Science.gov

Sample records for supply overhang creates

  1. Roof Overhangs for Solar Houses

    NASA Technical Reports Server (NTRS)

    Gracey, W.

    1985-01-01

    Convenient graphical method determines both width and vertical position of overhangs for standard wall section having "typical" window arrangement. Overhangs for this wall section determined for two extremes of latitude in United States.

  2. Creation of DNA overhangs by using modified DNA overhang cloning method.

    PubMed

    Li, Wei; Gao, Feng

    2007-06-01

    DNA overhang cloning (DOC) method was invented by Kevin A. Jarrell and colleagues to create DNA overhangs at the ends of polymerase chain reaction (PCR) fragments. To increase the ligation products of DOC and make it possible to join the ligation products together to yield a larger DNA fragment without amplification by using the secondary PCR, we modified the original method by lengthening RNA-DNA hybrids to 8 bp, using RNase H to digest RNA chains, and so on. We found that the ligation of PCR fragments with DNA overhangs could be improved significantly by using the modified DOC. The ligation products of the modified DOC were rich enough to be separated by using agarose gel and joined together to yield a larger DNA fragment without amplification by using the secondary PCR. The modified DOC is simpler and much more effective than the original one. The creation of DNA overhangs by using complementary DNA oligonucleotides, T4 ligase, and RNase H is simpler and cheaper than that by using reverse transcriptase and RNase H.

  3. How Sustainable Freight Creates a More Efficient Supply Chain

    EPA Pesticide Factsheets

    This EPA presentation focuses on the challenges in achieving sustainable freight transport in the supply chain, spotlighting Mondelez International and C.H. Robinson, their sustainability efforts, and how SmartWay helps.

  4. Apollo contributes to G-overhang maintenance and protects leading-end telomeres

    PubMed Central

    Wu, Peng; van Overbeek, Megan; Rooney, Sean; de Lange, Titia

    2010-01-01

    SUMMARY Mammalian telomeres contain a single-stranded 3′ overhang that is thought to mediate telomere protection. Here we identify the TRF2-interacting factor Apollo as a nuclease that contributes to the generation/maintenance of this overhang. The function of mouse Apollo was determined using Cre-mediated gene deletion, complementation with Apollo mutants, and the TRF2-F120A mutant that cannot bind Apollo. Cells lacking Apollo activated the ATM kinase at their telomeres in S phase and showed leading-end telomere fusions. These telomere dysfunction phenotypes were accompanied by a reduction in the telomeric overhang signal. The telomeric functions of Apollo required its TRF2-interaction and nuclease motifs. Thus, TRF2 recruits the Apollo nuclease to process telomere ends synthesized by leading-strand DNA synthesis, thereby creating a terminal structure that avoids ATM activation and resists end-joining. These data establish that the telomeric overhang is required for the protection of telomeres from the DNA damage response. PMID:20619712

  5. Stress Intensity Factor Analysis and the Stability of Overhanging Rock

    NASA Astrophysics Data System (ADS)

    Huang, R. Q.; Wu, L. Z.; He, Q.; Li, J. H.

    2017-08-01

    The collapse of overhanging rock is a common geological hazard in mountainous areas. The stability of overhanging rock is usually determined by the growth of a crack along a main structural plane. On the basis of linear fracture mechanics combined with the stress concentration coefficient, an analytical method to determine the stress intensity factor (SIF) of overhanging rock is developed to evaluate its stability. Experiments on pre-cracked sandstone were carried out to simulate failure of overhanging rock and verify the analytical solution to fracturing and failure of overhanging rocks. Additionally, numerical solutions using the finite element method are derived to compare with the experimental results. The J-integral and displacement extrapolation methods are used to determine stress changes at the crack tip in the overhanging rocks, and the results confirm that the analytical solutions are consistent with the results of the numerical solutions, including the displacement extrapolation used to analyze the SIF of the overhanging rock. The ratio of fracture toughness to effective SIF at the crack tip can be considered useful when examining the stability of overhanging rock.

  6. 14. DETAIL OF ENTRANCE OVERHANG, WEST SIDE OF NORTH PORTION. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. DETAIL OF ENTRANCE OVERHANG, WEST SIDE OF NORTH PORTION. SAME FEATURE AS A-13. - Chollas Heights Naval Radio Transmitting Facility, Transmitter Building, 6410 Zero Road, San Diego, San Diego County, CA

  7. Detail of castiron bracket supporting overhang on Train Shed. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Detail of cast-iron bracket supporting overhang on Train Shed. - Central of Georgia Railway, Passenger Station & Train Shed, Corner of Louisville (Railroad) Road & West Broad Street, Savannah, Chatham County, GA

  8. 1. GENERAL VIEW. OVERHANG, PAINTED RED, HAS VERTICAL SIDING AND ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. GENERAL VIEW. OVERHANG, PAINTED RED, HAS VERTICAL SIDING AND FADED PAINTINGS OF FARM ANIMALS: COW, DONKEYS AND HORSE. - De Turck House, Barn, State Route 662 vicinity, Oley Township, Oley, Berks County, PA

  9. DETAIL OF WEST ELEVATION ROOF OVERHANG Cape Canaveral Air ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    DETAIL OF WEST ELEVATION ROOF OVERHANG - Cape Canaveral Air Force Station, Launch Complex 34, Operations Support Building, Freedom Road, Southwest of Launch Stand CX-34, Cape Canaveral, Brevard County, FL

  10. View of Highway 140 and Overhang Rock. Location of junction ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of Highway 140 and Overhang Rock. Location of junction with Old Coulterville Road behind rock. Looking north-northwest - All Year Highway, Between Arch Rock & Yosemite Valley, El Portal, Mariposa County, CA

  11. Only adding stationary storage to vaccine supply chains may create and worsen transport bottlenecks.

    PubMed

    Haidari, Leila A; Connor, Diana L; Wateska, Angela R; Brown, Shawn T; Mueller, Leslie E; Norman, Bryan A; Schmitz, Michelle M; Paul, Proma; Rajgopal, Jayant; Welling, Joel S; Leonard, Jim; Claypool, Erin G; Weng, Yu-Ting; Chen, Sheng-I; Lee, Bruce Y

    2013-01-01

    Although vaccine supply chains in many countries require additional stationary storage and transport capacity to meet current and future needs, international donors tend to donate stationary storage devices far more often than transport equipment. To investigate the impact of only adding stationary storage equipment on the capacity requirements of transport devices and vehicles, we used HERMES (Highly Extensible Resource for Modeling Supply Chains) to construct a discrete event simulation model of the Niger vaccine supply chain. We measured the transport capacity requirement for each mode of transport used in the Niger vaccine cold chain, both before and after adding cold rooms and refrigerators to relieve all stationary storage constraints in the system. With the addition of necessary stationary storage, the average transport capacity requirement increased from 88% to 144% for cold trucks, from 101% to 197% for pickup trucks, and from 366% to 420% for vaccine carriers. Therefore, adding stationary storage alone may worsen or create new transport bottlenecks as more vaccines flow through the system, preventing many vaccines from reaching their target populations. Dynamic modeling can reveal such relationships between stationary storage capacity and transport constraints.

  12. DNA-PKcs dependence of Artemis endonucleolytic activity, differences between hairpins and 5' or 3' overhangs.

    PubMed

    Niewolik, Doris; Pannicke, Ulrich; Lu, Haihui; Ma, Yunmei; Wang, Ling-Chi Vicky; Kulesza, Peter; Zandi, Ebrahim; Lieber, Michael R; Schwarz, Klaus

    2006-11-10

    During V(D)J recombination, the RAG proteins create DNA hairpins at the V, D, or J coding ends, and the structure-specific nuclease Artemis is essential to open these hairpins prior to joining. Artemis also is an endonuclease for 5' and 3' overhangs at many DNA double strand breaks caused by ionizing radiation, and Artemis functions as part of the nonhomologous DNA end joining pathway in repairing these. All of these activities require activation of the Artemis protein by interaction with and phosphorylation by the DNA-dependent protein kinase catalytic subunit (DNA-PKcs). In this study, we have identified a region of the Artemis protein involved in the interaction with DNA-PKcs. Furthermore, the biochemical and functional analyses of C-terminally truncated Artemis variants indicate that the hair-pin opening and DNA overhang endonucleolytic features of Artemis are triggered by DNA-PKcs in two modes. First, autoinhibition mediated by the C-terminal tail of Artemis is relieved by phosphorylation of this tail by DNA-PKcs. Thus, C-terminally truncated Artemis derivatives imitate DNA-PKcs-activated wild type Artemis protein and exhibit intrinsic hairpin opening activity. Second, DNA-PKcs may optimally configure 5' and 3' overhang substrates for the endonucleolytic function of Artemis.

  13. Manufacture of Overhanging Sharp Corner by Means of 6-Axis Control Machining with the Application of Ultrasonic Vibrations

    NASA Astrophysics Data System (ADS)

    Japitana, Feliciano H.; Morishige, Koichi; Yasuda, Shugo; Takeuchi, Yoshimi

    The study proposes a new machining method to create an overhanging sharp corner. Sharp corners on overhanging surfaces are difficult to machine in conventional way or even in 3 to 5-axis EDM especially if the surfaces have different angles. This is due to the limitation of the feed direction and the structure of the electrode wherein it must be symmetrical with the target shape. In present research, we try to machine the sharp corner with overhanging surfaces using the new machining method. The 6-axis control machining is applied to set a non-rotational tool at an arbitrary position with arbitrary attitude against the workpiece. During cutting, the ultrasonic vibration is applied on the cutting edge of the tool, while the tool travels along the feed direction. As the cutting is performed, the 6 axes (X, Y, Z, A, B, and C) move simultaneously, depending on the tool attitude at a certain cutting point. From the experimental results, it is shown that the 6-axis control ultrasonic vibration cutting is capable of producing a sharp corner on overhanging surfaces.

  14. DETAIL OF TYPICAL OVERHANGING EAVES. NOTE THE CONCRETE PARTY WALL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    DETAIL OF TYPICAL OVERHANGING EAVES. NOTE THE CONCRETE PARTY WALL OF THE REAR LANAI WITH DECORATIVE MASONRY. VIEW FACING WEST - Camp H.M. Smith and Navy Public Works Center Manana Title VII (Capehart) Housing, U-Shaped Three-Bedroom Duplex Type 2, Acacia Road, Birch Circle, and Cedar Drive, Pearl City, Honolulu County, HI

  15. Energy and visual comfort performance of electrochromic windowswith overhangs

    SciTech Connect

    Lee, E.S.; Tavil, A.

    2005-11-03

    DOE-2 building energy simulations were conducted to determine if there were practical architectural and control strategy solutions that would enable electrochromic (EC) windows to significantly improve visual comfort without eroding energy-efficiency benefits. EC windows were combined with overhangs since opaque overhangs provide protection from direct sun which EC windows are unable to do alone. The window wall was divided into an upper and lower aperture so that various combinations of overhang position and control strategies could be considered. The overhang was positioned either at the top of the upper window aperture or between the upper and lower apertures. Overhang depth was varied. EC control strategies were fully bleached at all times, modulated based on incident vertical solar radiation limits, or modulated to meet the design work plane illuminance with daylight. The EC performance was compared to a state-of-the-art spectrally selective low-e window with the same divided window wall, window size, and overhang as the EC configuration. The reference window was also combined with an interior shade which was manually deployed to control glare and direct sun. Both systems had the same daylighting control system to dim the electric lighting. Results were given for south-facing private offices in a typical commercial building. In hot and cold climates such as Houston and Chicago, EC windows with overhangs can significantly reduce the average annual daylight glare index (DGI) and deliver significant annual energy use savings if the window area is large. Total primary annual energy use was increased by 2-5% for moderate-area windows in either climate but decreased by 10% in Chicago and 5% in Houston for large-area windows. Peak electric demand can be reduced by 7-8% for moderate-area windows and by 14-16% for large-area windows in either climate. Energy and peak demand reductions can be significantly greater if the reference case does not have exterior shading or

  16. Iliopsoas tendonitis caused by overhang of a collared femoral prosthesis.

    PubMed

    Brew, Christopher J; Stockley, Ian; Grainger, Andrew J; Stone, Martin H

    2011-04-01

    Pain after total hip arthroplasty can be due to a variety of causes, one of the less common being iliopsoas tendonitis. We report an unusual case of iliopsoas tendonitis caused by overhang of the femoral calcar by a collared femoral prosthesis resulting in impingement on the iliopsoas tendon. An ultrasound-guided corticosteroid and local anesthetic diagnostic injection to the site of impingement confirmed the diagnosis with temporary symptom relief. Revision of the femoral stem to a collarless prosthesis resulted in immediate and complete resolution of symptoms.

  17. Creating high-stability high-precision bipolar trim power supply

    SciTech Connect

    Chen, Zhe; Merz, William A.

    2012-07-01

    Thomas Jefferson National Accelerator Facility (TJNAF) is founded by the US Department of Energy (DOE) office of science for the technology advancement and physics research in electron beam accelerator. This facility has the state of the art technology to carry out world-class cutting-edge experiments for the nucleus composition and atomic characteristics identification and exploration for the nature of the matter in the universe. A continuous wave electron beam is featured for such experiments, thus precise and stable trim power supply is required to meet such purpose. This paper demonstrates the challenges and solutions to design, assemble, fabrication and test such high-precision high-stability power supplies. This paper presents the novel design and first article test of the ±20A ±75V bipolar, 100ppm stability level current-regulated high-power trim power supplies for the beam manipulation. This special design can provide valuable documentation and reference values for future designs and special applications in particle accelerator power supply creation.

  18. Warming may create substantial water supply shortages in the Colorado River basin

    NASA Astrophysics Data System (ADS)

    McCabe, Gregory J.; Wolock, David M.

    2007-11-01

    The high demand for water, the recent multiyear drought (1999-2007), and projections of global warming have raised questions about the long-term sustainability of water supply in the southwestern United States. In this study, the potential effects of specific levels of atmospheric warming on water-year streamflow in the Colorado River basin are evaluated using a water-balance model, and the results are analyzed within the context of a multi-century tree-ring reconstruction (1490-1998) of streamflow for the basin. The results indicate that if future warming occurs in the basin and is not accompanied by increased precipitation, then the basin is likely to experience periods of water supply shortages more severe than those inferred from the long-term historical tree-ring reconstruction. Furthermore, the modeling results suggest that future warming would increase the likelihood of failure to meet the water allocation requirements of the Colorado River Compact.

  19. Warming may create substantial water supply shortages in the Colorado River basin

    USGS Publications Warehouse

    McCabe, G.J.; Wolock, D.M.

    2007-01-01

    The high demand for water, the recent multiyear drought (1999-2007), and projections of global warming have raised questions about the long-term sustainability of water supply in the southwestern United States. In this study, the potential effects of specific levels of atmospheric warming on water-year streamflow in the Colorado River basin are evaluated using a water-balance model, and the results are analyzed within the context of a multi-century tree-ring reconstruction (1490-1998) of streamflow for the basin. The results indicate that if future warming occurs in the basin and is not accompanied by increased precipitation, then the basin is likely to experience periods of water supply shortages more severe than those inferred from the longterm historical tree-ring reconstruction. Furthermore, the modeling results suggest that future warming would increase the likelihood of failure to meet the water allocation requirements of the Colorado River Compact.

  20. Air Supply System Particularly Suited to Remove Contaminants Created by Chemical, Biological or Radiological Conditions

    DTIC Science & Technology

    2000-02-15

    inches. The first filter is a pleated -medium which filters and removes particles of at 20 least a first or relatively small size. The second filter 22...necessary filtering element , and 14 because of its single structure, is conveniently mounted into bulkheads related to the system 10 of the present...BACKGROUND OF THE INVENTION 1.0 Field of the Invention 20 The present invention relates to air filtering systems and, more particularly, to an air supply

  1. On the way to creating a system of distant power supply for space vehicles

    SciTech Connect

    Prisniakov, V.F.; Lyagushin, S.F.; Statsenko, I.N.; Dranovsky, V.I.

    1996-12-31

    Solar energy is the most suitable basis for power supply for the majority of projects in the near-Earth space. Passing on to the large-scale space-based systems of power supply requires putting into life demonstration experiments in which power transmission by electromagnetic emission is supposed. In the paper the expedience of developing an autonomous power module which provides the possibility of space programs with great power consumption and wireless transmission system running-up is proved. Ukraine can design a solar power satellite of 10-20kW power on the basis of the research satellite AUOS-SM. Two variants of design solutions for such satellite with solar arrays of great area are presented. Power transmission to the space vehicle-consumer can be conducted by cable as well as in a wireless way. The possibilities of placing microwave and laser energy transmission systems on board the satellite are analysed. It is shown that a power supply system for space vehicles with transmission distance of thousands km can be designed basing on modern lasers. Some experiments making use of great electric power generated by the plant of the satellite under consideration are proposed. The running-up of electric thrusters which are necessary for orientation and distancing is of great interest. Wireless power transmission may be carried on to a small satellite equipped with electric thrusters. 26 refs., 6 figs., 2 tabs.

  2. Influence of the permanent magnet overhang on the performance of the brushless dc motor

    NASA Astrophysics Data System (ADS)

    Wang, J. P.; Lieu, D. K.; Lorimer, W. L.; Hartman, A.

    1998-06-01

    Axial overhang of the permanent magnets has been used to enhance the performance of radial flux brushless dc motors, but its precise contribution to performance is not well known. This article aims at the investigation of the overhang effects by finite element and lumped parameter modeling. An empirical formula which allows two-dimensional analysis to account for overhang effects is proposed. A three-dimensional equivalent magnetic circuit model is developed and its ability to accurately predict overhang effects is assessed. Results of finite element and lumped parameter models are compared and a design methodology is forwarded.

  3. Superamphiphobic overhang structured coating on a biobased material

    NASA Astrophysics Data System (ADS)

    Tuominen, Mikko; Teisala, Hannu; Haapanen, Janne; Mäkelä, Jyrki M.; Honkanen, Mari; Vippola, Minnamari; Bardage, Stig; Wålinder, Magnus E. P.; Swerin, Agne

    2016-12-01

    A superamphiphobic coating on a biobased material shows extreme liquid repellency with static contact angles (CA) greater than 150° and roll-off angles less than 10° against water, ethylene glycol, diiodomethane and olive oil, and a CA for hexadecane greater than 130°. The coating consisting of titania nanoparticles deposited by liquid flame spray (LFS) and hydrophobized using plasma-polymerized perfluorohexane was applied to a birch hardwood. Scanning electron microscopy (SEM) imaging after sample preparation by UV laser ablation of coated areas revealed that capped structures were formed and this, together with the geometrically homogeneous wood structure, fulfilled the criteria for overhang structures to occur. The coating showed high hydrophobic durability by still being non-wetted after 500 000 water drop impacts, and this is discussed in relation to geometrical factors and wetting forces. The coating was semi-transparent with no significant coloration. A self-cleaning effect was demonstrated with both water and oil droplets. A self-cleanable, durable and highly transparent superamphiphobic coating based on a capped overhang structure has a great potential for commercial feasibility in a variety of applications, here exemplified for a biobased material.

  4. Histopathology and treatment of a huge overhanging filtering bleb.

    PubMed

    Ou-Yang, Ping-Bo; Qi, Xin; Duan, Xuan-Chu

    2016-10-06

    The giant filtering bleb encroaching onto the corneal surface is a rare occurrence in our and other's clinical experience (Kapoor and Syed, Int. Ophthalmol 31(5):403-404, 2011), even in patients having had a trabeculectomy with mitomycin C, and how it developed is debated. In this paper, we report a patient who developed a huge overhanging filtering bleb after trabeculectomy, and present our intraoperative photographs, histopathology and immunohistochemistry results. A 62-year-old female visited our hospital due to the giant filtering bleb encroaching onto the corneal surface which was about 6 mm × 8 mm × 3 mm. We dissected the filtering bleb from the cornea and present the histopathology and immunohistochemistry results of it. The results from histopathology and immunohistochemistry in this study are consistent with the filtering cicatrix hypothesis. However, our finding that the overhanging blebs had tight connections with the corneal tissue or corneoscleral limbus, rather than simply leaning on it, might be highly related to their development and still needs to be further studied.

  5. Implant Overhang after Unicompartmental Knee Arthroplasty: Oxford Prosthesis versus Miller-Galante II Prosthesis.

    PubMed

    Kim, Geon-Hyeong; Park, Bum-Yong; Bae, Tae-Yong; Song, Kwang-Yun; In, Yong

    2014-06-01

    The purpose of the present study is to compare the prevalence of implant overhang between the Oxford and the Miller-Galante II (M-G II) unicompartmental knee arthroplasty (UKA) prostheses and determine whether overhang is associated with postoperative clinical results. We retrospectively reviewed one hundred and seven UKAs which consisted of 37 Oxford UKAs and 70 M-G II. Overhang was considered present if ≥3 mm overhang was observed in any zone. The range of motion, the Knee Society scores and the Western Ontario and McMaster scores were compared after a mean follow-up duration of 48 months. Thirty three of 107 knees (30.8%) had overhang in at least one zone of the femoral or tibial component. In the tibial side, there were no significant differences between the groups in component overhang in each zone. In the femoral side, the Oxford UKA group showed a significantly higher prevalence of the posterior overhang of the femoral component (19/37, 51.4%) than did the M-G II UKA group (3/70, 4.3%; p<0.001). However, no significant differences in clinical results were observed between the two groups. There were also no significant differences in clinical results between the overhang and the non-overhang groups. Posterior overhang of the femoral component was highly prevalent in Oxford UKA patients. However, posterior overhang of the femoral component had no significant relationship with postoperative clinical results in both Oxford and M-G II UKAs at a mean of 48 months follow-up.

  6. Novel Overhang Support Designs for Powder-Based Electron Beam Additive Manufacturing (EBAM)

    NASA Technical Reports Server (NTRS)

    Nabors, Sammy A.

    2014-01-01

    NASA Marshall Space Flight Center, in collaboration with the University of Alabama, has developed a contact-free support structure used to fabricate overhang-type geometries via EBAM. The support structure is used for 3-D metal-printed components for the aerospace, automotive, biomedical and other industries. Current techniques use support structures to address deformation challenges inherent in 3-D metal printing. However, these structures (overhangs) are bonded to the component and need to be removed in post-processing using a mechanical tool. This new technology improves the overhang support structure design for components by eliminating associated geometric defects and post-processing requirements.

  7. Transverse vibration of a simply supported beam with symmetric overhang of arbitrary length

    Treesearch

    J. F. Murphy

    1997-01-01

    The numerical solution to the frequency equation for the transverse vibration of a simple beam with symmetric overhang is found. The numerical results converge to the analytical solutions for the two limiting cases of a beam with no overhang and a beam with no span and agree with the case in which the supports are at the nodal points of a freely vibrating beam. An...

  8. Co-creating value through demand and supply integration in senior industry-observations on 33 senior enterprises in Taiwan.

    PubMed

    Yang, Ya-Ting; Iqbal, Usman; Chen, Ya-Mei; Su, Shyi; Chang, Yao-Mao; Handa, Yujiro; Lin, Neng-Pai; Hsu, Yi-Hsin Elsa

    2016-09-01

    With global population aging, great business opportunities are driven by the various needs that the elderly face in everyday living. Internet development makes information spread faster, also allows elderly and their caregivers to more easily access information and actively participate in value co-creation in the services. This study aims to investigate the designs of value co-creation by the supply and demand sides of the senior industry. This study investigated senior industry in Taiwan and analyzed bussiness models of 33 selected successful senior enterprises in 2013. We adopted series field observation, reviews of documentations, analysis of meeting records and in-depth interviews with 65 CEOs and managers. Thirty-three quality enterprises in senior industry. Sixty-five CEOs and managers in 33 senior enterprises. None. Value co-creation design, value co-creating process. We constructed a conceptual model that comprehensively describes essential aspects of value co-creation and categorized the value co-creation designs into four types applying for different business models: (i) interaction in experience spaces co-creation design, (ii) on-site interacting co-creation design, (iii) social networking platform co-creation design and (iv) empowering customers co-creation design. Through value co-creation platform design, the senior enterprises have converted the originally passive roles of the elderly and caregivers into active participants in the value co-creation process. The new paradigm of value co-creation designs not only promote innovative development during the interactive process, lead enterprises reveal and meet customers' needs but also increase markets and profits. © The Author 2016. Published by Oxford University Press in association with the International Society for Quality in Health Care. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. DNA strand transfer catalyzed by vaccinia topoisomerase: ligation of DNAs containing a 3' mononucleotide overhang.

    PubMed

    Cheng, C; Shuman, S

    2000-05-01

    The specificity of vaccinia topoisomerase for transesterification to DNA at the sequence 5'-CCCTT and its versatility in strand transfer have illuminated the recombinogenic properties of type IB topoisomerases and spawned topoisomerase-based strategies for DNA cloning. Here we characterize a pathway of topoisomerase-mediated DNA ligation in which enzyme bound covalently to a CCCTT end with an unpaired +1T nucleotide rapidly and efficiently joins the CCCTT strand to a duplex DNA containing a 3' A overhang. The joining reaction occurs with high efficiency, albeit slowly, to duplex DNAs containing 3' G, T or C overhangs. Strand transfer can be restricted to the correctly paired 3' A overhang by including 0.5 M NaCl in the ligation reaction mixture. The effects of base mismatches and increased ionic strength on the rates of 3' overhang ligation provide a quantitative picture of the relative contributions of +1 T:A base pairing and electrostatic interactions downstream of the scissile phosphate to the productive binding of an unlinked acceptor DNA to the active site. The results clarify the biochemistry underlying topoisomerase-cloning of PCR products with non-templated 3' overhangs.

  10. E-Area Low-Level Waste Facility Cover Overhang Analysis

    SciTech Connect

    Hang, T.; Flach, G. P.

    2016-05-18

    PORFLOW related analyses were performed with a focus on Slit and Engineered Trenches to evaluate the minimum required cover overhang size that would prevent any adverse impact on the ELLWF overall performance. Cover overhang is defined as the lateral distance that a low-infiltration cover extends beyond the edge of the trench unit in any direction. Analyses were carried out for H-3 (short half-life), I-129 (very long half-life), and Sr-90 (moderate half-life with intermediate Kd) at different overhang sizes (5ft, 10ft, 20ft, 50ft, and infinite), cover timing (0yr, 10yr, 20yr, and 30yr), and scenarios (Intact and a limited Dynamic Compaction Case). H-3, I-129 and Sr-90 are representative of nuclides that typically drive the sum-of-fractions for a trench disposal unit.

  11. Experimental evaluation of overhanging bamboo in Anopheles darlingi larval habitat selection in Belize, Central America.

    PubMed

    Achee, Nicole L; Grieco, John P; Andre, Richard G; Roberts, Donald R; Rejmankova, Eliska

    2006-06-01

    Previous studies in Belize have shown the preferred breeding habitats of the malaria vector Anopheles darlingi were floating detritus patches within riverine systems that were associated with overhanging bamboo. The present study focused on an experimental evaluation of overhanging bamboo in An. darlingi habitat selection using larval counts as an indicator of attractiveness. Four sets of 1-m2 floating screened enclosures were placed at a location with a documented presence of both larval and adult An. darlingi populations. Each enclosure set comprised a control (i.e., open water) and three other experimental treatments consisting of: 1) detritus, 2) detritus with overhanging bamboo, and 3) overhanging bamboo alone. Larvae were sampled from all treatments on Day 5, Day 11, and Day 17 post-setup. A total of 2,461 An. darlingi larvae were collected and identified from three trials conducted from March-May 2002. Of these, 1,997 larvae were sampled from detritus treatments, 256 from enclosures with bamboo and detritus, 139 from bamboo treatments, and 69 from control enclosures. The detritus treatment had a significantly higher average count of An. darlingi larvae than the other treatments (P<0.01), and no difference existed between the control treatment and the treatment containing overhanging bamboo alone (P=0.423). More importantly, enclosures containing the overhanging bamboo with detritus treatments did not have greater larval populations than the enclosures with only detritus. These data suggest that bamboo does not contribute to An. darlingi larval habitat attractiveness but may function as a barrier to surface water flow causing the lodging of debris, the preferred habitat, that will then attract gravid females for oviposition.

  12. Dynamic effect of overhangs and islands at the depinning transition in two-dimensional magnets.

    PubMed

    Zhou, N J; Zheng, B

    2010-09-01

    With the Monte Carlo methods, we systematically investigate the short-time dynamics of domain-wall motion in the two-dimensional random-field Ising model with a driving field (DRFIM). We accurately determine the depinning transition field and critical exponents. Through two different definitions of the domain interface, we examine the dynamics of overhangs and islands. At the depinning transition, the dynamic effect of overhangs and islands reaches maximum. We argue that this should be an important mechanism leading the DRFIM model to a different universality class from the Edwards-Wilkinson equation with quenched disorder.

  13. Influences of large height differences and overhangs on the dynamic scaling behavior of discrete models

    NASA Astrophysics Data System (ADS)

    Xun, Zhi-Peng; Zhang, Zhe; Chen, Yi-Li; Wu, Ling; Tang, Gang

    2017-04-01

    In order to investigate the influences of large height differences and overhangs on the dynamic scaling behavior of discrete models, meanwhile reducing the finite-size effects, the Etching model is modified to reduce large height differences, and the overhangs in Ballistic Deposition surfaces are removed under certain principles. Numerical simulations are carried out for the modified models, and the results show that the modified surfaces lead to good dynamic scaling behavior even on small system length scales. The values of the dynamic scaling exponents are in excellent agreement with theoretical predictions of the Kardar-Parisi-Zhang equation in (1 + 1) dimensions.

  14. Telomeric overhang length determines structural dynamics and accessibility to telomerase and ALT associated proteins

    PubMed Central

    Hwang, Helen; Kreig, Alex; Calvert, Jacob; Lormand, Justin; Kwon, Yongho; Daley, James M.; Sung, Patrick; Opresko, Patricia L.; Myong, Sua

    2014-01-01

    The G-rich single stranded DNA at the 3′ end of human telomeres can self-fold into G-quaduplex (GQ). However, telomere lengthening by telomerase or the recombination-based alternative lengthening of telomere (ALT) mechanism requires protein loading on the overhang. Using single molecule fluorescence spectroscopy we discovered that lengthening the telomeric overhang also increased the rate of dynamic exchanges between structural conformations. Overhangs with five to seven TTAGGG repeats, compared to four repeats, showed much greater dynamics and accessibility to telomerase binding and activity, and loading of the ALT-associated proteins RAD51, WRN and BLM. Although the eight repeats are highly dynamic, they can fold into two GQs, which limited protein accessibility. In contrast, the telomere-specific protein, POT1 is unique in that it binds independently of repeat number. Our results suggest that the telomeric overhang length and dynamics may contribute to the regulation of telomere extension via telomerase action and the ALT mechanism. PMID:24836024

  15. Unique C. elegans telomeric overhang structures reveal the evolutionarily conserved properties of telomeric DNA

    PubMed Central

    Školáková, Petra; Foldynová-Trantírková, Silvie; Bednářová, Klára; Fiala, Radovan; Vorlíčková, Michaela; Trantírek, Lukáš

    2015-01-01

    There are two basic mechanisms that are associated with the maintenance of the telomere length, which endows cancer cells with unlimited proliferative potential. One mechanism, referred to as alternative lengthening of telomeres (ALT), accounts for approximately 10–15% of all human cancers. Tumours engaged in the ALT pathway are characterised by the presence of the single stranded 5′-C-rich telomeric overhang (C-overhang). This recently identified hallmark of ALT cancers distinguishes them from healthy tissues and renders the C-overhang as a clear target for anticancer therapy. We analysed structures of the 5′-C-rich and 3′-G-rich telomeric overhangs from human and Caenorhabditis elegans, the recently established multicellular in vivo model of ALT tumours. We show that the telomeric DNA from C. elegans and humans forms fundamentally different secondary structures. The unique structural characteristics of C. elegans telomeric DNA that are distinct not only from those of humans but also from those of other multicellular eukaryotes allowed us to identify evolutionarily conserved properties of telomeric DNA. Differences in structural organisation of the telomeric DNA between the C. elegans and human impose limitations on the use of the C. elegans as an ALT tumour model. PMID:25855805

  16. Failure Analysis of Overhanging Blocks in the Walls of a Gas Storage Salt Cavern: A Case Study

    NASA Astrophysics Data System (ADS)

    Wang, Tongtao; Yang, Chunhe; Li, Jianjun; Li, Jinlong; Shi, Xilin; Ma, Hongling

    2017-01-01

    Most of the rock salt of China is bedded, in which non-salt layers and rock salt layers alternate. Due to the poor solubility of the non-salt layers, many blocks overhang on the walls of the caverns used for gas storage, constructed by water leaching. These overhanging blocks may collapse at any time, which may damage the tubing and casing string, and even cause instability of the cavern. They are one of the main factors threatening the safety of caverns excavated in bedded rock salt formations. In this paper, a geomechanical model of the JJKK-D salt cavern, located in Jintan salt district, Jintan city, Jiangsu province, China, is established to evaluate the stability of the overhanging blocks on its walls. The characters of the target formation, property parameters of the rock mass, and actual working conditions are considered in the geomechanical model. An index system composed of stress, displacement, plastic zone, safety factor, and equivalent strain is used to predict the collapse length of the overhanging blocks, the moment the collapse will take place, and the main factors causing the collapse. The sonar survey data of the JJKK-D salt cavern are used to verify the reliability and accuracy of the proposed geomechanical model. The results show that the proposed geomechanical model has a good reliability and accuracy, and can be used for the collapse prediction of the overhanging blocks on the wall of the JJKK-D salt cavern. The collapse length of the overhanging block is about 8 m. We conclude that the collapse takes place during the debrining. The reason behind the collapse is the sudden decrease of the fluid density, leading to the increase of the self-weight of the overhanging blocks. This study provides a basis for the collapse prediction method of the overhanging blocks of Jintan salt cavern gas storage, and can also serve as a reference for salt cavern gas storage with similar conditions to deal with overhanging blocks.

  17. Analysis and optimal design of Si microstrip detector with overhanging metal electrode

    NASA Astrophysics Data System (ADS)

    Ranjan, Kirti; Bhardwaj, Ashutosh; Namrata; Chatterji, Sudeep; Srivastava, Ajay K.; Shivpuri, R. K.

    2001-07-01

    The harsh radiation environment to be encountered at LHC (large hadron collider) and RHIC (relativistic heavy ion collider) poses a challenging task for the fabrication of Si microstrip detectors. Due to high luminosities, detectors are required to sustain very high voltage operation well exceeding the bias voltage needed to fully deplete them. The `overhanging' metal contact is now a well established technique for improving the breakdown performance of the Si microstrip detector. Based on computer simulation, the influence of various physical and geometrical parameters on the electrical breakdown of the Si detectors equipped with metal overhangs is extensively analysed. Furthermore, optimization of design parameters is performed to achieve breakdown voltages close to maximum realizable values. The simulation results are found to be in good agreement with experimental data.

  18. The Impact of Overhang Design on the Performance of ElectrochromicWindows

    SciTech Connect

    Tavil, Aslihan; Lee, Eleanor S.

    2005-08-01

    In this study, various facade designs with overhangs combined with electrochromic window control strategies were modeled with a prototypical commercial office building in a hot and cold climate using the DOE 2.1E building energy simulation program. Annual total energy use (ATE), peak electric demand (PED), average daylight illuminance (DI), and daylight glare index (DGI) were computed and compared to determine which combinations of fagade design and control strategies yielded the greatest energy efficiency, daylight amenity, and visual comfort.

  19. Can artificial techniques supply morally neutral human embryos for research? Part I. Creating novel categories of human embryos.

    PubMed

    Jones, Nancy L; Cheshire, William P

    2005-01-01

    Manipulations of the molecular composition and formation of human embryos are posing vital new challenges to traditional concepts of human identity and procreation. Current trends in embryology in particular are reshaping the ethical question of how scientific research should treat experimentally derived embryos. Some investigators have argued that embryos created through artificial means are technologically novel entities that should be exempt from ethical restraints placed on research involving human embryos that come into being through natural processes. These include uniparental embryos derived through cloning or parthenogenesis, as well as multiparental, hybrid-parental, and xenohybrid-parental embryos. If confined to natural means many of these genetic unions could not occur, but through the intervention of technology, it is becoming possible to design and grow strange and unusual forms of embryos, in some cases using human gametes. Regardless of the genetic contributors or the processes used to fertilize and stimulate egg activation, in each case the new embryo represents an individual organism that begins a process of development. We conclude that the prospect of creating or redesigning new human life should be held to a stringent ethical standard of precaution, even higher than that of deciding to destroy existing embryonic life. Accordingly, we urge cautious ethical reflection and broad public discussion prior to deciding whether to permit embryologic research into novel forms of procreative means in nonhuman animals, to be further extended to humans.

  20. Trimming of damaged 3' overhangs of DNA double-strand breaks by the Metnase and Artemis endonucleases.

    PubMed

    Mohapatra, Susovan; Yannone, Steven M; Lee, Suk-Hee; Hromas, Robert A; Akopiants, Konstantin; Menon, Vijay; Ramsden, Dale A; Povirk, Lawrence F

    2013-06-01

    Both Metnase and Artemis possess endonuclease activities that trim 3' overhangs of duplex DNA. To assess the potential of these enzymes for facilitating resolution of damaged ends during double-strand break rejoining, substrates bearing a variety of normal and structurally modified 3' overhangs were constructed, and treated either with Metnase or with Artemis plus DNA-dependent protein kinase (DNA-PK). Unlike Artemis, which trims long overhangs to 4-5 bases, cleavage by Metnase was more evenly distributed over the length of the overhang, but with significant sequence dependence. In many substrates, Metnase also induced marked cleavage in the double-stranded region within a few bases of the overhang. Like Artemis, Metnase efficiently trimmed overhangs terminated in 3'-phosphoglycolates (PGs), and in some cases the presence of 3'-PG stimulated cleavage and altered its specificity. The nonplanar base thymine glycol in a 3' overhang severely inhibited cleavage by Metnase in the vicinity of the modified base, while Artemis was less affected. Nevertheless, thymine glycol moieties could be removed by Metnase- or Artemis-mediated cleavage at sites farther from the terminus than the lesion itself. In in vitro end-joining systems based on human cell extracts, addition of Artemis, but not Metnase, effected robust trimming of an unligatable 3'-PG overhang, resulting in a dramatic stimulation of ligase IV- and XLF-dependent end joining. Thus, while both Metnase and Artemis are biochemically capable of resolving a variety of damaged DNA ends for the repair of complex double-strand breaks, Artemis appears to act more efficiently in the context of other nonhomologous end joining proteins. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Trimming of damaged 3′ overhangs of DNA double-strand breaks by the Metnase and Artemis endonucleases

    PubMed Central

    Mohapatra, Susovan; Yannone, Steven M.; Lee, Suk-Hee; Hromas, Robert A.; Akopiants, Konstantin; Menon, Vijay; Ramsden, Dale A.; Povirk, Lawrence F.

    2013-01-01

    Both Metnase and Artemis possess endonuclease activities that trim 3′ overhangs of duplex DNA. To assess the potential of these enzymes for facilitating resolution of damaged ends during double-strand break rejoining, substrates bearing a variety of normal and structurally modified 3′ overhangs were constructed, and treated either with Metnase or with Artemis plus DNA-dependent protein kinase (DNA-PK). Unlike Artemis, which trims long overhangs to 4–5 bases, cleavage by Metnase was more evenly distributed over the length of the overhang, but with significant sequence dependence. In many substrates, Metnase also induced marked cleavage in the double-stranded region within a few bases of the overhang. Like Artemis, Metnase efficiently trimmed overhangs terminated in 3′-phosphoglycolates (PGs), and in some cases the presence of 3′-PG stimulated cleavage and altered its specificity. The nonplanar base thymine glycol in a 3′ overhang severely inhibited cleavage by Metnase in the vicinity of the modified base, while Artemis was less affected. Nevertheless, thymine glycol moieties could be removed by Metnase- or Artemis-mediated cleavage at sites farther from the terminus than the lesion itself. In in vitro end-joining systems based on human cell extracts, addition of Artemis, but not Metnase, effected robust trimming of an unligatable 3′-PG overhang, resulting in a dramatic stimulation of ligase IV- and XLF-dependent end joining. Thus, while both Metnase and Artemis are biochemically capable of resolving a variety of damaged DNA ends for the repair of complex double-strand breaks, Artemis appears to act more efficiently in the context of other nonhomologous end joining proteins. PMID:23602515

  2. Treatment of overhanging blebs with frequency-doubled Nd:YAG laser.

    PubMed

    Sony, Parul; Kumar, Harsh; Pushker, Neelam

    2004-01-01

    Large overhanging blebs can be associated with various complications (eg, overfiltration, endophthalmitis, and dellen formation). Argon laser treatment of such blebs has already been described. The authors used frequency-doubled Nd:YAG laser in 3 eyes of 3 patients with large filtering blebs. Gentian violet was used to stain the bleb surface and enhance the laser absorption. Laser spots were applied over the bleb surface. Bleb shrinkage and remodeling was observed in all 3 eyes. Intraocular pressure remained normal, suggesting that the filtering capability of the blebs was maintained.

  3. dsRNA with 5' overhangs contributes to endogenous and antiviral RNA silencing pathways in plants.

    PubMed

    Fukunaga, Ryuya; Doudna, Jennifer A

    2009-03-04

    In plants, SGS3 and RNA-dependent RNA polymerase 6 (RDR6) are required to convert single- to double-stranded RNA (dsRNA) in the innate RNAi-based antiviral response and to produce both exogenous and endogenous short-interfering RNAs. Although a role for RDR6-catalysed RNA-dependent RNA polymerisation in these processes seems clear, the function of SGS3 is unknown. Here, we show that SGS3 is a dsRNA-binding protein with unexpected substrate selectivity favouring 5'-overhang-containing dsRNA. The conserved XS and coiled-coil domains are responsible for RNA-binding activity. Furthermore, we find that the V2 protein from tomato yellow leaf curl virus, which suppresses the RNAi-based host immune response, is a dsRNA-binding protein with similar specificity to SGS3. In competition-binding experiments, V2 outcompetes SGS3 for substrate dsRNA recognition, whereas a V2 point mutant lacking the suppressor function in vivo cannot efficiently overcome SGS3 binding. These findings suggest that SGS3 recognition of dsRNA containing a 5' overhang is required for subsequent steps in RNA-mediated gene silencing in plants, and that V2 functions as a viral suppressor by preventing SGS3 from accessing substrate RNAs.

  4. The effect of overhanging nucleotides on fluorescence properties of hybridising oligonucleotides labelled with Alexa-488 and FAM fluorophores.

    PubMed

    Noble, J E; Wang, L; Cole, K D; Gaigalas, A K

    2005-03-01

    In order to rationally select and design probes for real-time PCR, we have determined the influence of the overhang region of the complementary strand on the resulting fluorescence from a hybridising probe. A series of target oligonucleotides, each with a unique 3' overhang (4 bases), was hybridised to either 5' fluorescein (FAM)- or Alexa-488-labelled probes, and the changes in fluorescence properties were monitored. We found that the number of guanine bases in the overhang region of the target oligonucleotides was proportional to the amount of fluorescence quenching observed for both the FAM and Alexa-488 dyes. FAM appeared to be more sensitive to guanine-induced quenching with three and four guanine bases resulting in greater than a twofold decrease in the quantum yield of the fluorophore compared to the no-overhang target. In addition, we found that adenine bases caused fluorescence quenching of the Alexa-488-labelled probe, whereas the FAM-labelled probe appeared insensitive. The quenching data, generated with the steady-state fluorescence measurements, displayed a linear correlation with that obtained using a fluorescent thermal cycler, suggesting the applicability to real-time PCR measurements. Anisotropy data from the series of duplexes correlated with the fluorescence quantum yield, suggesting that quenching was accompanied by increased dye mobility.

