processes are developed, wherein three service stages are presented sequentially. Just like supply chains with finished goods inventory, healthcare service supply chains also show dynamic behaviour. Comparing options, service reduction, and capacity adjustment delays showed that reducing capacity adjustment and service delays gives better results. The study is confined to health service-oriented supply chains. Further work includes extending the study to service-oriented supply chains with parallel processing, i.e. having more than one stage to perform a similar operation and also to study the behaviour in service-oriented supply chains that have re-entrant orders and applications. Specific case studies can also be developed to reveal factors relevant to particular service-oriented supply chains. The paper explains the bullwhip effect in healthcare service-oriented supply chains. Reducing stages and capacity adjustment are strategic options for service-oriented supply chains. The paper throws light on policy options for managing healthcare service-oriented supply chain dynamics.
NASA Astrophysics Data System (ADS)
Nickel, D.; Barthel, R.; Schmid, C.; Braun, J.
2003-04-01
The research project GLOWA-Danube, financed by the German Federal Government, investigates long-term changes in the water cycle of the Upper Danube river basin in light of global climatic change. Its concrete aim is to build a fully integrated decision support tool that combines the competence of eleven different institutes in domains covering all major aspects governing the water cycle - from the formation of clouds to groundwater flow patterns to the behaviour of the water consumer. The research group "Water Supply" at the Institute of Hydraulic Engineering (IWS), Universitaet Stuttgart, has the central task of creating an agent-based model of the water supply sector. The Water Supply model will act as a link between the various physical models determining water quality and availability on the one hand and the actors models determining water demand on the other, which together form the tool DANUBIA. Ultimately, with the help of scenario testing, the water supply model will indicate the ability of the water supply system in the Upper Danube catchment to adapt to changing boundary conditions using different management approaches. The specific aim of the Water Supply model is the creation of a model which is not only able to simulate the present day system of water extraction, treatment and distribution but also its development and change with time. As most changes to the system are brought about by decisions made by relevant actors in the field of water management or their behaviour (in response to political and economic boundary conditions, changes in water demand or water quality, advances in technology etc.), the use of agent-based modelling was chosen, whereby an agent is seen as a computer system (in our case representing a human or group of humans) which is aware of its environment, has defined objectives and is able to act independently in order to meet these objectives. Whereas agent-based modelling has received much attention over the past decades, the use
Improving agricultural commodity supply-chain to promote economic activities in rural area
NASA Astrophysics Data System (ADS)
Padjung, R.
2018-05-01
Long supply chain of agricultural commodities has become concern to governments particularly in large countries such as Indonesia as it causes high price disparity between farm-gate and retailer. Policies to overcome such problem are usually by shortening the chain, by which farmers sell the products directly to retailers. Using an action research in AEDEF (Aceh Economic Development Financing Facilities) Program, conducted in the province of Nangro Aceh Darussalam (NAD) Indonesia, the paper shows that shortening the commodity supply chain is not the best solution to such problem, as it causes loss of jobs in the villages. High price disparity between farm-gate and retailer is not necessary brought about by long supply-chain but by the efficiency of the chain instead. Efficiency of the chain can be improved by creating enabling business environment such that every actors and players work in a fair manner. This can be achieved by transparency in price and quality grade. With development achieved in Information and Communication Technology (ICT), having a good and reliable flow of such information is not difficult. In addition to information flow, the availability and quality of infrastructure to support flow of goods from farm-gate to end-user is of reasonably important.
The pathways and outcomes of mycobacterial NHEJ depend on the structure of the broken DNA ends
Aniukwu, Jideofor; Glickman, Michael S.; Shuman, Stewart
2008-01-01
Mycobacteria can repair DNA double-strand breaks (DSBs) via a nonhomologous end-joining (NHEJ) system that includes a dedicated DNA ligase (LigD) and the DNA end-binding protein Ku. Here we exploit an improved plasmid-based NHEJ assay and a collection of Mycobacterium smegmatis strains bearing deletions or mutations in Ku or the DNA ligases to interrogate the contributions of LigD’s three catalytic activities (polymerase, ligase, and 3′ phosphoesterase) and structural domains (POL, LIG, and PE) to the efficiency and molecular outcomes of NHEJ in vivo. By analyzing in parallel the repair of blunt, 5′ overhang, and 3′ overhang DSBs, we discovered a novel end-joining pathway specific to breaks with 3′ overhangs that is Ku- and LigD-independent and perfectly faithful. This 3′ overhang NHEJ pathway is independent of ligases B and C; we surmise that it relies on NAD+-dependent LigA, the essential replicative ligase. We find that efficient repair of blunt and 5′ overhang DSBs depends stringently on Ku and the LigD POL domain, but not on the LigD polymerase activity, which mainly serves to promote NHEJ infidelity. The lack of an effect of PE-inactivating LigD mutations on NHEJ outcomes, especially the balance between deletions and insertions at blunt or 5′ overhang breaks, argues against LigD being the catalyst of deletion formation. Ligase-inactivating LigD mutations (or deletion of the LIG domain) have a modest impact on the efficiency of blunt and 5′ overhang DSB repair, because the strand sealing activity can be provided in trans by one of the other resident ATP-dependent ligases (likely LigC). Reliance on the backup ligase is accompanied by a drastic loss of fidelity during blunt end and 5′ overhang DSB repair. We conclude that the mechanisms of mycobacterial NHEJ are many and the outcomes depend on the initial structures of the DSBs and the available ensemble of end-processing and end-sealing components, which are not limited to Ku and LigD. PMID
NASA Astrophysics Data System (ADS)
Höök, Mikael
2018-03-01
Documenting the emissions and net energy of a crude supply could be essential to meeting national emission and energy security targets. Using data from hundreds of fields worldwide, a well-to-refinery study presents a high-granularity profile of China's crude oil supply in terms of emissions and energy return on input.
Opportunities of energy supply of farm holdings on the basis of small-scale renewable energy sources
NASA Astrophysics Data System (ADS)
Efendiev, A. M.; Nikolaev, Yu. E.; Evstaf'ev, D. P.
2016-02-01
One of the major national economic problems of Russia is raising of agricultural production, which will provide strategic security and sustainable supply of the population with provisions. Creation of subsidiary small holdings, farm holdings, and peasant farm holdings will require addressing issues of energy supply. At considerable distance of small farms from centralized energy systems (by fuel, electricity and thermal energy) it is proposed to create a system of local energy networks on the basis of low-powered power plants using renewable energy sources (RES). There is economic unreasonableness of use of imported components of small power plants. Creation of new combined small power plants on renewable energy sources produced by domestic manufacturers is recommended. Schemes of arrangements of small power plants based on renewable energy sources are proposed, variants and characteristics of a basic source are provided—biogas plants developed by the authors. Calculations revealed that heat and power supply of self-contained farms distant from small power plants based on renewable energy sources is 2.5-2.6 times cheaper than from centralized networks. Production of biogas through anaerobic fermentation of organic waste of cattle complexes is considered as the basis. The analysis of biowaste output in various cattle farms is carried out, and the volume of biogas is determined to meet the requirements of these farms in electrical and thermal energy. The objective of the present article is to study the possibility of creating small combined power plants in Russia based on renewable sources of energy for independent consumers.
Teaching Lean Six Sigma within a Supply Chain Context: The Airplane Supply Chain Simulation
ERIC Educational Resources Information Center
Ellis, Scott C.; Goldsby, Thomas J.; Bailey, Ana M.; Oh, Jae-Young
2014-01-01
Lean six sigma is a management methodology that firms can employ to achieve substantial improvement in supply chain performance. However, few pedagogical exercises facilitate students' use of a comprehensive set of lean six sigma principles within a supply chain context. We describe the Airplane Supply Chain Simulation that helps students…
NASA Astrophysics Data System (ADS)
Kondratjevs, K.; Zabasta, A.; Selmanovs-Pless, V.
2016-02-01
In recent years, there has been significant research focus that revolves around harvesting and minimising energy consumption by wireless sensor network nodes. When a sensor node is depleted of energy, it becomes unresponsive and disconnected from the network that can significantly influence the performance of the whole network. The purpose of the present research is to create a power supply management module in order to provide stable operating voltage for autonomous operations of radio signal repeaters, sensors or gateways of WSN. The developed management module is composed of a solar panel, lithium battery and power supply management module. The novelty of the research is the management module, which ensures stable and uninterrupted operations of electronic equipment in various power supply modes in different situations, simultaneously ensuring energy protection and sustainability of the module components. The management module is able to provide power supply of 5 V for electronics scheme independently, without power interruption switching between power sources and power flows in different directions.
Otañez, Marty
2011-01-01
Background Tobacco companies have come under increased criticism because of environmental and labor practices related to growing tobacco in developing countries. Methods Analysis of tobacco industry documents, industry web sites and interviews with tobacco farmers in Tanzania and tobacco farm workers, farm authorities, trade unionists, government officials and corporate executives from global tobacco leaf companies in Malawi. Results British American Tobacco and Philip Morris created supply chains in the 1990s to improve production efficiency, control, access to markets, and profits. In the 2000s, the companies used their supply chains in an attempt to legitimize their portrayals of tobacco farming as socially and environmentally friendly, rather than take meaningful steps to eliminate child labor and reduce deforestation in developing countries. The tobacco companies used nominal self-evaluation (not truly independent evaluators) and public relations to create the impression of social responsibility. The companies benefit from $1.2 billion in unpaid labor costs due to child labor and more than $64 million annually in costs that would have been made to avoid tobacco related deforestation in the top twelve tobacco growing developing countries, far exceeding the money they spend nominally working to change these practices. Conclusions The tobacco industry uses green supply chains to make tobacco farming in developing countries appear sustainable while continuing to purchase leaf produced with child labor and high rates of deforestation. Strategies to counter green supply chain schemes include securing implementing protocols for the WHO Framework Convention on Tobacco Control to regulate the companies’ practices at the farm level. PMID:21504915
Otañez, Marty; Glantz, Stanton A
2011-11-01
Tobacco companies have come under increased criticism because of environmental and labour practices related to growing tobacco in developing countries. Analysis of tobacco industry documents, industry websites and interviews with tobacco farmers in Tanzania and tobacco farm workers, farm authorities, trade unionists, government officials and corporate executives from global tobacco leaf companies in Malawi. British American Tobacco and Philip Morris created supply chains in the 1990 s to improve production efficiency, control, access to markets and profits. In the 2000s, the companies used their supply chains in an attempt to legitimise their portrayals of tobacco farming as socially and environmentally friendly, rather than take meaningful steps to eliminate child labour and reduce deforestation in developing countries. The tobacco companies used nominal self-evaluation (not truly independent evaluators) and public relations to create the impression of social responsibility. The companies benefit from $1.2 billion in unpaid labour costs because of child labour and more than $64 million annually in costs that would have been made to avoid tobacco-related deforestation in the top 12 tobacco growing developing countries, far exceeding the money they spend nominally working to change these practices. The tobacco industry uses green supply chains to make tobacco farming in developing countries appear sustainable while continuing to purchase leaf produced with child labour and high rates of deforestation. Strategies to counter green supply chain schemes include securing implementing protocols for the WHO Framework Convention on Tobacco Control to regulate the companies' practices at the farm level.
Irrigation, risk aversion, and water right priority under water supply uncertainty
NASA Astrophysics Data System (ADS)
Li, Man; Xu, Wenchao; Rosegrant, Mark W.
2017-09-01
This paper explores the impacts of a water right's allocative priority—as an indicator of farmers' risk-bearing ability—on land irrigation under water supply uncertainty. We develop and use an economic model to simulate farmers' land irrigation decision and associated economic returns in eastern Idaho. Results indicate that the optimal acreage of land irrigated increases with water right priority when hydroclimate risk exhibits a negatively skewed or right-truncated distribution. Simulation results suggest that prior appropriation enables senior water rights holders to allocate a higher proportion of their land to irrigation, 6 times as much as junior rights holders do, creating a gap in the annual expected net revenue reaching up to 141.4 acre-1 or 55,800 per farm between the two groups. The optimal irrigated acreage, expected net revenue, and shadow value of a water right's priority are subject to substantial changes under a changing climate in the future, where temporal variation in water supply risks significantly affects the profitability of agricultural land use under the priority-based water sharing mechanism.
Irrigation, risk aversion, and water right priority under water supply uncertainty.
Li, Man; Xu, Wenchao; Rosegrant, Mark W
2017-09-01
This paper explores the impacts of a water right's allocative priority-as an indicator of farmers' risk-bearing ability-on land irrigation under water supply uncertainty. We develop and use an economic model to simulate farmers' land irrigation decision and associated economic returns in eastern Idaho. Results indicate that the optimal acreage of land irrigated increases with water right priority when hydroclimate risk exhibits a negatively skewed or right-truncated distribution. Simulation results suggest that prior appropriation enables senior water rights holders to allocate a higher proportion of their land to irrigation, 6 times as much as junior rights holders do, creating a gap in the annual expected net revenue reaching up to $141.4 acre -1 or $55,800 per farm between the two groups. The optimal irrigated acreage, expected net revenue, and shadow value of a water right's priority are subject to substantial changes under a changing climate in the future, where temporal variation in water supply risks significantly affects the profitability of agricultural land use under the priority-based water sharing mechanism.
Irrigation, risk aversion, and water right priority under water supply uncertainty
Xu, Wenchao; Rosegrant, Mark W.
2017-01-01
Abstract This paper explores the impacts of a water right's allocative priority—as an indicator of farmers' risk‐bearing ability—on land irrigation under water supply uncertainty. We develop and use an economic model to simulate farmers' land irrigation decision and associated economic returns in eastern Idaho. Results indicate that the optimal acreage of land irrigated increases with water right priority when hydroclimate risk exhibits a negatively skewed or right‐truncated distribution. Simulation results suggest that prior appropriation enables senior water rights holders to allocate a higher proportion of their land to irrigation, 6 times as much as junior rights holders do, creating a gap in the annual expected net revenue reaching up to $141.4 acre−1 or $55,800 per farm between the two groups. The optimal irrigated acreage, expected net revenue, and shadow value of a water right's priority are subject to substantial changes under a changing climate in the future, where temporal variation in water supply risks significantly affects the profitability of agricultural land use under the priority‐based water sharing mechanism. PMID:29200529
Food supply mechanisms for cold-water corals along a continental shelf edge
NASA Astrophysics Data System (ADS)
Thiem, Øyvind; Ravagnan, Elisa; Fosså, Jan Helge; Berntsen, Jarle
2006-05-01
In recent years it has been documented that deep-water coral reefs of the species Lophelia pertusa are a major benthic habitat in Norwegian waters. However, basic information about the biology and ecology of this species is still unknown. Lophelia live and thrive under special environmental conditions of which factors such as temperature, water depth, water movement and food supply are important. The present work explores the hypothesis that Lophelia forms reefs in places where the encounter rate of food particles is sufficiently high and stable over long periods of time for continuous growth. This is done by relating the distribution of reefs with the results of numerical ocean modelling. Numerical simulations have been performed with an idealized bottom topography similar to what is found outside parts of the Norwegian coast. In the simulations the model is first forced with an along slope jet and then with an idealized atmospheric low pressure. The model results show that the encounter rates between the particles and the water layer near the seabed are particularly high close to the shelf break. This may indicate that many Lophelia reefs are located along the shelf edges because the supply of food is particularly good in these areas. A sensitivity study of the particle supply in the area close to the seabed for increasing latitude has also been done. This shows that the Ekman transport in the benthic layer tends to create a steady supply of food for benthic organisms near the shelf edge away from the equator.
Developing sustainable food supply chains.
Smith, B Gail
2008-02-27
This paper reviews the opportunities available for food businesses to encourage consumers to eat healthier and more nutritious diets, to invest in more sustainable manufacturing and distribution systems and to develop procurement systems based on more sustainable forms of agriculture. The important factors in developing more sustainable supply chains are identified as the type of supply chain involved and the individual business attitude to extending responsibility for product quality into social and environmental performance within their own supply chains. Interpersonal trust and working to standards are both important to build more sustainable local and many conserved food supply chains, but inadequate to transform mainstream agriculture and raw material supplies to the manufactured and commodity food markets. Cooperation among food manufacturers, retailers, NGOs, governmental and farmers' organizations is vital in order to raise standards for some supply chains and to enable farmers to adopt more sustainable agricultural practices.
Developing Tailored Supply Strategies
2007-01-01
David J . Closs, and M. Bixby Cooper, Supply Chain Logistics Management, New York: McGraw-Hill, 2002. Burt, David N., and Richard L. Pinkerton, A ...Supply Chain Management, Vol. 37, No. 2, Spring 2001, pp. 8–15. Bibliography 119 Coyle, John J ., Edward J . Bardi , and C. John Langley Jr., The...Gelderman, Cees J ., and Arjan J . van Weele, “Strategic Direction Through Purchasing Portfolio Management: A Case Study,” The Journal of Supply Chain
Adaptive significance of avian beak morphology for ectoparasite control
Clayton, Dale H; Moyer, Brett R; Bush, Sarah E; Jones, Tony G; Gardiner, David W; Rhodes, Barry B; Goller, Franz
2005-01-01
The beaks of Darwin's finches and other birds are among the best known examples of adaptive evolution. Beak morphology is usually interpreted in relation to its critical role in feeding. However, the beak also plays an important role in preening, which is the first line of defence against harmful ectoparasites such as feather lice, fleas, bugs, flies, ticks and feather mites. Here, we show a feature of the beak specifically adapted for ectoparasite control. Experimental trimming of the tiny (1–2 mm) maxillary overhang of rock pigeons (Columba livia) had no effect on feeding efficiency, yet triggered a dramatic increase in feather lice and the feather damage they cause. The overhang functions by generating a shearing force against the tip of the lower mandible, which moves forward remarkably quickly during preening, at up to 31 times per second. This force damages parasite exoskeletons, significantly enhancing the efficiency of preening for parasite control. Overhangs longer than the natural mean of 1.6 mm break significantly more often than short overhangs. Hence, stabilizing selection will favour overhangs of intermediate length. The adaptive radiation of beak morphology should be re-assessed with both feeding and preening in mind. PMID:15888414
The Anaesthesia Gas Supply System
Das, Sabyasachi; Chattopadhyay, Subhrajyoti; Bose, Payel
2013-01-01
The anaesthesia gas supply system is designed to provide a safe, cost-effective and convenient system for the delivery of medical gases at the point of-use. The doctrine of the anaesthesia gas supply system is based on four essential principles: Identity, continuity, adequacy and quality. Knowledge about gas supply system is an integral component of safe anaesthetic practice. Mishaps involving the malfunction or misuse of medical gas supply to operating theatres have cost many lives. The medical gases used in anaesthesia and intensive care are oxygen, nitrous oxide, medical air, entonox, carbon dioxide and heliox. Oxygen is one of the most widely used gases for life-support and respiratory therapy besides anaesthetic procedures. In this article, an effort is made to describe the production, storage and delivery of anaesthetic gases. The design of anaesthesia equipment must take into account the local conditions such as climate, demand and power supply. The operational policy of the gas supply system should have a backup plan to cater to the emergency need of the hospital, in the event of the loss of the primary source of supply. PMID:24249882
Schoellhamer, David H.; Wright, Scott A.; Drexler, Judith Z.
2013-01-01
The general progression of human land use is an initial disturbance (e.g., deforestation, mining, agricultural expansion, overgrazing, and urbanization) that creates a sediment pulse to an estuary followed by dams that reduce sediment supply. We present a conceptual model of the effects of increasing followed by decreasing sediment supply that includes four sequential regimes, which propagate downstream: a stationary natural regime, transient increasing sediment supply, transient decreasing sediment supply, and a stationary altered regime. The model features characteristic lines that separate the four regimes. Previous studies of the San Francisco Estuary and watershed are synthesized in the context of this conceptual model. Hydraulic mining for gold in the watershed increased sediment supply to the estuary in the late 1800s. Adjustment to decreasing sediment supply began in the watershed and upper estuary around 1900 and in the lower estuary in the 1950s. Large freshwater flow in the late 1990s caused a step adjustment throughout the estuary and watershed. It is likely that the estuary and watershed are still capable of adjusting but further adjustment will be as steps that occur only during greater floods than previously experienced during the adjustment period. Humans are actively managing the system to try to prevent greater floods. If this hypothesis of step changes occurring for larger flows is true, then the return interval of step changes will increase or, if humans successfully control floods in perpetuity, there will be no more step changes.
Architecture Study for a Fuel Depot Supplied from Lunar Assets
NASA Technical Reports Server (NTRS)
Perrin, Thomas M.; Casler, James G.
2016-01-01
This architecture study sought to determine the optimum architecture for a fuel depot supplied from lunar assets. Four factors - the location of propellant processing (on the Moon or on the depot), the depot location (on the Moon, L1, GEO, or LEO), the propellant transfer location (L1, GEO, or LEO), and the propellant transfer method (bulk fuel or canister exchange) were combined to identify 18 candidate architectures. Two design reference missions (DRMs) - a commercial satellite servicing mission and a Government cargo mission to Mars - created demand for propellants, while a propellant delivery DRM examined supply issues. The study concluded Earth-Moon L1 is the best location for an orbiting depot. For all architectures, propellant boiloff was less than anticipated, and was far overshadowed by delta-v requirements and resulting fuel consumption. Bulk transfer is the most flexible for both the supplier and customer. However, since canister exchange bypasses the transfer of bulk cryogens and necessary chilldown losses, canister exchange shows promise and merits further investigation. Overall, this work indicates propellant consumption and loss is an essential factor in assessing fuel depot architectures.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 1 2011-07-01 2011-07-01 false Supplies. 31.33 Section 31.33 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER FEDERAL ASSISTANCE UNIFORM... Requirements Changes, Property, and Subawards § 31.33 Supplies. (a) Title. Title to supplies acquired under a...
Code of Federal Regulations, 2010 CFR
2010-01-01
... 10 Energy 4 2010-01-01 2010-01-01 false Supplies. 603.1330 Section 603.1330 Energy DEPARTMENT OF ENERGY (CONTINUED) ASSISTANCE REGULATIONS TECHNOLOGY INVESTMENT AGREEMENTS Definitions of Terms Used in this Part § 603.1330 Supplies. Tangible property other than real property and equipment. Supplies have...
NASA Astrophysics Data System (ADS)
Orlov, A. M.; Yavtushenko, I. O.; Bodnarskii, D. S.
2013-03-01
The variation of the pressure of a gas phase activated by spark discharges between an aqueous electrolyte solution (liquid cathode) and a metallic electrode (anode) hanging over the solution is studied. A mathematical model of the proceeding reaction kinetics is constructed, and the variation of the partial pressures of all initial and produced components in the gas phase is calculated. Both the Faraday and non-Faraday mechanisms of gas component production from water are confirmed. It is found that a large overhanging drop responsible for additional supply of simultaneously produced H2 and O2 molecules forms rapidly at the end face of the anodically polarized electrode.
When should governments increase the supply of psychiatric beds?
