Sample records for suppressed cpg-induced il-6

  1. Normal mitogen-induced suppression of the interleukin-6 (IL-6) response and its deficiency in systemic lupus erythematosus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Warrington, R.J.; Rutherford, W.J.

    1990-01-01

    A low-frequency suppressor-cell population in normal peripheral blood inhibits the B-cell CESS response to IL-6, following pokeweed mitogen stimulation. The suppression of IL-6 responsiveness is radiation sensitive, directed against CESS targets and not mediated by inhibition of IL-6 production, and associated with nonspecific cytotoxic activity against CESS targets. The generation of these cytolytic cells is also radiation sensitive. A correlation was found between PWM-induced cytotoxicity against CESS and the suppression of IL-6-dependent IgG production. But cytotoxicity toward CESS targets is not responsible for this suppression because IL-2 induces equivalent or greater nonspecific cytotoxicity against CESS in the total absence ofmore » suppression of CESS-derived IgG production and suppression is also induced by mitogen-activated PBL separated from CESS targets by a cell-impermeable membrane. This suppression was not mediated by TNF alpha/beta or IFN-gamma. In systemic lupus erythematosus, suppression of IL-6-dependent IgG production is impaired in patients with active disease (29.2 +/- 13.7%) compared to patients with inactive disease (70 +/- 19.5%) or normal controls (82.8 +/- 9.2%). There is also a defect in mitogen-induced nonspecific cytotoxicity in active SLE (specific lysis 15.1 +/- 3.5%, compared to 34 +/- 4% in normals). Pokeweed mitogen-activated PBL can therefore normally induce suppression of B-cell IL-6 responses and this response is deficient in lupus.« less

  2. Herbal remedy magnolol suppresses IL-6-induced STAT3 activation and gene expression in endothelial cells

    PubMed Central

    Chen, Shih-Chung; Chang, Ying-Ling; Wang, Danny Ling; Cheng, Jing-Jy

    2006-01-01

    Magnolol (Mag), an active constituent isolated from the Chinese herb Hou p'u (Magnolia officinalis) has long been used to suppress inflammatory processes. Chronic inflammation is well known to be involved in vascular injuries such as atherosclerosis in which interleukin (IL)-6 may participate. Signal transducer and activator of transcription protein 3 (STAT3), a transcription factor involved in inflammation and the cell cycle, is activated by IL-6. In this study, we evaluated whether Mag can serve as an anti-inflammatory agent during endothelial injuries. The effects of Mag on IL-6-induced STAT3 activation and downstream target gene induction in endothelial cells (ECs) were examined. Pretreatment of ECs with Mag dose dependently inhibited IL-6-induced Tyr705 and Ser727 phosphorylation in STAT3 without affecting the phosphorylation of JAK1, JAK2, and ERK1/2. Mag pretreatment of these ECs dose dependently suppressed IL-6-induced promoter activity of intracellular cell adhesion molecule (ICAM)-1 that contains functional IL-6 response elements (IREs). An electrophoretic mobility shift assay (EMSA) revealed that Mag treatment significantly reduced STAT3 binding to the IRE region. Consistently, Mag treatment markedly inhibited ICAM-1 expression on the endothelial surface. As a result, reduced monocyte adhesion to IL-6-activated ECs was observed. Furthermore, Mag suppressed IL-6-induced promoter activity of cyclin D1 and monocyte chemotactic protein (MCP)-1 for which STAT3 activation plays a role. In conclusion, our results indicate that Mag inhibits IL-6-induced STAT3 activation and subsequently results in the suppression of downstream target gene expression in ECs. These results provide a therapeutic basis for the development of Mag as an anti-inflammatory agent for vascular disorders including atherosclerosis. PMID:16520748

  3. Ketamine suppresses the substance P-induced production of IL-6 and IL-8 by human U373MG glioblastoma/astrocytoma cells.

    PubMed

    Yamaguchi, Keisuke; Kumakura, Seiichiro; Murakami, Taisuke; Someya, Akimasa; Inada, Eiichi; Nagaoka, Isao

    2017-03-01

    The neuropeptide substance P (SP) is an important mediator of neurogenic inflammation within the central and peripheral nervous systems. SP has been shown to induce the expression of pro-inflammatory cytokines implicated in the pathogenesis of several disorders of the human brain via the neurokinin-1 receptor (NK-1R). Ketamine, an intravenous anesthetic agent, functions as a competitive antagonist of the excitatory neurotransmission N-methyl-D‑aspartate (NMDA) receptor, and also antagonizes the NK-1R by interfering with the binding of SP. In the present study, we investigated the anti-inflammatory effects of ketamine on the SP-induced activation of a human astrocytoma cell line, U373MG, which expresses high levels of NK-1R. The results from our experiments indicated that ketamine suppressed the production of interleukin (IL)-6 and IL-8 by the U373MG cells. Furthermore, ketamine inhibited the SP-induced activation of extracellular signal‑regulated kinase (ERK)1/2, p38 mitogen-activated protein kinase (MAPK) and nuclear factor-κB (NF-κB). Taken together, these observations suggest that ketamine may suppress the SP-induced activation (IL-6 and IL-8 production) of U373MG cells by inhibiting the phosphorylation of signaling molecules (namely ERK1/2, p38 MAPK and NF-κB), thereby exerting anti‑inflammatory effects. Thus, ketamine may modulate SP-induced inflammatory responses by NK-1R‑expressing cells through the suppression of signaling molecules (such as ERK1/2, p38 MAPK and NF-κB).

  4. A semi-synthetic natural product blocks collagen induced arthritis by preferentially suppressing the production of IL-6.

    PubMed

    Kulkarni-Almeida, Asha; Shah, Meet; Jadhav, Mahesh; Hegde, Bindu; Trivedi, Jacqueline; Mishra, Prabhu D; Mahajan, Girish B; Dadarkar, Shruta; Gupte, Ravindra; Dagia, Nilesh

    2016-04-01

    Rheumatoid arthritis (RA), an autoimmune-inflammatory disease is characterized by dysregulation of signal transduction pathways, increased production of pro-inflammatory cytokines, enhanced leukocyte infiltration into synovial microvascular endothelium, extensive formation of hyper proliferative pannus, degradation of cartilage and bone erosion. Several compounds that abrogate cytokine production demonstrate a therapeutic effect in experimental models of arthritis. In this study, we report that a novel semi-synthetic natural product (Compound A) being a preferential IL-6 inhibitor, is efficacious in a murine model of arthritis. In vitro evaluations of pro-inflammatory cytokine production reveal that Compound A preferentially inhibits induced production of IL-6 and not TNF-α from THP-1 cells and isolated human monocytes. Furthermore, Compound A robustly inhibits the spontaneous production of IL-6 from pathologically relevant synovial tissue cells isolated from patients with active RA. In a physiologically relevant assay, Compound A selectively inhibits the activated T cell contact-mediated production of IL-6 from human monocytes. Compound A, at pharmacologically efficacious concentrations, does not significantly curtail the LPS-induced activation of p38 MAPKs. In the collagen-induced arthritis (CIA) mouse model (i) macroscopic observations demonstrate that Compound A, administered subcutaneously in a therapeutic regimen, significantly and dose-dependently inhibits disease associated increases in articular index and paw thickness; (ii) histological analyses of paw tissues reveal that Compound A prominently diminishes joint destruction, hyperproliferative pannus formation and infiltration of inflammatory cells. Collectively, these results provide direct evidence that Compound A, a novel preferential IL-6 inhibitor, suppresses collagen-induced arthritis, and may be a potential therapeutic for treating patients with active RA. Copyright © 2016. Published by Elsevier B.V.

  5. Midazolam suppresses interleukin-1β-induced interleukin-6 release from rat glial cells

    PubMed Central

    2011-01-01

    Background Peripheral-type benzodiazepine receptor (PBR) expression levels are low in normal human brain, but their levels increase in inflammation, brain injury, neurodegenerative states and gliomas. It has been reported that PBR functions as an immunomodulator. The mechanisms of action of midazolam, a benzodiazepine, in the immune system in the CNS remain to be fully elucidated. We previously reported that interleukin (IL)-1β stimulates IL-6 synthesis from rat C6 glioma cells and that IL-1β induces phosphorylation of inhibitory kappa B (IκB), p38 mitogen-activated protein (MAP) kinase, stress-activated protein kinase (SAPK)/c-Jun N-terminal kinase (JNK), extracellular signal-regulated kinase 1/2, and signal transducer and activator of transcription (STAT)3. It has been shown that p38 MAP kinase is involved in IL-1β-induced IL-6 release from these cells. In the present study, we investigated the effect of midazolam on IL-1β-induced IL-6 release from C6 cells, and the mechanisms of this effect. Methods Cultured C6 cells were stimulated by IL-1β. IL-6 release from C6 cells was measured using an enzyme-linked immunosorbent assay, and phosphorylation of IκB, the MAP kinase superfamily, and STAT3 was analyzed by Western blotting. Results Midazolam, but not propofol, inhibited IL-1β-stimulated IL-6 release from C6 cells. The IL-1β-stimulated levels of IL-6 were suppressed by wedelolactone (an inhibitor of IκB kinase), SP600125 (an inhibitor of SAPK/JNK), and JAK inhibitor I (an inhibitor of JAK 1, 2 and 3). However, IL-6 levels were not affected by PD98059 (an inhibitor of MEK1/2). Midazolam markedly suppressed IL-1β-stimulated STAT3 phosphorylation without affecting the phosphorylation of p38 MAP kinase, SAPK/JNK or IκB. Conclusion These results strongly suggest that midazolam inhibits IL-1β-induced IL-6 release in rat C6 glioma cells via suppression of STAT3 activation. Midazolam may affect immune system function in the CNS. PMID:21682888

  6. A standardized extract of Butea monosperma (Lam.) flowers suppresses the IL-1β-induced expression of IL-6 and matrix-metalloproteases by activating autophagy in human osteoarthritis chondrocytes.

    PubMed

    Ansari, Mohammad Y; Khan, Nazir M; Haqqi, Tariq M

    2017-12-01

    Osteoarthritis (OA) is a leading cause of joint dysfunction, disability and poor quality of life in the affected population. The underlying mechanism of joint dysfunction involves increased oxidative stress, inflammation, high levels of cartilage extracellular matrix degrading proteases and decline in autophagy-a mechanism of cellular defense. There is no disease modifying therapies currently available for OA. Different parts of the Butea monosperma (Lam.) plant have widely been used in the traditional Indian Ayurvedic medicine system for the treatment of various human diseases including inflammatory conditions. Here we studied the chondroprotective effect of hydromethanolic extract of Butea monosperma (Lam.) flowers (BME) standardized to the concentration of Butein on human OA chondrocytes stimulated with IL-1β. The hydromethanolic extract of Butea monosperma (Lam.) (BME) was prepared with 70% methanol-water mixer using Soxhlet. Chondrocytes viability after BME treatment was measured by MTT assay. Gene expression levels were determined by quantitative polymerase chain reaction (qPCR) using TaqMan assays and immunoblotting with specific antibodies. Autophagy activation was determined by measuring the levels of microtubule associated protein 1 light chain 3-II (LC3-II) by immunoblotting and visualization of autophagosomes by transmission electron and confocal microscopy. BME was non-toxic to the OA chondrocytes at the doses employed and suppressed the IL-1β induced expression of inerleukin-6 (IL-6) and matrix metalloprotease-3 (MMP-3), MMP-9 and MMP-13. BME enhanced autophagy in chondrocytes as determined by measuring the levels of LC3-II by immunoblotting and increased number of autophagosomes in BME treated chondrocytes by transmission electron microscopy and confocal microscopy. BME upregulated the expression of several autophagy related genes and increased the autophagy flux in human OA chondrocytes under pathological conditions. Further analysis revealed that

  7. Combination of IL-6 and sIL-6R differentially regulate varying levels of RANKL-induced osteoclastogenesis through NF-κB, ERK and JNK signaling pathways.

    PubMed

    Feng, Wei; Liu, Hongrui; Luo, Tingting; Liu, Di; Du, Juan; Sun, Jing; Wang, Wei; Han, Xiuchun; Yang, Kaiyun; Guo, Jie; Amizuka, Norio; Li, Minqi

    2017-01-27

    Interleukin (IL)-6 is known to indirectly enhance osteoclast formation by promoting receptor activator of nuclear factor kappa-B ligand (RANKL) production by osteoblastic/stromal cells. However, little is known about the direct effect of IL-6 on osteoclastogenesis. Here, we determined the direct effects of IL-6 and its soluble receptor (sIL-6R) on RANKL-induced osteoclast formation by osteoclast precursors in vitro. We found IL-6/sIL-6R significantly promoted and suppressed osteoclast differentiation induced by low- (10 ng/ml) and high-level (50 ng/ml) RANKL, respectively. Using a bone resorption pit formation assay, expression of osteoclastic marker genes and transcription factors confirmed differential regulation of RANKL-induced osteoclastogenesis by IL-6/sIL-6R. Intracellular signaling transduction analysis revealed IL-6/sIL-6R specifically upregulated and downregulated the phosphorylation of NF-κB (nuclear factor kappa-light-chain-enhancer of activated B cells), ERK (extracellular signal-regulated kinase) and JNK (c-Jun N-terminal kinase) induced by low- and high level RANKL, respectively. Taken together, our findings demonstrate that IL-6/sIL-6R differentially regulate RANKL-induced osteoclast differentiation and activity through modulation of NF-κB, ERK and JNK signaling pathways. Thus, IL-6 likely plays a dual role in osteoclastogenesis either as a pro-resorption factor or as a protector of bone, depending on the level of RANKL within the local microenvironment.

  8. Interleukin-6 and soluble interleukin-6 receptor suppress osteoclastic differentiation by inducing PGE(2) production in chondrocytes.

    PubMed

    Honda, Kazuhiro

    2011-03-01

    This study examined how interleukin-6 (IL-6) and soluble IL-6 receptor (sIL-6r) influence osteoclastic differentiation through the function of chondrocytes. Chondrocytes were cultured with or without IL-6 and/or sIL-6r in the presence or absence of NS398, a specific inhibitor of cyclooxygenase (COX)-2, for up to 28 days. Chondrocytes were also cultured with or without IL-6 and sIL-6r for 28 days, and the conditioned medium from cells cultured without IL-6 and sIL-6r was used to induce differentiation of RAW264.7 cells into osteoclast precursors. Osteoclastic differentiation was assessed by tartrate-resistant acid phosphatase (TRAP) staining. Expression of osteoprotegerin (OPG), receptor activator of NF-κB ligand (RANKL), COX-2, and prostaglandin E(2) (PGE(2)) increased in cells exposed to IL-6 and sIL-6r, whereas expression of macrophage colony-stimulating factor (M-CSF) and bone resorption-related enzymes decreased. NS398 blocked the stimulatory/suppressive effects of IL-6 and sIL-6r on the expression of OPG, RANKL, and M-CSF. Fewer TRAP-positive multinucleated cells were detected after treatment with conditioned medium from IL-6- and sIL-6r-treated chondrocytes than after treatment with conditioned medium from untreated chondrocytes. These results suggest that IL-6 and sIL-6r interfere with osteoclast function through the involvement of chondrocytes. Specifically, they appear to suppress the differentiation of osteoclast precursors into osteoclasts by inducing chondrocytic PGE(2) production, which, in turn, increases OPG secretion and decreases M-CSF secretion by chondrocytes.

  9. DNA activates human immune cells through a CpG sequence-dependent manner

    PubMed Central

    Bauer, M; Heeg, K; Wagner, H; Lipford, G B

    1999-01-01

    While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

  10. Nicotine induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Tingting; Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; Chen, Man

    Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a singlemore » site CpG methylation at nt -377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. -- Highlights: Black-Right-Pointing-Pointer Nicotine-induced StAR inhibition in two human adrenal cell models. Black-Right-Pointing-Pointer Nicotine-induced single CpG site methylation in StAR promoter. Black-Right-Pointing-Pointer Persistent StAR inhibition and single CpG methylation after nicotine

  11. ST2 suppresses IL-6 production via the inhibition of I{kappa}B degradation induced by the LPS signal in THP-1 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Takezako, Naoki; Hayakawa, Morisada; Hayakawa, Hiroko

    2006-03-10

    LPS induces the production of inflammatory cytokines via the stimulation of Toll-like receptors. In this study, we demonstrated that a soluble secreted form of the ST2 gene product (ST2), a member of the interleukin-1 receptor family, suppressed the production of IL-6 in an LPS-stimulated human monocytic leukemia cell line, THP-1. Immunofluorescence confocal microscopy revealed the binding of ST2 to the surface of the THP-1 cells, in which ST2 led to decreased binding of nuclear factor-{kappa}B to the IL-6 promoter. Furthermore, the degradation of I{kappa}B in the cytoplasm after LPS stimulation was reduced by pretreatment with ST2. These results demonstrated thatmore » ST2 negatively regulates LPS-induced IL-6 production via the inhibition of I{kappa}B degradation in THP-1 cells.« less

  12. Epicutaneous immunization with ovalbumin and CpG induces TH1/TH17 cytokines, which regulate IgE and IgG2a production

    PubMed Central

    Majewska-Szczepanik, Monika; Askenase, Philip W.; Lobo, Francis M.; Marcińska, Katarzyna; Wen, Li; Szczepanik, Marian

    2017-01-01

    Background Subcutaneous allergen-specific immunotherapy is a standard route for the immunotherapy of allergic diseases. It modulates the course of allergy and can generate long-term remission. However, subcutaneous allergen-specific immunotherapy can also induce anaphylaxis in some patients, and therefore additional routes of administration should be investigated to improve the safety and tolerability of immunotherapy. Objective We sought to determine whether epicutaneous treatment with antigen in the presence of a Toll-like receptor 9 agonist can suppress TH2-mediated responses in an antigen-specific manner. Methods Epicutaneous immunization was performed by applying a skin patch soaked with ovalbumin (OVA) plus CpG, and its suppressor activity was determined by using the mouse model of atopic dermatitis. Finally, adoptive cell transfers were implemented to characterize the regulatory cells that are induced by epicutaneous immunization. Results Epicutaneous immunization with OVA and CpG reduces the production of OVA-specific IgE and increases the synthesis of OVA-specific IgG2a antibodies in an antigen-specific manner. Moreover, eosinophil peroxidase activity in the skin and production of IL-4, IL-5, IL-10, and IL-13 are suppressed. The observed reduction of IgE synthesis is transferable with T-cell receptor (TCR) αβ+CD4+CD25− cells, whereas IgG2a production is dependent on both TCRαβ+ and TCRγδ+ T cells. Further experiments show that the described phenomenon is myeloid differentiation primary response 88, IFN-γ, and IL-17A dependent. Finally, the results suggest that epicutaneous immunization with OVA and CpG decreases the synthesis of OVA-specific IgE and skin eosinophil peroxidase activity in mice with ongoing skin allergy. Conclusion Epicutaneous application of protein antigen in the presence of adjuvant could be an attractive needle-free and self-administered immunotherapy for allergic diseases. PMID:26810716

  13. Activation of GPER suppresses migration and angiogenesis of triple negative breast cancer via inhibition of NF-κB/IL-6 signals.

    PubMed

    Liang, Shuwei; Chen, Zhuojia; Jiang, Guanmin; Zhou, Yan; Liu, Qiao; Su, Qiao; Wei, Weidong; Du, Jun; Wang, Hongsheng

    2017-02-01

    Triple-negative breast cancer (TNBC) is characterized by high vascularity and frequent metastasis. Here, we found that activation of G protein-coupled estrogen receptor (GPER) by its specific agonist G-1 can significantly inhibit interleukin 6 (IL-6) and vascular endothelial growth factor A (VEGF-A). TNBC tissue microarrays from 100 TNBC patients revealed GPER is negatively associated with IL-6 levels and higher grade and stage. Activation of GPER or anti-IL-6 antibody can inhibit both in vitro tube formation of human umbilical vein endothelial cells (HUVECs) and migration of TNBC cells. While recombinant IL-6 supplementary can significantly reverse the inhibitory effects of G-1, suggesting the essential role of IL-6 in G-1 induced suppression of angiogenesis and invasiveness of TNBC cells. G-1 treatment decreased the phosphorylation, nuclear localization, transcriptional activities of NF-κB and suppressed its binding with IL-6 promoter. BAY11-7028, the inhibitor of NF-κB, can mimic the effect of G-1 to suppression of IL-6 and VEGF-A. While over expression of p65 can attenuate the inhibitory effects of G-1 on IL-6 and VEGF expression. The suppression of IL-6 by G-1 can further inhibit HIF-1α and STAT3 signals in TNBC cells by inhibition their expression, phosphorylation and/or nuclear localization. Moreover, G-1 also inhibited the in vivo NF-κB/IL-6 signals and angiogenesis and metastasis of MDA-MB-231 xenograft tumors. In conclusion, our study demonstrated that activation of GPER can suppress migration and angiogenesis of TNBC via inhibition of NF-κB/IL-6 signals, therefore it maybe act as an important target for TNBC treatment. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  14. Voluntary Running Suppresses Tumor Growth through Epinephrine- and IL-6-Dependent NK Cell Mobilization and Redistribution.

    PubMed

    Pedersen, Line; Idorn, Manja; Olofsson, Gitte H; Lauenborg, Britt; Nookaew, Intawat; Hansen, Rasmus Hvass; Johannesen, Helle Hjorth; Becker, Jürgen C; Pedersen, Katrine S; Dethlefsen, Christine; Nielsen, Jens; Gehl, Julie; Pedersen, Bente K; Thor Straten, Per; Hojman, Pernille

    2016-03-08

    Regular exercise reduces the risk of cancer and disease recurrence. Yet the mechanisms behind this protection remain to be elucidated. In this study, tumor-bearing mice randomized to voluntary wheel running showed over 60% reduction in tumor incidence and growth across five different tumor models. Microarray analysis revealed training-induced upregulation of pathways associated with immune function. NK cell infiltration was significantly increased in tumors from running mice, whereas depletion of NK cells enhanced tumor growth and blunted the beneficial effects of exercise. Mechanistic analyses showed that NK cells were mobilized by epinephrine, and blockade of β-adrenergic signaling blunted training-dependent tumor inhibition. Moreover, epinephrine induced a selective mobilization of IL-6-sensitive NK cells, and IL-6-blocking antibodies blunted training-induced tumor suppression, intratumoral NK cell infiltration, and NK cell activation. Together, these results link exercise, epinephrine, and IL-6 to NK cell mobilization and redistribution, and ultimately to control of tumor growth. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Photodynamic therapy affects the expression of IL-6 and IL-10 in vivo

    NASA Astrophysics Data System (ADS)

    Gollnick, Sandra O.; Musser, David A.; Henderson, Barbara W.

    1998-05-01

    Photodynamic therapy (PDT), which can effectively destroy malignant tissue, also induces a complex immune response which potentiates anti-tumor immunity, but also inhibits skin contact hypersensitivity (CHS) and prolongs skin graft survival. The underlying mechanisms responsible for these effects are poorly understood, but are likely to involve meditation by cytokines. We demonstrate in a BALB/c mouse model that PDT delivered to normal and tumor tissue in vivo causes marked changes in the expression of cytokines interleukin (IL)-6 and IL-10. IL-6 mRNA and protein are rapidly and strongly enhanced in the PDT treated EMT6 tumor. Previous studies have shown that intratumoral injection of IL- 6 or transduction of the IL-6 gene into tumor cells can enhance tumor immunogenicity and inhibit tumor growth in experimental murine tumor systems. Thus, PDT may enhance local anti-tumor immunity by up-regulating IL-6. PDT also results in an increase in IL-10 mRNA and protein in the skin. The same PDT regime which enhances IL-10 production in the skin has been shown to strongly inhibit the CHS response. The kinetics of IL-10 expression coincide with the known kinetics of PDT induced CHS suppression and we propose that the enhanced IL-10 expression plays a role in the observed suppression of cell mediated responses seen following PDT.

  16. Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

    NASA Astrophysics Data System (ADS)

    Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

    2015-08-01

    In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

  17. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei

    PubMed Central

    Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.

    2006-01-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571

  18. A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

    PubMed

    Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

    2006-03-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

  19. Doxycycline Attenuates Leptospira-Induced IL-1β by Suppressing NLRP3 Inflammasome Priming

    PubMed Central

    Zhang, Wenlong; Xie, Xufeng; Wu, Dianjun; Jin, Xuemin; Liu, Runxia; Hu, Xiaoyu; Fu, Yunhe; Ding, Zhuang; Zhang, Naisheng; Cao, Yongguo

    2017-01-01

    Doxycycline (Dox), a semisynthetic antibiotic, has been reported to exert multiple immunomodulatory effects. Treatment with Dox has a satisfactory curative effect against leptospirosis. In addition to its antibacterial action, we supposed that Dox also modulated immune response in controlling leptospira infection. Using J774A.1 mouse macrophages, the effects of Dox on protein and mRNA levels of IL-1β and TNF-α were investigated after infection with live or sonicated Leptospira interrogans serovar Lai strain Lai (56601). Specifically, the level of IL-1β but not TNF-α was sharply decreased when treated with Dox in leptospira-infected macrophages. Western blot analysis showed that Dox suppressed the activation of leptospira-induced MAPK and NF-κB signaling pathways. Using NLRP3-deficient and NLRC4-deficient mice, the data showed that the expression of leptospira-induced IL-1β was mainly dependent on the presence of NLRP3 inflammasome in macrophages. Meanwhile, Dox suppressed leptospira-induced NLRP3 inflammasome priming with the upregulation of the Na/K-ATPase Pump β1 subunit. The inhibition effect of Dox on IL-1β was also conspicuous in cells with lipopolysaccharide and ATP stimulation. These results were confirmed in vivo, as peritoneal fluids of mice and organs of hamsters expressed less IL-1β after treatment of leptospiral infection with Dox. Our results indicated that Dox also modulated immune response to attenuate leptospira-induced IL-1β by suppressing p38, JNK, p65, and NLRP3 inflammasome priming. PMID:28791016

  20. IL-6 Improves Energy and Glucose Homeostasis in Obesity via Enhanced Central IL-6 trans-Signaling.

    PubMed

    Timper, Katharina; Denson, Jesse Lee; Steculorum, Sophie Marie; Heilinger, Christian; Engström-Ruud, Linda; Wunderlich, Claudia Maria; Rose-John, Stefan; Wunderlich, F Thomas; Brüning, Jens Claus

    2017-04-11

    Interleukin (IL)-6 engages similar signaling mechanisms to leptin. Here, we find that central application of IL-6 in mice suppresses feeding and improves glucose tolerance. In contrast to leptin, whose action is attenuated in obesity, the ability of IL-6 to suppress feeding is enhanced in obese mice. IL-6 suppresses feeding in the absence of neuronal IL-6-receptor (IL-6R) expression in hypothalamic or all forebrain neurons of mice. Conversely, obese mice exhibit increased soluble IL-6R levels in the cerebrospinal fluid. Blocking IL-6 trans-signaling in the CNS abrogates the ability of IL-6 to suppress feeding. Furthermore, gp130 expression is enhanced in the paraventricular nucleus of the hypothalamus (PVH) of obese mice, and deletion of gp130 in the PVH attenuates the beneficial central IL-6 effects on metabolism. Collectively, these experiments indicate that IL-6 trans-signaling is enhanced in the CNS of obese mice, allowing IL-6 to exert its beneficial metabolic effects even under conditions of leptin resistance. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  1. IL-21/IL-21R signaling suppresses intestinal inflammation induced by DSS through regulation of Th responses in lamina propria in mice

    PubMed Central

    Wang, Yuanyuan; Jiang, Xuefeng; Zhu, Junfeng; Dan Yue; Zhang, Xiaoqing; Wang, Xiao; You, Yong; Wang, Biao; Xu, Ying; Lu, Changlong; Sun, Xun; Yoshikai, Yasunobu

    2016-01-01

    Serum level of IL-21 is increased in patients with inflammatory bowel diseases (IBD), suggesting that IL-21/IL-21 receptor (IL-21R) signaling may be involved in the pathogenesis of IBD. However, the role of IL-21/IL-21 receptor signaling plays in the pathogenesis of IBD is not very clear. In this study, using IL-21R.KO mice, we tested the role of IL-21/IL-21R signaling in the regulation of T helper cell responses during intestinal inflammation. Here we found that IL-21R.KO mice were more susceptible to DSS-induced colitis as compared with C57BL/6 mice. The spontaneous inflammatory cytokines released by macrophages in LP of colon were significantly increased, and Th2, Th17 and Treg responses were down-regulated markedly. However, Th1 responses were significantly up-regulated in IL-21R.KO mice. Meanwhile, the population of CD8+CD44+IFN-γ+ T cells was markedly elevated in LP of inflammatory intestine of IL-21RKO mice. In vivo, after disease onset, DSS-induced intestinal inflammation was ameliorated in C57BL/6 mice treated with rIL-21. Our results demonstrate that IL-21/IL-21R signaling contributes to protection against DSS-induced acute colitis through suppression of Th1 and activation of Th2, Th17 and Treg responses in mice. Therefore, therapeutic manipulation of IL-21/IL-21R activity may allow improved immunotherapy for IBD and other inflammatory diseases associated with Th cell responses. PMID:27545302

  2. Increased expression of interleukin-6 (IL-6) gene transcript in relation to IL-6 promoter hypomethylation in gingival tissue from patients with chronic periodontitis.

    PubMed

    Kobayashi, Tetsuo; Ishida, Kohei; Yoshie, Hiromasa

    2016-09-01

    DNA methylation of the cytokine genes may play a role in the pathogenesis of periodontitis. The aim of this study is to evaluate whether the alteration of interleukin-6 (IL-6) gene promoter methylation in the gingival tissue (GT) and peripheral blood (PB) is unique to chronic periodontitis (CP). DNA isolated from the GT and PB of 25 patients with (CP) and 20 healthy controls (H) was modified with sodium bisulfite and analyzed for IL-6 promoter methylation with direct sequencing. The levels of IL-6 mRNA and serum IL-6 protein were evaluated by a quantitative reverse transcription polymerase chain reaction and an enzyme-linked immunosorbent assay. The CP group showed that the overall methylation rates of IL-6 promoter that contained 19 cytosine-guanine dinucleotide (CpG) motifs were significantly decreased in GT in comparison to PB (p<0.001), which was significantly negatively correlated with the probing depth (p=0.003). The GT and PB of the H group displayed similar overall methylation rates. No significant difference was observed in the methylation rates at each CpG in GT in comparison to the PB in both groups. The levels of IL-6 mRNA in the GT and PB and serum IL-6 of the two groups were comparable. The ratio of IL-6 mRNA in the GT relative to the PB was significantly higher in the CP group than in the H group (p=0.03). The increased expression of IL-6 gene transcription may be related to IL-6 promoter hypomethylation in the GT from CP patients. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Avian leukosis virus subgroup J induces VEGF expression via NF-κB/PI3K-dependent IL-6 production.

    PubMed

    Gao, Yanni; Zhang, Yao; Yao, Yongxiu; Guan, Xiaolu; Liu, Yongzhen; Qi, Xiaole; Wang, Yongqiang; Liu, Changjun; Zhang, Yanping; Gao, Honglei; Nair, Venugopal; Wang, Xiaomei; Gao, Yulong

    2016-12-06

    Avian leukosis virus subgroup J (ALV-J) is an oncogenic virus causing hemangiomas and myeloid tumors in chickens. Interleukin-6 (IL-6) is a multifunctional pro-inflammatory interleukin involved in many types of cancer. We previously demonstrated that IL-6 expression was induced following ALV-J infection in chickens. The aim of this study is to characterize the mechanism by which ALV-J induces IL-6 expression, and the role of IL-6 in tumor development. Our results demonstrate that ALV-J infection increases IL-6 expression in chicken splenocytes, peripheral blood lymphocytes, and vascular endothelial cells. IL-6 production is induced by the ALV-J envelope protein gp85 and capsid protein p27 via PI3K- and NF-κB-mediated signaling. IL-6 in turn induced expression of vascular endothelial growth factor (VEGF)-A and its receptor, VEGFR-2, in vascular endothelial cells and embryonic vascular tissues. Suppression of IL-6 using siRNA inhibited the ALV-J induced VEGF-A and VEGFR-2 expression in vascular endothelial cells, indicating that the ALV-J-induced VEGF-A/VEGFR-2 expression is mediated by IL-6. As VEGF-A and VEGFR-2 are important factors in oncogenesis, our findings suggest that ALV-J hijacks IL-6 to promote tumorigenesis, and indicate that IL-6 could potentially serve as a therapeutic target in ALV-J infections.

  4. Regulatory effect of calcineurin inhibitor, tacrolimus, on IL-6/sIL-6R-mediated RANKL expression through JAK2-STAT3-SOCS3 signaling pathway in fibroblast-like synoviocytes

    PubMed Central

    2013-01-01

    Introduction This study investigated whether the calcineurin inhibitor, tacrolimus, suppresses receptor activator of NF-κB ligand (RANKL) expression in fibroblast-like synoviocytes (FLS) through regulation of IL-6/Janus activated kinase (JAK2)/signal transducer and activator of transcription-3 (STAT3) and suppressor of cytokine signaling (SOCS3) signaling. Methods The expression of RANKL, JAK2, STAT3, and SOCS3 proteins was assessed by western blot analysis, real-time PCR and ELISA in IL-6 combined with soluble IL-6 receptor (sIL-6R)-stimulated rheumatoid arthritis (RA)-FLS with or without tacrolimus treatment. The effects of tacrolimus on synovial inflammation and bone erosion were assessed using mice with arthritis induced by K/BxN serum. Immunofluorescent staining was performed to identify the effect of tacrolimus on RANKL and SOCS3. The tartrate-resistant acid phosphatase staining assay was performed to assess the effect of tacrolimus on osteoclast differentiation. Results We found that RANKL expression in RA FLS is regulated by the IL-6/sIL-6R/JAK2/STAT3/SOCS3 pathway. Inhibitory effects of tacrolimus on RANKL expression in a serum-induced arthritis mice model were identified. Tacrolimus inhibits RANKL expression in IL-6/sIL-6R-stimulated FLS by suppressing STAT3. Among negative regulators of the JAK/STAT pathway, such as CIS1, SOCS1, and SOCS3, only SOCS3 is significantly induced by tacrolimus. As compared to dexamethasone and methotrexate, tacrolimus more potently suppresses RANKL expression in FLS. By up-regulating SOCS3, tacrolimus down-regulates activation of the JAK-STAT pathway by IL-6/sIL-6R trans-signaling, thus decreasing RANKL expression in FLS. Conclusions These data suggest that tacrolimus might affect the RANKL expression in IL-6 stimulated FLS through STAT3 suppression, together with up-regulation of SOCS3. PMID:23406906

  5. Irinotecan (CPT-11)-induced elevation of bile acids potentiates suppression of IL-10 expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fang, Zhong-Ze; Department of Toxicology, School of Public Health, Tianjin Medical University, Tianjin; Joint Center for Translational Medicine, Dalian Institute of Chemical Physics, Chinese Academy of Sciences and First Affiliated Hospital of Liaoning Medical University, Dalian

    Irinotecan (CPT-11) is a first-line anti-colon cancer drug, however; CPT-11-induced toxicity remains a key factor limiting its clinical application. To search for clues to the mechanism of CPT-11-induced toxicity, metabolomics was applied using ultra-performance liquid chromatography coupled with electrospray ionization quadrupole time-of-flight mass spectrometry. Intraperitoneal injection of 50 mg/kg of CPT-11 induced loss of body weight, and intestine toxicity. Changes in gallbladder morphology suggested alterations in bile acid metabolism, as revealed at the molecular level by analysis of the liver, bile, and ileum metabolomes between the vehicle-treated control group and the CPT-11-treated group. Analysis of immune cell populations further showedmore » that CPT-11 treatment significantly decreased the IL-10-producing CD4 T cell frequency in intestinal lamina propria lymphocytes, but not in spleen or mesenteric lymph nodes. In vitro cell culture studies showed that the addition of bile acids deoxycholic acid and taurodeoxycholic acid accelerated the CPT-11-induced suppression of IL-10 secretion by activated CD4{sup +} naive T cells isolated from mouse splenocytes. These results showed that CPT-11 treatment caused metabolic changes in the composition of bile acids that altered CPT-11-induced suppression of IL-10 expression. - Highlights: • CPT-11 is an effective anticancer drug, but induced toxicity limits its application in the clinic. • CPT-11 decreased IL-10-producing CD4 T cell frequency in intestinal lamina propria lymphocytes. • CPT-11 altered the composition of bile acid metabolites, notably DCA and TDCA in liver, bile and intestine. • DCA and TDCA potentiated CPT-11-induced suppression of IL-10 secretion by active CD4{sup +} naive T cells.« less

  6. Carvedilol suppresses circulating and hepatic IL-6 responsible for hepatocarcinogenesis of chronically damaged liver in rats

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Balaha, Mohamed, E-mail: Mohamed.Balaha@Med.Tanta.

    Carvedilol is an anti-oxidant non-selective β-blocker used for reduction of portal blood pressure, prophylaxis of esophageal varices development and bleeding in chronic liver diseases. Recently, it exhibited potent anti-inflammatory, anti-fibrotic, anti-proliferative and anti-carcinogenic effects. In the present study, we evaluated the possible suppressive effect of carvedilol on circulating and hepatic IL-6 levels responsible for hepatocarcinogenesis in a rat model of hepatic cirrhosis. Besides, its effect on hepatic STAT-3 levels, function tests, oxidative stress markers, and hydroxyproline content, hepatic tissue histopathological changes and immunohistochemical expression of E & N-cadherin. Nine-week-old male Wistar rats injected intraperitoneal by 1 ml/kg 10% CCL{sub 4}more » in olive oil three times/week (every other day) for 12 weeks to induce hepatic cirrhosis. Carvedilol (10 mg/kg/day suspended in 0.5% CMC orally), silymarin (50 mg/kg/day suspended in 0.5% CMC orally) or combination of both used to treat hepatic cirrhosis from 15th to 84th day. Our data showed that carvedilol and silymarin co-treatment each alone or in combination efficiently reduced the elevated serum IL-6, ALT, AST, ALP and BIL, hepatic IL-6, STAT-3, MDA levels and hydroxyproline content. In addition, it elevated the reduced serum ALB level, hepatic CAT activity and GSH level. Meanwhile, it apparently restored the normal hepatic architecture, collagen distribution and immunohistochemical E & N-cadherin expression. Furthermore, carvedilol was superior to silymarin in improving MDA level. Moreover, the combination of carvedilol and silymarin showed an upper hand in amelioration of the CCL{sub 4} induced hepatotoxicity than each alone. Therefore, carvedilol could be promising in prevention of hepatocarcinogenesis in chronic hepatic injuries. - Highlights: • Chronic liver damage ends into hepatocellular carcinoma in 5% of patients. • Persistent elevation of IL-6 induces

  7. TLR2/4 ligand-amplified liver inflammation promotes initiation of autoimmune hepatitis due to sustained IL-6/IL-12/IL-4/IL-25 expression.

    PubMed

    Chi, Gang; Feng, Xin-Xia; Ru, Ying-Xia; Xiong, Ting; Gao, Yuan; Wang, Han; Luo, Zhen-Long; Mo, Ran; Guo, Fang; He, Yong-Pei; Zhang, Gui-Mei; Tian, De-An; Feng, Zuo-Hua

    2018-05-21

    Autoimmune hepatitis (AIH), a serious autoimmune liver disease, can be a lifelong illness, leading to fibrosis, cirrhosis, and hepatocellular carcinoma (HCC). So far the mechanisms for disease initiation are largely unknown. Here we report that the amplified non-AIH liver inflammation could promote the initiation of AIH due to the sustained increase of IL-6, IL-12, IL-4, and IL-25 in the liver. The liver injury resulting from virus (adenovirus) or chemicals (CCl 4 ) could induce an amplified (stronger/long-lasting) hepatic inflammation by releasing the ligands for TLR2/TLR4. The amplified inflammation resulted in the increase of multiple cytokines and chemokines in the liver. Among them, the sustained increase of IL-6/IL-12 resulted in the activation of STAT3 and STAT4 in hepatic CD4 + CD25 + Treg cells, thus suppressing Foxp3 gene expression to reduce the suppressive function of Treg cells in the liver, but not those in the spleen. The increase of IL-12 and the impairment of Treg function promoted Th1 response in presence of self-mimicking antigen (human CYP2D6). Intriguingly, the amplified inflammation resulted in the increase of IL-4 and IL-25 in the liver. The moderate increase of IL-4 was sufficient for cooperating with IL-25 to initiate Th2 response, but inefficient in suppressing Th1 response, favoring the initiation of autoimmune response. Consequently, either adenovirus/CYP2D6 or CCl 4 /CYP2D6 could induce the autoimmune response and AIH in the mice, leading to hepatic fibrosis. The findings in this study suggest that the amplified non-AIH inflammation in the liver could be a driving force for the initiation of autoimmune response and AIH. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. High-fat Diet-induced Inflammation Accelerates Prostate Cancer Growth via IL6 Signaling.

    PubMed

    Hayashi, Takuji; Fujita, Kazutoshi; Nojima, Satoshi; Hayashi, Yujiro; Nakano, Kosuke; Ishizuya, Yu; Wang, Cong; Yamamoto, Yoshiyuki; Kinouchi, Toshiro; Matsuzaki, Kyosuke; Jingushi, Kentaro; Kato, Taigo; Kawashima, Atsunari; Nagahara, Akira; Ujike, Takeshi; Uemura, Motohide; Rodriguez Pena, Maria Del Carmen; Gordetsky, Jennifer B; Morii, Eiichi; Tsujikawa, Kazutake; Netto, George J; Nonomura, Norio

    2018-05-18

    High-fat diet (HFD) could induce prostate cancer progression. The aim of this study is to identify mechanisms of HFD-induced prostate cancer progression, focusing on inflammation. We administered HFD and celecoxib to autochthonous immunocompetent Pb-Cre+; Pten(fl/fl) model mice for prostate cancer. Tumor growth was evaluated by tumor weight and Ki67 stain, and local immune cells were assessed by flow cytometry at 22 weeks of age. Cytokines which correlated with tumor growth were identified, and the changes of tumor growth and local immune cells after inhibition of the cytokine signals were evaluated in the mice. Immunohistochemical analyses using prostatectomy specimens of obese patients were performed. HFD accelerated tumor growth, and increased the myeloid-derived suppressor cells (MDSCs) fraction and M2/M1 macrophage ratio in the model mice. Celecoxib suppressed tumor growth, and decreased both local MDSCs and M2/M1 macrophage ratio in HFD-fed mice. HFD-induced tumor growth was associated with IL6 secreted by prostatic macrophages, as were phosphorylated signal transducer and activator of transcription 3 (pSTAT3)-positive tumor cells. Anti-IL6 receptor antibody administration suppressed tumor growth, and decreased local MDSCs and pSTAT3-positive cell fractions in HFD-fed mice. The tumor-infiltrating CD11b-positive cell count was significantly higher in prostatectomy specimens of obese than those of non-obese prostate cancer patients. HFD increased MDSCs and accelerated prostate cancer tumor growth via IL6/pSTAT3 signaling in the mice. This mechanism could exist in obese prostate cancer patients. IL6-mediated inflammation could be a therapeutic target for prostate cancer. Copyright ©2018, American Association for Cancer Research.