  5. Overhang polarity of chromosomal double-strand breaks impacts kinetics and fidelity of yeast non-homologous end joining.

    PubMed

    Liang, Zhuobin; Sunder, Sham; Nallasivam, Sivakumar; Wilson, Thomas E

    2016-04-07

    Non-homologous end joining (NHEJ) is the main repair pathway for DNA double-strand breaks (DSBs) in cells with limited 5' resection. To better understand how overhang polarity of chromosomal DSBs affects NHEJ, we made site-specific 5'-overhanging DSBs (5' DSBs) in yeast using an optimized zinc finger nuclease at an efficiency that approached HO-induced 3' DSB formation. When controlled for the extent of DSB formation, repair monitoring suggested that chromosomal 5' DSBs were rejoined more efficiently than 3' DSBs, consistent with a robust recruitment of NHEJ proteins to 5' DSBs. Ligation-mediated qPCR revealed that Mre11-Rad50-Xrs2 rapidly modified 5' DSBs and facilitated protection of 3' DSBs, likely through recognition of overhang polarity by the Mre11 nuclease. Next-generation sequencing revealed that NHEJ at 5' DSBs had a higher mutation frequency, and validated the differential requirement of Pol4 polymerase at 3' and 5' DSBs. The end processing enzyme Tdp1 did not impact joining fidelity at chromosomal 5' DSBs as in previous plasmid studies, although Tdp1 was recruited to only 5' DSBs in a Ku-independent manner. These results suggest distinct DSB handling based on overhang polarity that impacts NHEJ kinetics and fidelity through differential recruitment and action of DSB modifying enzymes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Overhang polarity of chromosomal double-strand breaks impacts kinetics and fidelity of yeast non-homologous end joining

    PubMed Central

    Liang, Zhuobin; Sunder, Sham; Nallasivam, Sivakumar; Wilson, Thomas E.

    2016-01-01

    Non-homologous end joining (NHEJ) is the main repair pathway for DNA double-strand breaks (DSBs) in cells with limited 5′ resection. To better understand how overhang polarity of chromosomal DSBs affects NHEJ, we made site-specific 5′-overhanging DSBs (5′ DSBs) in yeast using an optimized zinc finger nuclease at an efficiency that approached HO-induced 3′ DSB formation. When controlled for the extent of DSB formation, repair monitoring suggested that chromosomal 5′ DSBs were rejoined more efficiently than 3′ DSBs, consistent with a robust recruitment of NHEJ proteins to 5′ DSBs. Ligation-mediated qPCR revealed that Mre11-Rad50-Xrs2 rapidly modified 5′ DSBs and facilitated protection of 3′ DSBs, likely through recognition of overhang polarity by the Mre11 nuclease. Next-generation sequencing revealed that NHEJ at 5′ DSBs had a higher mutation frequency, and validated the differential requirement of Pol4 polymerase at 3′ and 5′ DSBs. The end processing enzyme Tdp1 did not impact joining fidelity at chromosomal 5′ DSBs as in previous plasmid studies, although Tdp1 was recruited to only 5′ DSBs in a Ku-independent manner. These results suggest distinct DSB handling based on overhang polarity that impacts NHEJ kinetics and fidelity through differential recruitment and action of DSB modifying enzymes. PMID:26773053

  7. The Perceptions of the Automotive Supply Industry Related to Information Technology Utilization and Creating Barriers to Competitive Market Entry: A Case Study of the Implications for Strategic Planning

    ERIC Educational Resources Information Center

    Cargal, Joseph L.

    2010-01-01

    The purpose of this study was to examine information technology/systems strategy related factors in the automotive supply industry based on responses to the Strategic Planning and Business Performance Survey provided to automotive suppliers. This population produces supplies to the automotive industry with products valued at hundreds of billions…

  8. The Perceptions of the Automotive Supply Industry Related to Information Technology Utilization and Creating Barriers to Competitive Market Entry: A Case Study of the Implications for Strategic Planning

    ERIC Educational Resources Information Center

    Cargal, Joseph L.

    2010-01-01

    The purpose of this study was to examine information technology/systems strategy related factors in the automotive supply industry based on responses to the Strategic Planning and Business Performance Survey provided to automotive suppliers. This population produces supplies to the automotive industry with products valued at hundreds of billions…

  9. Reconstructing Buildings with Discontinuities and Roof Overhangs from Oblique Aerial Imagery

    NASA Astrophysics Data System (ADS)

    Frommholz, D.; Linkiewicz, M.; Meissner, H.; Dahlke, D.

    2017-05-01

    This paper proposes a two-stage method for the reconstruction of city buildings with discontinuities and roof overhangs from oriented nadir and oblique aerial images. To model the structures the input data is transformed into a dense point cloud, segmented and filtered with a modified marching cubes algorithm to reduce the positional noise. Assuming a monolithic building the remaining vertices are initially projected onto a 2D grid and passed to RANSAC-based regression and topology analysis to geometrically determine finite wall, ground and roof planes. If this should fail due to the presence of discontinuities the regression will be repeated on a 3D level by traversing voxels within the regularly subdivided bounding box of the building point set. For each cube a planar piece of the current surface is approximated and expanded. The resulting segments get mutually intersected yielding both topological and geometrical nodes and edges. These entities will be eliminated if their distance-based affiliation to the defining point sets is violated leaving a consistent building hull including its structural breaks. To add the roof overhangs the computed polygonal meshes are projected onto the digital surface model derived from the point cloud. Their shapes are offset equally along the edge normals with subpixel accuracy by detecting the zero-crossings of the second-order directional derivative in the gradient direction of the height bitmap and translated back into world space to become a component of the building. As soon as the reconstructed objects are finished the aerial images are further used to generate a compact texture atlas for visualization purposes. An optimized atlas bitmap is generated that allows perspectivecorrect multi-source texture mapping without prior rectification involving a partially parallel placement algorithm. Moreover, the texture atlases undergo object-based image analysis (OBIA) to detect window areas which get reintegrated into the building

  10. Advances in stream shade modelling. Accounting for canopy overhang and off-centre view

    NASA Astrophysics Data System (ADS)

    Davies-Colley, R.; Meleason, M. A.; Rutherford, K.

    2005-05-01

    Riparian shade controls the stream thermal regime and light for photosynthesis of stream plants. The quantity difn (diffuse non-interceptance), defined as the proportion of incident lighting received under a sky of uniform brightness, is useful for general specification of stream light exposure, having the virtue that it can be measured directly with common light sensors of appropriate spatial and spectral character. A simple model (implemented in EXCEL-VBA) (Davies-Colley & Rutherford Ecol. Engrg in press) successfully reproduces the broad empirical trend of decreasing difn at the channel centre with increasing ratio of canopy height to stream width. We have now refined this model to account for (a) foliage overhanging the channel (for trees of different canopy form), and (b) off-centre view of the shade (rather than just the channel centre view). We use two extreme geometries bounding real (meandering) streams: the `canyon' model simulates an infinite straight canal, whereas the `cylinder' model simulates a stream meandering so tightly that its geometry collapses into an isolated pool in the forest. The model has been validated using a physical `rooftop' model of the cylinder case, with which it is possible to measure shade with different geometries.

  11. Comparing 2-nt 3' overhangs against blunt-ended siRNAs: a systems biology based study

    PubMed Central

    Ghosh, Preetam; Dullea, Robert; Fischer, James E; Turi, Tom G; Sarver, Ronald W; Zhang, Chaoyang; Basu, Kalyan; Das, Sajal K; Poland, Bradley W

    2009-01-01

    In this study, we formulate a computational reaction model following a chemical kinetic theory approach to predict the binding rate constant for the siRNA-RISC complex formation reaction. The model allowed us to study the potency difference between 2-nt 3' overhangs against blunt-ended siRNA molecules in an RNA interference (RNAi) system. The rate constant predicted by this model was fed into a stochastic simulation of the RNAi system (using the Gillespie stochastic simulator) to study the overall potency effect. We observed that the stochasticity in the transcription/translation machinery has no observable effects in the RNAi pathway. Sustained gene silencing using siRNAs can be achieved only if there is a way to replenish the dsRNA molecules in the cell. Initial findings show about 1.5 times more blunt-ended molecules will be required to keep the mRNA at the same reduced level compared to the 2-nt overhang siRNAs. However, the mRNA levels jump back to saturation after a longer time when blunt-ended siRNAs are used. We found that the siRNA-RISC complex formation reaction rate was 2 times slower when blunt-ended molecules were used pointing to the fact that the presence of the 2-nt overhangs has a greater effect on the reaction in which the bound RISC complex cleaves the mRNA. PMID:19594876

  12. C. elegans telomeres contain G-strand and C-strand overhangs that are bound by distinct proteins.

    PubMed

    Raices, Marcela; Verdun, Ramiro E; Compton, Sarah A; Haggblom, Candy I; Griffith, Jack D; Dillin, Andrew; Karlseder, Jan

    2008-03-07

    Single-strand extensions of the G strand of telomeres are known to be critical for chromosome-end protection and length regulation. Here, we report that in C. elegans, chromosome termini possess 3' G-strand overhangs as well as 5' C-strand overhangs. C tails are as abundant as G tails and are generated by a well-regulated process. These two classes of overhangs are bound by two single-stranded DNA binding proteins, CeOB1 and CeOB2, which exhibit specificity for G-rich or C-rich telomeric DNA. Strains of worms deleted for CeOB1 have elongated telomeres as well as extended G tails, whereas CeOB2 deficiency leads to telomere-length heterogeneity. Both CeOB1 and CeOB2 contain OB (oligo-saccharide/oligo-nucleotide binding) folds, which exhibit structural similarity to the second and first OB folds of the mammalian telomere binding protein hPOT1, respectively. Our results suggest that C. elegans telomere homeostasis relies on a novel mechanism that involves 5' and 3' single-stranded termini.

  13. Sticking like sticky tape: tree frogs use friction forces to enhance attachment on overhanging surfaces.

    PubMed

    Endlein, Thomas; Ji, Aihong; Samuel, Diana; Yao, Ning; Wang, Zhongyuan; Barnes, W Jon P; Federle, Walter; Kappl, Michael; Dai, Zhendong

    2013-03-06

    To live and clamber about in an arboreal habitat, tree frogs have evolved adhesive pads on their toes. In addition, they often have long and slender legs to facilitate not only long jumps, but also to bridge gaps between leaves when climbing. Both adhesive pads and long limbs are used in conjunction, as we will show in this study. Previous research has shown that tree frogs change from a crouched posture (where the limbs are close to the body) to a sprawled posture with extended limbs when clinging on to steeper inclines such as vertical or overhanging slopes. We investigated this change in posture in White's tree frogs (Litoria caerulea) by challenging the frogs to cling onto a tiltable platform. The platform consisted of an array of 24 three-dimensional force transducers, which allowed us to measure the ground reaction forces of the frogs during a tilt. Starting from a crouched resting position, the normal forces on the forelimbs changed sign and became increasingly negative with increasing slope angle of the platform. At about 106° ± 12°, tilt of the platform the frogs reacted by extending one or two of their limbs outwards. At a steeper angle (131° ± 11°), the frogs spread out all their limbs sideways, with the hindlimbs stretched out to their maximum reach. Although the extension was strongest in the lateral direction, limbs were significantly extended in the fore-aft direction as well. With the extension of the limbs, the lateral forces increased relative to the normal forces. The large contribution of the in-plane forces helped to keep the angle between the force vector and the platform small. The Kendall theory for the peeling of adhesive tape predicts that smaller peel angles lead to higher attachment forces. We compare our data with the predictions of the Kendall model and discuss possible implications of the sliding of the pads on the surface. The forces were indeed much larger for smaller angles and thus can be explained by peeling theory.

  14. Sticking like sticky tape: tree frogs use friction forces to enhance attachment on overhanging surfaces

    PubMed Central

    Endlein, Thomas; Ji, Aihong; Samuel, Diana; Yao, Ning; Wang, Zhongyuan; Barnes, W. Jon P.; Federle, Walter; Kappl, Michael; Dai, Zhendong

    2013-01-01

    To live and clamber about in an arboreal habitat, tree frogs have evolved adhesive pads on their toes. In addition, they often have long and slender legs to facilitate not only long jumps, but also to bridge gaps between leaves when climbing. Both adhesive pads and long limbs are used in conjunction, as we will show in this study. Previous research has shown that tree frogs change from a crouched posture (where the limbs are close to the body) to a sprawled posture with extended limbs when clinging on to steeper inclines such as vertical or overhanging slopes. We investigated this change in posture in White's tree frogs (Litoria caerulea) by challenging the frogs to cling onto a tiltable platform. The platform consisted of an array of 24 three-dimensional force transducers, which allowed us to measure the ground reaction forces of the frogs during a tilt. Starting from a crouched resting position, the normal forces on the forelimbs changed sign and became increasingly negative with increasing slope angle of the platform. At about 106°±12°, tilt of the platform the frogs reacted by extending one or two of their limbs outwards. At a steeper angle (131°±11°), the frogs spread out all their limbs sideways, with the hindlimbs stretched out to their maximum reach. Although the extension was strongest in the lateral direction, limbs were significantly extended in the fore–aft direction as well. With the extension of the limbs, the lateral forces increased relative to the normal forces. The large contribution of the in-plane forces helped to keep the angle between the force vector and the platform small. The Kendall theory for the peeling of adhesive tape predicts that smaller peel angles lead to higher attachment forces. We compare our data with the predictions of the Kendall model and discuss possible implications of the sliding of the pads on the surface. The forces were indeed much larger for smaller angles and thus can be explained by peeling theory. PMID

  15. Enhancing capacitive DNA biosensor performance by target overhang with application on screening test of HLA-B*58:01 and HLA-B*57:01 genes.

    PubMed

    Thipmanee, Orawan; Numnuam, Apon; Limbut, Warakorn; Buranachai, Chittanon; Kanatharana, Proespichaya; Vilaivan, Tirayut; Hirankarn, Nattiya; Thavarungkul, Panote

    2016-08-15

    A highly sensitive label-free DNA biosensor based on PNA probes immobilized on a gold electrode was used to detect a hybridization event. The effect of a target DNA overhang on the hybridization efficiency was shown to enhance the detected signal and allowed detection at a very low concentration. The sensors performances were investigated with a complementary target that had the same length as the probe, and the signal was compared to the target DNAs with different lengths and overhangs. A longer target DNA overhang was found to provide a better response. When the overhang was on the electrode side the signal enhancement was greater than when the overhang was on the solution side due to the increased thickness of the sensing surface, hence produced a larger capacitance change. Using conformationally constrained acpcPNA probes, double stranded DNA was detected sensitively and specifically without any denaturing step. When two acpcPNA probes were applied for the screening test for the double stranded HLA-B*58:01 and HLA-B*57:01 genes that are highly similar, the method differentiated the two genes in all samples. Both purified and unpurified PCR products gave comparable results. This method would be potentially useful as a rapid screening test without the need for purification and denaturation of the PCR products.

  16. Power supply

    DOEpatents

    Hart, Edward J.; Leeman, James E.; MacDougall, Hugh R.; Marron, John J.; Smith, Calvin C.

    1976-01-01

    An electric power supply employs a striking means to initiate ferroelectric elements which provide electrical energy output which subsequently initiates an explosive charge which initiates a second ferroelectric current generator to deliver current to the coil of a magnetic field current generator, creating a magnetic field around the coil. Continued detonation effects compression of the magnetic field and subsequent generation and delivery of a large output current to appropriate output loads.

  17. Improving accuracy of overhanging structures for selective laser melting through reliability characterization of single track formation on thick powder beds

    NASA Astrophysics Data System (ADS)

    Mohanty, Sankhya; Hattel, Jesper H.

    2016-04-01

    Repeatability and reproducibility of parts produced by selective laser melting is a standing issue, and coupled with a lack of standardized quality control presents a major hindrance towards maturing of selective laser melting as an industrial scale process. Consequently, numerical process modelling has been adopted towards improving the predictability of the outputs from the selective laser melting process. Establishing the reliability of the process, however, is still a challenge, especially in components having overhanging structures. In this paper, a systematic approach towards establishing reliability of overhanging structure production by selective laser melting has been adopted. A calibrated, fast, multiscale thermal model is used to simulate the single track formation on a thick powder bed. Single tracks are manufactured on a thick powder bed using same processing parameters, but at different locations in a powder bed and in different laser scanning directions. The difference in melt track widths and depths captures the effect of changes in incident beam power distribution due to location and processing direction. The experimental results are used in combination with numerical model, and subjected to uncertainty and reliability analysis. Cumulative probability distribution functions obtained for melt track widths and depths are found to be coherent with observed experimental values. The technique is subsequently extended for reliability characterization of single layers produced on a thick powder bed without support structures, by determining cumulative probability distribution functions for average layer thickness, sample density and thermal homogeneity.

  18. Development of 4-Pixel-Array TES Microcalorimeters with Mushroom-Shaped Absorbers with Insulating Layers Supporting Overhang Regions

    NASA Astrophysics Data System (ADS)

    Maehata, K.; Iyomoto, N.; Maeda, M.; Ezaki, S.; Takano, A.; Matsumura, S.; Hara, T.; Mitsuda, K.; Yamasaki, N. Y.; Tanaka, K.

    2014-08-01

    A four-pixel-array superconducting transition-edge sensor (TES) microcalorimeter with a mushroom-shaped absorber was developed for energy dispersive spectroscopy performed on a transmission electron microscope. The TES consists of a bilayer of Au/Ti with either a 120- or 50-nm thickness. The absorber is made from a Au layer and its stem is deposited in the center of the TES surface. A TaO insulating layer of 100-nm thickness is inserted between the overhang region of the absorber and the TES surface. Two types of microcalorimeter were fabricated with differing absorber thicknesses of 0.5 and 5.0 m. An energy resolution of 15 eV FWHM with 5.9-keV X-rays was obtained using the 0.5-m-type microcalorimeter.

  19. Probing molecular pathways for DNA orientational trapping, unzipping and translocation in nanopores by using a tunable overhang sensor

    NASA Astrophysics Data System (ADS)

    Wang, Yong; Tian, Kai; Hunter, Lehr L.; Ritzo, Brandon; Gu, Li-Qun

    2014-09-01

    Nanopores provide a unique single-molecule platform for genetic and epigenetic detection. The target nucleic acids can be accurately analyzed by characterizing their specific electric fingerprints or signatures in the nanopore. Here we report a series of novel nanopore signatures generated by target nucleic acids that are hybridized with a probe. A length-tunable overhang appended to the probe functions as a sensor to specifically modulate the nanopore current profile. The resulting signatures can reveal multiple mechanisms for the orientational trapping, unzipping, escaping and translocation of nucleic acids in the nanopore. This universal approach can be used to program various molecular movement pathways, elucidate their kinetics, and enhance the sensitivity and specificity of the nanopore sensor for nucleic acid detection.Nanopores provide a unique single-molecule platform for genetic and epigenetic detection. The target nucleic acids can be accurately analyzed by characterizing their specific electric fingerprints or signatures in the nanopore. Here we report a series of novel nanopore signatures generated by target nucleic acids that are hybridized with a probe. A length-tunable overhang appended to the probe functions as a sensor to specifically modulate the nanopore current profile. The resulting signatures can reveal multiple mechanisms for the orientational trapping, unzipping, escaping and translocation of nucleic acids in the nanopore. This universal approach can be used to program various molecular movement pathways, elucidate their kinetics, and enhance the sensitivity and specificity of the nanopore sensor for nucleic acid detection. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr03195d

  20. In vitro analysis of the radiodensity of indirect composites and ceramic inlay systems and its influence on the detection of cement overhangs.

    PubMed

    Soares, Carlos José; Santana, Fernanda Ribeiro; Fonseca, Rodrigo Borges; Martins, Luis Roberto Marcondes; Neto, Francisco Haiter

    2007-12-01

    The purpose of this study was to evaluate the radiodensity of indirect restorative systems and to determine its influence on detection of resin cement overhangs. Sixty sound molars with similar dimensions were selected, and MOD inlay preparations were made in a standardized fashion with 6 degrees taper of the walls. Restorations were made with a porcelain, Duceram LFC, and with three indirect composites, Solidex, Artglass, and Targis. Digital radiographic images were taken before and after cementation of the inlays (Digora system) and were analyzed on two regions, the cervical and the isthmus floor. Digital radiodensity measurements were performed on standardized points symmetrically distributed over each restoration and tooth structure. Cement overhangs were detected through visual analysis by three evaluators. Data were statistically analyzed utilizing ANOVA following Tukey's test (p < 0.05), showing that Solidex presented lower radiodensity than Duceram LFC, and both Artglass and Targis presented similar higher levels of radiodensity than the other groups. Radiodensity of cervical regions was always greater than for isthmus floor regions. Detection of the resin cement overhangs is easier observed on Solidex and Duceram LFC. Radiodensity is highly influenced by restorative material type and tooth regions. The detection of radiopaque resin cement overhangs is influenced by radiodensity of restorative materials.

  1. Wind tunnel pressure distribution tests on a series of biplane wing models Part II : effects of changes in decalage, dihedral, sweepback and overhang

    NASA Technical Reports Server (NTRS)

    Knight, Montgomery; Noyes, Richard W

    1929-01-01

    This preliminary report furnishes information on the changes in the forces on each wing of a biplane cellule when the decalage, dihedral, sweepback and overhang are separately varied. The data were obtained from pressure distribution tests made in the Atmospheric Wind Tunnel of the Langley Memorial Aeronautical Laboratory. Since each test was carried up to 90 degree angle of attack, the results may be used in the study of stalled flight and of spinning and in the structural design of biplane wings.

  2. Early and late steps in telomere overhang processing in normal human cells: the position of the final RNA primer drives telomere shortening

    PubMed Central

    Chow, Tracy T.; Zhao, Yong; Mak, Sabrina S.; Shay, Jerry W.; Wright, Woodring E.

    2012-01-01

    Telomere overhangs are essential for telomere end protection and telomerase extension, but how telomere overhangs are generated is unknown. Leading daughter strands synthesized by conventional semiconservation DNA replication are initially blunt, while lagging daughter strands are shorter by at least the size of the final RNA primer, which is thought to be located at extreme chromosome ends. We developed a variety of new approaches to define the steps in the processing of these overhangs. We show that the final lagging RNA primer is not terminal but is randomly positioned ∼70–100 nucleotides from the ends and is not removed for more than an hour. This identifies an important intrinsic step in replicative aging. Telomeric termini are processed in two distinct phases. During the early phase, which occupies 1–2 h following replication of the duplex telomeric DNA, several steps occur on both leading and lagging daughters. Leading telomere processing remains incomplete until late S/G2, when the C-terminal nucleotide is specified—referred to as the late phase. These observations suggest the presence of previously unsuspected complexes and signaling events required for the replication of the ends of human chromosomes. PMID:22661228

  3. Creating Poetry.

    ERIC Educational Resources Information Center

    Drury, John

    Encouraging exploration and practice, this book offers hundreds of exercises and numerous tips covering every step involved in creating poetry. Each chapter is a self-contained unit offering an overview of material in the chapter, a definition of terms, and poetry examples from well-known authors designed to supplement the numerous exercises.…

  4. Hairpin DNA probe with 5'-TCC/CCC-3' overhangs for the creation of silver nanoclusters and miRNA assay.

    PubMed

    Xia, Xiaodong; Hao, Yuanqiang; Hu, Shengqiang; Wang, Jianxiu

    2014-01-15

    A facile strategy for the assay of target miRNA using fluorescent silver nanoclusters (AgNCs) has been described. Due to the preferable interaction between cytosine residues and Ag(+), a short cytosine-rich oligonucleotide (ODN) with only six bases 5'-TCCCCC-3' served as an efficient scaffold for the creation of the AgNCs. The AgNCs displayed a bright red emission when excited at 545nm. Such ODN base-stabilized AgNCs have been exploited for miRNA sensing. Overhangs of TCC at the 5' end (5'-TCC) and CCC at the 3' end (CCC-3') (denoted as 5'-TCC/CCC-3') appended to the hairpin ODN probe which also contains recognition sequences for target miRNA were included. Interestingly, the AgNCs/hairpin ODN probe showed similar spectral properties as that templated by 5'-TCCCCC-3'. The formation of the hairpin ODN probe/miRNA duplex separated the 5'-TCC/CCC-3' overhangs, thus disturbing the optical property or structure of the AgNCs. As a result, fluorescence quenching of the AgNCs/hairpin ODN probe was obtained, which allows for facile determination of target miRNA. The proposed method is simple and cost-effective, holding great promise for clinical applications. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Salt supply to and significance of asymmetric salt diapirs

    NASA Astrophysics Data System (ADS)

    Koyi, H.; Burliga, S.; Chemia, Z.

    2012-04-01

    Salt diapirs can be asymmetric both internally and externally reflecting their evolution history. As such, this asymmetry bear a significant amount of information about the differential loading (± lateral forces) and in turn the salt supply that have shaped the diapir. In two dimensions, In this study we compare results of analogue and numerical models of diapirs with two natural salt diapris (Klodawa and Gorleben diapirs) to explain their salt supply and asymmetric evolution. In a NW-SE section, the Gorleben salt diapir possesses an asymmetric external geometry represented by a large southeastern overhang due to salt extrusion during Middle Cretaceous followed by its burial in Tertiary. This external asymmetry is also reflected in the internal configuration of the diapir which shows different rates of salt flow on the two halves of the structure. The asymmetric external and internal geometry of the Gorleben diapir reflect an asymmetric salt supply driven by an asymmetric differential loading. The Kłodawa Salt Structure of Poland is also an asymmetric salt structure driven by asymmetric differential loading from the overlying sediments. The KSS is a salt ridge built of Zechstein evaporite series located in the axial part of the former Mid-Polish Trough. This extensional basin was filled with Zechstein to Cretaceous sediments and was inverted in the Late Cretaceous to Paleogene time. The diapir was triggered in Triassic above a basement fault. In late Triassic, after intruding cover sediments, the diapir extruded an overhang. Using the asymmetric Kłodawa Salt Structure (KSS) in central Poland as a prototype, a series of analogue models were carried out to investigate the evolution history and salt supply driven by asymmetric differential loading. During extension of the model, a daipir was upbuilt by the sand cover above the basement fault. The ductile layer was allowed to extrude a wide overhang at the model "late Triassic" time. The diapir was later downbuilt

  6. Nursing Supplies

    MedlinePlus

    ... Stages Listen Español Text Size Email Print Share Nursing Supplies Page Content Article Body Throughout most of ... budget. (Nursing equipment also makes wonderful baby gifts.) Nursing Bras A well-made nursing bra that comfortably ...

  7. Power Supply

    NASA Astrophysics Data System (ADS)

    1991-01-01

    Maxwell Laboratories capacitor charging power supply is the first commercial spinoff from the NASA CCDS program - a consortia of industries and government establishments to accelerate development of ground and space based commercial applications of NASA technology. The power supply transforms and conditions large voltages to charge capacitors used in x-ray sources, medical accelerators, etc. It is lighter, more reliable, more compact and efficient. Originally developed for space lasers, its commercial potential was soon recognized.

  8. Ready for supply inflation?

    PubMed

    Larkin, Howard

    2006-03-01

    Hurricane Katrina was expected to provoke major hikes in the prices that hospitals pay for supplies and commodities. But other forces--global demand for raw materials and for access to shipping, in particular--are having an even bigger impact on everything from heating oil to synthetic gloves. Hospitals are using old strategies and creating new ones to try to manage risk and blunt the effect of this inflationary spiral.

  9. 25 CFR 137.1 - Water supply.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Water supply. 137.1 Section 137.1 Indians BUREAU OF... CARLOS INDIAN IRRIGATION PROJECT, ARIZONA § 137.1 Water supply. The engineering report dealt with in... capacity of the San Carlos reservoir created by the Coolidge Dam and the water supply therefor over...

  10. 25 CFR 137.1 - Water supply.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 25 Indians 1 2011-04-01 2011-04-01 false Water supply. 137.1 Section 137.1 Indians BUREAU OF... CARLOS INDIAN IRRIGATION PROJECT, ARIZONA § 137.1 Water supply. The engineering report dealt with in... capacity of the San Carlos reservoir created by the Coolidge Dam and the water supply therefor over...

  11. 25 CFR 137.1 - Water supply.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 25 Indians 1 2013-04-01 2013-04-01 false Water supply. 137.1 Section 137.1 Indians BUREAU OF... CARLOS INDIAN IRRIGATION PROJECT, ARIZONA § 137.1 Water supply. The engineering report dealt with in... capacity of the San Carlos reservoir created by the Coolidge Dam and the water supply therefor over...

  12. 25 CFR 137.1 - Water supply.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 25 Indians 1 2014-04-01 2014-04-01 false Water supply. 137.1 Section 137.1 Indians BUREAU OF... CARLOS INDIAN IRRIGATION PROJECT, ARIZONA § 137.1 Water supply. The engineering report dealt with in... capacity of the San Carlos reservoir created by the Coolidge Dam and the water supply therefor over...

  13. 25 CFR 137.1 - Water supply.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 25 Indians 1 2012-04-01 2011-04-01 true Water supply. 137.1 Section 137.1 Indians BUREAU OF INDIAN... INDIAN IRRIGATION PROJECT, ARIZONA § 137.1 Water supply. The engineering report dealt with in section 1... of the San Carlos reservoir created by the Coolidge Dam and the water supply therefor over a...

  14. Extending the "Knowledge Advantage": Creating Learning Chains

    ERIC Educational Resources Information Center

    Maqsood, Tayyab; Walker, Derek; Finegan, Andrew

    2007-01-01

    Purpose: The purpose of this paper is to develop a synergy between the approaches of knowledge management in a learning organisation and supply chain management so that learning chains can be created in order to unleash innovation and creativity by managing knowledge in supply chains. Design/methodology/approach: Through extensive literature…

  15. Extending the "Knowledge Advantage": Creating Learning Chains

    ERIC Educational Resources Information Center

    Maqsood, Tayyab; Walker, Derek; Finegan, Andrew

    2007-01-01

    Purpose: The purpose of this paper is to develop a synergy between the approaches of knowledge management in a learning organisation and supply chain management so that learning chains can be created in order to unleash innovation and creativity by managing knowledge in supply chains. Design/methodology/approach: Through extensive literature…

  16. Power supply

    DOEpatents

    Yakymyshyn, Christopher Paul; Hamilton, Pamela Jane; Brubaker, Michael Allen

    2007-12-04

    A modular, low weight impedance dropping power supply with battery backup is disclosed that can be connected to a high voltage AC source and provide electrical power at a lower voltage. The design can be scaled over a wide range of input voltages and over a wide range of output voltages and delivered power.

  17. Strategic Supply

    DTIC Science & Technology

    2006-01-01

    leaders as Sears, Limited Brands, DHL, Circuit City, Cingular, Nestle and IKEA (Manugistics, 2006). The Strategic Supply Chain Industry Study Group...inventory turns have increased. Other global customers have also reaped the benefits of the Manugistics software. IKEA , Sweden’s retail icon...turned to Manugistics after a mid-1990s ERP implementation failed to fix their forecasting problems, which gave way to fluctuating inventory levels. IKEA

  18. Strategic Supply

    DTIC Science & Technology

    2005-01-01

    turn helped fuel its highly efficient and effective distribution network. Wal-Mart has characteristically been at the forefront 2 of IT advances...identification technologies that is wireless and applied to tags and labels that capture a host of characteristics of objects. Within the supply chain...behavior, leading to faster processing and improved productivity. RFID technology can authenticate objects and monitor environmental characteristics

  19. Comparative assessment of 5' A/T-rich overhang sequences with optimal and sub-optimal primers to increase PCR yields and sensitivity.

    PubMed

    Arif, M; Ochoa-Corona, F M

    2013-09-01

    Efficient PCR amplifications require precisely designed and optimized oligonucleotide primers, components, and cycling conditions. Despite recent software development and reaction improvement, primer design can still be enhanced. The aims of this research are to understand (1) the effect on PCR efficiency and DNA yields of primer thermodynamics parameters, and (2) the incorporation of 5' A/T-rich overhanging sequences (flaps) during primer design. Two primer sets, one optimal (ΔG = 0) and one sub-optimal (ΔG = 0.9), were designed using web interface software Primer3, BLASTn, and mFold to target a movement protein gene of Tobacco mosaic virus. The optimal primer set amplifies a product of 195 bp and supports higher PCR sensitivity and yields compared to the sub-optimal primer set, which amplifies a product of 192 bp. Greater fluorescence was obtained using optimal primers compared to that with sub-optimal primers. Primers designed with sub-optimal thermodynamics can be substantially improved by adding 5' flaps. Results indicate that even if the performance of some primers can be improved substantially by 5' flap addition, not all primers will be similarly improved. Optimal 5' flap sequences are dependent on the primer sequences, and alter the primer's T m value. The manipulation of this feature may enhance primer's efficiency to increase the PCR sensitivity and DNA yield.

  20. Phe 771 of Escherichia coli DNA polymerase I (Klenow fragment) is the major site for the interaction with the template overhang and the stabilization of the pre-polymerase ternary complex.

    PubMed

    Srivastava, Aashish; Singh, Kamalendra; Modak, Mukund J

    2003-04-08

    To identify the sites in the Klenow fragment of Escherichia coli DNA polymerase I that interact with the ssDNA overhang of the template strand in the pre-polymerase ternary complex, we carried out UV-mediated photo-cross-linking of the enzyme-DNA-dNTP ternary complex. The template strand contained a nine-nucleotide overhang and was radiolabeled at the 5'-end. Since the enzyme-TP-dNTP ternary complex but not the E-TP binary complex is stable at high ionic strengths, the cross-linking was carried out in the presence of 0.5 M NaCl. The cross-linked E-TP-dNTP complex was purified and subjected to trypsin digestion. The radiolabeled TP cross-linked peptide was further purified by DEAE-Sepharose and C18 column chromatography and subjected to amino acid sequencing. The release of radiolabeled DNA during each sequencing cycle was also monitored. The sequencing results as well as the radioactivity release pattern show that F771, contained in a peptide spanning amino acids 759-775 of pol I, is the unequivocal site of the template cross-linking. A qualitative assessment of the cross-linking efficiency of the template overhang containing a TT sequence at different positions in the ternary complex further suggests that the major cross-linking site within the template overhang is at the second and/or third nucleotide. An examination of the F771A mutant enzyme showed that it was able to form the E-TP binary as well as E-TP-dNTP ternary complex; however, it could not cross-link to the template-primer in the ternary complex. Furthermore, the ternary complex with F771A was qualitatively defective and exhibited some salt sensitivity. These results suggest that F771 participates in the stabilization of the pre-polymerase ternary complex.

  1. Highly sensitive detection of cancer-related genes based on complete fluorescence restoration of a molecular beacon with a functional overhang.

    PubMed

    Li, Feng; Zhou, Ying-Ying; Peng, Ting; Xu, Huo; Zhang, Rong-Bo; Zhao, Hui; Wang, Zheng-Yong; Lv, Jian-Xin; Wu, Zai-Sheng; Shen, Zhi-Fa

    2016-07-21

    The accurate detection of cancer-related genes is of great significance for early diagnosis and targeted therapy of cancer. In this contribution, an automatically cycling operation of a functional overhang-containing molecular beacon (OMB)-based sensing system was proposed to perform amplification detection of the p53 gene. Contrary to the common molecular beacon (MB), a target DNA is designated to hybridize with a label-free recognition probe (RP) with a hairpin structure rather than OMB. In the presence of a target DNA of interest, the locked primer in RP opens and triggers the subsequent amplification procedures. The newly-developed OMB is not only capable of accomplishing cyclical nucleic acid strand-displacement polymerization (CNDP) with the help of polymerase and nicking endonuclease, but is also cleaved by restriction endonucleases, removing the quencher away from the fluorophore. Thus, the target DNA at an extremely low concentration is expected to generate a considerable amount of double-stranded and cleaved OMBs, and the quenched fluorescence is completely restored, leading to a dramatic increase in fluorescence intensity. Utilizing this sensing platform, the target gene can be detected down to 8.2 pM in a homogeneous way, and a linear response range of 0.01 to 150 nM could be obtained. More strikingly, the mutant genes can be easily distinguished from the wild-type ones. The proof-of-concept demonstrations reported herein are expected to promote the development of DNA biosensing systems, showing great potential in basic research and clinical diagnosis.

  2. Information flow in the pharmaceutical supply chain

    PubMed Central

    Yousefi, Nazila; Alibabaei, Ahmad

    2015-01-01

    Managing the supply chain plays an important role in creating competitive advantages for companies. Adequate information flow in supply chain is one of the most important issues in SCM. Therefore, using certain Information Systems can have a significant role in managing and integrating data and information within the supply chain. Pharmaceutical supply chain is more complex than many other supply chains, in the sense that it can affect social and political perspectives. On the other hand, managing the pharmaceutical supply chain is difficult because of its complexity and also government regulations in this field. Although, Iran has progressed a lot in pharmaceutical manufacturing, still there are many unsolved issues in managing the information flow in the pharmaceutical supply chain. In this study, we reviewed the benefits of using different levels of an integrated information system in the supply chain and the possible challenges ahead. PMID:26664401

  3. Information flow in the pharmaceutical supply chain.

    PubMed

    Yousefi, Nazila; Alibabaei, Ahmad

    2015-01-01

    Managing the supply chain plays an important role in creating competitive advantages for companies. Adequate information flow in supply chain is one of the most important issues in SCM. Therefore, using certain Information Systems can have a significant role in managing and integrating data and information within the supply chain. Pharmaceutical supply chain is more complex than many other supply chains, in the sense that it can affect social and political perspectives. On the other hand, managing the pharmaceutical supply chain is difficult because of its complexity and also government regulations in this field. Although, Iran has progressed a lot in pharmaceutical manufacturing, still there are many unsolved issues in managing the information flow in the pharmaceutical supply chain. In this study, we reviewed the benefits of using different levels of an integrated information system in the supply chain and the possible challenges ahead.

  4. Creating "SMART" Supply Chain Scenarios Using SAP R/3

    ERIC Educational Resources Information Center

    Ragan, Joseph M.; McGettigan, Patrick J.; Storms, Michael R.; Rizman, Brian

    2004-01-01

    Pedagogical revisions to the undergraduate Haub School of Business curriculum at Saint Joseph's University employing the SAP R/3 system encompass the core accounting courses traversing the sophomore and junior years. The entire accounting curriculum was overhauled in order to integrate SAP R/3. Each course progressively builds upon and expands the…

  5. The triple-A supply chain.

    PubMed

    Lee, Hau L

    2004-10-01

    Building a strong supply chain is essential for business success. But when it comes to improving their supply chains, few companies take the right approach. Many businesses work to make their chains faster or more cost-effective, assuming that those steps are the keys to competitive advantage. To the contrary: Supply chains that focus on speed and costs tend to deteriorate over time. The author has spent 15 years studying more than 60 companies to gain insight into this and other supply chain dilemmas. His conclusion: Only companies that build supply chains that are agile, adaptable, and aligned get ahead of their rivals. All three components are essential; without any one of them, supply chains break down. Great companies create supply chains that respond to abrupt changes in markets. Agility is critical because in most industries, both demand and supply fluctuate rapidly and widely. Supply chains typically cope by playing speed against costs, but agile ones respond both quickly and cost-efficiently. Great companies also adapt their supply networks when markets or strategies change. The best supply chains allow managers to identify structural shifts early by recording the latest data, filtering out noise, and tracking key patterns. Finally, great companies align the interests of the partners in their supply chains with their own. That's important because every firm is concerned solely with its own interests. If its goals are out of alignment with those of other partners in the supply chain, performance will suffer. When companies hear about the triple-A supply chain, they assume that building one will require increased technology and investment. But most firms already have the infrastructure in place to create one. A fresh attitude alone can go a long way toward making it happen.

  6. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    SciTech Connect

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  7. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  8. Reinforcement learning in supply chains.

    PubMed

    Valluri, Annapurna; North, Michael J; Macal, Charles M

    2009-10-01

    Effective management of supply chains creates value and can strategically position companies. In practice, human beings have been found to be both surprisingly successful and disappointingly inept at managing supply chains. The related fields of cognitive psychology and artificial intelligence have postulated a variety of potential mechanisms to explain this behavior. One of the leading candidates is reinforcement learning. This paper applies agent-based modeling to investigate the comparative behavioral consequences of three simple reinforcement learning algorithms in a multi-stage supply chain. For the first time, our findings show that the specific algorithm that is employed can have dramatic effects on the results obtained. Reinforcement learning is found to be valuable in multi-stage supply chains with several learning agents, as independent agents can learn to coordinate their behavior. However, learning in multi-stage supply chains using these postulated approaches from cognitive psychology and artificial intelligence take extremely long time periods to achieve stability which raises questions about their ability to explain behavior in real supply chains. The fact that it takes thousands of periods for agents to learn in this simple multi-agent setting provides new evidence that real world decision makers are unlikely to be using strict reinforcement learning in practice.

  9. Creating a National Skills Corporation. Policy Report.

    ERIC Educational Resources Information Center

    Atkinson, Rob

    To address the skills shortages stemming from the transition to a more technological and skills-intensive economy, Congress established a program whereby funds from H-1B visa fees would provide seed funds for private companies, labor, and government to join together in creating training alliances focused on skills in short supply. Unfortunately,…

  10. Health supply chain management.

    PubMed

    Zimmerman, Rolf; Gallagher, Pat

    2010-01-01

    This chapter gives an educational overview of: * The actual application of supply chain practice and disciplines required for service delivery improvement within the current health environment. * A rationale for the application of Supply Chain Management (SCM) approaches to the Health sector. * The tools and methods available for supply chain analysis and benchmarking. * Key supply chain success factors.

  11. Economic drivers of mineral supply

    USGS Publications Warehouse

    Wagner, Lorie A.; Sullivan, Daniel E.; Sznopek, John L.

    2003-01-01

    The debate over the adequacy of future supplies of mineral resources continues in light of the growing use of mineral-based materials in the United States. According to the U.S. Geological Survey, the quantity of new materials utilized each year has dramatically increased from 161 million tons2 in 1900 to 3.2 billion tons in 2000. Of all the materials used during the 20th century in the United States, more than half were used in the last 25 years. With the Earth?s endowment of natural resources remaining constant, and increased demand for resources, economic theory states that as depletion approaches, prices rise. This study shows that many economic drivers (conditions that create an economic incentive for producers to act in a particular way) such as the impact of globalization, technological improvements, productivity increases, and efficient materials usage are at work simultaneously to impact minerals markets and supply. As a result of these economic drivers, the historical price trend of mineral prices3 in constant dollars has declined as demand has risen. When price is measured by the cost in human effort, the price trend also has been almost steadily downward. Although the United States economy continues its increasing mineral consumption trend, the supply of minerals has been able to keep pace. This study shows that in general supply has grown faster than demand, causing a declining trend in mineral prices.

  12. Bioindustry Creates Green Jobs

    SciTech Connect

    2013-07-01

    The U.S. bioindustry is expanding rapidly in response to the need for a near-term alternative to liquid petroleum fuels. The Energy Independence and Security Act of 2007 (EISA) requires that renewable fuels collectively supply at least 36 billion gallons of U.S. motor fuels by 2022.