Allison, S; Bastiampillai, T; Licinio, J; Fuller, D A; Bidargaddi, N; Sharfstein, S S
2018-04-01
Low numbers of hospital-based psychiatric beds create problems for people with severe mental illness (SMI), when they face extended emergency department (ED) waits, higher thresholds for admission to an acute bed, and short revolving-door stays with high rates of rehospitalisation. Limited access to inpatient treatment has been associated with higher suicide risk, premature mortality, homelessness, violent crime and incarceration. Ultimately, people with SMI can be transinstitutionalised to the criminal justice system. In the USA, for example, prisons have replaced mental hospitals as the largest institutions housing people with SMI. There is no international consensus on the safe minimum numbers of acute, forensic and rehabilitation beds needed to reduce these risks. As a consequence, Organisation for Economic Cooperation and Development (OECD) countries have wide variations in the mix of hospital beds with an average of 71 beds per 100 000 population. Policymakers face difficult choices with few studies to guide decisions on supplying beds. The UK Royal College of Psychiatrists offered a policy framework, which was adapted for Australia. The government of the State of South Australia increased the supplies of crisis, acute and forensic beds to meet a mandatory target to safely reduce mental health boarding in the EDs.
Code of Federal Regulations, 2010 CFR
2010-07-01
... REHABILITATION AND EDUCATION Temporary Program of Vocational Training for Certain New Pension Recipients Supplies...: 38 U.S.C. 1524(b)(2)) (b) Definition. The term supplies includes books, tools and other supplies and... discontinued from an independent living services program. (Authority: 38 U.S.C. 1524(b)(2)) Medical and Related...
Code of Federal Regulations, 2011 CFR
2011-07-01
... REHABILITATION AND EDUCATION Temporary Program of Vocational Training for Certain New Pension Recipients Supplies...: 38 U.S.C. 1524(b)(2)) (b) Definition. The term supplies includes books, tools and other supplies and... discontinued from an independent living services program. (Authority: 38 U.S.C. 1524(b)(2)) Medical and Related...
Code of Federal Regulations, 2010 CFR
2010-04-01
... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Supplies. 85.33 Section 85.33... TRIBAL GOVERNMENTS Post-Award Requirements Changes, Property, and Subawards § 85.33 Supplies. (a) Title. Title to supplies acquired under a grant or subgrant will vest, upon acquisition, in the grantee or...
Code of Federal Regulations, 2010 CFR
2010-10-01
... 45 Public Welfare 3 2010-10-01 2010-10-01 false Supplies. 1157.33 Section 1157.33 Public Welfare... AND LOCAL GOVERNMENTS Post-Award Requirements Changes, Property, and Subawards § 1157.33 Supplies. (a) Title. Title to supplies acquired under a grant or subgrant will vest, upon acquisition, in the grantee...
Code of Federal Regulations, 2010 CFR
2010-01-01
... aggregate fair market value upon termination or completion of the award, and if the supplies are not needed... 7 Agriculture 15 2010-01-01 2010-01-01 false Supplies. 3016.33 Section 3016.33 Agriculture... GOVERNMENTS Post-Award Requirements Changes, Property, and Subawards § 3016.33 Supplies. (a) Title. Title to...
Code of Federal Regulations, 2010 CFR
2010-10-01
... 45 Public Welfare 3 2010-10-01 2010-10-01 false Supplies. 1174.33 Section 1174.33 Public Welfare... STATE AND LOCAL GOVERNMENTS Post-Award Requirements Changes, Property, and Subawards § 1174.33 Supplies. (a) Title. Title to supplies acquired under a grant or subgrant will vest, upon acquisition, in the...
Windisch, Ricarda; Waiswa, Peter; Neuhann, Florian; Scheibe, Florian; de Savigny, Don
2011-08-01
Strengthened national health systems are necessary for effective and sustained expansion of antiretroviral therapy (ART). ART and its supply chain management in Uganda are largely based on parallel and externally supported efforts. The question arises whether systems are being strengthened to sustain access to ART. This study applies systems thinking to assess supply chain management, the role of external support and whether investments create the needed synergies to strengthen health systems. This study uses the WHO health systems framework and examines the issues of governance, financing, information, human resources and service delivery in relation to supply chain management of medicines and the technologies. It looks at links and causal chains between supply chain management for ART and the national supply system for essential drugs. It combines data from the literature and key informant interviews with observations at health service delivery level in a study district. Current drug supply chain management in Uganda is characterized by parallel processes and information systems that result in poor quality and inefficiencies. Less than expected health system performance, stock outs and other shortages affect ART and primary care in general. Poor performance of supply chain management is amplified by weak conditions at all levels of the health system, including the areas of financing, governance, human resources and information. Governance issues include the lack to follow up initial policy intentions and a focus on narrow, short-term approaches. The opportunity and need to use ART investments for an essential supply chain management and strengthened health system has not been exploited. By applying a systems perspective this work indicates the seriousness of missing system prerequisites. The findings suggest that root causes and capacities across the system have to be addressed synergistically to enable systems that can match and accommodate investments in
2011-01-01
Background Strengthened national health systems are necessary for effective and sustained expansion of antiretroviral therapy (ART). ART and its supply chain management in Uganda are largely based on parallel and externally supported efforts. The question arises whether systems are being strengthened to sustain access to ART. This study applies systems thinking to assess supply chain management, the role of external support and whether investments create the needed synergies to strengthen health systems. Methods This study uses the WHO health systems framework and examines the issues of governance, financing, information, human resources and service delivery in relation to supply chain management of medicines and the technologies. It looks at links and causal chains between supply chain management for ART and the national supply system for essential drugs. It combines data from the literature and key informant interviews with observations at health service delivery level in a study district. Results Current drug supply chain management in Uganda is characterized by parallel processes and information systems that result in poor quality and inefficiencies. Less than expected health system performance, stock outs and other shortages affect ART and primary care in general. Poor performance of supply chain management is amplified by weak conditions at all levels of the health system, including the areas of financing, governance, human resources and information. Governance issues include the lack to follow up initial policy intentions and a focus on narrow, short-term approaches. Conclusion The opportunity and need to use ART investments for an essential supply chain management and strengthened health system has not been exploited. By applying a systems perspective this work indicates the seriousness of missing system prerequisites. The findings suggest that root causes and capacities across the system have to be addressed synergistically to enable systems that can match
NASA Astrophysics Data System (ADS)
Brown, Casey; Carriquiry, Miguel
2007-11-01
This paper explores the performance of a system of economic instruments designed to facilitate the reduction of hydroclimatologic variability-induced impacts on stakeholders of shared water supply. The system is composed of bulk water option contracts between urban water suppliers and agricultural users and insurance indexed on reservoir inflows. The insurance is designed to cover the financial needs of the water supplier in situations where the option is likely to be exercised. Insurance provides the irregularly needed funds for exercising the water options. The combined option contract - reservoir index insurance system creates risk sharing between sectors that is currently lacking in many shared water situations. Contracts are designed for a shared agriculture - urban water system in Metro Manila, Philippines, using optimization and Monte Carlo analysis. Observed reservoir inflows are used to simulate contract performance. Results indicate the option - insurance design effectively smooths water supply costs of hydrologic variability for both agriculture and urban water.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 32 National Defense 1 2010-07-01 2010-07-01 false Supplies. 37.1365 Section 37.1365 National... TECHNOLOGY INVESTMENT AGREEMENTS Definitions of Terms Used in This Part § 37.1365 Supplies. Tangible property other than real property and equipment. Supplies have a useful life of less than one year or an...
Code of Federal Regulations, 2010 CFR
2010-10-01
... aggregate fair market value upon termination or completion of the award, and if the supplies are not needed... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Supplies. 13.33 Section 13.33... GOVERNMENTS Post-Award Requirements Changes, Property, and Subawards § 13.33 Supplies. (a) Title. Title to...
Code of Federal Regulations, 2010 CFR
2010-07-01
... is a residual inventory of unused supplies exceeding $5,000 in total aggregate fair market value upon... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Supplies. 66.33 Section 66.33 Judicial... Supplies. (a) The Omnibus Crime Control and Safe Streets Act of 1968, as amended, Public Law 90-351...
10 CFR 215.3 - Supply reports.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 10 Energy 3 2010-01-01 2010-01-01 false Supply reports. 215.3 Section 215.3 Energy DEPARTMENT OF ENERGY OIL COLLECTION OF FOREIGN OIL SUPPLY AGREEMENT INFORMATION § 215.3 Supply reports. (a) Any person... oil for the period specified in the agreement, pursuant to supply arrangements with the host...
Code of Federal Regulations, 2010 CFR
2010-07-01
... aggregate fair market value upon termination or completion of the award, and if the supplies are not needed... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Supplies. 105-71.133...-Award Requirements/Changes, Property, and Subawards § 105-71.133 Supplies. (a) Title. Title to supplies...
Code of Federal Regulations, 2010 CFR
2010-10-01
... aggregate fair market value upon termination or completion of the award, and if the supplies are not needed... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Supplies. 12.73 Section 12.73 Public Lands... State and Local Governments Changes, Property, and Subawards § 12.73 Supplies. (a) Title. Title to...
Code of Federal Regulations, 2010 CFR
2010-07-01
... aggregate fair market value upon termination or completion of the award, and if the supplies are not needed... 29 Labor 1 2010-07-01 2010-07-01 true Supplies. 97.33 Section 97.33 Labor Office of the Secretary... GOVERNMENTS Post-Award Requirements Changes, Property, and Subawards § 97.33 Supplies. (a) Title. Title to...
46 CFR 108.467 - Water supply.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 46 Shipping 4 2011-10-01 2011-10-01 false Water supply. 108.467 Section 108.467 Shipping COAST... Fire Extinguishing Systems Foam Extinguishing Systems § 108.467 Water supply. The water supply of a foam extinguishing system must not be the water supply of the fire main system on the unit unless when...
46 CFR 108.467 - Water supply.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 46 Shipping 4 2010-10-01 2010-10-01 false Water supply. 108.467 Section 108.467 Shipping COAST... Fire Extinguishing Systems Foam Extinguishing Systems § 108.467 Water supply. The water supply of a foam extinguishing system must not be the water supply of the fire main system on the unit unless when...
10 CFR 218.11 - Supply orders.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 10 Energy 3 2010-01-01 2010-01-01 false Supply orders. 218.11 Section 218.11 Energy DEPARTMENT OF ENERGY OIL STANDBY MANDATORY INTERNATIONAL OIL ALLOCATION Supply Orders § 218.11 Supply orders. (a) A supply order shall require that the firm to which it is issued take actions specified therein relating to...
46 CFR 108.467 - Water supply.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 46 Shipping 4 2013-10-01 2013-10-01 false Water supply. 108.467 Section 108.467 Shipping COAST... Fire Extinguishing Systems Foam Extinguishing Systems § 108.467 Water supply. The water supply of a foam extinguishing system must not be the water supply of the fire main system on the unit unless when...
46 CFR 108.467 - Water supply.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 46 Shipping 4 2014-10-01 2014-10-01 false Water supply. 108.467 Section 108.467 Shipping COAST... Fire Extinguishing Systems Foam Extinguishing Systems § 108.467 Water supply. The water supply of a foam extinguishing system must not be the water supply of the fire main system on the unit unless when...
46 CFR 108.467 - Water supply.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 46 Shipping 4 2012-10-01 2012-10-01 false Water supply. 108.467 Section 108.467 Shipping COAST... Fire Extinguishing Systems Foam Extinguishing Systems § 108.467 Water supply. The water supply of a foam extinguishing system must not be the water supply of the fire main system on the unit unless when...
NASA Astrophysics Data System (ADS)
Chikozho, C.; Kujinga, K.
2017-08-01
Decision makers in developing countries are often confronted by difficult choices regarding the selection and deployment of appropriate water supply governance regimes that sufficiently take into account national socio-economic and political realities. Indeed, scholars and practitioners alike continue to grapple with the need to create the optimum water supply and allocation decision-making space applicable to specific developing countries. In this paper, we review documented case studies from various parts of the world to explore the utility of free-market economics approaches in water supply governance. This is one of the major paradigms that have emerged in the face of enduring questions regarding how best to govern water supply systems in developing countries. In the paper, we postulate that increasing pressure on available natural resources may have already rendered obsolete some of the water supply governance regimes that have served human societies very well for many decades. Our main findings show that national and municipal water supply governance paradigms tend to change in tandem with emerging national development frameworks and priorities. While many developing countries have adopted water management and governance policy prescriptions from the international arena, national and local socio-economic and political realities ultimately determine what works and what does not work on the ground. We thus, conclude that the choice of what constitutes an appropriate water supply governance regime in context is never simple. Indeed, the majority of case studies reviewed in the paper tend to rely on a mix of market economics and developmental statism to make their water governance regimes more realistic and workable on the ground.
Braund, Rhiannon; Ratnayake, Kaushalya; Tong, Katie; Song, Jackie; Chai, Stephen; Gauld, Natalie
2018-06-01
Background In 2014, New Zealand reclassified sildenafil (for erectile dysfunction) to allow supply by specially trained pharmacists under strict criteria. Objective The study aimed to determine pharmacists' experiences and perspectives on the training for, and supply of sildenafil under this model. Setting New Zealand community pharmacy. Method This qualitative study captured data with a semi-structured interview used with purposively-sampled participants. A maximum variation sample was used to select a wide range of pharmacists working in various pharmacies, including pharmacists who were trained to provide sildenafil and those not trained to supply sildenafil. Consenting pharmacists were interviewed, with interviews audio-recorded and transcribed. Analysis used a framework approach. Main outcome measures Topics explored included: satisfaction and experience of the training; suitability and usability of the screening tools; experiences of the supply process and why some pharmacists chose not to become trained. Results Thirty-five pharmacists were interviewed. Training was seen as uncomplicated and the screening tools provided confidence that key consultation areas were covered. Most consultations reportedly took 15-20 min, some up to 60 min. Pharmacists reported being comfortable with the consultations. Many men requesting supply fell outside of the parameters, resulting in medical referral. This new model of supply was seen as a positive for pharmacists and their patients. Unaccredited pharmacists reported a perceived lack of interest from men, or ability to provide the service as reasons for not seeking accreditation. Conclusion New Zealand's model of pharmacist supply of sildenafil appears workable with some areas for improvement identified.
HYDRA: A Middleware-Oriented Integrated Architecture for e-Procurement in Supply Chains
NASA Astrophysics Data System (ADS)
Alor-Hernandez, Giner; Aguilar-Lasserre, Alberto; Juarez-Martinez, Ulises; Posada-Gomez, Ruben; Cortes-Robles, Guillermo; Garcia-Martinez, Mario Alberto; Gomez-Berbis, Juan Miguel; Rodriguez-Gonzalez, Alejandro
The Service-Oriented Architecture (SOA) development paradigm has emerged to improve the critical issues of creating, modifying and extending solutions for business processes integration, incorporating process automation and automated exchange of information between organizations. Web services technology follows the SOA's principles for developing and deploying applications. Besides, Web services are considered as the platform for SOA, for both intra- and inter-enterprise communication. However, an SOA does not incorporate information about occurring events into business processes, which are the main features of supply chain management. These events and information delivery are addressed in an Event-Driven Architecture (EDA). Taking this into account, we propose a middleware-oriented integrated architecture that offers a brokering service for the procurement of products in a Supply Chain Management (SCM) scenario. As salient contributions, our system provides a hybrid architecture combining features of both SOA and EDA and a set of mechanisms for business processes pattern management, monitoring based on UML sequence diagrams, Web services-based management, event publish/subscription and reliable messaging service.
Flexibility evaluation of multiechelon supply chains.
Almeida, João Flávio de Freitas; Conceição, Samuel Vieira; Pinto, Luiz Ricardo; de Camargo, Ricardo Saraiva; Júnior, Gilberto de Miranda
2018-01-01
Multiechelon supply chains are complex logistics systems that require flexibility and coordination at a tactical level to cope with environmental uncertainties in an efficient and effective manner. To cope with these challenges, mathematical programming models are developed to evaluate supply chain flexibility. However, under uncertainty, supply chain models become complex and the scope of flexibility analysis is generally reduced. This paper presents a unified approach that can evaluate the flexibility of a four-echelon supply chain via a robust stochastic programming model. The model simultaneously considers the plans of multiple business divisions such as marketing, logistics, manufacturing, and procurement, whose goals are often conflicting. A numerical example with deterministic parameters is presented to introduce the analysis, and then, the model stochastic parameters are considered to evaluate flexibility. The results of the analysis on supply, manufacturing, and distribution flexibility are presented. Tradeoff analysis of demand variability and service levels is also carried out. The proposed approach facilitates the adoption of different management styles, thus improving supply chain resilience. The model can be extended to contexts pertaining to supply chain disruptions; for example, the model can be used to explore operation strategies when subtle events disrupt supply, manufacturing, or distribution.
Simple constant-current-regulated power supply
NASA Technical Reports Server (NTRS)
Priebe, D. H. E.; Sturman, J. C.
1977-01-01
Supply incorporates soft-start circuit that slowly ramps current up to set point at turn-on. Supply consists of full-wave rectifier, regulating pass transistor, current feedback circuit, and quad single-supply operational-amplifier circuit providing control. Technique is applicable to any system requiring constant dc current, such as vacuum tube equipment, heaters, or battery charges; it has been used to supply constant current for instrument calibration.
Kasonde, Musonda; Steele, Pamela
2017-04-19
Human resources is the backbone of any system and the key enabler for all other functions to effectively perform. This is no different with the Immunization Supply Chain, more so in todays' complex operating environment with the increasing strain caused by new vaccines and expanding immunization programmes (Source: WHO, UNICEF). In order to drive the change that is required for sustainability and continuous improvement, every immunization supply chain needs an effective leader. A dedicated and competent immunization supply chain leader with adequate numbers of skilled, accountable, motivated and empowered personnel at all levels of the health system to overcome existing and emerging immunization supply chain (ISC) challenges. Without an effective supply chain leader supported by capable and motivated staff, none of the interventions designed to strengthen the supply chain can be effective or sustainable (Source: Gavi Alliance SC Strategy 2014). This landscape analysis was preceded by an HR Evidence Review (March 2014) and has served to inform global partner strategies and country activities, as well as highlight where most support is required. The study also aimed to define the status quo in order to create some form of baseline against which to measure the impact of interventions related to HR going forward. The analysis was comprised of a comprehensive desk review, a survey of 40 respondents from 32 countries and consultations with ISC practitioners in several forums. The findings highlight key areas that should inform the pillars of a HR capacity development plan. At the same time, it revealed that there are some positive examples of where countries are actively addressing some of the issues identified and putting in place mechanisms and structures to optimize the SC function. Copyright © 2017. Published by Elsevier Ltd.
Cycling capacity recovery effect: A coulombic efficiency and post-mortem study
NASA Astrophysics Data System (ADS)
Wilhelm, Jörn; Seidlmayer, Stefan; Keil, Peter; Schuster, Jörg; Kriele, Armin; Gilles, Ralph; Jossen, Andreas
2017-10-01
The analysis of lithium-ion battery aging relies on correct differentiation between irreversible and reversible capacity changes. Anode overhang regions have been observed to influence Coulombic Efficiency (CE) measurements through lithium diffusion into and out of these areas, complicating precise capacity determination. This work presents an analysis of the extent of graphite anode overhang lithiation after calendar storage by means of local X-ray diffraction (XRD), CE measurements, and color change analysis. We found LiC12 lithiation of the anode overhang area after 20 month storage at 40 °C at high state of charge (SoC) and partial lithiation (LiC18) at medium SoC storage at 40 °C and 25 °C. Graphite color changes in the overhang areas are observed and consistent with the state of lithiation measured by XRD. Coulombic efficiencies greater than unity and increasing capacity during 1200 h of cycling are detected for high SoC storage cells. The capacity difference between high and low storage SoC batteries decreases by up to 40 mAh (3.6% of nominal capacity) after cycling compared to tests directly after storage. Consequently, the size of the anode overhang areas as well as the battery storage temperature and duration need to be considered in CE analysis and state of health assessment.
Shock-activated electrochemical power supplies
Benedick, William B.; Graham, Robert A.; Morosin, Bruno
1988-01-01
A shock-activated electrochemical power supply is provided which is initiated extremely rapidly and which has a long shelf life. Electrochemical power supplies of this invention are initiated much faster than conventional thermal batteries. Power supplies of this invention comprise an inactive electrolyte and means for generating a high-pressure shock wave such that the shock wave is propagated through the electrolytes rendering the electrolyte electrochemically active.
Professor Created On-line Biology Laboratory Course
NASA Technical Reports Server (NTRS)
Bowman, Arthur W.
2010-01-01
This paper will share the creation, implementation, and modification of an online college level general biology laboratory course offered for non-science majors as a part of a General Education Curriculum. The ability of professors to develop quality online laboratories will address a growing need in Higher Education as more institutions combine course sections and look for suitable alternative course delivery formats due to declining departmental budgets requiring reductions in staffing, equipment, and supplies. Also, there is an equal or greater need for more professors to develop the ability to create online laboratory experiences because many of the currently available online laboratory course packages from publishers do not always adequately parallel on-campus laboratory courses, or are not as aligned with the companion lecture sections. From a variety of scientific simulation and animation web sites, professors can easily identify material that closely fit the specific needs of their courses, instructional environment, and students that they serve. All too often, on-campus laboratory courses in the sciences provide what are termed confirmation experiences that do NOT allow students to experience science as would be carried out by scientists. Creatively developed online laboratory experiences can often provide the type of authentic investigative experiences that are not possible on-campus due to the time constraints of a typical two-hour, once-per-week-meeting laboratory course. In addition, online laboratory courses can address issues related to the need for students to more easily complete missing laboratory assignments, and to have opportunities to extend introductory exercises into more advanced undertakings where a greater sense of scientific discovery can be experienced. Professors are strongly encourages to begin creating online laboratory exercises for their courses, and to consider issues regarding assessment, copyrights, and Intellectual Property
Supply Chain Interoperability Measurement
2015-06-19
Supply Chain Interoperability Measurement DISSERTATION June 2015 Christos E. Chalyvidis, Major, Hellenic Air...ENS-DS-15-J-001 SUPPLY CHAIN INTEROPERABILITY MEASUREMENT DISSERTATION Presented to the Faculty Department of Operational Sciences...INTEROPERABILITY MEASUREMENT Christos E. Chalyvidis, BS, MSc. Major, Hellenic Air Force Committee Membership: Dr. A.W. Johnson Chair
Flexibility evaluation of multiechelon supply chains
Conceição, Samuel Vieira; Pinto, Luiz Ricardo; de Camargo, Ricardo Saraiva; Júnior, Gilberto de Miranda
2018-01-01
Multiechelon supply chains are complex logistics systems that require flexibility and coordination at a tactical level to cope with environmental uncertainties in an efficient and effective manner. To cope with these challenges, mathematical programming models are developed to evaluate supply chain flexibility. However, under uncertainty, supply chain models become complex and the scope of flexibility analysis is generally reduced. This paper presents a unified approach that can evaluate the flexibility of a four-echelon supply chain via a robust stochastic programming model. The model simultaneously considers the plans of multiple business divisions such as marketing, logistics, manufacturing, and procurement, whose goals are often conflicting. A numerical example with deterministic parameters is presented to introduce the analysis, and then, the model stochastic parameters are considered to evaluate flexibility. The results of the analysis on supply, manufacturing, and distribution flexibility are presented. Tradeoff analysis of demand variability and service levels is also carried out. The proposed approach facilitates the adoption of different management styles, thus improving supply chain resilience. The model can be extended to contexts pertaining to supply chain disruptions; for example, the model can be used to explore operation strategies when subtle events disrupt supply, manufacturing, or distribution. PMID:29584755
Shock-activated electrochemical power supplies
Benedick, W.B.; Graham, R.A.; Morosin, B.