  9. Suppression of IL-1beta-induced COX-2 expression by trichostatin A (TSA) in human endometrial stromal cells.

    PubMed

    Wu, Yan; Guo, Sun-Wei

    2007-11-01

    Over-production of cyclooxygenase-2 (COX-2) plays an important role in the positive feedback loop that leads to proliferation and inflammation in endometriosis. Following our observation that histone deacetylase inhibitors (HDACIs) trichostatin A (TSA) and valproic acid (VPA) can suppress proliferation of endometrial stromal cells, we sought to determine whether TSA suppresses IL-1beta-induced COX-2 expression in endometrial stromal cells. In vitro study using a recently established immortalized endometrial stromal cell line. The stromal cells were pretreated with TSA before stimulation with IL-1beta, and COX-2 gene and protein expression was measured by real-time quantitative RT-PCR and Western blot analysis, respectively. IL-1beta stimulated COX-2 expression in a concentration-dependent manner in endometrial stromal cells. The induced COX-2 gene and protein expression were suppressed by TSA pretreatment. TSA suppresses IL-1beta-induced COX-2 gene and protein expression in endometrial stromal cells. This finding, coupled with the findings that TSA and another HDACI, valproic acid, suppress proliferation and induce cell cycle arrest, suggests that HDACIs are a promising class of compound that has therapeutic potential for endometriosis.

  10. IL-1β directly suppress ghrelin mRNA expression in ghrelin-producing cells.

    PubMed

    Bando, Mika; Iwakura, Hiroshi; Ueda, Yoko; Ariyasu, Hiroyuki; Inaba, Hidefumi; Furukawa, Yasushi; Furuta, Hiroto; Nishi, Masahiro; Akamizu, Takashi

    2017-05-15

    In animal models, ghrelin production is suppressed by LPS administration. To elucidate the detailed molecular mechanisms involved in the phenomenon, we investigated the effects of LPS and LPS-inducible cytokines, including TNF-α, IL-1β, and IL-6, on the expression of ghrelin in the ghrelin-producing cell line MGN3-1. These cells expressed IL-1R, and IL-1β significantly suppressed ghrelin mRNA levels. The suppressive effects of IL-1β were attenuated by knockdown of IKKβ, suggesting the involvement of the NF-κB pathway. These results suggested that IL-1β is a major regulator of ghrelin expression during inflammatory processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Growth of HepG2 cells was suppressed through modulation of STAT6/IL-4 and IL-10 in RAW 264.7 cells treated by phytoglycoprotein (38 kDa).

    PubMed

    Lee, Jin; Lim, Kye-Taek

    2013-06-01

    Macrophage type 2 (M2) is closely associated with tumor progression and metastasis. Thus, in this study, the antitumor effect of Styrax japonica Siebold et al. Zuccarini (SJSZ) glycoprotein on HepG2 cell proliferation through modulating M2 was investigated by measuring [³H]-thymidine incorporation and proliferating cell nuclear antigen (PCNA), nitric oxide (NO), reactive oxygen species (ROS), mitogen-activated protein kinases, signal transducer and activator of transcription (STAT) 6, cytokines [interleukin (IL)-4, IL-10, IL-12, and interferon (IFN)-γ], and CD163-positive cells using biochemical analysis, radioactivity, Western blot, ELISA, quantitative real-time polymerase chain reaction, and flow cytometry in coculture system. RAW 264.7 cells were found to be cytotoxic to HepG2 cells but [³H]-thymidine incorporation and expression of PCNA was suppressed in the presence of the SJSZ glycoprotein (20 μg/ml). The SJSZ glycoprotein normalized production of NO and ROS and expression of inducible nitric oxide synthase, IFN-γ, and IL-12 but suppressed expression of pSTAT6, IL-4, IL-10, and CD163-positive cells. Thus, the results of this study suggest that the SJSZ glycoprotein suppresses proliferation of HepG2 cells by modulating M2.

  12. TLR4 induces CREB-mediated IL-6 production via upregulation of F-spondin to promote vascular smooth muscle cell migration

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Guan-Lin; Graduate Institutes of Life Sciences, National Defense Medical Center, Taipei, Taiwan; Wu, Jing-Yiing

    Toll-like receptor 4 (TLR4) is important in promoting inflammation and vascular smooth muscle cell (VSMC) migration, both of which contribute to atherosclerosis development and progression. But the mechanism underlying the regulation of TLR4 in VSMC migration remains unclear. Stimulation of VSMCs with LPS increased the cellular level of F-spondin which is associated with the regulation of proinflammatory cytokine production. The LPS-induced F-spondin expression depended on TLR4-mediated PI3K/Akt pathway. Suppression of F-spondin level by siRNA inhibited not only F-spondin expression but also LPS-induced phosphorylation of cAMP response element binding protein (CREB) and IL-6 expression, VSMC migration and proliferation as well asmore » MMP9 expression. Moreover, suppression of CREB level by siRNA inhibited TLR4-induced IL-6 production and VSMC migration. Inhibition of F-spondin siRNA on LPS-induced migration was restored by addition of exogenous recombinant mouse IL-6. We conclude that upon ligand binding, TLR4 activates PI3K/Akt signaling to induce F-spondin expression, subsequently control CREB-mediated IL-6 production to promote VSMC migration. These findings provide vital insights into the essential role of F-spondin in VSMC function and will be valuable for developing new therapeutic strategies against atherosclerosis. -- Highlights: •LPS-induced F-spondin expression of VSMCs is via a TLR4/PI3K/Akt signaling. •F-spondin is pivotal for LPS-induced CREB-mediated IL-6 production. •F-spondin is required for LPS-induced VSMC migration and proliferation.« less

  13. DNA containing CpG motifs induces angiogenesis

    NASA Astrophysics Data System (ADS)

    Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

    2002-06-01

    New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

  14. Nicotine Induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

    PubMed Central

    Wang, Tingting; Chen, Man; Liu, Lian; Cheng, Huaiyan; Yan, You-E; Feng, Ying-Hong; Wang, Hui

    2011-01-01

    Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a single site CpG methylation at nt −377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. PMID:21971485

  15. COX-2 contributes to LPS-induced Stat3 activation and IL-6 production in microglial cells

    PubMed Central

    Zhu, Jie; Li, Shuzhen; Zhang, Yue; Ding, Guixia; Zhu, Chunhua; Huang, Songming; Zhang, Aihua; Jia, Zhanjun; Li, Mei

    2018-01-01

    Many stimuli including lipopolysaccharide (LPS) could activate microglial cells to subsequently cause inflammatory nerve injury. However, the mechanism of LPS-induced neuroinflammation in microglial cells is still elusive. Thus, the present study was undertaken to examine the role of COX-2 in mediating the activation of Stat3 and the production of IL-6 in BV2 cells challenged with LPS. After 24 h treatment, LPS dose-dependently enhanced COX-2 expression at both mRNA and protein levels. Meanwhile, IL-6 with other inflammatory cytokines including IL-1β, TNF-α, and MCP-1 were similarly enhanced by LPS. Then a specific COX-2 inhibitor (NS-398) was administered to BV2 before LPS treatment. Significantly, COX-2 inhibition suppressed the upregulation of IL-6 at both mRNA and protein levels in line with the trend blockade on IL-1β, TNF-α, and MCP-1. Stat3 drives proinflammatory signaling pathways and contributes to IL-6 production via a transcriptional mechanism in many diseases. Here we found that inhibition of COX-2 entirely blocked LPS-induced Stat3 phosphorylation, which might contribute to the blockade of IL-6 production to some extent. Meanwhile, COX-2 siRNA approach largely reproduced the phenotypes shown by specific COX-2 inhibitor in LPS-treated BV2 cells. Together, these findings suggested that COX-2 might contribute to LPS-induced IL-6 production possibly through activating Stat3 signaling pathway in microglial cells. PMID:29636886

  16. The IL-6/sIL-6R treatment of a malignant melanoma cell line enhances susceptibility to TNF-{alpha}-induced apoptosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wagley, Yadav; Yoo, Yung-Choon; Seo, Han Geuk

    2007-03-23

    Melanoma is an intractable tumor that has shown very impressive and promising response to local administration of high dose recombinant TNF-{alpha} in combination with IFN-{gamma} in clinical studies. In this study, we investigated the effect of IL-6/sIL-6R on TNF-{alpha}-resistant B16/F10.9 melanoma cells. A low dose of TNF-{alpha} or IL-6/sIL-6R had minimal affect on the cell growth. However, the highly active fusion protein of sIL-6R and IL-6 (IL6RIL6), covalently linked by a flexible peptide, sensitized TNF-{alpha}-resistant F10.9 melanoma cells to TNF-{alpha}-induced apoptosis. Stimulation of the cells with IL6RIL6 plus TNF-{alpha} resulted in both the activation of caspase-3 and the reduction ofmore » bcl-2 expression. Flow cytometry analysis showed that IL6RIL6-upregulated TNF-R55 and TNF-R75 expression, suggesting an increase in TNF-{alpha} responsiveness by IL6RIL6 resulting from the induction of TNF receptors. Moreover, exposure of F10.9 cells to neutralizing antibody to TNF-R55 significantly inhibited IL6RIL6/TNF-{alpha}-induced cytotoxicity. These results suggest that the IL6/sIL6R/gp130 system, which sensitizes TNF-{alpha}-resistant melanoma cells to TNF-{alpha}-induced apoptosis, may provide a new target for immunotherapy.« less

  17. IL-6 promotes an increase in human mast cell number and reactivity through suppression of SOCS3

    PubMed Central

    Desai, Avanti; Jung, Mi-Yeon; Olivera, Ana; Gilfillan, Alasdair M.; Prussin, Calman; Kirshenbaum, Arnold S.; Beaven, Michael A.; Metcalfe, Dean D.

    2015-01-01

    Background IL-6, which is reported to be elevated in association with mastocytosis, asthma and urticaria, is used in conjunction with stem cell factor (SCF) to generate human MCs (HuMCs) from progenitor (CD34+) cells. Despite these associations, the effects on, and mechanisms by which prolonged exposure to IL-6 alters HuMC number and function are not well understood. Objectives To study the effect of IL-6 on HuMC function, the mechanisms by which IL-6 exerts its effects, and the relationship of these findings to mastocytosis. Methods HuMCs were cultured in SCF with or without IL-6. The responses to FcεRI aggregation, and the expression of proteases and receptors including the soluble IL-6 receptor (sIL-6R) were then quantitated. Epigenetic changes in SOCS3 were determined using methylation specific PCR. Serum samples from healthy controls and patients with mastocytosis were assayed for IL-6, tryptase, and sIL-6R. Results IL-6 enhanced MC proliferation, maturation, and reactivity following FcεRI aggregation. IL-6 reduced expression of SOCS3, which correlated with methylation of the SOCS3 promoter, and increased expression and activation of STAT3. IL-6 also suppressed constitutive production of sIL-6R and serum levels of sIL-6R were similarly reduced in patients with mastocytosis. Conclusion IL-6 increases mast cell proliferation and formation of a more reactive phenotype enabled by suppressing proteolytic cleavage of sIL-6R from IL-6R and down regulation of the SOCS3 auto-inhibitory pathway. We suggest IL-6 blockade might ameliorate MC related symptoms and pathology in MC-related diseases associated with elevated IL-6 including mastocytosis. PMID:26774658

  18. Dexamethasone antagonizes IL-4 and IL-10-induced release of IL-1RA by monocytes but augments IL-4-, IL-10-, and TGF-beta-induced suppression of TNF-alpha release.

    PubMed

    Joyce, D A; Steer, J H; Kloda, A

    1996-07-01

    The activities of monocyte-derived tumor necrosis factor (TNF)-alpha and interleukin (IL)-1 beta are potentially modified by IL-1RA and soluble receptors for TNF (sTNF-R), which are themselves monocyte products. IL-4, IL-10, TGF-beta, and glucocorticoids (GC) all suppress the lipopolysaccharide (LPS)-stimulated release of TNF-alpha and IL-1beta but vary in their effects on IL-1RA and sTNF-R. This raises the prospect of interactions between the cytokines and glucocorticoids, which may be antagonistic or additive on IL-1 and TNF activity. We, therefore, studied the interactions of the GC dexamethasone (Dex) with IL-4, IL-10, and transforming growth factor (TGF)-beta on the release of TNF-alpha and IL-1RA by human monocytes and the monocytic THP-1 cell line. Low concentration of Dex (10(-8)-10(-7)M) acted additively with low concentrations of IL-4 (0.01-1 ng/ml), IL-10 (0.01-0.1 U/ml), or TGF-beta (0.01-1 ng/ml) to profoundly suppress LPS-stimulated release of TNF-alpha by whole blood and, to a lesser degree, THP-1 cells. Dex also suppressed spontaneous release of IL-1RA from PBMC and THP-1 cells, whereas IL-4 and IL-10, but not TGF-beta, stimulated release. Dex antagonized the enhanced release in IL-4 and IL-10-stimulated cultures. The capacity to stimulate release of IL-1RA may contribute to the anti-inflammatory potential of IL-4 and IL-10 in monocyte/macrophage-mediated disease. GC, therefore, do not uniquely enhance the suppressive functions of IL-4 and IL-10 on monokine activity. The therapeutic benefit of combinations of GC and IL-4, IL-10 or TGF-beta in disease may depend on the roles of the individual monokines and antagonists in pathogenesis.

  19. Follicular expression of pro-inflammatory cytokines tumour necrosis factor-α (TNFα), interleukin 6 (IL6) and their receptors in cattle: TNFα, IL6 and macrophages suppress thecal androgen production in vitro.

    PubMed

    Samir, Moafaq; Glister, Claire; Mattar, Dareen; Laird, Mhairi; Knight, Phil G

    2017-07-01

    Pro-inflammatory cytokines secreted by macrophages and other cell types are implicated as intraovarian factors affecting different aspects of ovarian function including follicle and corpus luteum 'turnover', steroidogenesis and angiogenesis. Here, we compared granulosal (GC) and thecal (TC) expression of TNF, IL6 and their receptors (TNFRSF1A, TNFRSF1B and IL6R) during bovine antral follicle development; all five mRNA transcripts were detected in both GC and TC and statistically significant cell-type and follicle stage-related differences were evident. Since few studies have examined cytokine actions on TC steroidogenesis, we cultured TC under conditions that retain a non-luteinized 'follicular' phenotype and treated them with TNFα and IL6 under basal and LH-stimulated conditions. Both TNFα and IL6 suppressed androgen secretion concomitantly with CYP17A1 and LHCGR mRNA expression. In addition, TNFα reduced INSL3, HSD3B1 and NOS3 expression but increased NOS2 expression. IL6 also reduced LHCGR and STAR expression but did not affect HSD3B1, INSL3, NOS2 or NOS3 expression. As macrophages are a prominent source of these cytokines in vivo , we next co-cultured TC with macrophages and observed an abolition of LH-induced androgen production accompanied by a reduction in CYP17A1, INSL3, LHCGR, STAR, CYP11A1 and HSD3B1 expression. Exposure of TC to bacterial lipopolysaccharide also blocked LH-induced androgen secretion, an effect reduced by a toll-like receptor blocker (TAK242). Collectively, the results support an inhibitory action of macrophages on thecal androgen production, likely mediated by their secretion of pro-inflammatory cytokines that downregulate the expression of LHCGR, CYP17A1 and INSL3. Bovine theca interna cells can also detect and respond directly to lipopolysaccharide. © 2017 Society for Reproduction and Fertility.

  20. Mangiferin inhibits lipopolysaccharide-induced production of interleukin-6 in human oral epithelial cells by suppressing toll-like receptor signaling.

    PubMed

    Li, Hao; Wang, Qi; Chen, Xinmin; Ding, Yi; Li, Wei

    2016-11-01

    Oral epithelial cells have currently been found to play an important role in inflammatory modulation in periodontitis. Mangiferin is a natural glucosylxanthone with anti-inflammatory activity. The aim of this study was to investigate the regulatory effect of mangiferin on lipopolysaccharide (LPS)-induced production of proinflammatory cytokine interleukin-6 (IL-6) in oral epithelial cells and the underlying mechanisms. The levels of LPS-induced IL-6 production in OKF6/TERT-2 oral keratinocytes were detected using enzyme-linked immunosorbent assay (ELISA). The expression of Toll-like receptor (TLR) 2 and TLR4 was determined using western blot analysis. And the phosphorylation of TLR downstream nuclear factor-κB (NF-κB), p38 mitogen-activated protein kinase (p38 MAPK) and c-Jun N-terminal kinase (JNK) was examined using cell-based protein phosphorylation ELISA kits. We found that mangiferin reduced LPS-upregulated IL-6 production in OKF6/TERT-2 cells. Additionally, mangiferin inhibited LPS-induced TLR2 and TLR4 overexpression, and suppressed the phosphorylation of NF-κB, p38 MAPK and JNK. Moreover, mangiferin repressed IL-6 production and TLR signaling activation in a dose-dependent manner after 24h treatment. Mangiferin decreases LPS-induced production of IL-6 in human oral epithelial cells by suppressing TLR signaling, and this glucosylxanthone may have potential for the treatment of periodontitis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Differential expression of IL-6/IL-6R and MAO-A regulates invasion/angiogenesis in breast cancer.

    PubMed

    Bharti, Rashmi; Dey, Goutam; Das, Anjan Kumar; Mandal, Mahitosh

    2018-04-26

    Monoamine oxidases (MAO) are mitochondrial enzymes functioning in oxidative metabolism of monoamines. The action of MAO-A has been typically described in neuro-pharmacological domains. Here, we have established a co-relation between IL-6/IL-6R and MAO-A and their regulation in hypoxia induced invasion/angiogenesis. We employed various in-vitro and in-vivo techniques and clinical samples. We studied a co-relation among MAO-A and IL-6/IL-6R and tumour angiogenesis/invasion in hypoxic environment in breast cancer model. Activation of IL-6/IL-6R and its downstream was found in hypoxic cancer cells. This elevation of IL-6/IL-6R caused sustained inhibition of MAO-A in hypoxic environment. Inhibition of IL-6R signalling or IL-6R siRNA increased MAO-A activity and inhibited tumour angiogenesis and invasion significantly in different models. Further, elevation of MAO-A with 5-azacytidine (5-Aza) modulated IL-6 mediated angiogenesis and invasive signatures including VEGF, MMPs and EMT in hypoxic breast cancer. High grade invasive ductal carcinoma (IDC) clinical specimen displayed elevated level of IL-6R and depleted MAO-A expression. Expression of VEGF and HIF-1α was unregulated and loss of E-Cadherin was observed in high grade IDC tissue specimen. Suppression of MAO-A by IL-6/IL-6R activation promotes tumour angiogenesis and invasion in hypoxic breast cancer environment.

  2. Umbilical Cord-derived Mesenchymal Stem Cells Instruct Monocytes Towards an IL10-producing Phenotype by Secreting IL6 and HGF.

    PubMed

    Deng, Yinan; Zhang, Yingcai; Ye, Linsen; Zhang, Tong; Cheng, Jintao; Chen, Guihua; Zhang, Qi; Yang, Yang

    2016-12-05

    Human UC-MSCs are regarded as an attractive alternative to BM-MSCs for clinical applications due to their easy preparation, higher proliferation and lower immunogenicity. However, the mechanisms underlying immune suppression by UC-MSCs are still unclear. We studied the mechanism of inhibition by UC-MSCs during the differentiation of monocytes into DCs and focused on the specific source and the role of the involved cytokines. We found that UC-MSCs suppressed monocyte differentiation into DCs and instructed monocytes towards other cell types, with clear decreases in the expression of co-stimulatory molecules, in the secretion of inflammatory factors and in allostimulatory capacity. IL6, HGF and IL10 might be involved in this process because they were detected at higher levels in a coculture system. UC-MSCs produce IL-6 and HGF, and neutralization of IL-6 and HGF reversed the suppressive effect of UC-MSCs. IL10 was not produced by UC-MSCs but was exclusively produced by monocytes after exposure to UC-MSCs, IL-6 or HGF. In summary, we found that the UC-MSC-mediated inhibitory effect was dependent on IL6 and HGF secreted by UC-MSCs and that this effect induced monocyte-derived cells to produce IL10, which might indirectly strengthen the suppressive effect of UC-MSCs.

  3. Identification of active compounds from Caesalpinia sappan L. extracts suppressing IL-6 production in RAW 264.7 cells by PLS.

    PubMed

    Chu, Ming-Juan; Wang, You-Zhi; Itagaki, Kiyoshi; Ma, Hong-Xing; Xin, Ping; Zhou, Xue-Gang; Chen, Guo-You; Li, Sen; Sun, Shi-Qin

    2013-06-21

    Caesalpinia sappan L. is distributed in Southeast Asia and also used as herbal medicine for the treatment of various diseases such as burning sensations, leprosy, dysentery, osteoarthritis and rheumatoid arthritis (RA). The overproduction of IL-6 plays an important role in the prognosis of RA, but the active compounds from the extracts of Caesalpinia sappan L. suppressing IL-6 production remain unknown. Identifying the main active compounds of Caesalpinia sappan L. extracts inhibiting the IL-6 production in LPS-stimulated RAW 264.7 cells by partial least squares (PLS). Sixty-four samples with different proportions of compounds were prepared from Caesalpinia sappan L. by supercritical CO2 fluid extraction (SCFE) and refluxing. Each of 64 samples was applied to RAW 264.7 cells with LPS to evaluate whether IL-6 production by LPS is affected by addition of each sample. The IL-6 production in medium was determined by ELISA and the inhibitory activity of each sample was analyzed. In addition, the fingerprints of these 64 samples were also established by ultra-performance liquid chromatography electrospray ionization tandem mass spectrometry (UPLC-MS). We used the PLS, a simplified method, to evaluate the results from IL-6 production and fingerprints. Each of 64 samples markedly suppressed LPS-induced IL-6 production in RAW cells. The fingerprints by UPLC-MS clearly revealed variations among 64 samples produced in different extract conditions. The PLS analysis with IL-6 production and fingerprints by UPLC-MS suggested that the peaks 71, 93, 150, 157, 168 have more influence on the inhibitory activity of Caesalpinia sappan L. extracts. The peaks 71, 93, 150 are likely representing sappanone A, protosappanin E and neoprotosappanin, respectively. The peaks 157 and 168 are still at large. This is the first report that sappanone A, protosappanin E, neoprotosappanin and two unidentified compounds can be considered as possible active compounds that might inhibit IL-6 production

  4. Response of immune response genes to adjuvants poly [di(sodium carboxylatoethylphenoxy)phosphazene] (PCEP), CpG oligodeoxynucleotide and emulsigen at intradermal injection site in pigs.

    PubMed

    Magiri, R B; Lai, K; Chaffey, A M; Wilson, H L; Berry, W E; Szafron, M L; Mutwiri, G K

    2016-07-01

    Understanding the mechanisms by which adjuvants mediate their effects provide critical information on how innate immunity influences the development of adaptive immunity. Despite being a critical vaccine component, the mechanisms by which adjuvants mediate their effects are not fully understood and this is especially true when they are used in large animals. This lack of understanding limits our ability to design effective vaccines. In the present study, we administered polyphosphazene (PCEP), CpG oligodeoxynucleotides (CpG), emulsigen or saline via an intradermal injection into pigs and assessed the impact on the expression of reported 'adjuvant response genes' over time. CpG induced a strong upregulation of the chemokine CXL10 several 'Interferon Response Genes', as well as TNFα, and IL-10, and a down-regulation of IL-17 genes. Emulsigen upregulated expression of chemokines CCL2 and CCL5, proinflammatory cytokines IL-6 and TNFα, as well as TLR9, and several IFN response genes. PCEP induced the expression of chemokine CCL2 and proinflammatory cytokine IL-6. These results suggest that emulsigen and CpG may promote recruitment of innate immune cells and Th1 type cytokine production but that PCEP may promote a Th-2 type immune response through the induction of IL-6, an inducer of B cell activity and differentiation. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Targeting Inhibitor of κB Kinase β Prevents Inflammation-Induced Preterm Delivery by Inhibiting IL-6 Production from Amniotic Cells.

    PubMed

    Toda, Aska; Sawada, Kenjiro; Fujikawa, Tomoyuki; Wakabayashi, Atsuko; Nakamura, Koji; Sawada, Ikuko; Yoshimura, Akihiko; Nakatsuka, Erika; Kinose, Yasuto; Hashimoto, Kae; Mabuchi, Seiji; Tokuhira, Atsushi; Nakayama, Masahiro; Itai, Akiko; Kurachi, Hirohisa; Kimura, Tadashi

    2016-03-01

    Preterm delivery (PTD) remains a serious challenge in perinatology. Intrauterine infection and/or inflammation, followed by increased inflammatory cytokines, represented by IL-6, are involved in this pathology. Our aim was to identify IL-6-producing cells in the placenta and to analyze the potential of targeting IκB kinase β (IKKβ) signaling to suppress IL-6 production for the treatment of PTD. Immunohistochemical analyses using placentas complicated with severe chorioamnionitis revealed that IL-6 is mainly expressed in human amniotic mesenchymal stromal cells (hAMSCs). Primary hAMSCs were collected, and strong IL-6 expression was confirmed. In hAMSCs, the treatment of tumor necrosis factor-α or IL-1β drastically induced IL-6 production, followed by the phosphorylation of IKKs. A novel IKKβ inhibitor, IMD-0560, almost completely inhibited IL-6 production from hAMSCs. Using an experimental lipopolysaccharide-induced PTD mouse model, the therapeutic potential of IMD-0560 was examined. IMD-0560 was delivered vaginally 4 hours before lipopolysaccharide administration. Mice in the IMD-0560 (30 mg/kg, twice a day) group had a significantly lower rate of PTD [10 of 22 (45%)] without any apparent adverse events on the mice and their pups. In uteri collected from mice, IMD-0560 inhibited not only IL-6 production but also production of related cytokines, such as keratinocyte-derived protein chemokine/CXCL1, macrophage inflammatory protein-2/CXCL2, and monocyte chemoattractant protein-1/chemokine ligand 2. Targeting IKKβ signaling shows promising effects through the suppression of these cytokines and can be explored as a future option for the prevention of PTD. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  6. Alpha-Lipoic Acid Downregulates IL-1β and IL-6 by DNA Hypermethylation in SK-N-BE Neuroblastoma Cells.

    PubMed

    Dinicola, Simona; Proietti, Sara; Cucina, Alessandra; Bizzarri, Mariano; Fuso, Andrea

    2017-09-26

    Alpha-lipoic acid (ALA) is a pleiotropic molecule with antioxidant and anti-inflammatory properties, of which the effects are exerted through the modulation of NF-kB. This nuclear factor, in fact, modulates different inflammatory cytokines, including IL-1b and IL-6, in different tissues and cell types. We recently showed that IL-1b and IL-6 DNA methylation is modulated in the brain of Alzheimer's disease patients, and that IL-1b expression is associated to DNA methylation in the brain of patients with tuberous sclerosis complex. These results prompted us to ask whether ALA-induced repression of IL-1b and IL-6 was dependent on DNA methylation. Therefore, we profiled DNA methylation in the 5'-flanking region of the two aforementioned genes in SK-N-BE human neuroblastoma cells cultured in presence of ALA 0.5 mM. Our experimental data pointed out that the two promoters are hypermethylated in cells supplemented with ALA, both at CpG and non-CpG sites. Moreover, the observed hypermethylation is associated with decreased mRNA expression and decreased cytokine release. These results reinforce previous findings indicating that IL-1b and IL-6 undergo DNA methylation-dependent modulation in neural models and pave the road to study the epigenetic mechanisms triggered by ALA.

  7. Umbilical Cord-derived Mesenchymal Stem Cells Instruct Monocytes Towards an IL10-producing Phenotype by Secreting IL6 and HGF

    PubMed Central

    Deng, Yinan; Zhang, Yingcai; Ye, Linsen; Zhang, Tong; Cheng, Jintao; Chen, Guihua; Zhang, Qi; Yang, Yang

    2016-01-01

    Human UC-MSCs are regarded as an attractive alternative to BM-MSCs for clinical applications due to their easy preparation, higher proliferation and lower immunogenicity. However, the mechanisms underlying immune suppression by UC-MSCs are still unclear. We studied the mechanism of inhibition by UC-MSCs during the differentiation of monocytes into DCs and focused on the specific source and the role of the involved cytokines. We found that UC-MSCs suppressed monocyte differentiation into DCs and instructed monocytes towards other cell types, with clear decreases in the expression of co-stimulatory molecules, in the secretion of inflammatory factors and in allostimulatory capacity. IL6, HGF and IL10 might be involved in this process because they were detected at higher levels in a coculture system. UC-MSCs produce IL-6 and HGF, and neutralization of IL-6 and HGF reversed the suppressive effect of UC-MSCs. IL10 was not produced by UC-MSCs but was exclusively produced by monocytes after exposure to UC-MSCs, IL-6 or HGF. In summary, we found that the UC-MSC-mediated inhibitory effect was dependent on IL6 and HGF secreted by UC-MSCs and that this effect induced monocyte-derived cells to produce IL10, which might indirectly strengthen the suppressive effect of UC-MSCs. PMID:27917866

  8. CpG DNA: A pathogenic factor in systemic lupus erythematosus?

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krieg, A.M.

    1995-11-01

    Systemic lupus erythematosus (SLE) is a multifactorial disease of unknown etiology. Characteristic features of SLE include (1) polyclonal B cell activation, (2) overexpression of the immune stimulatory cytokine interleukin-6 (IL-6), (3) defective tolerance to self antigens, and (4) production of anti-DNA antibodies (Ab). Bacterial infection has been suspected as a triggering factor for lupus. Bacterial DNA differs from vertebrate DNA in the frequency and methylation of CpG dinucleotides. These CpG motifs in bacterial DNA induce a variety of immune effects, including (1) polyclonal activation of murine and human B cells, (2) IL-6 secretion, and (3) resistance to apoptosis, thereby potentiallymore » allowing the survival of autoreactive cells. These results suggest that microbial DNA could therefore be a pathogenic factor in SLE. SLE patients have elevated levels of circulating plasma DNA which is reportedly enriched in hypomethylated CpGs. Genomic DNA is also hypomethylated in SLE. The purpose of this review is to summarize the immune effects of CpG motifs and to present the evidence for their possible involvement in the pathogenesis of SLE. 77 refs.« less

  9. Epigallocatechin-3-gallate inhibits IL-6 synthesis and suppresses transsignaling by enhancing soluble gp130 production

    PubMed Central

    Ahmed, Salahuddin; Marotte, Hubert; Kwan, Kevin; Ruth, Jeffrey H.; Campbell, Phillip L.; Rabquer, Bradley J.; Pakozdi, Angela; Koch, Alisa E.

    2008-01-01

    Regulation of IL-6 transsignaling by the administration of soluble gp130 (sgp130) receptor to capture the IL-6/soluble IL-6R complex has shown promise for the treatment of rheumatoid arthritis (RA). However, enhancing endogenous sgp130 via alternative splicing of the gp130 gene has not yet been tested. We found that epigallocatechin-3-gallate (EGCG), an anti-inflammatory compound found in green tea, inhibits IL-1β–induced IL-6 production and transsignaling in RA synovial fibroblasts by inducing alternative splicing of gp130 mRNA, resulting in enhanced sgp130 production. Results from in vivo studies using a rat adjuvant-induced arthritis model showed specific inhibition of IL-6 levels in the serum and joints of EGCG-treated rats by 28% and 40%, respectively, with concomitant amelioration of rat adjuvant-induced arthritis. We also observed a marked decrease in membrane-bound gp130 protein expression in the joint homogenates of the EGCG-treated group. In contrast, quantitative RT-PCR showed that the gp130/IL-6Rα mRNA ratio increased by ∼2-fold, suggesting a possible mechanism of sgp130 activation by EGCG. Gelatin zymography results showed EGCG inhibits IL-6/soluble IL-6R–induced matrix metalloproteinase-2 activity in RA synovial fibroblasts and in joint homogenates, possibly via up-regulation of sgp130 synthesis. The results of these studies provide previously undescribed evidence of IL-6 synthesis and transsignaling inhibition by EGCG with a unique mechanism of sgp130 up-regulation, and thus hold promise as a potential therapeutic agent for RA. PMID:18796608

  10. Interleukin-6 (IL-6) mediated the increased contraction of distal colon in streptozotocin-induced diabetes in rats via IL-6 receptor pathway

    PubMed Central

    Chang, Xin-Wen; Qin, Ying; Jin, Zhi; Xi, Tao-Fang; Yang, Xiao; Lu, Ze-Hao; Tang, Yu-Ping; Cai, Wen-Ting; Chen, Shao-Jun; Xie, Dong-Ping

    2015-01-01

    Colonic dysmotility occurs in diabetes and blood plasma interleukin (IL)-6 levels are significantly elevated in type 1 diabetes mellitus. The aim of this study was to investigate whether IL-6 and the IL-6 receptor pathway mediates colonic dysfunction in type 1 diabetes mellitus. Male SD rats were treated with a single intraperitoneally injected dose of streptozotocin (STZ), and those displaying sustained high blood glucose were selected as diabetes mellitus models. Longitudinal muscle strips of colon were prepared to monitor colonic contraction in vitro. Contractile responses of strips of colon were recorded following treatment with IL-6 in control animals, and following anti IL-6 antibody treatment in STZ-induced diabetes in rats. Concentration of IL-6 in plasma and colon were determined by ELISA. Expressions of IL-6 α-receptor and IL-6 β-receptor in colon tissues were determined by immunohistochemistry or Western blot analysis. The non-diabetes rats treated with IL-6 and the untreated diabetes rats showed increased contraction of distal colon, whereas the diabetes rats treated with anti-IL-6 antibody showed decreased contraction of distal colon compared with the untreated diabetes rats. The IL-6 levels of plasma but not colon increased in diabetes rats. The expression of IL-6 α-receptor increased in diabetes rats. These results indicate that diabetes rats show an increase in the contractions of distal colon partly via the IL-6-IL-6 receptor pathway. PMID:26191141

  11. PGRN is a key adipokine mediating high fat diet-induced insulin resistance and obesity through IL-6 in adipose tissue.

    PubMed

    Matsubara, Toshiya; Mita, Ayako; Minami, Kohtaro; Hosooka, Tetsuya; Kitazawa, Sohei; Takahashi, Kenichi; Tamori, Yoshikazu; Yokoi, Norihide; Watanabe, Makoto; Matsuo, Ei-Ichi; Nishimura, Osamu; Seino, Susumu

    2012-01-04

    Adipose tissue secretes adipokines that mediate insulin resistance, a characteristic feature of obesity and type 2 diabetes. By differential proteome analysis of cellular models of insulin resistance, we identified progranulin (PGRN) as an adipokine induced by TNF-α and dexamethasone. PGRN in blood and adipose tissues was markedly increased in obese mouse models and was normalized with treatment of pioglitazone, an insulin-sensitizing agent. Ablation of PGRN (Grn(-/-)) prevented mice from high fat diet (HFD)-induced insulin resistance, adipocyte hypertrophy, and obesity. Grn deficiency blocked elevation of IL-6, an inflammatory cytokine, induced by HFD in blood and adipose tissues. Insulin resistance induced by chronic administration of PGRN was suppressed by neutralizing IL-6 in vivo. Thus, PGRN is a key adipokine that mediates HFD-induced insulin resistance and obesity through production of IL-6 in adipose tissue, and may be a promising therapeutic target for obesity. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Acetyl salicylic acid inhibits Th17 airway inflammation via blockade of IL-6 and IL-17 positive feedback

    PubMed Central

    Moon, Hyung-Geun; Kang, Chil Sung; Choi, Jun-Pyo; Choi, Dong Sic; Choi, Hyun Il; Choi, Yong Wook; Jeon, Seong Gyu; Yoo, Joo-Yeon; Jang, Myoung Ho; Gho, Yong Song; Kim, Yoon-Keun

    2013-01-01

    T-helper (Th)17 cell responses are important for the development of neutrophilic inflammatory disease. Recently, we found that acetyl salicylic acid (ASA) inhibited Th17 airway inflammation in an asthma mouse model induced by sensitization with lipopolysaccharide (LPS)-containing allergens. To investigate the mechanism(s) of the inhibitory effect of ASA on the development of Th17 airway inflammation, a neutrophilic asthma mouse model was generated by intranasal sensitization with LPS plus ovalbumin (OVA) and then challenged with OVA alone. Immunologic parameters and airway inflammation were evaluated 6 and 48 h after the last OVA challenge. ASA inhibited the production of interleukin (IL)-17 from lung T cells as well as in vitro Th17 polarization induced by IL-6. Additionally, ASA, but not salicylic acid, suppressed Th17 airway inflammation, which was associated with decreased expression of acetyl-STAT3 (downstream signaling of IL-6) in the lung. Moreover, the production of IL-6 from inflammatory cells, induced by IL-17, was abolished by treatment with ASA, whereas that induced by LPS was not. Altogether, ASA, likely via its acetyl moiety, inhibits Th17 airway inflammation by blockade of IL-6 and IL-17 positive feedback. PMID:23306703

  13. Role of IL-1 beta and COX2 in silica-induced IL-6 release and loss of pneumocytes in co-cultures.

    PubMed

    Herseth, Jan I; Refsnes, Magne; Låg, Marit; Schwarze, Per E

    2009-10-01

    The pro-inflammatory cytokines IL-1 beta, TNF-alpha and IL-6 are of great importance in the development of silica-induced lung damage and repair. In this study we investigated the role of IL-1 beta, TNF-alpha and COX2 in silica-induced regulation of IL-6 release and pneumocyte loss in various mono- and co-cultures of monocytes, pneumocytes and endothelial cells. All co-cultures with monocytes, and especially cultures including endothelial cells, showed an increase of silica-induced release of IL-6 compared to the respective monocultures. Treatment with the antagonist IL-1 ra strongly decreased IL-1 beta and IL-6 release in contact co-cultures of monocytes and pneumocytes. COX2 up-regulation by silica and IL-1 beta was eliminated by IL-1 ra. Inhibition of COX2 markedly reduced both IL-1 beta and IL-6 release. IL-1 ra was more effective than COX2-inhibition in reduction of IL-6, but not of IL-1 beta. Silica-induced pneumocyte loss was reduced by IL-1 beta, but this effect was not counteracted by the IL-1 receptor antagonist. Our findings suggest that silica-induced IL-6 release from pneumocytes is mainly mediated via IL-1 beta release from the monocytes, via both COX2-dependent and -independent pathways. Notably, COX2-derived mediators seem crucial for a positive feed-back regulation of IL-1 beta release from the monocytes. In contrast to silica-induced IL-6, the reduction in pneumocyte loss by IL-1 beta does not seem to be regulated through an IL-1R1-dependent mechanism.

  14. Monoamine oxidase A expression is suppressed in human cholangiocarcinoma via coordinated epigenetic and IL-6-driven events.

    PubMed

    Huang, Li; Frampton, Gabriel; Rao, Arundhati; Zhang, Kun-song; Chen, Wei; Lai, Jia-ming; Yin, Xiao-yu; Walker, Kimberly; Culbreath, Brianne; Leyva-Illades, Dinorah; Quinn, Matthew; McMillin, Matthew; Bradley, Michelle; Liang, Li-Jian; DeMorrow, Sharon

    2012-10-01

    The secretion of dopamine and serotonin is increased in cholangiocarcinoma, which has growth-promoting effects. Monoamine oxidase A (MAOA), the degradation enzyme of serotonin and dopamine, is suppressed in cholangiocarcinoma via an unknown mechanism. The aims of this study were to (i) correlate MAOA immunoreactivity with pathophysiological parameters of cholangiocarcinoma, (ii) determine the mechanism by which MAOA expression is suppressed and (iii) evaluate the consequences of restored MAOA expression in cholangiocarcinoma. MAOA expression was assessed in cholangiocarcinoma and nonmalignant controls. The control of MAOA expression by promoter hypermethylation was evaluated and the contribution of interleukin-6 (IL-6) signaling to the suppression of MAOA expression was determined. The effects of MAOA overexpression on cholangiocarcinoma growth and invasion were also assessed. MAOA expression is correlated with differentiation, invasion and survival in cholangiocarcinoma. The MAOA promoter was hypermethylated immediately upstream of the start codon in cholangiocarcinoma samples and cell lines but not in nonmalignant counterparts. IL-6 signaling also decreased MAOA expression via a mechanism independent of hypermethylation, involving the regulation of the balance between SP-1 transcriptional activity and its inhibitor, R1 repressor. Inhibition of both IL-6 signaling and DNA methylation restored MAOA levels to those observed in cholangiocytes. Forced MAOA overexpression inhibited cholangiocarcinoma growth and invasion. MAOA expression is suppressed by the coordinated control of promoter hypermethylation and IL-6 signaling. MAOA may be a useful prognostic marker in the management of cholangiocarcinoma, and therapies designed to increase MAOA expression might prove beneficial in the treatment of cholangiocarcinoma.

  15. Chronic administration of recombinant IL-6 upregulates lipogenic enzyme expression and aggravates high-fat-diet-induced steatosis in IL-6-deficient mice

    PubMed Central

    Vida, Margarita; Gavito, Ana Luisa; Pavón, Francisco Javier; Bautista, Dolores; Serrano, Antonia; Suarez, Juan; Arrabal, Sergio; Decara, Juan; Romero-Cuevas, Miguel; Rodríguez de Fonseca, Fernando; Baixeras, Elena

    2015-01-01

    ABSTRACT Interleukin-6 (IL-6) has emerged as an important mediator of fatty acid metabolism with paradoxical effects in the liver. Administration of IL-6 has been reported to confer protection against steatosis, but plasma and tissue IL-6 concentrations are elevated in chronic liver diseases, including fatty liver diseases associated with obesity and alcoholic ingestion. In this study, we further investigated the role of IL-6 on steatosis induced through a high-fat diet (HFD) in wild-type (WT) and IL-6-deficient (IL-6−/−) mice. Additionally, HFD-fed IL-6−/− mice were also chronically treated with recombinant IL-6 (rIL-6). Obesity in WT mice fed a HFD associated with elevated serum IL-6 levels, fatty liver, upregulation of carnitine palmitoyltransferase 1 (CPT1) and signal transducer and activator of transcription-3 (STAT3), increased AMP kinase phosphorylation (p-AMPK), and downregulation of the hepatic lipogenic enzymes fatty acid synthase (FAS) and stearoyl-CoA desaturase 1 (SCD1). The HFD-fed IL-6−/− mice showed severe steatosis, no changes in CPT1 levels or AMPK activity, no increase in STAT3 amounts, inactivated STAT3, and marked downregulation of the expression of acetyl-CoA carboxylase (ACCα/β), FAS and SCD1. The IL-6 chronic replacement in HFD-fed IL-6−/− mice restored hepatic STAT3 and AMPK activation but also increased the expression of the lipogenic enzymes ACCα/β, FAS and SCD1. Furthermore, rIL-6 administration was associated with aggravated steatosis and elevated fat content in the liver. We conclude that, in the context of HFD-induced obesity, the administration of rIL-6 might contribute to the aggravation of fatty liver disease through increasing lipogenesis. PMID:26035386

  16. IL-6 promotes an increase in human mast cell numbers and reactivity through suppression of suppressor of cytokine signaling 3.