  13. Feedstock Supply System Logistics

    SciTech Connect

    2006-06-01

    Feedstock supply is a significant cost component in the production of biobased fuels, products, and power. The uncertainty of the biomass feedstock supply chain and associated risks are major barriers to procuring capital funding for start-up biorefineries.

  14. Pursuing supply chain gains.

    PubMed

    Long, Gene

    2005-09-01

    Five hallmarks of an effective supply chain are: A strong relationship is developed with a single GPO. Physicians are involved in supply standardization. Supply contracts are routinely reviewed at time of renewal. Freight costs are understood and negotiated effectively. Products are distributed through an in-house distribution center.

  15. Creating physics stars

    NASA Astrophysics Data System (ADS)

    Banks, Michael

    2013-07-01

    Korea has begun an ambitious 5bn plan to create 50 new institutes dedicated to fundamental research. Michael Banks meets physicist Se-Jung Oh, president of the Institute for Basic Science, to find out more.

  16. Create a Logo.

    ERIC Educational Resources Information Center

    Duchen, Gail

    2002-01-01

    Presents an art lesson that introduced students to graphic art as a career path. Explains that the students met a graphic artist and created a logo for a pretend client. Explains that the students researched logos. (CMK)

  17. Controlling supply expenses through capitated supply contracting.

    PubMed

    Kowalski, J C

    1997-07-01

    Some providers dealing with the financial challenges of managed care are attempting to control supply expenses through capitated supply contracting and similar risk/reward sharing arrangements. Under such arrangements, a supplier sells products and services to a provider for a fixed, prospective price in exchange for the provider's exclusive business. If expenses exceed the prospectively established amount, the supplier and provider share the loss. Conversely, if expenses are less than the fixed amount, they share the savings. For a capitated supply arrangement to be successful, providers must be able to identify and track supply expense drivers, such as clinical pathways, technology utilization, and product selection and utilization. Sophisticated information systems are needed to capture data, such as total and per-transaction product usage/volume; unit price per item; average and cost per item; average and total cost per transaction; and total cost per outcome. Providers also will need to establish mutually cooperative relationships with the suppliers with whom they contract.

  18. Supply chain challenges. building relationships.

    PubMed

    Beth, Scott; Burt, David N; Copacino, William; Gopal, Chris; Lee, Hau L; Lynch, Robert Porter; Morris, Sandra

    2003-07-01

    Supply chain management is all about software and systems, right? Put in the best technology, sit back, and watch as your processes run smoothly and the savings roll in? Apparently not. When HBR convened a panel of leading thinkers in the field of supply chain management, technology was not top of mind. People and relationships were the dominant issues of the day. The opportunities and problems created by globalization, for example, are requiring companies to establish relationships with new types of suppliers. The ever-present pressure for speed and cost containment is making it even more important to break down stubbornly high internal barriers and establish more effective cross-functional relationships. The costs of failure have never been higher. The leading supply chain performers are applying new technology, new innovations, and process thinking to far greater advantage than the laggards, reaping tremendous gains in all the variables that affect shareholder value: cost, customer service, asset productivity, and revenue generation. And the gap between the leaders and the losers is growing in almost every industry. This roundtable gathered many of the leading thinkers and doers in the field of supply chain management, including practitioners Scott Beth of Intuit, Sandra Morris of Intel, and Chris Gopal of Unisys. David Burt of the University of San Diego and Stanford's Hau Lee bring the latest research from academia. Accenture's William Copacino and the Warren Company's Robert Porter Lynch offer the consultant's perspectives. Together, they take a wide-ranging view of such topics as developing talent, the role of the chief executive, and the latest technologies, exploring both the tactical and the strategic in the current state of supply chain management.

  19. E-commerce for healthcare supply procurement.

    PubMed

    Arbietman, D; Lirov, E; Lirov, R; Lirov, Y

    2001-01-01

    The total investment of the more than fifty e-commerce startups that entered healthcare supply chain management in the past three years has surpassed $500 million. However, none of these early entrants has delivered on the initial promise of restructuring the entire supply chain, replacing the traditional intermediaries, or at least achieving substantial revenue. This article offers a new business-to-business (B2B) e-commerce solution classification paradigm and uses it to analyze the functional requirements for an effective and, efficient healthcare supply chain marketplace. The analysis exposes several fundamental B2B market complexities that prevent the early entrants from creating a solid customer base and reaching desired liquidity goals. It also identifies several technological solutions to the problems mentioned. These new technologies create a comprehensive and symmetric order-matching engine that is capable of aggregating buy orders, requesting quotes from multiple vendors simultaneously, and negotiating along multiple criteria.

  20. Creating Special Events

    ERIC Educational Resources Information Center

    deLisle, Lee

    2009-01-01

    "Creating Special Events" is organized as a systematic approach to festivals and events for students who seek a career in event management. This book looks at the evolution and history of festivals and events and proceeds to the nuts and bolts of event management. The book presents event management as the means of planning, organizing, directing,…

  1. Creating dedicated bioenergy crops

    USDA-ARS?s Scientific Manuscript database

    Bioenergy is one of the current mechanisms of producing renewable energy to reduce our use of nonrenewable fossil fuels and to reduce carbon emissions into the atmosphere. Humans have been using bioenergy since we first learned to create and control fire - burning manure, peat, and wood to cook food...

  2. Creating a Classroom Newspaper.

    ERIC Educational Resources Information Center

    Buss, Kathleen, Ed.; McClain-Ruelle, Leslie, Ed.

    Based on the premise that students can learn a great deal by reading and writing a newspaper, this book was created by preservice instructors to teach upper elementary students (grades 3-5) newspaper concepts, journalism, and how to write newspaper articles. It shows how to use newspaper concepts to help students integrate knowledge from multiple…

  3. Creating a Virtual Gymnasium

    ERIC Educational Resources Information Center

    Fiorentino, Leah H.; Castelli, Darla

    2005-01-01

    Physical educators struggle with the challenges of assessing student performance, providing feedback about motor skills, and creating opportunities for all students to engage in game-play on a daily basis. The integration of technology in the gymnasium can address some of these challenges by improving teacher efficiency and increasing student…

  4. Creating an Interactive PDF

    ERIC Educational Resources Information Center

    Branzburg, Jeffrey

    2008-01-01

    There are many ways to begin a PDF document using Adobe Acrobat. The easiest and most popular way is to create the document in another application (such as Microsoft Word) and then use the Adobe Acrobat software to convert it to a PDF. In this article, the author describes how he used Acrobat's many tools in his project--an interactive…

  5. Creating a Classroom Makerspace

    ERIC Educational Resources Information Center

    Rivas, Luz

    2014-01-01

    What is a makerspace? Makerspaces are community-operated physical spaces where people (makers) create do-it-yourself projects together. These membership spaces serve as community labs where people learn together and collaborate on projects. Makerspaces often have tools and equipment like 3-D printers, laser cutters, and soldering irons.…

  6. Creating Motivating Job Aids.

    ERIC Educational Resources Information Center

    Tilaro, Angie; Rossett, Allison

    1993-01-01

    Explains how to create job aids that employees will be motivated to use, based on a review of pertinent literature and interviews with professionals. Topics addressed include linking motivation with job aids; Keller's ARCS (Attention, Relevance, Confidence, Satisfaction) model of motivation; and design strategies for job aids based on Keller's…

  7. Creating Dialogue by Storytelling

    ERIC Educational Resources Information Center

    Passila, Anne; Oikarinen, Tuija; Kallio, Anne

    2013-01-01

    Purpose: The objective of this paper is to develop practice and theory from Augusto Boal's dialogue technique (Image Theatre) for organisational use. The paper aims to examine how the members in an organisation create dialogue together by using a dramaturgical storytelling framework where the dialogue emerges from storytelling facilitated by…

  8. Light-created chemiluminescence

    NASA Astrophysics Data System (ADS)

    Vasil'ev, Rostislav F.; Tsaplev, Yuri B.

    2006-11-01

    The results of studies of light-created chemiluminescence are described systematically. Conditions for the transformation of a dark chemical reaction into a chemiluminescence reaction are considered. Examples of photosensitised and photoinduced processes as well as of analytical applications are given.

  9. Creating Quality Schools.

    ERIC Educational Resources Information Center

    American Association of School Administrators, Arlington, VA.

    This booklet presents information on how total quality management can be applied to school systems to create educational improvement. Total quality management offers education a systemic approach and a new set of assessment tools. Chapter 1 provides a definition and historical overview of total quality management. Chapter 2 views the school…

  10. Creating snags with explosives.

    Treesearch

    Evelyn L. Bull; Arthur D. Partridge; Wayne G. Williams

    1981-01-01

    The tops of ponderosa pine (Pinus ponderosa) trees were blown off with dynamite to create nest sites for cavity-nesting wildlife. The procedure included drilling a hole almost through the trunk, inserting the dynamite, and setting the charge with primacord and fuse. Trees were simultaneously innoculated with a decay organism. The average cost was $...

  11. Creating a Virtual Gymnasium

    ERIC Educational Resources Information Center

    Fiorentino, Leah H.; Castelli, Darla

    2005-01-01

    Physical educators struggle with the challenges of assessing student performance, providing feedback about motor skills, and creating opportunities for all students to engage in game-play on a daily basis. The integration of technology in the gymnasium can address some of these challenges by improving teacher efficiency and increasing student…

  12. Creating Dialogue by Storytelling

    ERIC Educational Resources Information Center

    Passila, Anne; Oikarinen, Tuija; Kallio, Anne

    2013-01-01

    Purpose: The objective of this paper is to develop practice and theory from Augusto Boal's dialogue technique (Image Theatre) for organisational use. The paper aims to examine how the members in an organisation create dialogue together by using a dramaturgical storytelling framework where the dialogue emerges from storytelling facilitated by…

  13. Looking, Writing, Creating.

    ERIC Educational Resources Information Center

    Katzive, Bonnie

    1997-01-01

    Describes how a middle school language arts teacher makes analyzing and creating visual art a partner to reading and writing in her classroom. Describes a project on art and Vietnam which shows how background information can add to and influence interpretation. Describes a unit on Greek mythology and Greek vases which leads to a related visual…

  14. Create Your State

    ERIC Educational Resources Information Center

    Dunham, Kris; Melvin, Samantha

    2011-01-01

    Students are often encouraged to work together with their classmates, sometimes with other classes, occasionally with kids at other schools, but rarely with kids across the country. In this article the authors describe the Create Your State project, a collaborative nationwide project inspired by the Texas Chair Project wherein the artist, Damien…

  15. Creating a Third Culture

    ERIC Educational Resources Information Center

    Weisbuch, Robert A.

    2008-01-01

    In this article, the author laments higher education's lack of concern towards the development of teaching in the public schools over the last half of the 20th century. Most of academe's work on the topic of teacher training has been done at the branches of state universities that needed to make money and create a niche. The author observes that…

  16. Creating a Market.

    ERIC Educational Resources Information Center

    Kazimirski, J.; And Others

    The second in a series of programmed books, "Creating a Market" is published by the International Labour Office as a manual for persons studying marketing. This manual was designed to meet the needs of the labor organization's technical cooperation programs and is primarily concerned with consumer goods industries. Using a fill-in-the-blanks and…

  17. Creating a Classroom Makerspace

    ERIC Educational Resources Information Center

    Rivas, Luz

    2014-01-01

    What is a makerspace? Makerspaces are community-operated physical spaces where people (makers) create do-it-yourself projects together. These membership spaces serve as community labs where people learn together and collaborate on projects. Makerspaces often have tools and equipment like 3-D printers, laser cutters, and soldering irons.…

  18. Creating an Assessments Library

    ERIC Educational Resources Information Center

    Duncan, Greg; Gilbert, Jacqueline; Mackenzie, Mary; Meulener, Carol; Smith, Martin; Yetman, Beatrice; Zeppieri, Rosanne

    2006-01-01

    This article presents the steps taken over three years (2003-2006) by the Consortium for Assessing Performance Standards, a New Jersey Grant Project to create a database of thematically organized, integrated performance assessment tasks at the benchmark levels of proficiency, novice-mid, intermediate-low and pre-advanced as defined by the ACTFL…

  19. Creating Historical Drama.

    ERIC Educational Resources Information Center

    Cassler, Robert

    1990-01-01

    Describes creating for the National Archives Public Education Department a historical drama, "Second in the Realm," based on the story of the Magna Carta. Demonstrates the effectiveness of historical drama as a teaching tool. Explains the difficulties of writing such dramas and provides guidelines for overcoming these problems. (NL)

  20. [Teenagers creating art].

    PubMed

    Ahovi, Jonathan; Viverge, Agathe

    Teenagers need to interpret the world around them, sometimes in a completely different way to that in which, as children, they represented external reality. Some like drawing. They can use it to express their thoughts on death, sexuality or freedom. Their creative capacities are immense: they are creating art.

  1. Creating Special Events

    ERIC Educational Resources Information Center

    deLisle, Lee

    2009-01-01

    "Creating Special Events" is organized as a systematic approach to festivals and events for students who seek a career in event management. This book looks at the evolution and history of festivals and events and proceeds to the nuts and bolts of event management. The book presents event management as the means of planning, organizing, directing,…

  2. Creating Motivating Job Aids.

    ERIC Educational Resources Information Center

    Tilaro, Angie; Rossett, Allison

    1993-01-01

    Explains how to create job aids that employees will be motivated to use, based on a review of pertinent literature and interviews with professionals. Topics addressed include linking motivation with job aids; Keller's ARCS (Attention, Relevance, Confidence, Satisfaction) model of motivation; and design strategies for job aids based on Keller's…

  3. Creating Photo Illustrations.

    ERIC Educational Resources Information Center

    Wilson, Bradley

    2003-01-01

    Explains the uses of photo illustrations. Notes that the key to developing a successful photo illustration is collaborative planning. Outlines the following guidelines for photo illustrations: never set up a photograph to mimic reality; create only abstractions with photo illustrations; clearly label photo illustrations; and never play photo…

  4. Creating Customer Delight.

    ERIC Educational Resources Information Center

    Black, Jim

    1995-01-01

    This article proposes that college admissions officers interested in improving service should focus on creating customer delight rather than simply satisfaction, studying the system when things go wrong rather than placing blame, establishing employee well-being as the highest priority of the organization, providing necessary tools and training…

  5. Creating a Reference Toolbox.

    ERIC Educational Resources Information Center

    Scott, Jane

    1997-01-01

    To help students understand that references are tools used to locate specific information, one librarian has her third-grade students create their own reference toolboxes as she introduces dictionaries, atlases, encyclopedias, and thesauri. Presents a lesson plan to introduce print and nonprint thesauri to third and fourth graders and includes a…

  6. Creating a Study Guide.

    ERIC Educational Resources Information Center

    Kelley, Laura C.

    2001-01-01

    Argues that making a theater study guide is an excellent in-class project, encouraging research, analysis, writing, and creative thinking. Offers a framework for creating one as a classroom project using John Steinbeck's "Of Mice and Men" as an example. Lists further resources. (SR)

  7. Creating an Effective Newsletter

    ERIC Educational Resources Information Center

    Shackelford, Ray; Griffis, Kurt

    2006-01-01

    Newsletters are an important resource or form of media. They offer a cost-effective way to keep people informed, as well as to promote events and programs. Production of a newsletter makes an excellent project, relevant to real-world communication, for technology students. This article presents an activity on how to create a short newsletter. The…

  8. How Banks Create Money.

    ERIC Educational Resources Information Center

    Beale, Lyndi

    This teaching module explains how the U.S. banking system uses excess reserves to create money in the form of new deposits for borrowers. The module is part of a computer-animated series of four-to-five-minute modules illustrating standard concepts in high school economics. Although the module is designed to accompany the video program, it may be…

  9. Creating Pupils' Internet Magazine

    ERIC Educational Resources Information Center

    Bognar, Branko; Šimic, Vesna

    2014-01-01

    This article presents an action research, which aimed to improve pupils' literary creativity and enable them to use computers connected to the internet. The study was conducted in a small district village school in Croatia. Creating a pupils' internet magazine appeared to be an excellent way for achieving the educational aims of almost all…

  10. Creating Collaborative Advantage.

    ERIC Educational Resources Information Center

    Huxham, Chris, Ed.

    Although interorganizational collaboration is becoming increasingly significant as a means of achieving organizational objectives, it is not an easy process to implement. Drawing on the work of authors with extensive experience, an accessible introduction to the theory and practice of creating collaborative advantage is presented in this volume.…

  11. Supply chain optimization for pediatric perioperative departments.

    PubMed

    Davis, Janice L; Doyle, Robert

    2011-09-01

    Economic challenges compel pediatric perioperative departments to reduce nonlabor supply costs while maintaining the quality of patient care. Optimization of the supply chain introduces a framework for decision making that drives fiscally responsible decisions. The cost-effective supply chain is driven by implementing a value analysis process for product selection, being mindful of product sourcing decisions to reduce supply expense, creating logistical efficiency that will eliminate redundant processes, and managing inventory to ensure product availability. The value analysis approach is an analytical methodology for product selection that involves product evaluation and recommendation based on consideration of clinical benefit, overall financial impact, and revenue implications. Copyright © 2011 AORN, Inc. Published by Elsevier Inc. All rights reserved.

  12. Creating bulk nanocrystalline metal.

    SciTech Connect

    Fredenburg, D. Anthony; Saldana, Christopher J.; Gill, David D.; Hall, Aaron Christopher; Roemer, Timothy John; Vogler, Tracy John; Yang, Pin

    2008-10-01

    Nanocrystalline and nanostructured materials offer unique microstructure-dependent properties that are superior to coarse-grained materials. These materials have been shown to have very high hardness, strength, and wear resistance. However, most current methods of producing nanostructured materials in weapons-relevant materials create powdered metal that must be consolidated into bulk form to be useful. Conventional consolidation methods are not appropriate due to the need to maintain the nanocrystalline structure. This research investigated new ways of creating nanocrystalline material, new methods of consolidating nanocrystalline material, and an analysis of these different methods of creation and consolidation to evaluate their applicability to mesoscale weapons applications where part features are often under 100 {micro}m wide and the material's microstructure must be very small to give homogeneous properties across the feature.

  13. Sustainable Supply Chain Management Programs in the 21st Century

    ERIC Educational Resources Information Center

    Neureuther, Brian D.; O'Neill, Kevin

    2011-01-01

    One of the most difficult challenges for an undergraduate supply chain management program at smaller universities is to create an environment of sustainability. Supply chain management is not at the tip of tongue for many graduating high school students and few undergraduate curriculums require a course in the content area. This research addresses…

  14. Creating Geoscience Leaders

    NASA Astrophysics Data System (ADS)

    Buskop, J.; Buskop, W.

    2013-12-01

    The United Nations Educational, Scientific, and Cultural Organization recognizes 21 World Heritage in the United States, ten of which have astounding geological features: Wrangell St. Elias National Park, Olympic National Park, Mesa Verde National Park, Chaco Canyon, Glacier National Park, Carlsbad National Park, Mammoth Cave, Great Smokey Mountains National Park, Hawaii Volcanoes National Park, and Everglades National Park. Created by a student frustrated with fellow students addicted to smart phones with an extreme lack of interest in the geosciences, one student visited each World Heritage site in the United States and created one e-book chapter per park. Each chapter was created with original photographs, and a geological discovery hunt to encourage teen involvement in preserving remarkable geological sites. Each chapter describes at least one way young adults can get involved with the geosciences, such a cave geology, glaciology, hydrology, and volcanology. The e-book describes one park per chapter, each chapter providing a geological discovery hunt, information on how to get involved with conservation of the parks, geological maps of the parks, parallels between archaeological and geological sites, and how to talk to a ranger. The young author is approaching UNESCO to publish the work as a free e-book to encourage involvement in UNESCO sites and to prove that the geosciences are fun.

  15. Competing for supply.

    PubMed

    Stolle, B

    2001-02-01

    The Internet was supposed to make it possible for anybody anywhere to get anything anytime. Instead, it's magnified suppliers' miscalculations into global shortages. But if the Net caused these supply chain woes, it's also the solution, says the CEO of a supply-chain software manufacturer.

  16. Wood supply and demand

    Treesearch

    Peter J. Ince; David B. McKeever

    2011-01-01

    At times in history, there have been concerns that demand for wood (timber) would be greater than the ability to supply it, but that concern has recently dissipated. The wood supply and demand situation has changed because of market transitions, economic downturns, and continued forest growth. This article provides a concise overview of this change as it relates to the...

  17. Power supply conditioning circuit

    NASA Technical Reports Server (NTRS)

    Primas, L. E.; Loveland, R.

    1987-01-01

    A power supply conditioning circuit that can reduce Periodic and Random Deviations (PARD) on the output voltages of dc power supplies to -150 dBV from dc to several KHz with no measurable periodic deviations is described. The PARD for a typical commercial low noise power supply is -74 dBV for frequencies above 20 Hz and is often much worse at frequencies below 20 Hz. The power supply conditioning circuit described here relies on the large differences in the dynamic impedances of a constant current diode and a zener diode to establish a dc voltage with low PARD. Power supplies with low PARD are especially important in circuitry involving ultrastable frequencies for the Deep Space Network.

  18. Spatial Data Supply Chains

    NASA Astrophysics Data System (ADS)

    Varadharajulu, P.; Azeem Saqiq, M.; Yu, F.; McMeekin, D. A.; West, G.; Arnold, L.; Moncrieff, S.

    2015-06-01

    This paper describes current research into the supply of spatial data to the end user in as close to real time as possible via the World Wide Web. The Spatial Data Infrastructure paradigm has been discussed since the early 1990s. The concept has evolved significantly since then but has almost always examined data from the perspective of the supplier. It has been a supplier driven focus rather than a user driven focus. The current research being conducted is making a paradigm shift and looking at the supply of spatial data as a supply chain, similar to a manufacturing supply chain in which users play a significant part. A comprehensive consultation process took place within Australia and New Zealand incorporating a large number of stakeholders. Three research projects that have arisen from this consultation process are examining Spatial Data Supply Chains within Australia and New Zealand and are discussed within this paper.

  19. Hospitals leave national GPOs to create their own competitive contracts.

    PubMed

    1999-10-01

    Hospitals cut better medical/surgical supply deals in smaller, innovative group purchasing networks. Meridian Health System in New Jersey posted an annual $1.5 million savings by renegotiating about a dozen of its supply contracts over the past year. By ditching memberships with the big GPOs and creating its own group purchasing cooperative, administrators there are cutting competitive deals. Find out how they're doing it.

  20. Creating new growth platforms.

    PubMed

    Laurie, Donald L; Doz, Yves L; Sheer, Claude P

    2006-05-01

    Sooner or later, most companies can't attain the growth rates expected by their boards and CEOs and demanded by investors. To some extent, such businesses are victims of their own successes. Many were able to sustain high growth rates for a long time because they were in high-growth industries. But once those industries slowed down, the businesses could no longer deliver the performance that investors had come to take for granted. Often, companies have resorted to acquisition, though this strategy has a discouraging track record. Over time, 65% of acquisitions destroy more value than they create. So where does real growth come from? For the past 12 years, the authors have been researching and advising companies on this issue. With the support of researchers at Harvard Business School and Insead, they instituted a project titled "The CEO Agenda and Growth". They identified and approached 24 companies that had achieved significant organic growth and interviewed their CEOs, chief strategists, heads of R&D, CFOs, and top-line managers. They asked, "Where does your growth come from?" and found a consistent pattern in the answers. All the businesses grew by creating new growth platforms (NGPs) on which they could build families of products and services and extend their capabilities into multiple new domains. Identifying NGP opportunities calls for executives to challenge conventional wisdom. In all the companies studied, top management believed that NGP innovation differed significantly from traditional product or service innovation. They had independent, senior-level units with a standing responsibility to create NGPs, and their CEOs spent as much as 50% of their time working with these units. The payoff has been spectacular and lasting. For example, from 1985 to 2004, the medical devices company Medtronic grew revenues at 18% per year, earnings at 20%, and market capitalization at 30%.

  1. Creating a practice website.

    PubMed

    Downes, P K

    2007-05-26

    A website is a window to the outside world. For a dental practice, it may be the first point of contact for a prospective new patient and will therefore provide them with their 'first impression'; this may be days or weeks before actually visiting the practice. This section considers the different ways of creating a dental practice website and lists some of the main dental website design companies. It also describes what factors make a successful website and offers advice on how to ensure that it complies with current regulations and recommendations.

  2. Creating healthy camp experiences.

    PubMed

    Walton, Edward A; Tothy, Alison S

    2011-04-01

    The American Academy of Pediatrics has created recommendations for health appraisal and preparation of young people before participation in day or resident camps and to guide health and safety practices for children at camp. These recommendations are intended for parents, primary health care providers, and camp administration and health center staff. Although camps have diverse environments, there are general guidelines that apply to all situations and specific recommendations that are appropriate under special conditions. This policy statement has been reviewed and is supported by the American Camp Association.

  3. Automating power supply checkout

    SciTech Connect

    Laster, J.; Bruno, D.; D'Ottavio, T.; Drozd, J.; Marr, G.; Mi, C.

    2011-03-28

    Power Supply checkout is a necessary, pre-beam, time-critical function. At odds are the desire to decrease the amount of time to perform the checkout while at the same time maximizing the number and types of checks that can be performed and analyzing the results quickly (in case any problems exist that must be addressed). Controls and Power Supply Group personnel have worked together to develop tools to accomplish these goals. Power Supply checkouts are now accomplished in a time-frame of hours rather than days, reducing the number of person-hours needed to accomplish the checkout and making the system available more quickly for beam development. The goal of the Collider-Accelerator Department (CAD) at Brookhaven National Laboratory is to provide experimenters with collisions of heavy-ions and polarized protons. The Relativistic Heavy-Ion Collider (RHIC) magnets are controlled by 100's of varying types of power supplies. There is a concentrated effort to perform routine maintenance on the supplies during shutdown periods. There is an effort at RHIC to streamline the time needed for system checkout in order to quickly arrive at a period of beam operations for RHIC. This time-critical period is when the checkout of the power supplies is performed as the RHIC ring becomes cold and the supplies are connected to their physical magnets. The checkout process is used to identify problems in voltage and current regulation by examining data signals related to each for problems in settling and regulation (ripple).

  4. Hydrogen supply system

    SciTech Connect

    Teitel, R.J.

    1981-11-24

    A system for supplying hydrogen to an apparatus which utilizes hydrogen contains a metal hydride hydrogen supply component and a microcavity hydrogen storage hydrogen supply component which in tandem supply hydrogen for the apparatus. The metal hydride hydrogen supply component includes a first storage tank filled with a composition which is capable of forming a metal hydride of such a nature that the hydride will release hydrogen when heated but will absorb hydrogen when cooled. This first storage tank is equipped with a heat exchanger for both adding heat to and extracting heat from the composition to regulate the absorption/deabsorption of hydrogen from the composition. The microcavity hydrogen storage hydrogen supply component includes a second tank containing the microcavity hydrogen supply. The microcavity hydrogen storage contains hydrogen held under high pressure within individual microcavities. The hydrogen is released from the microcavities by heating the cavities. This heating is accomplished by including within the tank for the microcavity hydrogen storage a heating element.

  5. Supply chain planning classification

    NASA Astrophysics Data System (ADS)

    Hvolby, Hans-Henrik; Trienekens, Jacques; Bonde, Hans

    2001-10-01

    Industry experience a need to shift in focus from internal production planning towards planning in the supply network. In this respect customer oriented thinking becomes almost a common good amongst companies in the supply network. An increase in the use of information technology is needed to enable companies to better tune their production planning with customers and suppliers. Information technology opportunities and supply chain planning systems facilitate companies to monitor and control their supplier network. In spite if these developments, most links in today's supply chains make individual plans, because the real demand information is not available throughout the chain. The current systems and processes of the supply chains are not designed to meet the requirements now placed upon them. For long term relationships with suppliers and customers, an integrated decision-making process is needed in order to obtain a satisfactory result for all parties. Especially when customized production and short lead-time is in focus. An effective value chain makes inventory available and visible among the value chain members, minimizes response time and optimizes total inventory value held throughout the chain. In this paper a supply chain planning classification grid is presented based current manufacturing classifications and supply chain planning initiatives.

  6. Developing a Model for Agile Supply: an Empirical Study from Iranian Pharmaceutical Supply Chain

    PubMed Central

    Rajabzadeh Ghatari, Ali; Mehralian, Gholamhossein; Zarenezhad, Forouzandeh; Rasekh, Hamid Reza

    2013-01-01

    Agility is the fundamental characteristic of a supply chain needed for survival in turbulent markets, where environmental forces create additional uncertainty resulting in higher risk in the supply chain management. In addition, agility helps providing the right product, at the right time to the consumer. The main goal of this research is therefore to promote supplier selection in pharmaceutical industry according to the formative basic factors. Moreover, this paper can configure its supply network to achieve the agile supply chain. The present article analyzes the supply part of supply chain based on SCOR model, used to assess agile supply chains by highlighting their specific characteristics and applicability in providing the active pharmaceutical ingredient (API). This methodology provides an analytical modeling; the model enables potential suppliers to be assessed against the multiple criteria using both quantitative and qualitative measures. In addition, for making priority of critical factors, TOPSIS algorithm has been used as a common technique of MADM model. Finally, several factors such as delivery speed, planning and reorder segmentation, trust development and material quantity adjustment are identified and prioritized as critical factors for being agile in supply of API. PMID:24250689

  7. Developing a model for agile supply: an empirical study from Iranian pharmaceutical supply chain.

    PubMed

    Rajabzadeh Ghatari, Ali; Mehralian, Gholamhossein; Zarenezhad, Forouzandeh; Rasekh, Hamid Reza

    2013-01-01

    Agility is the fundamental characteristic of a supply chain needed for survival in turbulent markets, where environmental forces create additional uncertainty resulting in higher risk in the supply chain management. In addition, agility helps providing the right product, at the right time to the consumer. The main goal of this research is therefore to promote supplier selection in pharmaceutical industry according to the formative basic factors. Moreover, this paper can configure its supply network to achieve the agile supply chain. The present article analyzes the supply part of supply chain based on SCOR model, used to assess agile supply chains by highlighting their specific characteristics and applicability in providing the active pharmaceutical ingredient (API). This methodology provides an analytical modeling; the model enables potential suppliers to be assessed against the multiple criteria using both quantitative and qualitative measures. In addition, for making priority of critical factors, TOPSIS algorithm has been used as a common technique of MADM model. Finally, several factors such as delivery speed, planning and reorder segmentation, trust development and material quantity adjustment are identified and prioritized as critical factors for being agile in supply of API.

  8. Creating corporate advantage.

    PubMed

    Collis, D J; Montgomery, C A

    1998-01-01

    What differentiates truly great corporate strategies from the merely adequate? How can executives at the corporate level create tangible advantage for their businesses that makes the whole more than the sum of the parts? This article presents a comprehensive framework for value creation in the multibusiness company. It addresses the most fundamental questions of corporate strategy: What businesses should a company be in? How should it coordinate activities across businesses? What role should the corporate office play? How should the corporation measure and control performance? Through detailed case studies of Tyco International, Sharp, the Newell Company, and Saatchi and Saatchi, the authors demonstrate that the answers to all those questions are driven largely by the nature of a company's special resources--its assets, skills, and capabilities. These range along a continuum from the highly specialized at one end to the very general at the other. A corporation's location on the continuum constrains the set of businesses it should compete in and limits its choices about the design of its organization. Applying the framework, the authors point out the common mistakes that result from misaligned corporate strategies. Companies mistakenly enter businesses based on similarities in products rather than the resources that contribute to competitive advantage in each business. Instead of tailoring organizational structures and systems to the needs of a particular strategy, they create plain-vanilla corporate offices and infrastructures. The company examples demonstrate that one size does not fit all. One can find great corporate strategies all along the continuum.

  9. Creating sustainable performance.

    PubMed

    Spreitzer, Gretchen; Porath, Christine

    2012-01-01

    What makes for sustainable individual and organizational performance? Employees who are thriving-not just satisfied and productive but also engaged in creating the future. The authors found that people who fit this description demonstrated 16% better overall performance, 125% less burnout, 32% more commitment to the organization, and 46% more job satisfaction than their peers. Thriving has two components: vitality, or the sense of being alive and excited, and learning, or the growth that comes from gaining knowledge and skills. Some people naturally build vitality and learning into their jobs, but most employees are influenced by their environment. Four mechanisms, none of which requires heroic effort or major resources, create the conditions for thriving: providing decision-making discretion, sharing information about the organization and its strategy, minimizing incivility, and offering performance feedback. Organizations such as Alaska Airlines, Zingerman's, Quicken Loans, and Caiman Consulting have found that helping people grow and remain energized at work is valiant on its own merits-but it can also boost performance in a sustainable way.

  10. Entanglement Created by Dissipation

    SciTech Connect

    Alharbi, Abdullah F.; Ficek, Zbigniew

    2011-10-27

    A technique for entangling closely separated atoms by the process of dissipative spontaneous emission is presented. The system considered is composed of two non-identical two-level atoms separated at the quarter wavelength of a driven standing wave laser field. At this atomic distance, only one of the atoms can be addressed by the laser field. In addition, we arrange the atomic dipole moments to be oriented relative to the inter-atomic axis such that the dipole-dipole interaction between the atoms is zero at this specific distance. It is shown that an entanglement can be created between the atoms on demand by tuning the Rabi frequency of the driving field to the difference between the atomic transition frequencies. The amount of the entanglement created depends on the ratio between the damping rates of the atoms, but is independent of the frequency difference between the atoms. We also find that the transient buildup of an entanglement between the atoms may differ dramatically for different initial atomic conditions.

  11. Supply chain assessment methodology.

    PubMed

    Topor, E

    2000-08-01

    This article describes an assessment methodology based on the supply chain proficiency model that can be used to set realistic supply chain objectives. The assessment centers on a business model that identifies the logical stages of supply chain proficiency as measured against a comprehensive set of business characteristics. For each characteristic, an enterprise evolves from one stage to the next. The magnitude of change inherent in moving forward usually prohibits skipping stages. Although it is possible to be at different stages for each characteristic, it is usually desirable to maintain balance.

  12. Lifting BLS Power Supplies

    SciTech Connect

    Sarychev, Michael

    2007-08-01

    This note describes BLS power supplies lifting techniques and provides stress calculations for lifting plate and handles bolts. BLS power supply weight is about 120 Lbs, with the center of gravity shifted toward the right front side. A lifting plate is used to attach a power supply to a crane or a hoist. Stress calculations show that safety factors for lifting plate are 12.9 (vs. 5 required) for ultimate stress and 5.7 (vs. 3 required) for yield stress. Safety factor for shackle bolt thread shear load is 37, and safety factor for bolts that attach handles is 12.8.

  13. Natural Hazards and Supply Chain Disruptions

    NASA Astrophysics Data System (ADS)

    Haraguchi, M.

    2016-12-01

    Natural hazards distress the global economy through disruptions in supply chain networks. Moreover, despite increasing investment to infrastructure for disaster risk management, economic damages and losses caused by natural hazards are increasing. Manufacturing companies today have reduced inventories and streamlined logistics in order to maximize economic competitiveness. As a result, today's supply chains are profoundly susceptible to systemic risks, which are the risk of collapse of an entire network caused by a few node of the network. For instance, the prolonged floods in Thailand in 2011 caused supply chain disruptions in their primary industries, i.e. electronic and automotive industries, harming not only the Thai economy but also the global economy. Similar problems occurred after the Great East Japan Earthquake and Tsunami in 2011, the Mississippi River floods and droughts during 2011 - 2013, and the Earthquake in Kumamoto Japan in 2016. This study attempts to discover what kind of effective measures are available for private companies to manage supply chain disruptions caused by floods. It also proposes a method to estimate potential risks using a Bayesian network. The study uses a Bayesian network to create synthetic networks that include variables associated with the magnitude and duration of floods, major components of supply chains such as logistics, multiple layers of suppliers, warehouses, and consumer markets. Considering situations across different times, our study shows desirable data requirements for the analysis and effective measures to improve Value at Risk (VaR) for private enterprises and supply chains.

  14. Creating a TQM culture.

    PubMed

    Lynn, G; Curto, C

    1992-11-01

    Creating a culture and environment for quality improvement is hard work that takes time and commitment. It is often frustrating and painful. For an organization to be successful in this transformation, leadership is not just important, it is vital. The leaders in TQM have new roles to play, roles that go against the grain of many of the forces that led to management success. The tasks of the leaders in a TQM organization emphasize building teamwork and removing barriers that prevent the organization from meeting customer needs. When Jamie Haughton, CEO of Corning, was asked where in his job he found the time to commit to TQM, he replied, "Continuous quality improvement is my job; it is the most important thing I do ... Quality is the primary responsibility of the leader."

  15. Creating With Carbon

    NASA Technical Reports Server (NTRS)

    2003-01-01

    A subsidiary of SI Diamond Technology, Inc., Applied Nanotech, of Austin, Texas, is creating a buzz among various technology firms and venture capital groups interested in the company s progressive research on carbon-related field emission devices, including carbon nanotubes, filaments of pure carbon less than one ten-thousandth the width of human hair. Since their discovery in 1991, carbon nanotubes have gained considerable attention due to their unique physical properties. For example, a single perfect carbon nanotube can range from 10 to 100 times stronger than steel, per unit weight. Recent studies also indicate that the nanotubes may be the best heat-conducting material in existence. These properties, combined with the ease of growing thin films or nanotubes by a variety of deposition techniques, make the carbon-based material one of the most desirable for cold field emission cathodes.

  16. Creating virtual ARDS patients.

    PubMed

    Das, Anup; Haque, Mainul; Chikhani, Marc; Wenfei Wang; Hardman, Jonathan G; Bates, Declan G

    2016-08-01

    This paper presents the methodology used in patient-specific calibration of a novel highly integrated model of the cardiovascular and pulmonary pathophysiology associated with Acute Respiratory Distress Syndrome (ARDS). We focus on data from previously published clinical trials on the static and dynamic cardio-pulmonary responses of three ARDS patients to changes in ventilator settings. From this data, the parameters of the integrated model were identified using an optimization-based methodology in multiple stages. Computational simulations confirm that the resulting model outputs accurately reproduce the available clinical data. Our results open up the possibility of creating in silico a biobank of virtual ARDS patients that could be used to evaluate current, and investigate novel, therapeutic strategies.

  17. Creating the living brand.

    PubMed

    Bendapudi, Neeli; Bendapudi, Venkat

    2005-05-01

    It's easy to conclude from the literature and the lore that top-notch customer service is the province of a few luxury companies and that any retailer outside that rarefied atmosphere is condemned to offer mediocre service at best. But even companies that position themselves for the mass market can provide outstanding customer-employee interactions and profit from them, if they train employees to reflect the brand's core values. The authors studied the convenience store industry in depth and focused on two that have developed a devoted following: QuikTrip (QT) and Wawa. Turnover rates at QT and Wawa are 14% and 22% respectively, much lower than the typical rate in retail. The authors found six principles that both firms embrace to create a strong culture of customer service. Know what you're looking for: A focus on candidates' intrinsic traits allows the companies to hire people who will naturally bring the right qualities to the job. Make the most of talent: In mass-market retail, talent is generally viewed as a commodity, but that outlook becomes a self-fulfilling prophesy. Create pride in the brand: Service quality depends directly on employees' attachment to the brand. Build community: Wawa and QT have made concerted efforts to build customer loyalty through a sense of community. Share the business context: Employees need a clear understanding of how their company operates and how it defines success. Satisfy the soul: To win an employee's passionate engagement, a company must meet his or her needs for security, esteem, and justice.

  18. Creating Griffith Observatory

    NASA Astrophysics Data System (ADS)

    Cook, Anthony

    2013-01-01

    Griffith Observatory has been the iconic symbol of the sky for southern California since it began its public mission on May 15, 1935. While the Observatory is widely known as being the gift of Col. Griffith J. Griffith (1850-1919), the story of how Griffith’s gift became reality involves many of the people better known for other contributions that made Los Angeles area an important center of astrophysics in the 20th century. Griffith began drawing up his plans for an observatory and science museum for the people of Los Angeles after looking at Saturn through the newly completed 60-inch reflector on Mt. Wilson. He realized the social impact that viewing the heavens could have if made freely available, and discussing the idea of a public observatory with Mt. Wilson Observatory’s founder, George Ellery Hale, and Director, Walter Adams. This resulted, in 1916, in a will specifying many of the features of Griffith Observatory, and establishing a committee managed trust fund to build it. Astronomy popularizer Mars Baumgardt convinced the committee at the Zeiss Planetarium projector would be appropriate for Griffith’s project after the planetarium was introduced in Germany in 1923. In 1930, the trust committee judged funds to be sufficient to start work on creating Griffith Observatory, and letters from the Committee requesting help in realizing the project were sent to Hale, Adams, Robert Millikan, and other area experts then engaged in creating the 200-inch telescope eventually destined for Palomar Mountain. A Scientific Advisory Committee, headed by Millikan, recommended that Caltech Physicist Edward Kurth be put in charge of building and exhibit design. Kurth, in turn, sought help from artist Russell Porter. The architecture firm of John C. Austin and Fredrick Ashley was selected to design the project, and they adopted the designs of Porter and Kurth. Philip Fox of the Adler Planetarium was enlisted to manage the completion of the Observatory and become its

  19. [The study of medical supplies automation replenishment algorithm in hospital on medical supplies supplying chain].

    PubMed

    Sheng, Xi

    2012-07-01

    The thesis aims to study the automation replenishment algorithm in hospital on medical supplies supplying chain. The mathematical model and algorithm of medical supplies automation replenishment are designed through referring to practical data form hospital on the basis of applying inventory theory, greedy algorithm and partition algorithm. The automation replenishment algorithm is proved to realize automatic calculation of the medical supplies distribution amount and optimize medical supplies distribution scheme. A conclusion could be arrived that the model and algorithm of inventory theory, if applied in medical supplies circulation field, could provide theoretical and technological support for realizing medical supplies automation replenishment of hospital on medical supplies supplying chain.

  20. Natural Gas Supply SBIR Program

    SciTech Connect

    Shoemaker, H.D.; Gwilliam, W.J.

    1995-07-01

    The Small Business Innovation Research (SBIR) program was created in 1982 by Public Law 97-219 and reauthorized in 1992 until the year 2000 by Public Law 102-564. The purposes of the new law are to (1) expand and improve the SBIR program, 2) emphasize the program`s goal of increasing private sector commercialization of technology developed through Federal R&D, (3) increase small business participation in Federal R&D, and (4) improve the Federal Government`s dissemination of information concerning the SBIR program. DOE`s SBIR pro-ram has two features that are unique. In the 1995 DOE SBIR solicitation, the DOE Fossil Energy topics were: environmental technology for natural gas, oil, and coal; advanced recovery of oil; natural gas supply; natural gas utilization; advanced coal-based power systems; and advanced fossil fuels research. The subtopics for this solicitation`s Natural Gas Supply topic are (1) drilling, completion, and stimulation; (2) low-permeability Formations; (3) delivery and storage; and (4) natural gas upgrading.