1988-11-08
A shock-activated electrochemical power supply is provided which is initiated extremely rapidly and which has a long shelf life. Electrochemical power supplies of this invention are initiated much faster than conventional thermal batteries. Power supplies of this invention comprise an inactive electrolyte and means for generating a high-pressure shock wave such that the shock wave is propagated through the electrolytes rendering the electrolyte electrochemically active. 2 figs.
Cultures of Death and Politics of Corpse Supply
Buklijas, Tatjana
2008-01-01
Summary Nineteenth-century Vienna is well known to medical historians as a leading centre of medical research and education, offering easy access to patients and corpses to students from all over the world. This article seeks to explain how this enviable supply with cadavers was achieved, why it provoked so little opposition at a time when Britain and the United States saw widespread protests against dissection, and how it was threatened from mid-century. To understand permissive Viennese attitudes we need to place them in a longue durée history of death and dissection, and to pay close attention to the city’s political geography as it was transformed into a major imperial capital. The tolerant stance of the Roman Catholic Church, strong links to Southern Europe and the weak position of individuals in the absolutist state all contributed to an idiosyncratic anatomical culture. But as the fame of the Vienna medical school peaked in the later 1800s, the increased demand created by rising student numbers combined with intensified interdisciplinary competition to produce a shortfall that professors found increasingly difficult to meet. Around 1900, new religious groups and mass political parties challenged the long-standing anatomical practice by refusing to supply cadavers and making dissection into an instrument of political struggle. This study of the material preconditions for anatomy at one of Europe’s most influential medical schools provides a contrast to the dominant Anglo-American histories of death and dissection. PMID:18791297
Hold-up power supply for flash memory
NASA Technical Reports Server (NTRS)
Ott, William E. (Inventor)
2004-01-01
A hold-up power supply for flash memory systems is provided. The hold-up power supply provides the flash memory with the power needed to temporarily operate when a power loss exists. This allows the flash memory system to complete any erasures and writes, and thus allows it to shut down gracefully. The hold-up power supply detects when a power loss on a power supply bus is occurring and supplies the power needed for the flash memory system to temporally operate. The hold-up power supply stores power in at least one capacitor. During normal operation, power from a high voltage supply bus is used to charge the storage capacitors. When a power supply loss is detected, the power supply bus is disconnected from the flash memory system. A hold-up controller controls the power flow from the storage capacitors to the flash memory system. The hold-up controller uses feedback to assure that the proper voltage is provided from the storage capacitors to the flash memory system. This power supplied by the storage capacitors allows the flash memory system to complete any erasures and writes, and thus allows the flash memory system to shut down gracefully.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sahin, Sinan; Celebi, Ahmet; Yalcin, Yalim
2005-04-15
Scimitar syndrome is a rare congenital disorder. It is characterized by partial or total abnormal venous drainage of the right lung into the inferior vena cava, which is often associated with anomalous systemic arterial supply to the right lung, congenital cardiac anomalies, hypoplasia of the right lung and bronchial anomalies. Symptoms depend on the degree of the shunt and severity of the associated anomalies, which determine the treatment. We present a 6-year-old boy who was diagnosed as having the adult form of scimitar syndrome during evaluation for recurrent pulmonary infections, and underwent embolization with a detachable silicon balloon of themore » anomalous systemic arterial supply from the abdominal aorta to the right lower lung lobe. Successful elective surgery was performed 6 months later, in which right pulmonary veins were directed to the left atrium using a Gore-Tex patch by creating an intra-atrial tunnel. The patient has been symptom-free period during 6 months of follow-up, which supports the idea that recurrent pulmonary infections can be eliminated by embolization of the anomalous arterial supply.« less
[Hygienic assessment of the characteristics of centralized hot water supply in case of Moscow].
Bukshuk, A A; Egorova, N A
2011-01-01
The paper considers the characteristics of domestic hot water consumption by Moscow dwellers. It gives the results of questionnaire surveys in 100 respondents aged 20-80 years about the modes and intensity of hot water use, by indicating the time and frequency of contact with hot water complaints about hot water supply. According to the authors'studies, the daily consumption of hot water per capita was 1.1-2 times greater than that of cold water; at the same time the total water use remained to be 1.3-3 times less than the Moscow standard levels. Top stationary point measurements of water temperature showed the noncompliance with its hygienic requirements: 95 of 98 hot water samples had a temperature of 5-22 degrees C less than the standard temperature (60 degrees C). A decrease in hot water temperature in the centralized hot water supply systems creates conditions for Legionella pneumophila propagation and ensures no hot water safety with regards to the possible development of Legionella pneumonia.
Knapp, Katherine K; Cultice, James M
2007-01-01
To revise the 2000 Bureau of Health Professions Pharmacist Supply Model based on new data. Stock-flow model. United States. A 2004 estimate of active pharmacists reported by the Bureau of Labor Statistics was used to derive the base count for the 2007 supply model. Starting with a 2004 base of active pharmacists, new graduates are added to the supply annually and losses resulting from death and retirement are subtracted. Age- and gender-based pharmacist supply estimates, 2004-2020. Increased U.S. pharmacist supply estimates (236,227 in 2007 to 304,986 in 2020) indicate that pharmacists will remain the third largest professional health group behind nurses and physicians. Increases were driven by longer persistence in the workforce (59%), increased numbers of U.S. graduates (35%), and increases from international pharmacy graduates (IPGs) achieving U.S. licensure (6%). Since more pharmacists are expected to be working part time the full-time equivalent (FTE) supply will be reduced by about 15%. The mean age of pharmacists was projected to decline from 47 to 43 by 2020. Because of unequal distribution across age groups, large pharmacist cohorts approaching retirement age will result in fewer pharmacists available to replace them. The ratio of pharmacists to the over-65 population is expected to decrease after 2011 and continue to fall beyond 2020; this is likely a reflection of baby boomers passing through older age cohorts. The revised estimated active U.S. pharmacist head count in 2006 is 232,597, with equivalent FTEs totaling approximately 198,000. The substantial increase over the 2000 pharmacist supply model estimates is primarily attributable to pharmacists remaining in the workforce longer and educational expansion. U.S. licensed IPGs account for less than 6% of overall increases. The pharmacist work-force is projected to become younger on average by about 4 years by 2020. Coincident demands for more physicians and nurses over the same period and shortages in
41 CFR 101-30.603 - GSA Supply Catalog.
Code of Federal Regulations, 2014 CFR
2014-07-01
... Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 30-FEDERAL CATALOG SYSTEM 30.6-GSA Section of the Federal Supply Catalog § 101-30.603 GSA Supply Catalog. (a) The GSA Supply... GSA Supply Catalog contains all necessary information for ordering from the GSA Federal Supply Service...
41 CFR 101-30.603 - GSA Supply Catalog.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 30-FEDERAL CATALOG SYSTEM 30.6-GSA Section of the Federal Supply Catalog § 101-30.603 GSA Supply Catalog. (a) The GSA Supply... GSA Supply Catalog contains all necessary information for ordering from the GSA Federal Supply Service...
41 CFR 101-30.603 - GSA Supply Catalog.
Code of Federal Regulations, 2012 CFR
2012-07-01
... Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 30-FEDERAL CATALOG SYSTEM 30.6-GSA Section of the Federal Supply Catalog § 101-30.603 GSA Supply Catalog. (a) The GSA Supply... GSA Supply Catalog contains all necessary information for ordering from the GSA Federal Supply Service...
41 CFR 101-30.603 - GSA Supply Catalog.
Code of Federal Regulations, 2013 CFR
2013-07-01
... Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 30-FEDERAL CATALOG SYSTEM 30.6-GSA Section of the Federal Supply Catalog § 101-30.603 GSA Supply Catalog. (a) The GSA Supply... GSA Supply Catalog contains all necessary information for ordering from the GSA Federal Supply Service...
41 CFR 101-30.603 - GSA Supply Catalog.
Code of Federal Regulations, 2011 CFR
2011-07-01
... Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 30-FEDERAL CATALOG SYSTEM 30.6-GSA Section of the Federal Supply Catalog § 101-30.603 GSA Supply Catalog. (a) The GSA Supply... GSA Supply Catalog contains all necessary information for ordering from the GSA Federal Supply Service...
Code of Federal Regulations, 2011 CFR
2011-07-01
... members (such as balusters), when used between posts, shall be not more than 19 inches (48 cm) apart. (iv... the top edge. (4) When the 200 pound (890 N) test load specified in paragraph (b)(3) of this section... overhang the terminal posts, except where such overhang does not constitute a projection hazard. (8) Steel...
Forecasting Ontario's blood supply and demand.
Drackley, Adam; Newbold, K Bruce; Paez, Antonio; Heddle, Nancy
2012-02-01
Given an aging population that requires increased medical care, an increasing number of deferrals from the donor pool, and a growing immigrant population that typically has lower donation rates, the purpose of this article is to forecast Ontario's blood supply and demand. We calculate age- and sex-specific donation and demand rates for blood supply based on 2008 data and project demand between 2008 and 2036 based on these rates and using population data from the Ontario Ministry of Finance. Results indicate that blood demand will outpace supply as early as 2012. For instance, while the total number of donations made by older cohorts is expected to increase in the coming years, the number of red blood cell (RBC) transfusions in the 70+ age group is forecasted grow from approximately 53% of all RBC transfusions in 2008 (209,515) in 2008 to 68% (546,996) by 2036. A series of alternate scenarios, including projections based on a 2% increase in supply per year and increased use of apheresis technology, delays supply shortfalls, but does not eliminate them without active management and/or multiple methods to increase supply and decrease demand. Predictions show that demand for blood products will outpace supply in the near future given current age- and sex-specific supply and demand rates. However, we note that the careful management of the blood supply by Canadian Blood Services, along with new medical techniques and the recruitment of new donors to the system, will remove future concerns. © 2012 American Association of Blood Banks.
Surface Structure and Wetting Characteristics of Collembola Cuticles
Gundersen, Håkon; Leinaas, Hans Petter; Thaulow, Christian
2014-01-01
The cuticles of the arthropods Collembola (springtails) are known to be superhydrophobic, displaying such properties as water-repellence and plastron formation; overhanging surface structures have been suggested as the source of these properties. Superhydrophobicity is closely related to surface structuring and other surfaces with overhanging structures have been shown to possess robust superhydrophobic properties. In effort to correlate the wetting performance and surface structuring of the cuticles, from both a technical and evolutionary point of view, we investigated a selection of Collembola species including species from several families and covering habitats ranging from aquatic to very dry. The observed contact angles of wetting was in general larger than those predicted by the conventional models. Not all the studied Collembola were found to have superhydrophobic properties, indicating that superhydrophobicity is common, but not a universal trait in Collembola. Overhanging structures were found in some, but not all Collembola species with superhydrophobic cuticles; which leads to the conclusion that there is no direct link between overhanging surface structures and superhydrophobicity in Collembola. PMID:24498281
NASA Technical Reports Server (NTRS)
2006-01-01
6 April 2006 This Mars Global Surveyor (MGS) Mars Orbiter Camera (MOC) image shows the edge (running diagonally from the lower left to the upper right) of a trough, which is part of a large pit crater complex in Noachis Terra. This type of trough forms through the collapse of surface materials into the subsurface, and often begins as a series of individual pit craters. Over time, continued collapse increases the diameter of individual pits until finally, adjacent pits merge to form a trough such as the one captured in this image. The deep shadowed area is caused in part by an overhang; layered rock beneath this overhang is less resistant to erosion, and thus has retreated tens of meters backward, beneath the overhang. A person could walk up inside this 'cave' formed by the overhanging layered material. Location near: 47.0oS, 355.7oW Image width: 3 km (1.9 mi) Illumination from: upper left Season: Southern SummerNASA Astrophysics Data System (ADS)
He, Li; Song, Xuan
2018-03-01
In recent years, ceramic fabrication using stereolithography (SLA) has gained in popularity because of its high accuracy and density that can be achieved in the final part of production. One of the key challenges in ceramic SLA is that support structures are required for building overhanging features, whereas removing these support structures without damaging the components is difficult. In this research, a suspension-enclosing projection-stereolithography process is developed to overcome this challenge. This process uses a high-yield-stress ceramic slurry as the feedstock material and exploits the elastic force of the material to support overhanging features without the need for building additional support structures. Ceramic slurries with different solid loadings are studied to identify the rheological properties most suitable for supporting overhanging features. An analytical model of a double doctor-blade module is established to obtain uniform and thin recoating layers from a high-yield-stress slurry. Several test cases highlight the feasibility of using a high-yield-stress slurry to support overhanging features in SLA.
Essential tools of supply chain management.
Buddress, L; Raedels, A
2000-08-01
At a recent conference, the keynote speaker provoked an incredulous response when he said, "Today, competition among individual firms is dead." He then went on to explain that today, competition is supply chain against supply chain. Whichever firm has the superior supply chain will win out in the marketplace. Given the global marketplace in which we all operate, most of us would agree that his statements are true. How does a firm establish a world-class supply base? What kinds of contracts and agreements are necessary to support the diverse requirements of today's firms? How should a firm select from among the available contract types? These are foundation questions for supply chain management.
Creating value-focused healthcare delivery systems: Part three--Core competencies.
Beveridge, R N
1997-01-01
-effective price. Outcomes must not only be compared to best practices, but to what is possible. Providers must constantly strive to enhance the quality of the services. Financial/cost management ensures that care is cost-effective and that a marginal profit is maintained to allow continued investment in new technology and continuing medical education to enhance the quality of care and lifestyles for all stakeholders. Information management is the binding element, or keystone, in providing value-focused care. Through the collection, storing, transfer, manipulation, sorting, and reporting of data, more effective decision-making can occur. Integrated MIS allows information to be generated about the cost-effectiveness of treatment regimens, employee productivity, physician cost-effectiveness, supply utilization, and clinical outcomes, as well as patient information to be readily available throughout the healthcare system. Having this information available will allow providers to become more cost-effective in the delivery of care, which results in perceived higher value for the services. Customers demand value. Value is created by meeting the needs and demands of the customers through the delivery of cost-effective, high-quality healthcare services that are easily accessible and meet with high patient satisfaction. Providers who can demonstrate their ability to provide the services in this manner will create a competitive advantage in the marketplace and will be perceived as the value provider of choice by loyal customers.
pPCV, a versatile vector for cloning PCR products.
Janner, Christiane R; Brito, Ana Lívia P; Moraes, Lidia Maria P; Reis, Viviane Cb; Torres, Fernando Ag
2013-01-01
The efficiency of PCR product cloning depends on the nature of the DNA polymerase employed because amplicons may have blunt-ends or 3' adenosines overhangs. Therefore, for amplicon cloning, available commercial vectors are either blunt-ended or have a single 3' overhanging thymidine. The aim of this work was to offer in a single vector the ability to clone both types of PCR products. For that purpose, a minimal polylinker was designed to include restriction sites for EcoRV and XcmI which enable direct cloning of amplicons bearing blunt-ends or A-overhangs, respectively, still offering blue/white selection. When tested, the resulting vector, pPCV, presented high efficiency cloning of both types of amplicons.
48 CFR 11.701 - Supply contracts.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Supply contracts. 11.701 Section 11.701 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION ACQUISITION PLANNING DESCRIBING AGENCY NEEDS Variation in Quantity 11.701 Supply contracts. (a) A fixed-price supply contract may...
Learning to Integrate: Supply Chains Reconceptualised
ERIC Educational Resources Information Center
Sense, Andrew J.; Clements, Michael D. J.
2007-01-01
This paper introduces and explains a conception of supply chains from a situated learning perspective. This non-conventional supply chain perspective invites the reader to consider supply chain scenarios as "situated learning opportunities involving multiple communities of practice" interacting and participating together. It is argued that by…
A stochastic simulator of a blood product donation environment with demand spikes and supply shocks.
An, Ming-Wen; Reich, Nicholas G; Crawford, Stephen O; Brookmeyer, Ron; Louis, Thomas A; Nelson, Kenrad E
2011-01-01
The availability of an adequate blood supply is a critical public health need. An influenza epidemic or another crisis affecting population mobility could create a critical donor shortage, which could profoundly impact blood availability. We developed a simulation model for the blood supply environment in the United States to assess the likely impact on blood availability of factors such as an epidemic. We developed a simulator of a multi-state model with transitions among states. Weekly numbers of blood units donated and needed were generated by negative binomial stochastic processes. The simulator allows exploration of the blood system under certain conditions of supply and demand rates, and can be used for planning purposes to prepare for sudden changes in the public's health. The simulator incorporates three donor groups (first-time, sporadic, and regular), immigration and emigration, deferral period, and adjustment factors for recruitment. We illustrate possible uses of the simulator by specifying input values for an 8-week flu epidemic, resulting in a moderate supply shock and demand spike (for example, from postponed elective surgeries), and different recruitment strategies. The input values are based in part on data from a regional blood center of the American Red Cross during 1996-2005. Our results from these scenarios suggest that the key to alleviating deficit effects of a system shock may be appropriate timing and duration of recruitment efforts, in turn depending critically on anticipating shocks and rapidly implementing recruitment efforts.
Supply and demand of some critical metals and present status of their recycling in WEEE.
Zhang, Shengen; Ding, Yunji; Liu, Bo; Chang, Chein-Chi
2017-07-01
New development and technological innovations make electrical and electronic equipment (EEE) more functional by using an increasing number of metals, particularly the critical metals (e.g. rare and precious metals) with specialized properties. As millions of people in emerging economies adopt a modern lifestyle, the demand for critical metals is soaring. However, the increasing demand causes the crisis of their supply because of their simple deficiency in the Earth's crust or geopolitical constraints which might create political issues for their supply. This paper focuses on the sustainable supply of typical critical metals (indium, rare earth elements (REEs), lithium, cobalt and precious metals) through recycling waste electrical and electronic equipment (WEEE). To illuminate this issue, the production, consumption, expected future demand, current recycling situation of critical metals, WEEE management and their recycling have been reviewed. We find that the demand of indium, REEs, lithium and cobalt in EEE will continuously increasing, while precious metals are decreasing because of new substitutions with less or even without precious metals. Although the generation of WEEE in 2014 was about 41.9 million tons (Mt), just about 15% (6.5 Mt) was treated environmentally. The inefficient collection of WEEE is the main obstacle to relieving the supply risk of critical metals. Furthermore, due to the widespread use in low concentrations, such as indium, their recycling is not just technological problem, but economic feasibility is. Finally, relevant recommendations are point out to address these issues. Copyright © 2017 Elsevier Ltd. All rights reserved.
A Stochastic Simulator of a Blood Product Donation Environment with Demand Spikes and Supply Shocks
An, Ming-Wen; Reich, Nicholas G.; Crawford, Stephen O.; Brookmeyer, Ron; Louis, Thomas A.; Nelson, Kenrad E.
2011-01-01
The availability of an adequate blood supply is a critical public health need. An influenza epidemic or another crisis affecting population mobility could create a critical donor shortage, which could profoundly impact blood availability. We developed a simulation model for the blood supply environment in the United States to assess the likely impact on blood availability of factors such as an epidemic. We developed a simulator of a multi-state model with transitions among states. Weekly numbers of blood units donated and needed were generated by negative binomial stochastic processes. The simulator allows exploration of the blood system under certain conditions of supply and demand rates, and can be used for planning purposes to prepare for sudden changes in the public's health. The simulator incorporates three donor groups (first-time, sporadic, and regular), immigration and emigration, deferral period, and adjustment factors for recruitment. We illustrate possible uses of the simulator by specifying input values for an -week flu epidemic, resulting in a moderate supply shock and demand spike (for example, from postponed elective surgeries), and different recruitment strategies. The input values are based in part on data from a regional blood center of the American Red Cross during –. Our results from these scenarios suggest that the key to alleviating deficit effects of a system shock may be appropriate timing and duration of recruitment efforts, in turn depending critically on anticipating shocks and rapidly implementing recruitment efforts. PMID:21814550
19 CFR 357.102 - Short supply allowances.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 19 Customs Duties 3 2010-04-01 2010-04-01 false Short supply allowances. 357.102 Section 357.102 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE SHORT SUPPLY PROCEDURES § 357.102 Short supply allowances. (a) The Secretary will authorize a short supply allowance if: (1) The...
19 CFR 357.102 - Short supply allowances.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 19 Customs Duties 3 2012-04-01 2012-04-01 false Short supply allowances. 357.102 Section 357.102 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE SHORT SUPPLY PROCEDURES § 357.102 Short supply allowances. (a) The Secretary will authorize a short supply allowance if: (1) The...
19 CFR 357.102 - Short supply allowances.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 19 Customs Duties 3 2011-04-01 2011-04-01 false Short supply allowances. 357.102 Section 357.102 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE SHORT SUPPLY PROCEDURES § 357.102 Short supply allowances. (a) The Secretary will authorize a short supply allowance if: (1) The...
47 CFR 80.859 - Main power supply.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 47 Telecommunication 5 2010-10-01 2010-10-01 false Main power supply. 80.859 Section 80.859... power supply. (a) The main power supply must simultaneously energize the radiotelephone transmitter at... main power supply at the radiotelephone input terminals must not deviate from its rated potential by...
47 CFR 80.859 - Main power supply.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 47 Telecommunication 5 2011-10-01 2011-10-01 false Main power supply. 80.859 Section 80.859... power supply. (a) The main power supply must simultaneously energize the radiotelephone transmitter at... main power supply at the radiotelephone input terminals must not deviate from its rated potential by...
30 CFR 874.14 - Water supply restoration.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Water supply restoration. 874.14 Section 874.14... ABANDONED MINE LAND RECLAMATION GENERAL RECLAMATION REQUIREMENTS § 874.14 Water supply restoration. (a) Any... supply restoration projects. For purposes of this section, “water supply restoration projects” are those...
Automatic Electronic Oxygen Supply
Ford, Patricia; Hoodless, D. J.
1971-01-01
An automatic electronic oxygen system has been devised to supply an intensive care unit with a “fail-safe” supply of continuous oxygen. All parts of the system are fitted with alarms, as the oxygen powers gas-driven ventilators. Since the system is cheap it can be installed in hospitals where finance is limited. PMID:5278618
20 CFR 654.405 - Water supply.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 20 Employees' Benefits 3 2011-04-01 2011-04-01 false Water supply. 654.405 Section 654.405... THE EMPLOYMENT SERVICE SYSTEM Housing for Agricultural Workers Housing Standards § 654.405 Water supply. (a) An adequate and convenient supply of water that meets the standards of the State health...