    PubMed

    Desai, Avanti; Jung, Mi-Yeon; Olivera, Ana; Gilfillan, Alasdair M; Prussin, Calman; Kirshenbaum, Arnold S; Beaven, Michael A; Metcalfe, Dean D

    2016-06-01

    IL-6, levels of which are reported to be increased in association with mastocytosis, asthma, and urticaria, is used in conjunction with stem cell factor to generate CD34(+) cell-derived primary human mast cell (HuMC) cultures. Despite these associations, the effects on and mechanisms by which prolonged exposure to IL-6 alters HuMC numbers and function are not well understood. We sought to study the effect of IL-6 on HuMC function, the mechanisms by which IL-6 exerts its effects, and the relationship of these findings to mastocytosis. HuMCs were cultured in stem cell factor with or without IL-6. Responses to FcεRI aggregation and expression of proteases and receptors, including the soluble IL-6 receptor (sIL-6R), were then quantitated. Epigenetic changes in suppressor of cytokine signaling 3 (SOCS3) were determined by using methylation-specific PCR. Serum samples from healthy control subjects and patients with mastocytosis were assayed for IL-6, tryptase, and sIL-6R. IL-6 enhanced mast cell (MC) proliferation, maturation, and reactivity after FcεRI aggregation. IL-6 reduced expression of SOCS3, which correlated with methylation of the SOCS3 promoter and increased expression and activation of signal transducer and activator of transcription 3. IL-6 also suppressed constitutive production of sIL-6R, and serum levels of sIL-6R were similarly reduced in patients with mastocytosis. IL-6 increases MC proliferation and formation of a more reactive phenotype enabled by suppressing proteolytic cleavage of sIL-6R from IL-6R and downregulation of the SOCS3 autoinhibitory pathway. We suggest IL-6 blockade might ameliorate MC-related symptoms and pathology in patients with MC-related diseases associated with increased IL-6 levels, including mastocytosis. Published by Elsevier Inc.

  17. Mangiferin suppresses CIA by suppressing the expression of TNF-α, IL-6, IL-1β, and RANKL through inhibiting the activation of NF-κB and ERK1/2.

    PubMed

    Tsubaki, Masanobu; Takeda, Tomoya; Kino, Toshiki; Itoh, Tatsuki; Imano, Motohiro; Tanabe, Genzo; Muraoka, Osamu; Satou, Takao; Nishida, Shozo

    2015-01-01

    Rheumatoid arthritis is a systemic autoimmune disease characterized by chronic inflammation of synovial joints, ultimately leading to a progressive and irreversible joint destruction. Activation of nuclear factor-kappa B (NF-κB) promotes production of proinflammatory cytokines in various inflammatory diseases including rheumatoid arthritis. Mangiferin, 1,3,6,7-tetrahydroxyxanthone-C2-β-D-glucoside (C-glucosyl xanthone), is a naturally occurring polyphenol. Our previous results showed that mangiferin suppressed NF-κB activation. However, it is unclear, whether mangiferin can prevent rheumatoid arthritis through suppression of NF-κB activation and expression of various cytokines, such as tumor necrosis factor α (TNF-α) and interleukin-6 (IL-6), which play a critical role in the pathogenesis of rheumatoid arthritis. In the present study, we found that mangiferin suppressed the progression and incidence of CIA in DBA1/J mice. In CIA mice, mangiferin inhibited the mRNA expression of cytokine genes in thymus and spleen of CIA mie and led to decreased serum levels of IL-1β, IL-6, TNF-α, and receptor activator NF-κB ligand (RANKL) via inhibition of NF-κB and activation of extracellular signal-regulated kinase 1/2 (ERK1/2). In addition, mangiferin markedly inhibited not only developing but also clinically evident CIA. These findings suggest that mangiferin has potential clinical applications for the treatment of rheumatoid arthritis.

  18. Probable Chemical Hypoxia Effects on Progress of CNV Through Induction of Promoter CpG Demethylation and Overexpression of IL17RC in Human RPE Cells.

    PubMed

    Alivand, Mohammad Reza; Sabouni, Farzaneh; Soheili, Zahra-Soheila

    2016-09-01

    To survey the changes of promoter CpG methylation status and mRNA expression of IL17RC (interleukin 17 receptor C) gene in retinal pigment epithelium (RPE) cells under chemical hypoxia condition for choroidal neovascularization (CNV) modeling in vitro. RPE cells were cultured in both untreated as a control group and treated by cobalt chloride media as a hypoxia group for various concentrations (100-150μM) and times (24-36 hrs.) To confirm chemical hypoxia condition, mRNA expression of HIF (Hypoxia Inducible Factor) -1α, -2α, and Vascular Endothelial Growth Factor (VEGF) was compared between two groups by Real-time PCR. Also, in normoxia and hypoxia conditions, IL17RC expression changes and promoter CpG methylation status were evaluated by Real-time PCR and methylation-specific PCR (MSP) techniques, respectively. Overexpression of HIF-1α, HIF-2α, and VEGF was significant in hypoxia versus normoxia conditions. Our data showed overexpression of IL17RC (2.1- to 6.3-fold) and decreasing of its promoter methylation in comparison with hypoxia and normoxia conditions. It was found that there are significant association between promoter methylation status and expression of IL17RC in chemical hypoxia condition. Therefore, methylation of IL17RC could play as a marker in CNV and degeneration of RPE cells in vitro. Additionally, HIF-α and methylation phenomena may be considered as critical targets for blocking in angiogenesis of age-related degeneration in future studies.

  19. Monoamine oxidase A expression is suppressed in human cholangiocarcinoma via coordinated epigenetic and IL-6-driven events

    PubMed Central

    Huang, Li; Frampton, Gabriel; Rao, Arundhati; Zhang, Kun-song; Chen, Wei; Lai, Jia-ming; Yin, Xiao-yu; Walker, Kimberly; Culbreath, Brianne; Leyva-Illades, Dinorah; Quinn, Matthew; McMillin, Matthew; Bradley, Michelle; Liang, Li-Jian; DeMorrow, Sharon

    2014-01-01

    Objectives The secretion of dopamine and serotonin is increased in cholangiocarcinoma, which has growth-promoting effects. Monoamine oxidase A (MAOA), the degradation enzyme of serotonin and dopamine, is suppressed in cholangiocarcinoma via an unknown mechanism. The aims of this study were to (i) correlate MAOA immunoreactivity with pathophysiological parameters of cholangiocarcinoma, (ii) determine the mechanism by which MAOA expression is suppressed and (iii) evaluate the consequences of restored MAOA expression in cholangiocarcinoma. Design MAOA expression was assessed in cholangiocarcinoma and non-malignant controls. The control of MAOA expression by promoter hypermethylation was evaluated and the contribution of IL-6 signaling to the suppression of MAOA expression was determined. The effects of MAOA overexpression on cholangiocarcinoma growth and invasion were also assessed. Results MAOA expression is correlated with differentiation, invasion and survival in cholangiocarcinoma. The MAOA promoter was hypermethylated immediately upstream of the start codon in cholangiocarcinoma samples and cell lines but not in non-malignant counterparts. IL-6 signaling also decreased MAOA expression via a mechanism independent of hypermethylation, involving the regulation of the balance between SP-1 transcriptional activity and its inhibitor, R1 repressor. Inhibition of both IL-6 signaling and DNA methylation restored MAOA levels to those observed in cholangiocytes. Forced MAOA overexpression inhibited cholangiocarcinoma growth and invasion. Conclusions MAOA expression is suppressed by the coordinated control of promoter hypermethylation and IL-6 signaling. MAOA may be a useful prognostic marker in the management of cholangiocarcinoma, and therapies designed to increase MAOA expression might prove beneficial in the treatment of cholangiocarcinoma. PMID:22906985

  20. Decreased interferon-α production in response to CpG DNA dysregulates cytokine responses in patients with multiple sclerosis.

    PubMed

    Hirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Yaguchi, Hiroaki; Nakamura, Masakazu; Kikuchi, Seiji; Sasaki, Hidenao

    2012-05-01

    Type I interferons (IFNs), represented by IFN-α and β, activate immune effector cells belonging to the innate and adaptive immune systems. Plasmacytoid dendritic cells (pDCs) produce IFN-α in response to CpG DNA. We aimed to examine the impact of pDC-produced IFN-α on the adaptive immune system in Multiple Sclerosis (MS). Our results demonstrated that CpG DNA-induced IFN-α production was significantly decreased in PBMCs from MS patients. Decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were found in CpG DNA-treated PBMCs of healthy subjects unlike in those from MS patients. In samples pre-treated with IFN-α and IFN-β, decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were detected in PBMCs from MS patients. These results suggest that CpG DNA-induced decreased IFN-α production causes pro-inflammatory cytokine secretion, and either IFN-α or IFN-β induces anti-inflammatory cytokine secretion in the adaptive immune system in MS. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. CpG DNA in the prevention and treatment of infections.

    PubMed

    Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus

    2002-01-01

    Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.

  2. HO-1 inhibits IL-13-induced goblet cell hyperplasia associated with CLCA1 suppression in normal human bronchial epithelial cells.

    PubMed

    Mishina, Kei; Shinkai, Masaharu; Shimokawaji, Tadasuke; Nagashima, Akimichi; Hashimoto, Yusuke; Inoue, Yoriko; Inayama, Yoshiaki; Rubin, Bruce K; Ishigatsubo, Yoshiaki; Kaneko, Takeshi

    2015-12-01

    Mucus hypersecretion and goblet cell hyperplasia are common features that characterize asthma. IL-13 increases mucin (MUC) 5AC, the major component of airway mucus, in airway epithelial cells. According to the literature, IL-13 receptor activation leads to STAT6 activation and consequent induction of chloride channel accessory 1 (CLCA1) gene expression, associated with the induction of MUC5AC. Heme oxygenase-1 (HO-1) is an enzyme that catalyzes oxidation of heme to biliverdin, and has anti-inflammatory and anti-oxidant properties. We examined the effects of HO-1 on mucin production and goblet cell hyperplasia induced by IL-13. Moreover, we assessed the cell signaling intermediates that appear to be responsible for mucin production. Normal human bronchial epithelial (NHBE) cells were grown at air liquid interface (ALI) in the presence or absence of IL-13 and hemin, a HO-1 inducer, for 14 days. Protein concentration was analyzed using ELISA, and mRNA expression was examined by real-time PCR. Histochemical analysis was performed using HE staining, andWestern blotting was performed to evaluate signaling transduction pathway. Hemin (4 μM) significantly increased HO-1 protein expression (p b 0.01) and HO-1 mRNA expression (p b 0.001). IL-13 significantly increased goblet cells, MUC5AC protein secretion (p b 0.01) and MUC5AC mRNA (p b 0.001), and these were decreased by hemin by way of HO-1. Tin protoporphyrin (SnPP)-IX, a HO-1 inhibitor, blocked the effect of hemin restoring MUC5AC protein secretion (p b 0.05) and goblet cell hyperplasia. Hemin decreased the expression of CLCA1 mRNA (p b 0.05) and it was reversed by SnPP-IX, but could not suppress IL-13-induced phosphorylation of STAT6 or SAM pointed domain-containing ETS transcription factor (SPDEF) and Forkhead box A2 (FOXA2) mRNA expression. In summary, HO-1 overexpression suppressed IL-13-induced goblet cell hyperplasia and MUC5AC production, and involvement of CLCA1 in the mechanism was suggested.

  3. Maternal treatment with a high dose of CpG ODN during gestation alters fetal craniofacial and distal limb development in C57BL/6 mice.

    PubMed

    Prater, M Renee; Johnson, Victor J; Germolec, Dori R; Luster, Michael I; Holladay, Steven D

    2006-01-16

    Synthetic oligodeoxynucleotides (ODN) containing CpG motifs, characteristic of bacterial DNA, are currently being evaluated as vaccine adjuvants for inducing protective immunity. Recently, there is increasing pressure to vaccinate pregnant women against maternally transmitted diseases including AIDS and tetanus, as well as against potential bio-weapons such as anthrax. CpG vaccines are effective because they trigger transient increases in T(H)1 cytokine production. Recent literature suggests, however, that a shift toward a T(H)1 cytokine profile during pregnancy may increase the risk of fetal morphologic defects. On this basis, we hypothesized that exposure to CpG motifs during pregnancy could result in T(H)1 inflammation leading to adverse effects on fetal development. To address this hypothesis, pregnant C57BL/6 mice were injected with CpG ODN (0-300 microg/dam) and maternal and fetal outcomes were determined. Injection of dams with the highest dose of CpG ODN resulted in markedly increased fetal resorptions and craniofacial/limb defects, while lower doses had little, if any effects. Histological examination of placentas revealed cellular necrosis with mixed inflammation and calcification in the spongiotrophoblast layer and dysregulation of labyrinthine vascular development. Concomitant elevations in maternal serum cytokine levels were observed including interleukin (IL)-2, IL-10 and IL-12. Treatment with 300 microg of non-CpG ODN did not cause any adverse effects. The 300 microg dose of CpG ODN used in the present study is 30-fold higher than the highest dose that has been administered to humans during clinical trials. These results suggest that the induction of T(H)1 cytokines during pregnancy by CpG motifs may potentially increase the risk of fetal loss and morphologic defects in mice, at least at high doses, and support the need for further investigation of teratogenesis that may result from exposure to vaccine adjuvants designed to produce T(H)1 cytokine

  4. Bacterial DNA-induced NK cell IFN-gamma production is dependent on macrophage secretion of IL-12.

    PubMed

    Chace, J H; Hooker, N A; Mildenstein, K L; Krieg, A M; Cowdery, J S

    1997-08-01

    Bacterial DNA (bDNA) activates B cells and macrophages and can augment inflammatory responses by inducing release of proinflammatory cytokines. We found that bDNA stimulation of mouse spleen cells induced NK cell IFN-gamma production that was dependent upon the presence of unmethylated CpG motifs, and oligonucleotides with internal CpG motifs could also induce splenocytes to secrete IFN-gamma. The bDNA-induced IFN-gamma response was strictly macrophages dependent. While splenocytes from SCID mice secreted IFN-gamma in response to bDNA, depletion of macrophages eliminated this response. Additionally, purified NK cells did not respond to bDNA; however, addition of macrophages restored the NK cell IFN-gamma response. Coculture of NK cells with preactivated macrophages further increased bDNA-induced NK cell IFN-gamma production. Anti-IL-12 or IL-10 inhibited bDNA-induced IFN-gamma response. Treatment of purified macrophages with bDNA resulted in IL-12 secretion accompanied by an increase in IL-12 p40 mRNA level. Although isolated NK cells did not make IFN-gamma in response to bDNA, NK cells costimulated with IL-12 gained the ability to respond to bDNA. These experiments show that bDNA induces macrophage IL-12 production which, in turn, stimulates NK cell IFN-gamma production. Macrophage-derived IL-12 renders NK cells responsive to bDNA permitting an even greater IFN-gamma response to bDNA.

  5. The nuclear IkappaB protein IkappaBNS selectively inhibits lipopolysaccharide-induced IL-6 production in macrophages of the colonic lamina propria.

    PubMed

    Hirotani, Tomonori; Lee, Pui Y; Kuwata, Hirotaka; Yamamoto, Masahiro; Matsumoto, Makoto; Kawase, Ichiro; Akira, Shizuo; Takeda, Kiyoshi

    2005-03-15

    Macrophages play an important role in the pathogenesis of chronic colitis. However, it remains unknown how macrophages residing in the colonic lamina propria are regulated. We characterized colonic lamina proprial CD11b-positive cells (CLPMphi). CLPMphi of wild-type mice, but not IL-10-deficient mice, displayed hyporesponsiveness to TLR stimulation in terms of cytokine production and costimulatory molecule expression. We compared CLPMphi gene expression profiles of wild-type mice with IL-10-deficient mice, and identified genes that are selectively expressed in wild-type CLPMphi. These genes included nuclear IkappaB proteins such as Bcl-3 and IkappaBNS. Because Bcl-3 has been shown to specifically inhibit LPS-induced TNF-alpha production, we analyzed the role of IkappaBNS in macrophages. Lentiviral introduction of IkappaBNS resulted in impaired LPS-induced IL-6 production, but not TNF-alpha production in the murine macrophage cell line RAW264.7. IkappaBNS expression led to constitutive and intense DNA binding of NF-kappaB p50/p50 homodimers. IkappaBNS was recruited to the IL-6 promoter, but not to the TNF-alpha promoter, together with p50. Furthermore, small interference RNA-mediated reduction in IkappaBNS expression in RAW264.7 cells resulted in increased LPS-induced production of IL-6, but not TNF-alpha. Thus, IkappaBNS selectively suppresses LPS-induced IL-6 production in macrophages. This study established that nuclear IkappaB proteins differentially regulate LPS-induced inflammatory cytokine production in macrophages.

  6. A Novel Mechanism of γ-Irradiation-Induced IL-6 Production Mediated by P2Y11 Receptor in Epidermal Keratinocytes.

    PubMed

    Ohsaki, Airi; Miyano, Yuki; Tanaka, Rei; Tanuma, Sei-Ichi; Kojima, Shuji; Tsukimoto, Mitsutoshi

    2018-06-01

    Skin inflammation is caused by excessive production of cytokines and chemokines in response to an external stimulus, such as radiation, but the mechanisms involved are not completely understood. Here, we report a novel mechanism of γ-irradiation-induced interleukin-6 (IL-6) production mediated by P2Y11 receptors in epidermal cells. After irradiation of HaCaT cells derived from human epidermal keratinocytes with 5 Gy of γ-rays ( 137 Cs: 0.78 Gy/min), IL-6 production was unchanged at 24 h after γ-irradiation, but was increased at 48 h. IL-6 mRNA was increased at 30 h, and IL-6 production was increased at 33 h after irradiation. The production of IL-6 was sustained at least for 4 d after irradiation. P2Y11 receptor antagonist NF157 inhibited IL-6 production in irradiated cells. Treatment with ATP, a ligand of P2Y11 receptor caused IL-6 production within 24 h. ATP-induced IL-6 production was also suppressed by NF157. Extracellular ATP level was increased after irradiation. The p38 mitogen-activated protein kinase (MAPK) and nuclear factor-kappaB (NF-κB) signaling was involved in the production of IL-6 at the downstream of P2Y11 receptor activation. In addition, the cell cycle was arrested at the G2/M phase, and DNA repair foci were not disappeared at 48 h after γ-irradiation. The protein level of histone methylation enzyme G9a, which inhibits IL-6 production, was decreased after γ-irradiation. In conclusion, we suggest that γ-irradiation induces sustained IL-6 production in HaCaT cells from 33 h after irradiation, which is mediated through P2Y11 receptor-p38 MAPK-NF-κB signaling pathway and G9a degradation. This is a novel mechanism of cytokine production in γ-irradiated cells.

  7. Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model.

    PubMed

    Cho, Hyeon Cheol; Kim, Bo Hwan; Kim, Kyunghoon; Park, Ju Youn; Chang, Jae-Ho; Kim, Soo-Ki

    2008-10-01

    While CpG oligodeoxynucleotides (ODN) are excellent candidates for cancer immunotherapeutics, the numbers of usable CpG ODNs are limited in current clinical settings. To resolve this, we investigated whether novel CpG ODN (KSK-CpG) would be an effective immunotherapeutic in a murine tumor model by affecting in vivo and in vitro parameters, such as survival span, the number of tumor nodules, natural killer (NK) cell and cytotoxic T lymphocyte (CTL) activity and interleukin (IL)-6 or IL-12 cytokine release in splenocytes. We found that KSK-CpG was effective in the murine cancer model by way of prolonging survival span, reducing the number of tumor nodules, augmenting NK cell and CTL cytotoxicity, as well as evoking IL-6 and IL-12 cytokine release in splenocytes. Collectively, these data demonstrate that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse model via innate immune augmentation.

  8. Tangeretin suppresses IL-1beta-induced cyclooxygenase (COX)-2 expression through inhibition of p38 MAPK, JNK, and AKT activation in human lung carcinoma cells.

    PubMed

    Chen, Kuan-Hung; Weng, Meng-Shih; Lin, Jen-Kun

    2007-01-15

    Tangeretin (5,6,7,8,4'-pentamethoxyflavone) is a polymethoxylated flavonoid concentrated in the peel of citrus fruits. Recent studies have shown that tangeretin exhibits anti-proliferative, anti-invasive, anti-metastatic, and antioxidant activities. However, the anti-inflammatory properties of tangeretin are unclear. In this study, we examine the effects of tangeretin and its structure-related compound, nobiletin, on the expression of cyclooxygenases-2 (COX-2) in human lung epithelial carcinoma cells, A549, and human non-small cell lung carcinoma cells, H1299. Tangeretin exerts a much better inhibitory activity than nobiletin against IL-1beta-induced production of COX-2 in A549 cells, and it effectively represses the constitutively expressed COX-2 in H1299. RT-PCR was used to investigate the transcriptional inhibition of COX-2 by tangeretin. COX-2 mRNA was rapidly induced by IL-1beta in 3h and markedly suppressed by tangeretin. IL-1beta-induced the activation of ERK, p38 MAPK, JNK, and AKT in A549 cells. COX-2 expression in response to IL-1beta was attenuated by pretreatment with SB203580, SP600125, and LY294002, but not with PD98059, suggesting the involvement of p38 MAPK, JNK, and PI3K in this response. Pretreatment of cells with tangeretin inhibited IL-1beta-induced p38 MAPK, JNK, and AKT phosphorylation and the downstream activation of NF-kappaB. These results may reveal that the tangeretin inhibition of IL-1beta-induced COX-2 expression in A549 cells is, at least in part, mediated through suppression of NF-kappaB transcription factor as well as through suppression of the signaling proteins of p38 MAPK, JNK, and PI3K, but not of ERK.

  9. IL-6 inhibits upregulation of membrane-bound TGF-beta 1 on CD4+ T cells and blocking IL-6 enhances oral tolerance

    PubMed Central

    Kuhn, Chantal; Rezende, Rafael Machado; M'Hamdi, Hanane; da Cunha, Andre Pires; Weiner, Howard L.

    2016-01-01

    Oral administration of antigen induces regulatory T cells that express latent membrane-bound TGF-beta (LAP) and that have been shown to play an important role in the induction of oral tolerance. We developed an in vitro model to study modulation of LAP+ on CD4+ T cells. The combination of anti-CD3 mAb, anti-CD28 mAb and recombinant IL-2 induced expression of LAP on naïve CD4+ T cells, independent of FoxP3 or exogenous TGF-β. In vitro generated CD4+LAP+FoxP3− T cells were suppressive in vitro, inhibiting proliferation of naïve CD4+ T cells and IL-17A secretion by Th17 cells. Assessing the impact of different cytokines and neutralizing antibodies against cytokines we found that LAP induction was decreased in the presence of IL-6 and IL-21, and to a lesser extent by IL-4 and TNFα. IL-6 abrogated the in vitro induction of CD4+LAP+ T cells by STAT3 dependent inhibition of Lrrc32 (GARP), the adapter protein that tethers TGF-beta to the membrane. Oral tolerance induction was enhanced in mice lacking expression of IL-6R by CD4+ T cells and by treatment of wild-type mice with neutralizing anti-IL-6 mAb. These results suggest that pro-inflammatory cytokines interfere with oral tolerance induction and that blocking the IL-6 pathway is a potential strategy for enhancing oral tolerance in the setting of autoimmune and inflammatory diseases. PMID:28039301

  10. Systemic inhibition of IL-6/Stat3 signalling protects against experimental osteoarthritis.

    PubMed

    Latourte, Augustin; Cherifi, Chahrazad; Maillet, Jérémy; Ea, Hang-Korng; Bouaziz, Wafa; Funck-Brentano, Thomas; Cohen-Solal, Martine; Hay, Eric; Richette, Pascal

    2017-04-01

    To investigate the impact of systemic inhibition of interleukin 6 (IL-6) or signal transducer and activator of transcription (Stat3) in an experimental model of osteoarthritis (OA). Expression of major catabolic and anabolic factors of cartilage was determined in IL-6-treated mouse chondrocytes and cartilage explants. The anti-IL-6-receptor neutralising antibody MR16-1 was used in the destabilisation of the medial meniscus (DMM) mouse model of OA. Stat3 blockade was investigated by the small molecule Stattic ex vivo and in the DMM model. In chondrocytes and cartilage explants, IL-6 treatment reduced proteoglycan content with increased production of matrix metalloproteinase (MMP-3 and MMP-13) and a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS-4 and ADAMTS-5). IL-6 induced Stat3 and extracellular signal-regulated kinase (ERK) 1/2 signalling but not p38, c-Jun N-terminal kinase or Akt. In the DMM model, Stat3 was activated in cartilage, but neither in the synovium nor in the subchondral bone. Systemic blockade of IL-6 by MR16-1 alleviated DMM-induced OA cartilage lesions, impaired the osteophyte formation and the extent of synovitis. In the same model, Stattic had similar beneficial effects on cartilage and osteophyte formation. Stattic, but not an ERK1/2 inhibitor, significantly counteracted the catabolic effects of IL-6 on cartilage explants and suppressed the IL-6-induced chondrocytes apoptosis. IL-6 induces chondrocyte catabolism mainly via Stat3 signalling, a pathway activated in cartilage from joint subjected to DMM. Systemic blockade of IL-6 or STAT-3 can alleviate DMM-induced OA in mice. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  11. Multiple lipopolysaccharide (LPS) injections alter interleukin 6 (IL-6), IL-7, IL-10 and IL-6 and IL-7 receptor mRNA in CNS and spleen.

    PubMed

    Szot, Patricia; Franklin, Allyn; Figlewicz, Dianne P; Beuca, Timothy Petru; Bullock, Kristin; Hansen, Kim; Banks, William A; Raskind, Murray A; Peskind, Elaine R

    2017-07-04

    Neuroinflammation is proposed to be an important component in the development of several central nervous system (CNS) disorders including depression, Alzheimer's disease, Parkinson's disease, and traumatic brain injury. However, exactly how neuroinflammation leads to, or contributes to, these central disorders is unclear. The objective of the study was to examine and compare the expression of mRNAs for interleukin-6 (IL-6), IL-7, IL-10 and the receptors for IL-6 (IL-6R) and IL-7 (IL-7R) using in situ hybridization in discrete brain regions and in the spleen after multiple injections of 3mg/kg lipopolysaccharide (LPS), a model of neuroinflammation. In the spleen, LPS significantly elevated IL-6 mRNA expression, then IL-10 mRNA, with no effect on IL-7 or IL-7R mRNA, while significantly decreasing IL-6R mRNA expression. In the CNS, LPS administration had the greatest effect on IL-6 and IL-6R mRNA. LPS increased IL-6 mRNA expression only in non-neuronal cells throughout the brain, but significantly elevated IL-6R mRNA in neuronal populations, where observed, except the cerebellum. LPS resulted in variable effects on IL-10 mRNA, and had no effect on IL-7 or IL-7R mRNA expression. These studies indicate that LPS-induced neuroinflammation has substantial but variable effects on the regional and cellular patterns of CNS IL-6, IL-7 and IL-10, and for IL-6R and IL-7R mRNA expression. It is apparent that administration of LPS can affect non-neuronal and neuronal cells in the brain. Further research is required to determine how CNS inflammatory changes associated with IL-6, IL-10 and IL-6R could in turn contribute to the development of CNS neurological disorders. Published by Elsevier Ltd.

  12. The effect of TLR9 agonist CpG oligodeoxynucleotides on the intestinal immune response of cobia (Rachycentron canadum).

    PubMed

    Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

    2014-01-01

    Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.

  13. The Effect of TLR9 Agonist CpG Oligodeoxynucleotides on the Intestinal Immune Response of Cobia (Rachycentron canadum)

    PubMed Central

    Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

    2014-01-01

    Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578

  14. Blockade of the IL-6 trans-signalling/STAT3 axis suppresses cachexia in Kras-induced lung adenocarcinoma.

    PubMed

    Miller, A; McLeod, L; Alhayyani, S; Szczepny, A; Watkins, D N; Chen, W; Enriori, P; Ferlin, W; Ruwanpura, S; Jenkins, B J

    2017-05-25

    Lung cancer is the leading cause of cancer death worldwide, and is frequently associated with the devastating paraneoplastic syndrome of cachexia. The potent immunomodulatory cytokine interleukin (IL)-6 has been linked with the development of lung cancer as well as cachexia; however, the mechanisms by which IL-6 promotes muscle wasting in lung cancer cachexia are ill-defined. In this study, we report that the gp130 F/F knock-in mouse model displaying hyperactivation of the latent transcription factor STAT3 via the common IL-6 cytokine family signalling receptor, gp130, develops cachexia during Kras-driven lung carcinogenesis. Specifically, exacerbated weight loss, early mortality and reduced muscle and adipose tissue mass were features of the gp130 F/F :Kras G12D model, but not parental Kras G12D mice in which STAT3 was not hyperactivated. Gene expression profiling of muscle tissue in cachectic gp130 F/F :Kras G12D mice revealed the upregulation of IL-6 and STAT3-target genes compared with Kras G12D muscle tissue. These cachectic features of gp130 F/F :Kras G12D mice were abrogated upon the genetic normalization of STAT3 activation or ablation of IL-6 in gp130 F/F :Kras G12D :Stat3 -/+ or gp130 F/F :Kras G12D :Il6 -/- mice, respectively. Furthermore, protein levels of the soluble IL-6 receptor (sIL-6R), which is the central facilitator of IL-6 trans-signalling, were elevated in cachectic muscle from gp130 F/F :Kras G12D mice, and the specific blockade of IL-6 trans-signalling, but not classical signalling, with an anti-IL-6R antibody ameliorated cachexia-related characteristics in gp130 F/F :Kras G12D mice. Collectively, these preclinical findings identify trans-signalling via STAT3 as the signalling modality by which IL-6 promotes muscle wasting in lung cancer cachexia, and therefore support the clinical evaluation of the IL-6 trans-signalling/STAT3 axis as a therapeutic target in advanced lung cancer patients presenting with cachexia.

  15. Hepatic carcinoma-associated fibroblasts induce IDO-producing regulatory dendritic cells through IL-6-mediated STAT3 activation

    PubMed Central

    Cheng, J-t; Deng, Y-n; Yi, H-m; Wang, G-y; Fu, B-s; Chen, W-j; Liu, W; Tai, Y; Peng, Y-w; Zhang, Q

    2016-01-01

    Although carcinoma-associated fibroblasts (CAFs) in tumor microenvironments have a critical role in immune cell modulation, their effects on the generation of regulatory dendritic cells (DCs) are still unclear. In this study, we initially show that CAFs derived from hepatocellular carcinoma (HCC) tumors facilitate the generation of regulatory DCs, which are characterized by low expression of costimulatory molecules, high suppressive cytokines production and enhanced regulation of immune responses, including T-cell proliferation impairment and promotion of regulatory T-cell (Treg) expansion via indoleamine 2,3-dioxygenase (IDO) upregulation. Our findings also indicate that STAT3 activation in DCs, as mediated by CAF-derived interleukin (IL)-6, is essential to IDO production. Moreover, IDO inhibitor, STAT3 and IL-6 blocking antibodies can reverse this hepatic CAF-DC regulatory function. Therefore, our results provide new insights into the mechanisms by which CAFs induce tumor immune escape as well as a novel cancer immunotherapeutic approach (for example, targeting CAFs, IDO or IL-6). PMID:26900950

  16. Immunization against an IL-6 peptide induces anti-IL-6 antibodies and modulates the Delayed-Type Hypersensitivity reaction in cynomolgus monkeys.

    PubMed

    Desallais, Lucille; Bouchez, Caroline; Mouhsine, Hadley; Moreau, Gabriel; Ratsimandresy, Rojo; Montes, Matthieu; Do, Hervé; Quintin-Colonna, Françoise; Zagury, Jean-François

    2016-01-19

    Interleukin-6 (IL-6) overproduction has been involved in the pathogenesis of several chronic inflammatory diseases and the administration of an anti-IL-6 receptor monoclonal antibody has been proven clinically efficient to treat them. However, the drawbacks of monoclonal antibodies have led our group to develop an innovative anti-IL-6 strategy using a peptide-based active immunization. This approach has previously shown its efficacy in a mouse model of systemic sclerosis. Here the safety, immunogenicity, and efficacy of this strategy was assessed in non human primates. No unscheduled death and clinical signs of toxicity was observed during the study. Furthermore, the cynomolgus monkeys immunized against the IL-6 peptide produced high levels of anti-IL-6 antibodies as well as neutralizing antibodies compared to control groups. They also showed an important decrease of the cumulative inflammatory score following a delayed-type hypersensitivity reaction induced by the Tetanus vaccine compared to control groups (minus 57,9%, P = 0.014). These findings are highly significant because the immunizing IL-6 peptide used in this study is identical in humans and in monkeys and this novel anti-IL-6 strategy could thus represent a promising alternative to monoclonal antibodies.

  17. IL-6 Inhibits Upregulation of Membrane-Bound TGF-β 1 on CD4+ T Cells and Blocking IL-6 Enhances Oral Tolerance.

    PubMed

    Kuhn, Chantal; Rezende, Rafael Machado; M'Hamdi, Hanane; da Cunha, Andre Pires; Weiner, Howard L

    2017-02-01

    Oral administration of Ag induces regulatory T cells that express latent membrane-bound TGF-β (latency-associated peptide [LAP]) and have been shown to play an important role in the induction of oral tolerance. We developed an in vitro model to study modulation of LAP + on CD4 + T cells. The combination of anti-CD3 mAb, anti-CD28 mAb, and recombinant IL-2 induced expression of LAP on naive CD4 + T cells, independent of Foxp3 or exogenous TGF-β. In vitro generated CD4 + LAP + Foxp3 - T cells were suppressive in vitro, inhibiting proliferation of naive CD4 + T cells and IL-17A secretion by Th17 cells. Assessing the impact of different cytokines and neutralizing Abs against cytokines, we found that LAP induction was decreased in the presence of IL-6 and IL-21, and to a lesser extent by IL-4 and TNF-α. IL-6 abrogated the in vitro induction of CD4 + LAP + T cells by STAT3-dependent inhibition of Lrrc32 (glycoprotein A repetitions predominant [GARP]), the adapter protein that tethers TGF-β to the membrane. Oral tolerance induction was enhanced in mice lacking expression of IL-6R by CD4 + T cells and by treatment of wild-type mice with neutralizing anti-IL-6 mAb. These results suggest that proinflammatory cytokines interfere with oral tolerance induction and that blocking the IL-6 pathway is a potential strategy for enhancing oral tolerance in the setting of autoimmune and inflammatory diseases. Copyright © 2017 by The American Association of Immunologists, Inc.

  18. CpG ODN 1668 induce innate and adaptive immune responses in rock bream (Oplegnathus fasciatus) against rock bream iridovirus (RBIV) infection.

    PubMed

    Jung, Myung-Hwa; Jung, Sung-Ju

    2017-10-01

    Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. IL-1 receptor antagonist-deficient mice develop autoimmune arthritis due to intrinsic activation of IL-17-producing CCR2+Vγ6+γδ T cells

    PubMed Central

    Akitsu, Aoi; Ishigame, Harumichi; Kakuta, Shigeru; Chung, Soo-hyun; Ikeda, Satoshi; Shimizu, Kenji; Kubo, Sachiko; Liu, Yang; Umemura, Masayuki; Matsuzaki, Goro; Yoshikai, Yasunobu; Saijo, Shinobu; Iwakura, Yoichiro

    2015-01-01

    Interleukin-17 (IL-17)-producing γδ T (γδ17) cells have been implicated in inflammatory diseases, but the underlying pathogenic mechanisms remain unclear. Here, we show that both CD4+ and γδ17 cells are required for the development of autoimmune arthritis in IL-1 receptor antagonist (IL-1Ra)-deficient mice. Specifically, activated CD4+ T cells direct γδ T-cell infiltration by inducing CCL2 expression in joints. Furthermore, IL-17 reporter mice reveal that the Vγ6+ subset of CCR2+ γδ T cells preferentially produces IL-17 in inflamed joints. Importantly, because IL-1Ra normally suppresses IL-1R expression on γδ T cells, IL-1Ra-deficient mice exhibit elevated IL-1R expression on Vγ6+ cells, which play a critical role in inducing them to produce IL-17. Our findings demonstrate a pathogenic mechanism in which adaptive and innate immunity induce an autoimmune disease in a coordinated manner. PMID:26108163

  20. IL-6-Type Cytokine Signaling in Adipocytes Induces Intestinal GLP-1 Secretion.

    PubMed

    Wueest, Stephan; Laesser, Céline I; Böni-Schnetzler, Marianne; Item, Flurin; Lucchini, Fabrizio C; Borsigova, Marcela; Müller, Werner; Donath, Marc Y; Konrad, Daniel

    2018-01-01

    We recently showed that interleukin (IL)-6-type cytokine signaling in adipocytes induces free fatty acid release from visceral adipocytes, thereby promoting obesity-induced hepatic insulin resistance and steatosis. In addition, IL-6-type cytokines may increase the release of leptin from adipocytes and by those means induce glucagon-like peptide 1 (GLP-1) secretion. We thus hypothesized that IL-6-type cytokine signaling in adipocytes may regulate insulin secretion. To this end, mice with adipocyte-specific knockout of gp130, the signal transducer protein of IL-6, were fed a high-fat diet for 12 weeks. Compared with control littermates, knockout mice showed impaired glucose tolerance and circulating leptin, GLP-1, and insulin levels were reduced. In line, leptin release from isolated adipocytes was reduced, and intestinal proprotein convertase subtilisin/kexin type 1 ( Pcsk1 ) expression, the gene encoding PC1/3, which controls GLP-1 production, was decreased in knockout mice. Importantly, treatment with the GLP-1 receptor antagonist exendin 9-39 abolished the observed difference in glucose tolerance between control and knockout mice. Ex vivo, supernatant collected from isolated adipocytes of gp130 knockout mice blunted Pcsk1 expression and GLP-1 release from GLUTag cells. In contrast, glucose- and GLP-1-stimulated insulin secretion was not affected in islets of knockout mice. In conclusion, adipocyte-specific IL-6 signaling induces intestinal GLP-1 release to enhance insulin secretion, thereby counteracting insulin resistance in obesity. © 2017 by the American Diabetes Association.

  1. Prostaglandin E2 Induces IL-6 and IL-8 Production by the EP Receptors/Akt/NF-κB Pathways in Nasal Polyp-Derived Fibroblasts.

    PubMed

    Cho, Jung-Sun; Han, In-Hye; Lee, Hye Rim; Lee, Heung-Man

    2014-09-01

    Interleukin 6 (IL-6) and IL-8 participate in the pathogenesis of chronic rhinosinusitis with nasal polyps, and their levels are increased by prostaglandin E2 (PGE2) in different cell types. The purposes of this study were to determine whether PGE2 has any effect on the increase in the levels of IL-6 and IL-8 in nasal polyp-derived fibroblasts (NPDFs) and subsequently investigate the possible mechanism of this effect. Different concentrations of PGE2 were used to stimulate NPDFs at different time intervals. NPDFs were treated with agonists and antagonists of E prostanoid (EP) receptors. To determine the signaling pathway for the expression of PGE2-induced IL-6 and IL-8, PGE2 was treated with Akt and NF-κB inhibitors in NPDFs. Reverse transcription-polymerase chain reaction for IL-6 and IL-8 mRNAs was performed. IL-6 and IL-8 levels were measured byenzyme-linked immunosorbent assay (ELISA). The activation of Akt and NF-κB was evaluated by western blot analysis. PGE2 significantly increased the mRNA and protein expression levels of IL-6 and IL-8 in NPDFs. The EP2 and EP4 agonists and antagonists induced and inhibited IL-6 expression. However, the EP4 agonist and antagonist were only observed to induce and inhibit IL-8 expression level. The Akt and NF-κB inhibitors significantly blocked PGE2-induced expression of IL-6 and IL-8. PGE2 increases IL-6 expression via EP2 and EP4 receptors, and IL-8 expression via the EP4 receptor in NPDFs. It also activates the Akt and NF-κB signal pathways for the production of IL-6 and IL-8 in NPDFs. These results suggest that signaling pathway for IL-6 and IL-8 expression induced by PGE2 might be a useful therapeutic target for the treatment of nasal polyposis.

  2. Neutralization of both IL-1α/IL-1β plays a major role in suppressing combined cigarette smoke/virus-induced pulmonary inflammation in mice.