  1. Creating alternatives in science

    PubMed Central

    2009-01-01

    Traditional scientist training at the PhD level does not prepare students to be competitive in biotechnology or other non-academic science careers. Some universities have developed biotechnology-relevant doctoral programmes, but most have not. Forming a life science career club makes a statement to university administrators that it is time to rework the curriculum to include biotechnology-relevant training. A career club can supplement traditional PhD training by introducing students to available career choices, help them develop a personal network and teach the business skills that they will need to be competitive in science outside of academia. This paper is an instructional guide designed to help students create a science career club at their own university. These suggestions are based on the experience gained in establishing such a club for the Graduate School at the University of Colorado Denver. We describe the activities that can be offered, the job descriptions for the offices required and potential challenges. With determination, a creative spirit, and the guidance of this paper, students should be able to greatly increase awareness of science career options, and begin building the skills necessary to become competitive in non-academic science. PMID:20161069

  2. Creating alternatives in science.

    PubMed

    Gravagna, Nicole G

    2009-04-01

    Traditional scientist training at the PhD level does not prepare students to be competitive in biotechnology or other non-academic science careers. Some universities have developed biotechnology-relevant doctoral programmes, but most have not. Forming a life science career club makes a statement to university administrators that it is time to rework the curriculum to include biotechnology-relevant training. A career club can supplement traditional PhD training by introducing students to available career choices, help them develop a personal network and teach the business skills that they will need to be competitive in science outside of academia. This paper is an instructional guide designed to help students create a science career club at their own university. These suggestions are based on the experience gained in establishing such a club for the Graduate School at the University of Colorado Denver. We describe the activities that can be offered, the job descriptions for the offices required and potential challenges. With determination, a creative spirit, and the guidance of this paper, students should be able to greatly increase awareness of science career options, and begin building the skills necessary to become competitive in non-academic science.

  3. Creating new market space.

    PubMed

    Kim, W C; Mauborgne, R

    1999-01-01

    Most companies focus on matching and beating their rivals. As a result, their strategies tend to take on similar dimensions. What ensues is head-to-head competition based largely on incremental improvements in cost, quality, or both. The authors have studied how innovative companies break free from the competitive pack by staking out fundamentally new market space--that is, by creating products or services for which there are no direct competitors. This path to value innovation requires a different competitive mind-set and a systematic way of looking for opportunities. Instead of looking within the conventional boundaries that define how an industry competes, managers can look methodically across them. By so doing, they can find unoccupied territory that represents real value innovation. Rather than looking at competitors within their own industry, for example, managers can ask why customers make the trade-off between substitute products or services. Home Depot, for example, looked across the substitutes serving home improvement needs. Intuit looked across the substitutes available to individuals managing their personal finances. In both cases, powerful insights were derived from looking at familiar data from a new perspective. Similar insights can be gleaned by looking across strategic groups within an industry; across buyer groups; across complementary product and service offerings; across the functional-emotional orientation of an industry; and even across time. To help readers explore new market space systematically, the authors developed a tool, the value curve, that can be used to represent visually a range of value propositions.

  4. Creating an open mind.

    PubMed

    Monaghan, Duncan

    2011-07-01

    Duncan Monaghan is 33 years old and in his second year of an Arts degree in Creative Writing. He is a published poet and is currently producing a music CD. Duncan has a history of bipolar disorder which was diagnosed when he was nineteen: "It worried me at first a lot. It played on my mind constantly. I felt different from everybody else--I did not understand what was happening to me." Drawing on his life experiences, Duncan has been enhancing his recovery through creativity--in poetry, lyrics, music and story. "Life for me was a constant battle of relying on medication and appointments with my case manager...until I realized I could combine my recovery with my passions as a tool to use as an outlet to many of the "mind traps" I so often found hindering my own recovery." Duncan is Aboriginal and has experience of the mental health systems in most states and territories and now lives in Brisbane. This is a shortened version of his presentation at Creating Futures 2010.

  5. Creating Heliophysics Concept Maps

    NASA Astrophysics Data System (ADS)

    Ali, N. A.; Peticolas, L. M.; Paglierani, R.; Mendez, B. J.

    2011-12-01

    The Center for Science Education at University of California Berkeley's Space Sciences Laboratory is creating concept maps for Heliophysics and would like to get input from scientists. The purpose of this effort is to identify key concepts related to Heliophysics and map their progression to show how students' understanding of Heliophysics might develop from Kindergarten through higher education. These maps are meant to tie into the AAAS Project 2061 Benchmarks for Scientific Literacy and National Science Education Standards. It is hoped that the results of this effort will be useful for curriculum designers developing Heliophysics-related curriculum materials and classroom teachers using Heliophysics materials. The need for concept maps was identified as a result of product analysis undertaken by the NASA Heliophysics Forum Team. The NASA Science Education and Public Outreach Forums have as two of their goals to improve the characterization of the contents of the Science Mission Directorate and Public Outreach (SMD E/PO) portfolio (Objective 2.1) and assist SMD in addressing gaps in the portfolio of SMD E/PO products and project activities (Objective 2.2). An important part of this effort is receiving feedback from solar scientists regarding the inclusion of key concepts and their progression in the maps. This session will introduce the draft concept maps and elicit feedback from scientists.

  6. Petroleum supply monthly

    SciTech Connect

    1995-10-01

    The Petroleum Supply Monthly (PSM) is one of a family of four publications produced by the Petroleum Supply Division within the Energy Information Administration (EIA) reflecting different levels of data timeliness and completeness. The other publications are the Weekly Petroleum Status Report (WPSR), the Winter Fuels Report, and the Petroleum Supply Annual (PSA). Data presented in the PSM describe the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the United States (50 States and the District of Columbia). The reporting universe includes those petroleum sectors in primary supply. Included are: petroleum refiners, motor gasoline blends, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States.

  7. Petroleum Supply Monthly

    SciTech Connect

    1996-02-01

    The Petroleum Supply Monthly (PSM) is one of a family of four publications produced by the Petroleum Supply Division within the Energy Information Administration (EIA) reflecting different levels of data timeliness and completeness. The other publications are the Weekly Petroleum Status Report (WPSR), the Winter Fuels Report, and the Petroleum Supply Annual (PSA). Data presented in the PSM describe the supply and disposition of petroleum products in the United States and major U.S. geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the United States (50 States and the District of Columbia). The reporting universe includes those petroleum sectors in primary supply. Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States. Data presented in the PSM are divided into two sections: Summary Statistics and Detailed Statistics.

  8. Perioperative supply chain management.

    PubMed

    Feistritzer, N R; Keck, B R

    2000-09-01

    Faced with declining revenues and increasing operating expenses, hospitals are evaluating numerous mechanisms designed to reduce costs while simultaneously maintaining quality care. Many facilities have targeted initial cost reduction efforts in the reduction of labor expenses. Once labor expenses have been "right sized," facilities have continued to focus on service delivery improvements by the optimization of the "supply chain" process. This report presents a case study of the efforts of Vanderbilt University Medical Center in the redesign of its supply chain management process in the department of Perioperative Services. Utilizing a multidisciplinary project management structure, 3 work teams were established to complete the redesign process. To date, the project has reduced costs by $2.3 million and enhanced quality patient care by enhancing the delivery of appropriate clinical supplies during the perioperative experience.

  9. Coal supply for California

    NASA Technical Reports Server (NTRS)

    Yancik, J. J.

    1978-01-01

    The potential sources and qualities of coals available for major utility and industrial consumers in California are examined and analyzed with respect to those factors that would affect the reliability of supplies. Other considerations, such as the requirements and assurances needed by the coal producers to enter into long-term contracts and dedicate large reserves of coal to these contracts are also discussed. Present and potential future mining contraints on coal mine operators are identified and analyzed with respect to their effect on availability of supply.

  10. Creating a Social World

    PubMed Central

    Kendler, Kenneth S.; Jacobson, Kristen C.; Gardner, Charles O.; Gillespie, Nathan; Aggen, Steven A.; Prescott, Carol A.

    2014-01-01

    Context Peer-group deviance is strongly associated with externalizing behaviors. We have limited knowledge of the sources of individual differences in peer-group deviance. Objective To clarify genetic and environmental contributions to peer-group deviance in twins from mid-childhood through early adulthood. Design Retrospective assessments using a life-history calendar. Analysis by biometric growth curves. Setting General community. Participants Members of male-male pairs from the population-based Virginia Twin Registry personally interviewed in 1998–2004 (n=1802). Main Outcome Measure Self-reported peer-group deviance at ages 8 to 11, 12 to 14, 15 to 17, 18 to 21, and 22 to 25 years. Results Mean and variance of peer-group deviance increased substantially with age. Genetic effects on peer-group deviance showed a strong and steady increase over time. Family environment generally declined in importance over time. Individual-specific environmental influences on peer-group deviance levels were stable in the first 3 age periods and then increased as most twins left home. When standardized, the heritability of peer-group deviance is approximately 30% at ages 8 to 11 years and rises to approximately 50% across the last 3 time periods. Both genes and shared environment contributed to individual differences in the developmental trajectory of peer-group deviance. However, while the correlation between childhood peer-group deviance levels and the subsequent slope of peer-group deviance over time resulting from genetic factors was positive, the same relationship resulting from shared environmental factors was negative. Conclusions As male twins mature and create their own social worlds, genetic factors play an increasingly important role in their choice of peers, while shared environment becomes less influential. The individual specific environment increases in importance when individuals leave home. Individuals who have deviant peers in childhood, as a result of genetic vs

  11. Researchers Create Artificial Mouse 'Embryo'

    MedlinePlus

    ... news/fullstory_163881.html Researchers Create Artificial Mouse 'Embryo' Experiment used two types of gene-modified stem ... they've created a kind of artificial mouse embryo using stem cells, which can be coaxed to ...

  12. Creating Chemigrams in the Classroom.

    ERIC Educational Resources Information Center

    Guhin, Paula

    2003-01-01

    Describes an art activity in which students create "chemigrams" using exposed photo paper to create designs. Explains that this activity can be used with middle and high school students as an introduction to photography or use of chemicals. (CMK)

  13. Creating Chemigrams in the Classroom.

    ERIC Educational Resources Information Center

    Guhin, Paula

    2003-01-01

    Describes an art activity in which students create "chemigrams" using exposed photo paper to create designs. Explains that this activity can be used with middle and high school students as an introduction to photography or use of chemicals. (CMK)

  14. Supply-Chain Optimization Template

    NASA Technical Reports Server (NTRS)

    Quiett, William F.; Sealing, Scott L.

    2009-01-01

    The Supply-Chain Optimization Template (SCOT) is an instructional guide for identifying, evaluating, and optimizing (including re-engineering) aerospace- oriented supply chains. The SCOT was derived from the Supply Chain Council s Supply-Chain Operations Reference (SCC SCOR) Model, which is more generic and more oriented toward achieving a competitive advantage in business.

  15. Supply Chain Management

    NASA Astrophysics Data System (ADS)

    Bauer, Jürgen

    Die Produktionslogistik hat im Rahmen der Materialbeschaffung und der Belieferung von externen Kunden vielfältige Beziehungen zu Lieferanten und Kunden. Im Ansatz des Supply Chain Managements (Lieferkettenmanagement), kurz auch als SCM bezeichnet, versucht man, sowohl Lieferanten als auch Kunden in die gesamte Logistikplanung zu integrieren. SCM umfasst dabei vor allem folgende Aufgaben: Bedarfs- und Bestandsplanung der Materialien entlang der Lieferkette

  16. Supply and Demand

    MedlinePlus

    ... breast to continue producing an adequate supply of milk. In fact, the protein contained in the residual milk remaining in the ... or fluid) content, and the composition of your milk will change. Over the next week or so, the protein content will decline and the fat and lactose ...

  17. Maintenance and supply options

    NASA Technical Reports Server (NTRS)

    1988-01-01

    The object of the Maintenance and Supply Option was to develop a high level operational philosophy related to maintenance and supply operations and incorporate these concepts into the Lunar Base Study. Specific products to be generated during this task were three trade studies and a conceptual design of the Logistic Supply Module. The crew size study was performed to evaluate crew sizes from the baseline size of four to a crew size of eight and determine the preferred crew size. The second trade study was to determine the impact of extending surface stay times and recommend a preferred duration of stay time as a function of crew, consumables, and equipment support capabilities. The third trade study was an evaluation of packaging and storage methods to determine the preferred logistics approach to support the lunar base. A modified scenario was developed and served as the basis of the individual trade studies. Assumptions and guidelines were also developed from experience with Apollo programs, Space Shuttle operations, and Space Station studies. With this information, the trade studies were performed and a conceptual design for the Logistic Supply Module was developed.

  18. Exploration Supply Chain Simulation

    NASA Technical Reports Server (NTRS)

    2008-01-01

    The Exploration Supply Chain Simulation project was chartered by the NASA Exploration Systems Mission Directorate to develop a software tool, with proper data, to quantitatively analyze supply chains for future program planning. This tool is a discrete-event simulation that uses the basic supply chain concepts of planning, sourcing, making, delivering, and returning. This supply chain perspective is combined with other discrete or continuous simulation factors. Discrete resource events (such as launch or delivery reviews) are represented as organizational functional units. Continuous resources (such as civil service or contractor program functions) are defined as enabling functional units. Concepts of fixed and variable costs are included in the model to allow the discrete events to interact with cost calculations. The definition file is intrinsic to the model, but a blank start can be initiated at any time. The current definition file is an Orion Ares I crew launch vehicle. Parameters stretch from Kennedy Space Center across and into other program entities (Michaud Assembly Facility, Aliant Techsystems, Stennis Space Center, Johnson Space Center, etc.) though these will only gain detail as the file continues to evolve. The Orion Ares I file definition in the tool continues to evolve, and analysis from this tool is expected in 2008. This is the first application of such business-driven modeling to a NASA/government-- aerospace contractor endeavor.

  19. Lightweight Regulated Power Supply

    NASA Technical Reports Server (NTRS)

    Mclyman, C. W.

    1985-01-01

    Power-supply circuit regulates output voltage by adjusting frequency of chopper circuit according to variations. Currently installed in battery charger for electric wheelchair, circuit is well suited to other uses in which light weight is important - for example, in portable computers, radios, and test instruments.

  20. APS power supply controls

    SciTech Connect

    Saunders, C.W.; Despe, O.D.

    1994-03-31

    The purpose of this document is to provide comprehensive coverage of the APS power supply control design. This includes application software, embedded controller software, networks, and hardware. The basic components will be introduced first, followed by the requirements driving the overall design. Subsequent sections will address each component of the design one by one. Latter sections will address specific applications.

  1. Supply chain management.

    PubMed

    Palevich, R F

    1999-02-01

    This article describes how Do It Best Corp. has used technology to improve its supply chain management. Among other topics it discusses the company's use of electronic data interchange, the Internet, electronic forecasting, and warehouse management systems to gain substantial savings and increase its competitiveness.

  2. Teleconnected food supply shocks

    NASA Astrophysics Data System (ADS)

    Bren d'Amour, Christopher; Wenz, Leonie; Kalkuhl, Matthias; Steckel, Jan Christoph; Creutzig, Felix

    2016-03-01

    The 2008-2010 food crisis might have been a harbinger of fundamental climate-induced food crises with geopolitical implications. Heat-wave-induced yield losses in Russia and resulting export restrictions led to increases in market prices for wheat across the Middle East, likely contributing to the Arab Spring. With ongoing climate change, temperatures and temperature variability will rise, leading to higher uncertainty in yields for major nutritional crops. Here we investigate which countries are most vulnerable to teleconnected supply-shocks, i.e. where diets strongly rely on the import of wheat, maize, or rice, and where a large share of the population is living in poverty. We find that the Middle East is most sensitive to teleconnected supply shocks in wheat, Central America to supply shocks in maize, and Western Africa to supply shocks in rice. Weighing with poverty levels, Sub-Saharan Africa is most affected. Altogether, a simultaneous 10% reduction in exports of wheat, rice, and maize would reduce caloric intake of 55 million people living in poverty by about 5%. Export bans in major producing regions would put up to 200 million people below the poverty line at risk, 90% of which live in Sub-Saharan Africa. Our results suggest that a region-specific combination of national increases in agricultural productivity and diversification of trade partners and diets can effectively decrease future food security risks.

  3. Baby supplies you need

    MedlinePlus

    ... Newborn care - baby supplies References Carlo WA. The newborn infant. In: Kliegman RM, Stanton BF, St Geme JW, ... A.M. Editorial team. Related MedlinePlus Health Topics Infant and Newborn Care Browse the Encyclopedia A.D.A.M., ...

  4. Supply chain quality.

    PubMed

    Feary, Simon

    2009-01-01

    As the development of complex manufacturing models and virtual companies become more prevalent in today's growing global markets, it is increasingly important to support the relationships between manufacturer and supplier. Utilising these relationships will ensure that supply chains operate more effectively and reduce costs, risks and time-to-market time frames, whilst maintaining product quality.

  5. Taxol commercial supply strategy.

    PubMed

    DeFuria, M D; Horovitz, Z

    1993-01-01

    Evidence of Taxol's safety and efficacy for treatment of refractory ovarian cancer convinced the National Cancer Institute (NCI) to seek a pharmaceutical partner and approval. After an open competition, NCI entered a Cooperative Research and Development Agreement with Bristol-Myers Squibb Company (BMS) to obtain approval of a New Drug Application (NDA) so that Taxol could be marketed as well as to provide supplies for clinical trials and compassionate use. To assure a successful commercialization of Taxol, BMS developed a strategic plan for expanding drug supplies. The strategy included immediately increasing the amount of Taxol derived from yew bark and establishing a broad research program to evaluate alternative sourcing options and their commercial feasibility. The options included precursor isolation and semisynthesis, yew plantations for biomass production, plant cell culture, and total synthesis. A number of both academic and industrial investigators, already interested in various Taxol supply issues, were enlisted for collaborations with the company. Progress on this research during the first 18 months has enabled BMS to do the following: 1) double the yield of Taxol from bark extraction; 2) exceed NCI's request for drug supplies in 1991, permitting establishment of an ovarian cancer treatment referral center (TRC) with a national network of comprehensive cancer centers; 3) increase NCI supplies from 5000 to 50,000 vials/month in 1992, permitting establishment of TRC protocol for breast cancer; 4) identify several potentially viable alternative sources; 5) schedule production of large amounts of Taxol by precursor conversion during 1993; and 6) ensure that sufficient quantities of the product will be available for treatment and continued clinical research.(ABSTRACT TRUNCATED AT 250 WORDS)

  6. Discontinuous Mode Power Supply

    NASA Technical Reports Server (NTRS)

    Lagadinos, John; Poulos, Ethel

    2012-01-01

    A document discusses the changes made to a standard push-pull inverter circuit to avoid saturation effects in the main inverter power supply. Typically, in a standard push-pull arrangement, the unsymmetrical primary excitation causes variations in the volt second integral of each half of the excitation cycle that could lead to the establishment of DC flux density in the magnetic core, which could eventually cause saturation of the main inverter transformer. The relocation of the filter reactor normally placed across the output of the power supply solves this problem. The filter reactor was placed in series with the primary circuit of the main inverter transformer, and is presented as impedance against the sudden changes on the input current. The reactor averaged the input current in the primary circuit, avoiding saturation of the main inverter transformer. Since the implementation of the described change, the above problem has not reoccurred, and failures in the main power transistors have been avoided.

  7. High voltage power supply

    NASA Astrophysics Data System (ADS)

    Ruitberg, A. P.; Young, K. M.

    1985-05-01

    A high voltage power supply is formed by three discrete circuits energized by a battery to provide a plurality of concurrent output signals floating at a high output voltage on the order of several tens of kilovolts. In the first two circuits, the regulator stages are pulse width modulated and include adjustable ressistances for varying the duty cycles of pulse trains provided to corresponding oscillator stages while the third regulator stage includes an adjustable resistance for varying the amplitude of a steady signal provided to a third oscillator stage. In the first circuit, the oscillator, formed by a constant current drive network and a tuned resonant network included a step up transformer, is coupled to a second step up transformer which, in turn, supplies an amplified sinusoidal signal to a parallel pair of complementary poled rectifying, voltage multiplier stages to generate the high output voltage.

  8. High voltage power supply

    NASA Technical Reports Server (NTRS)

    Ruitberg, A. P.; Young, K. M. (Inventor)

    1985-01-01

    A high voltage power supply is formed by three discrete circuits energized by a battery to provide a plurality of concurrent output signals floating at a high output voltage on the order of several tens of kilovolts. In the first two circuits, the regulator stages are pulse width modulated and include adjustable ressistances for varying the duty cycles of pulse trains provided to corresponding oscillator stages while the third regulator stage includes an adjustable resistance for varying the amplitude of a steady signal provided to a third oscillator stage. In the first circuit, the oscillator, formed by a constant current drive network and a tuned resonant network included a step up transformer, is coupled to a second step up transformer which, in turn, supplies an amplified sinusoidal signal to a parallel pair of complementary poled rectifying, voltage multiplier stages to generate the high output voltage.

  9. Detection of Slope Movement by Comparing Point Clouds Created by SFM Software

    NASA Astrophysics Data System (ADS)

    Oda, Kazuo; Hattori, Satoko; Takayama, Toko

    2016-06-01

    This paper proposes movement detection method between point clouds created by SFM software, without setting any onsite georeferenced points. SfM software, like Smart3DCaputure, PhotoScan, and Pix4D, are convenient for non-professional operator of photogrammetry, because these systems require simply specification of sequence of photos and output point clouds with colour index which corresponds to the colour of original image pixel where the point is projected. SfM software can execute aerial triangulation and create dense point clouds fully automatically. This is useful when monitoring motion of unstable slopes, or loos rocks in slopes along roads or railroads. Most of existing method, however, uses mesh-based DSM for comparing point clouds before/after movement and it cannot be applied in such cases that part of slopes forms overhangs. And in some cases movement is smaller than precision of ground control points and registering two point clouds with GCP is not appropriate. Change detection method in this paper adopts CCICP (Classification and Combined ICP) algorithm for registering point clouds before / after movement. The CCICP algorithm is a type of ICP (Iterative Closest Points) which minimizes point-to-plane, and point-to-point distances, simultaneously, and also reject incorrect correspondences based on point classification by PCA (Principle Component Analysis). Precision test shows that CCICP method can register two point clouds up to the 1 pixel size order in original images. Ground control points set in site are useful for initial setting of two point clouds. If there are no GCPs in site of slopes, initial setting is achieved by measuring feature points as ground control points in the point clouds before movement, and creating point clouds after movement with these ground control points. When the motion is rigid transformation, in case that a loose Rock is moving in slope, motion including rotation can be analysed by executing CCICP for a loose rock and

  10. Beryllium Metal Supply Options

    DTIC Science & Technology

    1989-01-01

    given to the National Academy of Sciences by its congressional charter to be an advisor to the federal government ard, upon its own initiative , to...instrumental in initiating the request for an independent assessment by the National Research Council of the current domestic beryllium metal supply...future environ- mental requirements i. examined. In view of the small quantity of metal needed, the size of the total market, and the present status of

  11. Emergency Supply Expert System

    DTIC Science & Technology

    1993-04-01

    Supply Expert System (ESEX) is one of three studies being provided to the Defense Logistics Agency (DLA) under KPMG Peat Marwick delivery order F7-04...benefits of implementing ESEX. The sources of this data included an ESEX Executive Summary Report/Business Case dated February 1992, historical budget...individual AVRS engines. Methodology The study team gathered statistical data from the three sites currently operating ESEX within DLA. Through trips to two

  12. Streamlining the supply chain.

    PubMed

    Neumann, Lydon

    2003-07-01

    Effective management of the supply chain requires attention to: Product management--formulary development and maintenance, compliance, clinical involvement, standardization, and demand-matching. Sourcing and contracting--vendor consolidation, GPO portfolio management, price leveling, content management, and direct contracting Purchasing and payment-cycle--automatic placement, web enablement, centralization, evaluated receipts settlement, and invoice matching Inventory and distribution management--"unofficial" and "official" locations, vendor-managed inventory, automatic replenishment, and freight management.

  13. Mobile Uninterruptible Power Supply

    NASA Technical Reports Server (NTRS)

    Mears, Robert L.

    1990-01-01

    Proposed mobile unit provides 20 kVA of uninterruptible power. Used with mobile secondary power-distribution centers to provide power to test equipment with minimal cabling, hazards, and obstacles. Wheeled close to test equipment and system being tested so only short cable connections needed. Quickly moved and set up in new location. Uninterruptible power supply intended for tests which data lost or equipment damaged during even transient power failure.

  14. Defining a Closed-Loop U.S. Aluminum Can Supply Chain Through Technical Design and Supply Chain Innovation

    NASA Astrophysics Data System (ADS)

    Buffington, Jack; Peterson, Ray

    2013-08-01

    The purpose of this study is to conduct a supply chain material flow analysis (MFA) for the U.S. aluminum can market, consistent with studies conducted for the overall worldwide aluminum industry. A technical definition of the use of alloys 5182 and 3104 is conducted by metallurgists for use in the "aluminum can" MFA. Four propositions are created: technical, economic, and supply chain factors are as important to secondary aluminum recycling in an aluminum can as higher recycling rates (P1); the development of a unialloy aluminum can will increase reuse rates, but recycling rates must increase for this to happen (P2); a closed-loop aluminum can supply chain is not able to be fully realized in today's environment but is very useful for understanding improvement through both supply and demand (P3); and UBC supply can improve through a "voluntary deposit-refund system" approach (P4).

  15. Background: What the States Created

    ERIC Educational Resources Information Center

    Cox, James C.

    2009-01-01

    Prior to 2003, virtual universities were being created at a rate that would question the usual perception that higher education rarely changed, or changed (if at all) at a glacial speed. No comprehensive study of what was actually being created had been done; nor had anyone tapped the experiences of the developers in the states to see what was…

  16. The Leadership Assignment: Creating Change.

    ERIC Educational Resources Information Center

    Calabrese, Raymond L.

    This book provides change-motivated leaders with an understanding of the change process and the tools to drive change. Eight change principles guide change agents in creating and sustaining change: prepare to lead change; knowledge is power; create empowering mental models; overcome resistance to change; lead change; accelerate the change process;…

  17. Creating Student-Friendly Tests

    ERIC Educational Resources Information Center

    Salend, Spencer J.

    2011-01-01

    Creating a fair, reliable, teacher-made test is a challenge. Every year poorly designed tests fail to accurately measure many students' learning--and negatively affect their academic futures. Salend, a well-known writer on assessment for at-risk students who consults with schools on assessment procedures, offers guidelines for creating tests that…

  18. Supply instability and oil-market behavior

    SciTech Connect

    Jacoby, H.D.; Paddock, J.L.

    1980-01-01

    The disruption in world oil markets that was triggered by the 1978 to 1979 Iranian revolution is analyzed. The resultant price rises are explored in the context of the behavior of the spot market and key OPEC countries. In particular, the economic and political roles of excess oil supply in the Persian Gulf nations are discussed. Conclusions for the likely future are presented together with the implications for United States policy. Constructive steps could be taken to create a data series on secondary stocks in the major consuming countries and the strategic oil stockpile could be used to moderate price increases. It is prudent to assume that recent energy-supply and price situations will continue and to take whatever steps are necessary to moderate the effects. 11 references, 4 tables.

  19. Eurodollars and the US money supply

    SciTech Connect

    Balbach, A.B.; Resler, D.H.

    1980-06-01

    It is frequently asserted that the Eurodollar market has contributed substantially to worldwide inflation and general economic instability. Eurodollars allegedly move with ease from country to country, disrupting national credit and money markets and creating fears about the inflationary consequences for the US economy if all these dollars pour back into the US banking system. This article addresses a related question by focusing on the relationship between the Eurodollar market and monetary control. It assumes throughout that the Federal Reserve System does not engage in Eurodollar transactions or alter its monetary policy as a result of such transactions. The first section of the article describes the Eurodollar market. The second section illustrates, through the use of balance sheets, how Eurodollar transactions may affect the US money supply. The third section investigates the effects of Eurodollar transactions on the US money supply in the context of a money-multiplier model.

  20. Power-Supply-Conditioning Circuit

    NASA Technical Reports Server (NTRS)

    Primas, L. E.; Loveland, R. C.

    1989-01-01

    Fluctuations of voltage suppressed in power supplies for precise radio-frequency circuits. Circuit suppresses both periodic and random deviations of dc supply voltage from desired steady level. Highly-stable feedback voltage regulator, conditioner intended in conjunction with conventional power-supply circuit to provide constant voltage to atomic frequency standard or other precise oscillator. Without conditioners, outputs of most commercial power supplies contain fluctuations causing unacceptably-large phase and amplitude modulation of precise oscillators.

  1. Food and water supply

    NASA Technical Reports Server (NTRS)

    Popov, I. G.

    1975-01-01

    Supplying astronauts with adequate food and water on short and long-term space flights is discussed based on experiences gained in space flight. Food consumption, energy requirements, and suitability of the foodstuffs for space flight are among the factors considered. Physicochemical and biological methods of food production and regeneration of water from astronaut metabolic wastes, as well as wastes produced in a closed ecological system, or as a result of technical processes taking place in various spacecraft systems are suggested for long-term space flights.

  2. Food and water supply

    NASA Technical Reports Server (NTRS)

    Popov, I. G.

    1975-01-01

    Supplying astronauts with adequate food and water on short and long-term space flights is discussed based on experiences gained in space flight. Food consumption, energy requirements, and suitability of the foodstuffs for space flight are among the factors considered. Physicochemical and biological methods of food production and regeneration of water from astronaut metabolic wastes, as well as wastes produced in a closed ecological system, or as a result of technical processes taking place in various spacecraft systems are suggested for long-term space flights.

  3. Progress 39 Supply Vehicle

    NASA Image and Video Library

    2011-02-20

    ISS026-E-028490 (20 Feb. 2011) --- Backdropped by a blue and white part of Earth, the unpiloted ISS Progress 39 supply vehicle appears to be very small as it departs from the International Space Station at 8:12 a.m. (EST) on Feb. 20, 2011. At 11:12 a.m., the deorbit burn braked the trash-loaded cargo ship into its re-entry trajectory over the Pacific Ocean, where it was burned up in Earth’s atmosphere.

  4. Future natural gas supplies

    NASA Astrophysics Data System (ADS)

    Despite recent optimism about the outlook for the future supply of domestic conventional natural gas, the Congressional Office of Technology Assessment (OTA) finds insufficient evidence to clearly justify either an optimistic or a pessimistic view. In a technical memorandum entitled “U.S. Natural Gas Availability: Conventional Gas Supply Through the Year 2000,” released recently by Rep. Philip R. Sharp (D-Ind,), chairman of the Subcommittee on Fossil and Synthetic Fuels of the Committee on Energy and Commerce, OTA concluded that substantial technical uncertainties prevented a reliable estimation of the likely natural gas production rates for later in this century. Even ignoring the potential for significant changes in gas prices and technology, OTA estimated that conventional gas production by the lower 48 states in the year 2000 could range from 9 to 19 trillion cubic feet (TCF) (0.25 to 0.53 trillion cubic meters), compared to 1982 production of 17.5 TCF. Similarly, production in the year 1990 could range from 13 to 20 TCF.

  5. Integrating the healthcare supply chain.

    PubMed

    Brennan, C D

    1998-01-01

    Today's integrated delivery systems (IDSs) require efficient supply chain processes to speed products to users at the lowest possible cost. Most excess costs within the supply chain are a result of inefficient and redundant processes involved in the transport and delivery of supplies from suppliers to healthcare providers. By integrating and assuming control of these supply chain processes, improving supply chain management practices, and organizing and implementing a disciplined redesign plan, IDSs can achieve substantial savings and better focus their organizations on their core patient care mission.

  6. Creating Energy-Efficient Buildings.

    ERIC Educational Resources Information Center

    Burr, Donald F.

    This paper was presented during the time the author was president of the Council of Educational Facility Planners, International, (CEFP/I). The presentation begins with a summary of the state of the world's natural gas and petroleum supplies and states that since one-third of all energy consumed in the United States is to heat and cool buildings,…

  7. Creating Energy-Efficient Buildings.

    ERIC Educational Resources Information Center

    Burr, Donald F.

    This paper was presented during the time the author was president of the Council of Educational Facility Planners, International, (CEFP/I). The presentation begins with a summary of the state of the world's natural gas and petroleum supplies and states that since one-third of all energy consumed in the United States is to heat and cool buildings,…

  8. Creating and Nurturing Strong Teams.

    ERIC Educational Resources Information Center

    Martin, Kaye M.

    1999-01-01

    Discusses ways to create and sustain strong teaching teams, including matching curriculum goals, complementary professional strengths, and exercise of autonomy. Elaborates the administrator's role in nurturing and supporting teamwork. (JPB)

  9. Creating and Exploring Simple Models

    ERIC Educational Resources Information Center

    Hubbard, Miles J.

    2007-01-01

    Students manipulate data algebraically, and statistically to create models applied to a falling ball. They also borrow tools from arithmetic progressions to examine the relationship between the velocity and the distance the ball falls. (Contains 2 tables and 5 figures.)

  10. Creating a family health history

    MedlinePlus

    Family health history; Create a family health history; Family medical history ... Many factors affect your health. These include your: Genes Diet and exercise habits Environment Family members tend to share certain behaviors, genetic traits, and habits. ...

  11. Creating visual explanations improves learning.

    PubMed

    Bobek, Eliza; Tversky, Barbara

    2016-01-01

    Many topics in science are notoriously difficult for students to learn. Mechanisms and processes outside student experience present particular challenges. While instruction typically involves visualizations, students usually explain in words. Because visual explanations can show parts and processes of complex systems directly, creating them should have benefits beyond creating verbal explanations. We compared learning from creating visual or verbal explanations for two STEM domains, a mechanical system (bicycle pump) and a chemical system (bonding). Both kinds of explanations were analyzed for content and learning assess by a post-test. For the mechanical system, creating a visual explanation increased understanding particularly for participants of low spatial ability. For the chemical system, creating both visual and verbal explanations improved learning without new teaching. Creating a visual explanation was superior and benefitted participants of both high and low spatial ability. Visual explanations often included crucial yet invisible features. The greater effectiveness of visual explanations appears attributable to the checks they provide for completeness and coherence as well as to their roles as platforms for inference. The benefits should generalize to other domains like the social sciences, history, and archeology where important information can be visualized. Together, the findings provide support for the use of learner-generated visual explanations as a powerful learning tool.

  12. World petroleum supplies

    NASA Astrophysics Data System (ADS)

    Bell, Peter M.

    A number of conclusions by political conservatives about the fate of world petroleum supplies have been emerging lately. Among the most recent of them arose from discussions, held at the 1983 spring meeting of the American Association for the Advancement of Science (AAAS), which focused on the environment and resource study entitled “The Global 2000 Report” (New Scientist, June 9, 1983). Fred Singer, representing the Heritage Foundation of Washington, D.C., criticized the report, which predicted shortages in the near future, saying that the current world-wide oil glut will continue beyond the year 2000. Alternatives to the use of petroleum are a part of the cause. Singer argued that conservation, nuclear energy, and other petroleum substitutes will continue to suppress the demand for petroleum. In addition, according to other evaluations, exploration for petroleum and natural gas has not really begun.

  13. Sustainable Biomass Supply Systems

    SciTech Connect

    Erin Searcy; Dave Muth; Erin Wilkerson; Shahab Sokansanj; Bryan Jenkins; Peter Titman; Nathan Parker; Quinn Hart; Richard Nelson

    2009-04-01

    The U.S. Department of Energy (DOE) aims to displace 30% of the 2004 gasoline use (60 billion gal/yr) with biofuels by 2030 as outlined in the Energy Independence and Security Act of 2007, which will require 700 million tons of biomass to be sustainably delivered to biorefineries annually. Lignocellulosic biomass will make an important contribution towards meeting DOE’s ethanol production goals. For the biofuels industry to be an economically viable enterprise, the feedstock supply system (i.e., moving the biomass from the field to the refinery) cannot contribute more that 30% of the total cost of the biofuel production. The Idaho National Laboratory in collaboration with Oak Ridge National Laboratory, University of California, Davis and Kansas State University are developing a set of tools for identifying economical, sustainable feedstocks on a regional basis based on biorefinery siting.

  14. Switching power supply

    DOEpatents

    Mihalka, A.M.

    1984-06-05

    The invention is a repratable capacitor charging, switching power supply. A ferrite transformer steps up a dc input. The transformer primary is in a full bridge configuration utilizing power MOSFETs as the bridge switches. The transformer secondary is fed into a high voltage, full wave rectifier whose output is connected directly to the energy storage capacitor. The transformer is designed to provide adequate leakage inductance to limit capacitor current. The MOSFETs are switched to the variable frequency from 20 to 50 kHz to charge a capacitor from 0.6 kV. The peak current in a transformer primary and secondary is controlled by increasing the pulse width as the capacitor charges. A digital ripple counter counts pulses and after a preselected desired number is reached an up-counter is clocked.

  15. NNSA TRITIUM SUPPLY CHAIN

    SciTech Connect

    Wyrick, Steven; Cordaro, Joseph; Founds, Nanette; Chambellan, Curtis

    2013-08-21

    Savannah River Site plays a critical role in the Tritium Production Supply Chain for the National Nuclear Security Administration (NNSA). The entire process includes: • Production of Tritium Producing Burnable Absorber Rods (TPBARs) at the Westinghouse WesDyne Nuclear Fuels Plant in Columbia, South Carolina • Production of unobligated Low Enriched Uranium (LEU) at the United States Enrichment Corporation (USEC) in Portsmouth, Ohio • Irradiation of TPBARs with the LEU at the Tennessee Valley Authority (TVA) Watts Bar Reactor • Extraction of tritium from the irradiated TPBARs at the Tritium Extraction Facility (TEF) at Savannah River Site • Processing the tritium at the Savannah River Site, which includes removal of nonhydrogen species and separation of the hydrogen isotopes of protium, deuterium and tritium.

  16. Power Supply Unit

    NASA Technical Reports Server (NTRS)

    1982-01-01

    The Cuk DC to DC Switching Converter was developed by Caltech Professors, Slobodan Cuk and R. D. Middlebrook. The converter changes unsuitable dc voltage into one or more voltages suitable for powering electronic equipment; it can also be used in converting dc current to ac and vice versa. It was named one of the 100 most significant technical advances of 1979. The Cuk converter is more efficient than previous conversion devices, simpler, smaller, lighter, cheaper and highly reliable. The first application of the technology is in the Compucorp 685 word/data processor, manufactured by Compucorp. NASA waived title rights; Caltech granted exclusive license to the inventors, who in turn, transferred their rights to a company they founded called TESLA Company, which sublicenses the converter design and related technology to companies making power supplies for use in their own products.

  17. Programmable photomultiplier power supply

    SciTech Connect

    Kantor, E.L.; Lantsov, V.V.; Potapov, V.M.

    1985-01-01

    This paper describes a precision photomultiplier power supply that provides compensation of errors introduced by switch losses, and compression of the range of scale resistors required with introduction of digital control data into the low-voltage branch of the inverse feedback divider. Parameters are as follows: U /SUB out/ =0.5-2kV, I /SUB out/ =0.5 mA, step size /SUB d/ U /SUB out/ =1 V; uncertainty deltaoU /SUB out/ less than or equal to /SUP +or-/ 0.5V; temperature drift delta U /SUB out/ less than or equal to /SUB +or-/ 5 10 T%/K; time drift deltaU /SUB out/ (T)less than or equal to /SUB +or-/ 10 S%/10h; output ripple U aboutless than or equal to30 mV.

  18. Stab water supply system

    SciTech Connect

    Hammett, D.S.

    1983-02-08

    Apparatus and method for fire suppression on offshore oil platforms including a stab receptacle on an outer surface of a platform connected to a fluid distribution system within the platform for distributing fire suppressing fluid to selected locations, a stab carrying a fluid conduit from a self-propelled service vessel, with the stab being in turn supported on a boom extending from the service vessel, a pumping system on the service vessel for supplying fire suppressing fluid through the conduit to the stab and thereby to the preselected locations. The service vessel is preferably a semi-submersible and includes a system for dynamic positioning of the vessel such as side thrusters in addition to a main propulsion unit.

  19. Oxygen supplies in disaster management.

    PubMed

    Blakeman, Thomas C; Branson, Richard D

    2013-01-01

    Mass casualty events and disasters, both natural and human-generated, occur frequently around the world and can generate scores of injured or ill victims in need of resources. Of the available medical supplies, oxygen remains the critical consumable resource in disaster management. Strategic management of oxygen supplies in disaster scenarios remains a priority. Hospitals have large supplies of liquid oxygen and a supply of compressed gas oxygen cylinders that allow several days of reserve, but a large influx of patients from a disaster can strain these resources. Most backup liquid oxygen supplies are attached to the main liquid system and supply line. In the event of damage to the main system, the reserve supply is rendered useless. The Strategic National Stockpile supplies medications, medical supplies, and equipment to disaster areas, but it does not supply oxygen. Contracted vendors can deliver oxygen to alternate care facilities in disaster areas, in the form of concentrators, compressed gas cylinders, and liquid oxygen. Planning for oxygen needs following a disaster still presents a substantial challenge, but alternate care facilities have proven to be valuable in relieving pressure from the mass influx of patients into hospitals, especially for those on home oxygen who require only an electrical source to power their oxygen concentrator.

  20. Developing sustainable food supply chains.

    PubMed

    Smith, B Gail

    2008-02-27

    This paper reviews the opportunities available for food businesses to encourage consumers to eat healthier and more nutritious diets, to invest in more sustainable manufacturing and distribution systems and to develop procurement systems based on more sustainable forms of agriculture. The important factors in developing more sustainable supply chains are identified as the type of supply chain involved and the individual business attitude to extending responsibility for product quality into social and environmental performance within their own supply chains. Interpersonal trust and working to standards are both important to build more sustainable local and many conserved food supply chains, but inadequate to transform mainstream agriculture and raw material supplies to the manufactured and commodity food markets. Cooperation among food manufacturers, retailers, NGOs, governmental and farmers' organizations is vital in order to raise standards for some supply chains and to enable farmers to adopt more sustainable agricultural practices.

  1. Supply-Chain Risk Analysis

    DTIC Science & Technology

    2016-06-07

    security score upon first submission – 3/1/2010 Measured Against CWE/SANS Top-25 Errors 24 SQL Database Query Output: All records with ID = 48983...exploitable design or coding errors • Very little data for software supply chains 8 Software Supply Chain Complexity-1 Composite inherits risk from any point... Relative Effort Operational Capabilities Knowledge of Supplier Capabilities Knowledge of Product Attributes 13 Supply-Chain Risk Categories Category

  2. Reliability Estimates for Power Supplies

    SciTech Connect

    Lee C. Cadwallader; Peter I. Petersen

    2005-09-01

    Failure rates for large power supplies at a fusion facility are critical knowledge needed to estimate availability of the facility or to set priorties for repairs and spare components. A study of the "failure to operate on demand" and "failure to continue to operate" failure rates has been performed for the large power supplies at DIII-D, which provide power to the magnet coils, the neutral beam injectors, the electron cyclotron heating systems, and the fast wave systems. When one of the power supplies fails to operate, the research program has to be either temporarily changed or halted. If one of the power supplies for the toroidal or ohmic heating coils fails, the operations have to be suspended or the research is continued at de-rated parameters until a repair is completed. If one of the power supplies used in the auxiliary plasma heating systems fails the research is often temporarily changed until a repair is completed. The power supplies are operated remotely and repairs are only performed when the power supplies are off line, so that failure of a power supply does not cause any risk to personnel. The DIII-D Trouble Report database was used to determine the number of power supply faults (over 1,700 reports), and tokamak annual operations data supplied the number of shots, operating times, and power supply usage for the DIII-D operating campaigns between mid-1987 and 2004. Where possible, these power supply failure rates from DIII-D will be compared to similar work that has been performed for the Joint European Torus equipment. These independent data sets support validation of the fusion-specific failure rate values.