47 CFR 80.1015 - Power supply.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 47 Telecommunication 5 2011-10-01 2011-10-01 false Power supply. 80.1015 Section 80.1015... MARITIME SERVICES Radiotelephone Installations Required by the Bridge-to-Bridge Act § 80.1015 Power supply. (a) There must be readily available for use under normal load conditions, a power supply sufficient...
49 CFR 236.516 - Power supply.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 49 Transportation 4 2011-10-01 2011-10-01 false Power supply. 236.516 Section 236.516..., Train Control and Cab Signal Systems Standards § 236.516 Power supply. Automatic cab signal, train stop, or train control device hereafter installed shall operate from a separate or isolated power supply...
47 CFR 80.1015 - Power supply.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 47 Telecommunication 5 2010-10-01 2010-10-01 false Power supply. 80.1015 Section 80.1015... MARITIME SERVICES Radiotelephone Installations Required by the Bridge-to-Bridge Act § 80.1015 Power supply. (a) There must be readily available for use under normal load conditions, a power supply sufficient...
49 CFR 236.516 - Power supply.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 49 Transportation 4 2010-10-01 2010-10-01 false Power supply. 236.516 Section 236.516..., Train Control and Cab Signal Systems Standards § 236.516 Power supply. Automatic cab signal, train stop, or train control device hereafter installed shall operate from a separate or isolated power supply...
20 CFR 654.405 - Water supply.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Water supply. 654.405 Section 654.405... THE EMPLOYMENT SERVICE SYSTEM Housing for Agricultural Workers Housing Standards § 654.405 Water supply. (a) An adequate and convenient supply of water that meets the standards of the State health...
7 CFR 3015.171 - Unused supplies.
Code of Federal Regulations, 2010 CFR
2010-01-01
..., DEPARTMENT OF AGRICULTURE UNIFORM FEDERAL ASSISTANCE REGULATIONS Property § 3015.171 Unused supplies. (a) If unused supplies exceeding $1,000 in total aggregate market value are left over upon termination or... 7 Agriculture 15 2010-01-01 2010-01-01 false Unused supplies. 3015.171 Section 3015.171...
20 CFR 654.405 - Water supply.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 20 Employees' Benefits 3 2012-04-01 2012-04-01 false Water supply. 654.405 Section 654.405... THE EMPLOYMENT SERVICE SYSTEM Housing for Agricultural Workers Housing Standards § 654.405 Water supply. (a) An adequate and convenient supply of water that meets the standards of the State health...
20 CFR 654.405 - Water supply.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 20 Employees' Benefits 3 2014-04-01 2014-04-01 false Water supply. 654.405 Section 654.405... THE EMPLOYMENT SERVICE SYSTEM Housing for Agricultural Workers Housing Standards § 654.405 Water supply. (a) An adequate and convenient supply of water that meets the standards of the State health...
20 CFR 654.405 - Water supply.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 20 Employees' Benefits 3 2013-04-01 2013-04-01 false Water supply. 654.405 Section 654.405... THE EMPLOYMENT SERVICE SYSTEM Housing for Agricultural Workers Housing Standards § 654.405 Water supply. (a) An adequate and convenient supply of water that meets the standards of the State health...
Analysis of rubber supply in Sri Lanka
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hartley, M.J.; Nerlove, M.; Peters, R.K. Jr.
1987-11-01
An analysis of the supply response for perennial crops is undertaken for rubber in Sir Lanka, focusing on the uprooting-replanting decision and disaggregating the typical reduced-form supply response equation into several structural relationships. This approach is compared and contrasted with Dowling's analysis of supply response for rubber in Thailand, which is based upon a sophisticated reduced-form supply function developed by Wickens and Greenfield for Brazilian coffee. Because the uprooting-replanting decision is central to understanding rubber supply response in Sri Lanka and for other perennial crops where replanting activities dominate new planting, the standard approaches do not adequately capture supply response.
24 CFR 3285.605 - Fuel supply system.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 24 Housing and Urban Development 5 2012-04-01 2012-04-01 false Fuel supply system. 3285.605... URBAN DEVELOPMENT MODEL MANUFACTURED HOME INSTALLATION STANDARDS Ductwork and Plumbing and Fuel Supply Systems § 3285.605 Fuel supply system. (a) Proper supply pressure. The gas piping system in the home is...
46 CFR 197.340 - Breathing gas supply.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 46 Shipping 7 2012-10-01 2012-10-01 false Breathing gas supply. 197.340 Section 197.340 Shipping... GENERAL PROVISIONS Commercial Diving Operations Equipment § 197.340 Breathing gas supply. (a) A primary breathing gas supply for surface-supplied diving must be sufficient to support the following for the...
46 CFR 197.340 - Breathing gas supply.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 46 Shipping 7 2014-10-01 2014-10-01 false Breathing gas supply. 197.340 Section 197.340 Shipping... GENERAL PROVISIONS Commercial Diving Operations Equipment § 197.340 Breathing gas supply. (a) A primary breathing gas supply for surface-supplied diving must be sufficient to support the following for the...
46 CFR 197.340 - Breathing gas supply.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 46 Shipping 7 2013-10-01 2013-10-01 false Breathing gas supply. 197.340 Section 197.340 Shipping... GENERAL PROVISIONS Commercial Diving Operations Equipment § 197.340 Breathing gas supply. (a) A primary breathing gas supply for surface-supplied diving must be sufficient to support the following for the...
46 CFR 197.340 - Breathing gas supply.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 46 Shipping 7 2011-10-01 2011-10-01 false Breathing gas supply. 197.340 Section 197.340 Shipping... GENERAL PROVISIONS Commercial Diving Operations Equipment § 197.340 Breathing gas supply. (a) A primary breathing gas supply for surface-supplied diving must be sufficient to support the following for the...
46 CFR 197.456 - Breathing supply hoses.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Breathing supply hoses. 197.456 Section 197.456 Shipping....456 Breathing supply hoses. (a) The diving supervisor shall insure that— (1) Each breathing supply....5 times its maximum working pressure; (2) Each breathing supply hose assembly, prior to being placed...
Aligning incentives in supply chains.
Narayanan, V G; Raman, Ananth
2004-11-01
Most companies don't worry about the behavior of their supply chain partners. Instead, they expect the supply chain to work efficiently without interference, as if guided by Adam Smith's famed invisible hand. In their study of more than 50 supply networks, V.G. Narayanan and Ananth Raman found that companies often looked out for their own interests and ignored those of their network partners. Consequently, supply chains performed poorly. Those results aren't shocking when you consider that supply chains extend across several functions and many companies, each with its own priorities and goals. Yet all those functions and firms must pull in the same direction for a chain to deliver goods and services to consumers quickly and cost-effectively. According to the authors, a supply chain works well only if the risks, costs, and rewards of doing business are distributed fairly across the network. In fact, misaligned incentives are often the cause of excess inventory, stock-outs, incorrect forecasts, inadequate sales efforts, and even poor customer service. The fates of all supply chain partners are interlinked: If the firms work together to serve consumers, they will all win. However, they can do that only if incentives are aligned. Companies must acknowledge that the problem of incentive misalignment exists and then determine its root cause and align or redesign incentives. They can improve alignment by, for instance, adopting revenue-sharing contracts, using technology to track previously hidden information, or working with intermediaries to build trust among network partners. It's also important to periodically reassess incentives, because even top-performing networks find that changes in technology or business conditions alter the alignment of incentives.
48 CFR 225.903 - Exempted supplies.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Exempted supplies. 225.903... OF DEFENSE SOCIOECONOMIC PROGRAMS FOREIGN ACQUISITION Customs and Duties 225.903 Exempted supplies. (b)(i) For an explanation of the term “supplies,” see PGI 225.903(b)(i). (ii) The duty-free...
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 9 2011-01-01 2011-01-01 false Supply plant. 1000.6 Section 1000.6 Agriculture... Definitions § 1000.6 Supply plant. Supply plant means a plant approved by a duly constituted regulatory agency... diverts fluid milk products to other plants or manufactures dairy products on its premises. ...
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 9 2010-01-01 2009-01-01 true Supply plant. 1000.6 Section 1000.6 Agriculture... Definitions § 1000.6 Supply plant. Supply plant means a plant approved by a duly constituted regulatory agency... diverts fluid milk products to other plants or manufactures dairy products on its premises. ...
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 9 2012-01-01 2012-01-01 false Supply plant. 1000.6 Section 1000.6 Agriculture... Definitions § 1000.6 Supply plant. Supply plant means a plant approved by a duly constituted regulatory agency... diverts fluid milk products to other plants or manufactures dairy products on its premises. ...
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 9 2014-01-01 2013-01-01 true Supply plant. 1000.6 Section 1000.6 Agriculture... Definitions § 1000.6 Supply plant. Supply plant means a plant approved by a duly constituted regulatory agency... diverts fluid milk products to other plants or manufactures dairy products on its premises. ...
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 9 2013-01-01 2013-01-01 false Supply plant. 1000.6 Section 1000.6 Agriculture... Definitions § 1000.6 Supply plant. Supply plant means a plant approved by a duly constituted regulatory agency... diverts fluid milk products to other plants or manufactures dairy products on its premises. ...
47 CFR 80.915 - Main power supply.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 47 Telecommunication 5 2010-10-01 2010-10-01 false Main power supply. 80.915 Section 80.915... supply. (a) There must be readily available for use under normal load conditions a main power supply... required receiver. Under this load condition the potential of the main power supply at the power input...
47 CFR 80.915 - Main power supply.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 47 Telecommunication 5 2011-10-01 2011-10-01 false Main power supply. 80.915 Section 80.915... supply. (a) There must be readily available for use under normal load conditions a main power supply... required receiver. Under this load condition the potential of the main power supply at the power input...
Antiretroviral procurement and supply chain management.
Ripin, David J; Jamieson, David; Meyers, Amy; Warty, Umesh; Dain, Mary; Khamsi, Cyril
2014-01-01
Procurement, the country-level process of ordering antiretrovirals (ARVs), and supply chain management, the mechanism by which they are delivered to health-care facilities, are critical processes required to move ARVs from manufacturers to patients. To provide a glimpse into the ARV procurement and supply chain, the following pages provide an overview of the primary stakeholders, principal operating models, and policies and regulations involved in ARV procurement. Also presented are key challenges that need to be addressed to ensure that the supply chain is not a barrier to the goal of universal coverage. This article will cover the steps necessary to order and distribute ARVs, including different models of delivery, key stakeholders involved, strategic considerations that vary depending on context and policies affecting them. The single drug examples given illustrate the complications inherent in fragmented supply and demand-driven models of procurement and supply chain management, and suggest tools for navigating these hurdles that will ultimately result in more secure and reliable ARV provision. Understanding the dynamics of ARV supply chain is important for the global health community, both to ensure full and efficient treatment of persons living with HIV as well as to inform the supply chain decisions for other public health products.
24 CFR 3285.603 - Water supply.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 24 Housing and Urban Development 5 2011-04-01 2011-04-01 false Water supply. 3285.603 Section 3285... § 3285.603 Water supply. (a) Crossover. Multi-section homes with plumbing in both sections require water... pressure and reduction. When the local water supply pressure exceeds 80 psi to the manufactured home, a...
Code of Federal Regulations, 2011 CFR
2011-01-01
... 9 Animals and Animal Products 2 2011-01-01 2011-01-01 false Water supply. 354.224 Section 354.224....224 Water supply. The water supply shall be ample, clean, and potable with adequate facilities for its distribution in the plant and its protection against contamination and pollution. (a) Hot water at a...
24 CFR 3285.603 - Water supply.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 24 Housing and Urban Development 5 2010-04-01 2010-04-01 false Water supply. 3285.603 Section 3285... § 3285.603 Water supply. (a) Crossover. Multi-section homes with plumbing in both sections require water... pressure and reduction. When the local water supply pressure exceeds 80 psi to the manufactured home, a...
24 CFR 3280.803 - Power supply.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 24 Housing and Urban Development 5 2011-04-01 2011-04-01 false Power supply. 3280.803 Section 3280... DEVELOPMENT MANUFACTURED HOME CONSTRUCTION AND SAFETY STANDARDS Electrical Systems § 3280.803 Power supply. (a) The power supply to the manufactured home shall be a feeder assembly consisting of not more than one...
Code of Federal Regulations, 2010 CFR
2010-01-01
... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Water supply. 354.224 Section 354.224....224 Water supply. The water supply shall be ample, clean, and potable with adequate facilities for its distribution in the plant and its protection against contamination and pollution. (a) Hot water at a...
Code of Federal Regulations, 2010 CFR
2010-04-01
... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Water supply. 801.6... POLICIES § 801.6 Water supply. (a) The Susquehanna River Basin is rich in water resources. With proper... forth in the comprehensive plan. (c) The Commission shall study the basin's water supply needs, the...
48 CFR 25.903 - Exempted supplies.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Exempted supplies. 25.903... PROGRAMS FOREIGN ACQUISITION Customs and Duties 25.903 Exempted supplies. (a) Subchapters VIII and X of Chapter 98 of the Harmonized Tariff Schedule of the United States (19 U.S.C. 1202) list supplies for which...
24 CFR 3285.603 - Water supply.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 24 Housing and Urban Development 5 2013-04-01 2013-04-01 false Water supply. 3285.603 Section 3285... § 3285.603 Water supply. (a) Crossover. Multi-section homes with plumbing in both sections require water... pressure and reduction. When the local water supply pressure exceeds 80 psi to the manufactured home, a...
Code of Federal Regulations, 2012 CFR
2012-01-01
... 9 Animals and Animal Products 2 2012-01-01 2012-01-01 false Water supply. 354.224 Section 354.224....224 Water supply. The water supply shall be ample, clean, and potable with adequate facilities for its distribution in the plant and its protection against contamination and pollution. (a) Hot water at a...
Code of Federal Regulations, 2014 CFR
2014-01-01
... 9 Animals and Animal Products 2 2014-01-01 2014-01-01 false Water supply. 354.224 Section 354.224....224 Water supply. The water supply shall be ample, clean, and potable with adequate facilities for its distribution in the plant and its protection against contamination and pollution. (a) Hot water at a...
24 CFR 3285.603 - Water supply.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 24 Housing and Urban Development 5 2012-04-01 2012-04-01 false Water supply. 3285.603 Section 3285... § 3285.603 Water supply. (a) Crossover. Multi-section homes with plumbing in both sections require water... pressure and reduction. When the local water supply pressure exceeds 80 psi to the manufactured home, a...
24 CFR 3285.603 - Water supply.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 24 Housing and Urban Development 5 2014-04-01 2014-04-01 false Water supply. 3285.603 Section 3285... § 3285.603 Water supply. (a) Crossover. Multi-section homes with plumbing in both sections require water... pressure and reduction. When the local water supply pressure exceeds 80 psi to the manufactured home, a...
Code of Federal Regulations, 2013 CFR
2013-01-01
... 9 Animals and Animal Products 2 2013-01-01 2013-01-01 false Water supply. 354.224 Section 354.224....224 Water supply. The water supply shall be ample, clean, and potable with adequate facilities for its distribution in the plant and its protection against contamination and pollution. (a) Hot water at a...
Modelling Lean and Green Supply Chain
NASA Astrophysics Data System (ADS)
Duarte, Susana Carla Vieira Lino Medina
The success of an organization depends on the effective control of its supply chain. It is important to recognize new opportunities for organization and its supply chain. In the last few years the approach to lean, agile, resilient and green supply chain paradigms has been addressed in the scientific literature. Research in this field shows that the integration of these concepts revealed some contradictions among so many paradigms. This thesis is mainly focused on the lean and green approaches. Thirteen different management frameworks, embodied in awards, standards and tools were studied to understand if they could contribute for the modelling process of a lean and green approach. The study reveals a number of categories that are common in most management frameworks, providing adequate conditions for a lean and green supply chain transformation. A conceptual framework for the evaluation of a lean and green organization`s supply chain was proposed. The framework considers six key criteria, namely, leadership, people, strategic planning, stakeholders, processes and results. It was proposed an assessment method considering a criteria score for each criterion. The purpose is to understand how lean and green supply chain can be compatible, using principles, practices, techniques or tools (i.e. elements) that support both, a lean and a green approach, in all key criteria. A case study in the automotive upstream supply chain was performed to understand more deeply if the elements proposed for the conceptual framework could be implemented in a real-scenario. Based on the conceptual framework and the case study, a roadmap to achieve a lean-green transformation is presented. The proposed roadmap revealed its contribution to the understanding on how and when an organization`s supply chain should apply the lean and green elements. This study is relevant to practice, as it may assist managers in the adoption of a lean and green supply chain approach, giving insights for the
Peter J. Ince; David B. McKeever
2011-01-01
At times in history, there have been concerns that demand for wood (timber) would be greater than the ability to supply it, but that concern has recently dissipated. The wood supply and demand situation has changed because of market transitions, economic downturns, and continued forest growth. This article provides a concise overview of this change as it relates to the...
Modular High Voltage Power Supply
DOE Office of Scientific and Technical Information (OSTI.GOV)
Newell, Matthew R.
The goal of this project is to develop a modular high voltage power supply that will meet the needs of safeguards applications and provide a modular plug and play supply for use with standard electronic racks.
A new bipolar Qtrim power supply system
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mi, C.; Bruno, D.; Drozd, J.
2015-05-03
This year marks the 15th run of RHIC (Relativistic Heavy Ion Collider) operations. The reliability of superconducting magnet power supplies is one of the essential factors in the entire accelerator complex. Besides maintaining existing power supplies and their associated equipment, newly designed systems are also required based on the physicist’s latest requirements. A bipolar power supply was required for this year’s main quadruple trim power supply. This paper will explain the design, prototype, testing, installation and operation of this recently installed power supply system.
NASA Astrophysics Data System (ADS)
Gass, S. I.
1982-05-01
The theoretical and applied state of the art of oil and gas supply models was discussed. The following areas were addressed: the realities of oil and gas supply, prediction of oil and gas production, problems in oil and gas modeling, resource appraisal procedures, forecasting field size and production, investment and production strategies, estimating cost and production schedules for undiscovered fields, production regulations, resource data, sensitivity analysis of forecasts, econometric analysis of resource depletion, oil and gas finding rates, and various models of oil and gas supply.
47 CFR 80.860 - Reserve power supply.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 47 Telecommunication 5 2011-10-01 2011-10-01 false Reserve power supply. 80.860 Section 80.860... Reserve power supply. (a) When the main power supply is not on the same deck as the main wheelhouse or at least one deck above the vessel's main deck, a reserve power supply must be provided and must be so...
47 CFR 80.860 - Reserve power supply.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 47 Telecommunication 5 2010-10-01 2010-10-01 false Reserve power supply. 80.860 Section 80.860... Reserve power supply. (a) When the main power supply is not on the same deck as the main wheelhouse or at least one deck above the vessel's main deck, a reserve power supply must be provided and must be so...
47 CFR 80.917 - Reserve power supply.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 47 Telecommunication 5 2010-10-01 2010-10-01 false Reserve power supply. 80.917 Section 80.917... a reserve power supply located on the same deck as the main wheel house or at least one deck above the vessel's main deck, unless the main power supply is so situated. (b) The reserve power supply must...
47 CFR 80.917 - Reserve power supply.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 47 Telecommunication 5 2011-10-01 2011-10-01 false Reserve power supply. 80.917 Section 80.917... a reserve power supply located on the same deck as the main wheel house or at least one deck above the vessel's main deck, unless the main power supply is so situated. (b) The reserve power supply must...
Enabling Reanalysis Intercomparison with the CREATE-IP and CREATE-V Projects
NASA Astrophysics Data System (ADS)
Carriere, L.; Potter, G. L.; Hertz, J.; Shen, Y.; Britzolakis, G.; Peters, J.; Maxwell, T. P.; Li, J.; Strong, S.; Schnase, J. L.
2016-12-01
NASA Goddard Space Flight Center's Office of Computational and Information Sciences and Technology, the NASA Center for Climate Simulation (NCCS), and the Earth System Grid Federation (ESGF) are working together to build a uniform environment for the comparative study and use of a group of reanalysis datasets of particular importance to the research community. This effort is called the Collaborative REAnalysis Technical Environment (CREATE) and it contains two components: the CREATE-Intercomparison Project (CREATE-IP) and CREATE-V. For CREATE-IP, our target reanalyses include ECMWF ERA-Interim, NASA/GMAO MERRA and MERRA2, NOAA/NCEP CFSR, NOAA/ESRL 20CR and 20CRv2, JMA JRA25, and JRA55. Each dataset is reformatted similarly to the models in the CMIP5 archive. By repackaging the reanalysis data into a common structure and format, it simplifies access, subsetting, and reanalysis comparison. Both monthly average data and a selection of high frequency data (6-hr) relevant to investigations such as the 2016 El Niño are provided. Much of the processing workflow has been automated and new data appear on a regular basis. In collaboration with the CLIVAR Global Synthesis and Observations Panel (GSOP), we are also processing and publishing eight ocean reanalyses, from 1980 to the present. Here, the data are regridded to a common 1° x 1° grid, vertically interpolated to the World Ocean Atlas 09 (WOA09) depths, and an ensemble is generated. CREATE-V is a web based visualization tool that allows the user to simultaneously view four reanalyses to facilitate comparison. The addition of a backend analytics engine, based on UV-CDAT and Scala provides the ability to generate a time series and anomaly for any given location on a map. The system enables scientists to identify data of interest and visualize, subset, and compare data without the need for download large volumes of data for local visualization.
Maintenance and supply options
NASA Technical Reports Server (NTRS)
1988-01-01
The object of the Maintenance and Supply Option was to develop a high level operational philosophy related to maintenance and supply operations and incorporate these concepts into the Lunar Base Study. Specific products to be generated during this task were three trade studies and a conceptual design of the Logistic Supply Module. The crew size study was performed to evaluate crew sizes from the baseline size of four to a crew size of eight and determine the preferred crew size. The second trade study was to determine the impact of extending surface stay times and recommend a preferred duration of stay time as a function of crew, consumables, and equipment support capabilities. The third trade study was an evaluation of packaging and storage methods to determine the preferred logistics approach to support the lunar base. A modified scenario was developed and served as the basis of the individual trade studies. Assumptions and guidelines were also developed from experience with Apollo programs, Space Shuttle operations, and Space Station studies. With this information, the trade studies were performed and a conceptual design for the Logistic Supply Module was developed.