    PubMed

    Bucher, Hannes; Mang, Samuel; Keck, Martina; Przibilla, Michèl; Lamb, David J; Schiele, Felix; Wittenbrink, Mareike; Fuchs, Klaus; Jung, Birgit; Erb, Klaus J; Peter, Daniel

    2017-06-01

    Smoking is an important risk factor for the development of chronic obstructive pulmonary disease (COPD) and viral infections are believed to be major triggers of exacerbations, which periodically lead to a worsening of symptoms. The pro-inflammatory IL-1 family members IL-1α and IL-1β are increased in COPD patients and might contribute to disease pathology. We investigated whether individual or combined inhibition of these cytokines reduced lung inflammation in cigarette smoke (CS)-exposed and H1N1-infected BALB/c mice. Animals were treated with individual or combined antibodies (Abs) directed against IL-1α, IL-1β or IL-1R1. Cells in BAL fluid and cytokines/chemokines in lung homogenate were determined. The viral load was investigated. Blocking IL-1α had significant suppressive effects on total cells, neutrophils, and macrophages. Furthermore, it reduced KC levels significantly. Blocking of IL-1β did not provide significant activity. In primary human bronchial epithelial air-liquid-interface cell cultures infected with H1N1, IL-1α Abs but not IL-1β Abs reduced levels of TNF-α and IL-6. Concomitant usage of Abs against IL-1α/IL-1β revealed strong effects in vivo and reduced total cells, neutrophils and macrophages. Additionally, levels of KC, IL-6, TNF-α, MCP-1, MIP-1α and MIP-1β were significantly reduced and ICAM-1 and MUC5 A/C mRNA expression was attenuated. The viral load decreased significantly upon combined IL-1α/IL-1β Ab treatment. Blocking the IL-1R1 provided significant effects on total cells, neutrophils and macrophages but was inferior compared to inhibiting both its soluble ligands IL-1α/IL-1β. Our results suggest that combined inhibition of IL-1α/IL-1β might be beneficial to reduce CS/H1N1-induced airway inflammation. Moreover, combined targeting of both IL-1α/IL-1β might be more efficient compared to individual neutralization IL-1α or IL-1β or inhibition of the IL-1R1. Copyright © 2017 The Authors. Published by Elsevier Ltd

  3. Herbal Extract SH003 Suppresses Tumor Growth and Metastasis of MDA-MB-231 Breast Cancer Cells by Inhibiting STAT3-IL-6 Signaling

    PubMed Central

    Woo, Sang-Mi; Park, Sunju; Shin, Yong Cheol; Ko, Seong-Gyu

    2014-01-01

    Cancer inflammation promotes cancer progression, resulting in a high risk of cancer. Here, we demonstrate that our new herbal extract, SH003, suppresses both tumor growth and metastasis of MDA-MB-231 breast cancer cells via inhibiting STAT3-IL-6 signaling path. Our new herbal formula, SH003, mixed extract from Astragalus membranaceus, Angelica gigas, and Trichosanthes kirilowii Maximowicz, suppressed MDA-MB-231 tumor growth and lung metastasis in vivo and reduced the viability and metastatic abilities of MDA-MB-231 cells in vitro. Furthermore, SH003 inhibited STAT3 activation, which resulted in a reduction of IL-6 production. Therefore, we conclude that SH003 suppresses highly metastatic breast cancer growth and metastasis by inhibiting STAT3-IL-6 signaling path. PMID:24976685

  4. Lnk adaptor suppresses radiation resistance and radiation-induced B-cell malignancies by inhibiting IL-11 signaling

    PubMed Central

    Louria-Hayon, Igal; Frelin, Catherine; Ruston, Julie; Gish, Gerald; Jin, Jing; Kofler, Michael M.; Lambert, Jean-Philippe; Adissu, Hibret A.; Milyavsky, Michael; Herrington, Robert; Minden, Mark D.; Dick, John E.; Gingras, Anne-Claude; Iscove, Norman N.; Pawson, Tony

    2013-01-01

    The Lnk (Sh2b3) adaptor protein dampens the response of hematopoietic stem cells and progenitors (HSPCs) to a variety of cytokines by inhibiting JAK2 signaling. As a consequence, Lnk−/− mice develop hematopoietic hyperplasia, which progresses to a phenotype resembling the nonacute phase of myeloproliferative neoplasm. In addition, Lnk mutations have been identified in human myeloproliferative neoplasms and acute leukemia. We find that Lnk suppresses the development of radiation-induced acute B-cell malignancies in mice. Lnk-deficient HSPCs recover more effectively from irradiation than their wild-type counterparts, and this resistance of Lnk−/− HSPCs to radiation underlies the subsequent emergence of leukemia. A search for the mechanism responsible for radiation resistance identified the cytokine IL-11 as being critical for the ability of Lnk−/− HSPCs to recover from irradiation and subsequently become leukemic. In IL-11 signaling, wild-type Lnk suppresses tyrosine phosphorylation of the Src homology region 2 domain-containing phosphatase-2/protein tyrosine phosphatase nonreceptor type 11 and its association with the growth factor receptor-bound protein 2, as well as activation of the Erk MAP kinase pathway. Indeed, Src homology region 2 domain-containing phosphatase-2 has a binding motif for the Lnk Src Homology 2 domain that is phosphorylated in response to IL-11 stimulation. IL-11 therefore drives a pathway that enhances HSPC radioresistance and radiation-induced B-cell malignancies, but is normally attenuated by the inhibitory adaptor Lnk. PMID:24297922

  5. The role of genetic variation across IL-1β, IL-2, IL-6, and BDNF in antipsychotic-induced weight gain.

    PubMed

    Fonseka, Trehani M; Tiwari, Arun K; Gonçalves, Vanessa F; Lieberman, Jeffrey A; Meltzer, Herbert Y; Goldstein, Benjamin I; Kennedy, James L; Kennedy, Sidney H; Müller, Daniel J

    2015-01-01

    Antipsychotics with high weight gain-inducing propensities influence the expression of immune and neurotrophin genes, which have been independently related to obesity indices. Thus, we investigated whether variants in the genes encoding interleukin (IL)-1β, IL-2, and IL-6 and brain-derived neurotrophic factor (BDNF) Val66Met are associated with antipsychotic-induced weight gain (AIWG). Nineteen polymorphisms were genotyped using Taqman(®) assays in 188 schizophrenia patients on antipsychotic treatment for up to 14 weeks. Mean weight change (%) from baseline was compared across genotypic groups using analysis of covariance (ANCOVA). Epistatic effects between cytokine polymorphisms and BDNF Val66Met were tested using Model-Based Multifactor Dimensionality Reduction. In European patients, IL-1β rs16944*GA (P = 0.013, Pcorrected = 0.182), IL-1β rs1143634*G (P = 0.001, Pcorrected = 0.014), and BDNF Val66Met (Val/Val, P = 0.004, Pcorrected = 0.056) were associated with greater AIWG, as were IL-1β rs4849127*A (P = 0.049, Pcorrected = 0.784), and IL-1β rs16944*GA (P = 0.012, Pcorrected = 0.192) in African Americans. BDNF Val66Met interacted with both IL-1β rs13032029 (Val/Met+ TT, PPerm = 0.029), and IL-6 rs2069837 (Val/Val+ AA, PPerm = 0.021) in Europeans, in addition to IL-1β rs16944 (Val/Val+ GA, PPerm = 0.006) in African Americans. SNPs across IL-1β and BDNF Val66Met may influence AIWG. Replication of these findings in larger, independent samples is warranted.

  6. Heparinoid suppresses Der p-induced IL-1β production by inhibiting ERK and p38 MAPK pathways in keratinocytes.

    PubMed

    Utsunomiya, Ryo; Dai, Xiuju; Murakami, Masamoto; Okazaki, Hidenori; Tsuda, Teruko; Mori, Hideki; Shiraishi, Ken; Tohyama, Mikiko; Sayama, Koji

    2018-05-13

    Epidermal keratinocytes initiate skin inflammation by activating immune cells. The skin barrier is disrupted in atopic dermatitis (AD) and epidermal keratinocytes can be exposed to environmental stimuli, such as house dust mite (HDM) allergens. We showed previously that HDM allergens activate the NLRP3 inflammasome of keratinocytes, thereby releasing pro-inflammatory cytokines. Heparinoid is an effective moisturizer for atopic dry skin. However, a recent report showed that heparinoid treatment can improve inflammation of lichen planus. Therefore, we hypothesized that it acts on epidermal keratinocytes not only as a moisturizer, but also as a suppressant of the triggers of skin inflammation. We found that HDM allergen-induced interleukin (IL)-1β release from keratinocytes was inhibited significantly by heparinoid pretreatment without affecting cell viability. However, heparinoid did not affect caspase-1 release, suggesting that heparinoid did not affect HDM allergen-induced inflammasome activation. Heparinoid treatment not only decreased intracellular levels of pro-IL-1β, but also suppressed IL-1β messenger RNA (mRNA) expression in keratinocytes. Among the intracellular signaling pathways, the activation of extracellular signal-regulated kinase and p38 pathways, which are required for IL-1β expression in keratinocytes, was inhibited by heparinoid treatment. The inhibitory effect of heparinoid on IL-1β mRNA expression was also confirmed with living skin equivalents. Our results demonstrated that heparinoid suppresses the initiation of keratinocyte-mediated skin inflammation. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  7. Topical application of glycolic acid suppresses the UVB induced IL-6, IL-8, MCP-1 and COX-2 inflammation by modulating NF-κB signaling pathway in keratinocytes and mice skin.

    PubMed

    Tang, Sheau-Chung; Liao, Pei-Yun; Hung, Sung-Jen; Ge, Jheng-Siang; Chen, Shiou-Mei; Lai, Ji-Ching; Hsiao, Yu-Ping; Yang, Jen-Hung

    2017-06-01

    Glycolic acid (GA), commonly present in fruits, has been used to treat dermatological diseases. Extensive exposure to solar ultraviolet B (UVB) irradiation plays a crucial role in the induction of skin inflammation. The development of photo prevention from natural materials represents an effective strategy for skin keratinocytes. The aim of this study was to investigate the molecular mechanisms underlying the glycolic acid (GA)-induced reduction of UVB-mediated inflammatory responses. We determined the effects of different concentrations of GA on the inflammatory response of human keratinocytes HaCaT cells and C57BL/6J mice dorsal skin. After GA was topically applied, HaCaT and mice skin were exposed to UVB irradiation. GA reduced the production of UVB-induced nuclear factor kappa B (NF-κB)-dependent inflammatory mediators [interleukin (IL)-1β, IL-6, IL-8, cyclooxygenase (COX)-2, tumor necrosis factor-α, and monocyte chemoattractant protein (MCP-1)] at both mRNA and protein levels. GA inhibited the UVB-induced promoter activity of NF-κB in HaCaT cells. GA attenuated the elevation of senescence associated with β-galactosidase activity but did not affect the wound migration ability. The topical application of GA inhibited the genes expression of IL-1β, IL-6, IL-8, COX-2, and MCP-1 in UVB-exposed mouse skin. The mice to UVB irradiation after GA was topically applied for 9 consecutive days and reported that 1-1.5% of GA exerted anti-inflammatory effects on mouse skin. We clarified the molecular mechanism of GA protection against UVB-induced inflammation by modulating NF-κB signaling pathways and determined the optimal concentration of GA in mice skin exposed to UVB irradiation. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

  8. Identification of a boron nitride nanosphere-binding peptide for the intracellular delivery of CpG oligodeoxynucleotides

    NASA Astrophysics Data System (ADS)

    Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka

    2012-09-01

    CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7

  9. Docosahexaenoic acid inhibits IL-6 expression via PPARγ-mediated expression of catalase in cerulein-stimulated pancreatic acinar cells.

    PubMed

    Song, Eun Ah; Lim, Joo Weon; Kim, Hyeyoung

    2017-07-01

    Cerulein pancreatitis mirrors human acute pancreatitis. In pancreatic acinar cells exposed to cerulein, reactive oxygen species (ROS) mediate inflammatory signaling by Janus kinase (JAK) 2/signal transducer and activator of transcription (STAT) 3, and cytokine induction. Docosahexaenoic acid (DHA) acts as an agonist of peroxisome proliferator activated receptor γ (PPARγ), which mediates the expression of some antioxidant enzymes. We hypothesized that DHA may induce PPARγ-target catalase expression and reduce ROS levels, leading to the inhibition of JAK2/STAT3 activation and IL-6 expression in cerulein-stimulated acinar cells. Pancreatic acinar AR42J cells were treated with DHA in the presence or absence of the PPARγ antagonist GW9662, or treated with the PPARγ agonist troglitazone, and then stimulated with cerulein. Expression of IL-6 and catalase, ROS levels, JAK2/STAT3 activation, and nuclear translocation of PPARγ were assessed. DHA suppressed the increase in ROS, JAK2/STAT3 activation, and IL-6 expression induced nuclear translocation of PPARγ and catalase expression in cerulein-stimulated AR42J cells. Troglitazone inhibited the cerulein-induced increase in ROS and IL-6 expression, but induced catalase expression similar to DHA in AR42J cells. GW9662 abolished the inhibitory effect of DHA on cerulein-induced increase in ROS and IL-6 expression in AR42J cells. DHA-induced expression of catalase was suppressed by GW9662 in cerulein-stimulated AR42J cells. Thus, DHA induces PPARγ activation and catalase expression, which inhibits ROS-mediated activation of JAK2/STAT3 and IL-6 expression in cerulein-stimulated pancreatic acinar cells. Copyright © 2017. Published by Elsevier Ltd.

  10. Gamma-tocotrienol inhibits lipopolysaccharide-induced interlukin-6 and granulocyte-colony stimulating factor by suppressing C/EBP-β and NF-κB in macrophages

    PubMed Central

    Wang, Yun; Jiang, Qing

    2012-01-01

    Cytokines generated from macrophages contributes to pathogenesis of inflammation-associated diseases. Here we show that gamma-tocotrienol (γ-TE), a natural vitamin E form, inhibits lipopolysaccharide (LPS)-induced interleukin-6 (IL-6) production without affecting TNFα, IL-10 or cyclooxygenase-2 (COX-2) up-regulation in murine RAW267.4 macrophages. Mechanistic studies indicate that nuclear factor (NF)-κB, but not JNK, p38 or ERK MAP kinases, is important to IL-6 production and γ-TE treatment blocks NF-κB activation. In contrast, COX-2 appears to be regulated by p38 MAPK in RAW cells, but γ-TE has no effect on LPS-stimulated p38 phosphorylation. Despite necessary for IL-6, NF-κB activation by TNFα or other cytokines is not sufficient for IL-6 induction with exception of LPS. CCAAT-enhancer binding protein β (C/EBPβ) appears to be involved in IL-6 formation, because LPS induces C/EBPβ up-regulation, which parallels IL-6 production, and knockdown of C/EBPβ with siRNA results in diminished IL-6. LPS but not individual cytokines is capable of stimulating C/EBPβ and IL-6 in macrophages. Consistent with its dampening effect on IL-6, γ-TE blunts LPS-induced up-regulation of C/EBPβ without affecting C/EBPδ. γ-TE also decreases LPS-stimulated granulocyte-colony stimulating factor (G-CSF), a C/EBPβ target gene. Compared with RAW267.4 cells, γ-TE shows similar or stronger inhibitory effects on LPS-triggered activation of NF-κB, C/EPBβ and C/EBPδ, and more potently suppresses IL-6 and G-CSF in bone marrow-derived macrophages. Our study demonstrates that γ-TE has anti-inflammatory activities by inhibition of NF-κB and C/EBPs activation in macrophages. PMID:23246159

  11. IL6 induces TAM resistance via kinase-specific phosphorylation of ERα in OVCA cells.

    PubMed

    Wang, Yue; Niu, Xiu Long; Guo, Xiao Qin; Yang, Jing; Li, Ling; Qu, Ye; Xiu Hu, Cun; Mao, Li Qun; Wang, Dan

    2015-06-01

    About 40-60% of ovarian cancer (OVCA) cases express ERα, but only a small proportion of patients respond clinically to anti-estrogen treatment with estrogen receptor (ER) antagonist tamoxifen (TAM). The mechanism of TAM resistance in the course of OVCA progression remains unclear. However, IL6 plays a critical role in the development and progression of OVCA. Our recent results indicated that IL6 secreted by OVCA cells may promote the resistance of these cells to TAM via ER isoforms and steroid hormone receptor coactivator-1. Here we demonstrate that both exogenous (a relatively short period of treatment with recombinant IL6) and endogenous IL6 (generated as a result of transfection with a plasmid encoding sense IL6) increases expression of pERα-Ser118 and pERα-Ser167 in non-IL6-expressing A2780 cells, while deleting endogenous IL6 expression in IL6-overexpressing CAOV-3 cells (by transfection with a plasmid encoding antisense IL6) reduces expression of pERα-Ser118 and pERα-Ser167, indicating that IL6-induced TAM resistance may also be associated with increased expression of pERα-Ser118 and pERα-Ser167 in OVCA cells. Results of further investigation indicate that IL6 phosphorylates ERα at Ser118 and Ser167 by triggering activation of MEK/ERK and phosphotidylinositol 3 kinase/Akt signaling, respectively, to activate the ER pathway and thereby induce OVCA cells resistance to TAM. These results indicate that IL6 secreted by OVCA cells may also contribute to the refractoriness of these cells to TAM via the crosstalk between ER and IL6-mediated intracellular signal transduction cascades. Overexpression of IL6 not only plays an important role in OVCA progression but also promotes TAM resistance. Our results indicate that TAM-IL6-targeted adjunctive therapy may lead to a more effective intervention than TAM alone. © 2015 Society for Endocrinology.

  12. Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

    PubMed

    Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

    2012-06-06

    First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Metformin alleviated endotoxemia-induced acute lung injury via restoring AMPK-dependent suppression of mTOR.

    PubMed

    Wu, Kejia; Tian, Rui; Huang, Jing; Yang, Yongqiang; Dai, Jie; Jiang, Rong; Zhang, Li

    2018-05-31

    Inflammation requires intensive metabolic support and modulation of the metabolic pathways might become a novel strategy to limit inflammatory injury. Recent studies have revealed the anti-inflammatory effects of the anti-diabetic reagent metformin, but the underlying mechanisms remain unclear. In the present study, the potential effects of metformin on endotoxemia-induced acute lung injury (ALI) and their relationship with the representative metabolic regulator, including AMPK, sirtuin 1 and mTOR, were investigated. The results indicated that treatment with metformin suppressed LPS-induced upregulation of IL-6 and TNF-α, alleviated pulmonary histological abnormalities, improved the survival rate of LPS-challenged mice. Treatment with metformin reversed LPS-induced decline of AMPK phosphorylation. Co-administration of the AMPK inhibitor compound C abolished the stimulatory effects of metformin on AMPK phosphorylation, the suppressive effects of metformin on IL-6 induction and pulmonary lesions. In addition, co-administration of the mTOR activator 3BDO but not the sirtuin 1 inhibitor EX-527 abolished the effects of metformin on IL-6 induction and pulmonary lesions. Finally, treatment with metformin suppressed LPS-induced p70S6K1 phosphorylation, which was abolished by the AMPK inhibitor. These data suggest that metformin might provide anti-inflammatory benefits in endotoxemia-induced inflammatory lung injury via restoring AMPK-dependent suppression of mTOR. Copyright © 2018. Published by Elsevier B.V.

  14. The role of IL-6 in pathogenesis of abdominal aortic aneurysm in mice.

    PubMed

    Nishihara, Michihide; Aoki, Hiroki; Ohno, Satoko; Furusho, Aya; Hirakata, Saki; Nishida, Norifumi; Ito, Sohei; Hayashi, Makiko; Imaizumi, Tsutomu; Fukumoto, Yoshihiro

    2017-01-01

    Although the pathogenesis of abdominal aortic aneurysm (AAA) remains unclear, evidence is accumulating to support a central role for inflammation. Inflammatory responses are coordinated by various soluble cytokines of which IL-6 is one of the major proinflammatory cytokines. In this study we examined the role of IL-6 in the pathogenesis of experimental AAA induced by a periaortic exposure to CaCl2 in mice. We now report that the administration of MR16-1, a neutralizing monoclonal antibody specific for the mouse IL-6 receptor, mildly suppressed the development of AAA. The inhibition of IL-6 signaling provoked by MR16-1 also resulted in a suppression of Stat3 activity. Conversely, no significant changes in either NFκB activity, Jnk activity or the expression of matrix metalloproteinases (Mmp) -2 and -9 were identified. Transcriptome analyses revealed that MR16-1-sensitive genes encode chemokines and their receptors, as well as factors that regulate vascular permeability and cell migration. Imaging cytometric analyses then consistently demonstrated reduced cellular infiltration for MR16-1-treated AAA. These results suggest that IL-6 plays an important but limited role in AAA pathogenesis, and primarily regulates cell migration and infiltration. These data would also suggest that IL-6 activity may play an important role in scenarios of continuous cellular infiltration, possibly including human AAA.

  15. The role of IL-6 in pathogenesis of abdominal aortic aneurysm in mice

    PubMed Central

    Nishihara, Michihide; Ohno, Satoko; Furusho, Aya; Hirakata, Saki; Nishida, Norifumi; Ito, Sohei; Hayashi, Makiko; Imaizumi, Tsutomu; Fukumoto, Yoshihiro

    2017-01-01

    Although the pathogenesis of abdominal aortic aneurysm (AAA) remains unclear, evidence is accumulating to support a central role for inflammation. Inflammatory responses are coordinated by various soluble cytokines of which IL-6 is one of the major proinflammatory cytokines. In this study we examined the role of IL-6 in the pathogenesis of experimental AAA induced by a periaortic exposure to CaCl2 in mice. We now report that the administration of MR16-1, a neutralizing monoclonal antibody specific for the mouse IL-6 receptor, mildly suppressed the development of AAA. The inhibition of IL-6 signaling provoked by MR16-1 also resulted in a suppression of Stat3 activity. Conversely, no significant changes in either NFκB activity, Jnk activity or the expression of matrix metalloproteinases (Mmp) -2 and -9 were identified. Transcriptome analyses revealed that MR16-1-sensitive genes encode chemokines and their receptors, as well as factors that regulate vascular permeability and cell migration. Imaging cytometric analyses then consistently demonstrated reduced cellular infiltration for MR16-1-treated AAA. These results suggest that IL-6 plays an important but limited role in AAA pathogenesis, and primarily regulates cell migration and infiltration. These data would also suggest that IL-6 activity may play an important role in scenarios of continuous cellular infiltration, possibly including human AAA. PMID:28982132

  16. Involvement of IL-1β and IL-6 in antiarrhythmic properties of atorvastatin in ouabain-induced arrhythmia in rats.

    PubMed

    Najjari, Mahya; Vaezi, Gholamhassan; Hojati, Vida; Mousavi, Zahra; Bakhtiarian, Azam; Nikoui, Vahid

    2018-06-01

    Evidence show that statins possess wide beneficial cardioprotective and anti-inflammatory effects; therefore, in the present experiment, we investigated the antiarrhythmic properties of atorvastatin in ouabain-induced arrhythmia in isolated rat atria and the role of several inflammatory cytokines in this effect. Male rats were pretreated with either of atorvastatin (10 mg/kg) or vehicle, orally once daily for 6 weeks. After induction of anesthesia, we isolated the atria and after incubation with ouabain, time of onset of arrhythmia and asystole as well as atrial beating rate and contractile force were recorded. We also measured the atrial levels of IL-1β, IL-6, and TNF-α after the injection of ouabain to animals. Pretreatment with atorvastatin significantly delayed the onset of arrhythmia and asystole compared with vehicle-treated group (p < .01, p < .001, respectively). Incubation of ouabain boosted both atrial beating rate and contractile force in vehicle-treated group (p < .05), while these responses in atorvastatin-treated group were not significant (p > .05). Injection of ouabain elevated the atrial levels of IL-1β, IL-6, and TNF-α, while pretreatment of animals with atorvastatin could reverse the ouabain-induced increase in atrial IL-1β and IL-6 (p < .01 and p < .05, respectively). It is concluded that observed antiarrhythmic effects of atorvastatin might be attributed to modulation of some inflammatory cytokines, at least IL-1β and IL-6.

  17. (+/-)-3-[4-(2-dimethylamino-1-methylethoxy)-phenyl]-1H-pyrazolo[3,4- B]pyridine-1-acetic acid (Y-25510) stimulates production of IL-1 beta and IL-6 at the level of messenger RNA expression in cultured human monocytes.

    PubMed

    Kusuhara, H; Komatsu, H; Hisadome, M; Ikeda, Y

    1996-12-01

    (+/-)-3-[4-(2-Dimethylamino-1-methylethoxy)phenyl]-1H-pyrazolo[3, 4-b]pyridine-1-acetic acid (Y-25510) stimulated the mRNA expression for interleukin-1 beta (IL-1 beta), and enhanced the expression induced by lipopolysaccharide (LPS) in cultured human peripheral blood mononuclear cells (PBMC) and THP-1 cells, a cell-line derived from human monocytic leukemia. Y-25510 also stimulated the mRNA expression for IL-6 in both types of the cells, however, the stimulation required the presence of LPS. In THP-1 cells, the stimulation of IL-1 beta mRNA expression by Y-25510 was suppressed by cycloheximide, an inhibitor of protein synthesis. This phenomenon indicates that the stimulation requires de norv protein synthesis. In contrast, the stimulation of mRNA expression for IL-6 by Y-25510 was not suppressed by cycloheximide but suppressed by N alpha-p-tosyl-L-phenylalanine chloromethyl ketone (TPCK), an inhibitor of nuclear transcription factor-kappa B (NF-kappa B) activation, in the presence of LPS, suggesting that the stimulation requires NF-kappa activation. These results demonstrate that Y-25510 stimulates the mRNA expression for IL-1 beta and IL-6 by different mechanisms. Dexamethasone suppressed the LPS-induced expression of mRNA for IL-1 beta and IL-6 in THP-1 cells, whereas the drug never suppressed the mRNA expression for these cytokines in the presence of Y-25510. The result indicates that Y-25510 stimulates the mRNA expression for IL-1 beta and IL-6 by different mechanisms from those of LPS.

  18. Dendritic Cells Induce a Subpopulation of IL-12Rβ2-Expressing Treg that Specifically Consumes IL-12 to Control Th1 Responses

    PubMed Central

    Sela, Uri; Park, Chae Gyu; Park, Andrew; Olds, Peter; Wang, Shu; Fischetti, Vincent A.

    2016-01-01

    Cytokines secreted from dendritic cells (DCs) play an important role in the regulation of T helper (Th) cell differentiation and activation into effector cells. Therefore, controlling cytokine secretion from DCs may potentially regulate Th differentiation/activation. DCs also induce de-novo generation of regulatory T cells (Treg) that modulate the immune response. In the current study we used the mixed leukocyte reaction (MLR) to investigate the effect of allospecific Treg on IL-12, TNFα and IL-6 secretion by DCs. Treg cells were found to markedly down-regulate IL-12 secretion from DCs following stimulation with TLR7/8 agonist. This down-regulation of IL-12 was neither due to a direct suppression of its production by the DCs nor a result of marked DC death. We found that IL-12 was rather actively consumed by Treg cells. IL-12 consumption was mediated by a subpopulation of IL-12Rβ2-expressing Treg cells and was dependent on MHC class-II expressed on dendritic cells. Furthermore, IL-12 consumption by Tregs increased their suppressive effect on T cell proliferation and Th1 activation. These results provide a new pathway of Th1 response regulation where IL-12 secreted by DCs is consumed by a sub-population of IL-12Rβ2-expressing Treg cells. Consumption of IL-12 by Tregs not only reduces the availability of IL-12 to Th effector cells but also enhances the Treg immunosuppressive effect. This DC-induced IL-12Rβ2-expressing Treg subpopulation may have a therapeutic advantage in suppressing Th1 mediated autoimmunity. PMID:26745371

  19. Interleukin-6 promotes systemic lupus erythematosus progression with Treg suppression approach in a murine systemic lupus erythematosus model.

    PubMed

    Mao, Xiaoli; Wu, Yunyun; Diao, Huitian; Hao, Jianlei; Tian, Gaofei; Jia, Zhenghu; Li, Zheng; Xiong, Sidong; Wu, Zhenzhou; Wang, Puyue; Zhao, Liqing; Yin, Zhinan

    2014-11-01

    Our aim is to reveal the role of interleukin 6 (IL-6) in the pathogenesis of systemic lupus erythematosus (SLE) in a murine model of SLE. Normal female C57BL/6 mice were immunized with syngeneic-activated lymphocyte-derived DNA (ALD-DNA) to induce SLE. Non-immunized mice were used as control. SLE-associated markers, including anti-double-stranded DNA (anti-dsDNA) Abs, urine protein, and kidney histopathology, were assayed to ensure the induction of the disease. Compared with control mice, ALD-DNA immunized mice exhibited high levels of anti-dsDNA Abs, IL-6 expression in vivo and in vitro. We also found that IL-6 knockout (IL-6KO) mice were resistant to ALD-DNA-induced SLE. The activation of CD4(+) T cells in immunized IL-6KO mice was lower than in immunized wild-type (Wt) mice. Intracellular cytokine staining showed that Foxp3 expression in immunized IL-6KO mice was higher than in immunized Wt mice, which might be associated with the disease severity. We further discovered that ALD-DNA-stimulated dendritic cells supernatants could result in higher IL-6 and TNF-α expression and could suppress Foxp3 expression. In addition, blocking IL-6 could up-regulate Foxp3 expression. Therefore, our findings show that IL-6 promotes the progression of SLE via suppressing Treg differentiation.

  20. The influence of chronic IL-6 exposure, in vivo, on rat Achilles tendon extracellular matrix.

    PubMed

    Katsma, Mark S; Patel, Shivam H; Eldon, Erica; Corbell, Kathryn A; Shimkus, Kevin L; Fluckey, James D; Carroll, Chad C

    2017-05-01

    When compared to placebo, acetaminophen (APAP) reduces tendon stiffness and collagen cross-linking. APAP also enhances the exercise-induced increase in peritendinous levels of IL-6. Elevated levels of IL-6 are associated with tendinopathy, thus we hypothesized that chronic, elevated peritendinous IL-6 would alter tendon extracellular matrix (ECM). IL-6 (∼3000pgml -1 ) was injected (3dwk -1 for 8-wks) into the Achilles peritendinous region of male Wistar rats (n=16) with the opposite leg serving as a sham. Fractional synthesis rates (FSR) were determined using deuterium oxide. Collagen (hydroxyproline) and hydroxylysl pyridinoline (HP) cross-linking were analyzed by HPLC. ECM and IL-6 related genes were evaluated using qRT-PCR. Relative to sham, collagen (Col) 1a1 but not Col3a1 expression was suppressed (47%) in tendons exposed to IL-6 (p<0.05). Lysyl oxidase (LOX) and MMP-1 expression were also reduced (37%) in IL-6 treated tendons (p<0.05). Relative to sham the expression of MMP-2, -3, -9, and TIMP-1 were not altered by IL-6 treatment (p>0.05). Interleukin-6 receptor subunit beta precursor (IL6st) was lower (16%) in IL-6 treated tendons when compared to sham (p<0.05). Suppressor of cytokine signaling 3 (Socs3), signal transducer and activator of transcription 3 (STAT3), and protein inhibitor of activated STAT 1 (Pias1) were not altered by IL-6 exposure (p>0.05). Neither collagen nor cross-linking content were altered by IL-6 (p>0.05). Additionally, IL-6 treatment did not alter tendon FSR. Chronic treatment with physiologically relevant levels of IL-6 suppresses expression of Col1a1 and LOX while also altering expression of select MMPs but does not alter Achilles tendon collagen synthesis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Blood concentrations of the cytokines IL-1beta, IL-6, IL-10, TNF-alpha and IFN-gamma during experimentally induced swine dysentery

    PubMed Central

    Kruse, Robert; Essén-Gustavsson, Birgitta; Fossum, Caroline; Jensen-Waern, Marianne

    2008-01-01

    Background Knowledge of the cytokine response at infection with Brachyspira hyodysenteriae can help understanding disease mechanisme involved during swine dysentery. Since this knowledge is still limited the aim of the present study was to induce dysentery experimentally in pigs and to monitor the development of important immunoregulatory cytokines in blood collected at various stages of the disease. Methods Ten conventional pigs (~23 kg) were orally inoculated with Brachyspira hyodysenteriae B204T. Eight animals developed muco-haemorrhagic diarrhoea with impaired general body condition. Blood was sampled before inoculation and repeatedly during acute dysentery and recovery periods and cytokine levels of IL-1β, IL-6, Il-10, TNF-α and IFN-γ were measured by ELISA. Results IL-1β was increased at the beginning of the dysentery period and coincided with the appearance of Serum amyloid A and clinical signs of disease. TNF-α increased in all animals after inoculation, with a peak during dysentery, and IL-6 was found in 3 animals during dysentery and in the 2 animals that did not develop clinical signs of disease. IL-10 was found in all sick animals during the recovery period. IFN-γ was not detected on any occasion. Conclusion B. hyodysenteriae inoculation induced production of systemic levels of IL-1β during the dysentery period and increased levels of IL-10 coincided with recovery from dysentery. PMID:18700003

  2. Blood concentrations of the cytokines IL-1beta, IL-6, IL-10, TNF-alpha and IFN-gamma during experimentally induced swine dysentery.

    PubMed

    Kruse, Robert; Essén-Gustavsson, Birgitta; Fossum, Caroline; Jensen-Waern, Marianne

    2008-08-12

    Knowledge of the cytokine response at infection with Brachyspira hyodysenteriae can help understanding disease mechanism involved during swine dysentery. Since this knowledge is still limited the aim of the present study was to induce dysentery experimentally in pigs and to monitor the development of important immunoregulatory cytokines in blood collected at various stages of the disease. Ten conventional pigs (~23 kg) were orally inoculated with Brachyspira hyodysenteriae B204T. Eight animals developed muco-haemorrhagic diarrhoea with impaired general body condition. Blood was sampled before inoculation and repeatedly during acute dysentery and recovery periods and cytokine levels of IL-1beta, IL-6, Il-10, TNF-alpha and IFN-gamma were measured by ELISA. IL-1beta was increased at the beginning of the dysentery period and coincided with the appearance of Serum amyloid A and clinical signs of disease. TNF-alpha increased in all animals after inoculation, with a peak during dysentery, and IL-6 was found in 3 animals during dysentery and in the 2 animals that did not develop clinical signs of disease. IL-10 was found in all sick animals during the recovery period. IFN-gamma was not detected on any occasion. B. hyodysenteriae inoculation induced production of systemic levels of IL-1beta during the dysentery period and increased levels of IL-10 coincided with recovery from dysentery.

  3. Suppressive and proinflammatory roles for IL-4 in the pathogenesis of experimental DILI

    PubMed Central

    Njoku, Dolores B.; Li, Zhaoxia; Washington, Nicole D.; Mellerson, Jenelle L.; Talor, Monica V.; Sharma, Rajni; Rose, Noel R.

    2009-01-01

    Summary The pathogenesis of immune-mediated drug-induced liver injury (DILI) following halogenated anesthetics, carbamazepine, or alcohol has not been fully elucidated. Detecting cytochrome P4502E1 (CYP2E1) IgG4 autoantibodies in anesthetic DILI patients suggests a role for interleukin IL-4 in this hapten-mediated process. We investigated IL-4-mediated mechanisms using our model of experimental DILI induced by immunizing BALB/c (WT) and IL-4−/− (KO) mice with S100 liver proteins covalently modified by a trifluoroacetyl chloride (TFA) hapten formed following halogenated anesthetic metabolism by CYP2E1. WT mice developed more hepatitis, TFA and S100 antibodies (p<0.01), as well as T cell proliferation to CYP2E1 and TFA (p<0.01) than KO mice. Additionally, WT CD4+T cells adoptively transferred hepatitis to naïve Rag−/− mice (p<0.01). Pro-inflammatory cytokines were expectedly decreased in TFA hapten-stimulated KO splenocyte supernatants (p<0.001); however, IL-2 and interferon-γ (p<0.05), as well as IL-6 and IL-10 (p<0.001) levels were elevated in CYP2E1-stimulated KO splenocyte supernatants, suggesting dual IL-4-mediated proinflammatory and regulatory responses. Anti-IL-10 administered to KO mice increased hepatitis, TFA and CYP2E1 antibodies in KO mice confirming a critical role for IL-4. This is the first demonstration of dual roles for IL-4 in the pathogenesis of immune-mediated DILI by suppressing autoantigen-induced regulatory responses while promoting hapten-induced pro-inflammatory responses. PMID:19499520

  4. IL-6-Mediated Activation of Stat3α Prevents Trauma/Hemorrhagic Shock-Induced Liver Inflammation

    PubMed Central

    Moran, Ana; Thacker, Stephen A.; Arikan, Ayse Akcan; Mastrangelo, Mary-Ann A.; Wu, Yong; Yu, Bi; Tweardy, David J.

    2011-01-01

    Trauma complicated by hemorrhagic shock (T/HS) is the leading cause of morbidity and mortality in the United States for individuals under the age of 44 years. Initial survivors are susceptible to developing multiple organ failure (MOF), which is thought to be caused, at least in part, by excessive or maladaptive activation of inflammatory pathways. We previously demonstrated in rodents that T/HS results in liver injury that can be prevented by IL-6 administration at the start of resuscitation; however, the contribution of the severity of HS to the extent of liver injury, whether or not resuscitation is required, and the mechanism(s) for the IL-6 protective effect have not been reported. In the experiments described here, we demonstrated that the extent of liver inflammation induced by T/HS depends on the duration of hypotension and requires resuscitation. We established that IL-6 administration at the start of resuscitation is capable of completely reversing liver inflammation and is associated with increased Stat3 activation. Global assessment of the livers showed that the main effect of IL-6 was to normalize the T/HS-induced inflammation transcriptome. Pharmacological inhibition of Stat3 activity within the liver blocked the ability of IL-6 to prevent liver inflammation and to normalize the T/HS-induced liver inflammation transcriptome. Genetic deletion of a Stat3β, a naturally occurring, dominant-negative isoform of the Stat3, attenuated T/HS-induced liver inflammation, confirming a role for Stat3, especially Stat3α, in preventing T/HS-mediated liver inflammation. Thus, T/HS-induced liver inflammation depends on the duration of hypotension and requires resuscitation; IL-6 administration at the start of resuscitation reverses T/HS-induced liver inflammation, through activation of Stat3α, which normalized the T/HS-induced liver inflammation transcriptome. PMID:21738667

  5. The induced RNA-binding protein, HuR, targets 3'-UTR region of IL-6 mRNA and enhances its stabilization in periodontitis.

    PubMed

    Ouhara, K; Munenaga, S; Kajiya, M; Takeda, K; Matsuda, S; Sato, Y; Hamamoto, Y; Iwata, T; Yamasaki, S; Akutagawa, K; Mizuno, N; Fujita, T; Sugiyama, E; Kurihara, H

    2018-06-01

    RNA-binding proteins (RBPs) regulate mRNA stability by binding to the 3'-untranslated region (UTR) region of mRNA. Human antigen-R (HuR), one of the RBPs, is involved in the progression of diseases, such as rheumatoid arthritis, diabetes mellitus and some inflammatory diseases. Interleukin (IL)-6 is a major inflammatory cytokine regulated by HuR binding to mRNA. Periodontal disease (PD) is also an inflammatory disease caused by elevations in IL-6 following an infection by periodontopathogenic bacteria. The involvement of HuR in the progression of PD was assessed using in-vitro and in-vivo experiments. Immunohistochemistry of inflamed periodontal tissue showed strong staining of HuR in the epithelium and connective tissue. HuR mRNA and protein level was increased following stimulation with Porphyromonas gingivalis (Pg), one of the periodontopathogenic bacteria, lipopolysacchride (LPS)-derived from Pg (PgLPS) and tumour necrosis factor (TNF)-α in OBA-9, an immortalized human gingival epithelial cell. The luciferase activity of 3'-UTR of IL-6 mRNA was increased by TNF-α, Pg and PgLPS in OBA-9. Luciferase activity was also increased in HuR-over-expressing OBA-9 following a bacterial stimulation. Down-regulation of HuR by siRNA resulted in a decrease in mRNA expression and production of IL-6. In contrast, the over-expression of HuR increased IL-6 mRNA expression and production in OBA-9. The HuR inhibitor, quercetin, suppressed Pg-induced HuR mRNA expression and IL-6 production in OBA-9. An oral inoculation with quercetin also inhibited bone resorption in ligature-induced periodontitis model mice as a result of down-regulation of IL-6. These results show that HuR modulates inflammatory responses by regulating IL-6. © 2018 British Society for Immunology.

  6. Chlorogenic acid induces apoptosis to inhibit inflammatory proliferation of IL-6-induced fibroblast-like synoviocytes through modulating the activation of JAK/STAT and NF-κB signaling pathways

    PubMed Central

    LOU, LIXIA; ZHOU, JINGWEI; LIU, YUJUN; WEI, YI; ZHAO, JIULI; DENG, JIAGANG; DONG, BIN; ZHU, LINGQUN; WU, AIMING; YANG, YINGXI; CHAI, LIMIN

    2016-01-01

    Chlorogenic acid (CGA) is the primary constituent of Caulis Lonicerae, a Chinese herb used for the treatment of rheumatoid arthritis (RA). The present study aimed to investigate whether CGA was able to inhibit the proliferation of the fibroblast-like synoviocyte cell line (RSC-364), stimulated by interleukin (IL)-6, through inducing apoptosis. Following incubation with IL-6 or IL-6 and CGA, the cellular proliferation of RSC-364 cells was detected by MTT assay. The ratio of apoptosed cells were detected by flow cytometry. Western blot analysis was performed to observe protein expression levels of key molecules involved in the Janus-activated kinase/signal transducer and activator of transcription 3 (JAK/STAT) signaling pathway [phosphorylated (p)-STAT3, JAK1 and gp130] and the nuclear factor κB (NF-κB) signaling pathway [phosphorylated (p)-inhibitor of κB kinase subunit α/β and NF-κB p50). It was revealed that CGA was able to inhibit the inflammatory proliferation of RSC-364 cells mediated by IL-6 through inducing apoptosis. CGA was also able to suppress the expression levels of key molecules in the JAK/STAT and NF-κB signaling pathways, and inhibit the activation of these signaling pathways in the inflammatory response through IL-6-mediated signaling, thereby resulting in the inhibition of the inflammatory proliferation of synoviocytes. The present results indicated that CGA may have potential as a novel therapeutic agent for inhibiting inflammatory hyperplasia of the synovium through inducing synoviocyte apoptosis in patients with RA. PMID:27168850

  7. The histone methyltransferase Smyd2 is a negative regulator of macrophage activation by suppressing interleukin 6 (IL-6) and tumor necrosis factor α (TNF-α) production.

    PubMed

    Xu, Guiliang; Liu, Guilin; Xiong, Sidong; Liu, Haiyan; Chen, Xi; Zheng, Biao

    2015-02-27

    SET and MYND domain-containing 2 (Smyd2), a histone 3 lysine 4- and histone 3 lysine 36 (H3K36)-specific methyltransferase, plays critical roles in cardiac development and tumorigenesis. However, the role of Smyd2 in immunity and inflammation remains poorly understood. In this study, we report that Smyd2 is a novel negative regulator for macrophage activation and M1 polarization. Elevated Smyd2 expression suppresses the production of proinflammatory cytokines, including IL-6 and TNF, and inhibits the expression of important cell surface molecules, including major MHC-II and costimulatory molecules. Furthermore, macrophages with high Smyd2 expression inhibit Th-17 cell differentiation but promote regulatory T cell differentiation as a result of increased TGF-β production and decreased IL-6 secretion. In macrophages, Smyd2 specifically facilitates H3K36 dimethylation at Tnf and Il6 promoters to suppress their transcription and inhibits NF-κB and ERK signaling. Therefore, our data demonstrate that epigenetic modification by Smyd2-mediated H3K36 dimethylation at Tnf and Il6 promoters plays an important role in the regulation of macrophage activation during inflammation. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. The role of IL-6 and IL-1beta in painful perineural inflammatory neuritis.