  3. AGS Fast spin resonance jump, magnets and power supplies

    SciTech Connect

    Glenn,J.W.; Huang, H.; Liaw, C. J.; Marneris, I.; Meng, W.; Mi, J. L.; Rosas, P.; Sandberg, J.; Tuozzolo, J.; Zhang, A.

    2009-05-04

    In order to cross more rapidly the 82 weak spin resonances caused by the horizontal tune and the partial snakes, we plan to jump the horizontal tune 82 times during the acceleration of polarized protons. The current in the magnets creating this tune jump will rise in 100 {micro}s, hold flat for about 4 ms and fan to zero in 100 {micro}s. Laminated beam transport quadrupole magnets have been recycled by installing new two turn coils and longitudinal laminated pole tip shims that reduce inductance and power supply current. The power supply uses a high voltage capacitor discharge to raise the magnet current, which is then switched to a low voltage supply, and then the current is switched back to the high voltage capacitor to zero the current. The current in each of the magnet pulses must match the order of magnitude change in proton momentum during the acceleration cycle. The magnet, power supply and operational experience are described.

  4. Cholangiocytes and blood supply

    PubMed Central

    Gaudio, Eugenio; Franchitto, Antonio; Pannarale, Luigi; Carpino, Guido; Alpini, Gianfranco; Francis, Heather; Glaser, Shannon; Alvaro, Domenico; Onori, Paolo

    2006-01-01

    The microvascular supply of the biliary tree, the peribiliary plexus (PBP), stems from the hepatic artery branches and flows into the hepatic sinusoids. A detailed three-dimensional study of the PBP has been performed by using the Scanning Electron Microscopy vascular corrosion casts (SEMvcc) technique. Considering that the PBP plays a fundamental role in supporting the secretory and absorptive functions of the biliary epithelium, their organization in either normalcy and pathology is explored. The normal liver shows the PBP arranged around extra- and intrahepatic biliary tree. In the small portal tract PBP was characterized by a single layer of capillaries which progressively continued with the extrahepatic PBP where it showed a more complex vascular network. After common duct ligation (BDL), progressive modifications of bile duct and PBP proliferation are observed. The PBP presents a three-dimensional network arranged around many bile ducts and appears as bundles of vessels, composed by capillaries of homogeneous diameter with a typical round mesh structure. The PBP network is easily distinguishable from the sinusoidal network which appears normal. Considering the enormous extension of the PBP during BDL, the possible role played by the Vascular Endothelial Growth Factor (VEGF) is evaluated. VEGF-A, VEGF-C and their related receptors appeared highly immunopositive in proliferating cholangiocytes of BDL rats. The administration of anti-VEGF-A or anti-VEGF-C antibodies to BDL rats as well as hepatic artery ligation induced a reduced bile duct mass. The administration of rVEGF-A to BDL hepatic artery ligated rats prevented the decrease of cholangiocyte proliferation and VEGF-A expression as compared to BDL control rats. These data suggest the role of arterial blood supply of the biliary tree in conditions of cholangiocyte proliferation, such as it occurs during chronic cholestasis. On the other hand, the role played by VEGF as a tool of cross-talk between

  5. The supply of physicians' services.

    PubMed

    Brown, D M; Lapan, H E

    1979-04-01

    This paper presents a model of the supply of physicians' services based upon the assumption that physicians are price-taking utility maximizers. Assuming physicians' services are produced using physicians' labor and purchased inputs, the paper shows that the impact of changes in final product or input prices on the supply of physicians' services depends on the physicians' labor-leisure choice and on the degree of substitutability between physicians' labor and purchased inputs. The empirical results presented indicate that the physicians' labor supply curve is backward-bending, but that the supply curve of physicians' services is positively sloped.

  6. Journaling: creating space for "I".

    PubMed

    Charles, Jennell P

    2010-01-01

    As nurses engaged in a caring profession, it is critical that we learn not only to care for others but also to care for ourselves. To care effectively for ourselves, we must create the space and time in which to do this. Journaling is one tool that scholars offer as a way to create this space. Although there is no clear consensus about the best techniques for journaling, there is evidence that journaling, as a reflective, meditative activity, can promote creativity, self-awareness, and personal development.

  7. Making Supply Chains Resilient to Floods Using a Bayesian Network

    NASA Astrophysics Data System (ADS)

    Haraguchi, M.

    2015-12-01

    Natural hazards distress the global economy by disrupting the interconnected supply chain networks. Manufacturing companies have created cost-efficient supply chains by reducing inventories, streamlining logistics and limiting the number of suppliers. As a result, today's supply chains are profoundly susceptible to systemic risks. In Thailand, for example, the GDP growth rate declined by 76 % in 2011 due to prolonged flooding. Thailand incurred economic damage including the loss of USD 46.5 billion, approximately 70% of which was caused by major supply chain disruptions in the manufacturing sector. Similar problems occurred after the Great East Japan Earthquake and Tsunami in 2011, the Mississippi River floods and droughts during 2011 - 2013, and Hurricane Sandy in 2012. This study proposes a methodology for modeling supply chain disruptions using a Bayesian network analysis (BNA) to estimate expected values of countermeasures of floods, such as inventory management, supplier management and hard infrastructure management. We first performed a spatio-temporal correlation analysis between floods and extreme precipitation data for the last 100 years at a global scale. Then we used a BNA to create synthetic networks that include variables associated with the magnitude and duration of floods, major components of supply chains and market demands. We also included decision variables of countermeasures that would mitigate potential losses caused by supply chain disruptions. Finally, we conducted a cost-benefit analysis by estimating the expected values of these potential countermeasures while conducting a sensitivity analysis. The methodology was applied to supply chain disruptions caused by the 2011 Thailand floods. Our study demonstrates desirable typical data requirements for the analysis, such as anonymized supplier network data (i.e. critical dependencies, vulnerability information of suppliers) and sourcing data(i.e. locations of suppliers, and production rates and

  8. Sand supply to beaches

    NASA Astrophysics Data System (ADS)

    Aagaard, Troels

    2017-04-01

    In most cases, beaches and dunes are built by sand that has been transported onshore from the shoreface. While this has been known for a long time, we are still not able to quantitatively predict onshore sediment transport and sand supply to beaches. Sediment transport processes operating during brief, high-energy stormy conditions - when beaches erode and sand moves offshore - are fairly well known and they can be modelled with a reasonable degree of confidence. However, the slower onshore sand transport leading to beach recovery under low-to-moderate energy conditions - and the reason why beaches and dunes exist in the first place - is not yet well understood. This severely limits our capability to understand and predict coastal behaviour on long time scales, for example in response to changing sea level or wave conditions. This paper will discuss issues and recent developments in sediment transport measurement and prediction on the lower and upper shoreface and into the swash zone. The focus will be on the integration and upscaling of small-scale deterministic process measurements into parametric models that may increase modelling capabilities of coastal behaviour on larger temporal and spatial scales.

  9. Digital Piracy: An Assessment of Consumer Piracy Risk and Optimal Supply Chain Coordination Strategies

    ERIC Educational Resources Information Center

    Jeong, Bong-Keun

    2010-01-01

    Digital piracy and the emergence of new distribution channels have changed the dynamics of supply chain coordination and created many interesting problems. There has been increased attention to understanding the phenomenon of consumer piracy behavior and its impact on supply chain profitability. The purpose of this dissertation is to better…

  10. Leveraging Human Resource Development Expertise to Improve Supply Chain Managers' Skills and Competencies

    ERIC Educational Resources Information Center

    Ellinger, Alexander E.; Ellinger, Andrea D.

    2014-01-01

    Purpose: There is an ongoing shortage of talented supply chain managers with the necessary skills and business-related competencies to manage increasingly complex and strategically important supply chain processes. The purpose of this paper is to propose that organizations can create and maintain competitive advantage by leveraging the expertise…

  11. Digital Piracy: An Assessment of Consumer Piracy Risk and Optimal Supply Chain Coordination Strategies

    ERIC Educational Resources Information Center

    Jeong, Bong-Keun

    2010-01-01

    Digital piracy and the emergence of new distribution channels have changed the dynamics of supply chain coordination and created many interesting problems. There has been increased attention to understanding the phenomenon of consumer piracy behavior and its impact on supply chain profitability. The purpose of this dissertation is to better…

  12. Leveraging Human Resource Development Expertise to Improve Supply Chain Managers' Skills and Competencies

    ERIC Educational Resources Information Center

    Ellinger, Alexander E.; Ellinger, Andrea D.

    2014-01-01

    Purpose: There is an ongoing shortage of talented supply chain managers with the necessary skills and business-related competencies to manage increasingly complex and strategically important supply chain processes. The purpose of this paper is to propose that organizations can create and maintain competitive advantage by leveraging the expertise…

  13. Creating a Positive Work Environment

    ERIC Educational Resources Information Center

    Anderson, Susan

    2010-01-01

    The author believes happy staff make for happy classrooms and happy classrooms make for happy children. However, with all the pressures facing child care programs--from the economy to state requirements--creating and maintaining a positive work environment becomes tougher and tougher. In this article, the author discusses the importance of…

  14. Create a Polarized Light Show.

    ERIC Educational Resources Information Center

    Conrad, William H.

    1992-01-01

    Presents a lesson that introduces students to polarized light using a problem-solving approach. After illustrating the concept using a slinky and poster board with a vertical slot, students solve the problem of creating a polarized light show using Polya's problem-solving methods. (MDH)

  15. Creating Space for Children's Literature

    ERIC Educational Resources Information Center

    Serafini, Frank

    2011-01-01

    As teachers struggle to balance the needs of their students with the requirements of commercial reading materials, educators need to consider how teachers will create space for children's literature in today's classrooms. In this article, 10 practical recommendations for incorporating children's literature in the reading instructional framework…

  16. Creating Highlander Wherever You Are

    ERIC Educational Resources Information Center

    Williams, Susan; Mullett, Cathy

    2016-01-01

    Highlander Research and Education Center serves as a catalyst for grassroots organizing and movement building. This article focuses on an interview with education coordinator Susan Williams who has worked at Highlander for 26 years. We discuss how others can and do create powerful popular education experiences anywhere, whether they have a…

  17. Creating Adult Basic Education Programs.

    ERIC Educational Resources Information Center

    Harris, Dolores M.

    Adult basic education programs must teach the "social living skills" disadvantaged adults need, as well as basic literacy skills. In creating an ABE program, one must first assess the needs of the target population--through surveys, group meetings, an advisory council of members of the target population, demographic studies, and consideration of…

  18. Creating Frameworks for Reflective Teaching

    ERIC Educational Resources Information Center

    Carter, Margie

    2007-01-01

    The task of creating organizational policies and systems that promote and support reflective teaching is multifaceted and seldom enumerated in early childhood professional literature. One of the best overviews the author has found comes from Carol Brunson Phillips and Sue Bredekamp (1998). The author opines that if the early childhood profession…

  19. Creating a New Professional Association

    ERIC Educational Resources Information Center

    Journal of College Reading and Learning, 2009

    2009-01-01

    This position paper investigates the merits and potential benefits of creating a new, more comprehensive professional association for members of the learning assistance and developmental education profession. This was the task assigned to the College Reading and Learning Association/National Association for Developmental Education (CRLA/NADE)…

  20. Creating Great Overheads with Computers.

    ERIC Educational Resources Information Center

    Gribas, Cyndy; And Others

    1996-01-01

    Steps in preparing effective overhead projector transparencies for college instruction are outlined, using the PowerPoint program for Windows. They include thinking analogically in translating from concept to visual form; using the features of the presentation program to create a polished product; and assuring readability (visibility, typeface…

  1. Let's Create a Comic Strip.

    ERIC Educational Resources Information Center

    Wright, Gary; Sherman, Ross

    1999-01-01

    Considers how teachers can help students become literate, critical, creative thinkers by aligning curricula, teaching strategies, and instructional resources. Promotes literacy, higher-level thinking, and writing skills through the interdisciplinary approach of combining language and art. Suggests that creating a comic strip stimulates and…

  2. Creating a Positive Work Environment

    ERIC Educational Resources Information Center

    Anderson, Susan

    2010-01-01

    The author believes happy staff make for happy classrooms and happy classrooms make for happy children. However, with all the pressures facing child care programs--from the economy to state requirements--creating and maintaining a positive work environment becomes tougher and tougher. In this article, the author discusses the importance of…

  3. Creating a Global Perspective Campus

    ERIC Educational Resources Information Center

    Braskamp, Larry A.

    2011-01-01

    The author has written this Guidebook to assist users interested in creating a campus that will be more global in its mission, programs, and people. His approach is to focus on the views and contributions of the people who are engaged in higher education. Thus it has a "person" emphasis rather than a structural or policy point of view. The author…

  4. Creating Time for Equity Together

    ERIC Educational Resources Information Center

    Renée, Michelle

    2015-01-01

    Iin urban communities across the nation, a broad range of partners have committed to reinventing educational time together to ensure equitable access to rich learning opportunities for all young people. Across the nation, education partners are using their creativity, commitment, and unique resources to create new school and system designs that…

  5. Can Children Really Create Knowledge?

    ERIC Educational Resources Information Center

    Bereiter, Carl; Scardamalia, Marlene

    2010-01-01

    Can children genuinely create new knowledge, as opposed to merely carrying out activities that resemble those of mature scientists and innovators? The answer is yes, provided the comparison is not to works of genius but to standards that prevail in ordinary research communities. One important product of knowledge creation is concepts and tools…

  6. Creating Presentations on ICT Classes

    ERIC Educational Resources Information Center

    Marchis, Iuliana

    2010-01-01

    The article focuses on the creation of presentations on ICT classes. The first part highlights the most important steps when creating a presentation. The main idea is, that the computer presentation shouldn't consist only from the technological part, i.e. the editing of the presentation in a computer program. There are many steps before and after…

  7. Creating Highlander Wherever You Are

    ERIC Educational Resources Information Center

    Williams, Susan; Mullett, Cathy

    2016-01-01

    Highlander Research and Education Center serves as a catalyst for grassroots organizing and movement building. This article focuses on an interview with education coordinator Susan Williams who has worked at Highlander for 26 years. We discuss how others can and do create powerful popular education experiences anywhere, whether they have a…

  8. School Reports: Creating Common Understandings.

    ERIC Educational Resources Information Center

    Lewis, Sharon

    1998-01-01

    Suggesting that creating a report for each school involved in the Reading Recovery program can have a powerful impact, this paper shows the current model of campus reports for the Spring Branch Independent School District, Houston, Texas. The report form described in the paper is continually growing and changing through need and collaboration with…

  9. Creating Three-Dimensional Scenes

    ERIC Educational Resources Information Center

    Krumpe, Norm

    2005-01-01

    Persistence of Vision Raytracer (POV-Ray), a free computer program for creating photo-realistic, three-dimensional scenes and a link for Mathematica users interested in generating POV-Ray files from within Mathematica, is discussed. POV-Ray has great potential in secondary mathematics classrooms and helps in strengthening students' visualization…

  10. Creating Learner-Centered Accountability.

    ERIC Educational Resources Information Center

    Darling-Hammond, Linda; And Others

    The goals of education for the next century require a new conception of accountability, one that seeks to create responsible and responsive schools. This volume tries to outline such a conception of learner-centered accountability, and show how it looks in action in real schools. The first chapter provides a conceptual overview of a…

  11. Creating Frameworks for Reflective Teaching

    ERIC Educational Resources Information Center

    Carter, Margie

    2007-01-01

    The task of creating organizational policies and systems that promote and support reflective teaching is multifaceted and seldom enumerated in early childhood professional literature. One of the best overviews the author has found comes from Carol Brunson Phillips and Sue Bredekamp (1998). The author opines that if the early childhood profession…

  12. Creating a Global Perspective Campus

    ERIC Educational Resources Information Center

    Braskamp, Larry A.

    2011-01-01

    The author has written this Guidebook to assist users interested in creating a campus that will be more global in its mission, programs, and people. His approach is to focus on the views and contributions of the people who are engaged in higher education. Thus it has a "person" emphasis rather than a structural or policy point of view. The author…

  13. Creating speech-synchronized animation.

    PubMed

    King, Scott A; Parent, Richard E

    2005-01-01

    We present a facial model designed primarily to support animated speech. Our facial model takes facial geometry as input and transforms it into a parametric deformable model. The facial model uses a muscle-based parameterization, allowing for easier integration between speech synchrony and facial expressions. Our facial model has a highly deformable lip model that is grafted onto the input facial geometry to provide the necessary geometric complexity needed for creating lip shapes and high-quality renderings. Our facial model also includes a highly deformable tongue model that can represent the shapes the tongue undergoes during speech. We add teeth, gums, and upper palate geometry to complete the inner mouth. To decrease the processing time, we hierarchically deform the facial surface. We also present a method to animate the facial model over time to create animated speech using a model of coarticulation that blends visemes together using dominance functions. We treat visemes as a dynamic shaping of the vocal tract by describing visemes as curves instead of keyframes. We show the utility of the techniques described in this paper by implementing them in a text-to-audiovisual-speech system that creates animation of speech from unrestricted text. The facial and coarticulation models must first be interactively initialized. The system then automatically creates accurate real-time animated speech from the input text. It is capable of cheaply producing tremendous amounts of animated speech with very low resource requirements.

  14. Creating Space for Children's Literature

    ERIC Educational Resources Information Center

    Serafini, Frank

    2011-01-01

    As teachers struggle to balance the needs of their students with the requirements of commercial reading materials, educators need to consider how teachers will create space for children's literature in today's classrooms. In this article, 10 practical recommendations for incorporating children's literature in the reading instructional framework…

  15. Creating Great Overheads with Computers.

    ERIC Educational Resources Information Center

    Gribas, Cyndy; And Others

    1996-01-01

    Steps in preparing effective overhead projector transparencies for college instruction are outlined, using the PowerPoint program for Windows. They include thinking analogically in translating from concept to visual form; using the features of the presentation program to create a polished product; and assuring readability (visibility, typeface…

  16. Creating Three-Dimensional Scenes

    ERIC Educational Resources Information Center

    Krumpe, Norm

    2005-01-01

    Persistence of Vision Raytracer (POV-Ray), a free computer program for creating photo-realistic, three-dimensional scenes and a link for Mathematica users interested in generating POV-Ray files from within Mathematica, is discussed. POV-Ray has great potential in secondary mathematics classrooms and helps in strengthening students' visualization…

  17. Creating an Innovative Learning Organization

    ERIC Educational Resources Information Center

    Salisbury, Mark

    2010-01-01

    This article describes how to create an innovative learning (iLearning) organization. It begins by discussing the life cycle of knowledge in an organization, followed by a description of the theoretical foundation for iLearning. Next, the article presents an example of iLearning, followed by a description of the distributed nature of work, the…

  18. Creating Valuable Class Web Sites

    ERIC Educational Resources Information Center

    Baker, Elizabeth A.

    2008-01-01

    Even those teachers with the best intentions of taking advantage of the Internet to support learning may have obstacles before them. In researching the problem, the author has heard their complaints and understands some of the difficulties. However, creating a classroom Web site is not as difficult as one might think. In this article, the author…

  19. Create Your Own Learning Center.

    ERIC Educational Resources Information Center

    Mummert, Patricia A.

    This document is a descriptive guide for teachers on how to create a learning center cheaply but effectively. The foundational concept of this guide is that teachers are artists who must fashion and highlight the curriculum in such an attractive manner that it becomes most appealing to the child. The materials in the learning center are described…

  20. Building an efficient supply chain.

    PubMed

    Scalise, Dagmara

    2005-08-01

    Realizing at last that supply chain management can produce efficiencies and save costs, hospitals are beginning to adopt practices from other industries, such as the concept of extended supply chains, to improve product flow. They're also investing in enterprise planning resource software, radio frequency identification and other technologies, using quality data to drive standardization and streamlining processes.

  1. Repetitive resonant railgun power supply

    DOEpatents

    Honig, E.M.; Nunnally, W.C.

    1985-06-19

    A repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. The supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles.

  2. Repetitive resonant railgun power supply

    SciTech Connect

    Honig, Emanuel M.; Nunnally, William C.

    1988-01-01

    A repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. The supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles.

  3. The stocker cattle supply chain.

    PubMed

    Falconer, Lawrence L; Anderson, David P

    2006-07-01

    This article discusses supply chain management in the US beef industry and where stocker cattle procurement fits in that chain. The supply chain in the US beef industry is defined as well as grading mechanisms that signal prices used to manage the chain. Sources of stocker cattle are also described.

  4. Petroleum supply monthly, August 1993

    SciTech Connect

    Not Available

    1993-09-01

    This publication the Petroleum Supply Monthly (PSM) is one of a family of four publications produced by the Petroleum Supply Division within the Energy Information Administration (EIA) reflecting different levels of data timeliness and completeness. The other publications are the Weekly Petroleum Status Report, (WPSR), the Winter Fuels Report, and the Petroleum Supply Annual (PSA). Data presented describe the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the United States (50 States and the District of Columbia). The reporting universe includes those petroleum sectors in primary supply. Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. Data presented are divided into Summary Statistics and Detailed Statistics.

  5. Dispersal potential of a tidal river and colonization of a created tidal freshwater marsh

    PubMed Central

    Leck, Mary Allessio

    2012-01-01

    Background and aims A created tidal freshwater wetland, with no extant seed bank, was monitored to evaluate the colonization potential of a tidal river, vegetation and seed bank changes, and also species persistence. Methodology The 32.3-ha mitigation, adjacent to the Delaware River, was completed in 1994. Three sites, with differing completion dates, and three locations (channel edge, midpoint, upland edge) were sampled. From 1995 to 1999, surveys permitted a view of initial dynamics involving soil seed bank density or field vegetation cover, as well as species composition. Vegetation was monitored through 2011, and in 2011 a seed bank survey was also undertaken. Principal results Between 1995 and 1999, 177 species emerged from soil samples, with a maximum of 32.3 ± 1.8 (SE)/sample. Eight species were added in 2011, indicating continuing dispersal and input. Comparing species richness across three sites for midpoint locations, 2011 totals and species/sample were lower (61–90 % and 53–72 %, respectively) than 1998 values. In vegetation plots during the first 5 years, 72 cover species were present. In 2011, there were 44; 14 were new and the majority (13) were woody and part of an overhanging edge canopy. Dispersal was primarily via water. Overall, the trend was towards lower seed bank densities, except for Mikania scandens and Phragmites australis which had higher densities, as well as cover values. Species richness also decreased. Species varied in persistence in the seed bank and vegetation, and among sites and with location. Initial site colonization differences were still apparent in 2011 seed bank samples. While present, Lythrum salicaria did not reduce species richness; Phragmites, in contrast, had substantial impact. Conclusions The single most important change was an increase in Phragmites in the vegetation. Vegetation dynamics are now determined by this species, and the persistent seed bank and continuing dispersal input have little obvious future in

  6. Innovation Strategy: Creating a New Environment for Innovation Within the Defence Supply Chain

    DTIC Science & Technology

    2007-12-01

    isolation Modules - Innovative Suppliers - Thales Tech. Partner - QinetiQ Traking - Ongoing Development Supplier - BAE Systems & Ultra, Logica CMG...Thales Tech. Partner - QinetiQ Academic Partners - Loughborough & Imperial College MMI - Ongoing Development Supplier - BAE Systems & Ultra, Logica CMG

  7. Creating advanced health informatics certification.

    PubMed

    Gadd, Cynthia S; Williamson, Jeffrey J; Steen, Elaine B; Fridsma, Douglas B

    2016-07-01

    In 2005, AMIA leaders and members concluded that certification of advanced health informatics professionals would offer value to individual practitioners, organizations that hire them, and society at large. AMIA's work to create advanced informatics certification began by leading a successful effort to create the clinical informatics subspecialty for American Board of Medical Specialties board-certified physicians. Since 2012, AMIA has been working to establish advanced health informatics certification (AHIC) for all health informatics practitioners regardless of their primary discipline. In November 2015, AMIA completed the first of 3 key tasks required to establish AHIC, with the AMIA Board of Directors' endorsement of proposed eligibility requirements. This AMIA Board white paper describes efforts to establish AHIC, reports on the current status of AHIC components, and provides a context for the proposed AHIC eligibility requirements.

  8. Creating a climate for excellence.

    PubMed

    Lancaster, J

    1985-01-01

    Some people are motivated to achieve in a manner consistent with the goals of their organization while others pursue individual goals. The attitudes people hold determine their behavior. Therefore, the manager is charged with creating an environment that fosters employee commitment to organizational goals. To create a climate for achievement, managers must recognize that all employees want recognition. Employees perform more effectively when they understand the goals of the organization, know what is expected of them, and are part of a system that includes feedback and reinforcement. Generally, people perform more effectively in an environment with minimal threat and punishment; individual responsibility should be encouraged, rewards based on results, and a climate of trust and open communication should prevail.

  9. Creating a Mobile Library Website

    ERIC Educational Resources Information Center

    Cutshall, Tom C.; Blake, Lindsay; Bandy, Sandra L.

    2011-01-01

    The overwhelming results were iPhones and Android devices. Since the library wasn't equipped technologically to develop an in-house application platform and because we wanted the content to work across all mobile platforms, we decided to focus on creating a mobile web-based platform. From the NLM page of mobile sites we chose the basic PubMed/…

  10. Co-Creating a Movement.

    PubMed

    Jones-Schenk, Jan

    2017-10-01

    In 2011, the Robert Wood Johnson Foundation funded a national program office to support nurses' academic progression toward the goal of Bachelor of Science in Nursing preparation of 80% of the RN population by 2020. A new initiative, the National Education Progression in Nursing Collaborative, seeks to create a movement to sustain the momentum of educational progression for nurses. J Contin Educ Nurs. 2017;48(10):442-444. Copyright 2017, SLACK Incorporated.

  11. Creating a Mobile Library Website

    ERIC Educational Resources Information Center

    Cutshall, Tom C.; Blake, Lindsay; Bandy, Sandra L.

    2011-01-01

    The overwhelming results were iPhones and Android devices. Since the library wasn't equipped technologically to develop an in-house application platform and because we wanted the content to work across all mobile platforms, we decided to focus on creating a mobile web-based platform. From the NLM page of mobile sites we chose the basic PubMed/…

  12. Wetland and water supply

    USGS Publications Warehouse

    Baker, John Augustus

    1960-01-01

    The Geological Survey has received numerous inquiries about the effects of proposed changes in the wetland environment. The nature of the inquiries suggests a general confusion in the public mind as to wetland values and an increasing concern by the public with the need for facts as a basis for sound decisions when public action is required. Perhaps the largest gap in our knowledge is in regard to the role played by the wetland in the natural water scheme. Specialists in such fields as agriculture and conservation have studied the wetland in relation to its special uses and values for farming and as a habitat for fish and wildlife. However, except as studied incidentally by these specialists, the role of the wetland with respect to water has been largely neglected. This facet of the wetland problem is of direct concern to the Geological Survey. We commonly speak of water in terms of its place in the hydrologic environment---as, for example, surface water or ground water. These terms imply that water can be neatly pigeonholed. With respect to the wetland environment nothing can be further from the truth. In fact, one objective of this discussion is to demonstrate that for the wetland environment surface water, ground water, and soil water cannot be separated realistically, but are closely interrelated and must be studied together. It should be noted that this statement holds true for the hydrologic environment in general, and that the wetland environment is by no means unique in this respect. Our second and principal objective is to identify some of the problems that must be studied in order to clarify the role of the wetland in relation to water supply. We have chosen to approach these objectives by briefly describing one area for which we have some information, and by using this example to point out some of the problems that need study. First, however, let us define what we, as geohydrologists, mean by wetland and briefly consider wetland classifications. For our

  13. The Anaesthesia Gas Supply System

    PubMed Central

    Das, Sabyasachi; Chattopadhyay, Subhrajyoti; Bose, Payel

    2013-01-01

    The anaesthesia gas supply system is designed to provide a safe, cost-effective and convenient system for the delivery of medical gases at the point of-use. The doctrine of the anaesthesia gas supply system is based on four essential principles: Identity, continuity, adequacy and quality. Knowledge about gas supply system is an integral component of safe anaesthetic practice. Mishaps involving the malfunction or misuse of medical gas supply to operating theatres have cost many lives. The medical gases used in anaesthesia and intensive care are oxygen, nitrous oxide, medical air, entonox, carbon dioxide and heliox. Oxygen is one of the most widely used gases for life-support and respiratory therapy besides anaesthetic procedures. In this article, an effort is made to describe the production, storage and delivery of anaesthetic gases. The design of anaesthesia equipment must take into account the local conditions such as climate, demand and power supply. The operational policy of the gas supply system should have a backup plan to cater to the emergency need of the hospital, in the event of the loss of the primary source of supply. PMID:24249882

  14. Water supply and demand in an energy supply model

    SciTech Connect

    Abbey, D; Loose, V

    1980-12-01

    This report describes a tool for water and energy-related policy analysis, the development of a water supply and demand sector in a linear programming model of energy supply in the United States. The model allows adjustments in the input mix and plant siting in response to water scarcity. Thus, on the demand side energy conversion facilities can substitute more costly dry cooling systems for conventional evaporative systems. On the supply side groundwater and water purchased from irrigators are available as more costly alternatives to unappropriated surface water. Water supply data is developed for 30 regions in 10 Western states. Preliminary results for a 1990 energy demand scenario suggest that, at this level of spatial analysis, water availability plays a minor role in plant siting. Future policy applications of the modeling system are discussed including the evaluation of alternative patterns of synthetic fuels development.

  15. Petroleum supply monthly, February 1994

    SciTech Connect

    Not Available

    1994-03-01

    The Petroleum Supply Monthly presents data describing the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the US. The reporting universe includes those petroleum sectors in primary supply. Included are: petroleum refiners, motor gasoline blenders; operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. Data are divided into two sections: Summary statistics and Detailed statistics.

  16. Multiple resonant railgun power supply

    SciTech Connect

    Honig, E.M.; Nunnally, W.C.

    1985-06-19

    A multiple repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. A plurality of serially connected paired parallel rails are powered by similar power supplies. Each supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles. The multiple serial operation permits relatively small energy components to deliver overall relatively large amounts of energy to the projectiles being propelled.

  17. Multiple resonant railgun power supply

    SciTech Connect

    Honig, Emanuel M.; Nunnally, William C.

    1988-01-01

    A multiple repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. A plurality of serially connected paired parallel rails are powered by similar power supplies. Each supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles. The multiple serial operation permits relatively small energy components to deliver overall relatively large amounts of energy to the projectiles being propelled.

  18. Petroleum supply monthly, April 1994

    SciTech Connect

    Not Available

    1994-04-01

    Data presented in the Petroleum Supply Monthly (PSM) describe the supply and disposition of petroleum products in the United States and major US geographical regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the US. The reporting universe includes those petroleum sectors in primary supply. Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the US.

  19. Oil and Gas Supply Modeling

    NASA Astrophysics Data System (ADS)

    Gass, S. I.

    1982-05-01

    The theoretical and applied state of the art of oil and gas supply models was discussed. The following areas were addressed: the realities of oil and gas supply, prediction of oil and gas production, problems in oil and gas modeling, resource appraisal procedures, forecasting field size and production, investment and production strategies, estimating cost and production schedules for undiscovered fields, production regulations, resource data, sensitivity analysis of forecasts, econometric analysis of resource depletion, oil and gas finding rates, and various models of oil and gas supply.

  20. Getting Help From Others: The Effects of Demand and Supply

    PubMed Central

    2014-01-01

    Objectives. This article investigates whether the help with care needs that is received from others depends on the potential supply of family helpers. Methods. Data from the first round of survey data collected in the National Health and Aging Trends Study are used to create measures of whether help is received, the number of helpers, and the hours of help received. Regression analysis is used to relate these outcomes to indicators of the demand for and supply of helpers. Results. Analyses suggest limited evidence that the receipt of help is a supply-driven phenomenon. Although the measures of child–caregiver supply are not associated with a binary indicator of help received, caregiver-supply factors are associated with the number of helpers and the total hours of help received. Discussion. Findings on the total number of helpers and total hours of care have implications for the division of care labor within families and between families and nonfamily members. Foreseeable trends in the demand for and the supply of help suggest further evolution in patterns of elders’ receipt of help with care needs. Even if those with needs for care continue to have their needs addressed by one or more helpers, the number of helpers, and the aggregate amount of help they provide, is likely to undergo adjustment in response to changing family patterns. PMID:25342824

  1. Ergonomics and sustainability--challenges from global supply chains.

    PubMed

    Hasle, Peter; Jensen, Per Langaa

    2012-01-01

    The development of globalised supply chains is a major challenge for sustainability. For several years, there has been discussion within the profession whether and how ergonomics and human factors can play a role. Based on our research, we have identified five major challenges from global supply chains especially related to the social aspects of sustainability: (1) criteria for social sustainability, (2) the role of key performance indicators in the management of supply chains, (3) the constant changes in supply chains, (4) the challenge in establishing participation, and (5) the development of agency and regulatory mechanisms. There are obviously no clear and simple solutions to these challenges. One possible avenue for progress might lie in acquiring a greater understanding of the challenges from global supply chains and developing a strategy which combines social and long-term business sustainability. Starting from such a basis, the next step would be to find ways for the ergonomics and human factors community to create international collaboration which can impact specific global supply chains.

  2. Getting help from others: the effects of demand and supply.

    PubMed

    Wolf, Douglas A

    2014-11-01

    This article investigates whether the help with care needs that is received from others depends on the potential supply of family helpers. Data from the first round of survey data collected in the National Health and Aging Trends Study are used to create measures of whether help is received, the number of helpers, and the hours of help received. Regression analysis is used to relate these outcomes to indicators of the demand for and supply of helpers. Analyses suggest limited evidence that the receipt of help is a supply-driven phenomenon. Although the measures of child-caregiver supply are not associated with a binary indicator of help received, caregiver-supply factors are associated with the number of helpers and the total hours of help received. Findings on the total number of helpers and total hours of care have implications for the division of care labor within families and between families and nonfamily members. Foreseeable trends in the demand for and the supply of help suggest further evolution in patterns of elders' receipt of help with care needs. Even if those with needs for care continue to have their needs addressed by one or more helpers, the number of helpers, and the aggregate amount of help they provide, is likely to undergo adjustment in response to changing family patterns. © The Author 2014. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. Open Defecation in Newly Created Kenyan Counties: A Situational Analysis.

    PubMed

    Njuguna, John; Muruka, Charles

    2017-01-01

    An estimated 5.6 million Kenyans defecate in the open. This exposes them to sanitation related diseases. This study analysed open defecation trends among the 47 counties in Kenya, newly created in 2013. The study used four data sets on open defecation, unimproved water supply coverage, poverty levels, and population density. Mean open defecation rate across the 47 counties was 23.5% and the median rate 6.9%. The lowest rate was 0.1% and the highest 88.4%. Fifteen counties had open defecation rates of 40% and above. Another 21 counties had open defecation rates of less than 5%. Poverty was the most significant predictor accounting for 68.4% of the variance in open defecation after controlling for unimproved water supply and population density. Some counties have unacceptably high open defecation rates. Alleviating poverty may reduce open defecation in Kenya.

  4. Diffusing Supply Chain Innovations at Hewlett-Packard Company: Applications of Performance Technology.

    ERIC Educational Resources Information Center

    Cargille, Brian; Branvold, Dwight

    2000-01-01

    Explains how Hewlett-Packard creates supply chain management innovations and effectively diffuses new technologies. Outlines how performance technologists help accelerate the diffusion and adoption of innovations by modifying innovations, define the client adoption path, create resources to lead clients through adoption, and improve the diffusion…

  5. Diffusing Supply Chain Innovations at Hewlett-Packard Company: Applications of Performance Technology.

    ERIC Educational Resources Information Center

    Cargille, Brian; Branvold, Dwight

    2000-01-01

    Explains how Hewlett-Packard creates supply chain management innovations and effectively diffuses new technologies. Outlines how performance technologists help accelerate the diffusion and adoption of innovations by modifying innovations, define the client adoption path, create resources to lead clients through adoption, and improve the diffusion…

  6. Creating an environment for learning.

    PubMed

    Houghton, Trish

    2016-03-16

    This article, the third in a series of 11, provides guidance to new and existing mentors and practice teachers to enable them to progress in their role and develop a portfolio of evidence that meets the Nursing and Midwifery Council's Standards to Support Learning and Assessment in Practice (SSLAP). The importance of developing a high quality practice placement is discussed in relation to the fifth domain of the SSLAP, 'creating an environment for learning'. The article provides learning activities and suggests ways in which mentors and practice teachers can undertake various self-assessments, enabling them to gather relevant evidence to demonstrate how they can meet and maintain the requirements of this domain.

  7. Creating a digital medical illustration.

    PubMed

    Culley, Joanna

    2016-01-01

    This paper covers the steps required to complete a medical illustration in a digital format using Adobe Illustrator and Photoshop. The project example is the surgical procedure for the release of the glenohumeral joint for the condition known as 'frozen shoulder'. The purpose is to demonstrate one method which an artist can use within digital media to create a colour illustration such as the release of the glenohumeral joint. Included is a general overview as how to deal with the administration of a medical illustration commission through the experience of a professional freelance artist.

  8. The 3He Supply Problem

    SciTech Connect

    Kouzes, Richard T.

    2009-05-01

    One of the main uses for 3He is in gas proportional counters for neutron detection. Radiation portal monitors deployed for homeland security and non-proliferation use such detectors. Other uses of 3He are for research detectors, commercial instruments, well logging detectors, dilution refrigerators, for targets or cooling in nuclear research, and for basic research in condensed matter physics. The US supply of 3He comes almost entirely from the decay of tritium used in nuclear weapons by the US and Russia. A few other countries contribute a small amount to the world’s 3He supply. Due to the large increase in use of 3He for homeland security, the supply has dwindled, and can no longer meet the demand. This white paper reviews the problems of supply, utilization, and alternatives.

  9. TRANSISTOR HIGH VOLTAGE POWER SUPPLY

    DOEpatents

    Driver, G.E.

    1958-07-15

    High voltage, direct current power supplies are described for use with battery powered nuclear detection equipment. The particular advantages of the power supply described, are increased efficiency and reduced size and welght brought about by the use of transistors in the circuit. An important feature resides tn the employment of a pair of transistors in an alternatefiring oscillator circuit having a coupling transformer and other circuit components which are used for interconnecting the various electrodes of the transistors.

  10. Progress 28 supply vehicle docking

    NASA Image and Video Library

    2008-02-07

    ISS016-E-027827 (7 Feb. 2008) --- An unpiloted Progress supply vehicle approaches the International Space Station. Progress 28 resupply craft launched at 7:03 a.m. (CST) on Feb. 5, 2008 from the Baikonur Cosmodrome in Kazakhstan to deliver more than 2.5 tons of food, fuel, oxygen and other supplies to the Expedition 16 crewmembers onboard the station. Progress automatically docked to the Pirs Docking Compartment at 8:30 a.m. (CST) on Feb. 7.

  11. Progress 28 supply vehicle approach

    NASA Image and Video Library

    2008-02-07

    ISS016-E-027820 (7 Feb. 2008) --- An unpiloted Progress supply vehicle approaches the International Space Station. Progress 28 resupply craft launched at 7:03 a.m. (CST) on Feb. 5, 2008 from the Baikonur Cosmodrome in Kazakhstan to deliver more than 2.5 tons of food, fuel, oxygen and other supplies to the Expedition 16 crewmembers onboard the station. Progress automatically docked to the Pirs Docking Compartment at 8:30 a.m. (CST) on Feb. 7.

  12. Petroleum supply monthly, April 1990

    SciTech Connect

    1990-06-26

    The Petroleum Supply Monthly (PSM) is one of a family of three publications produced by the Petroleum Supply Division within the Energy Information Administration (EIA) reflecting different levels of data timeliness and completeness. The other two publications are the Weekly Petroleum Status Report (WPSR) and the Petroleum Supply Annual (PSA). Data presented in the Petroleum Supply Monthly describe (PSM) the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the United States (50 States and the District of Columbia). The reporting universe includes those petroleum sectors in Primary Supply.'' Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States. Data presented in the PSM are divided into two sections: (1) the Summary Statistics and (2) the Detailed Statistics.

  13. Creating Cross-disciplinary Courses

    PubMed Central

    Reynolds, Elaine R.

    2012-01-01

    Because of its focus on the biological underpinnings of action and behavior, neuroscience intersects with many fields of human endeavor. Some of these cross-disciplinary intersections have been long standing, while others, such as neurotheology or neuroeconomics, are more recently formed fields. Many undergraduate institutions have sought to include cross-disciplinary courses in their curriculum because this style of pedagogy is often seen as applicable to real world problems. However, it can be difficult for faculty with specialized training within their discipline to expand beyond their own fields to offer cross-disciplinary courses. I have been creating a series of multi- or cross-disciplinary courses and have found some strategies that have helped me successfully teach these classes. I will discuss general strategies and tools in developing these types of courses including: 1) creating mixed experience classrooms of students and contributing faculty 2) finding the right tools that will allow you to teach to a mixed population without prerequisites 3) examining the topic using multiple disciplinary perspectives 4) feeding off student experience and interest 5) assessing the impact of these courses on student outcomes and your neuroscience program. This last tool in particular is important in establishing the validity of this type of teaching for neuroscience students and the general student population. PMID:23494491

  14. Creating your own leadership brand.

    PubMed

    Kerfoot, Karlene

    2002-01-01

    Building equity in a brand happens through many encounters. The initial attraction must be followed by the meeting of expectations. This creates a loyalty that is part of an emotional connection to that brand. This is the same process people go through when they first meet a leader and decide if this is a person they want to buy into. People will examine your style, your competence, and your standards. If you fail on any of these fronts, your ability to lead will be severely compromised. People expect more of leaders now, because they know and recognize good leaders. And, predictably, people are now more cynical of leaders because of the well-publicized excess of a few leaders who advanced their own causes at the expense of their people and their financial future. This will turn out to be a good thing, because it will create a higher standard of leadership that all must aspire to achieve. When the bar is raised for us, our standards of performance are also raised.

  15. Supply chain value creation methodology under BSC approach

    NASA Astrophysics Data System (ADS)

    Golrizgashti, Seyedehfatemeh

    2014-06-01

    The objective of this paper is proposing a developed balanced scorecard approach to measure supply chain performance with the aim of creating more value in manufacturing and business operations. The most important metrics have been selected based on experts' opinion acquired by in-depth interviews focused on creating more value for stakeholders. Using factor analysis method, a survey research has been used to categorize selected metrics into balanced scorecard perspectives. The result identifies the intensity of correlation between perspectives and cause-and-effect chains among them using statistical method based on a real case study in home appliance manufacturing industries.