Ertem, Funda Cansu; Martínez-Blanco, Julia; Finkbeiner, Matthias; Neubauer, Peter; Junne, Stefan
2016-11-01
This paper analyses concepts to facilitate a demand oriented biogas supply at an agricultural biogas plant of a capacity of 500kWhel, operated with the co-digestion of maize, grass, rye silage and chicken manure. In contrast to previous studies, environmental impacts of flexible and the traditional baseload operation are compared. Life Cycle Assessment (LCA) was performed to detect the environmental impacts of: (i) variety of feedstock co-digestion scenarios by substitution of maize and (ii) loading rate scenarios with a focus on flexible feedstock utilization. Demand-driven biogas production is critical for an overall balanced power supply to the electrical grid. It results in lower amounts of emissions; feedstock loading rate scenarios resulted in 48%, 20%, 11% lower global warming (GWP), acidification (AP) and eutrophication potentials, and a 16% higher cumulative energy demand. Substitution of maize with biogenic-waste regarding to feedstock substitution scenarios could create 10% lower GWP and AP. Copyright © 2016 Elsevier Ltd. All rights reserved.
Petroleum supply monthly, October 1993
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1993-10-26
The Petroleum Supply Monthly (PSM) is one of a family of four publications produced by the Petroleum Supply Division within the Energy Information Administration (EIA) reflecting different levels of data timeliness and completeness. The other publications are the Weekly Petroleum Status Report (WPSR), the Winter Fuels Report, and the Petroleum Supply Annual (PSA). Data presented in the PSM describe the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products inmore » the United States (50 States and the District of Columbia). The reporting universe includes those petroleum sectors in primary supply. Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States. Data presented in the PSM are divided into two sections: Summary Statistics and Detailed Statistics.« less
Petroleum supply monthly, January 1996
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
The Petroleum Supply Monthly (PSM) is one of a family of four publications produced by the Petroleum Supply Division within the Energy Information Administration (EIA) reflecting different levels of data timeliness and completeness. The other publications are the Weekly Petroleum Status Report (WPSR), the Winter Fuels Report, and the Petroleum Supply Annual (PSA). Data presented in the PSM describe the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products inmore » the United States (50 States and the District of Columbia). The reporting universe includes those petroleum sectors in primary supply. Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States. Data presented in the PSM are divided into two sections: Summary Statistics and Detailed Statistics.« less
Yadav, Prashant; Lydon, Patrick; Oswald, Julianna; Dicko, Modibo; Zaffran, Michel
2014-11-28
One of the primary objectives of National Immunization Programs is to strengthen and optimize immunization supply chains so that vaccines are delivered to the end recipients effectively, efficiently and sustainably. As a result of larger investments in global health and a wider portfolio of vaccines, global agencies are recognizing the need for vaccine supply chains to operate at their most optimal levels. Integration with other supply chains is often presented as a strategy to improve efficiency. However, it remains unclear if the proposed benefits from integration of vaccine supply chains with other supply chains will outweigh the costs. This paper provides a framework for deciding where such integration offers the most significant benefits. It also cautions about the pitfalls of integration as a one size fits all strategy. It also highlights the need for systematic collection of cost and efficiency data in order to understand the value of integration and other such initiatives. Copyright © 2014 Elsevier Ltd. All rights reserved.
Modified allocation capacitated planning model in blood supply chain management
NASA Astrophysics Data System (ADS)
Mansur, A.; Vanany, I.; Arvitrida, N. I.
2018-04-01
Blood supply chain management (BSCM) is a complex process management that involves many cooperating stakeholders. BSCM involves four echelon processes, which are blood collection or procurement, production, inventory, and distribution. This research develops an optimization model of blood distribution planning. The efficiency of decentralization and centralization policies in a blood distribution chain are compared, by optimizing the amount of blood delivered from a blood center to a blood bank. This model is developed based on allocation problem of capacitated planning model. At the first stage, the capacity and the cost of transportation are considered to create an initial capacitated planning model. Then, the inventory holding and shortage costs are added to the model. These additional parameters of inventory costs lead the model to be more realistic and accurate.
NASA Astrophysics Data System (ADS)
Kasprzyk, J. R.; Reed, P. M.; Characklis, G. W.; Kirsch, B. R.
2010-12-01
This paper proposes and demonstrates a new interactive framework for sensitivity-informed de Novo programming, in which a learning approach to formulating decision problems can confront the deep uncertainty within water management problems. The framework couples global sensitivity analysis using Sobol’ variance decomposition with multiobjective evolutionary algorithms (MOEAs) to generate planning alternatives and test their robustness to new modeling assumptions and scenarios. We explore these issues within the context of a risk-based water supply management problem, where a city seeks the most efficient use of a water market. The case study examines a single city’s water supply in the Lower Rio Grande Valley (LRGV) in Texas, using both a 10-year planning horizon and an extreme single-year drought scenario. The city’s water supply portfolio comprises a volume of permanent rights to reservoir inflows and use of a water market through anticipatory thresholds for acquiring transfers of water through optioning and spot leases. Diagnostic information from the Sobol’ variance decomposition is used to create a sensitivity-informed problem formulation testing different decision variable configurations, with tradeoffs for the formulation solved using a MOEA. Subsequent analysis uses the drought scenario to expose tradeoffs between long-term and short-term planning and illustrate the impact of deeply uncertain assumptions on water availability in droughts. The results demonstrate water supply portfolios’ efficiency, reliability, and utilization of transfers in the water supply market and show how to adaptively improve the value and robustness of our problem formulations by evolving our definition of optimality to discover key tradeoffs.
Energy and air emission effects of water supply.
Stokes, Jennifer R; Horvath, Arpad
2009-04-15
Life-cycle air emission effects of supplying water are explored using a hybrid life-cycle assessment For the typically sized U.S. utility analyzed, recycled water is preferable to desalination and comparable to importation. Seawater desalination has an energy and air emission footprint that is 1.5-2.4 times larger than that of imported water. However, some desalination modes fare better; brackish groundwater is 53-66% as environmentally intensive as seawater desalination. The annual water needs (326 m3) of a typical Californian that is met with imported water requires 5.8 GJ of energy and creates 360 kg of CO2 equivalent emissions. With seawater desalination, energy use would increase to 14 GJ and 800 kg of CO2 equivalent emissions. Meeting the water demand of California with desalination would consume 52% of the state's electricity. Supply options were reassessed using alternative electricity mixes, including the average mix of the United States and several renewable sources. Desalination using solar thermal energy has lower greenhouse gas emissions than that of imported and recycled water (using California's electricity mix), but using the U.S. mix increases the environmental footprint by 1.5 times. A comparison with a more energy-intensive international scenario shows that CO2 equivalent emissions for desalination in Dubai are 1.6 times larger than in California. The methods, decision support tool (WEST), and results of this study should persuade decision makers to make informed water policy choices by including energy consumption and material use effects in the decision-making process.
... Stages Listen Español Text Size Email Print Share Nursing Supplies Page Content Article Body Throughout most of ... budget. (Nursing equipment also makes wonderful baby gifts.) Nursing Bras A well-made nursing bra that comfortably ...
In-service moisture content of hardboard lap siding in southern Florida
C. Carll; A. Tenwolde; V. Malinauskas; M. Knaebe; P. G. Sotos
1999-01-01
To evaluate the effect of backpriming on in-service performance,hardboard lap siding from one manufacturing plant was exposed on two test buildings in southern Florida for 29 months. The two buildings were identical, except that one had 0.3 m (12-inch) roof overhangs without gutters and the other had gutters but no roof overhangs. Siding installation was the same on...
Measuring diffuse ultraviolet exposures using Gafchromic EBT3 films
NASA Astrophysics Data System (ADS)
Tsang, P. Y.; Chan, P. M.; Yu, K. N.
The present work proposed to use Gafchromic EBT3 films for determining spatial variations of ultraviolet (UV) exposures in the environment, which required many simultaneous measurements, and demonstrated the feasibility by showing the variation of the diffuse component of solar (UVA + UVB) exposures (in Jcm-2) in shaded areas under overhangs with the elevation angle θ for the edge of the overhangs.
Lamers, Patrick; Tan, Eric C. D.; Searcy, Erin M.; ...
2015-08-20
Here, pioneer cellulosic biorefineries across the United States rely on a conventional feedstock supply system based on one-year contracts with local growers, who harvest, locally store, and deliver feed-stock in low-density format to the conversion facility. While the conventional system is designed for high biomass yield areas, pilot scale operations have experienced feedstock supply shortages and price volatilities due to reduced harvests and competition from other industries. Regional supply dependency and the inability to actively manage feedstock stability and quality, provide operational risks to the biorefinery, which translate into higher investment risk. The advanced feedstock supply system based on amore » network of depots can mitigate many of these risks and enable wider supply system benefits. This paper compares the two concepts from a system-level perspective beyond mere logistic costs. It shows that while processing operations at the depot increase feedstock supply costs initially, they enable wider system benefits including supply risk reduction (leading to lower interest rates on loans), industry scale-up, conversion yield improvements, and reduced handling equipment and storage costs at the biorefinery. When translating these benefits into cost reductions per liter of gasoline equivalent (LGE), we find that total cost reductions between -0.46 to -0.21 per LGE for biochemical and -0.32 to -0.12 per LGE for thermochemical conversion pathways are possible. Naturally, these system level benefits will differ between individual actors along the feedstock supply chain. Further research is required with respect to depot sizing, location, and ownership structures.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lamers, Patrick; Tan, Eric C. D.; Searcy, Erin M.
Here, pioneer cellulosic biorefineries across the United States rely on a conventional feedstock supply system based on one-year contracts with local growers, who harvest, locally store, and deliver feed-stock in low-density format to the conversion facility. While the conventional system is designed for high biomass yield areas, pilot scale operations have experienced feedstock supply shortages and price volatilities due to reduced harvests and competition from other industries. Regional supply dependency and the inability to actively manage feedstock stability and quality, provide operational risks to the biorefinery, which translate into higher investment risk. The advanced feedstock supply system based on amore » network of depots can mitigate many of these risks and enable wider supply system benefits. This paper compares the two concepts from a system-level perspective beyond mere logistic costs. It shows that while processing operations at the depot increase feedstock supply costs initially, they enable wider system benefits including supply risk reduction (leading to lower interest rates on loans), industry scale-up, conversion yield improvements, and reduced handling equipment and storage costs at the biorefinery. When translating these benefits into cost reductions per liter of gasoline equivalent (LGE), we find that total cost reductions between -0.46 to -0.21 per LGE for biochemical and -0.32 to -0.12 per LGE for thermochemical conversion pathways are possible. Naturally, these system level benefits will differ between individual actors along the feedstock supply chain. Further research is required with respect to depot sizing, location, and ownership structures.« less
Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Lagoumintzis, George; Poulas, Konstantinos
2017-01-01
During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors.
Demand and supply-based operating modes--a framework for analyzing health care service production.
Lillrank, Paul; Groop, P Johan; Malmström, Tomi J
2010-12-01
The structure of organizations that provide services should reflect the possibilities of and constraints on production that arise from the market segments they serve. Organizational segmentation in health care is based on urgency and severity as well as disease type, bodily function, principal method, or population subgroup. The result is conflicting priorities, goals, and performance metrics. A managerial perspective is needed to identify activities with similar requirements for integration, coordination, and control. The arguments in this article apply new reasoning to the previous literature. The method used in this article to classify health care provision distinguishes different types of health problems that share generic constraints of production. The analysis leads to seven different demand-supply combinations, each with its own operational logic. These are labeled demand and supply-based operating modes (DSO modes), and constitute the managerial building blocks of health care organizations. The modes are Prevention, Emergency, One visit, Project, Elective, Cure, and Care. As analytical categories the DSO modes can be used to understand current problems. Several operating modes in one unit create managerial problems of conflicting priorities, goals, and performance metrics. The DSO modes are constructed as managerially homogeneous categories or care platforms responding to general types of demand, and supply constraints. The DSO modes bring methods of industrial management to bear on efforts to improve health care. © 2010 Milbank Memorial Fund. Published by Wiley Periodicals Inc.
E-beam high voltage switching power supply
Shimer, D.W.; Lange, A.C.
1996-10-15
A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules. 5 figs.
E-beam high voltage switching power supply
Shimer, Daniel W.; Lange, Arnold C.
1996-01-01
A high-power power supply produces a controllable, constant high voltage put under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules.
Delivering radiology supplies just-in-time.
Clinton, M
1999-01-01
The radiology department at Dartmouth Hitchcock Medical Center (DHMC) adopted a just-in-time (JIT) inventory management system in 1992, reducing the volume of its in-house inventory of radiology supplies from a value of $400,000 to $16,000, just enough for four to five days of activity. An asset manager, the only person authorized to order supplies, was given responsibility for maintaining the department's supply of fixed and consumable assets. The first step in implementing the new system was to identify the supplies needed, standardize them and determine how often deliveries would be made. The JIT implementation team developed a request for proposal (RFP) that incorporated the standardized list of supplies. Three radiology supply vendors were invited to respond to the RFP. The team later determined that only one vendor was capable of implementing the JIT program. A three-year contract was awarded to that vendor. As that three-year contract reached completion, DHMC offered the JIT program to its eight affiliate hospitals and four outpatient clinics. The team decided to re-bid the contract for the entire network, which collectively performed 700,000 radiology exams annually. The new RFP encompassed 90 percent of the network's consumable supplies and offered customized delivery for each facility. The team identified eight criteria necessary for the evaluation of each vendor response to the RFP, rather than use price as the only consideration. The company that won the three-year contract furnished 90 percent of the radiology supplies for the DHMC network, allowing even further savings by the network, particularly for the smaller facilities and clinics. The program is continually monitored, adjusted and enhanced in order to incorporate changing departmental needs.
2015-12-30
This final rule establishes a prior authorization program for certain durable medical equipment, prosthetics, orthotics, and supplies (DMEPOS) items that are frequently subject to unnecessary utilization. This rule defines unnecessary utilization and creates a new requirement that claims for certain DMEPOS items must have an associated provisional affirmed prior authorization decision as a condition of payment. This rule also adds the review contractor's decision regarding prior authorization of coverage of DMEPOS items to the list of actions that are not initial determinations and therefore not appealable.
Lee, Yumi; Song, Sang Hwa; Cheong, Taesu
2018-01-01
In this paper, we examine a real-world case related to the consumer product supply chain to analyze the value of supply chain coordination under the condition of moral hazard. Because of the characteristics of a buyback contract scheme employed in the supply chain, the supplier company's sales department encourages retailers to order more inventory to meet their sales target, whereas retailers pay less attention to their inventory level and leftovers at the end of the season. This condition induces moral hazard problems in the operation of the supply chain, as suppliers suffer from huge returns of leftover inventory. This, in turn, is related to the obsolescence of returned inventory, even with penalty terms in the contract for the return of any leftovers. In this study, we show under the current buyback-based supply chain operation, the inventory levels of both the supplier and retailers exceed customer demand and develop vendor-managed inventory (VMI) system with base stock policy to remove any mismatch of supply and demand. A comparison of both systems shows that through the proper coordination of supply chain operations, both suppliers and retailers can gain additional benefits while providing proper services to end customers.
Power Supply For 25-Watt Arc Lamp
NASA Technical Reports Server (NTRS)
Leighty, B. D.
1985-01-01
Dual-voltage circuitry both strikes and maintains arc. New power supply designed (and several units already in use) that replaces relay/choke combination with solid-state starter. New power supply consists of two main sections. First section (low voltage power supply section) is 84-volt directcurrent supply. Second section (high-voltage starter circuit) is CockroftWalton voltage multiplier. Used as light sources for schlieren, shadowgraph, and other flow-visualization techniques.
Analysis of supply chain management of shallots in Medan
NASA Astrophysics Data System (ADS)
Alam, M. C.; Supriana, T.
2018-02-01
Supply chain is important for business. One of supply chain that needs to be studied is the shallots supply chain. Medan have high demand while the supply of shallots is limited. This study aims to analyze the flow of shallots supply chain distribution in Medan. The method used was survey by using questionnaires to shallots producers, collecting traders, distributors, traders as well as government involved in shallots supply chain. Descriptive analysis was used to explain the shallots supply chain distribution flow. The results showed that there are two shallots supply chain model in Medan that was local shallots model and imported shallots model. Local shallots model could be distinguished based on three producer area, those were models of Medan Marelan, Samosir, and Simalungun. Medan Marelan and Simalungun models have seven supply chains, while the Samosir Model has eight supply chains. This condition indicates that the local shallots supply chain management in Medan was not efficient because of the length of the distribution channel. Supply chain imported shallots was more efficient because it had a shorter distribution flow with five supply chains.
Multiple resonant railgun power supply
Honig, E.M.; Nunnally, W.C.
1985-06-19
A multiple repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. A plurality of serially connected paired parallel rails are powered by similar power supplies. Each supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles. The multiple serial operation permits relatively small energy components to deliver overall relatively large amounts of energy to the projectiles being propelled.
Multiple resonant railgun power supply
Honig, Emanuel M.; Nunnally, William C.
1988-01-01
A multiple repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. A plurality of serially connected paired parallel rails are powered by similar power supplies. Each supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles. The multiple serial operation permits relatively small energy components to deliver overall relatively large amounts of energy to the projectiles being propelled.
Quantifying Supply Risk at a Cellulosic Biorefinery
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hansen, Jason K; Jacobson, Jacob Jordan; Cafferty, Kara Grace
In order to increase the sustainability and security of the nation’s energy supply, the U.S. Department of Energy through its Bioenergy Technology Office has set a vision for one billion tons of biomass to be processed for renewable energy and bioproducts annually by the year 2030. The Renewable Fuels Standard limits the amount of corn grain that can be used in ethanol conversion sold in the U.S, which is already at its maximum. Therefore making the DOE’s vision a reality requires significant growth in the advanced biofuels industry where currently three cellulosic biorefineries convert cellulosic biomass to ethanol. Risk mitigationmore » is central to growing the industry beyond its infancy to a level necessary to achieve the DOE vision. This paper focuses on reducing the supply risk that faces a firm that owns a cellulosic biorefinery. It uses risk theory and simulation modeling to build a risk assessment model based on causal relationships of underlying, uncertain, supply driving variables. Using the model the paper quantifies supply risk reduction achieved by converting the supply chain from a conventional supply system (bales and trucks) to an advanced supply system (depots, pellets, and trains). Results imply that the advanced supply system reduces supply system risk, defined as the probability of a unit cost overrun, from 83% in the conventional system to 4% in the advanced system. Reducing cost risk in this nascent industry improves the odds of realizing desired growth.« less
Beyond the threshold for motion: river channel geometry and grain size reflect sediment supply
NASA Astrophysics Data System (ADS)
Pfeiffer, A.; Finnegan, N. J.; Willenbring, J. K.
2016-12-01
In many gravel-bedded rivers, floods that fill the channel banks create just enough shear stress to move the median-sized gravel particles on the bed surface (D50). Because this observation is common and is supported by theory, the coincidence of bankfull flow and the incipient motion of D50 has become a commonly employed assumption. However, not all natural gravel channels actually conform to this simple relationship; some channels maintain bankfull stresses far in excess of the critical stress required to initiate sediment transport. We use a database of >300 gravel-bedded rivers and >600 10Be-derived erosion rates from across North America to explore the hypothesis that sediment supply drives the magnitude of bankfull shear stress relative to the critical stress required to mobilize the median bed surface grain size. We find that the ratio of bankfull to critical stress is significantly higher in West Coast river reaches (2.47, n= 84) than in river reaches in the rest of the continent (1.03, n = 245). This pattern parallels trends in erosion rates (and hence sediment supplies). Supporting our hypothesis, we find a significant correlation between upstream erosion rate and local τ*bf/τ*c at sites where this comparison is possible. Our analysis reveals a decrease in bed surface armoring with increasing τ*bf/τ*c, suggesting that channels accommodate changes in sediment supply through adjustments in bed surface grain size, as predicted through numerical modeling. Our findings demonstrate that sediment supply is encoded in the bankfull hydraulic geometry of gravel-bedded channels through its control on bed surface grain size.
NASA Astrophysics Data System (ADS)
Marie, I. A.; Sugiarto, D.; Surjasa, D.; Witonohadi, A.
2018-01-01
Automotive battery supply chain include battery manufacturer, sulphuric acid suppliers, polypropylene suppliers, lead suppliers, transportation service providers, warehouses, retailers and even customers. Due to the increasingly dynamic condition of the environment, supply chain actors were required to improve their ability to overcome various uncertainty issues in the environment. This paper aims to describe the process of designing a knowledge management system for risk mitigation in supply chain uncertainty. The design methodology began with the identification of the knowledge needed to solve the problems associated with uncertainty and analysis of system requirements. The design of the knowledge management system was described in the form of a data flow diagram. The results of the study indicated that key knowledge area that needs to be managed were the knowledge to maintain the stability of process in sulphuric acid process and knowledge to overcome the wastes in battery manufacturing process. The system was expected to be a media acquisition, dissemination and storage of knowledge associated with the uncertainty in the battery supply chain and increase the supply chain performance.
1990-10-15
3010 o, AuTOVON 242-3010. - =n~m~m i ma ll lil~ m mm m i mii FOREWORD This futures study presents an analysis and discussion of a program used at the U.S...Operations Research Society, and The Planning Forum . iv CREATING STRATEGIC VISIONS 1 Introduction. The United States Army War College (USAWC) prepares its...consideration and time must be given to a program that attempts to help these potential leaders learn how to create strategic visions. In this paper
G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding
Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza
2014-01-01
Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170
Development of visible light-responsive RNA scissors based on the 10-23 DNAzyme.
Kamiya, Yukiko; Arimura, Yu; Ooi, Hideaki; Kato, Kenjiro; Liang, Xingguo; Asanuma, Hiroyuki
2018-04-22
10-23 DNAzyme is an artificially developed functional oligonucleotide, which can cleave RNA in a sequence-specific manner. In this study, we designed a new photo-driven DNAzyme possessing a photo-responsive DNA overhang complementary to the catalytic core region. The photo-responsive overhang region of the DNAzyme included either azobenzenes (Azos) or 2,6-dimethyl-4-(methylthio)azobenzenes (SDM-Azos) introduced via a D-threoninol linker. When the Azos or SDM-Azos were in the trans form, the photo-responsive DNA overhang hybridized with the DNAzyme, and the RNA cleavage activity was suppressed. Cis isomerization of Azos or SDM-Azos induced by 365 or 400 nm light, respectively, destabilized the duplex between the photo-responsive overhang and the catalytic core, and the DNAzyme recovered RNA cleavage activity. Reversible on and off of the DNAzyme activity was achieved by specific light irradiation. Further, light-dependent on and off of protein expression under the DNAzyme-containing condition was demonstrated. Thus, this photo-driven DNAzyme has potential for application in photo-controlled gene silencing system and a photo-activatable gene expression system. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 45 Public Welfare 3 2013-10-01 2013-10-01 false Supplies. 602.33 Section 602.33 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION UNIFORM ADMINISTRATIVE... the award, and if the supplies are not needed for any other federally sponsored programs or projects...
Code of Federal Regulations, 2012 CFR
2012-10-01
... 45 Public Welfare 3 2012-10-01 2012-10-01 false Supplies. 602.33 Section 602.33 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION UNIFORM ADMINISTRATIVE... the award, and if the supplies are not needed for any other federally sponsored programs or projects...