    PubMed

    Eliav, Eli; Benoliel, Rafael; Herzberg, Uri; Kalladka, Mythili; Tal, Michael

    2009-05-01

    Inflammation along a nerve trunk (perineural inflammation), without detectable axonal damage, has been shown to induce transient pain in the organ supplied by the nerve. The aims of the present study were to study the role IL-6 and IL-1beta, in pain induced by perineural inflammation. IL-6 and IL-1beta secretion from rat's sciatic nerves, L-5 Dorsal Root Ganglia (DRG), and the hind paw skin, 3 and 8 days following exposure of the nerve to Complete Freund's Adjuvant (CFA), were measured using ELISA method. Hind paw tactile-allodynia, mechano-hyperalgesia, heat-allodynia and electrical detection thresholds were tested up to 8 days following the application of CFA, IL-6 or IL-1beta adjacent to the sciatic nerve trunk. Employing electrophysiological recording, saphenous nerve spontaneous activity, nerve trunk mechano-sensitivity and paw tactile detection threshold (determined by recording action potential induced by the lowest mechanical stimulus) were assessed 3 and 8 days following exposure of the nerve trunk to CFA, IL-6, or IL-1beta. IL-6 and IL-1beta secretion from the nerve was significantly elevated on the 3rd day post-operation (DPO). On the 8th DPO, IL-6 levels returned to baseline while IL-1beta levels remained significantly elevated. The DRG cytokine's level was increased on the 3rd and 8th DPOs, contralateral cytokine's level was increased on the 3rd DPO. The skin IL-6 level was increased bilaterally on the 3rd DPO and returned to baseline on the 8th DPO. IL-1beta levels increased in the affected side on the 3rd and bilaterally on the 8th DPO. Direct application of IL-6 or CFA on the sciatic nerve induced significant hind paw tactile-allodynia from the 1st to 5th DPOs, reduced electrical detection threshold from the 1st to 3rd DPOs, mechano-hyperalgesia from 3rd to 5th DPOs and heat-allodynia on the 3rd DPO. Direct application of IL-1beta induced paw tactile and heat-allodynia on the 7-8th DPOs and mechano-hyperalgesia on the 5-8th DPOs. Perineural

  9. TNF-α, IL-6 and IL-10 expressions, responsible for disparity in action of curcumin against cisplatin-induced nephrotoxicity in rats.

    PubMed

    Kumar, Parveen; Sulakhiya, Kunjbihari; Barua, Chandana C; Mundhe, Nitin

    2017-07-01

    Cisplatin is a regularly employed effective chemotherapeutic agent for the treatment of many types of cancer. The main drawback of cisplatin treatment is kidney toxicity which affects 25-35% of treated patients. Many mechanisms are believed to be involved in this kidney damage, but inflammation plays a significant role in this event. Curcumin is a polyphenol and has antioxidant and anti-inflammatory effects. The purpose of this study was to determine the protective effects of curcumin on cisplatin-induced nephrotoxicity. Female rats were randomly divided into 5 groups: control, curcumin, cisplatin, curcumin plus cisplatin (pre-treatment group) and cisplatin plus curcumin (post-treatment group). Rats were given cisplatin (7.5 mg/kg body weight) with or without curcumin treatment (120 mg/kg body weight). Blood urea nitrogen (BUN), creatinine, albumin, tumour necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, IL-8, IL-10 expressions and histological changes were determined on the 5th day after cisplatin injection. Acute kidney damage was evident by increased BUN and creatinine levels. In addition, cisplatin showed a marked pro-inflammatory response as revealed by a significant increase in the tissue levels of TNF-α, IL-6, IL-8 and decrease in the IL-10 level. Pre-treatment of curcumin reduced cisplatin-induced nephrotoxicity which was clearly evident from the reduced BUN, creatinine, TNF-α, IL-6 and IL-8 levels and increased albumin and IL-10 levels. Additionally, these findings were also supported by histopathology of the kidneys. In contrast, post-treatment of curcumin failed to cut down the expression of inflammatory markers substantially and also neglected to increase the expression of IL-10. The disparity in the action of curcumin after pre- and post-treatment with cisplatin-induced nephrotoxicity was due to the inability of post-treatment to reduce TNF-α & IL-6, besides to show a concurrent rise in IL-10 expression in renal tissues.

  10. Suppression of T cell-induced osteoclast formation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karieb, Sahar; Fox, Simon W., E-mail: Simon.fox@plymouth.ac.uk

    2013-07-12

    Highlights: •Genistein and coumestrol prevent activated T cell induced osteoclast formation. •Anti-TNF neutralising antibodies prevent the pro-osteoclastic effect of activated T cells. •Phytoestrogens inhibit T cell derived TNF alpha and inflammatory cytokine production. •Phytoestrogens have a broader range of anti-osteoclastic actions than other anti-resorptives. -- Abstract: Inhibition of T cell derived cytokine production could help suppress osteoclast differentiation in inflammatory skeletal disorders. Bisphosphonates are typically prescribed to prevent inflammatory bone loss but are not tolerated by all patients and are associated with an increased risk of osteonecrosis of the jaw. In light of this other anti-resorptives such as phytoestrogens aremore » being considered. However the effect of phytoestrogens on T cell-induced osteoclast formation is unclear. The effect of genistein and coumestrol on activated T cell-induced osteoclastogenesis and cytokine production was therefore examined. Concentrations of genistein and coumestrol (10{sup −7} M) previously shown to directly inhibit osteoclast formation also suppressed the formation of TRAP positive osteoclast induced by con A activated T cells, which was dependent on inhibition of T cell derived TNF-α. While both reduced osteoclast formation their mechanism of action differed. The anti-osteoclastic effect of coumestrol was associated with a dual effect on con A induced T cell proliferation and activation; 10{sup −7} M coumestrol significantly reducing T cell number (0.36) and TNF-α (0.47), IL-1β (0.23) and IL-6 (0.35) expression, whereas genistein (10{sup −7} M) had no effect on T cell number but a more pronounced effect on T cell differentiation reducing expression of TNF-α (0.49), IL-1β (0.52), IL-6 (0.71) and RANKL (0.71). Phytoestrogens therefore prevent the pro-osteoclastic action of T cells suggesting they may have a role in the control of inflammatory bone loss.« less

  11. Thalidomide suppressed interleukin-6 but not tumor necrosis factor-alpha in volunteers with experimental endotoxemia.

    PubMed

    Shannon, Edward; Noveck, Robert; Sandoval, Felipe; Kamath, Burde; Kearney, Michael

    2007-11-01

    An early rationale for using thalidomide to treat erythema nodosum leprosum had been based on some reports that it suppresses tumor necrosis factor-alpha (TNF-alpha). However, in vivo and in vitro studies have yielded variable results, having shown that thalidomide can either enhance or suppress TNF-alpha. Since the course of circulating cytokines like TNF-alpha after infusion of endotoxin into volunteers is reproducible and characteristic, we investigated the effect of thalidomide on endotoxin-induced synthesis of TNF-alpha, interleukin (IL)-6, and IL-8. The cytokine response from 18 placebo-treated subjects who had undergone the endotoxin challenge were pooled with a placebo-treated subject from the current study and were compared with 4 subjects who received thalidomide (100 mg) every 6 h for 5 doses before endotoxin challenge. Thirty minutes after the last dose of thalidomide or placebo, volunteers were infused with 4-ng/kg endotoxin. Plasma was collected and assayed for cytokines by enzyme-linked immunosorbent assay. Endotoxin evoked the synthesis of the cytokines in all volunteers. The peak response for TNF-alpha was 1.5 h, 2.5 h for IL-8, and 3.0 h for IL-6. Thalidomide did not significantly delay the release of cytokines into the circulating blood. At the peak response, thalidomide reduced the concentration of the cytokines in the plasma. Using the area under the dose response curve (AUC(0 to 24) h), thalidomide reduced the AUC for IL-6 by 56%, for IL-8 by 30%, and TNF-alpha by 32%. In this model, thalidomide did not suppress TNF-alpha or IL-8, but it did suppress IL-6 at 4-h postinfusion with lipopolysaccharide (P=0.004), at 6 h (P=0.014), at 12 h (P=0.001), and at 16 h (P=0.012).

  12. Sequential signaling cascade of IL-6 and PGC-1α is involved in high glucose-induced podocyte loss and growth arrest

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Dong Il; Park, Soo Hyun, E-mail: parksh@chonnam.ac.kr

    Highlights: •The pathophysiological role of IL-6 in high glucose-induced podocyte loss. •The novel role of PGC-1α in the development of diabetic nephropathy. •Signaling of IL-6 and PGC-1α in high glucose-induced dysfunction of podocyte. -- Abstract: Podocyte loss, which is mediated by podocyte apoptosis, is implicated in the onset of diabetic nephropathy. In this study, we investigated the involvement of interleukin (IL)-6 in high glucose-induced apoptosis of rat podocytes. We also examined the pathophysiological role of peroxisome proliferator-activated receptor gamma coactivator-1 alpha (PGC-1α) in this system. High glucose treatment induced not only podocyte apoptosis but also podocyte growth arrest. High glucosemore » treatment also increased IL-6 secretion and activated IL-6 signaling. The high glucose-induced podocyte apoptosis was blocked by IL-6 neutralizing antibody. IL-6 treatment or overexpression induced podocyte apoptosis and growth arrest, and IL-6 siRNA transfection blocked high glucose-induced podocyte apoptosis and growth arrest. Furthermore, high glucose or IL-6 treatment increased PGC-1α expression, and PGC-1α overexpression also induced podocyte apoptosis and growth arrest. PGC-1α siRNA transfection blocked high glucose-induced podocyte apoptosis and growth arrest. Collectively, these findings showed that high glucose promoted apoptosis and cell growth arrest in podocytes via IL-6 signaling. In addition, PGC-1α is involved in podocyte apoptosis and cell growth arrest. Therefore, blocking IL-6 and its downstream mediators such as IL6Rα, gp130 and PGC-1α may attenuate the progression of diabetic nephropathy.« less

  13. Failure of FIV-infected cats to control Toxoplasma gondii correlates with reduced IL2, IL6, and IL12 and elevated IL10 expression by lymph node T cells.

    PubMed

    Levy, Julie K; Liang, Yinghua; Ritchey, Jerry W; Davidson, Michael G; Tompkins, Wayne A; Tompkins, Mary B

    2004-03-01

    Increased susceptibility to intracellular pathogens in HIV-infected individuals and FIV-infected cats is attributed to a defective T-helper 1 (Th1) immune response. However, little is known about specific cytokine responses to secondary pathogens. To address this question, control and FIV-infected cats were challenged with Toxoplasma gondii, and lymph node cells analyzed for cytokine mRNA expression. Twenty-four weeks post-FIV infection, prior to T. gondii challenge, IL2 and IL12 mRNAs were depressed, whereas IL10 and IFNgamma mRNAs were increased in CD4+ and CD8+ subsets. Following T. gondii challenge, control cats showed increased expression of IL2, IFNgamma, IL10, IL12, and IL6 mRNAs. In contrast, IL2, IL6, IFNgamma, and IL12 mRNAs were suppressed in FIV-T. gondii co-infected cats, whereas IL10 remained at the high prechallenge levels. IFNgamma and IL10 mRNAs were produced by both CD4+ and CD8+ cells in FIV-T. gondii cats. Elevated IL10 may suppress a Th1 cytokine response to T. gondii challenge.

  14. IL-33 inhibits RANKL-induced osteoclast formation through the regulation of Blimp-1 and IRF-8 expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kiyomiya, Hiroyasu; Division of Oral and Maxillofacial Surgery, Department of Science of Physical Functions, Kyushu Dental University, 2-6-1 Manazuru, Kokurakita-ku, Kitakyushu, Fukuoka 803-8580; Ariyoshi, Wataru

    2015-05-01

    Interleukin (IL)-33 is a recently discovered proinflammatory cytokine that belongs to the IL-1 family. Several studies have reported that IL-33 inhibits osteoclast differentiation. However, the mechanism of IL-33 regulation of osteoclastogenesis remains unclear. In the present study, we examined the effect of IL-33 on osteoclast formation in vitro. IL-33 suppressed osteoclast formation in both mouse bone marrow cells and monocyte/macrophage cell line RAW264.7 cells induced by receptor activator of NF-κB ligand (RANKL) and/or macrophage stimulating factor (M-CSF). IL-33 also inhibited the expression of RANKL-induced nuclear factor of activated T-cell cytoplasmic 1 (NFATc1), thereby decreasing the expression of osteoclastogenesis-related marker genes, includingmore » Cathepsin K, Osteoclast stimulatory transmembrane protein (Oc-stamp) and Tartrate-resistant acid phosphatase (Trap). Blockage of IL-33-ST2 binding suppressed the IL-33-mediated inhibition of NFATc1. RANKL-induced B-lymphocyte-induced maturation protein-1 (Blimp-1) expression was also suppressed by IL-33, which was followed by the stimulation of anti-osteoclastic genes such as interferon regulatory factor-8 (IRF-8). These results suggest that IL-33-ST2 interactions down-regulate both RANKL-induced NFATc1 activation and osteoclast differentiation via the regulation of Blimp-1 and IRF-8 expression. - Highlights: • IL-33 inhibits RANKL-induced osteoclast formation. • IL-33 has inhibitory effect on the RANKL-induced NFATc1 expression. • IL-33-induced NFATc1 suppression depends on the regulation of Blimp-1 and IRF-8.« less

  15. Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages

    PubMed Central

    Shi, Yongyu; Felder, Mildred A.R.; Sondel, Paul M.; Rakhmilevich, Alexander L.

    2015-01-01

    Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. PMID:25829245

  16. Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages.

    PubMed

    Shi, Yongyu; Felder, Mildred A R; Sondel, Paul M; Rakhmilevich, Alexander L

    2015-08-01

    Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. IL-11, IL-1α, IL-6, and TNF-α are induced by solar radiation in vitro and may be involved in facial subcutaneous fat loss in vivo.

    PubMed

    Li, Wen-Hwa; Pappas, Apostolos; Zhang, Li; Ruvolo, Eduardo; Cavender, Druie

    2013-07-01

    The loss of subcutaneous (sc) fat is associated with aging. Inflammatory cytokines, such as interleukin-1 α (IL-1α), interleukin-11 (IL-11) and tumor necrosis factor-α (TNF-α), are known to inhibit the differentiation of preadipocytes. This study investigated the potential role of inflammatory cytokines in solar-radiation-induced facial fat loss. Cultured fibroblasts, keratinocytes, and skin equivalents were exposed to various doses of radiation from a solar simulator. Inflammatory cytokines' mRNA production and protein secretion were examined by qRT-PCR and ELISA, respectively. In some experiments, epidermal-dermal equivalents were pretreated topically with a broad-spectrum sunscreen prior to solar simulated radiation (SSR). Human facial preadipocytes treated with recombinant IL-11 or with conditioned media from solar-irradiated equivalents were evaluated for the level of adipocyte differentiation by image analyses, Oil red O staining, and the expression of adipocyte differentiation markers. IL-11, IL-1α, IL-6, and TNF-α protein secretion were induced from epidermal-dermal equivalents by exposure to SSR. A sunscreen prevented SSR-induced inflammatory cytokines production from such equivalents. Exposure of facial preadipocytes to conditioned medium from solar-irradiated epidermal-dermal equivalents inhibited their differentiation into mature adipocytes. Consequently, conditioned medium from sunscreen-pretreated, solar-irradiated equivalents did not inhibit differentiation of preadipocytes. A cocktail of neutralizing antibodies to IL-11, IL-1α, IL-6 and TNF-α significantly reduced the SSR-induced inhibition of preadipocyte differentiation. These results support the hypothesis that SSR-induced inflammatory cytokine may be involved in the photoaging-induced loss of facial subcutaneous fat. Inhibition of this process, e.g. by sunscreens, might slow or prevent photoaging-induced changes in facial contouring. Copyright © 2013 Japanese Society for Investigative

  18. Interleukin-35 induces regulatory B cells that suppress autoimmune disease.

    PubMed

    Wang, Ren-Xi; Yu, Cheng-Rong; Dambuza, Ivy M; Mahdi, Rashid M; Dolinska, Monika B; Sergeev, Yuri V; Wingfield, Paul T; Kim, Sung-Hye; Egwuagu, Charles E

    2014-06-01

    Interleukin-10 (IL-10)-producing regulatory B (Breg) cells suppress autoimmune disease, and increased numbers of Breg cells prevent host defense to infection and promote tumor growth and metastasis by converting resting CD4(+) T cells to regulatory T (Treg) cells. The mechanisms mediating the induction and development of Breg cells remain unclear. Here we show that IL-35 induces Breg cells and promotes their conversion to a Breg subset that produces IL-35 as well as IL-10. Treatment of mice with IL-35 conferred protection from experimental autoimmune uveitis (EAU), and mice lacking IL-35 (p35 knockout (KO) mice) or defective in IL-35 signaling (IL-12Rβ2 KO mice) produced less Breg cells endogenously or after treatment with IL-35 and developed severe uveitis. Adoptive transfer of Breg cells induced by recombinant IL-35 suppressed EAU when transferred to mice with established disease, inhibiting pathogenic T helper type 17 (TH17) and TH1 cells while promoting Treg cell expansion. In B cells, IL-35 activates STAT1 and STAT3 through the IL-35 receptor comprising the IL-12Rβ2 and IL-27Rα subunits. As IL-35 also induced the conversion of human B cells into Breg cells, these findings suggest that IL-35 may be used to induce autologous Breg and IL-35(+) Breg cells and treat autoimmune and inflammatory disease.

  19. A novel cyclohexene derivative, ethyl (6R)-6-[N-(2-Chloro-4-fluorophenyl)sulfamoyl]cyclohex-1-ene-1-carboxylate (TAK-242), selectively inhibits toll-like receptor 4-mediated cytokine production through suppression of intracellular signaling.

    PubMed

    Ii, Masayuki; Matsunaga, Naoko; Hazeki, Kaoru; Nakamura, Kazuyo; Takashima, Katsunori; Seya, Tsukasa; Hazeki, Osamu; Kitazaki, Tomoyuki; Iizawa, Yuji

    2006-04-01

    Proinflammatory mediators such as cytokines and NO play pivotal roles in various inflammatory diseases. To combat inflammatory diseases successfully, regulation of proinflammatory mediator production would be a critical process. In the present study, we investigated the in vitro effects of ethyl (6R)-6-[N-(2-chloro-4-fluorophenyl)sulfamoyl]cyclohex-1-ene-1-carboxylate (TAK-242), a novel small molecule cytokine production inhibitor, and its mechanism of action. In RAW264.7 cells and mouse peritoneal macrophages, TAK-242 suppressed lipopolysaccharide (LPS)-induced production of NO, tumor necrosis factor-alpha (TNF-alpha), and interleukin (IL)-6, with 50% inhibitory concentration (IC50) of 1.1 to 11 nM. TAK-242 also suppressed the production of these cytokines from LPS-stimulated human peripheral blood mononuclear cells (PBMCs) at IC50 values from 11 to 33 nM. In addition, the inhibitory effects on the LPS-induced IL-6 and IL-12 production were similar in human PBMCs, monocytes, and macrophages. TAK-242 inhibited mRNA expression of IL-6 and TNF-alpha induced by LPS and interferon-gamma in RAW264.7 cells. The phosphorylation of mitogen-activated protein kinases induced by LPS was also inhibited in a concentration-dependent manner. However, TAK-242 did not antagonize the binding of LPS to the cells. It is noteworthy that TAK-242 suppressed the cytokine production induced by Toll-like receptor (TLR) 4 ligands, but not by ligands for TLR2, -3, and -9. In addition, IL-1beta-induced IL-8 production from human PBMCs was not markedly affected by TAK-242. These data suggest that TAK-242 suppresses the production of multiple cytokines by selectively inhibiting TLR4 intracellular signaling. Finally, TAK-242 is a novel small molecule TLR4 signaling inhibitor and could be a promising therapeutic agent for inflammatory diseases, whose pathogenesis involves TLR4.

  20. Radiation-induced interleukin-6 expression through MAPK/p38/NF-kappaB signaling pathway and the resultant antiapoptotic effect on endothelial cells through Mcl-1 expression with sIL6-Ralpha.

    PubMed

    Chou, Chia-Hung; Chen, Shee-Uan; Cheng, Jason Chia-Hsien

    2009-12-01

    To investigate the mechanism of interleukin-6 (IL-6) activity induced by ionizing radiation. Human umbilical vascular endothelial cells (HUVECs) were irradiated with different doses to induce IL-6. The IL-6 promoter assay and reverse transcriptase-polymerase chain reaction (RT-PCR) were used to examine transcriptional regulation. Specific chemical inhibitors, decoy double-stranded oligodeoxynucleotides, and Western blotting were conducted to investigate the signal transduction pathway. Recombinant soluble human IL-6 receptor alpha-chain (sIL6-Ralpha) and specific small interfering RNA were used to evaluate the biologic function of radiation-induced IL-6. Four grays of radiation induced the highest level of IL-6 protein. The promoter assay and RT-PCR data revealed that the induction of IL-6 was mediated through transcriptional regulation. The p38 inhibitor SB203580, by blocking nuclear factor-kappaB (NF-kappaB) activation, prevented both the transcriptional and translational regulation of radiation-induced IL-6 expression. The addition of sIL6-Ralpha rescued HUVECs from radiation-induced death in an IL-6 concentratio-dependent manner. The antiapoptotic effect of combined sIL6-Ralpha and radiation-induced IL-6 was inhibited by mcl-1-specific small interfering RNA. Radiation transcriptionally induces IL-6 expression in endothelial cells through mitogen-activated protein kinase/p38-mediated NF-kappaB/IkappaB (inhibitor of NF-kappaB) complex activation. In the presence of sIL6-Ralpha, radiation-induced IL-6 expression acts through Mcl-1 expression to rescue endothelial cells from radiation-induced death.

  1. A molecular mechanism for IL-4 suppression of loricrin transcription in epidermal keratinocytes: implication for atopic dermatitis pathogenesis.

    PubMed

    Bao, Lei; Mohan, Girish C; Alexander, Jaime B; Doo, Caroline; Shen, Kui; Bao, Jeremy; Chan, Lawrence S

    2017-11-01

    Skin barrier defects play an important role in atopic dermatitis (AD) pathogenesis. Loricrin, an important barrier protein suppressed in human AD, is down-regulated by IL-4 in keratinocytes. However, the molecular mechanism is unknown. Since loricrin transcription requires p300/CBP, and Stat6 also recruits this common coactivator for its stimulated factors, we hypothesize that IL-4-activated Stat6 competes for the available endogenous p300/CBP, leading to loricrin transcription inhibition. First, we showed that loricrin is suppressed in the skin of IL-4 transgenic mice, an AD mouse model. In human keratinocytes, IL-4 down-regulation of loricrin is abrogated by a pan-Jak inhibitor, suggesting that the Jak-Stat pathway is involved. To further investigate the downstream molecular mechanism, we transfected HaCat cells with a loricrin promoter and then treated them with either IL-4 or vehicle. Not surprisingly, IL-4 greatly suppressed the promoter activity. Interestingly, this suppression was prevented when we knocked down Stat6, indicating that Stat6 participates in IL-4 regulation of loricrin. A Stat6-specific inhibitor confirmed the knockdown study. Finally, IL-4 suppression of loricrin was reversed with transfection of a CBP expression vector in a dose-dependent manner. Taken together, for the first time, we delineate a molecular mechanism for IL-4 down-regulation of loricin expression in human keratinocytes, which may play an important role in AD pathogenesis.

  2. Extracellular forms of IL-37 inhibit innate inflammation in vitro and in vivo but require the IL-1 family decoy receptor IL-1R8.

    PubMed

    Li, Suzhao; Neff, C Preston; Barber, Kristina; Hong, Jaewoo; Luo, Yuchun; Azam, Tania; Palmer, Brent E; Fujita, Mayumi; Garlanda, Cecilia; Mantovani, Alberto; Kim, Soohyun; Dinarello, Charles Anthony

    2015-02-24

    Similar to IL-1α and IL-33, IL-1 family member IL-37b translocates to the nucleus and is associated with suppression of innate and adaptive immunity. Here we demonstrate an extracellular function of the IL-37 precursor and a processed form. Recombinant IL-37 precursor reduced LPS-induced IL-6 by 50% (P < 0.001) in highly inflammatory human blood-derived M1 differentiated macrophages derived from selective subjects but not M2 macrophages. In contrast, a neutralizing monoclonal anti-IL-37 increased LPS-induced IL-6, TNFα and IL-1β (P < 0.01). The suppression by IL-37 was consistently observed at low picomolar but not nanomolar concentrations. Whereas LPS induced a 12-fold increase in TNFα mRNA, IL-37 pretreatment decreased the expression to only 3-fold over background (P < 0.01). Mechanistically, LPS-induced p38 and pERK were reduced by IL-37. Recombinant IL-37 bound to the immobilized ligand binding α-chain of the IL-18 receptor as well as to the decoy receptor IL-1R8. In M1 macrophages, LPS increased the surface expression of IL-1R8. Compared with human blood monocytes, resting M1 cells express more surface IL-1R8 as well as total IL-1R8; there was a 16-fold increase in IL-1R8 mRNA levels when pretreated with IL-37. IL-37 reduced LPS-induced TNFα and IL-6 by 50-55% in mouse bone marrow-derived dendritic cells, but not in dendritic cells derived from IL-1R8-deficient mice. In mice subjected to systemic LPS-induced inflammation, pretreatment with IL-37 reduced circulating and organ cytokine levels. Thus, in addition to a nuclear function, IL-37 acts as an extracellular cytokine by binding to the IL-18 receptor but using the IL-1R8 for its anti-inflammatory properties.

  3. Cationic liposomes containing soluble Leishmania antigens (SLA) plus CpG ODNs induce protection against murine model of leishmaniasis.

    PubMed

    Heravi Shargh, Vahid; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jalali, Seyed Amir; Firouzmand, Hengameh; Abbasi, Azam; Badiee, Ali

    2012-07-01

    Development of an effective vaccine against leishmaniasis is possible due to the fact that individuals cured from cutaneous leishmaniasis (CL) are protected from further infection. First generation Leishmania vaccines consisting of whole killed parasites reached to phase 3 clinical trials but failed to show enough efficacies mainly due to the lack of an appropriate adjuvant. In this study, an efficient liposomal protein-based vaccine against Leishmania major infection was developed using soluble Leishmania antigens (SLA) as a first generation vaccine and cytidine phosphate guanosine oligodeoxynucleotides (CpG ODNs) as an immunostimulatory adjuvant. 1, 2-Dioleoyl-3-trimethylammonium-propane was used as a cationic lipid to prepare the liposomes due to its intrinsic adjuvanticity. BALB/c mice were immunized subcutaneously (SC), three times in 2-week intervals, with Lip-SLA-CpG, Lip-SLA, SLA + CpG, SLA, or HEPES buffer. As criteria for protection, footpad swelling at the site of challenge and spleen parasite loads were assessed, and the immune responses were evaluated by determination of IFN-γ and IL-4 levels of cultured splenocytes, and IgG subtypes. The group of mice that received Lip-SLA-CpG showed a significantly smaller footpad swelling, lower spleen parasite burden, higher IgG2a antibody, and lower IL-4 level compared to the control groups. It is concluded that cationic liposomes containing SLA and CpG ODNs are appropriate to induce Th1 type of immune response and protection against leishmaniasis.

  4. CCL2/CCL5 secreted by the stroma induce IL-6/PYK2 dependent chemoresistance in ovarian cancer.

    PubMed

    Pasquier, Jennifer; Gosset, Marie; Geyl, Caroline; Hoarau-Véchot, Jessica; Chevrot, Audrey; Pocard, Marc; Mirshahi, Massoud; Lis, Raphael; Rafii, Arash; Touboul, Cyril

    2018-02-19

    Minimal residual disease is the main issue of advanced ovarian cancer treatment. According to the literature and previous results, we hypothesized that Mesenchymal Stromal Cells (MSC) could support this minimal residual disease by protecting ovarian cancer cells (OCC) from chemotherapy. In vitro study confirmed that MSC could induce OCC chemoresistance without contact using transwell setting. Further experiments showed that this induced chemoresistance was dependent on IL-6 OCC stimulation. We combined meticulous in vitro profiling and tumor xenograft models to study the role of IL-6 in MSC/OCC intereactions. We demonstrated that Tocilizumab® (anti-IL-6R therapy) in association with chemotherapy significantly reduced the peritoneal carcinosis index (PCI) than chemotherapy alone in mice xenografted with OCCs+MSCs. Further experiments showed that CCL2 and CCL5 are released by MSC in transwell co-culture and induce OCCs IL-6 secretion and chemoresistance. Finally, we found that IL-6 induced chemoresistance was dependent on PYK2 phosphorylation. These findings highlight the potential key role of the stroma in protecting minimal residual disease from chemotherapy, thus favoring recurrences. Future clinical trials targeting stroma could use anti-IL-6 therapy in association with chemotherapy.

  5. Inhibition of interleukin-6 decreases atrogene expression and ameliorates tail suspension-induced skeletal muscle atrophy

    PubMed Central

    Yakabe, Mitsutaka; Ota, Hidetaka; Iijima, Katsuya; Eto, Masato; Ouchi, Yasuyoshi; Akishita, Masahiro

    2018-01-01

    Background Interleukin-6 (IL-6) is an inflammatory cytokine. Whether systemic IL-6 affects atrogene expression and disuse-induced skeletal muscle atrophy is unclear. Methods Tail-suspended mice were used as a disuse-induced muscle atrophy model. We administered anti-mouse IL-6 receptor antibody, beta-hydroxy-beta-methylbutyrate (HMB) and vitamin D to the mice and examined the effects on atrogene expression and muscle atrophy. Results Serum IL-6 levels were elevated in the mice. Inhibition of IL-6 receptor suppressed muscle RING finger 1 (MuRF1) expression and prevented muscle atrophy. HMB and vitamin D inhibited the serum IL-6 surge, downregulated the expression of MuRF1 and atrogin-1 in the soleus muscle, and ameliorated atrophy in the mice. Conclusion Systemic IL-6 affects MuRF1 expression and disuse-induced muscle atrophy. PMID:29351340

  6. Rosmarinus officinalis Extract Suppresses Propionibacterium acnes–Induced Inflammatory Responses

    PubMed Central

    Tsai, Tsung-Hsien; Chuang, Lu-Te; Lien, Tsung-Jung; Liing, Yau-Rong; Chen, Wei-Yu

    2013-01-01

    Abstract Propionibacterium acnes is a key pathogen involved in the progression of acne inflammation. The development of a new agent possessing antimicrobial and anti-inflammatory activity against P. acnes is therefore of interest. In this study, we investigated the inhibitory effect of rosemary (Rosmarinus officinalis) extract on P. acnes–induced inflammation in vitro and in vivo. The results showed that ethanolic rosemary extract (ERE) significantly suppressed the secretion and mRNA expression of proinflammatory cytokines, including interleukin (IL)-8, IL-1β, and tumor necrosis factor-α in P. acnes–stimulated monocytic THP-1 cells. In an in vivo mouse model, concomitant intradermal injection of ERE attenuated the P. acnes–induced ear swelling and granulomatous inflammation. Since ERE suppressed the P. acnes–induced nuclear factor kappa-B (NF-κB) activation and mRNA expression of Toll-like receptor (TLR) 2, the suppressive effect of ERE might be due, at least partially, to diminished NF-κB activation and TLR2-mediated signaling pathways. Furthermore, three major constituents of ERE, carnosol, carnosic acid, and rosmarinic acid, exerted different immumodulatory activities in vitro. In brief, rosmarinic acid significantly suppressed IL-8 production, while the other two compounds inhibited IL-1β production. Further study is needed to explore the role of bioactive compounds of rosemary in mitigation of P. acnes–induced inflammation. PMID:23514231

  7. Pregnancy, but not the allergic status, influences spontaneous and induced interleukin-1beta (IL-1beta), IL-6, IL-10 and IL-12 responses.

    PubMed

    Amoudruz, Petra; Minang, Jacob Taku; Sundström, Yvonne; Nilsson, Caroline; Lilja, Gunnar; Troye-Blomberg, Marita; Sverremark-Ekström, Eva

    2006-09-01

    In this study, we investigated how pregnancy influences cytokine production in response to stimulation of the innate and the adaptive immune system, respectively. Peripheral blood mononuclear cells (PBMCs) from allergic (n = 44) and non-allergic (n = 36) women were collected at three time-points: during the third trimester, at delivery and at a non-pregnant state 2 years after delivery. The production of interleukin-1beta (IL-1beta), IL-6, IL-10 and IL-12 was measured by enzyme-linked immunosorbent assay (ELISA) or enzyme-linked immunospot assay (ELISPOT). The spontaneous cytokine production, and the response following stimulation with agents that primarily activate the adaptive part of the immune system [phytohaemagglutinin (PHA), allergen extracts from cat and birch], or lipopolysaccharide (LPS) that activate innate immunity was measured in vitro. There was a significantly higher spontaneous in vitro production of IL-1beta, IL-6 and IL-10 by PBMCs during pregnancy than 2 years after pregnancy, and this was not affected by the allergic status of the women. Conversely, in PHA-stimulated cell cultures there was a lower production of IL-10 and IL-12 during pregnancy than 2 years after pregnancy. LPS-induced IL-6 levels were significantly lower in PBMCs obtained during pregnancy than at 2 years after pregnancy. In addition, we made the interesting observation that in allergic women total immunoglobulin E (IgE) levels were significantly lower 2 years after pregnancy compared to the levels during pregnancy. Taken together, our results indicate that while atopic allergy in women does not have a substantial effect on cytokine production, pregnancy has an obvious effect on the immune system in terms of cytokine production as well as on the total IgE levels.

  8. Human gingival fibroblasts express functional chemokine receptor CXCR6.

    PubMed

    Hosokawa, Y; Hosokawa, I; Ozaki, K; Nakae, H; Matsuo, T

    2009-06-01

    We have reported that CXCL16, a recently discovered transmembrane chemokine, is expressed in human gingival fibroblasts (HGF). However, it is not known whether HGF express CXCR6, the receptor for CXCL16, or CXCL16 affects HGF biology. We have shown that HGF expressed CXCR6 by reverse transcription-polymerase chain reaction and flow cytometric analysis. Moreover, we elucidated that tumour necrosis factor (TNF)-alpha and cytosine-guanine dinucleotide (CpG) DNA (Toll-like receptor-9 ligand) treatment enhanced CXCR6 expression by HGF. Interleukin (IL)-4, IL-13 and CpG DNA up-regulated CXCR6 expression by TNF-alpha-stimulated HGF. On the other hand, IL-1beta and interferon-gamma inhibited CXCR6 expression on TNF-alpha-treated HGF. CXCL16 treatment induced HGF proliferation and phosphorylation of extracellular regulated kinase (ERK) and protein kinase B (AKT) in HGF. In conclusion, HGF expressed CXCR6 functionally, because CXCL16 induced HGF proliferation and ERK and AKT phosphorylation in HGF. These results indicate that CXCL16 may play an important role in the pathogenesis and remodelling in periodontally diseased tissues.

  9. Complete Freund's adjuvant induces experimental autoimmune myocarditis by enhancing IL-6 production during initiation of the immune response.

    PubMed

    Fontes, Jillian A; Barin, Jobert G; Talor, Monica V; Stickel, Natalie; Schaub, Julie; Rose, Noel R; Čiháková, Daniela

    2017-06-01

    Complete Freund's Adjuvant (CFA) emulsified with an antigen is a widely used method to induce autoimmune disease in animal models, yet the contribution of CFA to the immune response is not well understood. We compared the effectiveness of CFA with Incomplete Freund's Adjuvant (IFA) or TiterMax Gold Adjuvant (TMax) in experimental autoimmune myocarditis (EAM) in male mice. EAM was induced in A/J, BALB/c, and IL6KO BALB/c male mice by injection of the myocarditogenic peptide in CFA, IFA, or TMax on days 0 and 7. EAM severity was analyzed by histology on day 21. In addition, specific flow cytometry outcomes were evaluated on day 21. Only mice immunized with CFA and myocarditogenic peptide on both days 0 and 7 developed substantial myocarditis as measured by histology. We observed a significantly increased level of IL6 in the spleen 3 days after CFA immunization. In the spleen and heart on day 21, there was an expansion of myeloid cells in CFA-immunized mice, as compared to IFA or TMax-immunized animals. Recombinant IL-6 at the time of IFA immunization partially restored susceptibility of the mice to EAM. We also treated EAM-resistant IL-6 knockout mice with recombinant IL-6 around the time of the first immunization, on days -1 to 2, completely restoring disease susceptibility, showing that the requirement for IL-6 coincides with primary immunization. Examining APC populations in the lymph node draining the immunization site evidenced the contribution of IL-6 to the CFA-dependence of EAM was through controlling local dendritic cell (DC) trafficking. CFA used with myocarditogenic peptide twice is required to induce EAM in both A/J and Balb/c mice. Although IFA and TiterMax induce antibody responses, only CFA preferentially induced autoantigen-specific responses. CFA expands monocytes in the heart and in the spleen. IL-6 signaling is required during short window around primary immunization to induce EAM. In addition, IL-6 deficient mice resistance to EAM could be

  10. miR-146b-5p mediates p16-dependent repression of IL-6 and suppresses paracrine procarcinogenic effects of breast stromal fibroblasts.

    PubMed

    Al-Ansari, Mysoon M; Aboussekhra, Abdelilah

    2015-10-06

    Increasing evidence support the critical roles of active stromal fibroblasts in breast cancer development and spread. However, the mediators and the mechanisms of regulation are still not well defined. We have shown here that the tumor suppressor p16(INK4A) protein inhibits the pro-carcinogenic effects of breast stromal fibroblasts through repressing the expression/secretion of IL-6. Indeed, p16(INK4A) suppresses IL-6 at the mRNA and protein levels. This effect is mediated trough miR-146b-5p, which inhibits IL-6 expression through a specific sequence at the IL-6 3'UTR. In addition, we present clear evidence that miR-146b-5p inhibition is sufficient to transactivate breast stromal fibroblasts, which promote epithelial-to-mesenchymal-transition in breast cancer cells in a paracrine manner. By contrast, ectopic expression of miR-146b-5p in active fibroblasts abrogated their pro-carcinogenic effects. The physiological importance of miR-146b-5p inhibition was revealed by showing that the levels of pre-miR-146b-5p as well as its mature form are reduced in cancer-associated fibroblasts as compared with their normal adjacent counterparts from cancer-free tissues isolated from the same patients. Interestingly, treatment of active breast stromal fibroblasts with curcumin increased the level of the p16(INK4A) coding CDKN2A mRNA and miR-146b-5p and suppressed IL-6, which confirms the repressive effect of these two tumor suppressor molecules on IL-6, and shows the possible "normalization" of cancer-related active fibroblasts. These results show that miR-146b-5p has non-cell-autonomous tumor suppressor function through inhibition of IL-6, suggesting that targeting this microRNA in breast stromal fibroblasts could be of great therapeutic value.

  11. 17β-estradiol exerts anticancer effects in anoikis-resistant hepatocellular carcinoma cell lines by targeting IL-6/STAT3 signaling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Seulki, E-mail: sl10f@naver.com; Lee, Minjong, E-mail: minjonglee2@naver.com; Kim, Jong Bin, E-mail: kkimjp@hanmail.net

    17β-Estradiol (E2) has been proven to exert protective effects against HCC; however, its mechanism on HCC proliferation and suppression of invasion remains to be further explored. Because HCC up-regulates serum Interleukin-6 (IL-6) levels and Signal Transducer and Activator of Transcription 3 (STAT3), molecular agents that attenuate IL-6/STAT3 signaling can potentially suppress HCC development. In this study, we examined involvement of E2 in anoikis resistance that induces invasion capacities and chemo-resistance. Huh-BAT and HepG2 cells grown under anchorage-independent condition were selected. The anoikis-resistant (AR) cells showed stronger chemo-resistance against sorafenib, doxorubicin, 5-fluorouracil and cisplatin compared to adherent HCC cells. AR HCCmore » cells exhibited decreased expression of E-cadherin and increased expression of the N-cadherin and vimentin compared to adherent HCC cells. We then demonstrated that E2 suppressed cell proliferation in AR HCC cells. IL-6 treatment enhanced invasive characteristics, and E2 reversed it. Regarding mechanism of E2, it decreased in the phosphorylation of STAT3 that overexpressed on AR HCC cells. The inhibitory effect of E2 on cell growth was accompanied with cell cycle arrest at G2/M phase and caspase-3/9/PARP activation through c-Jun N-terminal Kinase (JNK) phosphorylation. Taken together, these findings suggested that E2 inhibited the proliferation of AR HCC cells through down-regulation of IL-6/STAT3 signaling. Thus, E2 can be a potential therapeutic drug for treatment of metastatic or chemo-resistant HCC. -- Highlights: •Anoikis-resistant HCC cells characterized chemo-resistant and metastatic potentials. •17β-Estradiol down-regulated IL-6/STAT3 signaling in anoikis-resistant HCC cells. •17β-Estradiol suppressed cell proliferation by inducing G2/M phase arrest and apoptosis though JNK phosphorylation.« less

  12. Sulforaphane suppresses ultraviolet B-induced inflammation in HaCaT keratinocytes and HR-1 hairless mice.

    PubMed

    Shibata, Akira; Nakagawa, Kiyotaka; Yamanoi, Hiroko; Tsuduki, Tsuyoshi; Sookwong, Phumon; Higuchi, Ohki; Kimura, Fumiko; Miyazawa, Teruo

    2010-08-01

    Ultraviolet B (UVB) irradiation induces skin damage and inflammation. One way to reduce the inflammation is via the use of molecules termed photochemopreventive agents. Sulforaphane (4-methylsulfinylbutyl isothiocyanate, SF), which is found in cruciferous vegetables, is known for its potent physiological properties. This study was designed to evaluate the effect of SF on skin inflammation in vitro and in vivo. In in vitro study using immortalized human keratinocytes (HaCaT), UVB caused marked inflammatory responses [i.e., decrease of HaCaT viability and increase of production of an inflammatory marker interleukin-6 (IL-6)]. SF recovered the cell proliferation and suppressed the IL-6 production. These anti-inflammatory effects of SF were explained by its ability to reduce UVB-induced inflammatory gene expressions [IL-6, IL-1beta and cyclooxgenase-2 (COX-2)]. Because SF seems to have an impact on COX-2 expression, we focused on COX-2 and found that SF reduced UVB-induced COX-2 protein expression. In support of this, PGE(2) released from HaCaT was suppressed by SF. Western blot analysis revealed that SF inhibited p38, ERK and SAPK/JNK activation, indicating that the inhibition of mitogen-activated protein kinases (MAPK) by SF would attenuate the expression of inflammatory mediators (e.g., COX-2), thereby reducing inflammatory responses. Moreover, we conducted skin thickening assay using HR-1 hairless mice and found that UVB-induced skin thickness, COX-2 protein expression and hyperplasia were all suppressed by feeding SF to the mice. These results suggest that SF has a potential use as a compound for protection against UVB-induced skin inflammation. Copyright 2010 Elsevier Inc. All rights reserved.

  13. Features of Postoperative Immune Suppression Are Reversible With Interferon Gamma and Independent of Interleukin-6 Pathways.