  16. Can the Universe create itself?

    NASA Astrophysics Data System (ADS)

    Gott, J. Richard, III; Li, Li-Xin

    1998-07-01

    The question of first-cause has troubled philosophers and cosmologists alike. Now that it is apparent that our universe began in a big bang explosion, the question of what happened before the big bang arises. Inflation seems like a very promising answer, but as Borde and Vilenkin have shown, the inflationary state preceding the big bang could not have been infinite in duration-it must have had a beginning also. Where did it come from? Ultimately, the difficult question seems to be how to make something out of nothing. This paper explores the idea that this is the wrong question-that that is not how the Universe got here. Instead, we explore the idea of whether there is anything in the laws of physics that would prevent the Universe from creating itself. Because spacetimes can be curved and multiply connected, general relativity allows for the possibility of closed timelike curves (CTCs). Thus, tracing backwards in time through the original inflationary state we may eventually encounter a region of CTCs-giving no first-cause. This region of CTCs may well be over by now (being bounded toward the future by a Cauchy horizon). We illustrate that such models-with CTCs-are not necessarily inconsistent by demonstrating self-consistent vacuums for Misner space and a multiply connected de Sitter space in which the renormalized energy-momentum tensor does not diverge as one approaches the Cauchy horizon and solves Einstein's equations. Some specific scenarios (out of many possible ones) for this type of model are described. For example, a metastable vacuum inflates producing an infinite number of (big-bang-type) bubble universes. In many of these, either by natural causes or by action of advanced civilizations, a number of bubbles of metastable vacuum are created at late times by high energy events. These bubbles will usually collapse and form black holes, but occasionally one will tunnel to create an expanding metastable vacuum (a baby universe) on the other side of the

  17. Aligning incentives in supply chains.

    PubMed

    Narayanan, V G; Raman, Ananth

    2004-11-01

    Most companies don't worry about the behavior of their supply chain partners. Instead, they expect the supply chain to work efficiently without interference, as if guided by Adam Smith's famed invisible hand. In their study of more than 50 supply networks, V.G. Narayanan and Ananth Raman found that companies often looked out for their own interests and ignored those of their network partners. Consequently, supply chains performed poorly. Those results aren't shocking when you consider that supply chains extend across several functions and many companies, each with its own priorities and goals. Yet all those functions and firms must pull in the same direction for a chain to deliver goods and services to consumers quickly and cost-effectively. According to the authors, a supply chain works well only if the risks, costs, and rewards of doing business are distributed fairly across the network. In fact, misaligned incentives are often the cause of excess inventory, stock-outs, incorrect forecasts, inadequate sales efforts, and even poor customer service. The fates of all supply chain partners are interlinked: If the firms work together to serve consumers, they will all win. However, they can do that only if incentives are aligned. Companies must acknowledge that the problem of incentive misalignment exists and then determine its root cause and align or redesign incentives. They can improve alignment by, for instance, adopting revenue-sharing contracts, using technology to track previously hidden information, or working with intermediaries to build trust among network partners. It's also important to periodically reassess incentives, because even top-performing networks find that changes in technology or business conditions alter the alignment of incentives.

  18. Methodologies in Creating Skin Substitutes

    PubMed Central

    Nicholas, Mathew N; Jeschke, Marc G; Amini-Nik, Saeid

    2016-01-01

    The creation of skin substitutes has significantly decreased morbidity and mortality of skin wounds. Although there are still a number of disadvantages of currently available skin substitutes, there has been a significant decline in research advances over the past several years in improving these skin substitutes. Clinically most skin substitutes used are acellular and do not use growth factors to assist wound healing, key areas of potential in this field of research. This article discusses the five necessary attributes of an ideal skin substitute. It comprehensively discusses the three major basic components of currently available skin substitutes: scaffold materials, growth factors, and cells, comparing and contrasting what has been used so far. It then examines a variety of techniques in how to incorporate these basic components together to act as a guide for further research in the field to create cellular skin substitutes with clinically better results. PMID:27154041

  19. Creating genetic resistance to HIV.

    PubMed

    Burnett, John C; Zaia, John A; Rossi, John J

    2012-10-01

    HIV/AIDS remains a chronic and incurable disease, in spite of the notable successes of combination antiretroviral therapy. Gene therapy offers the prospect of creating genetic resistance to HIV that supplants the need for antiviral drugs. In sight of this goal, a variety of anti-HIV genes have reached clinical testing, including gene-editing enzymes, protein-based inhibitors, and RNA-based therapeutics. Combinations of therapeutic genes against viral and host targets are designed to improve the overall antiviral potency and reduce the likelihood of viral resistance. In cell-based therapies, therapeutic genes are expressed in gene modified T lymphocytes or in hematopoietic stem cells that generate an HIV-resistant immune system. Such strategies must promote the selective proliferation of the transplanted cells and the prolonged expression of therapeutic genes. This review focuses on the current advances and limitations in genetic therapies against HIV, including the status of several recent and ongoing clinical studies.

  20. Creating an effective poster presentation.

    PubMed

    Taggart, H M; Arslanian, C

    2000-01-01

    One way to build knowledge in nursing is to share research findings or clinical program outcomes. The dissemination of these findings is often a difficult final step in a project that has taken months or years to complete. One method of sharing findings in a relaxed and informal setting is a poster presentation. This method is an effective form for presenting findings using an interactive approach. The milieu of a poster presentation enables the presenters to interact and dialogue with colleagues. Guidelines for size and format require that the poster is clear and informative. Application of design helps to create visually appealing posters. This article summarizes elements of designing and conducting a poster presentation.

  1. Philanthropy's new agenda: creating value.

    PubMed

    Porter, M E; Kramer, M R

    1999-01-01

    During the past two decades, the number of charitable foundations in the United States has doubled while the value of their assets has increased more than 1,100%. As new wealth continues to pour into foundations, the authors take a timely look at the field and conclude that radical change is needed. First, they explain why. Compared with direct giving, foundations are strongly favored through tax preferences whose value increases in rising stock markets. As a nation, then, we make a substantial investment in foundation philanthropy that goes well beyond the original gifts of private donors. We should therefore expect foundations to achieve a social impact disproportionate to their spending. If foundations serve merely as passive conduits for giving, then they not only fall far short of their potential but also fail to meet an important societal obligation. Drawing on Porter's work on competition and strategy, the authors then present a framework for thinking systematically about how foundations create value and how the various approaches to value creation can be deployed within the context of an overarching strategy. Although many foundations talk about "strategic" giving, much current practice is at odds with strategy. Among the common problems, foundations scatter their funding too broadly, they overlook the value-creating potential of longer and closer working relationships with grantees, and they pay insufficient attention to the ultimate results of the work they fund. This article lays out a blueprint for change, challenging foundation leaders to spearhead the evolution of philanthropy from private acts of conscience into a professional field.

  2. Creating breakthroughs at 3M.

    PubMed

    von Hippel, E; Thomke, S; Sonnack, M

    1999-01-01

    Most senior managers want their product development teams to create break-throughs--new products that will allow their companies to grow rapidly and maintain high margins. But more often they get incremental improvements to existing products. That's partly because companies must compete in the short term. Searching for breakthroughs is expensive and time consuming; line extensions can help the bottom line immediately. In addition, developers simply don't know how to achieve breakthroughs, and there is usually no system in place to guide them. By the mid-1990s, the lack of such a system was a problem even for an innovative company like 3M. Then a project team in 3M's Medical-Surgical Markets Division became acquainted with a method for developing breakthrough products: the lead user process. The process is based on the fact that many commercially important products are initially thought of and even prototyped by "lead users"--companies, organizations, or individuals that are well ahead of market trends. Their needs are so far beyond those of the average user that lead users create innovations on their own that may later contribute to commercially attractive breakthroughs. The lead user process transforms the job of inventing breakthroughs into a systematic task of identifying lead users and learning from them. The authors explain the process and how the 3M project team successfully navigated through it. In the end, the team proposed three major new product lines and a change in the division's strategy that has led to the development of breakthrough products. And now several more divisions are using the process to break away from incrementalism.

  3. Applied magnetism: A supply-driven materials challenge

    DOE PAGES

    Rios, Orlando; McCall, Scott K.

    2016-05-27

    Permanent magnets are important in many green energy technologies including wind turbine generators and hybrid-electric vehicle motors. For these applications, volume and weight are important factors driving the overall design, and therefore a high energy density, or energy product, is an important figure of merit. This quantity defines the magnetic energy contained in a given volume of material, and so higher energy density magnets enable smaller, lighter applications. Currently, the most powerful magnets suitable for commercial purposes contain rare earth elements (REE), usually neodymium and dysprosium in the neodymium-iron-boride class of magnets. However, for select applications, often requiring high temperatures,more » samarium cobalt is the alloy of choice. These magnets have energy densities several times greater than their nearest non-REE-based competitor, which for some applications is the defining factor in creating a viable device. The global supply of these REE is overwhelmingly produced in China, which in 2015 mined more than ten times as much as the next largest producer (Australia). Such market domination effectively creates a single source of supply, leaving industries which rely on REE consumption susceptible to price shocks and supply disruptions of these critical materials. Furthermore, this supply sensitivity may act as a drag on the adaptation rate of green energy technologies, particularly for large-scale users.« less

  4. Applied magnetism: A supply-driven materials challenge

    SciTech Connect

    Rios, Orlando; McCall, Scott K.

    2016-05-27

    Permanent magnets are important in many green energy technologies including wind turbine generators and hybrid-electric vehicle motors. For these applications, volume and weight are important factors driving the overall design, and therefore a high energy density, or energy product, is an important figure of merit. This quantity defines the magnetic energy contained in a given volume of material, and so higher energy density magnets enable smaller, lighter applications. Currently, the most powerful magnets suitable for commercial purposes contain rare earth elements (REE), usually neodymium and dysprosium in the neodymium-iron-boride class of magnets. However, for select applications, often requiring high temperatures, samarium cobalt is the alloy of choice. These magnets have energy densities several times greater than their nearest non-REE-based competitor, which for some applications is the defining factor in creating a viable device. The global supply of these REE is overwhelmingly produced in China, which in 2015 mined more than ten times as much as the next largest producer (Australia). Such market domination effectively creates a single source of supply, leaving industries which rely on REE consumption susceptible to price shocks and supply disruptions of these critical materials. Furthermore, this supply sensitivity may act as a drag on the adaptation rate of green energy technologies, particularly for large-scale users.

  5. Applied magnetism: A supply-driven materials challenge

    SciTech Connect

    Rios, Orlando; McCall, Scott K.

    2016-05-27

    Permanent magnets are important in many green energy technologies including wind turbine generators and hybrid-electric vehicle motors. For these applications, volume and weight are important factors driving the overall design, and therefore a high energy density, or energy product, is an important figure of merit. This quantity defines the magnetic energy contained in a given volume of material, and so higher energy density magnets enable smaller, lighter applications. Currently, the most powerful magnets suitable for commercial purposes contain rare earth elements (REE), usually neodymium and dysprosium in the neodymium-iron-boride class of magnets. However, for select applications, often requiring high temperatures, samarium cobalt is the alloy of choice. These magnets have energy densities several times greater than their nearest non-REE-based competitor, which for some applications is the defining factor in creating a viable device. The global supply of these REE is overwhelmingly produced in China, which in 2015 mined more than ten times as much as the next largest producer (Australia). Such market domination effectively creates a single source of supply, leaving industries which rely on REE consumption susceptible to price shocks and supply disruptions of these critical materials. Furthermore, this supply sensitivity may act as a drag on the adaptation rate of green energy technologies, particularly for large-scale users.

  6. Create a Pint-Sized Photo Book.

    ERIC Educational Resources Information Center

    Gathright, Pat

    2003-01-01

    Explains a project, which involves creating a book using digital images. Notes that teachers can create books with samples of their work. Provides other suggestions for using this project, such as teaching scanning, creating a photo portfolio as a semester exam project, or creating introduction pieces for yearbook or newspaper staffers. (PM)

  7. Create a Pint-Sized Photo Book.

    ERIC Educational Resources Information Center

    Gathright, Pat

    2003-01-01

    Explains a project, which involves creating a book using digital images. Notes that teachers can create books with samples of their work. Provides other suggestions for using this project, such as teaching scanning, creating a photo portfolio as a semester exam project, or creating introduction pieces for yearbook or newspaper staffers. (PM)

  8. Petroleum supply monthly, October 1993

    SciTech Connect

    Not Available

    1993-10-26

    The Petroleum Supply Monthly (PSM) is one of a family of four publications produced by the Petroleum Supply Division within the Energy Information Administration (EIA) reflecting different levels of data timeliness and completeness. The other publications are the Weekly Petroleum Status Report (WPSR), the Winter Fuels Report, and the Petroleum Supply Annual (PSA). Data presented in the PSM describe the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the United States (50 States and the District of Columbia). The reporting universe includes those petroleum sectors in primary supply. Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States. Data presented in the PSM are divided into two sections: Summary Statistics and Detailed Statistics.

  9. Petroleum supply monthly, September 1991

    SciTech Connect

    Not Available

    1991-09-30

    The Petroleum Supply Monthly (PSM) is one of a family of three publications produced by the Petroleum Supply Division within the Energy Information Administration (EIA) reflecting different levels of data timeliness and completeness. The other two publications are the Weekly Petroleum Status Report (WPSR) and the Petroleum Supply Annual (PSA). Data presented in PSM describe the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administrations for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the United States (50 states and the District of Columbia). The reporting universe includes those petroleum sectors in Primary Supply. Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States. Data presented in the PSM are divided into two sections (1) the Summary Statistics and (2) the Detailed Statistics. 65 tabs.

  10. Petroleum supply monthly, May 1994

    SciTech Connect

    Not Available

    1994-05-27

    The Petroleum Supply Monthly (PSM) is one of a family of four publications produced by the Petroleum Supply Division within the Energy Information Administration (EIA) reflecting different levels of data timeliness and completeness. The other publications are the Weekly Petroleum Status Report (WPSR), the Winter Fuels Report, and the Petroleum supply annual (PSA). Data presented in the PSM describe the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the United States (50 States and the District of columbia). The reporting universe includes those petroleum sectors in primary supply. Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States. Data presented in the PSM are divided into two sections: Summary Statistics and Detailed Statistics.

  11. Petroleum Supply Monthly, August 1990

    SciTech Connect

    Not Available

    1990-10-30

    The Petroleum Supply Monthly (PSM) is one of a family of three publications produced by the Petroleum Supply Division within the Energy Information administration (EIA) reflecting different levels of data timeliness and completeness. The other two publications are the Weekly Petroleum Status Report (WPSR) and the Petroleum Supply Annual (PSA). Data presented in the PSM describe the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) district movements, and inventories by the primary suppliers of petroleum products in the United States (50 States and the District of Columbia). The reporting universe includes those petroleum sectors in Primary Supply. Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States. Data presented in the PSM are divided into two sections (1) the Summary Statistics and (2) the Detailed Statistics.

  12. Petroleum supply monthly, July 1994

    SciTech Connect

    Not Available

    1994-07-26

    The Petroleum Supply Monthly (PSM) is one of a family of four publications produced by the Petroleum Supply Division within the Energy Information Administration (EIA) reflecting different levels of data timeliness and completeness. The other publications are the Weekly Petroleum Status Report (WPSR), the Winter Fuels Report, and the Petroleum Supply Annual (PSA). Data presented in the PSM describe the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the United States (50 States and the District of Columbia). The reporting universe includes those petroleum sectors in primary supply. Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States. Data presented in the PSM are divided into two sections: Summary Statistics and Detailed Statistics.

  13. Petroleum supply monthly, June 1994

    SciTech Connect

    Not Available

    1994-06-28

    The Petroleum Supply Monthly (PSM) is one of a family of four publications produced by the Petroleum Supply Division within the Energy Information Administration (EIA) reflecting different levels of data timeliness and completeness. The other publications are the Weekly Petroleum Status Report (WPSR), the Winter Fuels Report, and the Petroleum Supply Annual (PSA). Data presented in the PSM describe the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the United States (50 States and the District of Columbia). The reporting universe includes those petroleum sectors in primary supply. Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States. Data presented in the PSM are divided into two sections: Summary Statistics and Detailed Statistics.

  14. Petroleum supply monthly, January 1996

    SciTech Connect

    1996-02-15

    The Petroleum Supply Monthly (PSM) is one of a family of four publications produced by the Petroleum Supply Division within the Energy Information Administration (EIA) reflecting different levels of data timeliness and completeness. The other publications are the Weekly Petroleum Status Report (WPSR), the Winter Fuels Report, and the Petroleum Supply Annual (PSA). Data presented in the PSM describe the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the United States (50 States and the District of Columbia). The reporting universe includes those petroleum sectors in primary supply. Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States. Data presented in the PSM are divided into two sections: Summary Statistics and Detailed Statistics.

  15. International Oil Supplies and Demands

    SciTech Connect

    Not Available

    1991-09-01

    The eleventh Energy Modeling Forum (EMF) working group met four times over the 1989--90 period to compare alternative perspectives on international oil supplies and demands through 2010 and to discuss how alternative supply and demand trends influence the world's dependence upon Middle Eastern oil. Proprietors of eleven economic models of the world oil market used their respective models to simulate a dozen scenarios using standardized assumptions. From its inception, the study was not designed to focus on the short-run impacts of disruptions on oil markets. Nor did the working group attempt to provide a forecast or just a single view of the likely future path for oil prices. The model results guided the group's thinking about many important longer-run market relationships and helped to identify differences of opinion about future oil supplies, demands, and dependence.

  16. International Oil Supplies and Demands

    SciTech Connect

    Not Available

    1992-04-01

    The eleventh Energy Modeling Forum (EMF) working group met four times over the 1989--1990 period to compare alternative perspectives on international oil supplies and demands through 2010 and to discuss how alternative supply and demand trends influence the world's dependence upon Middle Eastern oil. Proprietors of eleven economic models of the world oil market used their respective models to simulate a dozen scenarios using standardized assumptions. From its inception, the study was not designed to focus on the short-run impacts of disruptions on oil markets. Nor did the working group attempt to provide a forecast or just a single view of the likely future path for oil prices. The model results guided the group's thinking about many important longer-run market relationships and helped to identify differences of opinion about future oil supplies, demands, and dependence.

  17. A single supply biopotential amplifier.

    PubMed

    Spinelli, E M; Martinez, N H; Mayosky, M A

    2001-04-01

    A biopotential amplifier for single supply operation is presented. It uses a Driven Right Leg Circuit (DRL) to drive the patient's body to a DC common mode voltage, centering biopotential signals with respect to the amplifier's input voltage range. This scheme ensures proper range operation when a single power supply is used. The circuit described is especially suited for low consumption, battery-powered applications, requiring a single battery and avoiding switching voltage inverters to achieve dual supplies. The generic circuit is described and, as an example, a biopotential amplifier with a gain of 60 dB and a DC input range of +/-200 mV was implemented using low power operational amplifiers. A Common Mode Rejection Ratio (CMRR) of 126 dB at 50 Hz was achieved without trimming.

  18. The initial lunar supply base

    NASA Technical Reports Server (NTRS)

    Criswell, D.

    1979-01-01

    The first lunar supply base should have a mass less than 1000 tons, be deployed by 24 persons in 4 months, and be maintained by 10 persons. Output could be expanded 20 times in 5 years to 600,000 tons/yr by a factor of 10 expansion of the area of the solar array on the lunar surface, using low power soil beneficiation, increasing the fleet of mining vehicles, and illuminating the base continuously at night with lunar orbiting mirrors. The space manufacturing facility (SMF) will supply most of the mass (solar cells and orbiting mirrors) necessary for expansion. Several devices and procedures are suggested for development which could further reduce the total mass necessary to transport to the Moon to establish the initial lunar supply base.

  19. Petroleum supply monthly, July 1993

    SciTech Connect

    Not Available

    1993-07-29

    Data presented in the Petroleum Supply Monthly (PSM) describe the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the United States (50 States and the District of Columbia). The reporting universe includes those petroleum sectors in primary supply. Included are: Petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States.

  20. Petroleum supply monthly, August 1994

    SciTech Connect

    Not Available

    1994-08-26

    Data presented in the Petroleum Supply Monthly (PSM) describe the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the United States (50 States and the District of Columbia). The reporting universe includes those petroleum sectors in primary supply. Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States. Data presented in the PSM are divided into two sections: Summary Statistics and Detailed Statistics.

  1. Supply curves of conserved energy

    NASA Astrophysics Data System (ADS)

    Meier, A. K.

    1982-05-01

    Supply curves of conserved energy provide an accounting framework that expresses the potential for energy conservation. The economic worthiness of a conservation measure is expressed in terms of the cost of conserved energy, and a measure is considered economical when the cost of conserved energy is less than the price of the energy it replaces. A supply curve of conserved energy is independent of energy prices; however, the economical reserves of conserved energy will depend on energy prices. Double-counting of energy savings and error propagation are common problems when estimating conservation potentials, but supply curves minimize these difficulties and make their consequences predictable. The sensitivity of the cost of conserved energy is examined, as are variations in the optimal investment strategy in response to changes in inputs. Guidelines are presented for predicting the consequences of such changes.

  2. PFP supply fan motor starters

    SciTech Connect

    Keck, R.D.

    1995-05-31

    The Plutonium Finishing Plant (PFP) is currently stabilizing about 25 kg of Pu sludge; upon completion of this task, PFP will be maintained in a safe standby condition to await decision from the PFP NEPA review. It can take about 10 years to initiate and complete terminal cleanout after this; the facility will then be decommissioned and decontaminated. The 234-5Z ventilation system must continue to operate until terminal cleanout. Part of the ventilation system is the seismic fan shutdown system which shuts down the ventilation supply fans in case of strong earthquake. This document presents criteria for installing solid state, reduced voltage motor starters and isolation contactors for the 8 main ventilation supply fans. The isolation contactors will shutdown the supply fans in event of earthquake.

  3. Leading a supply chain turnaround.

    PubMed

    Slone, Reuben E

    2004-10-01

    Just five years ago, salespeople at Whirlpool were in the habit of referring to their supply chain organization as the "sales disablers." Now the company excels at getting products to the right place at the right time--while managing to keep inventories low. How did that happen? In this first-person account, Reuben Slone, Whirlpool's vice president of Global Supply Chain, describes how he and his colleagues devised the right supply chain strategy, sold it internally, and implemented it. Slone insisted that the right focal point for the strategy was the satisfaction of consumers at the end of the supply chain. Most supply chain initiatives do the opposite: They start with the realities of a company's manufacturing base and proceed from there. Through a series of interviews with trade customers large and small, his team identified 27 different capabilities that drove industry perceptions of Whirlpool's performance. Knowing it was infeasible to aim for world-class performance across all of them, Slone weighed the costs of excelling at each and found the combination of initiatives that would provide overall competitive advantage. A highly disciplined project management office and broad training in project management were key to keeping work on budget and on benefit. Slone set an intense pace--three "releases" of new capabilities every month--that the group maintains to this day. Lest this seem like a technology story, however, Slone insists it is just as much a "talent renaissance." People are proud today to be part of Whirlpool's supply chain organization, and its new generation of talent will give the company a competitive advantage for years to come.

  4. Supply prices to increase slightly.

    PubMed

    Hard, R

    1991-03-05

    Expect hospital supply prices to increase by about 3 percent to 4 percent during 1991, says the new economic forecast from the Joint Purchasing Corp. (JPC), New York City. JPC's report may help reduce the uncertainty for those making supply price forecasts during the current recession. The Economic Forecast and Budget Impact Report presents economic information from industry analysts and publishes the data in a single volume. The JPC forecast can be used as a guide to help determine price changes; however, it's also important to consider changes in consumption, utilization, and quality when using the report, says JPC's president.

  5. Progress 28 supply vehicle approach

    NASA Image and Video Library

    2008-02-07

    ISS016-E-027761 (7 Feb. 2008) --- Backdropped by a colorful Earth, an unpiloted Progress supply vehicle approaches the International Space Station. Progress 28 resupply craft launched at 7:03 a.m. (CST) on Feb. 5, 2008 from the Baikonur Cosmodrome in Kazakhstan to deliver more than 2.5 tons of food, fuel, oxygen and other supplies to the Expedition 16 crewmembers onboard the station. Progress automatically docked to the Pirs Docking Compartment at 8:30 a.m. (CST) on Feb. 7.

  6. Progress 28 supply vehicle approach

    NASA Image and Video Library

    2008-02-07

    ISS016-E-027742 (7 Feb. 2008) --- Backdropped by a blue and white Earth, an unpiloted Progress supply vehicle approaches the International Space Station. Progress 28 resupply craft launched at 7:03 a.m. (CST) on Feb. 5, 2008 from the Baikonur Cosmodrome in Kazakhstan to deliver more than 2.5 tons of food, fuel, oxygen and other supplies to the Expedition 16 crewmembers onboard the station. Progress automatically docked to the Pirs Docking Compartment at 8:30 a.m. (CST) on Feb. 7.

  7. Progress 28 supply vehicle approach

    NASA Image and Video Library

    2008-02-07

    ISS016-E-027798 (7 Feb. 2008) --- Backdropped by a blue and white Earth, an unpiloted Progress supply vehicle (seen as a tiny object just left of center) approaches the International Space Station. Progress 28 resupply craft launched at 7:03 a.m. (CST) on Feb. 5, 2008 from the Baikonur Cosmodrome in Kazakhstan to deliver more than 2.5 tons of food, fuel, oxygen and other supplies to the Expedition 16 crewmembers onboard the station. Progress automatically docked to the Pirs Docking Compartment at 8:30 a.m. (CST) on Feb. 7.

  8. Progress 28 supply vehicle approach

    NASA Image and Video Library

    2008-02-07

    ISS016-E-027815 (7 Feb. 2008) --- Backdropped by a colorful Earth, an unpiloted Progress supply vehicle approaches the International Space Station. Progress 28 resupply craft launched at 7:03 a.m. (CST) on Feb. 5, 2008 from the Baikonur Cosmodrome in Kazakhstan to deliver more than 2.5 tons of food, fuel, oxygen and other supplies to the Expedition 16 crewmembers onboard the station. Progress automatically docked to the Pirs Docking Compartment at 8:30 a.m. (CST) on Feb. 7.

  9. US energy consumption and supply

    NASA Astrophysics Data System (ADS)

    Vanatta, C. M.

    1981-01-01

    Energy consumption and cost in 1978 and 1979 are discussed with emphasis on the effect of imported oil on the economy of the United States. Some of the international aspects of energy supply are described, and actions to meet the probability of a cutoff of oil imports from the Persian Gulf area are suggested. Short and long range strategies for ensuring energy self sufficiency are discussed. A rationale for major, long range dependence on fission and fusion power is given, and the possible advantages of a nearly all electric energy system are mentioned. Projection of energy consumption and supply to the year 2020 based upon economic and demographic models is discussed.

  10. Petroleum supply monthly, January 1994

    SciTech Connect

    Not Available

    1994-01-01

    Data presented describe the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the United States. The reporting universe includes those petroleum sectors in primary supply. Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States.

  11. Creating experimental color harmony map

    NASA Astrophysics Data System (ADS)

    Chamaret, Christel; Urban, Fabrice; Lepinel, Josselin

    2014-02-01

    Starting in the 17th century with Newton, color harmony is a topic that did not reach a consensus on definition, representation or modeling so far. Previous work highlighted specific characteristics for color harmony on com- bination of color doublets or triplets by means of a human rating on a harmony scale. However, there were no investigation involving complex stimuli or pointing out how harmony is spatially located within a picture. The modeling of such concept as well as a reliable ground-truth would be of high value for the community, since the applications are wide and concern several communities: from psychology to computer graphics. We propose a protocol for creating color harmony maps from a controlled experiment. Through an eye-tracking protocol, we focus on the identification of disharmonious colors in pictures. The experiment was composed of a free viewing pass in order to let the observer be familiar with the content before a second pass where we asked "to search for the most disharmonious areas in the picture". Twenty-seven observers participated to the experiments that was composed of a total of 30 different stimuli. The high inter-observer agreement as well as a cross-validation confirm the validity of the proposed ground-truth.

  12. Creating Effective K-12 Outreach

    NASA Astrophysics Data System (ADS)

    Hopkins, J.

    2011-12-01

    Grant opportunities require investigators to provide 'broader impacts' for their scientific research. For most researchers this involves some kind of educational outreach for the K-12 community. I have been able to participate in many different types of grant funded science teacher professional development programs. The most valuable have been outreach where the research seamlessly integrated with my classroom curriculum and was sustainable with my future classes. To accomplish these types of programs, the investigators needed to research the K-12 community and identify several key aspects of the K-12 environment where their expertise would benefit me and my students. There are a lot of different K-12 learning environments, so researchers need to be sure to match up with the right grade level and administrative environment. You might want to consider non-main stream school settings, such as magnet programs, STEM academies, and distance learning. The goal is to try to make your outreach seem natural and productive. This presentation will illustrate how researchers can create an educational outreach project that will be a win-win situation for everyone involved.

  13. Laser Created Relativistic Positron Jets

    SciTech Connect

    Chen, H; Wilks, S C; Meyerhofer, D D; Bonlie, J; Chen, C D; Chen, S N; Courtois, C; Elberson, L; Gregori, G; Kruer, W; Landoas, O; Mithen, J; Murphy, C; Nilson, P; Price, D; Scheider, M; Shepherd, R; Stoeckl, C; Tabak, M; Tommasini, R; Beiersdorder, P

    2009-10-08

    Electron-positron jets with MeV temperature are thought to be present in a wide variety of astrophysical phenomena such as active galaxies, quasars, gamma ray bursts and black holes. They have now been created in the laboratory in a controlled fashion by irradiating a gold target with an intense picosecond duration laser pulse. About 10{sup 11} MeV positrons are emitted from the rear surface of the target in a 15 to 22-degree cone for a duration comparable to the laser pulse. These positron jets are quasi-monoenergetic (E/{delta}E {approx} 5) with peak energies controllable from 3-19 MeV. They have temperatures from 1-4 MeV in the beam frame in both the longitudinal and transverse directions. Positron production has been studied extensively in recent decades at low energies (sub-MeV) in areas related to surface science, positron emission tomography, basic antimatter science such as antihydrogen experiments, Bose-Einstein condensed positronium, and basic plasma physics. However, the experimental tools to produce very high temperature positrons and high-flux positron jets needed to simulate astrophysical positron conditions have so far been absent. The MeV temperature jets of positrons and electrons produced in our experiments offer a first step to evaluate the physics models used to explain some of the most energetic phenomena in the universe.

  14. Can we create gifted people?

    PubMed

    Ericsson, K A; Krampe, R T; Heizmann, S

    1993-01-01

    Only in the light of specific theoretical frameworks for the development of superior performance can we productively ask to what extent that performance is due to controllable external factors and thus could potentially be engineered or 'created'. The popular view of talent acknowledges that instruction and practice are necessary but not sufficient for the attainment of élite performance. With extensive practice individuals are assumed to achieve all possible modification through learning, so that the ultimate level of performance is a function of the components that cannot be modified and are thus presumably innate. However, recent research shows that improvements in performance are possible even after extensive experience in a domain, and that performance at an international level requires over ten years of intense preparation. Furthermore, research has failed to specify and measure talent factors that predict performance. An alternative framework has been proposed on the basis of the amount of deliberate activities aimed at improving performance. The amount of deliberate practice accumulated during many years of preparation is found to be related closely to performance, even at the highest levels. This framework accounts for expert performance in terms of acquired characteristics and identifies new and different constraints on its attainment.

  15. Creating engaging experiences for rehabilitation.

    PubMed

    McClusky, John F

    2008-01-01

    The traditional model of rehabilitation center design based on usability and function falls short of addressing the aspirations of those who use them. To better serve the motivational needs of both patients and therapists, we need to reconsider the gymnasium-inspired designs of current rehabilitation centers. Designers Patricia Moore and David Guynes have drawn inspiration from the everyday to create more engaging rehabilitation experiences with their Easy Street, Independence Square, Rehab 1-2-3, Our Town, and WorkSyms rehabilitation environments. Their designs simulate real-life situations to motivate patients by helping them connect their therapy to the life in which they aspire to return. Utilizing an empathic research process, Moore and Guynes build a deeper understanding of both patients' and therapists' values and apply that understanding to designs that are more directly connected to patients' aspirational goals while still meeting their functional rehabilitation needs. This same research-based design approach is utilized in all of their design work that has included, most recently, the design of the Phoenix Valley Transit Authority's Metro Light Rail Train. The train and stations have won awards for accessibility and will begin public operation in late 2008.

  16. Creating Healthy and Just Bioregions

    PubMed Central

    Pezzoli, Keith; Leiter, Robert A.

    2017-01-01

    Dramatic changes taking place locally, regionally, globally, demand that we rethink strategies to improve public health, especially in disadvantaged communities where the cumulative impacts of toxicant exposure and other environmental and social stressors are most damaging. The emergent field of sustainability science, including a new bioregionalism for the 21st Century, is giving rise to promising place-based (territorially rooted) approaches. Embedded in this bioregional approach is an Integrated Planning Framework that enables people to map and develop plans and strategies that cut across various scales (e.g., from regional to citywide to neighborhood scale) and various topical areas (e.g., urban land use planning, water resource planning, food systems planning and “green infrastructure” planning) with the specific intent of reducing the impacts of toxicants to public health and the natural environment. This paper describes a case of bioregionally inspired Integrated Planning in San Diego, California (USA). The paper highlights food-water-energy linkages and the importance of “rooted” community-university partnerships and knowledge-action collaboratives in creating healthy and just bioregions. PMID:26812849

  17. Creating a urine black hole

    NASA Astrophysics Data System (ADS)

    Hurd, Randy; Pan, Zhao; Meritt, Andrew; Belden, Jesse; Truscott, Tadd

    2015-11-01

    Since the mid-nineteenth century, both enlisted and fashion-conscious owners of khaki trousers have been plagued by undesired speckle patterns resulting from splash-back while urinating. In recent years, industrial designers and hygiene-driven entrepreneurs have sought to limit this splashing by creating urinal inserts, with the effectiveness of their inventions varying drastically. From this large assortment of inserts, designs consisting of macroscopic pillar arrays seem to be the most effective splash suppressers. Interestingly this design partially mimics the geometry of the water capturing moss Syntrichia caninervis, which exhibits a notable ability to suppress splash and quickly absorb water from impacting rain droplets. With this natural splash suppressor in mind, we search for the ideal urine black hole by performing experiments of simulated urine streams (water droplet streams) impacting macroscopic pillar arrays with varying parameters including pillar height and spacing, draining and material properties. We propose improved urinal insert designs based on our experimental data in hopes of reducing potential embarrassment inherent in wearing khakis.

  18. Animal health and price transmission along livestock supply chains.

    PubMed

    Aragrande, M; Canali, M

    2017-04-01

    Animal health diseases can severely affect the food supply chain by causing variations in prices and market demand. Price transmission analysis reveals in what ways price variations are transmitted along the supply chain, and how supply chains of substitute products and different regional markets are also affected. In perfect markets, a price variation would be completely and instantaneously transmitted across the different levels of the supply chain: producers, the processing industry, retailers and consumers. However, empirical studies show that food markets are often imperfect, with anomalies or asymmetries in price transmission and distortions in the distribution of market benefits. This means, for instance, that a price increase at the consumer level may not be transmitted from retailers to processors and producers; yet, on the other hand, price falls may rapidly affect the upstream supply chain. Market concentration and the consequent exertion of market power in key segments of the supply chain can explain price transmission asymmetries and their distributional effects, but other factors may also be involved, such as transaction costs, scale economies, and imperfect information. During the bovine spongiform encephalopathy (BSE) crisis, asymmetric price transmission in the beef supply chain and related meat markets determined distributional effects among sectors. After the spread of the BSE food scare, the fall in demand marginally affected the price paid to retailers, but producers and wholesalers suffered much more, in both price reductions and the time needed to recover to precrisis demand. Price transmission analysis investigates how animal health crises create different economic burdens for various types of stakeholder, and provides useful socioeconomic insights when used with other tools.

  19. 46 CFR 108.467 - Water supply.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 4 2011-10-01 2011-10-01 false Water supply. 108.467 Section 108.467 Shipping COAST... Fire Extinguishing Systems Foam Extinguishing Systems § 108.467 Water supply. The water supply of a foam extinguishing system must not be the water supply of the fire main system on the unit unless...

  20. 46 CFR 108.467 - Water supply.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Water supply. 108.467 Section 108.467 Shipping COAST... Fire Extinguishing Systems Foam Extinguishing Systems § 108.467 Water supply. The water supply of a foam extinguishing system must not be the water supply of the fire main system on the unit unless...

  1. 10 CFR 218.11 - Supply orders.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 3 2011-01-01 2011-01-01 false Supply orders. 218.11 Section 218.11 Energy DEPARTMENT OF ENERGY OIL STANDBY MANDATORY INTERNATIONAL OIL ALLOCATION Supply Orders § 218.11 Supply orders. (a) A...) The DOE shall serve a copy of the supply order on the firm directed to act as stated therein. (c)...

  2. 10 CFR 218.11 - Supply orders.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 3 2013-01-01 2013-01-01 false Supply orders. 218.11 Section 218.11 Energy DEPARTMENT OF ENERGY OIL STANDBY MANDATORY INTERNATIONAL OIL ALLOCATION Supply Orders § 218.11 Supply orders. (a) A...) The DOE shall serve a copy of the supply order on the firm directed to act as stated therein. (c)...

  3. Art Supply Inventors. Children's Art Diary.

    ERIC Educational Resources Information Center

    Szekely, George

    2001-01-01

    Discusses types of art materials that children enjoy using in their artworks. Explores the art materials such as tasty art supplies, such as candy; peeled supplies, such as pencil shavings; sticky art supplies, such as Band-Aids; and fast-food supplies, such as forks and spoons. (CMK)

  4. 46 CFR 108.467 - Water supply.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 4 2012-10-01 2012-10-01 false Water supply. 108.467 Section 108.467 Shipping COAST... Fire Extinguishing Systems Foam Extinguishing Systems § 108.467 Water supply. The water supply of a foam extinguishing system must not be the water supply of the fire main system on the unit unless...

  5. 46 CFR 108.467 - Water supply.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 4 2014-10-01 2014-10-01 false Water supply. 108.467 Section 108.467 Shipping COAST... Fire Extinguishing Systems Foam Extinguishing Systems § 108.467 Water supply. The water supply of a foam extinguishing system must not be the water supply of the fire main system on the unit unless...

  6. 46 CFR 108.467 - Water supply.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 4 2013-10-01 2013-10-01 false Water supply. 108.467 Section 108.467 Shipping COAST... Fire Extinguishing Systems Foam Extinguishing Systems § 108.467 Water supply. The water supply of a foam extinguishing system must not be the water supply of the fire main system on the unit unless...

  7. Identifying Innovative Interventions to Promote Healthy Eating Using Consumption-Oriented Food Supply Chain Analysis

    PubMed Central

    Hawkes, Corinna

    2009-01-01

    The mapping and analysis of supply chains is a technique increasingly used to address problems in the food system. Yet such supply chain management has not yet been applied as a means of encouraging healthier diets. Moreover, most policies recommended to promote healthy eating focus on the consumer end of the chain. This article proposes a consumption-oriented food supply chain analysis to identify the changes needed in the food supply chain to create a healthier food environment, measured in terms of food availability, prices, and marketing. Along with established forms of supply chain analysis, the method is informed by a historical overview of how food supply chains have changed over time. The method posits that the actors and actions in the chain are affected by organizational, financial, technological, and policy incentives and disincentives, which can in turn be levered for change. It presents a preliminary example of the supply of Coca-Cola beverages into school vending machines and identifies further potential applications. These include fruit and vegetable supply chains, local food chains, supply chains for health-promoting versions of food products, and identifying financial incentives in supply chains for healthier eating. PMID:23144674

  8. Environmental nutrient supply alters prevalence and weakens competitive interactions among coinfecting viruses.

    PubMed

    Lacroix, Christelle; Seabloom, Eric W; Borer, Elizabeth T

    2014-10-01

    The rates and ratios of environmental nutrient supplies can determine plant community composition. However, the effect of nutrient supplies on within-host microbial interactions is poorly understood. Resource competition is a promising theory for understanding microbial interactions, because microparasites require nitrogen (N) and phosphorus (P) for synthesis of macromolecules such as nucleic acids and proteins. To better understand the effects of nutrient supplies to hosts on pathogen interactions, we singly inoculated and coinoculated Avena sativa with two virus species, barley yellow dwarf virus-PAV (BYDV-PAV) and cereal yellow dwarf virus-RPV (CYDV-RPV). Host plants were grown across a factorial combination of N and P supply rates that created a gradient of N : P supply ratios, one being replicated at low and high nutrient supply. Nutrient supply affected prevalence and the interaction strength among viruses. P addition lowered CYDV-RPV prevalence. The two viruses had a distinct competitive hierarchy: the coinoculation of BYDV-PAV lowered CYDV-RPV infection rate, but the reverse was not true. This antagonistic interaction occurred at low nutrient supply rates and disappeared at high N supply rate. Given the global scale of human alterations of N and P cycles, these results suggest that elevated nutrient supply will increase risks of virus coinfection with likely effects on virus epidemiology, virulence and evolution. © 2014 The Authors New Phytologist © 2014 New Phytologist Trust.

  9. Identifying Innovative Interventions to Promote Healthy Eating Using Consumption-Oriented Food Supply Chain Analysis.

    PubMed

    Hawkes, Corinna

    2009-07-01

    The mapping and analysis of supply chains is a technique increasingly used to address problems in the food system. Yet such supply chain management has not yet been applied as a means of encouraging healthier diets. Moreover, most policies recommended to promote healthy eating focus on the consumer end of the chain. This article proposes a consumption-oriented food supply chain analysis to identify the changes needed in the food supply chain to create a healthier food environment, measured in terms of food availability, prices, and marketing. Along with established forms of supply chain analysis, the method is informed by a historical overview of how food supply chains have changed over time. The method posits that the actors and actions in the chain are affected by organizational, financial, technological, and policy incentives and disincentives, which can in turn be levered for change. It presents a preliminary example of the supply of Coca-Cola beverages into school vending machines and identifies further potential applications. These include fruit and vegetable supply chains, local food chains, supply chains for health-promoting versions of food products, and identifying financial incentives in supply chains for healthier eating.

  10. Creating a High-Skills Society during Recession: Issues for Policy Makers

    ERIC Educational Resources Information Center

    Panagiotakopoulos, Antonios

    2015-01-01

    The present study looks at the skill formation policies adopted by policy makers in Greece in order to create a high-skills society. It examines empirically the demand side of the skill creation process within 300 small enterprises in order to understand how far supply-side measures have influenced the demand for well-trained staff within small…

  11. Creating a High-Skills Society during Recession: Issues for Policy Makers

    ERIC Educational Resources Information Center

    Panagiotakopoulos, Antonios

    2015-01-01

    The present study looks at the skill formation policies adopted by policy makers in Greece in order to create a high-skills society. It examines empirically the demand side of the skill creation process within 300 small enterprises in order to understand how far supply-side measures have influenced the demand for well-trained staff within small…

  12. School Supplies on a Budget

    ERIC Educational Resources Information Center

    Dyrli, Kurt O.

    2008-01-01

    This article reports on the challenge that parents, teachers, and district administrators face in continuing to provide essential school supplies to their students despite budget cuts. At the Verona Area (Wisconsin) School District, administrators, teachers, and parents have recently faced this common challenge. Increasingly dependent on funding…

  13. Supply contract and portfolio insurance

    Treesearch

    Runsheng Yin; Bob Izlar

    2001-01-01

    The long-term growth of institutional timberland investments depends on the ability of timberland investment management organizations (TIMO) to deal effectively with securitization, leveraging, arbitraging, supply contracting, portfolio insurance, tax efficiency enhancement, and other issues. Financial engineering holds great promise for many of these issues. This...

  14. The Management of Groundwater Supplies.

    ERIC Educational Resources Information Center

    Hall, P. L.