Code of Federal Regulations, 2014 CFR
2014-10-01
... 45 Public Welfare 3 2014-10-01 2014-10-01 false Supplies. 602.33 Section 602.33 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION UNIFORM ADMINISTRATIVE... the award, and if the supplies are not needed for any other federally sponsored programs or projects...
Code of Federal Regulations, 2010 CFR
2010-10-01
... 45 Public Welfare 3 2010-10-01 2010-10-01 false Supplies. 602.33 Section 602.33 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION UNIFORM ADMINISTRATIVE... the award, and if the supplies are not needed for any other federally sponsored programs or projects...
Code of Federal Regulations, 2011 CFR
2011-10-01
... 45 Public Welfare 3 2011-10-01 2011-10-01 false Supplies. 602.33 Section 602.33 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION UNIFORM ADMINISTRATIVE... the award, and if the supplies are not needed for any other federally sponsored programs or projects...
Code of Federal Regulations, 2011 CFR
2011-10-01
... 44 Emergency Management and Assistance 1 2011-10-01 2011-10-01 false Supplies. 13.33 Section 13.33 Emergency Management and Assistance FEDERAL EMERGENCY MANAGEMENT AGENCY, DEPARTMENT OF HOMELAND SECURITY... GOVERNMENTS Post-Award Requirements Changes, Property, and Subawards § 13.33 Supplies. (a) Title. Title to...
Women, water supply and sanitation: INSTRAW's training initiatives.
Tavares, J
1997-01-01
The International Research and Training Institute for the Advancement of Women (INSTRAW) has worked on women, water supply and sanitation since 1986. The program aims to establish the relationship between women, water supply and sanitation and the promotion of the needs of women and their participation in Water Supply and Sanitation projects. Using a multimedia and modular approach, the training package on Women, Water Supply and Sanitation aims to provide an overview for the different government agencies, engineers, trainers and managers involved in water supply and sanitation projects. The six modules contained in this package include: 1) The International Drinking Water Supply and Sanitation Decade and beyond; 2) The Participation of Women in planning, Choice of Technology and Implementation of Sustainable Water Supply and Sanitation Projects; 3) Role of Women in Hygiene Education and Training Activities for Water Supply and Sanitation Projects; 4) Involvement of Women in Management of Water resources, Water Supply and Waste Disposal; 5) Women and Waste Management; and 6) Evaluation and Monitoring of Water Supply and Sanitation Programs, Projects and the Role of Women. In addition, each module comprises five components including objective description, detailed bibliography, feedback tools for each modular unit, lesson plan and guides for trainers and users, and audiovisual aids. In the face of water scarcity, INSTRAW highlights the importance of women¿s participation in the sustainable use of water supply.
NASA Astrophysics Data System (ADS)
Kongar, N. Elif
2004-12-01
Today, since customers are able to obtain similar-quality products for similar prices, the lead time has become the only preference criterion for most of the consumers. Therefore, it is crucial that the lead time, i.e., the time spent from the raw material phase till the manufactured good reaches the customer, is minimized. This issue can be investigated under the title of Supply Chain Management (SCM). An efficiently managed supply chain can lead to reduced response time for customers. To achieve this, continuous observation of supply chain efficiency, i.e., a constant performance evaluation of the current SCM is required. Widely used conventional performance measurement methods lack the ability to evaluate a SCM since the supply chain is a dynamic system that requires a more thorough and flexible performance measurement technique. Balanced Scorecard (BS) is an efficient tool for measuring the performance of dynamic systems and has a proven capability of providing the decision makers with the appropriate feedback data. In addition to SCM, a relatively new management field, namely reverse supply chain management (RSCM), also necessitates an appropriate evaluation approach. RSCM differs from SCM in many aspects, i.e., the criteria used for evaluation, the high level of uncertainty involved etc., not allowing the usage of identical evaluation techniques used for SCM. This study proposes a generic Balanced Scorecard to measure the performance of supply chain management while defining the appropriate performance measures for SCM. A scorecard prototype, ESCAPE, is presented to demonstrate the evaluation process.
What Happens When the Supply Chain Breaks? Implications for the Army Supply Chain Under Attack
2003-05-22
Supply Chain Integration office with Secretariat level leadership to facilitate DoD Component implementation of supply chain management practices...rather than cyber attack. Tim Belcher, Chief Technology Officer for Riptech, a computer security firm said “It was always assumed that a small group of
Quantitative Measures of Mineral Supply Risk
NASA Astrophysics Data System (ADS)
Long, K. R.
2009-12-01
Almost all metals and many non-metallic minerals are traded internationally. An advantage of global mineral markets is that minerals can be obtained from the globally lowest-cost source. For example, one rare-earth element (REE) mine in China, Bayan Obo, is able to supply most of world demand for rare earth elements at a cost significantly less than its main competitors. Concentration of global supplies at a single mine raises significant political risks, illustrated by China’s recent decision to prohibit the export of some REEs and severely limit the export of others. The expected loss of REE supplies will have a significant impact on the cost and production of important national defense technologies and on alternative energy programs. Hybrid vehicles and wind-turbine generators, for example, require REEs for magnets and batteries. Compact fluorescent light bulbs use REE-based phosphors. These recent events raise the general issue of how to measure the degree of supply risk for internationally sourced minerals. Two factors, concentration of supply and political risk, must first be addressed. Concentration of supply can be measured with standard economic tools for measuring industry concentration, using countries rather than firms as the unit of analysis. There are many measures of political risk available. That of the OECD is a measure of a country’s commitment to rule-of-law and enforcement of contracts, as well as political stability. Combining these measures provides a comparative view of mineral supply risk across commodities and identifies several minerals other than REEs that could suddenly become less available. Combined with an assessment of the impact of a reduction in supply, decision makers can use these measures to prioritize risk reduction efforts.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 34 Education 1 2010-07-01 2010-07-01 false Supplies. 80.33 Section 80.33 Education Office of the Secretary, Department of Education UNIFORM ADMINISTRATIVE REQUIREMENTS FOR GRANTS AND COOPERATIVE AGREEMENTS... supplies exceeding $5,000 in total aggregate fair market value upon termination or completion of the award...
42 CFR 84.130 - Supplied-air respirators; description.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 42 Public Health 1 2014-10-01 2014-10-01 false Supplied-air respirators; description. 84.130... SAFETY AND HEALTH RESEARCH AND RELATED ACTIVITIES APPROVAL OF RESPIRATORY PROTECTIVE DEVICES Supplied-Air Respirators § 84.130 Supplied-air respirators; description. Supplied-air respirators, including all completely...
42 CFR 84.130 - Supplied-air respirators; description.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 42 Public Health 1 2013-10-01 2013-10-01 false Supplied-air respirators; description. 84.130... SAFETY AND HEALTH RESEARCH AND RELATED ACTIVITIES APPROVAL OF RESPIRATORY PROTECTIVE DEVICES Supplied-Air Respirators § 84.130 Supplied-air respirators; description. Supplied-air respirators, including all completely...
48 CFR 46.316 - Responsibility for supplies.
Code of Federal Regulations, 2010 CFR
2010-10-01
... supplies. 46.316 Section 46.316 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION CONTRACT MANAGEMENT QUALITY ASSURANCE Contract Clauses 46.316 Responsibility for supplies. The contracting officer shall insert the clause at 52.246-16, Responsibility for Supplies, in solicitations and contracts...
Lee, Yumi; Song, Sang Hwa
2018-01-01
In this paper, we examine a real-world case related to the consumer product supply chain to analyze the value of supply chain coordination under the condition of moral hazard. Because of the characteristics of a buyback contract scheme employed in the supply chain, the supplier company’s sales department encourages retailers to order more inventory to meet their sales target, whereas retailers pay less attention to their inventory level and leftovers at the end of the season. This condition induces moral hazard problems in the operation of the supply chain, as suppliers suffer from huge returns of leftover inventory. This, in turn, is related to the obsolescence of returned inventory, even with penalty terms in the contract for the return of any leftovers. In this study, we show under the current buyback-based supply chain operation, the inventory levels of both the supplier and retailers exceed customer demand and develop vendor-managed inventory (VMI) system with base stock policy to remove any mismatch of supply and demand. A comparison of both systems shows that through the proper coordination of supply chain operations, both suppliers and retailers can gain additional benefits while providing proper services to end customers. PMID:29547625
Organization and scaling in water supply networks
NASA Astrophysics Data System (ADS)
Cheng, Likwan; Karney, Bryan W.
2017-12-01
Public water supply is one of the society's most vital resources and most costly infrastructures. Traditional concepts of these networks capture their engineering identity as isolated, deterministic hydraulic units, but overlook their physics identity as related entities in a probabilistic, geographic ensemble, characterized by size organization and property scaling. Although discoveries of allometric scaling in natural supply networks (organisms and rivers) raised the prospect for similar findings in anthropogenic supplies, so far such a finding has not been reported in public water or related civic resource supplies. Examining an empirical ensemble of large number and wide size range, we show that water supply networks possess self-organized size abundance and theory-explained allometric scaling in spatial, infrastructural, and resource- and emission-flow properties. These discoveries establish scaling physics for water supply networks and may lead to novel applications in resource- and jurisdiction-scale water governance.
Golden, Christopher D.; Mozaffarian, Dariush
2016-01-01
Insufficient data exist for accurate estimation of global nutrient supplies. Commonly used global datasets contain key weaknesses: 1) data with global coverage, such as the FAO food balance sheets, lack specific information about many individual foods and no information on micronutrient supplies nor heterogeneity among subnational populations, while 2) household surveys provide a closer approximation of consumption, but are often not nationally representative, do not commonly capture many foods consumed outside of the home, and only provide adequate information for a few select populations. Here, we attempt to improve upon these datasets by constructing a new model—the Global Expanded Nutrient Supply (GENuS) model—to estimate nutrient availabilities for 23 individual nutrients across 225 food categories for thirty-four age-sex groups in nearly all countries. Furthermore, the model provides historical trends in dietary nutritional supplies at the national level using data from 1961–2011. We determine supplies of edible food by expanding the food balance sheet data using FAO production and trade data to increase food supply estimates from 98 to 221 food groups, and then estimate the proportion of major cereals being processed to flours to increase to 225. Next, we estimate intake among twenty-six demographic groups (ages 20+, both sexes) in each country by using data taken from the Global Dietary Database, which uses nationally representative surveys to relate national averages of food consumption to individual age and sex-groups; for children and adolescents where GDD data does not yet exist, average calorie-adjusted amounts are assumed. Finally, we match food supplies with nutrient densities from regional food composition tables to estimate nutrient supplies, running Monte Carlo simulations to find the range of potential nutrient supplies provided by the diet. To validate our new method, we compare the GENuS estimates of nutrient supplies against independent
Smith, Matthew R; Micha, Renata; Golden, Christopher D; Mozaffarian, Dariush; Myers, Samuel S
2016-01-01
Insufficient data exist for accurate estimation of global nutrient supplies. Commonly used global datasets contain key weaknesses: 1) data with global coverage, such as the FAO food balance sheets, lack specific information about many individual foods and no information on micronutrient supplies nor heterogeneity among subnational populations, while 2) household surveys provide a closer approximation of consumption, but are often not nationally representative, do not commonly capture many foods consumed outside of the home, and only provide adequate information for a few select populations. Here, we attempt to improve upon these datasets by constructing a new model--the Global Expanded Nutrient Supply (GENuS) model--to estimate nutrient availabilities for 23 individual nutrients across 225 food categories for thirty-four age-sex groups in nearly all countries. Furthermore, the model provides historical trends in dietary nutritional supplies at the national level using data from 1961-2011. We determine supplies of edible food by expanding the food balance sheet data using FAO production and trade data to increase food supply estimates from 98 to 221 food groups, and then estimate the proportion of major cereals being processed to flours to increase to 225. Next, we estimate intake among twenty-six demographic groups (ages 20+, both sexes) in each country by using data taken from the Global Dietary Database, which uses nationally representative surveys to relate national averages of food consumption to individual age and sex-groups; for children and adolescents where GDD data does not yet exist, average calorie-adjusted amounts are assumed. Finally, we match food supplies with nutrient densities from regional food composition tables to estimate nutrient supplies, running Monte Carlo simulations to find the range of potential nutrient supplies provided by the diet. To validate our new method, we compare the GENuS estimates of nutrient supplies against independent
Barth, Johannes; Boutsiadis, Achilleas; Narbona, Pablo; Lädermann, Alexandre; Arrigoni, Paolo; Adams, Christopher R; Burkhart, Stephen S; Denard, Patrick J
2017-07-01
The aim of this study was to find reliable anatomic landmarks of the normal acromioclavicular joint (ACJ) that could enable the precise evaluation of the horizontal displacement of the clavicle after dislocation. The hypothesis was that the anterior borders of the acromion and the clavicle are always aligned in intact ACJs. In 30 cadaveric specimens, the anterior and posterior borders of the ACJ's articular facets and the most prominent anterior and posterior bony landmarks of the acromion and the clavicle were identified. The anterior and posterior overhang of the acromion and the clavicle was measured in relation to the borders of the articular facets. Therefore, the possible anterior and posterior alignment of the ACJ was evaluated. Anteriorly, only 18 ACJs (60%) were aligned whereas 7 (24%) had major overhang of the acromion and 3 (10%) had major overhang of the clavicle. Similarly, 18 cases (60%) were posteriorly aligned, whereas 6 (20%) had major clavicular overhang and 4 (14%) had major overhang of the acromion. In 78% of these cases, the ACJ was aligned as well anteriorly as posteriorly (P < .001). Finally, the larger the width of the acromion (P = .032) or the clavicle (P = .049), the better the posterior joint alignment. Our hypothesis was not verified. The acromion and clavicle are not perfectly aligned in a significant number of specimens with intact ACJs (40% of cases). The most reliable landmarks remain their articular facets. Copyright © 2017 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.
Leading a supply chain turnaround.
Slone, Reuben E
2004-10-01
Just five years ago, salespeople at Whirlpool were in the habit of referring to their supply chain organization as the "sales disablers." Now the company excels at getting products to the right place at the right time--while managing to keep inventories low. How did that happen? In this first-person account, Reuben Slone, Whirlpool's vice president of Global Supply Chain, describes how he and his colleagues devised the right supply chain strategy, sold it internally, and implemented it. Slone insisted that the right focal point for the strategy was the satisfaction of consumers at the end of the supply chain. Most supply chain initiatives do the opposite: They start with the realities of a company's manufacturing base and proceed from there. Through a series of interviews with trade customers large and small, his team identified 27 different capabilities that drove industry perceptions of Whirlpool's performance. Knowing it was infeasible to aim for world-class performance across all of them, Slone weighed the costs of excelling at each and found the combination of initiatives that would provide overall competitive advantage. A highly disciplined project management office and broad training in project management were key to keeping work on budget and on benefit. Slone set an intense pace--three "releases" of new capabilities every month--that the group maintains to this day. Lest this seem like a technology story, however, Slone insists it is just as much a "talent renaissance." People are proud today to be part of Whirlpool's supply chain organization, and its new generation of talent will give the company a competitive advantage for years to come.
Apollo-taking the lead in telomere protection.
Sarthy, Jay F; Baumann, Peter
2010-08-27
The single-stranded overhangs at the ends of telomeres are thought to be critical for telomere maintenance, but how they are generated has been largely unclear. Two studies (one in this issue of Molecular Cell, Wu et al., 2010) have now implicated the Apollo nuclease in maintaining the overhang specifically at those telomeres generated by leading-strand DNA synthesis. Copyright (c) 2010 Elsevier Inc. All rights reserved.
23 CFR 140.908 - Materials and supplies.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 23 Highways 1 2013-04-01 2013-04-01 false Materials and supplies. 140.908 Section 140.908 Highways FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION PAYMENT PROCEDURES REIMBURSEMENT Reimbursement for Railroad Work § 140.908 Materials and supplies. (a) Procurement. Materials and supplies, if...
23 CFR 140.908 - Materials and supplies.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 23 Highways 1 2014-04-01 2014-04-01 false Materials and supplies. 140.908 Section 140.908 Highways FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION PAYMENT PROCEDURES REIMBURSEMENT Reimbursement for Railroad Work § 140.908 Materials and supplies. (a) Procurement. Materials and supplies, if...
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Supplies. 1403.33 Section 1403.33 Food and Drugs OFFICE OF NATIONAL DRUG CONTROL POLICY UNIFORM ADMINISTRATIVE REQUIREMENTS FOR GRANTS AND COOPERATIVE... supplies exceeding $5,000 in total aggregate fair market value upon termination or completion of the award...
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 9 2011-04-01 2011-04-01 false Supplies. 1403.33 Section 1403.33 Food and Drugs OFFICE OF NATIONAL DRUG CONTROL POLICY UNIFORM ADMINISTRATIVE REQUIREMENTS FOR GRANTS AND COOPERATIVE... supplies exceeding $5,000 in total aggregate fair market value upon termination or completion of the award...
Code of Federal Regulations, 2010 CFR
2010-07-01
... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Supplies. 1207.33 Section 1207.33 Parks, Forests, and Public Property NATIONAL ARCHIVES AND RECORDS ADMINISTRATION GENERAL RULES... aggregate fair market value upon termination or completion of the award, and if the supplies are not needed...
Urban community perception towards intermittent water supply system.
Joshi, M W; Talkhande, A V; Andey, S P; Kelkar, P S
2002-04-01
While evaluating intermittent and continuous water supply systems, consumers opinion survey was undertaken for critical appraisal of both modes of operation. With the help of a pre-designed set of questions relating to various aspects of water supply and the opinion of consumers regarding degree of service, a house to house survey was conducted in the study area of Ghaziabad and Jaipur. The consumer opinion survey clearly indicated a satisfactory degree of service wherever adequate quantity of water was made available irrespective of the mode of water supply. Number of complaints regarding quality of water supplied, timings of supply, low pressures and breakdowns in supply were reported during intermittent water supply. Every family stored water for drinking and other uses. Most of the families discard drinking water once the fresh water supply is resumed next day. Discarded drinking water is usually used in kitchen for washing and gardening. Storage for other purposes depends on economic status and availability of other sources like open dug well in the house. While most of the respondents had no complaints on water tariff, all of them were in favour of continuous water supply.
Exploration Supply Chain Simulation
NASA Technical Reports Server (NTRS)
2008-01-01
The Exploration Supply Chain Simulation project was chartered by the NASA Exploration Systems Mission Directorate to develop a software tool, with proper data, to quantitatively analyze supply chains for future program planning. This tool is a discrete-event simulation that uses the basic supply chain concepts of planning, sourcing, making, delivering, and returning. This supply chain perspective is combined with other discrete or continuous simulation factors. Discrete resource events (such as launch or delivery reviews) are represented as organizational functional units. Continuous resources (such as civil service or contractor program functions) are defined as enabling functional units. Concepts of fixed and variable costs are included in the model to allow the discrete events to interact with cost calculations. The definition file is intrinsic to the model, but a blank start can be initiated at any time. The current definition file is an Orion Ares I crew launch vehicle. Parameters stretch from Kennedy Space Center across and into other program entities (Michaud Assembly Facility, Aliant Techsystems, Stennis Space Center, Johnson Space Center, etc.) though these will only gain detail as the file continues to evolve. The Orion Ares I file definition in the tool continues to evolve, and analysis from this tool is expected in 2008. This is the first application of such business-driven modeling to a NASA/government-- aerospace contractor endeavor.
Teleconnected food supply shocks
NASA Astrophysics Data System (ADS)
Bren d'Amour, Christopher; Wenz, Leonie; Kalkuhl, Matthias; Steckel, Jan Christoph; Creutzig, Felix
2016-03-01
The 2008-2010 food crisis might have been a harbinger of fundamental climate-induced food crises with geopolitical implications. Heat-wave-induced yield losses in Russia and resulting export restrictions led to increases in market prices for wheat across the Middle East, likely contributing to the Arab Spring. With ongoing climate change, temperatures and temperature variability will rise, leading to higher uncertainty in yields for major nutritional crops. Here we investigate which countries are most vulnerable to teleconnected supply-shocks, i.e. where diets strongly rely on the import of wheat, maize, or rice, and where a large share of the population is living in poverty. We find that the Middle East is most sensitive to teleconnected supply shocks in wheat, Central America to supply shocks in maize, and Western Africa to supply shocks in rice. Weighing with poverty levels, Sub-Saharan Africa is most affected. Altogether, a simultaneous 10% reduction in exports of wheat, rice, and maize would reduce caloric intake of 55 million people living in poverty by about 5%. Export bans in major producing regions would put up to 200 million people below the poverty line at risk, 90% of which live in Sub-Saharan Africa. Our results suggest that a region-specific combination of national increases in agricultural productivity and diversification of trade partners and diets can effectively decrease future food security risks.
21 CFR 864.9050 - Blood bank supplies.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Blood bank supplies. 864.9050 Section 864.9050...) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Products Used In Establishments That Manufacture Blood and Blood Products § 864.9050 Blood bank supplies. (a) Identification. Blood bank supplies are general...
21 CFR 864.9050 - Blood bank supplies.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Blood bank supplies. 864.9050 Section 864.9050...) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Products Used In Establishments That Manufacture Blood and Blood Products § 864.9050 Blood bank supplies. (a) Identification. Blood bank supplies are general...
21 CFR 864.9050 - Blood bank supplies.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Blood bank supplies. 864.9050 Section 864.9050...) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Products Used In Establishments That Manufacture Blood and Blood Products § 864.9050 Blood bank supplies. (a) Identification. Blood bank supplies are general...
41 CFR 101-30.404 - Supply support.
Code of Federal Regulations, 2011 CFR
2011-07-01
... Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 30-FEDERAL CATALOG SYSTEM 30.4-Use of the Federal Catalog System § 101-30.404 Supply support. Civilian agencies requiring supply... is in the GSA Handbook, Federal Catalog System-Logistics Data (FPMR 101-30.3), issued by the...
41 CFR 101-30.404 - Supply support.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 30-FEDERAL CATALOG SYSTEM 30.4-Use of the Federal Catalog System § 101-30.404 Supply support. Civilian agencies requiring supply... is in the GSA Handbook, Federal Catalog System-Logistics Data (FPMR 101-30.3), issued by the...
41 CFR 101-30.404 - Supply support.
Code of Federal Regulations, 2012 CFR
2012-07-01
... Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 30-FEDERAL CATALOG SYSTEM 30.4-Use of the Federal Catalog System § 101-30.404 Supply support. Civilian agencies requiring supply... is in the GSA Handbook, Federal Catalog System-Logistics Data (FPMR 101-30.3), issued by the...
41 CFR 101-30.404 - Supply support.
Code of Federal Regulations, 2014 CFR
2014-07-01
... Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 30-FEDERAL CATALOG SYSTEM 30.4-Use of the Federal Catalog System § 101-30.404 Supply support. Civilian agencies requiring supply... is in the GSA Handbook, Federal Catalog System-Logistics Data (FPMR 101-30.3), issued by the...