    PubMed

    Longbottom, E Rebecca; Torrance, Hew D T; Owen, Helen C; Fragkou, Paraskevi C; Hinds, Charles J; Pearse, Rupert M; O'Dwyer, Michael J

    2016-08-01

    The aim of this study was to evaluate the role of interleukin (IL)-6 pathways in postoperative immune suppression and to assess the reversibility of this phenomenon. The postoperative period is characterized by increased IL-6 production and features of immune suppression. In vitro, IL-6 mediates anti-inflammatory effects through inhibition of interferon gamma (IFN-γ) pathways. The significance of the immunomodulatory effects of IL-6 in the clinical setting of postoperative immune suppression remains unclear. Patients over 45 years old undergoing elective surgery, involving the gastrointestinal tract, were recruited. IL-6 levels were assayed using an enzyme linked immunosorbent assay preoperatively, and at 24 and 48 hours. Peripheral blood mononuclear cells from healthy volunteers were cultured in perioperative serum and CD14Human Leukocyte Antigen-DR (HLA-DR) [monocyte HLA-DR (mHLA-DR)] geometric mean florescent intensity was measured in the presence and absence of IL-6 neutralizing antibody and recombinant IFN-γ. Of the 108 patients, 41 developed a postoperative infection. The IL-6 levels increased 19-fold from the preoperative sample to 24 hours postoperatively (P < 0.0001). Higher IL-6 levels at 24 (P = 0.0002) and 48 hours (P = 0.003) were associated with subsequent postoperative infectious complications. mHLA-DR mean florescent intensity fell when healthy peripheral blood mononuclear cells were cultured with postoperative serum compared with preoperative serum (P = 0.008). This decrease was prevented by the presence of IFN-γ in the culture media, but not by the presence of IL-6-neutralizing antibody. IL-6 levels increase after a major surgery and are associated with an increased susceptibility to postoperative infections. Serum obtained from postoperative patients induces an immunosuppressive response, reflected in reduced mHLA-DR levels, mediated through IL-6 independent pathways and is reversible with IFN-γ. These data may have

  14. A novel anti-cancer agent Icaritin suppresses hepatocellular carcinoma initiation and malignant growth through the IL-6/Jak2/Stat3 pathway.

    PubMed

    Zhao, Hong; Guo, Yuming; Li, Shu; Han, Ruiqin; Ying, Jianming; Zhu, Hai; Wang, Yuanyuan; Yin, Li; Han, Yuqing; Sun, Lingzhi; Wang, Zhaoyi; Lin, Qingcong; Bi, Xinyu; Jiao, Yuchen; Jia, Hongying; Zhao, Jianjun; Huang, Zhen; Li, Zhiyu; Zhou, Jianguo; Song, Wei; Meng, Kun; Cai, Jianqiang

    2015-10-13

    Tumor-initiating cell (TIC) is a subpopulation of cells in tumors that are responsible for tumor initiation and progression. Recent studies indicate that hepatocellular carcinoma-initiating cells (HCICs) confer the high malignancy, recurrence and multi-drug resistance in hepatocellular carcinoma (HCC). In this study, we found that Icaritin, a prenylflavonoid derivative from Epimedium Genus, inhibited malignant growth of HCICs. Icaritin decreased the proportion of EpCAM-positive (a HCICs marker) cells, suppressed tumorsphere formation in vitro and tumor formation in vivo. We also found that Icaritin reduced expression of Interleukin-6 Receptors (IL-6Rs), attenuated both constitutive and IL-6-induced phosphorylation of Janus-activated kinases 2 (Jak2) and Signal transducer and activator of transcription 3 (Stat3), and inhibited Stat3 downstream genes, such as Bmi-1 and Oct4. The inhibitory activity of Icaritin in HCICs was augmented by siRNA-mediated silencing of Stat3 but attenuated by constitutive activation of Stat3.Taken together, our results indicate that Icaritin is able to inhibit malignant growth of HCICs and suggest that Icaritin may be developed into a novel therapeutic agent for effective treatment of HCC.

  15. Interleukin-6 counteracts therapy-induced cellular oxidative stress in multiple myeloma by up-regulating manganese superoxide dismutase.

    PubMed

    Brown, Charles O; Salem, Kelley; Wagner, Brett A; Bera, Soumen; Singh, Neeraj; Tiwari, Ajit; Choudhury, Amit; Buettner, Garry R; Goel, Apollina

    2012-06-15

    IL (interleukin)-6, an established growth factor for multiple myeloma cells, induces myeloma therapy resistance, but the resistance mechanisms remain unclear. The present study determines the role of IL-6 in re-establishing intracellular redox homoeostasis in the context of myeloma therapy. IL-6 treatment increased myeloma cell resistance to agents that induce oxidative stress, including IR (ionizing radiation) and Dex (dexamethasone). Relative to IR alone, myeloma cells treated with IL-6 plus IR demonstrated reduced annexin/propidium iodide staining, caspase 3 activation, PARP [poly(ADP-ribose) polymerase] cleavage and mitochondrial membrane depolarization with increased clonogenic survival. IL-6 combined with IR or Dex increased early intracellular pro-oxidant levels that were causally related to activation of NF-κB (nuclear factor κB) as determined by the ability of N-acetylcysteine to suppress both pro-oxidant levels and NF-κB activation. In myeloma cells, upon combination with hydrogen peroxide treatment, relative to TNF (tumour necrosis factor)-α, IL-6 induced an early perturbation in reduced glutathione level and increased NF-κB-dependent MnSOD (manganese superoxide dismutase) expression. Furthermore, knockdown of MnSOD suppressed the IL-6-induced myeloma cell resistance to radiation. MitoSOX Red staining showed that IL-6 treatment attenuated late mitochondrial oxidant production in irradiated myeloma cells. The present study provides evidence that increases in MnSOD expression mediate IL-6-induced resistance to Dex and radiation in myeloma cells. The results of the present study indicate that inhibition of antioxidant pathways could enhance myeloma cell responses to radiotherapy and/or chemotherapy.

  16. Interleukin-6 counteracts therapy-induced cellular oxidative stress in multiple myeloma by up-regulating manganese superoxide dismutase

    PubMed Central

    Brown, Charles O.; Salem, Kelley; Wagner, Brett A.; Bera, Soumen; Singh, Neeraj; Tiwari, Ajit; Choudhury, Amit; Buettner, Garry R.; Goel, Apollina

    2012-01-01

    IL (interleukin)-6, an established growth factor for multiple myeloma cells, induces myeloma therapy resistance, but the resistance mechanisms remain unclear. The present study determines the role of IL-6 in re-establishing intracellular redox homoeostasis in the context of myeloma therapy. IL-6 treatment increased myeloma cell resistance to agents that induce oxidative stress, including IR (ionizing radiation) and Dex (dexamethasone). Relative to IR alone, myeloma cells treated with IL-6 plus IR demonstrated reduced annexin/propidium iodide staining, caspase 3 activation, PARP [poly(ADP-ribose) polymerase] cleavage and mitochondrial membrane depolarization with increased clonogenic survival. IL-6 combined with IR or Dex increased early intracellular pro-oxidant levels that were causally related to activation of NF-κB (nuclear factor κB) as determined by the ability of N-acetylcysteine to suppress both pro-oxidant levels and NF-κB activation. In myeloma cells, upon combination with hydrogen peroxide treatment, relative to TNF (tumour necrosis factor)-α, IL-6 induced an early perturbation in reduced glutathione level and increased NF-κB-dependent MnSOD (manganese superoxide dismutase) expression. Furthermore, knockdown of MnSOD suppressed the IL-6-induced myeloma cell resistance to radiation. MitoSOX Red staining showed that IL-6 treatment attenuated late mitochondrial oxidant production in irradiated myeloma cells. The present study provides evidence that increases in MnSOD expression mediate IL-6-induced resistance to Dex and radiation in myeloma cells. The results of the present study indicate that inhibition of antioxidant pathways could enhance myeloma cell responses to radiotherapy and/or chemotherapy. PMID:22471522

  17. A dinucleotide motif in oligonucleotides shows potent immunomodulatory activity and overrides species-specific recognition observed with CpG motif.

    PubMed

    Kandimalla, Ekambar R; Bhagat, Lakshmi; Zhu, Fu-Gang; Yu, Dong; Cong, Yan-Ping; Wang, Daqing; Tang, Jimmy X; Tang, Jin-Yan; Knetter, Cathrine F; Lien, Egil; Agrawal, Sudhir

    2003-11-25

    Bacterial and synthetic DNAs containing CpG dinucleotides in specific sequence contexts activate the vertebrate immune system through Toll-like receptor 9 (TLR9). In the present study, we used a synthetic nucleoside with a bicyclic heterobase [1-(2'-deoxy-beta-d-ribofuranosyl)-2-oxo-7-deaza-8-methyl-purine; R] to replace the C in CpG, resulting in an RpG dinucleotide. The RpG dinucleotide was incorporated in mouse- and human-specific motifs in oligodeoxynucleotides (oligos) and 3'-3-linked oligos, referred to as immunomers. Oligos containing the RpG motif induced cytokine secretion in mouse spleen-cell cultures. Immunomers containing RpG dinucleotides showed activity in transfected-HEK293 cells stably expressing mouse TLR9, suggesting direct involvement of TLR9 in the recognition of RpG motif. In J774 macrophages, RpG motifs activated NF-kappa B and mitogen-activated protein kinase pathways. Immunomers containing the RpG dinucleotide induced high levels of IL-12 and IFN-gamma, but lower IL-6 in time- and concentration-dependent fashion in mouse spleen-cell cultures costimulated with IL-2. Importantly, immunomers containing GTRGTT and GARGTT motifs were recognized to a similar extent by both mouse and human immune systems. Additionally, both mouse- and human-specific RpG immunomers potently stimulated proliferation of peripheral blood mononuclear cells obtained from diverse vertebrate species, including monkey, pig, horse, sheep, goat, rat, and chicken. An immunomer containing GTRGTT motif prevented conalbumin-induced and ragweed allergen-induced allergic inflammation in mice. We show that a synthetic bicyclic nucleotide is recognized in the C position of a CpG dinucleotide by immune cells from diverse vertebrate species without bias for flanking sequences, suggesting a divergent nucleotide motif recognition pattern of TLR9.

  18. Corticotropin-releasing hormone regulates IL-6 expression during inflammation

    PubMed Central

    Venihaki, Maria; Dikkes, Pieter; Carrigan, Allison; Karalis, Katia P.

    2001-01-01

    Stimulation of the hypothalamic-pituitary-adrenal (HPA) axis by proinflammatory cytokines results in increased release of glucocorticoid that restrains further development of the inflammatory process. IL-6 has been suggested to stimulate the HPA axis during immune activation independent of the input of hypothalamic corticotropin-releasing hormone (CRH). We used the corticotropin-releasing hormone–deficient (Crh+/+) mouse to elucidate the effect of CRH deficiency on IL-6 expression and IL-6induced HPA axis activation during turpentine-induced inflammation. We demonstrate that during inflammation CRH is required for a normal adrenocorticotropin hormone (ACTH) increase but not for adrenal corticosterone rise. The paradoxical increase of plasma IL-6 associated with CRH deficiency suggests that IL-6 release during inflammation is CRH-dependent. We also demonstrate that adrenal IL-6 expression is CRH-dependent, as its basal and inflammation-induced expression is blocked by CRH deficiency. Our findings suggest that during inflammation, IL-6 most likely compensates for the effects of CRH deficiency on food intake. Finally, we confirm that the HPA axis response is defective in Crh+/+/IL-6+/+ mice. These findings, along with the regulation of IL-6 by CRH, support the importance of the interaction between the immune system and the HPA axis in the pathophysiology of inflammatory diseases. PMID:11602623

  19. PTP1B is a negative regulator of interleukin 4–induced STAT6 signaling

    PubMed Central

    Lu, Xiaoqing; Malumbres, Raquel; Shields, Benjamin; Jiang, Xiaoyu; Sarosiek, Kristopher A.; Natkunam, Yasodha

    2008-01-01

    Protein tyrosine phosphatase 1B (PTP1B) is a ubiquitously expressed enzyme shown to negatively regulate multiple tyrosine phosphorylation-dependent signaling pathways. PTP1B can modulate cytokine signaling pathways by dephosphorylating JAK2, TYK2, and STAT5a/b. Herein, we report that phosphorylated STAT6 may serve as a cytoplasmic substrate for PTP1B. Overexpression of PTP1B led to STAT6 dephosphorylation and the suppression of STAT6 transcriptional activity, whereas PTP1B knockdown or deficiency augmented IL-4–induced STAT6 signaling. Pretreatment of these cells with the PTK inhibitor staurosporine led to sustained STAT6 phosphorylation consistent with STAT6 serving as a direct substrate of PTP1B. Furthermore, PTP1B-D181A “substrate-trapping” mutants formed stable complexes with phosphorylated STAT6 in a cellular context and endogenous PTP1B and STAT6 interacted in an interleukin 4 (IL-4)–inducible manner. We delineate a new negative regulatory loop of IL-4–JAK-STAT6 signaling. We demonstrate that IL-4 induces PTP1B mRNA expression in a phosphatidylinositol 3-kinase–dependent manner and enhances PTP1B protein stability to suppress IL-4–induced STAT6 signaling. Finally, we show that PTP1B expression may be preferentially elevated in activated B cell–like diffuse large B-cell lymphomas. These observations identify a novel regulatory loop for the regulation of IL-4–induced STAT6 signaling that may have important implications in both neoplastic and inflammatory processes. PMID:18716132

  20. Foxp3+ Regulatory T Cells Delay Expulsion of Intestinal Nematodes by Suppression of IL-9-Driven Mast Cell Activation in BALB/c but Not in C57BL/6 Mice

    PubMed Central

    Brenz, Yannick; Eschbach, Marie-Luise; Hartmann, Wiebke; Haben, Irma; Sparwasser, Tim; Huehn, Jochen; Kühl, Anja; Feyerabend, Thorsten B.; Rodewald, Hans-Reimer; Breloer, Minka

    2014-01-01

    Accumulating evidence suggests that IL-9-mediated immunity plays a fundamental role in control of intestinal nematode infection. Here we report a different impact of Foxp3+ regulatory T cells (Treg) in nematode-induced evasion of IL-9-mediated immunity in BALB/c and C57BL/6 mice. Infection with Strongyloides ratti induced Treg expansion with similar kinetics and phenotype in both strains. Strikingly, Treg depletion reduced parasite burden selectively in BALB/c but not in C57BL/6 mice. Treg function was apparent in both strains as Treg depletion increased nematode-specific humoral and cellular Th2 response in BALB/c and C57BL/6 mice to the same extent. Improved resistance in Treg-depleted BALB/c mice was accompanied by increased production of IL-9 and accelerated degranulation of mast cells. In contrast, IL-9 production was not significantly elevated and kinetics of mast cell degranulation were unaffected by Treg depletion in C57BL/6 mice. By in vivo neutralization, we demonstrate that increased IL-9 production during the first days of infection caused accelerated mast cell degranulation and rapid expulsion of S. ratti adults from the small intestine of Treg-depleted BALB/c mice. In genetically mast cell-deficient (Cpa3-Cre) BALB/c mice, Treg depletion still resulted in increased IL-9 production but resistance to S. ratti infection was lost, suggesting that IL-9-driven mast cell activation mediated accelerated expulsion of S. ratti in Treg-depleted BALB/c mice. This IL-9-driven mast cell degranulation is a central mechanism of S. ratti expulsion in both, BALB/c and C57BL/6 mice, because IL-9 injection reduced and IL-9 neutralization increased parasite burden in the presence of Treg in both strains. Therefore our results suggest that Foxp3+ Treg suppress sufficient IL-9 production for subsequent mast cell degranulation during S. ratti infection in a non-redundant manner in BALB/c mice, whereas additional regulatory pathways are functional in Treg-depleted C57BL/6

  1. Targeting IL13Ralpha2 activates STAT6-TP63 pathway to suppress breast cancer lung metastasis.

    PubMed

    Papageorgis, Panagiotis; Ozturk, Sait; Lambert, Arthur W; Neophytou, Christiana M; Tzatsos, Alexandros; Wong, Chen K; Thiagalingam, Sam; Constantinou, Andreas I

    2015-07-25

    Basal-like breast cancer (BLBC) is an aggressive subtype often characterized by distant metastasis, poor patient prognosis, and limited treatment options. Therefore, the discovery of alternative targets to restrain its metastatic potential is urgently needed. In this study, we aimed to identify novel genes that drive metastasis of BLBC and to elucidate the underlying mechanisms of action. An unbiased approach using gene expression profiling of a BLBC progression model and in silico leveraging of pre-existing tumor transcriptomes were used to uncover metastasis-promoting genes. Lentiviral-mediated knockdown of interleukin-13 receptor alpha 2 (IL13Ralpha2) coupled with whole-body in vivo bioluminescence imaging was performed to assess its role in regulating breast cancer tumor growth and lung metastasis. Gene expression microarray analysis was followed by in vitro validation and cell migration assays to elucidate the downstream molecular pathways involved in this process. We found that overexpression of the decoy receptor IL13Ralpha2 is significantly enriched in basal compared with luminal primary breast tumors as well as in a subset of metastatic basal-B breast cancer cells. Importantly, breast cancer patients with high-grade tumors and increased IL13Ralpha2 levels had significantly worse prognosis for metastasis-free survival compared with patients with low expression. Depletion of IL13Ralpha2 in metastatic breast cancer cells modestly delayed primary tumor growth but dramatically suppressed lung metastasis in vivo. Furthermore, IL13Ralpha2 silencing was associated with enhanced IL-13-mediated phosphorylation of signal transducer and activator of transcription 6 (STAT6) and impaired migratory ability of metastatic breast cancer cells. Interestingly, genome-wide transcriptional analysis revealed that IL13Ralpha2 knockdown and IL-13 treatment cooperatively upregulated the metastasis suppressor tumor protein 63 (TP63) in a STAT6-dependent manner. These observations

  2. Differential involvement of IL-6 in the early and late phase of 1-methylnicotinamide (MNA) release in Concanavalin A-induced hepatitis.

    PubMed

    Sternak, Magdalena; Jakubowski, Andrzej; Czarnowska, Elzbieta; Slominska, Ewa M; Smolenski, Ryszard T; Szafarz, Malgorzata; Walczak, Maria; Sitek, Barbara; Wojcik, Tomasz; Jasztal, Agnieszka; Kaminski, Karol; Chlopicki, Stefan

    2015-09-01

    Exogenous 1-methylnicotinamide (MNA) displays anti-inflammatory activity. The aim of this work was to characterize the profile of release of endogenous MNA during the initiation and progression of murine hepatitis induced by Concanavalin A (ConA). In particular we aimed to clarify the role of interleukin-6 (IL-6) as well as the energy state of hepatocytes in MNA release in early and late phases of ConA-induced hepatitis in mice. Hepatitis was induced by ConA in IL-6(+/+) and IL-6(-/-) mice, and various parameters of liver inflammation and injury, as well as the energy state of hepatocytes, were analysed in relation to MNA release. The decrease in ATP/ADP and NADH/NAD ratios, cytokine release (IL-6, IFN-ɤ), acute phase response (e.g. haptoglobin) and liver injury (alanine aminotransaminase, ALT) were all blunted in ConA-induced hepatitis in IL-6(-/-) mice as compared to IL-6(+/+) mice. The release of MNA in response to Con A was also significantly blunted in IL-6(-/-) mice as compared to IL-6(+/+) mice in the early stage of ConA-induced hepatitis. In turn, nicotinamide N-methyltransferase (NNMT) and aldehyde oxidase (AO) activities were blunted in the liver and MNA plasma concentration was elevated to similar degree in the late stage after Concanavalin A in IL-6(+/+) and IL-6(-/-) mice. In conclusion, we demonstrated that in ConA-induced hepatitis, early, but not late MNA release was IL-6-dependent. Our results suggest that in the initiation and early hepatitis, MNA release is linked to the energy deficit/impaired redox status in hepatocytes, while in a later phase, MNA release is rather linked to the systemic inflammation. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. PRL-3 Is Involved in Estrogen- and IL-6-Induced Migration of Endometrial Stromal Cells From Ectopic Endometrium.

    PubMed

    Ren, Shifan; Zhou, Yefang; Fang, Xiaoling; She, Xiaoling; Wu, Yilin; Wu, Xianqing

    2016-05-24

    To investigate the role of phosphatase of regenerating liver-3 (PRL-3) in the 17β-estradiol (E2)- and interleukin 6 (IL-6)-induced migration of endometrial stromal cells (ESCs) from ectopic endometrium. Ectopic endometrial tissues were collected from patients with endometriosis, and PRL-3 expression in ectopic and eutopic endometrium was examined by immunohistochemistry. Endometrial stromal cells isolated from ectopic endometrium were treated with E2, progesterone (P), IL-6, or sodium orthovanadate (Sov) to inhibit PRL-3. Total RNA and protein were extracted from ESCs after treatment for quantitative real-time polymerase chain reaction and Western blot analyses. Cell migration was assessed using a scratch wound assay. Phosphatase of regenerating liver 3 protein was highly expressed in the endometrial glandular cells (EGCs) and ESCs in ectopic endometrium, whereas its weak expression was observed only in EGCs in eutopic endometrium. Both E2 and IL-6 treatment significantly increased PRL-3 messenger RNA and protein expression, and P treatment significantly inhibited PRL-3 expression. However, E2-induced PRL-3 expression in ESCs from ectopic endometrium was significantly blocked by IL-6 antibody. Moreover, E2- and IL-6-enhanced cell migration was completely abrogated by Sov treatment. Furthermore, Sov treatment could significantly promote PTEN expression but inhibit E2- and IL-6-induced p-AKT activation. Phosphatase of regenerating liver 3 plays a key role in the E2- and IL-6-induced migration of ESCs from ectopic endometrium, a process that is involved in the PTEN-AKT signaling pathway. © The Author(s) 2016.

  4. Toll-like receptor 9 mediates oral bacteria-induced IL-8 expression in gingival epithelial cells.

    PubMed

    Kim, Youngsook; Jo, Ah-ram; Jang, Da Hyun; Cho, Yong-Joon; Chun, Jongsik; Min, Byung-Moo; Choi, Youngnim

    2012-07-01

    Previously, we reported that various oral bacteria regulate interleukin (IL)-8 production differently in gingival epithelial cells. The aim of this study was to characterize the pattern recognition receptor(s) that mediate bacteria-induced IL-8 expression. Among ligands that mimic bacterial components, only a Toll-like receptor (TLR) 9 ligand enhanced IL-8 expression as determined by ELISA. Both normal and immortalized human gingival epithelial (HOK-16B) cells expressed TLR9 intracellularly and showed enhanced IL-8 expression in response to CpG-oligonucleotide. The ability of eight strains of four oral bacterial species to induce IL-8 expression in HOK-16B cells, and their invasion capacity were examined in the absence or presence of 2% human serum. The ability of purified bacterial DNA (bDNA) to induce IL-8 was also examined. Six out of eight strains increased IL-8 production in the absence of serum. Usage of an endosomal acidification blocker or a TLR9 antagonist inhibited the IL-8 induction by two potent strains. In the presence of serum, many strains lost the ability to induce IL-8 and presented substantially reduced invasion capacity. The IL-8-inducing ability of bacteria in the absence or presence of serum showed a strong positive correlation with their invasion index. The IL-8-inducing ability of bacteria in the absence of human serum was also correlated with the immunostimulatory activity of its bDNA. The observed immunostimulatory activity of the bDNA could not be linked to its CpG motif content. In conclusion, oral bacteria induce IL-8 in gingival epithelial cells through TLR9 and the IL-8-inducing ability depends on the invasive capacity and immunostimulating DNA.

  5. A novel tumor-promoting mechanism of IL6 and the therapeutic efficacy of tocilizumab: Hypoxia-induced IL6 is a potent autophagy initiator in glioblastoma via the p-STAT3-MIR155-3p-CREBRF pathway.

    PubMed

    Xue, Hao; Yuan, Guang; Guo, Xing; Liu, Qinglin; Zhang, Jinsen; Gao, Xiao; Guo, Xiaofan; Xu, Shugang; Li, Tong; Shao, Qianqian; Yan, Shaofeng; Li, Gang

    2016-07-02

    Hypoxia induces protective autophagy in glioblastoma cells and new therapeutic avenues that target this process may improve the outcome for glioblastoma patients. Recent studies have suggested that the autophagic process is upregulated in glioblastomas in response to extensive hypoxia. Hypoxia also induces the upregulation of a specific set of proteins and microRNAs (miRNAs) in a variety of cell types. IL6 (interleukin 6), an inflammatory autocrine and paracrine cytokine that is overexpressed in glioblastoma, has been reported to be a biomarker for poor prognosis because of its tumor-promoting effects. Here, we describe a novel tumor-promoting mechanism of IL6, whereby hypoxia-induced IL6 acts as a potent initiator of autophagy in glioblastoma via the phosphorylated (p)-STAT3-MIR155-3p pathway. IL6 and p-STAT3 levels correlated with the abundance of autophagic cells and HIF1A levels in human glioma tissues and with the grade of human glioma, whereas inhibition of exogenous or endogenous IL6 repressed autophagy in glioblastoma cells in vitro. Knockdown of endogenous MIR155-3p inhibited IL6-induced autophagy, and enforced expression of MIR155-3p restored the anti-autophagic activity of IL6 inhibitors. We show that the hypoxia-IL6-p-STAT3-MIR155-3p-CREBRF-CREB3-ATG5 pathway plays a central role in malignant glioma progression, with blockade of the IL6 receptor by tocilizumab demonstrating a certain level of therapeutic efficacy in a xenograft model in vivo, especially in combination with temozolomide. Moreover, tocilizumab inhibits autophagy by promoting tumor apoptosis. Collectively, our findings provide new insight into the molecular mechanisms underlying hypoxia-induced glioma cell autophagy and point toward a possible efficacious adjuvant therapy for glioblastoma patients.

  6. Thalidomide suppressed IL-1beta while enhancing TNF-alpha and IL-10, when cells in whole blood were stimulated with lipopolysaccharide.

    PubMed

    Shannon, Edward; Noveck, Robert; Sandoval, Felipe; Kamath, Burde

    2008-01-01

    Thalidomide is used to treat erythema nodosum leprosum (ENL). The events that precipitate this inflammatory reaction, which may occur in multibacillary leprosy patients, and the mechanism by which thalidomide arrest ENL, are not known. Thalidomide's ability to inhibit tumor necrosis factor alpha (TNF-alpha) in vitro has been proposed as a partial explanation of its effective treatment of ENL. In in vitro assays, thalidomide can enhance or suppress TNF-alpha. This is dependent on the stimulant used to evoke TNF-alpha; the procedure used to isolate the mononuclear cells from blood, and the predominant mononuclear cell type in the culture. To avoid artifacts that may occur during isolation of mononuclear cells from blood, we stimulated normal human blood with LPS and evaluated the effect of thalidomide and dexamethasone on TNF-alpha, and other inflammatory cytokines and biomarkers. Thalidomide suppressed interleukin 1 beta (IL-1beta) (p = 0.007), and it enhanced TNF-alpha (p = 0.007) and interleukin 10 (IL-10) (p = 0.031). Dexamethasone enhanced IL-10 (p = 0.013) and suppressed IL-1beta, TNF-alpha, interleukin 6 (IL-6), and interleukin 8 (IL-8) (p = 0.013). The two drugs did not suppress: C-reactive protein (CRP), Ig-superfamily cell-adhesion molecule 1 (ICAM 1), tumor necrosis factor receptor 1 (TNFR1), tumor necrosis factor receptor 2 (TNFR2), or amyloid A. In vitro and in vivo evidence is accumulating that TNF-alpha is not the primary cytokine targeted by thalidomide in ENL and other inflammatory conditions.

  7. IGF-1 and PDGF-bb Suppress IL-1β-Induced Cartilage Degradation through Down-Regulation of NF-κB Signaling: Involvement of Src/PI-3K/AKT Pathway

    PubMed Central

    Mobasheri, Ali; Buhrmann, Constanze; Aldinger, Constance; Rad, Jafar Soleimani; Shakibaei, Mehdi

    2011-01-01

    Objective Interleukin-1β (IL-1β) is a pro-inflammatory cytokine that plays a key role in the pathogenesis of osteoarthritis (OA). Growth factors (GFs) capable of antagonizing the catabolic actions of cytokines may have therapeutic potential in the treatment of OA. Herein, we investigated the potential synergistic effects of insulin-like growth factor (IGF-1) and platelet-derived growth factor (PDGF-bb) on different mechanisms participating in IL-1β-induced activation of nuclear transcription factor-κB (NF-κB) and apoptosis in chondrocytes. Methods Primary chondrocytes were treated with IL-1β to induce dedifferentiation and co-treated with either IGF-1 or/and PDGF-bb and evaluated by immunoblotting and electron microscopy. Results Pretreatment of chondrocytes with IGF-1 or/and PDGF-bb suppressed IL-1β-induced NF-κB activation via inhibition of IκB-α kinase. Inhibition of IκB-α kinase by GFs led to the suppression of IκB-α phosphorylation and degradation, p65 nuclear translocation and NF-κB-regulated gene products involved in inflammation and cartilage degradation (COX-2, MMPs) and apoptosis (caspase-3). GFs or BMS-345541 (specific inhibitor of the IKK) reversed the IL-1β-induced down-regulation of collagen type II, cartilage specific proteoglycans, β1-integrin, Shc, activated MAPKinase, Sox-9 and up-regulation of active caspase-3. Furthermore, the inhibitory effects of IGF-1 or/and PDGF-bb on IL-1β-induced NF-κB activation were sensitive to inhibitors of Src (PP1), PI-3K (wortmannin) and Akt (SH-5), suggesting that the pathway consisting of non-receptor tyrosine kinase (Src), phosphatidylinositol 3-kinase and protein kinase B must be involved in IL-1β signaling. Conclusion The results presented suggest that IGF-1 and PDGF-bb are potent inhibitors of IL-1β-mediated activation of NF-κB and apoptosis in chondrocytes, may be mediated in part through suppression of Src/PI-3K/AKT pathway, which may contribute to their anti-inflammatory effects. PMID

  8. Pirfenidone attenuates IL-1β-induced COX-2 and PGE2 production in orbital fibroblasts through suppression of NF-κB activity.

    PubMed

    Choi, Youn-Hee; Back, Keum Ok; Kim, Hee Ja; Lee, Sang Yeul; Kook, Koung Hoon

    2013-08-01

    The aim of this study was to determine the effect of pirfenidone on interleukin (IL)-1β-induced cyclooxygenase (COX)-2 and prostaglandin (PG)E2 expression in orbital fibroblasts from patients with thyroid-associated ophthalmopathy (TAO). Primary cultures of orbital fibroblasts from patients with TAO (n = 4) and non-TAO subjects (n = 4) were prepared. The level of PGE2 in orbital fibroblasts treated with IL-1β in the presence or absence of pirfenidone was measured using an enzyme-linked immunosorbent assay. The effect of pirfenidone on IL-1β-induced COX-2 expression in orbital fibroblasts from patients with TAO was evaluated by reverse transcription-polymerase chain reaction (PCR) and quantitative real-time PCR analyses, and verified by Western blot. Activation of nuclear factor-κB (NF-κB) was evaluated by immunoblotting for inhibitor of κB (IκB)α and phosphorylated IκBα, and DNA-binding activity of p50/p65 NF-κB was analyzed by electrophoretic mobility shift assay. In addition, IL-1 receptor type 1 (IL-1R1) expression was assessed by RT-PCR in IL-1β-treated cells with or without pirfenidone. Pirfenidone significantly attenuated IL-1β-induced PGE2 release in both TAO and non-TAO cells. IL-1β-induced COX-2 mRNA and protein expression decreased significantly following co-treatment with pirfenidone. IL-1β-induced IκBα phosphorylation and degradation decreased in the presence of pirfenidone and led to decreased nuclear translocation and DNA binding of the active NF-κB complex. In our system, neither IL-1β nor pirfenidone co-treatment influenced IL-1R1 expression. Our results suggest that pirfenidone attenuates the IL-1β-induced PGE2/COX-2 production in TAO orbital fibroblasts, which is related with suppression of the NF-κB activation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Newly identified CpG ODNs, M5-30 and M6-395, stimulate mouse immune cells to secrete TNF-alpha and enhance Th1-mediated immunity.

    PubMed

    Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin

    2010-08-01

    Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.

  10. Estrogen loss upregulates hematopoiesis in the mouse: a mediating role of IL-6.

    PubMed

    Jilka, R L; Passeri, G; Girasole, G; Cooper, S; Abrams, J; Broxmeyer, H; Manolagas, S C

    1995-06-01

    We have previously demonstrated that ovariectomy causes an increase in the number of colony-forming unit granulocyte/macrophage (CFU-GM) and an upregulation of osteoclastogenesis in mice, both of which are mediated by interleukin-6 (IL-6). IL-6 is involved in the development of several hematopoietic progenitors, including the burst-forming unit-erythroid (BFU-E) and multipotent CFUs (CFU-GEMM). Therefore, we performed studies to examine if other hematopoietic progenitors, besides CFU-GM and their progeny, are affected by estrogen loss. We found that ovariectomy caused an increase in the number of CFU-GEMM and BFU-E, as well as an increase of CFU-GM in marrow cells of the femur. Administration of 17 beta-estradiol or a neutralizing antibody against IL-6 prevented the ovariectomy-induced increase in the number of these progenitors in the marrow. Ovariectomy also caused an increase in the number of circulating lymphocytes, neutrophils, and monocytes, which were suppressed by administration of 17 beta-estradiol or the neutralizing antibody against IL-6; however, the number of circulating platelets was unaffected by loss of ovarian function. These data establish that, in addition to upregulation of osteoclastogenesis, loss of estrogens in the mouse causes widespread effects on hematopoiesis, which are apparently mediated by IL-6.

  11. Local Delivery of the Toll-Like Receptor 9 Ligand CpG Downregulates Host Immune and Inflammatory Responses, Ameliorating Established Leishmania (Viannia) panamensis Chronic Infection

    PubMed Central

    Fernández, Olga L.; Rodriguez-Pinto, Daniel; Castilho, Tiago M.; Corral Caridad, Maria J.; Goldsmith-Pestana, Karen; Saravia, Nancy Gore; McMahon-Pratt, Diane

    2017-01-01

    ABSTRACT Infection by Leishmania (Viannia) panamensis, the predominant etiologic agent for cutaneous leishmaniasis in Colombia, is characterized by a chronic mixed inflammatory response. Current treatment options are plagued by toxicity, lengthy treatment regimens, and growing evidence of drug resistance. Immunotherapy, modulating the immune system to mount a protective response, may provide an alternate therapeutic approach. We investigated the ability of the Toll-like receptor 9 (TLR9) ligand CpG to modulate established disease in the L. (V.) panamensis mouse model. Treatment of established infection with a high dose (50 μg) of CpG ameliorated disease and lowered parasite burden. Interestingly, immediately after treatment there was a significant increase in transforming growth factor β (TGF-β) and concomitantly an increase in T regulatory cell (Treg) function. Although a general reduction in cell-mediated immune cytokine and chemokine (gamma interferon [IFN-γ], interleukin 10 [IL-10], IL-13, IL-6, granulocyte-macrophage colony-stimulating factor [GM-CSF], IL-4, and MIP-1α) responses of the treated mice was observed, certain chemokines (RANTES, monocyte chemoattractant protein 1[MCP-1], and IP-10) were increased. Further, in peripheral blood mononuclear cells (PBMCs) from patients with cutaneous leishmaniasis, CpG treatment similarly exhibited a dose-response effect on the production of IFN-γ, IL-17, IL-10, and IL-13, with reductions observed at higher doses. To further understand the underlying mechanisms and cell populations driving the CpG mediated response, we examined the ex vivo dose effects mediated by the TLR9+ cell populations (dendritic cells, macrophages, and B cells) found to accumulate labeled CpG in vivo. Notably, B cells altered the production of IL-17, IL-13, and IFN-γ, supporting a role for B cells functioning as antigen-presenting cells (APCs) and/or regulatory cells during infection. Interestingly, B cells have been previously

  12. Increased serum IL-6 level time-dependently regulates hyperalgesia and spinal mu opioid receptor expression during CFA-induced arthritis

    PubMed Central

    Tekieh, E.; Zaringhalam, Jalal; Manaheji, H.; Maghsoudi, N.; Alani, B.; Zardooz, H.

    2011-01-01

    Interleukin (IL)-6 is known to cause pro- and anti-inflammatory effects during different stages of inflammation. Recent therapeutic investigations have focused on treatment of various inflammatory disorders with anti-cytokine substances. As a result, the aim of this study was to further elucidate the influence of IL-6 in hyperalgesia and edema during different stages of Complete Freund's Adjuvant (CFA)-induced arthritis (AA) in male Wistar rats. AA was induced by a single subcutaneous injection of CFA into the rats' hindpaw. Anti-IL-6 was administered either daily or weekly during the 21 days of study. Spinal mu opioid receptor (mOR) expression was detected by Western blotting. Daily and weekly treatment with an anti-IL-6 antibody significantly decreased paw edema in the AA group compared to the AA control group. Additionally, daily and weekly anti-IL-6 administration significantly reduced hyperalgesia on day 7 in the AA group compared to the AA control group; however, there were significant increases in hyperalgesia in the antibody-treated group on days 14 and 21 compared to the AA control group. IL-6 antibody-induced increases in hyperalgesia on the 14th and 21st days after CFA injection correlated with a time-dependent, significant reduction in spinal mOR expression during anti-IL-6 treatment. Our study confirmed the important time-dependent relationship between serum IL-6 levels and hyperalgesia during AA. These results suggest that the stages of inflammation in AA must be considered for anti-hyperalgesic and anti-inflammatory interventions via anti-IL-6 antibody treatment. PMID:27857662

  13. Increased serum IL-6 level time-dependently regulates hyperalgesia and spinal mu opioid receptor expression during CFA-induced arthritis.

    PubMed

    Tekieh, E; Zaringhalam, Jalal; Manaheji, H; Maghsoudi, N; Alani, B; Zardooz, H

    2011-01-01

    Interleukin (IL)-6 is known to cause pro- and anti-inflammatory effects during different stages of inflammation. Recent therapeutic investigations have focused on treatment of various inflammatory disorders with anti-cytokine substances. As a result, the aim of this study was to further elucidate the influence of IL-6 in hyperalgesia and edema during different stages of Complete Freund's Adjuvant (CFA)-induced arthritis (AA) in male Wistar rats. AA was induced by a single subcutaneous injection of CFA into the rats' hindpaw. Anti-IL-6 was administered either daily or weekly during the 21 days of study. Spinal mu opioid receptor (mOR) expression was detected by Western blotting. Daily and weekly treatment with an anti-IL-6 antibody significantly decreased paw edema in the AA group compared to the AA control group. Additionally, daily and weekly anti-IL-6 administration significantly reduced hyperalgesia on day 7 in the AA group compared to the AA control group; however, there were significant increases in hyperalgesia in the antibody-treated group on days 14 and 21 compared to the AA control group. IL-6 antibody-induced increases in hyperalgesia on the 14 th and 21 st days after CFA injection correlated with a time-dependent, significant reduction in spinal mOR expression during anti-IL-6 treatment. Our study confirmed the important time-dependent relationship between serum IL-6 levels and hyperalgesia during AA. These results suggest that the stages of inflammation in AA must be considered for anti-hyperalgesic and anti-inflammatory interventions via anti-IL-6 antibody treatment.

  14. IL-1 receptor antagonist-mediated therapeutic effect in murine myasthenia gravis is associated with suppressed serum proinflammatory cytokines, C3, and anti-acetylcholine receptor IgG1.

    PubMed

    Yang, Huan; Tüzün, Erdem; Alagappan, Dhivyaa; Yu, Xiang; Scott, Benjamin G; Ischenko, Alexander; Christadoss, Premkumar

    2005-08-01

    In myasthenia gravis (MG), TNF and IL-1beta polymorphisms and high serum levels of these proinflammatory cytokines have been observed. Likewise, TNF and IL-1beta are critical for the activation of acetylcholine receptor (AChR)-specific T and B cells and for the development of experimental autoimmune myasthenia gravis (EAMG) induced by AChR immunization. We tested the therapeutic effect of human recombinant IL-1 receptor antagonist (IL-1ra) in C57BL/6 mice with EAMG. Multiple daily injections of 0.01 mg of IL-1ra administered for 2 wk following two AChR immunizations decreased the incidence and severity of clinical EAMG. Furthermore, IL-1ra treatment of mice with ongoing clinical EAMG reduced the clinical symptoms of disease. The IL-1ra-mediated suppression of clinical disease was associated with suppressed serum IFN-gamma, TNF-alpha, IL-1beta, IL-2, IL-6, C3, and anti-AChR IgG1 without influencing total serum IgG. Therefore, IL-1ra could be used as a nonsteroidal drug for the treatment of MG.

  15. Autocrine IL-6 mediates pituitary tumor senescence

    PubMed Central

    Fuertes, Mariana; Ajler, Pablo; Carrizo, Guillermo; Cervio, Andrés; Sevlever, Gustavo; Stalla, Günter K.; Arzt, Eduardo

    2017-01-01

    Cellular senescence is a stable proliferative arrest state. Pituitary adenomas are frequent and mostly benign, but the mechanism for this remains unknown. IL-6 is involved in pituitary tumor progression and is produced by the tumoral cells. In a cell autonomous fashion, IL-6 participates in oncogene-induced senescence in transduced human melanocytes. Here we prove that autocrine IL-6 participates in pituitary tumor senescence. Endogenous IL-6 inhibition in somatotroph MtT/S shRNA stable clones results in decreased SA-β-gal activity and p16INK4a but increased pRb, proliferation and invasion. Nude mice injected with IL-6 silenced clones develop tumors contrary to MtT/S wild type that do not, demonstrating that clones that escape senescence are capable of becoming tumorigenic. When endogenous IL-6 is silenced, cell cultures derived from positive SA-β-gal human tumor samples decrease the expression of the senescence marker. Our results establish that IL-6 contributes to maintain senescence by its autocrine action, providing a natural model of IL-6 mediated benign adenoma senescence. PMID:27902467

  16. Therapeutic Targeting of the IL-6 Trans-Signaling/Mechanistic Target of Rapamycin Complex 1 Axis in Pulmonary Emphysema.

    PubMed

    Ruwanpura, Saleela M; McLeod, Louise; Dousha, Lovisa F; Seow, Huei J; Alhayyani, Sultan; Tate, Michelle D; Deswaerte, Virginie; Brooks, Gavin D; Bozinovski, Steven; MacDonald, Martin; Garbers, Christoph; King, Paul T; Bardin, Philip G; Vlahos, Ross; Rose-John, Stefan; Anderson, Gary P; Jenkins, Brendan J

    2016-12-15

    The potent immunomodulatory cytokine IL-6 is consistently up-regulated in human lungs with emphysema and in mouse emphysema models; however, the mechanisms by which IL-6 promotes emphysema remain obscure. IL-6 signals using two distinct modes: classical signaling via its membrane-bound IL-6 receptor (IL-6R), and trans-signaling via a naturally occurring soluble IL-6R. To identify whether IL-6 trans-signaling and/or classical signaling contribute to the pathogenesis of emphysema. We used the gp130 F/F genetic mouse model for spontaneous emphysema and cigarette smoke-induced emphysema models. Emphysema in mice was quantified by various methods including in vivo lung function and stereology, and terminal deoxynucleotidyl transferase dUTP nick end labeling assay was used to assess alveolar cell apoptosis. In mouse and human lung tissues, the expression level and location of IL-6 signaling-related genes and proteins were measured, and the levels of IL-6 and related proteins in sera from emphysematous mice and patients were also assessed. Lung tissues from patients with emphysema, and from spontaneous and cigarette smoke-induced emphysema mouse models, were characterized by excessive production of soluble IL-6R. Genetic blockade of IL-6 trans-signaling in emphysema mouse models and therapy with the IL-6 trans-signaling antagonist sgp130Fc ameliorated emphysema by suppressing augmented alveolar type II cell apoptosis. Furthermore, IL-6 trans-signaling-driven emphysematous changes in the lung correlated with mechanistic target of rapamycin complex 1 hyperactivation, and treatment of emphysema mouse models with the mechanistic target of rapamycin complex 1 inhibitor rapamycin attenuated emphysematous changes. Collectively, our data reveal that specific targeting of IL-6 trans-signaling may represent a novel treatment strategy for emphysema.