    1978-01-01

    The manager of a groundwater supply system must be involved in many different disciplines if he or she is to manage the system effectively. In areas in which specialized expertise is necessary, it can be obtained from consultants or government agencies. (BB)

  15. The Future Supply of Physicians.

    ERIC Educational Resources Information Center

    Ginzberg, Eli

    1996-01-01

    Reviews policy positions regarding the supply of physicians in the United States, from the 1910 Flexner Report to the present, and evaluates current policy alternatives that address the problem of physician oversupply. Maintains that, if future health care outlays increase as predicted, the demand for physicians should continue to grow. (MDM)

  16. Water Supply Infrastructure System Surety

    SciTech Connect

    EKMAN,MARK E.; ISBELL,DARYL

    2000-01-06

    The executive branch of the United States government has acknowledged and identified threats to the water supply infrastructure of the United States. These threats include contamination of the water supply, aging infrastructure components, and malicious attack. Government recognition of the importance of providing safe, secure, and reliable water supplies has a historical precedence in the water works of the ancient Romans, who recognized the same basic threats to their water supply infrastructure the United States acknowledges today. System surety is the philosophy of ''designing for threats, planning for failure, and managing for success'' in system design and implementation. System surety is an alternative to traditional compliance-based approaches to safety, security, and reliability. Four types of surety are recognized: reactive surety; proactive surety, preventative surety; and fundamental, inherent surety. The five steps of the system surety approach can be used to establish the type of surety needed for the water infrastructure and the methods used to realize a sure water infrastructure. The benefit to the water industry of using the system surety approach to infrastructure design and assessment is a proactive approach to safety, security, and reliability for water transmission, treatment, distribution, and wastewater collection and treatment.

  17. Supply Curves of Conserved Energy

    SciTech Connect

    Meier, Alan Kevin

    1982-05-01

    Supply curves of conserved energy provide an accounting framework that expresses the potential for energy conservation. The economic worthiness of a conservation measure is expressed in terms of the cost of conserved energy, and a measure is considered economical when the cost of conserved energy is less than the price of the energy it replaces. A supply curve of conserved energy is independent of energy prices; however, the economical reserves of conserved energy will depend on energy prices. Double-counting of energy savings and error propagation are common problems when estimating conservation potentials, but supply curves minimize these difficulties and make their consequences predictable. The sensitivity of the cost of conserved energy is examined, as are variations in the optimal investment strategy in response to changes in inputs. Guidelines are presented for predicting the consequences of such changes. The conservation supply curve concept can be applied to peak power, water, pollution, and other markets where consumers demand a service rather than a particular good.

  18. The Management of Groundwater Supplies.

    ERIC Educational Resources Information Center

    Hall, P. L.

    1978-01-01

    The manager of a groundwater supply system must be involved in many different disciplines if he or she is to manage the system effectively. In areas in which specialized expertise is necessary, it can be obtained from consultants or government agencies. (BB)

  19. Proceedings: 1987 fuel supply seminar

    SciTech Connect

    Prast, W.G.

    1988-08-01

    The seventh annual EPRI Fuel Supply Seminar was held in Baltimore, Maryland, from October 6 to 8, 1987. The major emphasis of the meeting was on identifying fuel market risks and planning concerns in order to cope with inherent uncertainties and make informed fuel supply decisions. Sessions dealt with the natural gas markets including the prospects for continued availability of gas as a boiler fuel, the relationship of gas and oil prices and the relevance of different regulatory issues. Other sessions addressed the political dimensions of world oil supply and the role of oil inventories in price dynamics, the interaction of world trade cycles, interest rates and currency fluctuations on utility fuel planning, and the role of strategic fuel planning in various utilities. The changing coal transportation market was the subject of several presentations, concluding with a review of utility experiences in integrating coal transportation and coal supply procurement. Presentations were made by various specialists including EPRI research contractors reporting on the results of ongoing research, speakers drawn from the utility, coal and natural gas industries, and independent consultants. The principal purpose of the seminar continues to be to provide utility fuel planners and fuel procurement managers with data and insights into the structure, operations and uncertainties of the fuel markets, thereby supporting their development of flexible fuel strategies and contributing to integrated utility decision making. Selected papers have been processed separately for inclusion in the energy data base.

  20. Petroleum supply monthly, March 1994

    SciTech Connect

    Not Available

    1994-03-30

    Data presented in the Petroleum Supply Monthly (PSM) describe the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the United States (50 States and the District of Columbia). The reporting universe includes those petroleum sectors in primary supply. Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States. Data presented in the PSM are divided into two sections: Summary Statistics and Detailed Statistics. The tables and figures in the Summary Statistics section of the PSM present a time series of selected petroleum data on a US level. Most time series include preliminary estimates for one month based on the Weekly Petroleum Supply Reporting System; statistics based on the most recent data from the Monthly Petroleum Supply Reporting System (MPSRS); and statistics published in prior issues of the PSM and PSA. The Detailed Statistics tables of the PSM present statistics for the most current month available as well as year-to-date. In most cases, the statistics are presented for several geographic areas -- the United States (50 States and the District of Columbia), five PAD Districts, and 12 Refining Districts. At the US and PAD District level, the total volume and the daily rate of activities are presented. The statistics are developed from monthly survey forms submitted by respondents to the EIA and from data provided from other sources.

  1. Petroleum supply monthly, June 1993

    SciTech Connect

    Not Available

    1993-06-28

    Data presented in the Petroleum Supply Monthly (PSM) describe the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the United States (50 States and the District of Columbia). The reporting universe includes those petroleum sectors in primary supply. Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States. Data presented in the PSM are divided into two sections: Summary Statistics and Detailed Statistics. The tables and figures ih the Summary Statistics section of the PSM present a time series of selected petroleum data on a US level. Most time series include preliminary estimates for one month based on the Weekly Petroleum Supply Reporting System; statistics based on the most recent data from the Monthly Petroleum Supply Reporting System (MPSRS); and statistics published in prior issues of the PSM and PSA. The Detailed Statistics tables of the PSM present statistics for the most current month available as well as year-to-date. In most cases, the statistics are presented for several geographic areas - - the United States (50 States and the District of Columbia), five PAD Districts, and 12 Refining Districts. At the US and PAD District level, the total volume and the daily rate of activities are presented. The statistics are developed from monthly survey forms submitted by respondents to the EIA and from data provided firom other sources.

  2. The Art of Gymnastics: Creating Sequences.

    ERIC Educational Resources Information Center

    Rovegno, Inez

    1988-01-01

    Offering students opportunities for creating movement sequences in gymnastics allows them to understand the essence of gymnastics, have creative experiences, and learn about themselves. The process of creating sequences is described. (MT)

  3. Scientists Create Mosquitoes Resistant to Dengue Virus

    MedlinePlus

    ... fullstory_163019.html Scientists Create Mosquitoes Resistant to Dengue Virus Hope is to eventually make the bugs ... say they have created mosquitoes resistant to the dengue virus, which might eventually help control the spread ...

  4. A manual system for storage and inventory control of laboratory supplies.

    PubMed

    Stewart, C E

    1977-09-01

    The demand for laboratory supplies has increased in relation to the increase in the quantity and complexity of the laboratory workload. This has created many problems for the laboratory administration and a major one has been the lack of a good system for storage and inventory control of supplies. This paper presents a manual system for such control and suggests the use of two different control procedures.

  5. Petroleum Supply Monthly, July 1990

    SciTech Connect

    Not Available

    1990-09-28

    Data presented in the PSM describe the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the United States (50 states and the District of Columbia). The reporting universe includes those petroleum sectors in Primary Supply. Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States.

  6. High voltage DC power supply

    DOEpatents

    Droege, T.F.

    1989-12-19

    A high voltage DC power supply having a first series resistor at the output for limiting current in the event of a short-circuited output, a second series resistor for sensing the magnitude of output current, and a voltage divider circuit for providing a source of feedback voltage for use in voltage regulation is disclosed. The voltage divider circuit is coupled to the second series resistor so as to compensate the feedback voltage for a voltage drop across the first series resistor. The power supply also includes a pulse-width modulated control circuit, having dual clock signals, which is responsive to both the feedback voltage and a command voltage, and also includes voltage and current measuring circuits responsive to the feedback voltage and the voltage developed across the second series resistor respectively. 7 figs.

  7. High voltage DC power supply

    DOEpatents

    Droege, Thomas F.

    1989-01-01

    A high voltage DC power supply having a first series resistor at the output for limiting current in the event of a short-circuited output, a second series resistor for sensing the magnitude of output current, and a voltage divider circuit for providing a source of feedback voltage for use in voltage regulation is disclosed. The voltage divider circuit is coupled to the second series resistor so as to compensate the feedback voltage for a voltage drop across the first series resistor. The power supply also includes a pulse-width modulated control circuit, having dual clock signals, which is responsive to both the feedback voltage and a command voltage, and also includes voltage and current measuring circuits responsive to the feedback voltage and the voltage developed across the second series resistor respectively.

  8. 1992 Conversion Resources Supply Document

    SciTech Connect

    Not Available

    1992-03-01

    In recent years conservation of electric power has become an integral part of utility planning. The 1980 Pacific Northwest Electric Power Planning and Conservation Act (Northwest Power Act) requires that the region consider conservation potential in planning acquisitions of resources to meet load growth. The Bonneville Power Administration (BPA) developed its first estimates of conservation potential in 1982. Since that time BPA has updated its conservation supply analyses as a part of its Resource Program and other planning efforts. Major updates were published in 1985 and in January 1990. This 1992 document presents updated supply curves, which are estimates of the savings potential over time (cumulative savings) at different cost levels of energy conservation measures (ECMs). ECMs are devices, pieces of equipment, or actions that increase the efficiency of electricity use and reduce the amount of electricity used by end-use equipment.

  9. Spatially Characterizing Effective Timber Supply

    NASA Technical Reports Server (NTRS)

    Berry, J. K.; Sailor, J.

    1982-01-01

    The structure of a computer-oriented cartographic model for assessing roundwood supply for generation of base load electricity is discussed. The model provides an analytical procedure for coupling spatial information of harvesting economics and owner willingness to sell stumpages. Supply is characterized in terms of standing timber; of accessibility considering various harvesting and hauling factors; and of availability as affected by ownership and residential patterns. Factors governing accessibility to timber include effective harvesting distance to haulic roads as modified by barriers and slopes. Haul distance is expressed in units that take into account the relative ease of travel along various road types to a central processing facility. Areas of accessible timber are grouped into spatial units, termed 'timbersheds', of common access to particular haul road segments that belong to unique 'transport zones'. Timber availability considerations include size of ownership parcels, housing density and excluded areas. The analysis techniques are demonstrated for a cartographic data base in western Massachusetts.

  10. 1992 Conversion Resources Supply Document

    SciTech Connect

    Not Available

    1992-03-01

    In recent years conservation of electric power has become an integral part of utility planning. The 1980 Pacific Northwest Electric Power Planning and Conservation Act (Northwest Power Act) requires that the region consider conservation potential in planning acquisitions of resources to meet load growth. The Bonneville Power Administration (BPA) developed its first estimates of conservation potential in 1982. Since that time BPA has updated its conservation supply analyses as a part of its Resource Program and other planning efforts. Major updates were published in 1985 and in January 1990. This 1992 document presents updated supply curves, which are estimates of the savings potential over time (cumulative savings) at different cost levels of energy conservation measures (ECMs). ECMs are devices, pieces of equipment, or actions that increase the efficiency of electricity use and reduce the amount of electricity used by end-use equipment.

  11. Petroluem Supply Monthly, May 1993

    SciTech Connect

    Not Available

    1993-06-04

    Data presented in the PSM describe the supply and disposition of petroleum products in the United States and major US geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the United States (50 States and the District of Columbia). The reporting universe includes those petroleum sectors in primary supply. Included are: petroleum refiners, motor gasoline blenders, operators of natural gas processing plants and fractionators, inter-PAD transporters, importers, and major inventory holders of petroleum products and crude oil. When aggregated, the data reported by these sectors approximately represent the consumption of petroleum products in the United States. Data presented in the PSM are divided into two sections: Summary Statistics and Detailed Statistics.

  12. Proceedings: fuel-supply seminars

    SciTech Connect

    Prast, W.G.

    1983-03-01

    The objectives of the seminars were to provide an up-to-date assessment of critical issues affecting fuel-supply and utility-fuel planning. The chief topics were coal, oil and gas, uranium, and utility coal conversion. Presentations were made by EPRI research contractors on the results of ongoing research within the Energy Resources Program and by speakers from the utility and coal industries, government, academia, and the consulting and legal professions. A supplementary paper compiling recent oil and gas supply-and-demand forecast is included in these proceedings. The message emerging from the seminars, and illustrated in numerous ways, is of continuing uncertainty in fuel markets and the necessity for utilities to pursue flexible fuel strategies. A separate abstract was prepared for each of the 19 presentations.

  13. Supply Current Diagnosis in VLSI

    NASA Technical Reports Server (NTRS)

    Frenzel, J. F.; Marinos, P. N.

    1990-01-01

    This paper presents a technique based upon the power supply current signature (cd) which allows for the testing of mixed-signal systems, in situ. Through experiments with a microprocessor, the cd is shown to contain important information concerning the operational status of the system which may be easily extracted using approaches based on statistical signal detection theory. The fault-detection performance of these techniques is compared to that achieved through auto-regressive modeling of the cd.

  14. Replenishable food supply on Mars

    NASA Astrophysics Data System (ADS)

    1990-11-01

    The design team's present objective is to design a facility which will provide an environment to grow plants on the surface of Mars for a continuous supply of food for a ten-man crew. The main focus of the project is the design of a greenhouse. Concentration of the current design effort is on the outer structure, internal layout, and construction methods. The project was conducted by undergraduate students at Prairie View A&M University during Fall 1989 and Spring 1990.

  15. Replenishable food supply on Mars

    NASA Technical Reports Server (NTRS)

    1990-01-01

    The design team's present objective is to design a facility which will provide an environment to grow plants on the surface of Mars for a continuous supply of food for a ten-man crew. The main focus of the project is the design of a greenhouse. Concentration of the current design effort is on the outer structure, internal layout, and construction methods. The project was conducted by undergraduate students at Prairie View A&M University during Fall 1989 and Spring 1990.

  16. Dietary mineral supplies in Africa

    PubMed Central

    Joy, Edward J M; Ander, E Louise; Young, Scott D; Black, Colin R; Watts, Michael J; Chilimba, Allan D C; Chilima, Benson; Siyame, Edwin W P; Kalimbira, Alexander A; Hurst, Rachel; Fairweather-Tait, Susan J; Stein, Alexander J; Gibson, Rosalind S; White, Philip J; Broadley, Martin R

    2014-01-01

    Dietary micronutrient deficiencies (MNDs) are widespread, yet their prevalence can be difficult to assess. Here, we estimate MND risks due to inadequate intakes for seven minerals in Africa using food supply and composition data, and consider the potential of food-based and agricultural interventions. Food Balance Sheets (FBSs) for 46 countries were integrated with food composition data to estimate per capita supply of calcium (Ca), copper (Cu), iron (Fe), iodine (I), magnesium (Mg), selenium (Se) and zinc (Zn), and also phytate. Deficiency risks were quantified using an estimated average requirement (EAR) ‘cut-point’ approach. Deficiency risks are highest for Ca (54% of the population), followed by Zn (40%), Se (28%) and I (19%, after accounting for iodized salt consumption). The risk of Cu (1%) and Mg (<1%) deficiency are low. Deficiency risks are generally lower in the north and west of Africa. Multiple MND risks are high in many countries. The population-weighted mean phytate supply is 2770 mg capita−1 day−1. Deficiency risks for Fe are lower than expected (5%). However, ‘cut-point’ approaches for Fe are sensitive to assumptions regarding requirements; e.g. estimates of Fe deficiency risks are 43% under very low bioavailability scenarios consistent with high-phytate, low-animal protein diets. Fertilization and breeding strategies could greatly reduce certain MNDs. For example, meeting harvestplus breeding targets for Zn would reduce dietary Zn deficiency risk by 90% based on supply data. Dietary diversification or direct fortification is likely to be needed to address Ca deficiency risks. PMID:24524331

  17. Analysis of rubber supply in Sri Lanka

    SciTech Connect

    Hartley, M.J.; Nerlove, M.; Peters, R.K. Jr.

    1987-11-01

    An analysis of the supply response for perennial crops is undertaken for rubber in Sir Lanka, focusing on the uprooting-replanting decision and disaggregating the typical reduced-form supply response equation into several structural relationships. This approach is compared and contrasted with Dowling's analysis of supply response for rubber in Thailand, which is based upon a sophisticated reduced-form supply function developed by Wickens and Greenfield for Brazilian coffee. Because the uprooting-replanting decision is central to understanding rubber supply response in Sri Lanka and for other perennial crops where replanting activities dominate new planting, the standard approaches do not adequately capture supply response.

  18. The future of oil supply.

    PubMed

    Miller, Richard G; Sorrell, Steven R

    2014-01-13

    Abundant supplies of oil form the foundation of modern industrial economies, but the capacity to maintain and grow global supply is attracting increasing concern. Some commentators forecast a peak in the near future and a subsequent terminal decline in global oil production, while others highlight the recent growth in 'tight oil' production and the scope for developing unconventional resources. There are disagreements over the size, cost and recoverability of different resources, the technical and economic potential of different technologies, the contribution of different factors to market trends and the economic implications of reduced supply. Few debates are more important, more contentious, more wide-ranging or more confused. This paper summarizes the main concepts, terms, issues and evidence that are necessary to understand the 'peak oil' debate. These include: the origin, nature and classification of oil resources; the trends in oil production and discoveries; the typical production profiles of oil fields, basins and producing regions; the mechanisms underlying those profiles; the extent of depletion of conventional oil; the risk of an approaching peak in global production; and the potential of various mitigation options. The aim is to introduce the subject to non-specialist readers and provide a basis for the subsequent papers in this Theme Issue.

  19. Radon in ground water supplies

    SciTech Connect

    Dixon, K.L.; Lee, R.G.

    1989-06-01

    In September 1986, the System Water Quality Department of the American Water Works Service Co. began conducting a radon survey that was designed to determine the levels of radon in American ground water supplies, and to assess the radon removal efficiency of existing treatment processes such as filtration through granular activated carbon (GAC) and various forms of aeration. The survey found that companies in the northeastern part of the country experienced the highest levels of radon in ground water supplies. The highest concentrations were in individual wells in New Hampshire, Maryland, Connecticut, Rhode Island, New Jersey, Pennsylvania and California. The analytical results from the occurrence phase of the survey seemed to correlate well with the known geology of the aquifer materials from which samples of ground water were drawn. The highest levels were associated with formations of uranium-bearing granitic rocks. GAC can effectively reduce radon concentrations in drinking water supplies to very low levels. However, the amount of contact time within the carbon bed required to do so would be prohibitive to many water utilities from an operational and economic standpoint. Further, disposal of the spent GAC as a low-level radioactive waste may be required. Aeration is very effective in the removal of radon from drinking water. Packed tower aerators achieved > 95% reduction in radon concentrations and conventional cascading tray aerators achieved > 75% reduction in radon concentrations. 7 refs., 6 tabs.

  20. The future of oil supply

    PubMed Central

    Miller, Richard G.; Sorrell, Steven R.

    2014-01-01

    Abundant supplies of oil form the foundation of modern industrial economies, but the capacity to maintain and grow global supply is attracting increasing concern. Some commentators forecast a peak in the near future and a subsequent terminal decline in global oil production, while others highlight the recent growth in ‘tight oil’ production and the scope for developing unconventional resources. There are disagreements over the size, cost and recoverability of different resources, the technical and economic potential of different technologies, the contribution of different factors to market trends and the economic implications of reduced supply. Few debates are more important, more contentious, more wide-ranging or more confused. This paper summarizes the main concepts, terms, issues and evidence that are necessary to understand the ‘peak oil’ debate. These include: the origin, nature and classification of oil resources; the trends in oil production and discoveries; the typical production profiles of oil fields, basins and producing regions; the mechanisms underlying those profiles; the extent of depletion of conventional oil; the risk of an approaching peak in global production; and the potential of various mitigation options. The aim is to introduce the subject to non-specialist readers and provide a basis for the subsequent papers in this Theme Issue. PMID:24298085

  1. Glucose supply and insulin demand dynamics of antidiabetic agents.

    PubMed

    Monte, Scott V; Schentag, Jerome J; Adelman, Martin H; Paladino, Joseph A

    2010-03-01

    For microvascular outcomes, there is compelling historical and contemporary evidence for intensive blood glucose reduction in patients with either type 1 diabetes mellitus (T1DM) or type 2 diabetes mellitus (T2DM). There is also strong evidence to support macrovascular benefit with intensive blood glucose reduction in T1DM. Similar evidence remains elusive for T2DM. Because cardiovascular outcome trials utilizing conventional algorithms to attain intensive blood glucose reduction have not demonstrated superiority to less aggressive blood glucose reduction (Action to Control Cardiovascular Risk in Diabetes; Action in Diabetes and Vascular Disease: Preterax and Diamicron Modified Release Controlled Evaluation; and Veterans Affairs Diabetes Trial), it should be considered that the means by which the blood glucose is reduced may be as important as the actual blood glucose. By identifying quantitative differences between antidiabetic agents on carbohydrate exposure (CE), hepatic glucose uptake (HGU), hepatic gluconeogenesis (GNG), insulin resistance (IR), peripheral glucose uptake (PGU), and peripheral insulin exposure (PIE), we created a pharmacokinetic/pharmacodynamic model to characterize the effect of the agents on the glucose supply and insulin demand dynamic. Glucose supply was defined as the cumulative percentage decrease in CE, increase in HGU, decrease in GNG, and decrease in IR, while insulin demand was defined as the cumulative percentage increase in PIE and PGU. With the glucose supply and insulin demand effects of each antidiabetic agent summated, the glucose supply (numerator) was divided by the insulin demand (denominator) to create a value representative of the glucose supply and insulin demand dynamic (SD ratio). Alpha-glucosidase inhibitors (1.25), metformin (2.20), and thiazolidinediones (TZDs; 1.25-1.32) demonstrate a greater effect on glucose supply (SD ratio >1), while secretagogues (0.69-0.81), basal insulins (0.77-0.79), and bolus insulins (0

  2. Geolocation Support for Water Supply and Sewerage Projects in Azerbaijan

    NASA Astrophysics Data System (ADS)

    Qocamanov, M. H.; Gurbanov, Ch. Z.

    2016-10-01

    Drinking water supply and sewerage system designing and reconstruction projects are being extensively conducted in Azerbaijan Republic. During implementation of such projects, collecting large amount of information about the area and detailed investigations are crucial. Joint use of the aerospace monitoring and GIS play an essential role for the studies of the impact of environmental factors, development of the analytical information systems and others, while achieving the reliable performance of the existing and designed major water supply pipelines, as well as construction and exploitation of the technical installations. With our participation the GIS has been created in "Azersu" OJSC that includes systematic database of the drinking water supply and sewerage system, and rain water networks to carry out necessary geo information analysis. GIScreated based on "Microstation" platform and aerospace data. Should be mentioned that, in the country, specifically in large cities (i.e. Baku, Ganja, Sumqait, etc.,) drinking water supply pipelines cross regions with different physico-geographical conditions, geo-morphological compositions and seismotectonics.Mains water supply lines in many accidents occur during the operation, it also creates problems with drinking water consumers. In some cases the damage is caused by large-scale accidents. Long-term experience gives reason to say that the elimination of the consequences of accidents is a major cost. Therefore, to avoid such events and to prevent their exploitation and geodetic monitoring system to improve the rules on key issues. Therefore, constant control of the plan-height positioning, geodetic measurements for the detailed examination of the dynamics, repetition of the geodetic measurements for certain time intervals, or in other words regular monitoring is very important. During geodetic monitoring using the GIS has special significance. Given that, collecting geodetic monitoring measurements of the main pipelines

  3. Potential effects of landscape change on water supplies in the presence of reservoir storage

    NASA Astrophysics Data System (ADS)

    Guswa, Andrew J.; Hamel, Perrine; Dennedy-Frank, P. James

    2017-04-01

    This work presents a set of methods to evaluate the potential effects of landscape changes on water supplies. Potential impacts are a function of the seasonality of precipitation, losses of water to evapotranspiration and deep recharge, the flow-regulating ability of watersheds, and the availability of reservoir storage. For a given reservoir capacity, simple reservoir simulations with daily precipitation and streamflow enable the determination of the maximum steady supply of water for both the existing watershed and a hypothetical counter-factual that has neither flow-regulating benefits nor any losses. These two supply values, representing land use end-members, create an envelope that defines the water-supply service and bounds the effect of landscape change on water supply. These bounds can be used to discriminate between water supplies that may be vulnerable to landscape change and those that are unlikely to be affected. Two indices of the water-supply service exhibit substantial variability across 593 watersheds in the continental United States. Rcross, the reservoir capacity at which landscape change is unlikely to have any detrimental effect on water supply has an interquartile range of 0.14-4% of mean-annual-streamflow. Steep, forested watersheds with seasonal climates tend to have greater service values, and the indices of water-supply service are positively correlated with runoff ratios during the months with lowest flows.

  4. A Framework of Multi Objectives Negotiation for Dynamic Supply Chain Model

    NASA Astrophysics Data System (ADS)

    Chai, Jia Yee; Sakaguchi, Tatsuhiko; Shirase, Keiichi

    Trends of globalization and advances in Information Technology (IT) have created opportunity in collaborative manufacturing across national borders. A dynamic supply chain utilizes these advances to enable more flexibility in business cooperation. This research proposes a concurrent decision making framework for a three echelons dynamic supply chain model. The dynamic supply chain is formed by autonomous negotiation among agents based on multi agents approach. Instead of generating negotiation aspects (such as amount, price and due date) arbitrary, this framework proposes to utilize the information available at operational level of an organization in order to generate realistic negotiation aspect. The effectiveness of the proposed model is demonstrated by various case studies.

  5. [Improvement of the supply norms for ships carrying combat missions in peace-time].

    PubMed

    Khankevich, Iu R; Dobrovol'skiĭ, A V

    2011-02-01

    The authors developed the projects of norms of supplying of ships of Northern Fleet by medical reinforcement groups. Norms are added by the medicals which are in the log-book of pharmaceuticals and necessary for the sudden problems. The third norm is added by the traumatologic set. Modern diagnostic equipment is also added to the norms. The authors came to conclusion that the forehanded planning of requirement of medical supply for medical reinforcement groups allows to create an adequate norms of supplying of medical reinforcement groups in the Northern Fleet.

  6. Coordinated supply chain dynamic production planning model

    NASA Astrophysics Data System (ADS)

    Chandra, Charu; Grabis, Janis

    2001-10-01

    Coordination of different and often contradicting interests of individual supply chain members is one of the important issues in supply chain management because the individual members can not succeed without success of the supply chain and vice versa. This paper investigates a supply chain dynamic production planning problem with emphasis on coordination. A planning problem is formally described using a supply chain kernel, which defines supply chain configuration, management policies, available resources and objectives both at supply chain or macro and supply chain member or micro levels. The coordinated model is solved in order to balance decisions made at the macro and micro levels and members' profitability is used as the coordination criterion. The coordinated model is used to determine inventory levels and production capacity across the supply chain. Application of the coordinated model distributes costs burden uniformly among supply chain members and preserves overall efficiency of the supply chain. Influence of the demand series uncertainty is investigated. The production planning model is a part of the integrated supply chain decision modeling system, which is shared among the supply chain members across the Internet.

  7. Architecture Study for a Fuel Depot Supplied from Lunar Resources

    NASA Technical Reports Server (NTRS)

    Perrin, Thomas M.

    2016-01-01

    Heretofore, discussions of space fuel depots assumed the depots would be supplied from Earth. However, the confirmation of deposits of water ice at the lunar poles in 2009 suggests the possibility of supplying a space depot with liquid hydrogen/liquid oxygen produced from lunar ice. This architecture study sought to determine the optimum architecture for a fuel depot supplied from lunar resources. Four factors - the location of propellant processing (on the Moon or on the depot), the location of the depot (on the Moon, or at L1, GEO, or LEO), the location of propellant transfer (L1, GEO, or LEO), and the method of propellant transfer (bulk fuel or canister exchange) were combined to identify 18 potential architectures. Two design reference missions (DRMs) - a satellite servicing mission and a cargo mission to Mars - were used to create demand for propellants, while a third DRM - a propellant delivery mission - was used to examine supply issues. The architectures were depicted graphically in a network diagram with individual segments representing the movement of propellant from the Moon to the depot, and from the depot to the customer.

  8. Architecture Study for a Fuel Depot Supplied from Lunar Resources

    NASA Technical Reports Server (NTRS)

    Perrin, Thomas M.

    2016-01-01

    Heretofore, discussions of space fuel depots assumed the depots would be supplied from Earth. However, the confirmation of deposits of water ice at the lunar poles in 2009 suggests the possibility of supplying a space depot with liquid hydrogen/liquid oxygen produced from lunar ice. This architecture study sought to determine the optimum architecture for a fuel depot supplied from lunar resources. Four factors - the location of propellant processing (on the Moon or on the depot), the location of the depot (on the Moon or in cislunar space), and if in cislunar space, where (LEO, GEO, or Earth-Moon L1), and the method of propellant transfer (bulk fuel or canister exchange) were combined to identify 18 potential architectures. Two design reference missions (DRMs) - a satellite servicing mission and a cargo mission to Mars - were used to create demand for propellants, while a third DRM - a propellant delivery mission - was used to examine supply issues. The architectures were depicted graphically in a network diagram with individual segments representing the movement of propellant from the Moon to the depot, and from the depot to the customer

  9. Adapting military field water supplies to the asymmetric battlefield.

    PubMed

    Lundquist, Arthur H; White, George H; Bonilla, Alejandro; Richards, Todd E; Richards, Stephen C

    2011-01-01

    Army transformation to a brigade-centric force has created a distributed battlefield, challenging the surveillance and logistical supply of field water. The daily requirement of up to 15 gal of potable water per person per day from bulk water supplies has been achievable for many years using currently fielded ROWPUs. However, the need to reduce the transport of water and move towards a sustainable force has created a gap in materiel capable of producing safe water at the individual and unit level. While materiel development is slow, the PM community, tasked with doctrine development and battlefield oversight of field water, is beginning to address the requirements of field water on the changed battlefield. In addition to materiel gaps, the transformed battlefield has created a lack of trained personnel for water production and oversight. Without trained operators and PM oversight, to what level of health risk are consumers of this water exposing themselves? Currently PM is unable to answer this question but is working diligently with the RDT&E community to develop materiel solutions, and with the medical community to provide interim guidance to reduce the potential health risks to using such equipment.

  10. 32 CFR 37.1365 - Supplies.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... TECHNOLOGY INVESTMENT AGREEMENTS Definitions of Terms Used in This Part § 37.1365 Supplies. Tangible property other than real property and equipment. Supplies have a useful life of less than one year or an...

  11. 32 CFR 37.1365 - Supplies.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... TECHNOLOGY INVESTMENT AGREEMENTS Definitions of Terms Used in This Part § 37.1365 Supplies. Tangible property other than real property and equipment. Supplies have a useful life of less than one year or an...

  12. 32 CFR 37.1365 - Supplies.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... TECHNOLOGY INVESTMENT AGREEMENTS Definitions of Terms Used in This Part § 37.1365 Supplies. Tangible property other than real property and equipment. Supplies have a useful life of less than one year or an...

  13. 38 CFR 21.6210 - Supplies.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... pursue training, obtain and maintain employment and achieve the goals of his or her program. (Authority: 38 U.S.C. 1524(b)(2)) (b) Definition. The term supplies includes books, tools and other supplies and...

  14. Decontamination Supplies Under the Worker Protection Standard

    EPA Pesticide Factsheets

    Employers at agricultural establishments must make sure that decontamination supplies for washing off pesticides and pesticide residues are available to workers and handlers. Learn about specific requirements for the type and location of these supplies.

  15. Climate Leadership Award for Supply Chain Leadership

    EPA Pesticide Factsheets

    Apply to the Climate Leadership Award for Supply Chain Leadership, which publicly recognizes organizations that are are at the leading edge of managing greenhouse gas emissions in their organizational supply chains.

  16. 7 CFR 3015.171 - Unused supplies.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... unused supplies exceeding $1,000 in total aggregate market value are left over upon termination or... by an amount computed by multiplying the Federal share of the supplies times the current market value...

  17. 7 CFR 3015.171 - Unused supplies.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... unused supplies exceeding $1,000 in total aggregate market value are left over upon termination or... by an amount computed by multiplying the Federal share of the supplies times the current market value...

  18. Predictors of Variation in Neurosurgical Supply Costs and Outcomes Across 4904 Surgeries at a Single Institution.

    PubMed

    Zygourakis, Corinna C; Valencia, Victoria; Boscardin, Christy; Nayak, Rahul U; Moriates, Christopher; Gonzales, Ralph; Theodosopoulos, Philip; Lawton, Michael T

    2016-12-01

    There is high variability in neurosurgical costs, and surgical supplies constitute a significant portion of cost. Anecdotally, surgeons use different supplies for various reasons, but there is little understanding of how supply choices affect outcomes. Our goal is to evaluate the effect of patient, procedural, and provider factors on supply cost and to determine if supply cost is associated with patient outcomes. We obtained patient information (age, gender, payor, case mix index [CMI], body mass index, admission source), procedural data (procedure type, length, date), provider information (name, case volume), and total surgical supply cost for all inpatient neurosurgical procedures from 2013 to 2014 at our institution (n = 4904). We created mixed-effect models to examine the effect of each factor on surgical supply cost, 30-day readmission, and 30-day mortality. There was significant variation in surgical supply cost between and within procedure types. Older age, female gender, higher CMI, routine/elective admission, longer procedure, and larger surgeon volume were associated with higher surgical supply costs (P < 0.05). Routine/elective admission and higher surgeon volume were associated with lower readmission rates (odds ratio, 0.707, 0.998; P < 0.01). Only patient factors of older age, male gender, private insurance, higher CMI, and emergency admission were associated with higher mortality (odds ratio, 1.029, 1.700, 1.692, 1.080, 2.809). There was no association between surgical supply cost and readmission or mortality (P = 0.307, 0.548). A combination of patient, procedural, and provider factors underlie the significant variation in neurosurgical supply costs at our institution. Surgical supply costs are not correlated with 30-day readmission or mortality. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Production and Supply Optimization in PT. Goodyear Indonesia Tbk

    NASA Astrophysics Data System (ADS)

    Edi Nugroho Soebandrija, Khristian; Reynaldo, Stephanus

    2013-06-01

    The Production and Supply Optimization in PT. Goodyear Indonesia Tbk and its study in this paper provide the purposes to create a model of the Master Production Schedule (MPS). The mentioned MPS complies with company policy, production capacity and supply received. From view point of Industrial Engineering, there are needs for forecasting method effectiveness toward the company production capacity. Furthermore, from view point of Information Systems, there are needs to provide the MPS as compare to prior systems that was done manually resulting in the frequent error at the time of making MPS deductible. Several Methods are used and considered, such as: The method of time series, Mean Square Error (MSE), Mean Absolute Percentage Error (MAPE), the calculation of production capacity, MPS, and designing information systems. By having the combination of views from Industrial Engineering and Information Systems perspective the improvement can be conducted from both theoretical development and its managerial implications.

  20. Logistics: Supply Based or Distribution Based?

    DTIC Science & Technology

    2007-04-01

    supply chain management, the need to adapt systems as conditions and capabilities change may not be clear or the root causes of problems may not be...logistics-system and supply - chain design and management positions. They need to become adept at integrating the full range of options available to...distribution-based and supply-based designs, the Army, in conjunction with its joint supply - chain partners, should seek optimal, balanced logistics system designs that it can adapt quickly to changing conditions.

  1. 7 CFR 1000.6 - Supply plant.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 9 2013-01-01 2013-01-01 false Supply plant. 1000.6 Section 1000.6 Agriculture... Definitions § 1000.6 Supply plant. Supply plant means a plant approved by a duly constituted regulatory agency... diverts fluid milk products to other plants or manufactures dairy products on its premises....

  2. 7 CFR 1000.6 - Supply plant.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 9 2014-01-01 2013-01-01 true Supply plant. 1000.6 Section 1000.6 Agriculture... Definitions § 1000.6 Supply plant. Supply plant means a plant approved by a duly constituted regulatory agency... diverts fluid milk products to other plants or manufactures dairy products on its premises....

  3. 7 CFR 1000.6 - Supply plant.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 9 2012-01-01 2012-01-01 false Supply plant. 1000.6 Section 1000.6 Agriculture... Definitions § 1000.6 Supply plant. Supply plant means a plant approved by a duly constituted regulatory agency... diverts fluid milk products to other plants or manufactures dairy products on its premises....

  4. 45 CFR 74.35 - Supplies.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 45 Public Welfare 1 2011-10-01 2011-10-01 false Supplies. 74.35 Section 74.35 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION UNIFORM ADMINISTRATIVE REQUIREMENTS FOR AWARDS... COMMERCIAL ORGANIZATIONS Post-Award Requirements Property Standards § 74.35 Supplies. (a) Title to supplies...

  5. Visualisation for System Learning in Supply Chains

    ERIC Educational Resources Information Center

    Lindskog, Magnus; Abrahamsson, Mats; Aronsson, Hakan

    2007-01-01

    Contemporary supply chains are vastly complex, and decisions made by actors have system-wide consequences that these might not be able to foresee. There are gaps between "best practice"-founded theory and actual practice in supply chains. To remedy this, we argue, the supply chain actors need to enhance systems knowledge. There is a need to…

  6. Learning to Integrate: Supply Chains Reconceptualised

    ERIC Educational Resources Information Center

    Sense, Andrew J.; Clements, Michael D. J.

    2007-01-01

    This paper introduces and explains a conception of supply chains from a situated learning perspective. This non-conventional supply chain perspective invites the reader to consider supply chain scenarios as "situated learning opportunities involving multiple communities of practice" interacting and participating together. It is argued that by…

  7. 9 CFR 354.224 - Water supply.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ....224 Water supply. The water supply shall be ample, clean, and potable with adequate facilities for its distribution in the plant and its protection against contamination and pollution. (a) Hot water at a... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Water supply. 354.224 Section...

  8. 9 CFR 354.224 - Water supply.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ....224 Water supply. The water supply shall be ample, clean, and potable with adequate facilities for its distribution in the plant and its protection against contamination and pollution. (a) Hot water at a... 9 Animals and Animal Products 2 2011-01-01 2011-01-01 false Water supply. 354.224 Section...

  9. 20 CFR 654.405 - Water supply.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 20 Employees' Benefits 3 2011-04-01 2011-04-01 false Water supply. 654.405 Section 654.405... THE EMPLOYMENT SERVICE SYSTEM Housing for Agricultural Workers Housing Standards § 654.405 Water supply. (a) An adequate and convenient supply of water that meets the standards of the State...

  10. 24 CFR 3285.603 - Water supply.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 24 Housing and Urban Development 5 2011-04-01 2011-04-01 false Water supply. 3285.603 Section 3285... § 3285.603 Water supply. (a) Crossover. Multi-section homes with plumbing in both sections require water... pressure and reduction. When the local water supply pressure exceeds 80 psi to the manufactured home,...

  11. 24 CFR 3285.603 - Water supply.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 24 Housing and Urban Development 5 2010-04-01 2010-04-01 false Water supply. 3285.603 Section 3285... § 3285.603 Water supply. (a) Crossover. Multi-section homes with plumbing in both sections require water... pressure and reduction. When the local water supply pressure exceeds 80 psi to the manufactured home,...

  12. 20 CFR 654.405 - Water supply.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Water supply. 654.405 Section 654.405... THE EMPLOYMENT SERVICE SYSTEM Housing for Agricultural Workers Housing Standards § 654.405 Water supply. (a) An adequate and convenient supply of water that meets the standards of the State...

  13. A Professional Supply and Demand Analysis

    ERIC Educational Resources Information Center

    McLaughlin, Gerald W.

    1975-01-01

    A model procedure for supply-and-demand forecasting is presented that can be adapted to many disciplines and can aid in avoiding an under- or over-supply of professionals. The model is illustrated with an examination of the supply and demand of veterinarians in the Southern Regional Education Board area. (Editor/JT)

  14. 21 CFR 1403.33 - Supplies.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 9 2014-04-01 2014-04-01 false Supplies. 1403.33 Section 1403.33 Food and Drugs... supplies exceeding $5,000 in total aggregate fair market value upon termination or completion of the award, and if the supplies are not needed for any other federally sponsored programs or projects, the...

  15. 7 CFR 1000.6 - Supply plant.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 9 2011-01-01 2011-01-01 false Supply plant. 1000.6 Section 1000.6 Agriculture... Definitions § 1000.6 Supply plant. Supply plant means a plant approved by a duly constituted regulatory agency... diverts fluid milk products to other plants or manufactures dairy products on its premises. ...

  16. 7 CFR 1000.6 - Supply plant.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Supply plant. 1000.6 Section 1000.6 Agriculture... Definitions § 1000.6 Supply plant. Supply plant means a plant approved by a duly constituted regulatory agency... diverts fluid milk products to other plants or manufactures dairy products on its premises. ...

  17. Visualisation for System Learning in Supply Chains

    ERIC Educational Resources Information Center

    Lindskog, Magnus; Abrahamsson, Mats; Aronsson, Hakan

    2007-01-01

    Contemporary supply chains are vastly complex, and decisions made by actors have system-wide consequences that these might not be able to foresee. There are gaps between "best practice"-founded theory and actual practice in supply chains. To remedy this, we argue, the supply chain actors need to enhance systems knowledge. There is a need to…

  18. Learning to Integrate: Supply Chains Reconceptualised

    ERIC Educational Resources Information Center

    Sense, Andrew J.; Clements, Michael D. J.

    2007-01-01

    This paper introduces and explains a conception of supply chains from a situated learning perspective. This non-conventional supply chain perspective invites the reader to consider supply chain scenarios as "situated learning opportunities involving multiple communities of practice" interacting and participating together. It is argued that by…

  19. 47 CFR 80.1015 - Power supply.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Power supply. 80.1015 Section 80.1015... MARITIME SERVICES Radiotelephone Installations Required by the Bridge-to-Bridge Act § 80.1015 Power supply. (a) There must be readily available for use under normal load conditions, a power supply...

  20. 10 CFR 603.1330 - Supplies.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Supplies. 603.1330 Section 603.1330 Energy DEPARTMENT OF ENERGY (CONTINUED) ASSISTANCE REGULATIONS TECHNOLOGY INVESTMENT AGREEMENTS Definitions of Terms Used in this Part § 603.1330 Supplies. Tangible property other than real property and equipment. Supplies have...

  1. Supply Chain Management in Humanitarian Relief Logistics

    DTIC Science & Technology

    2004-03-01

    supply chain management techniques to overcome...academic, organizational, and contemporary literature. Possible solutions to these barriers were selected from available supply chain management literature...can build upon the concept. The result of the study is a simple framework of supply chain management solutions for overcoming logistics difficulties during humanitarian relief operations. (3 tables, 66

  2. 47 CFR 80.1015 - Power supply.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 47 Telecommunication 5 2013-10-01 2013-10-01 false Power supply. 80.1015 Section 80.1015... MARITIME SERVICES Radiotelephone Installations Required by the Bridge-to-Bridge Act § 80.1015 Power supply. (a) There must be readily available for use under normal load conditions, a power supply...

  3. 47 CFR 80.1015 - Power supply.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 47 Telecommunication 5 2012-10-01 2012-10-01 false Power supply. 80.1015 Section 80.1015... MARITIME SERVICES Radiotelephone Installations Required by the Bridge-to-Bridge Act § 80.1015 Power supply. (a) There must be readily available for use under normal load conditions, a power supply...

  4. 47 CFR 80.1015 - Power supply.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 47 Telecommunication 5 2014-10-01 2014-10-01 false Power supply. 80.1015 Section 80.1015... MARITIME SERVICES Radiotelephone Installations Required by the Bridge-to-Bridge Act § 80.1015 Power supply. (a) There must be readily available for use under normal load conditions, a power supply...