41 CFR 101-30.404 - Supply support.
Code of Federal Regulations, 2013 CFR
2013-07-01
... Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 30-FEDERAL CATALOG SYSTEM 30.4-Use of the Federal Catalog System § 101-30.404 Supply support. Civilian agencies requiring supply... is in the GSA Handbook, Federal Catalog System-Logistics Data (FPMR 101-30.3), issued by the...
29 CFR 1910.425 - Surface-supplied air diving.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 29 Labor 5 2013-07-01 2013-07-01 false Surface-supplied air diving. 1910.425 Section 1910.425... Procedures § 1910.425 Surface-supplied air diving. (a) General. Employers engaged in surface-supplied air...-supplied air diving shall not be conducted at depths deeper than 190 fsw, except that dives with bottom...
29 CFR 1910.425 - Surface-supplied air diving.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 29 Labor 5 2012-07-01 2012-07-01 false Surface-supplied air diving. 1910.425 Section 1910.425... Procedures § 1910.425 Surface-supplied air diving. (a) General. Employers engaged in surface-supplied air...-supplied air diving shall not be conducted at depths deeper than 190 fsw, except that dives with bottom...
29 CFR 1910.425 - Surface-supplied air diving.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 29 Labor 5 2010-07-01 2010-07-01 false Surface-supplied air diving. 1910.425 Section 1910.425... Procedures § 1910.425 Surface-supplied air diving. (a) General. Employers engaged in surface-supplied air...-supplied air diving shall not be conducted at depths deeper than 190 fsw, except that dives with bottom...
29 CFR 1910.425 - Surface-supplied air diving.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 29 Labor 5 2011-07-01 2011-07-01 false Surface-supplied air diving. 1910.425 Section 1910.425... Procedures § 1910.425 Surface-supplied air diving. (a) General. Employers engaged in surface-supplied air...-supplied air diving shall not be conducted at depths deeper than 190 fsw, except that dives with bottom...
Using Water Transfers to Manage Supply Risk
NASA Astrophysics Data System (ADS)
Characklis, G. W.
2007-12-01
Most cities currently rely on water supplies with sufficient capacity to meet demand under almost all conditions. However, the rising costs of water supply development make the maintenance of infrequently used excess capacity increasingly expensive, and more utilities are considering the use of water transfers as a means of more cost effectively meeting demand under drought conditions. Transfers can take place between utilities, as well as different user groups (e.g., municipal and agricultural), and can involve both treated and untreated water. In cases where both the "buyer" and "seller" draw water from the same supply, contractual agreements alone can facilitate a transfer, but in other cases new infrastructure (e.g., pipelines) will be required. Developing and valuing transfer agreements and/or infrastructure investments requires probabilistic supply/demand analyses that incorporate elements of both hydrology and economics. The complexity of these analyses increases as more sophisticated types of agreements (e. g., options) are considered, and as utilities begin to consider how to integrate transfers into long-term planning efforts involving a more diversified portfolio of supply assets. This discussion will revolve around the methods used to develop minimum (expected) cost portfolios of supply assets that meet specified reliability goals. Two different case studies, one in both the eastern and western U.S., will be described with attention to: the role that transfers can play in reducing average supply costs; tradeoffs between costs and supply reliability, and; the effects of different transfer agreement types on the infrastructure capacity required to complete the transfers. Results will provide insights into the cost savings potential of more flexible water supply strategies.
Guragai, B; Takizawa, S; Hashimoto, T; Oguma, K
2017-12-01
To investigate the effects of unequal supply hours on consumers' coping strategies and perceptions of the intermittent water supply (IWS) in the Kathmandu Valley (KV), Nepal we conducted a randomized household survey (n=369) and on-site water quality tests. Half of the households received piped water for 6 or fewer hours per week. To augment or cope with the inadequate supply, 28% of the households used highly contaminated and expensive tanker-delivered water. Half of the piped water samples (n=13) were contaminated with Escherichia coli. Free chlorine concentration in all piped water samples was below the national standards (0.1-0.2mg/L), but combined chlorine was detected at an average of 0.24mg/L, indicating ingression of contaminants in the network. Point-of-use devices could increase access to safe water in the KV from 42% to 80%. The use of Lorenz curves and Gini coefficients revealed inequality of piped water supply hours per week both between and within service areas in the KV, due mainly to a small percentage of households who receive longer supply hours. To cope with reduced supply hours, home owners pay more to get water from alternative sources, while tenants compromise their water consumption. Under IWS, expectations for improvements in piped water quality and supply regularity are higher than those for supply volume. Consumers' perceptions of the piped water services worsen with the reduction in supply hours, but perceptions of piped water tariff are independent of supply hours. Copyright © 2017 Elsevier B.V. All rights reserved.
2016-03-29
Army Engineering and Support Center, Huntsville, Price Reasonableness Determinations for Federal Supply Schedule Orders for Supplies Need...0207.000) │ i Results in Brief U.S. Army Engineering and Support Center, Huntsville, Price Reasonableness Determinations for Federal Supply Schedule...Orders for Supplies Need Improvement Visit us at www.dodig.mil March 29, 2016 Objective We determined whether U.S. Army Corps of Engineers contracting
NASA Astrophysics Data System (ADS)
Characklis, G. W.; Ramsey, J.
2004-12-01
Water scarcity has become a reality in many areas as a result of population growth, fewer available sources, and reduced tolerance for the environmental impacts of developing the new supplies that do exist. As a result, successfully managing future water supply risk will become more dependent on coordinating the use of existing resources. Toward that end, flexible supply strategies that can rapidly respond to hydrologic variability will provide communities with increasing economic advantages, particularly if the frequency of more extreme events (e.g., drought) increases due to global climate change. Markets for established commodities (e.g., oil, gas) often provide a framework for efficiently responding to changes in supply and demand. Water markets, however, have remained relatively crude, with most transactions involving permanent transfers and long regulatory processes. Recently, interest in the use of flexible short-term transfers (e.g., leases, options) has begun to motivate consideration of more sophisticated strategies for managing supply risk, strategies similar to those used in more mature markets. In this case, communities can benefit from some of the advantages that water enjoys over other commodities, in particular, the ability to accurately characterize the stochastic nature of supply and demand through hydrologic modeling. Hydrologic-economic models are developed for two different water scarce regions supporting active water markets: Edward Aquifer and Lower Rio Grande Valley. These models are used to construct portfolios of water supply transfers (e.g., permanent transfers, options, and spot leases) that minimize the cost of meeting a probabilistic reliability constraint. Real and simulated spot price distributions allow each type of transfer to be priced in a manner consistent with financial theory (e.g., Black-Scholes). Market simulations are integrated with hydrologic models such that variability in supply and demand are linked with price behavior
Emergency Food Supplies in Food Secure Households.
Golem, Devon L; Byrd-Bredbenner, Carol
2015-08-01
Introduction Limited food supply paired with reduced access to food during emergency disasters can lead to malnutrition. To date, research evaluating the adequacy of household emergency food supplies relies on self-reported data from surveys and has not been measured objectively in households in the United States. The main objective of this study was to describe household calorie availability and nutrient density in a normal situation and to project changes that could occur when emergencies (eg, natural disasters) restrict replenishment of food supplies and disrupt water and/or energy needed for food preparation and storage. Hypothesis The calorie availability of the food supply within households in New Jersey (USA) is anticipated to be well above the recommended 3-day period. However, it is anticipated that the nutritional density of the food supply within these households will be negative. Additionally, the disaster-related factors that diminish the ability to consume stored food (eg, lack of water, power for cooking, and/or proper storage) will further reduce the caloric and nutritional adequacy of the household food supply. The household food supplies of 100 food secure families in New Jersey were inventoried at a non-emergency point in time. The number of days that the inventoried food supply would provide all household members 100% of the daily value (DV) for calories and other nutrients was determined. Additionally, the effects of water and power shortages on nutritional availability of household food supply were estimated. The households had an average of 33.16 days (SD=21.97; range=8.14-125.17 days) of calories at 100% DV for all household members. Lack of water, energy for cooking, or both would render a decrease in the total household calories by 28%, 35%, or 38%, respectively. Loss of power for greater than five days would reduce availability of household calories by 27%. A positive nutrient density was observed with and without the food
Unifying the DNA End-processing Roles of the Artemis Nuclease
Chang, Howard H. Y.; Watanabe, Go; Lieber, Michael R.
2015-01-01
Artemis is a member of the metallo-β-lactamase protein family of nucleases. It is essential in vertebrates because, during V(D)J recombination, the RAG complex generates hairpins when it creates the double strand breaks at V, D, and J segments, and Artemis is required to open the hairpins so that they can be joined. Artemis is a diverse endo- and exonuclease, and creating a unified model for its wide range of nuclease properties has been challenging. Here we show that Artemis resects iteratively into blunt DNA ends with an efficiency that reflects the AT-richness of the DNA end. GC-rich ends are not cut by Artemis alone because of a requirement for DNA end breathing (and confirmed using fixed pseudo-Y structures). All DNA ends are cut when both the DNA-dependent protein kinase catalytic subunit and Ku accompany Artemis but not when Ku is omitted. These are the first biochemical data demonstrating a Ku dependence of Artemis action on DNA ends of any configuration. The action of Artemis at blunt DNA ends is slower than at overhangs, consistent with a requirement for a slow DNA end breathing step preceding the cut. The AT sequence dependence, the order of strand cutting, the length of the cuts, and the Ku-dependence of Artemis action at blunt ends can be reconciled with the other nucleolytic properties of both Artemis and Artemis·DNA-PKcs in a model incorporating DNA end breathing of blunt ends to form transient single to double strand boundaries that have structural similarities to hairpins and fixed 5′ and 3′ overhangs. PMID:26276388
19 CFR 358.103 - Importation of supplies.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 19 Customs Duties 3 2010-04-01 2010-04-01 false Importation of supplies. 358.103 Section 358.103 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE SUPPLIES FOR USE IN EMERGENCY RELIEF WORK § 358.103 Importation of supplies. (a) Where the President, acting under section 318 of the...
34 CFR 76.661 - Equipment and supplies.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 34 Education 1 2010-07-01 2010-07-01 false Equipment and supplies. 76.661 Section 76.661 Education... Equipment and supplies. (a) Under some program statutes, a public agency must keep title to and exercise continuing administrative control of all equipment and supplies that the subgrantee acquires with program...
Pharmaceutical supply chain risks: a systematic review
2013-01-01
Introduction Supply of medicine as a strategic product in any health system is a top priority. Pharmaceutical companies, a major player of the drug supply chain, are subject to many risks. These risks disrupt the supply of medicine in many ways such as their quantity and quality and their delivery to the right place and customers and at the right time. Therefore risk identification in the supply process of pharmaceutical companies and mitigate them is highly recommended. Objective In this study it is attempted to investigate pharmaceutical supply chain risks with perspective of manufacturing companies. Methods Scopus, PubMed, Web of Science bibliographic databases and Google scholar scientific search engines were searched for pharmaceutical supply chain risk management studies with 6 different groups of keywords. All results found by keywords were reviewed and none-relevant articles were excluded by outcome of interests and researcher boundaries of study within 4 steps and through a systematic method. Results Nine articles were included in the systematic review and totally 50 main risks based on study outcome of interest extracted which classified in 7 categories. Most of reported risks were related to supply and supplier issues. Organization and strategy issues, financial, logistic, political, market and regulatory issues were in next level of importance. Conclusion It was shown that the majority of risks in pharmaceutical supply chain were internal risks due to processes, people and functions mismanagement which could be managed by suitable mitigation strategies. PMID:24355166
Pharmaceutical supply chain risks: a systematic review.
Jaberidoost, Mona; Nikfar, Shekoufeh; Abdollahiasl, Akbar; Dinarvand, Rassoul
2013-12-19
Supply of medicine as a strategic product in any health system is a top priority. Pharmaceutical companies, a major player of the drug supply chain, are subject to many risks. These risks disrupt the supply of medicine in many ways such as their quantity and quality and their delivery to the right place and customers and at the right time. Therefore risk identification in the supply process of pharmaceutical companies and mitigate them is highly recommended. In this study it is attempted to investigate pharmaceutical supply chain risks with perspective of manufacturing companies. Scopus, PubMed, Web of Science bibliographic databases and Google scholar scientific search engines were searched for pharmaceutical supply chain risk management studies with 6 different groups of keywords. All results found by keywords were reviewed and none-relevant articles were excluded by outcome of interests and researcher boundaries of study within 4 steps and through a systematic method. Nine articles were included in the systematic review and totally 50 main risks based on study outcome of interest extracted which classified in 7 categories. Most of reported risks were related to supply and supplier issues. Organization and strategy issues, financial, logistic, political, market and regulatory issues were in next level of importance. It was shown that the majority of risks in pharmaceutical supply chain were internal risks due to processes, people and functions mismanagement which could be managed by suitable mitigation strategies.
46 CFR 197.432 - Surface-supplied air diving.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 46 Shipping 7 2012-10-01 2012-10-01 false Surface-supplied air diving. 197.432 Section 197.432...-supplied air diving. The diving supervisor shall insure that— (a) Surface-supplied air diving is conducted... space; and (f) The surface-supplied air diver has the equipment required by § 197.346 (b) or (d). ...
46 CFR 197.432 - Surface-supplied air diving.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 46 Shipping 7 2013-10-01 2013-10-01 false Surface-supplied air diving. 197.432 Section 197.432...-supplied air diving. The diving supervisor shall insure that— (a) Surface-supplied air diving is conducted... space; and (f) The surface-supplied air diver has the equipment required by § 197.346 (b) or (d). ...
46 CFR 197.432 - Surface-supplied air diving.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Surface-supplied air diving. 197.432 Section 197.432...-supplied air diving. The diving supervisor shall insure that— (a) Surface-supplied air diving is conducted... space; and (f) The surface-supplied air diver has the equipment required by § 197.346 (b) or (d). ...
46 CFR 197.432 - Surface-supplied air diving.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 46 Shipping 7 2011-10-01 2011-10-01 false Surface-supplied air diving. 197.432 Section 197.432...-supplied air diving. The diving supervisor shall insure that— (a) Surface-supplied air diving is conducted... space; and (f) The surface-supplied air diver has the equipment required by § 197.346 (b) or (d). ...
42 CFR 84.131 - Supplied-air respirators; required components.
Code of Federal Regulations, 2010 CFR
2010-10-01
...) Facepiece, hood, or helmet; (2) Air supply valve, orifice, or demand or pressure-demand regulator; (3) Hand... 42 Public Health 1 2010-10-01 2010-10-01 false Supplied-air respirators; required components. 84... Supplied-Air Respirators § 84.131 Supplied-air respirators; required components. (a) Each supplied-air...
ERIC Educational Resources Information Center
Qrunfleh, Sufian M.
2010-01-01
Over the past decade, an important focus of researchers has been on supply chain management (SCM), as many organizations believe that effective SCM is the key to building and sustaining competitive advantage for their products/services. To manage the supply chain, companies need to adopt an SCM strategy (SCMS) and implement appropriate SCM…
Contingent approach to Internet-based supply network integration
NASA Astrophysics Data System (ADS)
Ho, Jessica; Boughton, Nick; Kehoe, Dennis; Michaelides, Zenon
2001-10-01
The Internet is playing an increasingly important role in enhancing the operations of supply networks as many organizations begin to recognize the benefits of Internet- enabled supply arrangements. However, the developments and applications to-date do not extend significantly beyond the dyadic model, whereas the real advantages are to be made with the external and network models to support a coordinated and collaborative based approach. The DOMAIN research group at the University of Liverpool is currently defining new Internet- enabled approaches to enable greater collaboration across supply chains. Different e-business models and tools are focusing on different applications. Using inappropriate e- business models, tools or techniques will bring negative results instead of benefits to all the tiers in the supply network. Thus there are a number of issues to be considered before addressing Internet based supply network integration, in particular an understanding of supply chain management, the emergent business models and evaluating the effects of deploying e-business to the supply network or a particular tier. It is important to utilize a contingent approach to selecting the right e-business model to meet the specific supply chain requirements. This paper addresses the issues and provides a case study on the indirect materials supply networks.
Squaring the circle of healthcare supplies.
Böhme, Tillmann; Williams, Sharon; Childerhouse, Paul; Deakins, Eric; Towill, Denis
2014-01-01
The purpose of this paper is to use a systems lens to assess the comparative performance of healthcare supply chains and provide guidance for their improvement. A well-established and rigorous multi-method audit methodology, based on the uncertainty circle model, yields an objective assessment of value stream performance in eight Australasian public sector hospitals. Cause-effect analysis identifies the major barriers to achieving smooth, seamless flows. Potentially high-leverage remedial actions identified using systems thinking are examined with the aid of an exemplar case. The majority of the healthcare value streams studied are underperforming compared with those in the European automotive industry. Every public hospital appears to be caught in the grip of vicious circles of system uncertainty, in large part being caused by problems of their own making. The single exception is making good progress towards seamless functional integration, which has been achieved by elevating supply chain management to a core competence; having a clearly articulated supply chain vision; adopting a systems approach; and, managing supplies with accurate information. The small number of cases limits the generalisability of the findings at this time. Hospital supply chain managers endeavouring to achieve smooth and seamless supply flows should attempt to elevate the status of supplies management within their organisation to that of a core competence, and should use accurate information to manage their value streams holistically as a set of interwoven processes. A four-level prism model is proposed as a useful framework for thus improving healthcare supply delivery systems. Material flow concepts originally developed to provide objective assessments of value stream performance in commercial settings are adapted for use in a healthcare setting. The ability to identify exemplar organisations via a context-free uncertainty measure, and to use systems thinking to identify high
47 CFR 80.963 - Main power supply.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 47 Telecommunication 5 2010-10-01 2010-10-01 false Main power supply. 80.963 Section 80.963... MARITIME SERVICES Radiotelephone Installation Required for Vessels on the Great Lakes § 80.963 Main power supply. (a) A main power supply must be available at all times while the vessel is subject to the...
47 CFR 80.963 - Main power supply.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 47 Telecommunication 5 2011-10-01 2011-10-01 false Main power supply. 80.963 Section 80.963... MARITIME SERVICES Radiotelephone Installation Required for Vessels on the Great Lakes § 80.963 Main power supply. (a) A main power supply must be available at all times while the vessel is subject to the...
47 CFR 80.965 - Reserve power supply.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 47 Telecommunication 5 2011-10-01 2011-10-01 false Reserve power supply. 80.965 Section 80.965... power supply. (a) Each passenger vessel of more than 100 gross tons and each cargo vessel of more than 300 gross tons must be provided with a reserve power supply independent of the vessel's normal...
47 CFR 80.965 - Reserve power supply.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 47 Telecommunication 5 2010-10-01 2010-10-01 false Reserve power supply. 80.965 Section 80.965... power supply. (a) Each passenger vessel of more than 100 gross tons and each cargo vessel of more than 300 gross tons must be provided with a reserve power supply independent of the vessel's normal...
Creating visual explanations improves learning.
Bobek, Eliza; Tversky, Barbara
2016-01-01
Many topics in science are notoriously difficult for students to learn. Mechanisms and processes outside student experience present particular challenges. While instruction typically involves visualizations, students usually explain in words. Because visual explanations can show parts and processes of complex systems directly, creating them should have benefits beyond creating verbal explanations. We compared learning from creating visual or verbal explanations for two STEM domains, a mechanical system (bicycle pump) and a chemical system (bonding). Both kinds of explanations were analyzed for content and learning assess by a post-test. For the mechanical system, creating a visual explanation increased understanding particularly for participants of low spatial ability. For the chemical system, creating both visual and verbal explanations improved learning without new teaching. Creating a visual explanation was superior and benefitted participants of both high and low spatial ability. Visual explanations often included crucial yet invisible features. The greater effectiveness of visual explanations appears attributable to the checks they provide for completeness and coherence as well as to their roles as platforms for inference. The benefits should generalize to other domains like the social sciences, history, and archeology where important information can be visualized. Together, the findings provide support for the use of learner-generated visual explanations as a powerful learning tool.
Building an efficient supply chain.
Scalise, Dagmara
2005-08-01
Realizing at last that supply chain management can produce efficiencies and save costs, hospitals are beginning to adopt practices from other industries, such as the concept of extended supply chains, to improve product flow. They're also investing in enterprise planning resource software, radio frequency identification and other technologies, using quality data to drive standardization and streamlining processes.
40 CFR 35.6305 - Obtaining supplies.
Code of Federal Regulations, 2011 CFR
2011-07-01
....6325 through 35.6340, and 35.6350. Supplies obtained with Core Program funds must be for non-site-specific purposes. All purchases of supplies under the Core Program must comply with the requirements in...
40 CFR 35.6305 - Obtaining supplies.
Code of Federal Regulations, 2010 CFR
2010-07-01
....6325 through 35.6340, and 35.6350. Supplies obtained with Core Program funds must be for non-site-specific purposes. All purchases of supplies under the Core Program must comply with the requirements in...
Coal slurry fuel supply and purge system
McDowell, Robert E.; Basic, Steven L.; Smith, Russel M.
1994-01-01
A coal slurry fuel supply and purge system for a locomotive engines is disclosed which includes a slurry recirculation path, a stand-by path for circulating slurry during idle or states of the engine when slurry fuel in not required by the engine, and an engine header fluid path connected to the stand-by path, for supplying and purging slurry fuel to and from fuel injectors. A controller controls the actuation of valves to facilitate supply and purge of slurry to and from the fuel injectors. A method for supplying and purging coal slurry in a compression ignition engine is disclosed which includes controlling fluid flow devices and valves in a plurality of fluid paths to facilitate continuous slurry recirculation and supply and purge of or slurry based on the operating state of the engine.
Scar-less multi-part DNA assembly design automation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hillson, Nathan J.
The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which tomore » assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.« less
NASA Technical Reports Server (NTRS)
Yancik, J. J.
1978-01-01
The potential sources and qualities of coals available for major utility and industrial consumers in California are examined and analyzed with respect to those factors that would affect the reliability of supplies. Other considerations, such as the requirements and assurances needed by the coal producers to enter into long-term contracts and dedicate large reserves of coal to these contracts are also discussed. Present and potential future mining contraints on coal mine operators are identified and analyzed with respect to their effect on availability of supply.
30 CFR 874.14 - Water supply restoration.
Code of Federal Regulations, 2012 CFR
2012-07-01
... adverse effect on water supplies referred to in this section occurred both prior to and after August 3..., 1977. (c) If the adverse effect on water supplies referred to in this section occurred both prior to... 30 Mineral Resources 3 2012-07-01 2012-07-01 false Water supply restoration. 874.14 Section 874.14...
30 CFR 874.14 - Water supply restoration.
Code of Federal Regulations, 2011 CFR
2011-07-01
... adverse effect on water supplies referred to in this section occurred both prior to and after August 3..., 1977. (c) If the adverse effect on water supplies referred to in this section occurred both prior to... 30 Mineral Resources 3 2011-07-01 2011-07-01 false Water supply restoration. 874.14 Section 874.14...