  17. Correlation of CpG Island Methylation of the Cytochrome P450 2E1/2D6 Genes with Liver Injury Induced by Anti-Tuberculosis Drugs: A Nested Case-Control Study.

    PubMed

    Zhang, Jinling; Zhu, Xuebin; Li, Yuhong; Zhu, Lingyan; Li, Shiming; Zheng, Guoying; Ren, Qi; Xiao, Yonghong; Feng, Fumin

    2016-08-01

    This study investigated the role of CpG island methylation of the CYP2E1 and CYP2D6 genes in liver injury induced by anti-TB drugs from an epigenetic perspective in a Chinese cohort. A 1:1 matched nested case-control study design was applied. Pulmonary tuberculosis (TB) patients, who underwent standard anti-TB therapy and developed liver injury were defined as cases, while those who did not develop liver injury were defined as control. The two groups were matched in terms of sex, treatment regimen, and age. In 114 pairs of cases, CpG island methylation levels of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA were found to be significantly correlated with the occurrence of anti-TB drug-induced liver injury (ADLI), with odds ratio (OR) values of 2.429 and 3.500, respectively (p < 0.01). Moreover, through multivariate logistic regression analysis, CpG island methylation of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA were found to be significantly correlated with the occurrence of ADLI, with adjusted OR values of 4.390 (95% confidence interval (CI): 1.982-9.724) and 9.193 (95% CI: 3.624-25.888), respectively (p < 0.001). These results suggest that aberrantly elevated methylation of CpG islands of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA may increase the risk of ADLI in Chinese TB patients.

  18. IL-17 Promotes Angiogenic Factors IL-6, IL-8, and Vegf Production via Stat1 in Lung Adenocarcinoma.

    PubMed

    Huang, Qi; Duan, Limin; Qian, Xin; Fan, Jinshuo; Lv, Zhilei; Zhang, Xiuxiu; Han, Jieli; Wu, Feng; Guo, Mengfei; Hu, Guorong; Du, Jiao; Chen, Caiyun; Jin, Yang

    2016-11-07

    Inflammation and angiogenesis are two hallmarks of carcinoma. The proinflammatory cytokine interleukin-17 (IL-17) facilitates angiogenesis in lung cancer; however, the underlying mechanism is not fully understood. In this study, tumour microvessel density (MVD) was positively associated with IL-17, interleukin-6 (IL-6), interleukin-8 (IL-8), and vascular endothelial cell growth factor (VEGF) expression in human lung adenocarcinoma tissues, and it was increased in tumour tissues of A549-IL-17 cell-bearing nude mice. Importantly, positive correlations were also detected between IL-17 expression and IL-6, IL-8 and VEGF expression in human lung adenocarcinoma tissues. Furthermore, IL-6, IL-8 and VEGF production, as well as STAT1 phosphorylation, were increased in tumour tissues of A549-IL-17 cell-bearing nude mice in vivo and in A549 and H292 cells following IL-17 stimulation in vitro. In addition, STAT1 knockdown using an inhibitor and siRNA attenuated the IL-17-mediated increases in IL-6, IL-8 and VEGF expression in A549 and H292 cells. In conclusion, IL-17 may promote the production of the angiogenic inducers IL-6, IL-8 and VEGF via STAT1 signalling in lung adenocarcinoma.

  19. Foxp3⁺ regulatory T cells delay expulsion of intestinal nematodes by suppression of IL-9-driven mast cell activation in BALB/c but not in C57BL/6 mice.

    PubMed

    Blankenhaus, Birte; Reitz, Martina; Brenz, Yannick; Eschbach, Marie-Luise; Hartmann, Wiebke; Haben, Irma; Sparwasser, Tim; Huehn, Jochen; Kühl, Anja; Feyerabend, Thorsten B; Rodewald, Hans-Reimer; Breloer, Minka

    2014-02-01

    Accumulating evidence suggests that IL-9-mediated immunity plays a fundamental role in control of intestinal nematode infection. Here we report a different impact of Foxp3⁺ regulatory T cells (Treg) in nematode-induced evasion of IL-9-mediated immunity in BALB/c and C57BL/6 mice. Infection with Strongyloides ratti induced Treg expansion with similar kinetics and phenotype in both strains. Strikingly, Treg depletion reduced parasite burden selectively in BALB/c but not in C57BL/6 mice. Treg function was apparent in both strains as Treg depletion increased nematode-specific humoral and cellular Th2 response in BALB/c and C57BL/6 mice to the same extent. Improved resistance in Treg-depleted BALB/c mice was accompanied by increased production of IL-9 and accelerated degranulation of mast cells. In contrast, IL-9 production was not significantly elevated and kinetics of mast cell degranulation were unaffected by Treg depletion in C57BL/6 mice. By in vivo neutralization, we demonstrate that increased IL-9 production during the first days of infection caused accelerated mast cell degranulation and rapid expulsion of S. ratti adults from the small intestine of Treg-depleted BALB/c mice. In genetically mast cell-deficient (Cpa3-Cre) BALB/c mice, Treg depletion still resulted in increased IL-9 production but resistance to S. ratti infection was lost, suggesting that IL-9-driven mast cell activation mediated accelerated expulsion of S. ratti in Treg-depleted BALB/c mice. This IL-9-driven mast cell degranulation is a central mechanism of S. ratti expulsion in both, BALB/c and C57BL/6 mice, because IL-9 injection reduced and IL-9 neutralization increased parasite burden in the presence of Treg in both strains. Therefore our results suggest that Foxp3⁺ Treg suppress sufficient IL-9 production for subsequent mast cell degranulation during S. ratti infection in a non-redundant manner in BALB/c mice, whereas additional regulatory pathways are functional in Treg-depleted C57BL/6

  20. Tranilast reduces serum IL-6 and IL-13 and protects against thioacetamide-induced acute liver injury and hepatic encephalopathy.

    PubMed

    Abdelaziz, Rania R; Elkashef, Wagdi F; Said, Eman

    2015-07-01

    Hepatic encephalopathy is a serious neuropsychiatric disorder usually affecting either acute or chronic hepatic failure patients. Hepatic encephalopathy was replicated in a validated rat model to assess the potential protective efficacy of tranilast against experimentally induced hepatic encephalopathy. Thioacetamide injection significantly impaired hepatic synthetic, metabolic and excretory functions with significant increase in serum NO, IL-6 and IL-13 levels and negative shift in the oxidant/antioxidant balance. Most importantly, there was a significant increase in serum ammonia levels with significant astrocytes' swelling and vacuolization; hallmarks of hepatic encephalopathy. Tranilast administration (300 mg/kg, orally) for 15 days significantly improved hepatic functions, restored oxidant/antioxidant balance, reduced serum NO, IL-6 and IL-13 levels. Meanwhile, serum ammonia significantly declined with significant reduction in astrocytes' swelling and vacuolization. Several mechanisms can be implicated in the observed hepato- and neuroprotective potentials of tranilast, such as its anti-inflammatory potential, its antioxidant potential as well as its immunomodulatory properties. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Electrical stimulation induces IL-6 in skeletal muscle through extracellular ATP by activating Ca(2+) signals and an IL-6 autocrine loop.

    PubMed

    Bustamante, Mario; Fernández-Verdejo, Rodrigo; Jaimovich, Enrique; Buvinic, Sonja

    2014-04-15

    Interleukin-6 (IL-6) is an important myokine that is highly expressed in skeletal muscle cells upon exercise. We assessed IL-6 expression in response to electrical stimulation (ES) or extracellular ATP as a known mediator of the excitation-transcription mechanism in skeletal muscle. We examined whether the canonical signaling cascade downstream of IL-6 (IL-6/JAK2/STAT3) also responds to muscle cell excitation, concluding that IL-6 influences its own expression through a positive loop. Either ES or exogenous ATP (100 μM) increased both IL-6 expression and p-STAT3 levels in rat myotubes, a process inhibited by 100 μM suramin and 2 U/ml apyrase. ATP also evoked IL-6 expression in both isolated skeletal fibers and extracts derived from whole FDB muscles. ATP increased IL-6 release up to 10-fold. STAT3 activation evoked by ATP was abolished by the JAK2 inhibitor HBC. Blockade of secreted IL-6 with a neutralizing antibody or preincubation with the STAT3 inhibitor VIII reduced STAT3 activation evoked by extracellular ATP by 70%. Inhibitor VIII also reduced by 70% IL-6 expression evoked by ATP, suggesting a positive IL-6 loop. In addition, ATP increased up to 60% the protein levels of SOCS3, a negative regulator of the IL-6 signaling pathway. On the other hand, intracellular calcium chelation or blockade of IP3-dependent calcium signals abolished STAT3 phosphorylation evoked by either extracellular ATP or ES. These results suggest that expression of IL-6 in stimulated skeletal muscle cells is mediated by extracellular ATP and nucleotide receptors, involving IP3-dependent calcium signals as an early step that triggers a positive IL-6 autocrine loop.

  2. In vitro induction of T regulatory cells by a methylated CpG DNA sequence in humans: Potential therapeutic applications in allergic and autoimmune diseases.

    PubMed

    Lawless, Oliver J; Bellanti, Joseph A; Brown, Milton L; Sandberg, Kathryn; Umans, Jason G; Zhou, Li; Chen, Weiqian; Wang, Julie; Wang, Kan; Zheng, Song Guo

    2018-03-01

    Allergic and autoimmune diseases comprise a group of inflammatory disorders caused by aberrant immune responses in which CD25+ Forkhead box P3-positive (FOXP3+) T regulatory (Treg) cells that normally suppress inflammatory events are often poorly functioning. This has stimulated an intensive investigative effort to find ways of increasing Tregs as a method of therapy for these conditions. One such line of investigation includes the study of how ligation of Toll-like receptors (TLRs) by CpG oligonucleotides (ODN) results in an immunostimulatory cascade that leads to induction of T-helper (Th) type 1 and Treg-type immune responses. The present study investigated the mechanisms by which calf thymus mammalian double-stranded DNA (CT-DNA) and a synthetic methylated DNA CpG ODN sequence suppress in vitro lymphoproliferative responses to antigens, mitogens, and alloantigens when measured by [3H]-thymidine incorporation and promote FoxP3 expression in human CD4+ T cells in the presence of transforming growth factor (TGF) beta and interleukin-2 (IL-2). Lymphoproliferative responses of peripheral blood mononuclear cells from four healthy subjects or nine subjects with systemic lupus erythematosus to CT-DNA or phytohemagglutinin (PHA) was measured by tritiated thymidine ([3H]-TdR) incorporation expressed as a stimulation index. Mechanisms of immunosuppressive effects of CT-DNA were evaluated by measurement of the degree of inhibition to lymphoproliferative responses to streptokinase-streptodornase, phytohemagglutinin (PHA), concanavalin A (Con A), pokeweed mitogen (PWM), or alloantigens by a Con A suppressor assay. The effects of CpG methylation on induction of FoxP3 expression in human T cells were measured by comparing inhibitory responses of synthetic methylated and nonmethylated 8-mer CpG ODN sequences by using cell sorting, in vitro stimulation, and suppressor assay. Here, we showed that CT-DNA and a synthetic methylated DNA 8-mer sequence could suppress antigen

  3. Erionite induces production of autoantibodies and IL-17 in C57BL/6 mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zebedeo, Christian Nash; Davis, Chad; Peña, Cecelia

    Background: Erionite has similar chemical and physical properties to amphibole asbestos, which induces autoantibodies in mice. Current exposures are occurring in North Dakota due to the use of erionite-contaminated gravel. While erionite is known to cause mesothelioma and other diseases associated with asbestos, there is little known about its effects on the immune system. Objectives: We performed this study to determine whether erionite evokes autoimmune reactions in mice. Methods: Bone marrow derived macrophages (BMDM) were used to measure toxicity induced by erionite. Cytokine production by BMDM and splenocytes of C57BL/6 mice was examined by bead arrays and ELISA following exposuremore » to erionite, amphiboles and chrysotile. Wild type C57BL/6 mice were exposed to saline, erionite, amphibole asbestos (Libby 6-Mix) or chrysotile through intratracheal instillations at equal mass (60 μg/mouse). Seven months after exposure, sera were examined for anti-nuclear antibodies (ANA) and IL-17. Immunohistochemistry was used to detect immune complex deposition in the kidneys. Results: Erionite and tremolite caused increased cytokine production belonging to the T{sub H}17 profile including IL-17, IL-6, TGF-β, and TNF-α. The frequency of ANA was increased in mice treated with erionite or amphibole compared to saline-treated mice. IL-17 and TNF-α were elevated in the sera of mice treated with erionite. The frequency of immune complex deposition in the kidneys increased from 33% in saline-treated mice to 90% with erionite. Conclusions: These data demonstrate that both erionite and amphibole asbestos induce autoimmune responses in mice, suggesting a potential for adverse effects in exposed communities. - Highlights: • Erionite, a fibrous mineral, is a current public health concern in the western USA. • Erionite exposure induces antinuclear autoantibodies in exposed mice. • Erionite induces a clear Th17 cytokine response in vitro and in vivo. • These responses were

  4. GPER negatively regulates TNFα-induced IL-6 production in human breast cancer cells via NF-κB pathway.

    PubMed

    Okamoto, Mariko; Mizukami, Yoichi

    2016-05-31

    Estrogen is known to have anti-inflammatory effects, that are thought to be mediated by the classical estrogen receptors (ERs), ERα and ERβ. G protein coupled estrogen receptor1 (GPER) is a novel membrane-type estrogen receptor that can mediate non-genomic estrogenic responses. Although there have been several reports asserting that the participation of GPER in anti-inflammatory effects is induced by estrogen, the role of GPER remains poorly understood. In this study, we investigated the involvement of GPER in the regulation of a representative inflammatory cytokine, IL-6. We first examined the expression of IL-6 mRNA by TNFα stimulation in the transfection of GPER-expression plasmid into HeLa cells. Exogenous GPER significantly inhibited TNFα-induced IL-6 expression, and blocked NF-κB promoter activity inducing the expression of IL-6 in a dose-dependent manner. The promoter activity was restored almost to control level by transfection with the C-terminal deletion mutant of GPER. Similar results have been observed in endogenous GPER using SKBR3 cells which do not express the classical ERs. The data have been validated by treatment of GPER with siRNA. These findings indicate that GPER negatively regulates TNFα-induced IL-6 expression, probably through inhibition of NF-κB promoter activity by a signal(s) derived from the C-terminal region of GPER.

  5. Vitamin C supplementation does not influence plasma and blood mononuclear cell IL-6 and IL-10 levels after exercise.

    PubMed

    Aguiló, Antoni; Monjo, Marta; Moreno, Carlos; Martinez, Pau; Martínez, Sonia; Tauler, Pedro

    2014-01-01

    The aim of this study was to determine whether the highest vitamin C supplementation associated with complete bioavailability influences the plasma and blood mononuclear cell IL-6 and IL-10 response to exercise. A double-blinded study of supplementation with vitamin C was performed. After 15 days of supplementation with vitamin C (500 mg · day(-1), n = 16) or a placebo (n = 15), participants in the study completed a 15-km run competition. Blood samples were taken before and after competition. Oxidative stress markers, antioxidants, cortisol, IL-6 and IL-10 were determined in plasma or serum. IL-6 and IL-10 protein and mRNA levels were measured in blood mononuclear cells. Although higher plasma and blood mononuclear cell vitamin C levels were observed in the supplemented group when compared with the placebo one, the two groups showed identical exercise-induced changes in all the measured parameters. Exercise induced increased IL-6 and IL-10 levels in plasma and blood mononuclear cells. IL-6 and IL-10 mRNA levels in blood mononuclear cells increased after the competition. After recovery, IL-6 mRNA returned to basal levels and IL-10 mRNA levels remained elevated. In conclusion, exercise induced increased IL-6 and IL-10 production in blood mononuclear cells. However, vitamin C supplementation did not influence IL-6 and IL-10 response to exercise.

  6. Imiquimod-induced psoriasis-like skin inflammation is suppressed by BET bromodomain inhibitor in mice through RORC/IL-17A pathway modulation.

    PubMed

    Nadeem, Ahmed; Al-Harbi, Naif O; Al-Harbi, Mohamed M; El-Sherbeeny, Ahmed M; Ahmad, Sheikh F; Siddiqui, Nahid; Ansari, Mushtaq A; Zoheir, Khairy M A; Attia, Sabry M; Al-Hosaini, Khaled A; Al-Sharary, Shakir D

    2015-09-01

    Psoriasis is one of the most common skin disorders characterized by erythematous plaques that result from hyperproliferative keratinocytes and infiltration of inflammatory leukocytes into dermis and epidermis. Recent studies suggest that IL-23/IL-17A/IL-22 cytokine axis plays an important role in the pathogenesis of psoriasis. The small molecule bromodomain and extraterminal domain (BET) inhibitors, that disrupt interaction of BET proteins with acetylated histones have recently demonstrated efficacy in various models of inflammation through suppression of several pathways, one of them being synthesis of IL-17A/IL-22 which primarily depends on transcription factor, retinoic acid receptor-related orphan receptor C (RORC). However, the efficacy and mechanistic aspect of a BET inhibitor in mouse model of skin inflammation has not been explored previously. Therefore, this study investigated the role of BET inhibitor, JQ-1 in mouse model of psoriasis-like inflammation. Mice were topically applied imiquimod (IMQ) to develop psoriasis-like inflammation on the shaved back and ear followed by assessment of skin inflammation (myeloperoxidase activity, ear thickness, and histopathology), RORC and its signature cytokines (IL-17A/IL-22). JQ-1 suppressed IMQ-induced skin inflammation as reflected by a decrease in ear thickness/myeloperoxidase activity, and RORC/IL-17A/IL-22 expression. Additionally, a RORα/γ agonist SR1078 was utilized to investigate the role of RORC in BET-mediated skin inflammation. SR1078 reversed the protective effect of JQ-1 on skin inflammation at both histological and molecular levels in the IMQ model. The current study suggests that BET bromodomains are involved in psoriasis-like inflammation through induction of RORC/IL-17A pathway. Therefore, inhibition of BET bromodomains may provide a new therapy against skin inflammation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. TNF-α-inducing protein of Helicobacter pylori induces epithelial-mesenchymal transition (EMT) in gastric cancer cells through activation of IL-6/STAT3 signaling pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Guodong; Tang, Na; Wang, Chao

    Tumor necrosis factor (TNF)-α-inducing protein (Tipα) is a newly identified carcinogenic factor secreted by Helicobacter pylori (H. pylori). Although it has been proved that Tipα is a strong inducer of epithelial-mesenchymal transition (EMT), a crucial process of migration, the exact molecular mechanism is unknown. Current evidence indicates that the oncogenic transcription factor signal transducers and activators of transcription 3 (STAT3) is inappropriately activated in multiple malignancies, including gastric cancer. In this study, we showed that Tipα significantly down-regulated the expression of EMT-related markers E-cadherin as well as up-regulated N-cadherin and vimentin in SGC7901 cells, with typical morphological changes of EMT. Tipα alsomore » promoted proliferation and migration of SGC7901 cells. Furthermore, Tipα activated interleukin-6 (IL-6)/STAT3 signaling pathway in SGC7901 cells. The effects of Tipα treatment observed was abolished when we block IL-6/STAT3 signaling pathway. Altogether, our data demonstrated that Tipα may accelerate tumor aggressiveness in gastric cancer by promoting EMT through activation of IL-6/STAT3 pathway. - Highlights: • Tipα induces EMT and activates IL-6/STAT3 pathway in gastric cancer cells. • IL-6/STAT3 pathway inhibition reverses Tipα-induced proliferation and migration in gastric cancer cells. • Tipα induces EMT in gastric cancer cells via IL-6/STAT3 pathway activation.« less

  8. IL-1beta, IL-6 and IL-8 levels in gyneco-obstetric infections.

    PubMed Central

    Basso, Beatriz; Giménez, Francisco; López, Carlos

    2005-01-01

    OBJECTIVE: During pregnancy cytokines and inflammatory mediators stimulate the expression of prostaglandin, the levels of which determine the onset of labor. The aim of this work was to study interleukin IL-1beta, IL-6 and IL-8 levels in the vaginal discharge, serum and urine of pregnant women with genitourinary infection before and after specific treatment. One hundred and fifty-one patients were studied during the second or third trimester of their pregnancy. METHODS: The selected patients were: healthy or control group (n = 52), those with bacterial vaginosis (n = 47), those with vaginitis (n = 37), those with asymptomatic urinary infection (n = 15) and post-treatment. The level of cytokines was assayed by ELISA test. The Mann-Whitney U-test was used for statistical analysis. RESULTS: The IL-1beta levels in vaginal discharge were: control 103.5 +/- 24.2 pg/ml, bacterial vaginosis 1030 +/- 59.5, vaginitis 749.14 +/- 66.7l ( p < 0.0001), post-treatment 101.4 +/- 28.7. IL-6 values were similar in both control and infected groups, and there were no patients with chorioamnionitis. In vaginal discharge IL-6: control 14.2 +/- 3.9 pg/ml, bacterial vaginosis 13.2 +/- 3.8, vaginitis 13 +/- 4.2. IL-8 levels were: control 1643 +/- 130.3 pg/ml, bacterial vaginosis 2612.7 +/- 257.7, vaginitis 3437 +/- 460 (p < 0.0001), post-treatment 1693 +/- 126.6. In urine the results were: control 40.2 +/- 17 pg/ml, asymptomatic urinary infection 1200.7 +/- 375 (p < 0.0001). In patients with therapeutic success both IL-1beta and IL-8 returned to normal levels. CONCLUSIONS: Genitourinary infections induce a significant increase in IL-1beta and IL-8 levels in vaginal secretions, and IL-8 in urine as well. Both cytokines could be useful as evolutive markers of infection. PMID:16338780

  9. Suppression of chronic experimental autoimmune neuritis by nasally administered recombinant rat interleukin-6

    PubMed Central

    DERETZI, G; PELIDOU, S-H; ZOU, L-P; QUIDING, C; MIX, E; LEVI, M; WAHREN, B; ZHU, J

    1999-01-01

    Experimental autoimmune neuritis (EAN) is a CD4+ T-cell-mediated demyelinating disease of the peripheral nervous system (PNS) and serves as experimental model for human immune-demyelinating neurophathies, especially the Guillain–Barré syndrome. In this study, we examined the effect of recombinant rat interleukin-6 (rrIL-6) on chronic EAN in Lewis rats induced by immunization with P2 peptide 57-81 and Freund’s complete adjuvant (FCA). Nasal administration of rat rIL-6 (1 μg/rat/day) beginning in the initial phase of EAN as a therapeutic agent, decreased the severity and the duration of clinical EAN. Low-grade inflammation and suppression of regional demyelination within the sciatic nerves were seen in rrIL-6-treated rats. Hyporesponsiveness of lymph node T cells, down-regulation of serum tumour necrosis factor-α (TNF-α) and increased levels of P2-specific immunoglobulin G1 (IgG1) antibodies document that nasal administration of rrIL-6 was effective systemically. However, because of the non-specific nature of the treatment and multiple effects of IL-6, more experience and great caution are needed, before nasal administration of IL-6 can be considered as a treatment of human autoimmune demyelinating neurophathies. PMID:10447716

  10. Genetic deletion of IL-25 (IL-17E) confers resistance to dextran sulfate sodium-induced colitis in mice

    USDA-ARS?s Scientific Manuscript database

    IL-25 is emerging as a key regulator of inflammation in the intestinal mucosa because of its ability to promote Th2 while suppressing Th1 and Th17 cytokine responses. We investigated the contribution of endogenous IL-25 to DSS-induced colitis in mice. Mice were exposed to DSS in drinking water ad li...

  11. Lactobacillus acidophilus Suppresses Colitis-Associated Activation of the IL-23/Th17 Axis

    PubMed Central

    Chen, Linlin; Zou, Yiyou; Peng, Jie; Lu, Fanggen; Yin, Yani; Li, Fujun; Yang, Junwen

    2015-01-01

    The aim of this paper is to determine the modulatory effects of Lactobacillus acidophilus on the IL-23/Th17 immune axis in experimental colitis. DSS-induced mouse models of UC were to be saline, hormones, and different concentrations of Lactobacillus acidophilus intervention. The expression of interleukin- (IL-) 17, tumor necrosis factor α (TNFα), IL-23, transforming growth factor β1 (TGFβ1), signal transducer and activator of transcription 3 (STAT3), and phosphorylated (p)-STAT3 was examined by RT-PCR, Western blotting, and immunohistochemical analysis. And the results showed that administration of L. acidophilus suppressed Th17 cell-mediated secretion of proinflammatory cytokine IL-17 through downregulation of IL-23 and TGFβ1 expression and downstream phosphorylation of p-STAT3. PMID:25973440

  12. IL-6 Production by TLR-Activated APC Broadly Enhances Aged Cognate CD4 Helper and B Cell Antibody Responses In Vivo.

    PubMed

    Brahmakshatriya, Vinayak; Kuang, Yi; Devarajan, Priyadharshini; Xia, Jingya; Zhang, Wenliang; Vong, Allen Minh; Swain, Susan L

    2017-04-01

    Naive CD4 T cell responses, especially their ability to help B cell responses, become compromised with aging. We find that using APC pretreated ex vivo with TLR agonists, polyinosinic-polycytidylic acid and CpG, to prime naive CD4 T cells in vivo, restores their ability to expand and become germinal center T follicular helpers and enhances B cell IgG Ab production. Enhanced helper responses are dependent on IL-6 production by the activated APC. Aged naive CD4 T cells respond suboptimally to IL-6 compared with young cells, such that higher doses are required to induce comparable signaling. Preactivating APC overcomes this deficiency. Responses of young CD4 T cells are also enhanced by preactivating APC with similar effects but with only partial IL-6 dependency. Strikingly, introducing just the activated APC into aged mice significantly enhances otherwise compromised Ab production to inactivated influenza vaccine. These findings reveal a central role for the production of IL-6 by APC during initial cognate interactions in the generation of effective CD4 T cell help, which becomes greater with age. Without APC activation, aging CD4 T cell responses shift toward IL-6-independent Th1 and CD4 cytotoxic Th cell responses. Thus, strategies that specifically activate and provide Ag to APC could potentially enhance Ab-mediated protection in vaccine responses. Copyright © 2017 by The American Association of Immunologists, Inc.

  13. In vitro progesterone modulation on bacterial endotoxin-induced production of IL-1β, TNFα, IL-6, IL-8, IL-10, MIP-1α, and MMP-9 in pre-labor human term placenta.

    PubMed

    Garcia-Ruíz, G; Flores-Espinosa, P; Preciado-Martínez, E; Bermejo-Martínez, L; Espejel-Nuñez, A; Estrada-Gutierrez, G; Maida-Claros, R; Flores-Pliego, A; Zaga-Clavellina, Veronica

    2015-10-07

    During human pregnancy, infection/inflammation represents an important factor that increases the risk of developing preterm labor. The purpose of this study was to determine if pre-treatment with progesterone has an immunomodulatory effect on human placenta production of endotoxin-induced inflammation and degradation of extracellular matrix markers. Placentas were obtained under sterile conditions from pregnancies delivered at term before the onset of labor by cesarean section. Explants from central cotyledons of 10 human placentas were pre-treated with different concentrations of progesterone (0.01, 01, 1.0 μM) and then stimulated with 1000 ng/mL of LPS of Escherichia coli. Cytokines TNFα, IL-1β, IL-6, IL-8, MIP-1α, IL-10 concentrations in the culture medium were then measured by specific ELISA. Secretion profile of MMP-9 was evaluated by ELISA and zymogram. Statistical differences were determined by one-way ANOVA followed by the appropriate ad hoc test; P < 0.05 was considered statistically significant. In comparison to the explants incubated with vehicle, the LPS treatment led to a significant increase in the level of all cytokines. In comparison to the explants treated only with LPS, pre-treatment with 0.01-1.0 μM progesterone significantly blunted (73, 56, 56, 75, 25, 48 %) the secretion of TNF-α, IL-1β, IL-6, IL-8, MIP-1α, IL-10, respectively. The MMP-9 induced by LPS treatment was inhibited only with the highest concentration of progesterone. Mifepristone (RU486) blocked the immunosuppressive effect of progesterone. The present results support the concept that progesterone could be part of the compensatory mechanism that limits the inflammation-induced cytotoxic effects associated with an infection process during gestation.

  14. Partial hepatic resistance to IL-6-induced inflammation develops in type 2 diabetic mice, while the anti-inflammatory effect of AMPK is maintained.

    PubMed

    Cansby, Emmelie; Nerstedt, Annika; Amrutkar, Manoj; Durán, Esther Nuñez; Smith, Ulf; Mahlapuu, Margit

    2014-08-05

    Interleukin-6 (IL-6) induces hepatic inflammation and insulin resistance, and therapeutic strategies to counteract the IL-6 action in liver are of high interest. In this study, we demonstrate that acute treatment with AMP-activated protein kinase (AMPK) agonists AICAR and metformin efficiently repressed IL-6-induced hepatic proinflammatory gene expression and activation of STAT3 in a mouse model of diet-induced type 2 diabetes, bringing it back to basal nonstimulated level. Surprisingly, the inflammatory response in liver induced by IL-6 administration in vivo was markedly blunted in the mice fed a high-fat diet, compared to lean chow-fed controls, while this difference was not replicated in vitro in primary hepatocytes derived from these two groups of mice. In summary, our work reveals that partial hepatic IL-6 resistance develops in the mouse model of type 2 diabetes, while the anti-inflammatory action of AMPK is maintained. Systemic factors, rather than differences in intracellular IL-6 receptor signaling, are likely mediating the relative impairment in IL-6 effect. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  15. Ga(III) Nanoparticles Inhibit Growth of both Mycobacterium tuberculosis and HIV and Release of Interleukin-6 (IL-6) and IL-8 in Coinfected Macrophages

    PubMed Central

    Choi, Seoung-ryoung; Britigan, Bradley E.

    2017-01-01

    ABSTRACT Treatment of individuals coinfected with human immunodeficiency virus (HIV) type 1 and Mycobacterium tuberculosis is challenging due to the prolonged treatment requirements, drug toxicity, and emergence of drug resistance. Mononuclear phagocytes (MP; macrophages) are one of the natural reservoirs for both HIV and M. tuberculosis. Here, the treatment of HIV and M. tuberculosis coinfection was studied by preloading human macrophages with MP-targeted gallium (Ga) nanoparticles to limit subsequent simultaneous infection with both HIV and M. tuberculosis. Ga nanoparticles provided sustained drug release for 15 days and significantly inhibited the replication of both HIV and M. tuberculosis. Addition of Ga nanoparticles to MP already infected with M. tuberculosis or HIV resulted in a significant decrease in the magnitude of these infections, but the magnitude was less than that achieved with nanoparticle preloading of the MP. In addition, macrophages that were coinfected with HIV and M. tuberculosis and that were loaded with Ga nanoparticles reduced the levels of interleukin-6 (IL-6) and IL-8 secretion for up to 15 days after drug loading. Ga nanoparticles also reduced the levels of IL-6 and IL-8 secretion by ionomycin- and lipopolysaccharide-induced macrophages, likely by modulating the IκB kinase-β/NF-κB pathway. Delivery of Ga nanoparticles to macrophages is a potent long-acting approach for suppressing HIV and M. tuberculosis coinfection of macrophages in vitro and sets the stage for the development of new approaches to the treatment of these important infections. PMID:28167548

  16. IL-12 and IL-15 induce the expression of CXCR6 and CD49a on peripheral natural killer cells.

    PubMed

    Hydes, Theresa; Noll, Angela; Salinas-Riester, Gabriela; Abuhilal, Mohammed; Armstrong, Thomas; Hamady, Zaed; Primrose, John; Takhar, Arjun; Walter, Lutz; Khakoo, Salim I

    2018-03-01

    Murine hepatic NK cells exhibit adaptive features, with liver-specific adhesion molecules CXCR6 and CD49a acting as surface markers. We investigated human liver-resident CXCR6+ and CD49a+ NK cells using RNA sequencing, flow cytometry, and functional analysis. We further assessed the role of cytokines in generating NK cells with these phenotypes from the peripheral blood. Hepatic CD49a+ NK cells could be induced using cytokines and produce high quantities of IFNγ and TNFα, in contrast to hepatic CXCR6+ NK cells. RNA sequencing of liver-resident CXCR6+ NK cells confirmed a tolerant immature phenotype with reduced expression of markers associated with maturity and cytotoxicity. Liver-resident double-positive CXCR6 + CD49a+ hepatic NK cells are immature but maintain high expression of Th1 cytokines as observed for single-positive CD49a+ NK cells. We show that stimulation with activating cytokines can readily induce upregulation of both CD49a and CXCR6 on NK cells in the peripheral blood. In particular, IL-12 and IL-15 can generate CXCR6 + CD49a+ NK cells in vitro from NK cells isolated from the peripheral blood, with comparable phenotypic and functional features to liver-resident CD49a+ NK cells, including enhanced IFNγ and NKG2C expression. IL-12 and IL-15 may be key for generating NK cells with a tissue-homing phenotype and strong Th1 cytokine profile in the blood, and links peripheral activation of NK cells with tissue-homing. These findings may have important therapeutic implications for immunotherapy of chronic liver disease. © 2017 The Authors. Immunity, Inflammation and Disease Published by John Wiley & Sons Ltd.

  17. The IL-6 receptor super-antagonist Sant7 enhances antiproliferative and apoptotic effects induced by dexamethasone and zoledronic acid on multiple myeloma cells.

    PubMed

    Tassone, Pierfrancesco; Galea, Eulalia; Forciniti, Samantha; Tagliaferri, Pierosandro; Venuta, Salvatore

    2002-10-01

    Interleukin-6 (IL-6) is the major growth and survival factor for multiple myeloma (MM), and has been shown to protect MM cells from apoptosis induced by a variety of agents. IL-6 receptor antagonists, which prevent the assembly of functional IL-6 receptor complexes, inhibit cell proliferation and induce apoptosis in MM cells. We have investigated whether the IL-6 receptor super-antagonist Sant7 might enhance the antiproliferative and apoptotic effects induced by the combination of dexamethasone (Dex) and zoledronic acid (Zln) on human MM cell lines and primary cells from MM patients. Here we show that each of these compounds individually induced detectable antiproliferative effects on MM cells. Sant7 significantly enhanced growth inhibition and apoptosis induced by Dex and Zln on both MM cell lines and primary MM cells. These results indicate that overcoming IL-6 mediated cell resistance by Sant7 potentiates the effect of glucocorticoides and bisphosphonates on MM cell growth and survival, providing a rationale for therapies including IL-6 antagonists in MM.

  18. Dependence of IL-4, IL-13, and nematode-induced alterations in murine small intestinal smooth muscle contractility on Stat6 and enteric nerves.

    PubMed

    Zhao, Aiping; McDermott, Joseph; Urban, Joseph F; Gause, William; Madden, Kathleen B; Yeung, Karla Au; Morris, Suzanne C; Finkelman, Fred D; Shea-Donohue, Terez

    2003-07-15

    IL-4 and IL-13 promote gastrointestinal worm expulsion in part through effects on nonlymphoid cells, such as intestinal smooth muscle cells. The roles of Stat6 in IL-4-, IL-13-, and parasitic nematode-induced effects on small intestinal smooth muscle contractility were investigated in BALB/c wild-type and Stat6-deficient mice treated with a long-lasting formulation of recombinant mouse IL-4 (IL-4C) or IL-13 for 7 days. Separate groups of BALB/c mice were infected with Nippostrongylus brasiliensis or were drug-cured of an initial Heligmosomoides polygyrus infection and later reinfected. Infected mice were studied 9 and 12 days after inoculation, respectively. Segments of jejunum were suspended in an organ bath, and responses to nerve stimulation and to acetylcholine and substance P in the presence and absence of tetradotoxin, a neurotoxin, were determined. Both IL-4 and IL-13 increased smooth muscle responses to nerve stimulation in wild-type mice, but the effects were greater in IL-13-treated mice and were absent in IL-13-treated Stat6-deficient mice. Similarly, hypercontractile responses to nerve stimulation in H. polygyrus- and N. brasiliensis-infected mice were dependent in part on Stat6. IL-13, H. polygyrus, and N. brasiliensis, but not IL-4, also increased contractility to acetylcholine by mechanisms that involved Stat6 and enteric nerves. These studies demonstrate that both IL-4 and IL-13 promote intestinal smooth muscle contractility, but by different mechanisms. Differences in these effects correlate with differences in the relative importance of these cytokines in the expulsion of enteric nematode parasites.

  19. Enhanced early innate and T cell-mediated responses in subjects immunized with Anthrax Vaccine Adsorbed Plus CPG 7909 (AV7909).

    PubMed

    Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W

    2014-11-28

    NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors

  20. Differential signaling mechanism for HIV-1 Nef-mediated production of IL-6 and IL-8 in human astrocytes.

    PubMed

    Liu, Xun; Kumar, Anil

    2015-06-15

    Variety of HIV-1 viral proteins including HIV-1 Nef are known to activate astrocytes and microglia in the brain and cause the release of pro-inflammatory cytokines, which is thought to be one of the mechanisms leading to HIV-1- mediated neurotoxicity. IL-6 and IL-8 have been found in the CSF of patients with HIV-1 associated dementia (HAD), suggesting that they might play important roles in HIV-1 neuropathology. In the present study we examined the effects of HIV-1 Nef on IL-6 and IL-8 induction in astrocytes. The results demonstrate that both IL-6 and IL-8 are significantly induced in HIV-1 Nef-transfected SVGA astrocytes and HIV-1 Nef-treated primary fetal astrocytes. We also determined the molecular mechanisms responsible for the HIV-1 Nef-induced increased IL-6 and IL-8 by using chemical inhibitors and siRNAs against PI3K/Akt/PKC, p38 MAPK, NF-κB, CEBP and AP-1. Our results clearly demonstrate that the PI3K/PKC, p38 MAPK, NF-κB and AP-1 pathways are involved in HIV-1 Nef-induced IL-6 production in astrocytes, while PI3K/PKC and NF-κB pathways are involved in HIV-1 Nef-induced IL-8 production. These results offer new potential targets to develop therapeutic strategy for treatment of HIV-1 associated neurological disorders, prevalent in > 40% of individuals infected with HIV-1.

  1. TLR9 Ligands Induce S100A8 in Macrophages via a STAT3-Dependent Pathway which Requires IL-10 and PGE2

    PubMed Central

    Hsu, Kenneth; Chung, Yuen Ming; Endoh, Yasumi; Geczy, Carolyn L.

    2014-01-01

    S100A8 and S100A9 are highly-expressed calcium-binding proteins in neutrophils and monocytes, and in subsets of macrophages in inflammatory lesions. Unmethylated CpG motifs found in bacterial and viral DNA are potent activators of innate immunity via Toll-like receptor 9 (TLR9). S100A8, but not S100A9, mRNA and protein was directly induced by CpG-DNA in murine and human macrophages. Induction in murine macrophages peaked at 16 h. CpG-DNA-induced S100A8 required de novo protein synthesis; IL-10 and Prostaglandin E2 (PGE2) synergistically enhanced expression and promoted earlier gene induction. Inhibitors of endogenous IL-10, PGE2, and the E prostanoid (EP) 4 receptor strongly suppressed S100A8 expression, particularly when combined. Thus, S100A8 induction by E. coli DNA required both IL-10 and PGE2/EP4 signaling. The MAPKs, PI3K and JAK pathways were essential, whereas ERK1/2 appeared to play a direct role. S100A8 induction by CpG-DNA was controlled at the transcriptional level. The promoter region responsible for activation, either directly, or indirectly via IL-10 and PGE2, was located within a −178 to −34-bp region and required STAT3 binding. Because of the robust links connecting IL-10 and PGE2 with an anti-inflammatory macrophage phenotype, the induction profile of S100A8 strongly indicates a role for this protein in resolution of inflammation. PMID:25098409

  2. TLR9 ligands induce S100A8 in macrophages via a STAT3-dependent pathway which requires IL-10 and PGE2.

    PubMed

    Hsu, Kenneth; Chung, Yuen Ming; Endoh, Yasumi; Geczy, Carolyn L

    2014-01-01

    S100A8 and S100A9 are highly-expressed calcium-binding proteins in neutrophils and monocytes, and in subsets of macrophages in inflammatory lesions. Unmethylated CpG motifs found in bacterial and viral DNA are potent activators of innate immunity via Toll-like receptor 9 (TLR9). S100A8, but not S100A9, mRNA and protein was directly induced by CpG-DNA in murine and human macrophages. Induction in murine macrophages peaked at 16 h. CpG-DNA-induced S100A8 required de novo protein synthesis; IL-10 and Prostaglandin E2 (PGE2) synergistically enhanced expression and promoted earlier gene induction. Inhibitors of endogenous IL-10, PGE2, and the E prostanoid (EP) 4 receptor strongly suppressed S100A8 expression, particularly when combined. Thus, S100A8 induction by E. coli DNA required both IL-10 and PGE2/EP4 signaling. The MAPKs, PI3K and JAK pathways were essential, whereas ERK1/2 appeared to play a direct role. S100A8 induction by CpG-DNA was controlled at the transcriptional level. The promoter region responsible for activation, either directly, or indirectly via IL-10 and PGE2, was located within a -178 to -34-bp region and required STAT3 binding. Because of the robust links connecting IL-10 and PGE2 with an anti-inflammatory macrophage phenotype, the induction profile of S100A8 strongly indicates a role for this protein in resolution of inflammation.

  3. [Brd3 promotes IL-6 production via enhancing acetylase CBP recruitment and histone 3 acetylation within IL6 promoter].