  5. 47 CFR 80.1015 - Power supply.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 5 2011-10-01 2011-10-01 false Power supply. 80.1015 Section 80.1015... MARITIME SERVICES Radiotelephone Installations Required by the Bridge-to-Bridge Act § 80.1015 Power supply. (a) There must be readily available for use under normal load conditions, a power supply...

  6. 41 CFR 105-71.133 - Supplies.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 41 Public Contracts and Property Management 3 2013-07-01 2013-07-01 false Supplies. 105-71.133 Section 105-71.133 Public Contracts and Property Management Federal Property Management Regulations System...-Award Requirements/Changes, Property, and Subawards § 105-71.133 Supplies. (a) Title. Title to supplies...

  7. 41 CFR 105-71.133 - Supplies.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 41 Public Contracts and Property Management 3 2012-01-01 2012-01-01 false Supplies. 105-71.133 Section 105-71.133 Public Contracts and Property Management Federal Property Management Regulations System...-Award Requirements/Changes, Property, and Subawards § 105-71.133 Supplies. (a) Title. Title to supplies...

  8. EU ENERGY STAR Certified Uninterruptible Power Supplies

    EPA Pesticide Factsheets

    Certified models meet all ENERGY STAR requirements as listed in the Version 1.0 ENERGY STAR Program Requirements for Uninterruptible Power Supplies that are effective as of August 1, 2012. A detailed listing of key efficiency criteria are available at http://www.energystar.gov/index.cfm?c=uninterruptible_power_supplies.pr_crit_uninterruptible_power_supplies

  9. ENERGY STAR Certified Uninterruptible Power Supplies

    EPA Pesticide Factsheets

    Certified models meet all ENERGY STAR requirements as listed in the Version 1.0 ENERGY STAR Program Requirements for Uninterruptible Power Supplies that are effective as of August 1, 2012. A detailed listing of key efficiency criteria are available at http://www.energystar.gov/index.cfm?c=uninterruptible_power_supplies.pr_crit_uninterruptible_power_supplies

  10. 20 CFR 654.405 - Water supply.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 20 Employees' Benefits 3 2013-04-01 2013-04-01 false Water supply. 654.405 Section 654.405... THE EMPLOYMENT SERVICE SYSTEM Housing for Agricultural Workers Housing Standards § 654.405 Water supply. (a) An adequate and convenient supply of water that meets the standards of the State...

  11. 9 CFR 354.224 - Water supply.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 9 Animals and Animal Products 2 2014-01-01 2014-01-01 false Water supply. 354.224 Section 354.224....224 Water supply. The water supply shall be ample, clean, and potable with adequate facilities for its distribution in the plant and its protection against contamination and pollution. (a) Hot water at...

  12. 9 CFR 354.224 - Water supply.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 9 Animals and Animal Products 2 2013-01-01 2013-01-01 false Water supply. 354.224 Section 354.224....224 Water supply. The water supply shall be ample, clean, and potable with adequate facilities for its distribution in the plant and its protection against contamination and pollution. (a) Hot water at...

  13. 20 CFR 654.405 - Water supply.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 20 Employees' Benefits 3 2014-04-01 2014-04-01 false Water supply. 654.405 Section 654.405... THE EMPLOYMENT SERVICE SYSTEM Housing for Agricultural Workers Housing Standards § 654.405 Water supply. (a) An adequate and convenient supply of water that meets the standards of the State...

  14. 24 CFR 3285.603 - Water supply.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 24 Housing and Urban Development 5 2012-04-01 2012-04-01 false Water supply. 3285.603 Section 3285... § 3285.603 Water supply. (a) Crossover. Multi-section homes with plumbing in both sections require water... pressure and reduction. When the local water supply pressure exceeds 80 psi to the manufactured home,...

  15. 24 CFR 3285.603 - Water supply.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 24 Housing and Urban Development 5 2014-04-01 2014-04-01 false Water supply. 3285.603 Section 3285... § 3285.603 Water supply. (a) Crossover. Multi-section homes with plumbing in both sections require water... pressure and reduction. When the local water supply pressure exceeds 80 psi to the manufactured home,...

  16. 9 CFR 354.224 - Water supply.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 9 Animals and Animal Products 2 2012-01-01 2012-01-01 false Water supply. 354.224 Section 354.224....224 Water supply. The water supply shall be ample, clean, and potable with adequate facilities for its distribution in the plant and its protection against contamination and pollution. (a) Hot water at...

  17. 20 CFR 654.405 - Water supply.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 20 Employees' Benefits 3 2012-04-01 2012-04-01 false Water supply. 654.405 Section 654.405... THE EMPLOYMENT SERVICE SYSTEM Housing for Agricultural Workers Housing Standards § 654.405 Water supply. (a) An adequate and convenient supply of water that meets the standards of the State...

  18. 24 CFR 3285.603 - Water supply.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 24 Housing and Urban Development 5 2013-04-01 2013-04-01 false Water supply. 3285.603 Section 3285... § 3285.603 Water supply. (a) Crossover. Multi-section homes with plumbing in both sections require water... pressure and reduction. When the local water supply pressure exceeds 80 psi to the manufactured home,...

  19. 32 CFR 34.24 - Supplies.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 32 National Defense 1 2011-07-01 2011-07-01 false Supplies. 34.24 Section 34.24 National Defense... § 34.24 Supplies. (a) Title shall vest in the recipient upon acquisition for supplies acquired with... shall retain the items for use on non-Federal sponsored activities or sell them, but shall, in...

  20. 32 CFR 34.24 - Supplies.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Supplies. 34.24 Section 34.24 National Defense... § 34.24 Supplies. (a) Title shall vest in the recipient upon acquisition for supplies acquired with... shall retain the items for use on non-Federal sponsored activities or sell them, but shall, in...

  1. Petroleum supply monthly: December 1993

    SciTech Connect

    Not Available

    1993-12-01

    Data are presented which describe the supply and disposition of petroleum products in the United States and major U.S. geographic regions. The data series describe production, imports and exports, inter-Petroleum Administration for Defense (PAD) District movements, and inventories by the primary suppliers of petroleum products in the United States. Data are presented in two sections: Summary Statistics, presenting a time series of selected petroleum data on a U.S. level, and Detailed Statistics, presenting statistics for the most current month available as well as year to date.

  2. Strategic materials availability and supply

    NASA Technical Reports Server (NTRS)

    Stephens, Joseph R.

    1989-01-01

    An evaluation is made of the supply sources and current availability of elements involved in superalloy compositions, as well as of development trends in the substitution of strategic materials for superalloys, giving attention to the results thus far achieved by NASA's Conservation of Strategic Aerospace Materials program, which formally operated only from 1980 to 1984 but whose various research initiatives have been continued under other NASA programs. Peacetime and wartime economies' need and probable availability analyses are presented for bauxite/aluminum, the Pt-group metals, and the alloying elements Mn, Nb, Ta, Co, Cr, Ni, W, Fe, Cu, Ti, Mo, and Mg.

  3. Preprototype nitrogen supply subsystem development

    NASA Technical Reports Server (NTRS)

    Heppner, D. B.; Fort, J. H.; Schubert, F. H.

    1982-01-01

    The design and development of a test stand for the Nitrogen Generation Module (NGM) and a series of tests which verified its operation and performance capability are described. Over 900 hours of parametric testing were achieved. The results from this testing were then used to design an advanced NGM and a self contained, preprototype Nitrogen Supply Subsystem. The NGM consists of three major components: nitrogen generation module, pressure controller and hydrazine storage tank and ancillary components. The most important improvement is the elimination of all sealing surfaces, achieved with a total welded or brazed construction. Additionally, performance was improved by increasing hydrogen separating capability by 20% with no increase in overall packaging size.

  4. Progress 23 supply vehicle approach

    NASA Image and Video Library

    2006-10-26

    ISS014-E-06544 (26 Oct. 2006) --- Backdropped by a blue and white Earth, an unpiloted Progress supply vehicle approaches the International Space Station. Progress docked to the aft port of the Zvezda Service Module at 9:29 a.m. (CDT) on Oct. 26. The spacecraft used the automated Kurs system to dock at the aft port of the Zvezda service module. Expedition 14 flight engineer Mikhail Tyurin stood by at the manual Toru docking system controls, but the automated system functioned as designed and manual intervention was not needed.

  5. Progress re-supply ship

    NASA Image and Video Library

    2010-01-14

    ISS01-324-002 (18 November 2000) --- A Progress supply ship linked up to the orbiting International Space Station (ISS) at 3:48 GMT, November 18, bringing Expedition 1 commander William M. Shepherd, pilot Yuri P. Gidzenko and flight engineer Sergei K. Krikalev two tons of food, clothing, hardware and holiday gifts from their families. The photograph was taken with a 35mm camera and the film was later handed over to the STS-97 crew members for return to Earth and subsequent processing.

  6. Superalloy resources: Supply and availability

    NASA Technical Reports Server (NTRS)

    Stephens, Joseph R.

    1987-01-01

    Over the past several decades there have been shortages of strategic materials because of our near total import dependence on such metals as chromium, cobalt, and tantalum. In response to the continued vulnerability of U.S. superalloy producers to disruptions in resource supplies, NASA has undertaken a program to address alternatives to the super-alloys containing significant quantities of the strategic materials such as chromium, cobalt, niobium, and tantalum. The research program called Conservation of Strategic Aerospace Materials (COSAM) focuses on substitution, processing, and alternate materials to achieve its goals. In addition to NASA Lewis Research Center, universities and industry play an important role in the COSAM Program. This paper defines what is meant by strategic materials in the aerospace community, presents a strategic materials index, and reviews the resource supply and availability picture from the U.S. point of view. In addition, research results from the COSAM Program are highlighted and future directions for the use of low strategic material alloys or alternate materials are discussed.

  7. Microbial consortia at steady supply

    PubMed Central

    Taillefumier, Thibaud; Posfai, Anna; Meir, Yigal; Wingreen, Ned S

    2017-01-01

    Metagenomics has revealed hundreds of species in almost all microbiota. In a few well-studied cases, microbial communities have been observed to coordinate their metabolic fluxes. In principle, microbes can divide tasks to reap the benefits of specialization, as in human economies. However, the benefits and stability of an economy of microbial specialists are far from obvious. Here, we physically model the population dynamics of microbes that compete for steadily supplied resources. Importantly, we explicitly model the metabolic fluxes yielding cellular biomass production under the constraint of a limited enzyme budget. We find that population dynamics generally leads to the coexistence of different metabolic types. We establish that these microbial consortia act as cartels, whereby population dynamics pins down resource concentrations at values for which no other strategy can invade. Finally, we propose that at steady supply, cartels of competing strategies automatically yield maximum biomass, thereby achieving a collective optimum. DOI: http://dx.doi.org/10.7554/eLife.22644.001 PMID:28473032

  8. Mars sample return power supply

    NASA Technical Reports Server (NTRS)

    Hoang, Don; Ludwigs, Sharon; Schmitz, Paul; Wright, John

    1988-01-01

    A power supply is designed for a vehicle able to operate on the surface of Mars for a period of 5 to 10 years. This vehicle will be used for sample and data collection. The design is based on the assumption that the vehicle will be unmanned. Also, there will be no means by which components could be repaired or replaced while on the Martian surface. A consequence of this is that all equipment must meet high standards of reliability and, if possible, redundancy. Power will be supplied to the vehicle by means of a General Purpose Heat Source capable of producing a minimum of 7 kW of thermal power. The heat generated from the General Purpose Heat Source will be transferred to a Stirling engine via hot side heat pipes. The Stirling engine will then convert this heat into 2 kW of electrical power. Cold side heat pipes will be used to carry away waste heat, which will be released to the Martian environment via radiators connected to the end of the cold side heat pipes.

  9. Proceedings: 1986 fuel supply seminar

    SciTech Connect

    Prast, W.G.

    1987-09-01

    The sixth annual EPRI Fuel Supply Seminar was held in San Diego, California, from December 3 to 5, 1986. The theme was the impact of lower prices on utility decisions, encompassing heightened competition with electricity and among sources of generation, shifts in new capacity choices, and risks and developments in domestic gas supply and pricing. In addition, key considerations behind world oil and economic projections were discussed. A panel session on bulk power transfers explored emerging trends, case studies, and pivotal fuel considerations. Recent findings on impacts of acid rain legislation on coal markets were discussed. Presentations were made by EPRI research contractors on the results of ongoing research and by speakers from the utility, coal and natural gas industries, as well as independent consultants. The principal purpose of the seminar, as in past years, was to provide utility fuel planners and corporate planners with information and insights into the uncertainties in current fuel markets, and to aid utilities in pursuing flexible fuel strategies.

  10. Mars sample return power supply

    NASA Astrophysics Data System (ADS)

    Hoang, Don; Ludwigs, Sharon; Schmitz, Paul; Wright, John

    A power supply is designed for a vehicle able to operate on the surface of Mars for a period of 5 to 10 years. This vehicle will be used for sample and data collection. The design is based on the assumption that the vehicle will be unmanned. Also, there will be no means by which components could be repaired or replaced while on the Martian surface. A consequence of this is that all equipment must meet high standards of reliability and, if possible, redundancy. Power will be supplied to the vehicle by means of a General Purpose Heat Source capable of producing a minimum of 7 kW of thermal power. The heat generated from the General Purpose Heat Source will be transferred to a Stirling engine via hot side heat pipes. The Stirling engine will then convert this heat into 2 kW of electrical power. Cold side heat pipes will be used to carry away waste heat, which will be released to the Martian environment via radiators connected to the end of the cold side heat pipes.

  11. A new bipolar Qtrim power supply system

    SciTech Connect

    Mi, C.; Bruno, D.; Drozd, J.; Nolan, T.; Orsatti, F.; Heppener, G.; Di Lieto, A.; Schultheiss, C.; Samms, T.; Zapasek, R.; Sandberg, J.

    2015-05-03

    This year marks the 15th run of RHIC (Relativistic Heavy Ion Collider) operations. The reliability of superconducting magnet power supplies is one of the essential factors in the entire accelerator complex. Besides maintaining existing power supplies and their associated equipment, newly designed systems are also required based on the physicist’s latest requirements. A bipolar power supply was required for this year’s main quadruple trim power supply. This paper will explain the design, prototype, testing, installation and operation of this recently installed power supply system.

  12. International labor migration and domestic labor supply.

    PubMed

    Kochhar, R

    1992-04-01

    "This paper constructs a dynamic, general equilibrium framework to study the relationship between international labor migration and domestic labor supply. The general equilibrium nature of the model enables us to endogenize the pattern of labor migration. The effect of labor migration on domestic wage rates and labor supply is shown to depend on the pattern of labor migration. If the substitution effect dominates the income effect in labor supply, the domestic supply of labor necessarily decreases in response to an inflow of migrants....Similarly, if the dominant effect is the income effect, the immigration of labor necessarily increases the domestic supply of labor."

  13. Power-supply regulation by microprocessor

    SciTech Connect

    Sheehan, J.; Langenbach, H.

    1983-01-01

    Many small-magnet power supplies are regulated by using a microprocessor system to generate control voltages to continuously servoregulate each power supply. The power supplies are of very simple design since all regulation and feedback hardware are parts of the microprocessor system. Most of the supplies are bipolar transistor followers, powered by a common unregulated dc power supply and are used to power trim steering magnets on the three NSLS synchrotron rings. Twelve-bit accuracy is obtained using commercially available microprocessor pc cards.

  14. Incorporating uncertainty into high-resolution groundwater supply models

    USGS Publications Warehouse

    Rahman, A.; Hartono, S.; Carlson, D.; Willson, C.S.; ,

    2003-01-01

    Groundwater modeling is a useful tool for evaluating whether an acquifer system is capable of supporting groundwater withdrawals over long periods of time and what effect, if any, such activity will have on the regional flow dynamics as well as on specific public water, agricultural and industrial supplies. An overview is given of an ongoing groundwater modeling study of the Chicot Aquifer in southwestern Louisiana where a low-resolution groundwater model is being used to study the regional flow in the Chicot acquifer and to provide boundary conditions for higher-resolution inset models created using telescopic mesh refinement (TMR).

  15. Creating a Culture of Professional Learning

    ERIC Educational Resources Information Center

    von Frank, Valerie, Ed.

    2008-01-01

    This compilation of articles from NSDC's newsletters and JSD is a comprehensive resource on creating a positive school culture. The collection includes descriptions of healthy cultures and specific information about how district and school leaders can take actions to create more positive environments, beginning with the audits provided and…

  16. Artists Create Puzzles, Scientists Solve Them.

    PubMed

    Goldstein, Joseph L

    2017-09-21

    The Spanish artist Diego Velázquez created a puzzle-painting 360 years ago that to this day remains unsolved, but still mystifies and intrigues. Unlike artists who get their thrills by creating puzzles that stimulate the imagination, scientists get their kicks by solving puzzles that advance biomedical research. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Educating Managers to Create Healthy Workplaces

    ERIC Educational Resources Information Center

    Gilbreath, Brad

    2012-01-01

    This article provides management educators with a comprehensive, research-based set of concepts they can use to enrich students' understanding of how to create healthy workplaces. To assist with that endeavor, learning objectives related to creating healthy workplaces are provided. Work environment stressors are discussed along with human and…

  18. Using Technology to Create Safer Schools.

    ERIC Educational Resources Information Center

    Townley, Arthur J.; Martinez, Kenneth

    1995-01-01

    Although classes to create student self-esteem and antigang programs are gaining in popularity, most school districts have not used available technology to help create safer campuses. Increased availability of telephones and two-way radios would enhance school security, along with incorporation of newer technologies such as computers, digitized…

  19. Learning Course Content by Creating a Wiki

    ERIC Educational Resources Information Center

    Matthew, Kathryn I.; Felvegi, Emese

    2009-01-01

    In this article, students' perceptions of the benefits and the challenges of creating a wiki for a language arts methods class are explored through their online reflections and interview transcripts. The students' own words describe their experiences about learning course content while collaborating to create a course wiki. Reflecting on the…

  20. Creating "Third Spaces": Promoting Learning through Dialogue

    ERIC Educational Resources Information Center

    Wilhelm, Jeffrey D.

    2010-01-01

    Wilhelm offers us a definition of "third spaces" as "more democratic and dialogic spaces than a classroom, as well as a metaphor for a space in which new, hybrid, and challenging discourses and real-world knowledge and applications are created." With helpful background and examples, he urges us to create such spaces for our students, adamant that…

  1. Creating Safe Spaces for Music Learning

    ERIC Educational Resources Information Center

    Hendricks, Karin S.; Smith, Tawnya D.; Stanuch, Jennifer

    2014-01-01

    This article offers a practical model for fostering emotionally safe learning environments that instill in music students a positive sense of self-belief, freedom, and purpose. The authors examine the implications for music educators of creating effective learning environments and present recommendations for creating a safe space for learning,…

  2. Learning by Doing: Creating Engaging Online Learning

    ERIC Educational Resources Information Center

    Romero, Liz; Glass, Maria

    2015-01-01

    The purpose of this article is to describe the implementation of a Learning-by-Doing Instructional model to create an innovative language course. The authors describe the structure of the course, the instructional strategies implemented, and the Learning Management System tools used to create an engaging learning experience.

  3. Creating "Third Spaces": Promoting Learning through Dialogue

    ERIC Educational Resources Information Center

    Wilhelm, Jeffrey D.

    2010-01-01

    Wilhelm offers us a definition of "third spaces" as "more democratic and dialogic spaces than a classroom, as well as a metaphor for a space in which new, hybrid, and challenging discourses and real-world knowledge and applications are created." With helpful background and examples, he urges us to create such spaces for our students, adamant that…

  4. Creating a Gender and Communication Course.

    ERIC Educational Resources Information Center

    Crowley-Long, Kathleen; Smith, Karen

    In an attempt to create interdisciplinary study at one college, a gender and communications class was created by professors from psychology and communications. Although the class was made-up of students who were white, middle-class, and heterosexual, the class attempted to discuss issues about race, class, ability, and sexual preference…

  5. Creating Safe Spaces for Music Learning

    ERIC Educational Resources Information Center

    Hendricks, Karin S.; Smith, Tawnya D.; Stanuch, Jennifer

    2014-01-01

    This article offers a practical model for fostering emotionally safe learning environments that instill in music students a positive sense of self-belief, freedom, and purpose. The authors examine the implications for music educators of creating effective learning environments and present recommendations for creating a safe space for learning,…

  6. Creating a representative map for arthroscopy simulation.

    PubMed

    Hachey, John Daniel; Lebel, Marie-Eve; Cristancho, Sayra

    2012-01-01

    The goal of this research was to create accurate task decompositions for arthroscopic shoulder and knee procedures. The methodology used has previously shown to be effective in other minimally invasive surgeries. Future research will integrate these task decompositions into surgical simulators and, along with movement and force data, will help create evaluation tools for surgical students.

  7. Educating Managers to Create Healthy Workplaces

    ERIC Educational Resources Information Center

    Gilbreath, Brad

    2012-01-01

    This article provides management educators with a comprehensive, research-based set of concepts they can use to enrich students' understanding of how to create healthy workplaces. To assist with that endeavor, learning objectives related to creating healthy workplaces are provided. Work environment stressors are discussed along with human and…

  8. Process to create simulated lunar agglutinate particles

    NASA Technical Reports Server (NTRS)

    Gustafson, Robert J. (Inventor); Gustafson, Marty A. (Inventor); White, Brant C. (Inventor)

    2011-01-01

    A method of creating simulated agglutinate particles by applying a heat source sufficient to partially melt a raw material is provided. The raw material is preferably any lunar soil simulant, crushed mineral, mixture of crushed minerals, or similar material, and the heat source creates localized heating of the raw material.

  9. Energy cost of creating quantum coherence

    NASA Astrophysics Data System (ADS)

    Misra, Avijit; Singh, Uttam; Bhattacharya, Samyadeb; Pati, Arun Kumar

    2016-05-01

    We consider physical situations where the resource theories of coherence and thermodynamics play competing roles. In particular, we study the creation of quantum coherence using unitary operations with limited thermodynamic resources. We find the maximal coherence that can be created under unitary operations starting from a thermal state and find explicitly the unitary transformation that creates the maximal coherence. Since coherence is created by unitary operations starting from a thermal state, it requires some amount of energy. This motivates us to explore the trade-off between the amount of coherence that can be created and the energy cost of the unitary process. We also find the maximal achievable coherence under the constraint on the available energy. Additionally, we compare the maximal coherence and the maximal total correlation that can be created under unitary transformations with the same available energy at our disposal. We find that when maximal coherence is created with limited energy, the total correlation created in the process is upper bounded by the maximal coherence, and vice versa. For two-qubit systems we show that no unitary transformation exists that creates the maximal coherence and maximal total correlation simultaneously with a limited energy cost.

  10. Learning by Doing: Creating Engaging Online Learning

    ERIC Educational Resources Information Center

    Romero, Liz; Glass, Maria

    2015-01-01

    The purpose of this article is to describe the implementation of a Learning-by-Doing Instructional model to create an innovative language course. The authors describe the structure of the course, the instructional strategies implemented, and the Learning Management System tools used to create an engaging learning experience.

  11. Carrier and Envelope Frequency Measurements for Supply-Modulated Microwave Power Amplifiers

    NASA Astrophysics Data System (ADS)

    Schafer, Scott R.

    Transmitters for high peak-to-average power ratio communication are increasingly using supply modulation to improve efficiency. In addition to a dc component, the dynamic supply may contain ac components up to 500MHz. The signal envelope dynamic impedance of the supply terminal of a power amplifier (PA) is often unknown and available nonlinear transistor models are unable to predict dynamic low frequency effects required for design of wideband efficient supply modulators. This thesis investigates envelope frequency effects on nonlinear behavior of microwave transistors and PAs under supply-modulated conditions. A measurement setup is created to characterize multi-frequency large-signal excitation of GaN transistors and PAs at carrier frequencies in the 10GHz range with 1-500MHz low frequency excitation on the drain terminal. A novel method for multi-frequency analysis of nonlinear circuit components based on describing functions is developed. It is shown that the describing functions agree with simulation and measurements. In addition, the measurement setup is used to characterize the low frequency drain impedance of a MMIC PA when connected to a simple resonant supply modulator. The main motivation for this work is to obtain knowledge of the dynamic supply terminal in the low frequency regime (1-500MHz) that can enable power amplifier and supply modulator co-design for very broadband signals.

  12. Uninterruptible power supply (UPS) systems

    SciTech Connect

    1997-04-01

    Use of this purchase specification is not mandatory. User should review the document and determine if it meets the user`s purpose. This document contains a fill-in-the-blanks guide specification for the procurement of uninterruptible power supply (UPS) systems greater than 10 kVA, organized as follows: Parts 1 through 7--technical requirements; Appendix A--technical requirements to be included in the proposal; Appendix B--UPS system data sheets to be completed by each bidder (Seller) and submitted with the proposal; Appendix C--general guidelines giving the specifier parameters for selecting a UPS system; it should be read before preparing an actual specification, and is not attached to the specification; Attachment 1--sketches prepared by the purchaser (Owner); Attachment 2--sample title page.

  13. Stand by electrical supply source

    SciTech Connect

    Mucsy, E.; Hoos, K.

    1985-06-25

    A stand-by electrical energy source for equipment to be operated with substantially continuous current supply, comprising three components one of which is at least one electric rotary machine, another of which is a flywheel and the third of which is an auxiliary energy source. Planetary gearing is provided, comprising a central shaft on which is mounted a sun gear, a planet gear and a ring gear, each of the three components being connected with a respective one of these gears. Two of the three components are interconnected by a drive with an infinitely variable transmission. In one embodiment, the electric rotary machine is connected to the planet gear, the flywheel is connected to the sun gear and the auxiliary energy source is connected with the ring gear. In another embodiment, the electric rotary machine is connected to the sun gear, the flywheel is connected to the ring gear, and the auxiliary energy source is connected to the planet gear.

  14. Standardized multiple output power supply

    NASA Technical Reports Server (NTRS)

    Ragusa, E. V.

    1975-01-01

    A comprehensive program to develop a prototype model of a standardized multiple output power supply for use in space flight applications is described. The prototype unit was tested and evaluated to assure that the design would provide near optimum performance for the planned application. The prototype design used a dc-to-dc converter incorporating reqenerative current feedback with a time-ratio controlled duty cycle to achieve high efficiency over a wide variation of input voltage and output loads. The packaging concept uses a mainframe capable of accommodating up to four inverter/regulator modules with one common input filter and housekeeping module. Each inverter/regulator module provides a maximum of 100 watts or 10 amperes. Each module is adaptable to operate at any voltage between 4.0 volts and 108 volts. The prototype unit contains +5, + or - 15 and +28 volt modules.

  15. Preprototype nitrogen supply subsystem development

    NASA Technical Reports Server (NTRS)

    Heppner, D. B.; Hallick, T. M.; Schubert, F. H.

    1981-01-01

    A nitrogen supply subsystem based on the dissociation of hydrazine into a mixture of hydrogen and nitrogen is developed. The latter is separated to provide makeup nitrogen to control the composition of spacecraft atmospheres. Specific hardware developments resulted in the design and fabrication of a nominal 3.6 kg/d nitrogen generation module. The design integrates a hydrazine catalytic dissociator, three ammonia dissociation stages and four hydrogen separation stages into a 33 kg, 14 cu dm module. A technique was devised to alternate the ammonia dissociation and hydrogen separation stages to give high nitrogen purity in the end product stream. Tests show the product stream to contain less than 0.5 percent hydrogen and 10 parts per million ammonia. The design and development of a test stand for the nitrogen generation module and a series of tests which verified its operation and performance capability are described.

  16. Food supply reliance on groundwater

    NASA Astrophysics Data System (ADS)

    Dalin, Carole; Puma, Michael; Wada, Yoshihide; Kastner, Thomas

    2016-04-01

    Water resources, essential to sustain human life, livelihoods and ecosystems, are under increasing pressure from population growth, socio-economic development and global climate change. As the largest freshwater resource on Earth, groundwater is key for human development and food security. Yet, excessive abstraction of groundwater for irrigation, driven by an increasing demand for food in recent decades, is leading to fast exhaustion of groundwater reserves in major agricultural areas of the world. Some of the highest depletion rates are observed in Pakistan, India, California Central Valley and the North China Plain aquifers. In addition, the growing economy and population of several countries, such as India and China, makes prospects of future available water and food worrisome. In this context, it is becoming particularly challenging to sustainably feed the world population, without exhausting our water resources. Besides, food production and consumption across the globe have become increasingly interconnected, with many areas' agricultural production destined to remote consumers. In this globalisation era, trade is crucial to the world's food system. As a transfer of water-intensive goods, across regions with varying levels of water productivity, food trade can save significant volumes of water resources globally. This situation makes it essential to address the issue of groundwater overuse for global food supply, accounting for international food trade. To do so, we quantify the current, global use of non-renewable groundwater for major crops, accounting for various water productivity and trade flows. This will highlight areas requiring quickest attention, exposing major exporters and importers of non-renewable groundwater, and thus help explore solutions to improve the sustainability of global food supply.

  17. Learning beyond Schooling: New Forms of Supply and New Demands. OECD Documents.

    ERIC Educational Resources Information Center

    Organisation for Economic Cooperation and Development, Paris (France).

    Knowledge and learning are becoming increasingly central to work and everyday life at the close of the 20th century. This document examines the potential for creating a new match between the demand for and the supply of new forms of learning. It draws on a range of recent Centre for Educational Research and Innovation (CERI) work and summarizes…

  18. The Role of Multi-Institutional Partnerships in Supply Chain Management Course Design and Improvement

    ERIC Educational Resources Information Center

    Long, Suzanna; Moos, J. Chris; Radic, Anne Bartel

    2012-01-01

    The authors examined the skills achieved through a multicultural, virtual student project environment among 3 supply chain management courses. The partnership included 2 universities in the United States and 1 in France and created virtual teams of students across university lines and is presented as a case study. The case includes detailed…

  19. The Role of Multi-Institutional Partnerships in Supply Chain Management Course Design and Improvement

    ERIC Educational Resources Information Center

    Long, Suzanna; Moos, J. Chris; Radic, Anne Bartel

    2012-01-01

    The authors examined the skills achieved through a multicultural, virtual student project environment among 3 supply chain management courses. The partnership included 2 universities in the United States and 1 in France and created virtual teams of students across university lines and is presented as a case study. The case includes detailed…

  20. High Power Amplifier and Power Supply

    NASA Technical Reports Server (NTRS)

    Duong, Johnny; Stride, Scot; Harvey, Wayne; Haque, Inam; Packard, Newton; Ng, Quintin; Ispirian, Julie Y.; Waian, Christopher; Janes, Drew

    2008-01-01

    A document discusses the creation of a high-voltage power supply (HVPS) that is able to contain voltages up to -20 kV, keep electrical field strengths to below 200 V/mil (approximately equal to 7.87 kV/mm), and can provide a 200-nanosecond rise/fall time focus modulator swinging between cathode potential of 16.3 kV and -19.3 kV. This HVPS can protect the 95-GHz, pulsed extended interaction klystron (EIK) from arcs/discharges from all sources, including those from within the EIK fs vacuum envelope. This innovation has a multi-winding pulse transformer design, which uses new winding techniques to provide the same delays and rise/fall times (less than 10 nanoseconds) at different potential levels ranging from -20 kV to -16 kV. Another feature involves a high-voltage printed-wiring board that was corona-free at -20 kV DC with a 3- kV AC swing. The corona-free multilayer high-voltage board is used to simulate fields of less than 200 V/mil (approximately equal to 7.87 kV/mm) at 20 kV DC. Drive techniques for the modulator FETs (field-effect transistors) (four to 10 in a series) were created to change states (3,000-V swing) without abrupt steps, while still maintaining required delays and transition times. The packing scheme includes a potting mold to house a ten-stage modulator in the space that, in the past, only housed a four-stage modulator. Problems keeping heat down were solved using aluminum oxide substrate in the high-voltage section to limit temperature rise to less than 10 while withstanding -20 kV DC voltage and remaining corona-free.

  1. Program Supplies Properties Of Parahydrogen

    NASA Technical Reports Server (NTRS)

    Walton, J. T.

    1994-01-01

    National Bureau of Standards Parahydrogen Properties Database (NBS+_PH2) computer program developed to provide selected thermal and transport properties of parahydrogen matching 1981 parahydrogen data of National Bureau of Standards (now called National Institute of Standards and Technology). Created to be linked with propulsion-simulation programs, which require mathematical model of parahydrogen covering wide range of pressures and temperatures. Provides data on parahydrogen for pressures from 10 kPa to 16 MPa and temperatures from 20 to 104 K. Provides following properties: density, thermal conductivity, viscosity, Prandtl number, enthalpy, specific heat, and speed of sound. Written in FORTRAN 77.

  2. Creating an Interactive Videodisc on Mapping.

    ERIC Educational Resources Information Center

    Andrews, Sona Karentz; Grozik, John

    1994-01-01

    Provides an overview of the University of Wisconsin-Milwaukee's Interactive Multimedia Cartography Project to create an interactive videodisc that would illustrate the topic of mapping and provide access to examples of cartography from the American Geographical Society Collection. (JLB)

  3. Taking medicine at home - create a routine

    MedlinePlus

    ... page: //medlineplus.gov/ency/patientinstructions/000613.htm Taking medicine at home - create a routine To use the ... teeth. Find Ways to Help You Remember Your Medicines You can: Set the alarm on your clock, ...

  4. Creating Great Neighborhoods: Density in Your Community

    EPA Pesticide Factsheets

    This report highlights nine community-led efforts to create vibrant neighborhoods through density, discusses the connections between smart growth and density, and introduces design principles to ensure that density becomes a community asset.

  5. Creating an Interactive Videodisc on Mapping.

    ERIC Educational Resources Information Center

    Andrews, Sona Karentz; Grozik, John

    1994-01-01

    Provides an overview of the University of Wisconsin-Milwaukee's Interactive Multimedia Cartography Project to create an interactive videodisc that would illustrate the topic of mapping and provide access to examples of cartography from the American Geographical Society Collection. (JLB)

  6. Creating Healthy Environments For Youth Athletes

    EPA Pesticide Factsheets

    EPA has created a presentation and companion checklist to help coaches and athletic administrators better understand the environmental health risks associated with youth sports and the steps they can follow to protect young athletes.

  7. Nevada test site water-supply wells

    SciTech Connect

    Gillespie, D.; Donithan, D.; Seaber, P.

    1996-05-01

    A total of 15 water-supply wells are currently being used at the Nevada Test Site (NTS). The purpose of this report is to bring together the information gleaned from investigations of these water-supply wells. This report should serve as a reference on well construction and completion, static water levels, lithologic and hydrologic characteristics of aquifers penetrated, and general water quality of water-supply wells at the NTS. Possible sources for contamination of the water-supply wells are also evaluated. Existing wells and underground nuclear tests conducted near (within 25 meters (m)) or below the water table within 2 kilometers (km) of a water-supply were located and their hydrogeologic relationship to the water-supply well determined.

  8. Upgrading the TFTR Transrex Power Supplies

    SciTech Connect

    J. E. Lawson, R. Marsala, S. Ramakrishnan, X. Zhao, P. Sichta

    2009-05-29

    In order to provide improved and expanded experimental capabilities, the existing Transrex power supplies at PPPL are to be upgraded and modernized. Each of the 39 power supplies consists of two six pulse silicon controlled rectifier sections forming a twelve pulse power supply. The first modification is to split each supply into two independent six pulse supplies by replacing the existing obsolete twelve pulse firing generator with two commercially available six pulse firing generators. The second change replaces the existing control link with a faster system, with greater capacity, which will allow for independent control of all 78 power supply sections. The third change replaces the existing Computer Automated Measurement and Control (CAMAC) based fault detector with an Experimental Physics and Industrial Control System (EPICS) compatible unit, eliminating the obsolete CAMAC modules. Finally the remaining relay logic and interfaces to the "Hardwired Control System" will be replaces with a Programmable Logic Controller (PLC).

  9. Creating Math Videos: Comparing Platforms and Software

    ERIC Educational Resources Information Center

    Abbasian, Reza O.; Sieben, John T.

    2016-01-01

    In this paper we present a short tutorial on creating mini-videos using two platforms--PCs and tablets such as iPads--and software packages that work with these devices. Specifically, we describe the step-by-step process of creating and editing videos using a Wacom Intuos pen-tablet plus Camtasia software on a PC platform and using the software…

  10. Creating a VAPEPS database: A VAPEPS tutorial

    NASA Technical Reports Server (NTRS)

    Graves, George

    1989-01-01

    A procedural method is outlined for creating a Vibroacoustic Payload Environment Prediction System (VAPEPS) Database. The method of presentation employs flowcharts of sequential VAPEPS Commands used to create a VAPEPS Database. The commands are accompanied by explanatory text to the right of the command in order to minimize the need for repetitive reference to the VAPEPS user's manual. The method is demonstrated by examples of varying complexity. It is assumed that the reader has acquired a basic knowledge of the VAPEPS software program.

  11. Creating Math Videos: Comparing Platforms and Software

    ERIC Educational Resources Information Center

    Abbasian, Reza O.; Sieben, John T.

    2016-01-01

    In this paper we present a short tutorial on creating mini-videos using two platforms--PCs and tablets such as iPads--and software packages that work with these devices. Specifically, we describe the step-by-step process of creating and editing videos using a Wacom Intuos pen-tablet plus Camtasia software on a PC platform and using the software…

  12. Creating Space Plasma from the Ground

    DTIC Science & Technology

    2016-05-12

    AFRL-AFOSR-VA-TR-2016-0179 CREATING SPACE PLASMA FROM THE GROUND Herbert C Carlson UTAH STATE UNIVERSITY Final Report 05/12/2016 DISTRIBUTION A...DATE (DD-MM-YYYY) 05/14/2016 2. REPORT TYPE Final 3. DATES COVERED (From - To) 08/14/2012-05/14/2016 4. TITLE AND SUBTITLE Creating space plasma from...shown multiple 15. SUBJECT TERMS Space plasmas plasma instabilities artificial ionospheres 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF

  13. Creating electron vortex beams with light.

    PubMed

    Handali, Jonathan; Shakya, Pratistha; Barwick, Brett

    2015-02-23

    We propose an all-optical method of creating electron vortices utilizing the Kapitza-Dirac effect. This technique uses the transfer of orbital angular momentum from photons to free electrons creating electron vortex beams in the process. The laser intensities needed for this experiment can be obtained with available pulsed lasers and the resulting electron beams carrying orbital angular momentum will be particularly useful in the study of magnetic materials and chiral plasmonic structures in ultrafast electron microscopy.

  14. Creating activity schedules using Microsoft Powerpoint.

    PubMed Central

    Rehfeldt, Ruth Anne; Kinney, Elisabeth M; Root, Shannon; Stromer, Robert

    2004-01-01

    We describe how PowerPoint presentation software can be used to create computer activity schedules to teach individuals with special needs. Presented are the steps involved in creating activity schedules with close-ended and open-ended activities, and for preparing schedules that include photos, sounds, text, and videos that can be used to occasion an individual's engagement in a variety of learning activities. PMID:15154226

  15. Creating activity schedules using Microsoft Powerpoint.

    PubMed

    Rehfeldt, Ruth Anne; Kinney, Elisabeth M; Root, Shannon; Stromer, Robert

    2004-01-01

    We describe how PowerPoint presentation software can be used to create computer activity schedules to teach individuals with special needs. Presented are the steps involved in creating activity schedules with close-ended and open-ended activities, and for preparing schedules that include photos, sounds, text, and videos that can be used to occasion an individual's engagement in a variety of learning activities.

  16. The Coalition for Sustainable Egg Supply project: An introduction

    PubMed Central

    Swanson, J. C.; Mench, J. A.; Karcher, D.

    2015-01-01

    In the United States, empirical information on the sustainability of commercial-scale egg production is lacking. The passage of state regulations specific to hen housing created urgency to better understand the effects of different housing systems on the sustainability of the egg supply, and stimulated the formation of a coalition, the Coalition for a Sustainable Egg Supply (CSES), to conduct research on this topic. The CSES is a multi-stakeholder group with 27 members, including food manufacturers, research institutions, scientists, restaurants, food service, retail food companies, egg suppliers, and nongovernmental organizations. A commercial-scale study was developed to better understand the effect of 3 housing systems (conventional cage, enriched colony, and cage-free aviary) on 5 areas related to a sustainable egg supply. These 5 sustainability areas represent effects on people, animals, and the environment: animal health and well-being, environment, food safety, worker health and safety, and food affordability. Five teams of scientists, each associated with a sustainability area, conducted an integrated field study at a commercial site in the upper Midwest through 2 flock cycles in 3 housing systems. This paper provides a brief overview of the CSES project to serve as an introduction for the papers that follow in this volume of Poultry Science. PMID:25737565

  17. The Coalition for Sustainable Egg Supply project: An introduction.

    PubMed

    Swanson, J C; Mench, J A; Karcher, D

    2015-03-01

    In the United States, empirical information on the sustainability of commercial-scale egg production is lacking. The passage of state regulations specific to hen housing created urgency to better understand the effects of different housing systems on the sustainability of the egg supply, and stimulated the formation of a coalition, the Coalition for a Sustainable Egg Supply (CSES), to conduct research on this topic. The CSES is a multi-stakeholder group with 27 members, including food manufacturers, research institutions, scientists, restaurants, food service, retail food companies, egg suppliers, and nongovernmental organizations. A commercial-scale study was developed to better understand the effect of 3 housing systems (conventional cage, enriched colony, and cage-free aviary) on 5 areas related to a sustainable egg supply. These 5 sustainability areas represent effects on people, animals, and the environment: animal health and well-being, environment, food safety, worker health and safety, and food affordability. Five teams of scientists, each associated with a sustainability area, conducted an integrated field study at a commercial site in the upper Midwest through 2 flock cycles in 3 housing systems. This paper provides a brief overview of the CSES project to serve as an introduction for the papers that follow in this volume of Poultry Science. © The Author 2015. Published by Oxford University Press on behalf of Poultry Science Association.

  18. Simplified power supplies for ion thrusters

    NASA Technical Reports Server (NTRS)

    Gruber, R. P.

    1981-01-01

    The initial development and demonstration of power supplies with an order of magnitude reduction in parts count, leading to increased reliability at lower weight, while still maintaining thrust system performance are discussed. Two new self-regulating keeper power supply circuits were developed and tested. One supply comprises 14 parts and uses an input voltage range of 18 to 36 volts, the other operates from 200 to 400 volts and requires 22 components. A technique for controlling heater power is also demonstrated.

  19. Intelligence Support to Supply Chain Risk Management

    DTIC Science & Technology

    2012-06-01

    U.S. companies and increased the brittleness of those chains ( Pettit , Fiksel, and Croxton, 2010; Giunipero and Eltantawy, 2004). Attempts to minimize...management. According to Pettit , Fiksel, and Croxton (2010:6), a supply chain is “the network of companies involved in the upstream and downstream...comprise a supply chain and the effects of an uncertain external environment, supply chains are vulnerable to disruption ( Pettit , Fiksel,and Croxton

  20. Petroleum supply annual 1995: Volume 1

    SciTech Connect

    1996-05-01

    The {ital Petroleum Supply Annual} contains information on supply and disposition of crude oil and petroleum products. It reflects data collected from the petroleum industry during 1995 through monthly surveys, and it is divided into 2 volumes. This volume contains three sections: summary statistics, detailed statistics, and selected refinery statistics, each with final annual data. (The other volume contains final statistics for each month and replaces data previously published in the {ital Petroleum Supply Monthly}).