2004-08-01
solar energy economically and environmentally more attractive ( Chiras 2002). In addition, the natural sunlight brought in from large, south-facing...heating principles in the design of any style home ( Chiras 2002). The case study home in this report is the residence of Gordon and Janice Plumblee... Chiras 2002). Special attention is required for designing roof I overhangs including gutters. Overhang lengths without gutters vary from 3.5 feet in hot
Life Support with Failures and Variable Supply
NASA Technical Reports Server (NTRS)
Jones, Harry
2010-01-01
The life support system for long duration missions will recycle oxygen and water to reduce the material resupply mass from Earth. The impact of life support failures was investigated by dynamic simulation of a lunar outpost habitat life support model. The model was modified to simulate resupply delays, power failures, recycling system failures, and storage failures. Many failures impact the lunar outpost water supply directly or indirectly, depending on the water balance and water storage. Failure effects on the water supply are reduced if Extra Vehicular Activity (EVA) water use is low and the water supply is ample. Additional oxygen can be supplied by scavenging unused propellant or by production from regolith, but the amounts obtained can vary significantly. The requirements for oxygen and water can also vary significantly, especially for EVA. Providing storage buffers can improve efficiency and reliability, and minimize the chance of supply failing to meet demand. Life support failures and supply variations can be survivable if effective solutions are provided by the system design
Resonant power supplies for a rapid-cycling accelerator
NASA Astrophysics Data System (ADS)
Karady, G.; Thiessen, H. A.; Schneider, E. J.
1988-10-01
A resonant power supply has been proposed as an efficient power supply for a future 60-GeV, Kaon-producing accelerator. The engineering design of the electric system of the main-ring power supplies is described. It is shown that the resonant power supply can be built with standard commercially available components. The most critical component is the bypass switch, which requires gate-turn off thyristors, connected in parallel. Standard metal-clad switchgear can be used for the AC system. The resonant power supplies can be fed directly from the 115-kV utility network, but the resonance power supplies draw pulse loads from the utility network. This pulse may produce disturbances. AC filter and reactive power compensation is needed for economical operation.
Macroeconomic susceptibility, inflation, and aggregate supply
NASA Astrophysics Data System (ADS)
Hawkins, Raymond J.
2017-03-01
We unify aggregate-supply dynamics as a time-dependent susceptibility-mediated relationship between inflation and aggregate economic output. In addition to representing well various observations of inflation-output dynamics this parsimonious formalism provides a straightforward derivation of popular representations of aggregate-supply dynamics and a natural basis for economic-agent expectations as an element of inflation formation. Our formalism also illuminates questions of causality and time-correlation that challenge central banks for whom aggregate-supply dynamics is a key constraint in their goal of achieving macroeconomic stability.
Glucagon in the artificial pancreas: supply and marketing challenges.
Rylander, Dick
2015-01-01
The use of glucagon, in conjunction with insulin, in a dual chamber pump (artificial pancreas, AP) is a working goal for multiple companies and researchers. However, capital investment to create, operate, and maintain facilities with sufficient scale to produce enough glucagon to treat millions of patients, at a level of profit that makes it feasible, will be substantial. It can be assumed that the marketplace will expect the daily cost of glucagon (to the consumer) to be similar to the daily cost of insulin. After one subtracts wholesaler and pharmacy markup, there may be very few dollars remaining for the drug company to cover profit, capital expenditures, marketing, burden, and other costs. Without the potential for adequate margins, manufacturers may not be willing to take the risk. Assuming that the projections discussed in this article are in the right ballpark, advance planning for the supply for glucagon needs to start today and not wait for the AP to come to market. © 2014 Diabetes Technology Society.
46 CFR 113.43-5 - Power supply.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 46 Shipping 4 2011-10-01 2011-10-01 false Power supply. 113.43-5 Section 113.43-5 Shipping COAST... SYSTEMS AND EQUIPMENT Steering Failure Alarm Systems § 113.43-5 Power supply. Each steering failure alarm system must be supplied by a circuit that: (a) Is independent of other steering gear system and steering...
46 CFR 113.43-5 - Power supply.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 46 Shipping 4 2010-10-01 2010-10-01 false Power supply. 113.43-5 Section 113.43-5 Shipping COAST... SYSTEMS AND EQUIPMENT Steering Failure Alarm Systems § 113.43-5 Power supply. Each steering failure alarm system must be supplied by a circuit that: (a) Is independent of other steering gear system and steering...
46 CFR 113.10-9 - Power supply.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 46 Shipping 4 2010-10-01 2010-10-01 false Power supply. 113.10-9 Section 113.10-9 Shipping COAST... SYSTEMS AND EQUIPMENT Fire and Smoke Detecting and Alarm Systems § 113.10-9 Power supply. (a) General... battery, the charger must be supplied from the final emergency power source. Upon loss of power to the...
46 CFR 113.10-9 - Power supply.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 46 Shipping 4 2011-10-01 2011-10-01 false Power supply. 113.10-9 Section 113.10-9 Shipping COAST... SYSTEMS AND EQUIPMENT Fire and Smoke Detecting and Alarm Systems § 113.10-9 Power supply. (a) General... battery, the charger must be supplied from the final emergency power source. Upon loss of power to the...
Visualisation for System Learning in Supply Chains
ERIC Educational Resources Information Center
Lindskog, Magnus; Abrahamsson, Mats; Aronsson, Hakan
2007-01-01
Contemporary supply chains are vastly complex, and decisions made by actors have system-wide consequences that these might not be able to foresee. There are gaps between "best practice"-founded theory and actual practice in supply chains. To remedy this, we argue, the supply chain actors need to enhance systems knowledge. There is a need to…
A profile of physiotherapy supply in Ireland.
Eighan, James; Walsh, Brendan; Smith, Samantha; Wren, Maev-Ann; Barron, Steve; Morgenroth, Edgar
2018-04-13
The lack of information on public and private physiotherapy supply in Ireland makes current and future resource allocation decisions difficult. This paper estimates the supply of physiotherapists in Ireland and profiles physiotherapists across acute and non-acute sectors, and across public and private practice. It examines geographic variation in physiotherapist supply, examining the implications of controlling for healthcare need. Physiotherapist headcounts are estimated using Health Service Personnel Census (HSPC) and Irish Society of Chartered Physiotherapists (ISCP) Register data. Headcounts are converted to whole-time equivalents (WTEs) using the HSPC and a survey of ISCP members to account for full- and part-time working practices. Non-acute supply per 10,000 population in each county is estimated to examine geographic inequalities and the raw population is adjusted in turn for a range of need indicators. An estimated 3172 physiotherapists were practising in Ireland in 2015; 6.8 physiotherapists per 10,000, providing an estimated 2620 WTEs. Females accounted for 74% of supply. Supply was greater in the non-acute sector; 1774 WTEs versus 846 WTEs in the acute sector. Physiotherapists in the acute sector were located mainly in publicly financed institutions (89%) with an even public/private split observed in the non-acute sector. Non-acute physiotherapist supply is unequally distributed across Ireland (Gini coefficient = 0.12; 95% CI 0.08-0.15), and inequalities remain after controlling for variations in healthcare needs across counties. The supply of physiotherapists in Ireland is 30% lower than the EU-28 average. Substantial inequality in the distribution of physiotherapists across counties is observed.
Repetitive resonant railgun power supply
Honig, E.M.; Nunnally, W.C.
1985-06-19
A repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. The supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles.
Repetitive resonant railgun power supply
Honig, Emanuel M.; Nunnally, William C.
1988-01-01
A repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. The supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles.
School Nurse Inspections Improve Handwashing Supplies
Ramos, Mary M.; Schrader, Ronald; Trujillo, Rebecca; Blea, Mary; Greenberg, Cynthia
2013-01-01
BACKGROUND Handwashing in the school setting is important for infectious disease control, yet maintaining adequate handwashing supplies is often made difficult by lack of funds, limited staff time, and student vandalism. This study measured the availability of handwashing supplies for students in New Mexico public schools and determined the impact of scheduled school nurse inspections on the availability of handwashing supplies. METHODS Participating school districts in New Mexico were matched by size and randomized into intervention and control groups. Baseline inspections were conducted in November 2008 followed by 2 subsequent bimonthly inspections. For each student bathroom, the presence or absence of soap and either paper towels or hand dryers was indicated on an inspection checklist. The intervention group reported findings to the New Mexico Department of Health (NMDOH) and to school administrative and custodial staff requesting that any identified problems be addressed. The control group reported inspection findings to the NMDOH only. Descriptive analyses were conducted to determine the proportion of bathrooms with soap and either paper towels or hand dryers. Comparisons were made between the intervention schools and the control schools at baseline and during the intervention period. RESULTS The intervention group had significantly higher probability of bathrooms being supplied with soap (p < .05) and paper towels/hand dryers (p < .02) during the intervention period. CONCLUSIONS Regularly scheduled school nurse inspections of hand hygiene supplies, with reporting to appropriate school officials, can improve the availability of handwashing supplies for students. PMID:21592131
Creating photo-realistic works in a 3D scene using layers styles to create an animation
NASA Astrophysics Data System (ADS)
Avramescu, A. M.
2015-11-01
Creating realist objects in a 3D scene is not an easy work. We have to be very careful to make the creation very detailed. If we don't know how to make these photo-realistic works, by using the techniques and a good reference photo we can create an amazing amount of detail and realism. For example, in this article there are some of these detailed methods from which we can learn the techniques necessary to make beautiful and realistic objects in a scene. More precisely, in this paper, we present how to create a 3D animated scene, mainly using the Pen Tool and Blending Options. Indeed, this work is based on teaching some simple ways of using the Layer Styles to create some great shadows, lights, textures and a realistic sense of 3 Dimension. The present work involves also showing how some interesting ways of using the illuminating and rendering options can create a realistic effect in a scene. Moreover, this article shows how to create photo realistic 3D models from a digital image. The present work proposes to present how to use Illustrator paths, texturing, basic lighting and rendering, how to apply textures and how to parent the building and objects components. We also propose to use this proposition to recreate smaller details or 3D objects from a 2D image. After a critic art stage, we are able now to present in this paper the architecture of a design method that proposes to create an animation. The aim is to create a conceptual and methodological tutorial to address this issue both scientifically and in practice. This objective also includes proposing, on strong scientific basis, a model that gives the possibility of a better understanding of the techniques necessary to create a realistic animation.
Simulating the Afghanistan-Pakistan opium supply chain
DOE Office of Scientific and Technical Information (OSTI.GOV)
Watkins, Jennifer H; MacKerrow, Edward P; Merritt, Terence M
2010-04-08
This paper outlines an opium supply chain using the Hilmand province of Afghanistan as exemplar. The opium supply chain model follows the transformation of opium poppy seed through cultivation and chemical alteration to brown heroin base. The purpose of modeling and simulating the Afghanistan-Pakistan opium supply chain is to discover and test strategies that will disrupt this criminal enterprise.
Intelligence Support to Supply Chain Risk Management
2012-06-01
of Master of Science in Operations Analysis Charles L. Carter, MA Major, USAF June 2012 DISTRIBUTION STATEMENT A. APPROVED FOR...literature regarding supply chain risk management and intelligence doctrine. This review established the importance of supply chain risk analysis to...risk analysis . This research culminated in the development of a methodology for intelligence professionals to use to support supply chain risk
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 9 2010-01-01 2009-01-01 true Supply plant. 1131.6 Section 1131.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1131.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 9 2012-01-01 2012-01-01 false Supply plant. 1005.6 Section 1005.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1005.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 9 2012-01-01 2012-01-01 false Supply plant. 1033.6 Section 1033.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1033.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 9 2010-01-01 2009-01-01 true Supply plant. 1126.6 Section 1126.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1126.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 9 2011-01-01 2011-01-01 false Supply plant. 1007.6 Section 1007.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1007.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 9 2010-01-01 2009-01-01 true Supply plant. 1005.6 Section 1005.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1005.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 9 2013-01-01 2013-01-01 false Supply plant. 1033.6 Section 1033.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Handling Definitions § 1033.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 9 2011-01-01 2011-01-01 false Supply plant. 1032.6 Section 1032.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1032.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 9 2011-01-01 2011-01-01 false Supply plant. 1006.6 Section 1006.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1006.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 9 2013-01-01 2013-01-01 false Supply plant. 1030.6 Section 1030.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Handling Definitions § 1030.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 9 2013-01-01 2013-01-01 false Supply plant. 1006.6 Section 1006.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Handling Definitions § 1006.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 9 2014-01-01 2013-01-01 true Supply plant. 1006.6 Section 1006.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Handling Definitions § 1006.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 9 2012-01-01 2012-01-01 false Supply plant. 1001.6 Section 1001.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1001.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 9 2013-01-01 2013-01-01 false Supply plant. 1005.6 Section 1005.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Handling Definitions § 1005.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 9 2012-01-01 2012-01-01 false Supply plant. 1006.6 Section 1006.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1006.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 9 2010-01-01 2009-01-01 true Supply plant. 1033.6 Section 1033.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1033.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 9 2014-01-01 2013-01-01 true Supply plant. 1126.6 Section 1126.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Handling Definitions § 1126.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 9 2010-01-01 2009-01-01 true Supply plant. 1006.6 Section 1006.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1006.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 9 2014-01-01 2013-01-01 true Supply plant. 1131.6 Section 1131.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Handling Definitions § 1131.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 9 2013-01-01 2013-01-01 false Supply plant. 1001.6 Section 1001.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Handling Definitions § 1001.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 9 2010-01-01 2009-01-01 true Supply plant. 1030.6 Section 1030.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1030.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 9 2011-01-01 2011-01-01 false Supply plant. 1005.6 Section 1005.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1005.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 9 2013-01-01 2013-01-01 false Supply plant. 1032.6 Section 1032.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Handling Definitions § 1032.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 9 2010-01-01 2009-01-01 true Supply plant. 1032.6 Section 1032.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1032.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 9 2014-01-01 2013-01-01 true Supply plant. 1001.6 Section 1001.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Handling Definitions § 1001.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 9 2014-01-01 2013-01-01 true Supply plant. 1032.6 Section 1032.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Handling Definitions § 1032.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 9 2014-01-01 2013-01-01 true Supply plant. 1005.6 Section 1005.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Handling Definitions § 1005.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 9 2014-01-01 2013-01-01 true Supply plant. 1007.6 Section 1007.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Handling Definitions § 1007.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 9 2010-01-01 2009-01-01 true Supply plant. 1007.6 Section 1007.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1007.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 9 2011-01-01 2011-01-01 false Supply plant. 1030.6 Section 1030.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1030.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 9 2011-01-01 2011-01-01 false Supply plant. 1001.6 Section 1001.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1001.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 9 2010-01-01 2009-01-01 true Supply plant. 1001.6 Section 1001.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1001.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 9 2011-01-01 2011-01-01 false Supply plant. 1126.6 Section 1126.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1126.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 9 2011-01-01 2011-01-01 false Supply plant. 1033.6 Section 1033.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1033.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 9 2014-01-01 2013-01-01 true Supply plant. 1033.6 Section 1033.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Handling Definitions § 1033.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 9 2012-01-01 2012-01-01 false Supply plant. 1007.6 Section 1007.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1007.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 9 2012-01-01 2012-01-01 false Supply plant. 1126.6 Section 1126.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1126.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 9 2012-01-01 2012-01-01 false Supply plant. 1131.6 Section 1131.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1131.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 9 2012-01-01 2012-01-01 false Supply plant. 1030.6 Section 1030.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1030.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 9 2013-01-01 2013-01-01 false Supply plant. 1126.6 Section 1126.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Handling Definitions § 1126.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 9 2013-01-01 2013-01-01 false Supply plant. 1007.6 Section 1007.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Handling Definitions § 1007.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 9 2012-01-01 2012-01-01 false Supply plant. 1032.6 Section 1032.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1032.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 9 2014-01-01 2013-01-01 true Supply plant. 1030.6 Section 1030.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Handling Definitions § 1030.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 9 2011-01-01 2011-01-01 false Supply plant. 1131.6 Section 1131.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1131.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 9 2013-01-01 2013-01-01 false Supply plant. 1131.6 Section 1131.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Handling Definitions § 1131.6 Supply plant. See § 1000.6. ...
Public water supplies in western Texas
Broadhurst, W.L.; Sundstrom, R.W.; Weaver, D.E.
1951-01-01
This report gives a summarized description of the public water supplies in a region comprising 81 counties of western Texas and lying generally west of the hundredth meridian. It is the fourth and last of this series of reports concerning the public water supplies of the State. It gives the available data for each of 142 communities, as follows: The population of the community; the name of the official from whom the information was obtained; the ownership of the waterworks, whether private or municipal; the source of supply, whether ground water or surface water; the amount of water consumed; the facilities for storage; the number of customers served; the character of the chemical and sanitary treatment of the water, if any; and the chemical analyses of the water. Where ground water is used the following also are given. Records of wells, including drillers' logs; character of the pumping equipment; and yield of the wells and water-level records where they are available. Of the 142 public supplies, 133 are obtained from ground water, 5 from surface water, and 4 from a combination of both. The total amount of water . used for public supply in the region averages about 78,000,000 gallons a day. Of this about 61,000,000 gallons a day is ground water and about 17,000,000 gallons a day is surface water. The ground-water resources of the region from which public water supplies are drawn are in rocks that range in age from Permian to Quaternary. The Ogallala formation of Tertiary age (Pliocene), which covers about 35,000 square miles of the High Plains in Texas, is the most important ground-water reservoir in the region. The formation furnishes water for 78 public supplies and for irrigating about 1,000,000 acres of land. The amount of water used for irrigating amounted to about 1,000,000 acre-feet in 1948. The Trinity and Fredericksburg groups of Lower Cretaceous age supply ground water in the western part of the Edwards Plateau, which constitutes an area of more than 22
Supply chain management in the clinical laboratory.
McHugh, Thomas M
2006-01-31
Between 15 and 45 percent of a clinical laboratory's operating budget is spent on supplies. Given the size of this expenditure, laboratory managers must pay close attention to the supply chain and develop effective strategies to manage their inventory. Areas that need analysis include the carrying cost of supplies, the cost to generate a purchase order, methods to efficiently count supplies on hand, processes to ensure that lot number items are used before their expiration, and detailed analysis of the inventory. At the University of California-San Francisco Medical Center, we investigated options to manage our inventory and implemented a computerized system. The system required modifications to existing practices, which initially seemed unwieldy. However, after a relatively short learning curve, the improvement to operations has been significant, with a reduction in wasted reagents, fewer staff hours used to count supplies, and the ability to provide prompt analysis of the inventory for audits and discussions with administration. Focusing on the supply chain has allowed us to reduce inventory expenses by approximately 8 percent, reduce waste, given us a more focused understanding of our operations, and provided us with the ability to analyze our inventory easily.
Academic food-supply veterinarians: future demand and likely shortages.
Bruce Prince, J; Andrus, David M; Gwinner, Kevin
2006-01-01
The future demand for and potential shortages of food-supply veterinarians have been the subject of much concern. Using the Delphi forecasting method in a three-phase Web-based survey process, a panel of experts identified the trends and issues shaping the demand for and supply of academic food-animal veterinarians, then forecasted the likely future demand and shortages of food-supply veterinarians employed in academic institutions in the United States and Canada through 2016. The results indicate that there will be increasing future demand and persistent shortages of academic food-supply veterinarians unless current trends are countered with targeted, strategic action. The Delphi panel also evaluated the effectiveness of several strategies for reversing current trends and increasing the number of food-supply veterinarians entering into academic careers. Academic food-supply veterinarians are a key link in the system that produces food-supply veterinarians for all sectors (private practice, government service, etc.); shortages in the academic sector will amplify shortages wherever food-supply veterinarians are needed. Even fairly small shortages have significant public-health, food-safety, animal-welfare, and bio-security implications. Recent events demonstrate that in an increasingly interconnected global economic food supply system, national economies and public health are at risk unless an adequate supply of appropriately trained food-supply veterinarians is available to counter a wide variety of threats ranging from animal and zoonotic diseases to bioterrorism.
Bioindustry Creates Green Jobs
DOE Office of Scientific and Technical Information (OSTI.GOV)
None
2013-07-01
The U.S. bioindustry is expanding rapidly in response to the need for a near-term alternative to liquid petroleum fuels. The Energy Independence and Security Act of 2007 (EISA) requires that renewable fuels collectively supply at least 36 billion gallons of U.S. motor fuels by 2022.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 9 2013-01-01 2013-01-01 false Supply plant. 1124.6 Section 1124.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Regulating Handling Definitions § 1124.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 9 2010-01-01 2009-01-01 true Supply plant. 1124.6 Section 1124.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Regulating Handling Definitions § 1124.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 9 2012-01-01 2012-01-01 false Supply plant. 1124.6 Section 1124.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Regulating Handling Definitions § 1124.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 9 2011-01-01 2011-01-01 false Supply plant. 1124.6 Section 1124.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Regulating Handling Definitions § 1124.6 Supply plant. See § 1000.6. ...
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 9 2014-01-01 2013-01-01 true Supply plant. 1124.6 Section 1124.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Regulating Handling Definitions § 1124.6 Supply plant. See § 1000.6. ...
Drinking Water Supply without Use of a Disinfectant
NASA Astrophysics Data System (ADS)
Rajnochova, Marketa; Tuhovcak, Ladislav; Rucka, Jan
2018-02-01
The paper focuses on the issue of drinking water supply without use of any disinfectants. Before the public water supply network operator begins to consider switching to operation without use of chemical disinfection, initial assessment should be made, whether or not the water supply system in question is suitable for this type of operation. The assessment is performed by applying the decision algorithm. The initial assessment is followed by another decision algorithm which serves for managing and controlling the process of switching to drinking water supply without use of a disinfectant. The paper also summarizes previous experience and knowledge of this way operated public water supply systems in the Czech Republic.
A single supply biopotential amplifier.
Spinelli, E M; Martinez, N H; Mayosky, M A
2001-04-01
A biopotential amplifier for single supply operation is presented. It uses a Driven Right Leg Circuit (DRL) to drive the patient's body to a DC common mode voltage, centering biopotential signals with respect to the amplifier's input voltage range. This scheme ensures proper range operation when a single power supply is used. The circuit described is especially suited for low consumption, battery-powered applications, requiring a single battery and avoiding switching voltage inverters to achieve dual supplies. The generic circuit is described and, as an example, a biopotential amplifier with a gain of 60 dB and a DC input range of +/-200 mV was implemented using low power operational amplifiers. A Common Mode Rejection Ratio (CMRR) of 126 dB at 50 Hz was achieved without trimming.
Yakymyshyn, Christopher Paul; Hamilton, Pamela Jane; Brubaker, Michael Allen
2007-12-04
A modular, low weight impedance dropping power supply with battery backup is disclosed that can be connected to a high voltage AC source and provide electrical power at a lower voltage. The design can be scaled over a wide range of input voltages and over a wide range of output voltages and delivered power.