    PubMed

    Ren, Wenhui; Sun, Donghao; Wang, Chunmei; Li, Nan

    2016-10-01

    Objective To investigate the role of bromodomain containing 3 (Brd3) in LPS-triggered interleukin-6 (IL-6) production in macrophages and the underlying mechanism. Methods CRISPR-Cas9 technology was used to screen an RAW264.7 cell line with Brd3 knockout (Brd3 -/- ). The Brd3 -/- cells were used as an experimental group, and the parential cells expressing wide-type Brd3 as a control group. The IL-6 level in cell culture supernatant was detected by ELISA after 100 ng/mL LPS challenging. Effect of Brd3 knockout on the expression and activation of signal pathways involved in IL-6 expression, including the NF-κB and mitogen-activated protein kinase (MAPK) pathways were examined by Western blot analysis. Chromatin immunoprecipitation (ChIP) assay was used to evaluate the recruitment of acetylase CREB-binding protein (CBP) to IL6 gene promoter and the acetylation level of histone 3 within IL6 gene promoter. Results LPS treatment significantly downregulated Brd3 expression in mouse peritoneal macrophages. LPS-induced production of IL-6 was significantly inhibited in Brd3 -/- macrophages. The expressions and activation of signal molecules within NF-κB and MAPK pathways were barely affected. Brd3 knockout significantly decreased the recruitment of acetylase CBP to IL6 gene promoter, and the acetylation level of histone3 within IL6 gene promoter was also repressed. Conclusion Brd3 promotes LPS-triggered IL-6 production via promoting the recruitment of CBP to IL6 promoter and enhancing the acetylation level of histone 3 within IL6 promoter.

  4. The function of the soluble interleukin 6 (IL-6) receptor in vivo: sensitization of human soluble IL-6 receptor transgenic mice towards IL- 6 and prolongation of the plasma half-life of IL-6

    PubMed Central

    1996-01-01

    Interleukin 6 (IL-6) is considered an important mediator of acute inflammatory responses. Moreover, IL-6 functions as a differentiation and growth factor of hematopoietic precursor cells, B cells, T cells, keratinocytes, neuronal cells, osteoclasts, and endothelial cells. IL-6 exhibits its action via a receptor complex consisting of a specific IL- 6 receptor (IL-6R) and a signal transducing subunit (gp130). Soluble forms of both receptor components are generated by shedding and are found in patients with various diseases such as acquired immune deficiency syndrome, rheumatoid arthritis, and others. The function of the soluble (s)IL-6R in vivo is unknown. Since human (h)IL-6 acts on human and murine target cells, but murine IL-6 on murine cells only, we constructed transgenic mice expressing the hsIL-6R. We report here that in the presence of hsIL-6R, mice are hypersensitized towards hIL-6, mounting an acute phase protein gene induction at significantly lower IL-6 dosages compared to control animals. Furthermore, in hsIL-6R transgenic mice, the detected acute phase response persists for a longer period of time. The IL-6/IL-6R complex prolongs markedly the Il- 6 plasma half-life. Our results reinforce the role of the hsIL-6R as an agonistic protein, help to understand the function of the hsIL-6R in vivo, and highlight the significance of the receptor in the induction of the acute phase response. PMID:8666898

  5. pcDNA-IL-12 vaccination blocks eosinophilic inflammation but not airway hyperresponsiveness following murine Toxocara canis infection.

    PubMed

    Malheiro, Adriana; Aníbal, Fernanda F; Martins-Filho, Olindo Assis; Teixeira-Carvalho, Andréa; Perini, Adenir; Martins, Milton A; Medeiros, Alexandra I; Turato, Walter M; Acencio, Milene P M; Brandão, Izaíra T; Nomizo, Auro; Silva, Célio L; Faccioli, Lúcia H

    2008-01-17

    We have investigated the effect of pcDNA3-CpG and pcDNA-IL-12, delivered by intradermal gene gun administration, on the blood/lung eosinophilia, airway hyperresponsiveness as well as the immune response in a murine model of toxocariasis. Our results demonstrated that pcDNA-IL-12 but not pcDNA3-CpG vaccination led to a persistent lower blood/bronchoalveolar eosinophilia following Toxocara canis infection, as pcDNA3-CpG led only to an early transient blockage of eosinophil transmigration into bronchoalveolar fluid following T. canis infection. Prominent Type-1 immune response was pointed out as the hallmark of T. canis infection following pcDNA-IL-12 vaccination. Outstanding IFN-gamma/IL-4 ratio besides low levels of IgG1 with subsequent high IgG2a/IgG1 ratio further characterized a Type-1 polarized immunological profile in pcDNA-IL-12-vaccinated animals. Nevertheless, only pcDNA3-CpG was able to prevent airway hyperresponsiveness induced by T. canis infection. The persistent airway hyperresponsiveness observed in pcDNA-IL-12-vaccinated animals demonstrated that the airway constriction involved other immunological mediator than those blocked by pcDNA-IL-12. Together, these data indicated that pcDNA-IL-12 and pcDNA3-CpG vaccines have distinct therapeutic benefits regarding the eosinophilic inflammation/airway hyperresponsiveness triggered by T. canis infection, suggesting their possible use in further combined therapeutic interventions.

  6. Curcumin protects against collagen-induced arthritis via suppression of BAFF production.

    PubMed

    Huang, Gang; Xu, Zhizhen; Huang, Yan; Duan, Xiaojun; Gong, Wei; Zhang, Yan; Fan, Jishan; He, Fengtian

    2013-04-01

    The aim of the present study was to evaluate whether the anti-Rheumatoid arthritis (RA) effect of curcumin is associated with the regulation of B cell-activating factor belonging to the TNF family (BAFF) production. Collagen-induced arthritis (CIA) was induced in DBA/1 J mice by immunization with bovine type II collagen. To investigate the anti-arthritic effect of curcumin in the CIA model, mice were injected intraperitoneally with curcumin (50 mg/kg) on every other day either from day 1 or from day 28 after the first immunization. The clinical severity of arthritis was monitored. BAFF, interleukin-6 (IL-6) and interferon-γ (IFNγ) production in serum were measured. Furthermore, the effect of curcumin on IFNγ-induced BAFF expression and transcriptional activation in B lymphocytes was determined by qPCR, Western Blot, and luciferase assay. Finally, IFNγ related signal transducers and activators of transcription 1 (STAT1) signaling in B lymphocytes were studied using Western Blot. Curcumin dramatically attenuated the progression and severity of CIA in DBA/1 J mice, accompanied with decrease of BAFF production in serum and spleen cells as well as decrease of serum IFNγ and IL-6. Treatment of B lymphocytes with curcumin suppressed IFNγ-induced BAFF expression, STAT1 phosphorylation and nuclear translocation, suggesting that curcumin may repress IFNγ-induced BAFF expression via negatively interfering with STAT1 signaling. The results of the present study suggest that suppression of BAFF production may be a novel mechanism by which curcumin improves RA.

  7. Comprehensive analysis of CpG islands in human chromosomes 21 and 22

    NASA Astrophysics Data System (ADS)

    Takai, Daiya; Jones, Peter A.

    2002-03-01

    CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.

  8. The PPARdelta agonist GW501516 suppresses interleukin-6-mediated hepatocyte acute phase reaction via STAT3 inhibition.

    PubMed

    Kino, T; Rice, K C; Chrousos, G P

    2007-05-01

    Interleukin-6 and downstream liver effectors acute phase reactants are implicated in the systemic inflammatory reaction. Peroxisome proliferator-activated receptor delta (PPARdelta), which binds to and is activated by a variety of fatty acids, was recently shown to have anti-inflammatory actions. We examined the ability of the synthetic PPARdelta agonist GW501516 to suppress interleukin-6-induced expression of acute phase proteins in human hepatoma HepG2 cells and rat primary hepatocytes. Results GW501516 dose-dependently suppressed interleukin-6-induced mRNA expression of the acute phase protein alpha1-antichymotrypsin in HepG2 cells. The compound also suppressed interleukin-6-induced mRNA expression of alpha2-acid glycoprotein, beta-fibrinogen and alpha2-macroglobulin in and the secretion of C-reactive protein by rat primary hepatocytes. Depletion of the PPARdelta receptor, but not of PPARalpha or gamma, attenuated the suppressive effect of GW501516 on interleukin-6-induced alpha1-antichymotrypsin mRNA expression, indicating that PPARdelta specifically mediated this effect. Since interleukin-6 stimulates the transcriptional activity of the alpha1-antichymotrypsin promoter by activating the signal transducer and activator of transcription (STAT) 3, we examined functional interaction of this transcription factor and PPARdelta on this promoter. Overexpression of PPARdelta enhanced the suppressive effect of GW501516 on STAT3-activated transcriptional activity of the alpha1-antichymotrypsin promoter, while GW501516 suppressed interleukin-6-induced binding of this transcription factor to this promoter. These findings indicate that agonist-activated PPARdelta interferes with interleukin-6-induced acute phase reaction in the liver by inhibiting the transcriptional activity of STAT3. PPARdelta agonists might be useful for the suppression of systemic inflammatory reactions in which IL-6 plays a central role.

  9. Histone deacetylase inhibitors restore IL-10 expression in lipopolysaccharide-induced cell inflammation and reduce IL-1β and IL-6 production in breast silicone implant in C57BL/6J wild-type murine model.

    PubMed

    Di Liddo, Rosa; Valente, Sergio; Taurone, Samanta; Zwergel, Clemens; Marrocco, Biagina; Turchetta, Rosaria; Conconi, Maria Teresa; Scarpa, Carlotta; Bertalot, Thomas; Schrenk, Sandra; Mai, Antonello; Artico, Marco

    2016-01-20

    Among epigenetic enzymes, histone deacetylases (HDACs) are responsible for regulating the expression of an extensive array of genes by reversible deacetylation of nuclear histones as well as a large number of non-histone proteins. Initially proposed for cancer therapy, recently the interest for HDAC inhibitors (HDACi) as orally active, safe, and anti-inflammatory agents is rising due to their ability in reducing the severity of inflammatory and autoimmune diseases. In particular, selective HDAC3, HDAC6, and HDAC8 inhibitors have been described to downregulate the expression of pro-inflammatory cytokines (TNF-α, TGF-β, IL-1β, and IL-6). Herein, using KB31, C2C12, and 3T3-J2 cell lines, we demonstrated that, under lipopolysaccharide-induced in vitro inflammation, HDAC3/6/8 inhibitor MC2625 and HDAC6-selective inhibitor MC2780 were effective at a concentration of 30 ng/mL to downregulate mRNA expression of pro-inflammatory cytokines (IL-1β and IL-6) and to promote the transcription of IL-10 gene, without affecting the cell viability. Afterwards, we investigated by immunohistochemistry the activity of MC2625 and MC2780 at a concentration of 60 ng/kg animal weight to regulate silicone-triggered immune response in C57BL/6J female mice. Our findings evidenced the ability of such inhibitors to reduce host inflammation in silicone implants promoting a thickness reduction of peri-implant fibrous capsule, upregulating IL-10 expression, and reducing the production of both IL-1β and IL-6. These results underline the potential application of MC2625 and MC2780 in inflammation-related diseases.

  10. Hypoxia-induced IL-32β increases glycolysis in breast cancer cells.

    PubMed

    Park, Jeong Su; Lee, Sunyi; Jeong, Ae Lee; Han, Sora; Ka, Hye In; Lim, Jong-Seok; Lee, Myung Sok; Yoon, Do-Young; Lee, Jeong-Hyung; Yang, Young

    2015-01-28

    IL-32β is highly expressed and increases the migration and invasion of gastric, lung, and breast cancer cells. Since IL-32 enhances VEGF production under hypoxic conditions, whether IL-32β is regulated by hypoxia was examined. Hypoxic conditions and a mimetic chemical CoCl2 enhanced IL-32β production. When cells were treated with various inhibitors of ROS generation to prevent hypoxia-induced ROS function, IL-32β production was suppressed by both NADPH oxidase and mitochondrial ROS inhibitors. IL-32β translocated to the mitochondria under hypoxic conditions, where it was associated with mitochondrial biogenesis. Thus, whether hypoxia-induced IL-32β is associated with oxidative phosphorylation (OXPHOS) or glycolysis was examined. Glycolysis under aerobic and anaerobic conditions is impaired in IL-32β-depleted cells, and the hypoxia-induced IL-32β increased glycolysis through activation of lactate dehydrogenase. Src is also known to increase lactate dehydrogenase activity, and the hypoxia-induced IL-32β was found to stimulate Src activation by inhibiting the dephosphorylation of Src. These findings revealed that a hypoxia-ROS-IL-32β-Src-glycolysis pathway is associated with the regulation of cancer cell metabolism. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  11. Counterbalancing of TH2-driven allergic airway inflammation by IL-12 does not require IL-10.

    PubMed

    Tournoy, K G; Kips, J C; Pauwels, R A

    2001-03-01

    Asthma is characterized by allergen-induced airway inflammation orchestrated by TH2 cells. The TH1-promoting cytokine IL-12 is capable of inhibiting the TH2-driven allergen-induced airway changes in mice and is therefore regarded as an interesting strategy for treating asthma. The antiallergic effects of IL-12 are only partially dependent of IFN-gamma. Because IL-12 is a potent inducer of the anti-inflammatory cytokine IL-10, the aim of the present study was to investigate in vivo whether the antiallergic effects of IL-12 are mediated through IL-10. C57BL/6J-IL-10 knock-out (IL-10(-/-)) mice were sensitized intraperitoneally to ovalbumin (OVA) and subsequently exposed from day 14 to day 21 to aerosolized OVA (1%). IL-12 was administered intraperitoneally during sensitization, subsequent OVA exposure, or both. IL-12 inhibited the OVA-induced airway eosinophilia, despite the absence of IL-10. Moreover, a shift from a TH2 inflammatory pattern toward a TH1 reaction was observed, with concomitant pronounced mononuclear peribronchial inflammation after IL-12 treatment. Allergen-specific IgE synthesis was completely suppressed only when IL-12 was administered along with the allergen sensitization. Furthermore, treating the animals with IL-12 at the time of the secondary allergen challenge resulted not only in a significant suppression of the airway responsiveness but also in an important IFN-gamma-associated toxicity. These results indicate that IL-12 is able to inhibit allergen-induced airway changes, even in the absence of IL-10. In addition, our results raise concerns regarding the redirection of TH2 inflammation by TH1-inducing therapies because treatment with IL-12 resulted not only in a disappearance of the TH2 inflammation but also in a TH1-driven inflammatory pulmonary pathology.

  12. Vitiligo inducing phenols activate the unfolded protein response in melanocytes resulting in upregulation of IL6 and IL8

    PubMed Central

    Toosi, Siavash; Orlow, Seth J.; Manga, Prashiela

    2012-01-01

    Vitiligo is characterized by depigmented skin patches due to loss of epidermal melanocytes. Oxidative stress may play a role in vitiligo onset, while autoimmunity contributes to disease progression. In this study we sought to identify mechanisms that link disease triggers and spreading of lesions. A hallmark of melanocytes at the periphery of vitiligo lesions is dilation of the endoplasmic reticulum (ER). We hypothesized that oxidative stress results in redox disruptions that extend to the ER, causing accumulation of misfolded peptides, which activates the unfolded protein response (UPR). We used 4-tertiary butyl phenol (4-TBP) and monobenzyl ether of hydroquinone (MBEH), known triggers of vitiligo. We show that expression of key UPR components, including the transcription factor X-box binding protein 1 (XBP1), are increased following exposure of melanocytes to phenols. XBP1 activation increases production of immune mediators interleukin-6 (IL6) and IL8. Co-treatment with XBP1 inhibitors reduced IL6 and IL8 production induced by phenols, while over-expression of XBP1 alone increased their expression. Thus, melanocytes themselves produce cytokines associated with activation of an immune response following exposure to chemical triggers of vitiligo. These results expand our understanding of the mechanisms underlying melanocyte loss in vitiligo and pathways linking environmental stressors and autoimmunity. PMID:22696056

  13. Acute myotube protein synthesis regulation by IL-6-related cytokines.

    PubMed

    Gao, Song; Durstine, J Larry; Koh, Ho-Jin; Carver, Wayne E; Frizzell, Norma; Carson, James A

    2017-11-01

    IL-6 and leukemia inhibitory factor (LIF), members of the IL-6 family of cytokines, play recognized paradoxical roles in skeletal muscle mass regulation, being associated with both growth and atrophy. Overload or muscle contractions can induce a transient increase in muscle IL-6 and LIF expression, which has a regulatory role in muscle hypertrophy. However, the cellular mechanisms involved in this regulation have not been completely identified. The induction of mammalian target of rapamycin complex 1 (mTORC1)-dependent myofiber protein synthesis is an established regulator of muscle hypertrophy, but the involvement of the IL-6 family of cytokines in this process is poorly understood. Therefore, we investigated the acute effects of IL-6 and LIF administration on mTORC1 signaling and protein synthesis in C2C12 myotubes. The role of glycoprotein 130 (gp130) receptor and downstream signaling pathways, including phosphoinositide 3-kinase (PI3K)-Akt-mTORC1 and signal transducer and activator of transcription 3 (STAT3)-suppressor of cytokine signaling 3 (SOCS3), was investigated by administration of specific siRNA or pharmaceutical inhibitors. Acute administration of IL-6 and LIF induced protein synthesis, which was accompanied by STAT3 activation, Akt-mTORC1 activation, and increased SOCS3 expression. This induction of protein synthesis was blocked by both gp130 siRNA knockdown and Akt inhibition. Interestingly, STAT3 inhibition or Akt downstream mTORC1 signaling inhibition did not fully block the IL-6 or LIF induction of protein synthesis. SOCS3 siRNA knockdown increased basal protein synthesis and extended the duration of the protein synthesis induction by IL-6 and LIF. These results demonstrate that either IL-6 or LIF can activate gp130-Akt signaling axis, which induces protein synthesis via mTORC1-independent mechanisms in cultured myotubes. However, IL-6- or LIF-induced SOCS3 negatively regulates the activation of myotube protein synthesis. Copyright © 2017 the

  14. Mechanisms of permanent loss of olfactory receptor neurons induced by the herbicide 2,6-dichlorobenzonitrile: Effects on stem cells and noninvolvement of acute induction of the inflammatory cytokine IL-6

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xie, Fang; Fang, Cheng; School of Public Health, State University of New York at Albany, NY 12201

    We explored the mechanisms underlying the differential effects of two olfactory toxicants, the herbicide 2,6-dichlorobenzonitrile (DCBN) and the anti-thyroid drug methimazole (MMZ), on olfactory receptor neuron (ORN) regeneration in mouse olfactory epithelium (OE). DCBN, but not MMZ, induced inflammation-like pathological changes in OE, and DCBN increased interleukin IL-6 levels in nasal-wash fluid to much greater magnitude and duration than did MMZ. At 24 h after DCBN injection, the population of horizontal basal cells (HBCs; reserve, normally quiescent OE stem cells) lining the DMM became severely depleted as some of them detached from the basal lamina, and sloughed into the nasalmore » cavity along with the globose basal cells (GBCs; heterogeneous population of stem and progenitor cells), neurons, and sustentacular cells of the neuroepithelium. In contrast, the layer of HBCs remained intact in MMZ-treated mice, as only the mature elements of the neuroepithelium were shed. Despite the respiratory metaplasia accompanying the greater severity of the DCBN lesion, residual HBCs that survived intoxication were activated by the injury and contributed to the metaplastic respiratory epithelium, as shown by tracing their descendants in a K5CreEr{sup T2}::fl(stop)TdTomato strain of mice in which recombination causes HBCs to express TdTomato in advance of the lesion. But, contrary to published observations with MMZ, the HBCs failed to form ORNs. A role for IL-6 in suppressing ORN regeneration in DCBN-treated mice was rejected by the failure of the anti-inflammatory drug dexamethasone to prevent the subsequent respiratory metaplasia in the DMM, suggesting that other factors lead to HBC neuro-incompetence. - Highlights: • The herbicide dichlobenil (DCBN) can damage olfactory epithelium stem cells. • Another olfactory toxicant, methimazole, leaves the olfactory stem cells intact. • DCBN, but not methimazole, induces a prolonged increase in nasal IL-6 levels.

  15. Cyr61 induces IL-6 production by fibroblast-like synoviocytes promoting Th17 differentiation in rheumatoid arthritis.

    PubMed

    Lin, Jinpiao; Zhou, Zhou; Huo, Rongfen; Xiao, Lianbo; Ouyang, Guilin; Wang, Li; Sun, Yue; Shen, Baihua; Li, Dangsheng; Li, Ningli

    2012-06-01

    Cysteine-rich protein 61 (Cyr61)/CCN1 is a product of an immediate early gene and functions in mediating cell adhesion and inducing cell migration. We previously showed that increased production of Cyr61 by fibroblast-like synoviocytes (FLS) in rheumatoid arthritis (RA) promotes FLS proliferation and participates in RA pathogenesis with the IL-17-dependent pathway. However, whether Cyr61 in turn regulates Th17 cell differentiation and further enhances inflammation of RA remained unknown. In the current study, we explored the potential role of Cyr61 as a proinflammatory factor in RA pathogenesis. We found that Cyr61 treatment dramatically induced IL-6 production in FLS isolated from RA patients. Moreover, IL-6 production was attenuated by Cyr61 knockdown in FLS. Mechanistically, we showed that Cyr61 activated IL-6 production via the αvβ5/Akt/NF-κB signaling pathway. Further, using a coculture system consisting of purified CD4(+) T cells and RA FLS, we found that RA FLS stimulated Th17 differentiation, and the pro-Th17 differentiation effect of RA FLS can be attenuated or stimulated by Cyr61 RNA interference or addition of exogenous Cyr61, respectively. Finally, using the collagen-induced arthritis animal model, we showed that treatment with the anti-Cyr61 mAb led to reduction of IL-6 levels, decrease of Th17 response, and attenuation of inflammation and disease progression in vivo. Taken together, our results reveal a novel role of Cyr61 in promoting Th17 development in RA via upregulation of IL-6 production by FLS, thus adding a new layer into the functional interplay between FLS and Th17 in RA pathogenesis. Our study also suggests that targeting of Cyr61 may represent a novel strategy in RA treatment.

  16. Gpr110 deficiency decelerates carcinogen-induced hepatocarcinogenesis via activation of the IL-6/STAT3 pathway

    PubMed Central

    Ma, Benting; Zhu, Junjie; Tan, Juan; Mao, Yulei; Tang, Lingyun; Shen, Chunling; Zhang, Hongxing; Kuang, Ying; Fei, Jian; Yang, Xiao; Wang, Zhugang

    2017-01-01

    Hepatocarcinogenesis is a complex process that includes pronounced necroinflammation, unregulated hepatocyte damage, subsequent extensive fibrosis, and carcinogenesis. GPR110 was an adhesion G protein-coupled receptor. Analysis of the expression pattern of Gpr110 in mice displayed that Gpr110 was expressed highly in liver, implicating the tissue compartments where Gpr110 could execute its functions, the role of Gpr110 in the physiological and pathological state of liver remains unclear. Based on a Gpr110 knockout mouse model, we evaluated the role of Gpr110 in hepatocarcinogenesis by using a carbon tetrachloride (CCl4)-induced liver injury and fibrosis model, as well as diethylnitrosamine (DEN) plus CCl4-induced liver cancer model. In this study, we found subdued chronic liver injury, reduced compensatory proliferation, lower liver fibrosis, but enhanced inflammation occurred in Gpr110-/- mice during CCl4 challenge. In addition, Gpr110-/- mice were resistant to liver tumorigenesis induced by DEN plus CCl4 injection. Molecular mechanisms underlying these differences correlated with augmented activation of the IL-6/STAT3 pathway, which exerted hepatoprotective effects during liver damage, fibrosis, and oncogenesis in Gpr110-/- mice. Furthermore, pharmacological inhibition of the activation of the IL-6/STAT3 pathway enhanced hepatic fibrosis and promoted DEN plus CCl4-induced carcinogenesis in Gpr110-/- mice. In summary, absence of Gpr110 decelerates liver fibrosis/cirrhosis progressing into tumorigenesis, due to strengthening activation of the IL-6/STAT3 pathway, leading to a weaker liver injury and fibrosis microenvironment. It is indicated that targeting Gpr110 and activating the IL-6/STAT3 pathway may be considered to be preventive methods for some cirrhosis transition. PMID:28401002

  17. ROCK activity affects IL-1-induced signaling possibly through MKK4 and p38 MAPK in Caco-2 cells.

    PubMed

    Banerjee, Sayantan; McGee, Dennis W

    2016-09-01

    Elevated levels of interleukin-1 (IL-1) accompany inflammatory bowel disease. IL-1-stimulated intestinal epithelial cells can secrete potent chemokines like CXCL8 to exacerbate inflammation. Previously, we found that inhibiting the Rho-associated kinase (ROCK) could inhibit IL-1- or TNF-α-induced CXCL8 secretion by the Caco-2 colonic epithelial cell line. This ROCK inhibition did not affect IκBα phosphorylation and degradation, but suppressed the phosphorylation of c-Jun N-terminal kinase (JNK). Therefore, ROCK must play an important role in epithelial cell CXCL8 responses through an effect on the JNK signaling pathway. Here, we extend these studies by showing that inhibiting ROCK suppressed the IL-1-induced phosphorylation of MKK4, a known activator of JNK, but not MKK7. Yet, ROCK inhibition had no significant effect on the IL-1-induced phosphorylation of extracellular-signal-regulated kinase (ERK) 1/2. Inhibiting ROCK also suppressed the phosphorylation of p38 MAPK after IL-1 stimulation, but this inhibition had no significant effect on the stability of CXCL8 messenger RNA (mRNA) after IL-1 stimulation. These results suggest that ROCK may be important in IL-1-induced signaling through MKK4 to JNK and the activation of p38 MAPK. Finally, inhibiting ROCK in IL-1 and TNF-α co-stimulated Caco-2 cells also resulted in a significant suppression of CXCL8 secretion and mRNA levels suggesting that inhibiting ROCK may be a mechanism to inhibit the overall response of epithelial cells to both cytokines. These studies indicate a novel signaling event, which could provide a target for suppressing intestinal epithelial cells (IEC) chemokine responses involved in mucosal inflammation.

  18. Daphnetin reduces endotoxin lethality in mice and decreases LPS-induced inflammation in Raw264.7 cells via suppressing JAK/STATs activation and ROS production.

    PubMed

    Shen, Lei; Zhou, Ting; Wang, Jing; Sang, Xiumei; Lan, Lei; Luo, Lan; Yin, Zhimin

    2017-07-01

    Here, we used various approaches to investigate the suppressive role of daphnetin in LPS-induced inflammatory response, with the goal to understand the underlining molecular mechanism by which daphnetin regulated these processes. We examined the survival rate and the lung injury in the mice model of LPS-induced endotoxemia. The production of pro-inflammatory factors including tumor necrosis factor α (TNF-α), interleukin-1β (IL-1β), IL-6, nitric oxide (NO), and prostaglandin E2 (PGE2) was measured by ELISA and nitrite analysis, respectively. The expression of inducible NO synthase (iNOS), cyclooxygenase 2 (COX-2), and the activation of signaling molecules was determined by immunoblotting. The production of reactive oxygen species (ROS) was measured by the ROS assay. In vivo study showed that daphnetin enhanced the survival rate and reduced the lung injury in mice with LPS-induced endotoxemia. Both in vivo and in vitro study showed that daphnetin prevented the production of pro-inflammatory factors including TNF-α, IL-1β, IL-6, NO, and PGE2 after LPS challenge. In Raw264.7 cells, we found that daphnetin reduced LPS-induced expression of iNOS and COX-2, and suppressed LPS-induced ROS production. In addition, we found that daphnetin suppressed the activation of JAK/STATs pathway and inhibited the nucleus import of STAT1 and STAT3. Here, our results indicate that daphnetin shows anti-inflammatory properties, at least in part, through suppressing LPS-induced activation of JAK/STATs cascades and ROS production.

  19. Model Based Targeting of IL-6-Induced Inflammatory Responses in Cultured Primary Hepatocytes to Improve Application of the JAK Inhibitor Ruxolitinib.

    PubMed

    Sobotta, Svantje; Raue, Andreas; Huang, Xiaoyun; Vanlier, Joep; Jünger, Anja; Bohl, Sebastian; Albrecht, Ute; Hahnel, Maximilian J; Wolf, Stephanie; Mueller, Nikola S; D'Alessandro, Lorenza A; Mueller-Bohl, Stephanie; Boehm, Martin E; Lucarelli, Philippe; Bonefas, Sandra; Damm, Georg; Seehofer, Daniel; Lehmann, Wolf D; Rose-John, Stefan; van der Hoeven, Frank; Gretz, Norbert; Theis, Fabian J; Ehlting, Christian; Bode, Johannes G; Timmer, Jens; Schilling, Marcel; Klingmüller, Ursula

    2017-01-01

    IL-6 is a central mediator of the immediate induction of hepatic acute phase proteins (APP) in the liver during infection and after injury, but increased IL-6 activity has been associated with multiple pathological conditions. In hepatocytes, IL-6 activates JAK1-STAT3 signaling that induces the negative feedback regulator SOCS3 and expression of APPs. While different inhibitors of IL-6-induced JAK1-STAT3-signaling have been developed, understanding their precise impact on signaling dynamics requires a systems biology approach. Here we present a mathematical model of IL-6-induced JAK1-STAT3 signaling that quantitatively links physiological IL-6 concentrations to the dynamics of IL-6-induced signal transduction and expression of target genes in hepatocytes. The mathematical model consists of coupled ordinary differential equations (ODE) and the model parameters were estimated by a maximum likelihood approach, whereas identifiability of the dynamic model parameters was ensured by the Profile Likelihood. Using model simulations coupled with experimental validation we could optimize the long-term impact of the JAK-inhibitor Ruxolitinib, a therapeutic compound that is quickly metabolized. Model-predicted doses and timing of treatments helps to improve the reduction of inflammatory APP gene expression in primary mouse hepatocytes close to levels observed during regenerative conditions. The concept of improved efficacy of the inhibitor through multiple treatments at optimized time intervals was confirmed in primary human hepatocytes. Thus, combining quantitative data generation with mathematical modeling suggests that repetitive treatment with Ruxolitinib is required to effectively target excessive inflammatory responses without exceeding doses recommended by the clinical guidelines.

  20. CBP501 suppresses macrophage induced cancer stem cell like features and metastases

    PubMed Central

    Mine, Naoki; Yamamoto, Sayaka; Saito, Naoya; Sato, Takuji; Sakakibara, Keiichi; Kufe, Donald W.; VonHoff, Daniel D.; Kawabe, Takumi

    2017-01-01

    CBP501 is an anti-cancer drug candidate which has been shown to increase cis-diamminedichloro-platinum (II) (CDDP) uptake into cancer cell through calmodulin (CaM) inhibition. However, the effects of CBP501 on the cells in the tumor microenvironment have not been addressed. Here, we investigated new aspects of the potential anti-tumor mechanism of action of CBP501 by examining its effects on the macrophages. Macrophages contribute to cancer-related inflammation and sequential production of cytokines such as IL-6 and TNF-α which cause various biological processes that promote tumor initiation, growth and metastasis (1). These processes include the epithelial to mesenchymal transition (EMT) and cancer stem cell (CSC) formation, which are well-known, key events for metastasis. The present work demonstrates that CBP501 suppresses lipopolysaccharide (LPS)-induced production of IL-6, IL-10 and TNF-α by macrophages. CBP501 also suppressed formation of the tumor spheroids by culturing with conditioned medium from the LPS-stimulated macrophage cell line RAW264.7. Moreover, CBP501 suppressed expression of ABCG2, a marker for CSCs, by inhibiting the interaction between cancer cells expressing VCAM-1 and macrophages expressing VLA-4. Consistently with these results, CBP501 in vivo suppressed metastases of a tumor cell line, 4T1, one which is insensitive to combination treatment of CBP501 and CDDP in vitro. Taken together, these results offer potential new, unanticipated advantages of CBP501 treatment in anti-tumor therapy through a mechanism that entails the suppression of interactions between macrophages and cancer cells with suppression of sequential CSC-like cell formation in the tumor microenvironment. PMID:28969049

  1. Expanding Diversity in Molecular Structures and Functions of the IL-6/IL-12 Heterodimeric Cytokine Family

    PubMed Central

    Hasegawa, Hideaki; Mizoguchi, Izuru; Chiba, Yukino; Ohashi, Mio; Xu, Mingli; Yoshimoto, Takayuki

    2016-01-01

    The interleukin (IL)-6/IL-12 family cytokines have pleiotropic functions and play critical roles in multiple immune responses. This cytokine family has very unique characteristics in that they comprise two distinct subunits forming a heterodimer and each cytokine and receptor subunit shares with each other. The members of this cytokine family are increasing; currently, there are more than six cytokines, including the tentatively named cytokines IL-Y (p28/p40), IL-12 (p35/p40), IL-23 (p19/p40), IL-27 [p28/Epstein–Barr virus-induced protein 3 (EBI3)], IL-35 (p35/EBI3), and IL-39 (p19/EBI3). This family of cytokines covers a very broad range of immune responses, including pro-inflammatory responses, such as helper T (Th)1, Th2, and Th17, to anti-inflammatory responses, such as regulatory T (Treg) cells and IL-10-producing Treg cells. IL-12 is the first member of this family, and IL-12, IL-23, and IL-27 are mainly produced by activated antigen-presenting cells, such as dendritic cells and macrophages. IL-12 plays a critical role in the promotion of Th1 immune responses by inducing interferon-γ production to combat pathogens and malignant tumors. IL-23 induces IL-17 production and is necessary to maintain pathogenic Th17 cells that cause inflammatory and autoimmune diseases. IL-27 was initially reported to play a critical role in promotion of Th1 differentiation; however, subsequent studies revealed that IL-27 has broader stimulatory and inhibitory roles by inducing IL-10-producing Treg cells. IL-35 is produced by forkhead box P3+ Treg cells and activated B cells and has immunosuppressive functions to maintain immune tolerance. The most recently identified cytokine, IL-39, is produced by activated B cells and has pro-inflammatory functions. The cytokine tentatively named IL-Y seems to have anti-inflammatory functions by inhibiting Th1 and Th17 differentiation. In addition, individual cytokine subunits were also shown to have self-standing activities. Thus

  2. Vitamin B6 Prevents IL-1β Protein Production by Inhibiting NLRP3 Inflammasome Activation.

    PubMed

    Zhang, Peipei; Tsuchiya, Kohsuke; Kinoshita, Takeshi; Kushiyama, Hiroko; Suidasari, Sofya; Hatakeyama, Mizuki; Imura, Hisanori; Kato, Norihisa; Suda, Takashi

    2016-11-18

    Vitamin B6 includes six water-soluble vitamers: pyridoxal (PL), pyridoxamine (PM), pyridoxine (PN), and their phosphorylated forms. Pyridoxal 5'-phosphate (PLP) is an important cofactor for many metabolic enzymes. Several lines of evidence demonstrate that blood levels of PLP are significantly lower in patients with inflammation than in control subjects and that vitamin B6 has anti-inflammatory effects, with therapeutic potential for a variety of inflammatory diseases. Although one of our group previously demonstrated that PL inhibits the NF-κB pathway, the molecular mechanism by which vitamin B6 suppresses inflammation is not well understood. Here, we showed that both PL and PLP suppressed the expression of cytokine genes in macrophages by inhibiting Toll-like receptor (TLR)-mediated TAK1 phosphorylation and the subsequent NF-κB and JNK activation. Furthermore, PL and PLP abolished NLRP3-dependent caspase-1 processing and the subsequent secretion of mature IL-1β and IL-18 in LPS-primed macrophages. In contrast, PM and PN had little effect on IL-1β production. PLP, but not PL, markedly reduced the production of mitochondrial reactive oxygen species (ROS) in peritoneal macrophages. Importantly, PL and PLP reduced IL-1β production induced by LPS and ATP, or by LPS alone, in mice. Moreover, PL and PLP protected mice from lethal endotoxic shock. Collectively, these findings reveal novel anti-inflammatory activities for vitamin B6 and suggest its potential for preventing inflammatory diseases driven by the NLRP3 inflammasome. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. The induction of antibody production by IL-6 is indirectly mediated by IL-21 produced by CD4+ T cells

    PubMed Central

    Dienz, Oliver; Eaton, Sheri M.; Bond, Jeffrey P.; Neveu, Wendy; Moquin, David; Noubade, Rajkumar; Briso, Eva M.; Charland, Colette; Leonard, Warren J.; Ciliberto, Gennaro; Teuscher, Cory; Haynes, Laura; Rincon, Mercedes

    2009-01-01

    Interleukin (IL) 6 is a proinflammtory cytokine produced by antigen-presenting cells and nonhematopoietic cells in response to external stimuli. It was initially identified as a B cell growth factor and inducer of plasma cell differentiation in vitro and plays an important role in antibody production and class switching in vivo. However, it is not clear whether IL-6 directly affects B cells or acts through other mechanisms. We show that IL-6 is sufficient and necessary to induce IL-21 production by naive and memory CD4+ T cells upon T cell receptor stimulation. IL-21 production by CD4+ T cells is required for IL-6 to promote B cell antibody production in vitro. Moreover, administration of IL-6 with inactive influenza virus enhances virus-specific antibody production, and importantly, this effect is dependent on IL-21. Thus, IL-6 promotes antibody production by promoting the B cell helper capabilities of CD4+ T cells through increased IL-21 production. IL-6 could therefore be a potential coadjuvant to enhance humoral immunity. PMID:19139170

  4. Computer-aided designing of immunosuppressive peptides based on IL-10 inducing potential

    PubMed Central

    Nagpal, Gandharva; Usmani, Salman Sadullah; Dhanda, Sandeep Kumar; Kaur, Harpreet; Singh, Sandeep; Sharma, Meenu; Raghava, Gajendra P. S.

    2017-01-01

    In the past, numerous methods have been developed to predict MHC class II binders or T-helper epitopes for designing the epitope-based vaccines against pathogens. In contrast, limited attempts have been made to develop methods for predicting T-helper epitopes/peptides that can induce a specific type of cytokine. This paper describes a method, developed for predicting interleukin-10 (IL-10) inducing peptides, a cytokine responsible for suppressing the immune system. All models were trained and tested on experimentally validated 394 IL-10 inducing and 848 non-inducing peptides. It was observed that certain types of residues and motifs are more frequent in IL-10 inducing peptides than in non-inducing peptides. Based on this analysis, we developed composition-based models using various machine-learning techniques. Random Forest-based model achieved the maximum Matthews’s Correlation Coefficient (MCC) value of 0.59 with an accuracy of 81.24% developed using dipeptide composition. In order to facilitate the community, we developed a web server “IL-10pred”, standalone packages and a mobile app for designing IL-10 inducing peptides (http://crdd.osdd.net/raghava/IL-10pred/). PMID:28211521

  5. Bone marrow mesenchymal stem cells suppress IL-9 in adjuvant-induced arthritis.

    PubMed

    Abd Elhalem, Sahar Sobhy; Haggag, Nawal Zakaria; El-Shinnawy, Nashwa Ahmed

    2018-02-01

    Interleukin-9 (IL-9) has been shown to be upregulated in rheumatoid arthritis (RA). The exact role of IL-9 has not yet been effectively studied. Mesenchymal stem cells (MSCs) have shown a promising immunomodulatory role towards repairing cartilage and restoring joint function. One of the key problems influencing the therapeutic efficacy of stem cell therapy is the poor cell survival following transplantation. This is attributed to oxidative and inflammatory stresses at the injured sites. Hesperidin (Hsd), a flavanone present in citrus fruits, has been studied as potential therapeutic agents that have anti-oxidant and anti-inflammatory activities. The objective of this study is to evaluate the therapeutic paracrine action of bone marrow MSCs on the IL-9 level in adjuvant-induced arthritis (AIA) and the enhancement effect of Hsd on transplanted MSCs. Articular tissue inflammation and cartilage damage were assessed by histological scoring. Antinuclear autoantibodies, tumour necrosis factor-alpha (TNF-α), IL-9, IL-4, interferon gamma (IFN-δ), and transforming growth factor-beta1 (TGF-β1), as well as malondialdehyde (MDA), glutathione (GSH), and superoxide dismutase (SOD) levels, were assessed in spleen tissue homogenates after treatment with MSCs either alone or combined with Hsd for 4 weeks in an AIA rat model. Results of this study confirmed that MSCs decreased IL-9 levels in AIA and provide novel insights into the application of Hsd on MSC-based treatments. Highlights Adjuvant-induced arthritis (AIA) is one of the most widely used models that has a great similarity to rheumatoid arthritis (RA). Few studies in recent years have estimated IL-9 in rheumatic diseases and it remains an understudied cytokine. For the first time, bone marrow mesenchymal stem cells (MSCs) therapy has a vital role in splenocytes IL-9 level and further studies are required. Combined therapy of MSCs with antioxidants as hesperidin (Hsd) can alleviate oxidative stress and enhance stem cells

  6. Formulation of vaccines containing CpG oligonucleotides and alum

    PubMed Central

    Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.

    2007-01-01

    CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533

  7. Overriding TKI resistance of renal cell carcinoma by combination therapy with IL-6 receptor blockade.

    PubMed

    Ishibashi, Kei; Haber, Tobias; Breuksch, Ines; Gebhard, Susanne; Sugino, Takashi; Kubo, Hitoshi; Hata, Junya; Koguchi, Tomoyuki; Yabe, Michihiro; Kataoka, Masao; Ogawa, Soichiro; Hiraki, Hiroyuki; Yanagida, Tomohiko; Haga, Nobuhiro; Thüroff, Joachim W; Prawitt, Dirk; Brenner, Walburgis; Kojima, Yoshiyuki

    2017-08-15

    Metastatic renal cell carcinoma (RCC) is a tumor entity with poor prognosis due to limited therapy options. Tyrosine kinase inhibitors (TKI) represent the standard of care for RCCs, however a significant proportion of RCC patients develop resistance to this therapy. Interleukin-6 (IL-6) is considered to be associated with poor prognosis in RCCs. We therefore hypothesized that TKI resistance and IL-6 secretion are causally connected. We first analyzed IL-6 expression after TKI treatment in RCC cells and RCC tumor specimens. Cell proliferation and signal transduction activity were then quantified after co-treatment with tocilizumab, an IL-6R inhibitor, in vitro and in vivo . 786-O RCC cells secrete high IL-6 levels after low dose stimulation with the TKIs sorafenib, sunitinib and pazopanib, inducing activation of AKT-mTOR pathway, NFκB, HIF-2α and VEGF expression. Tocilizumab neutralizes the AKT-mTOR pathway activation and results in reduced proliferation. Using a mouse xenograft model we can show that a combination therapy with tocilizumab and low dosage of sorafenib suppresses 786-O tumor growth, reduces AKT-mTOR pathway and inhibits angiogenesis in vivo more efficient than sorafenib alone. Furthermore FDG-PET imaging detected early decrease of maximum standardized uptake values prior to extended central necrosis. Our findings suggest that a combination therapy of IL-6R inhibitors and TKIs may represent a novel therapeutic approach for RCC treatment.

  8. B cells produce less IL-10, IL-6 and TNF-α in myasthenia gravis.

    PubMed

    Yilmaz, Vuslat; Oflazer, Piraye; Aysal, Fikret; Parman, Yeşim G; Direskeneli, Haner; Deymeer, Feza; Saruhan-Direskeneli, Güher

    2015-06-01

    B cells from myasthenia gravis (MG) patients with autoantibodies (Aab) against acetylcholine receptor (AChR), muscle-specific kinase (MuSK) or with no detectable Aab were investigated as cytokine producing cells in this study. B cells were evaluated for memory phenotypes and expressions of IL-10, IL-6 and IL-12A. Induced productions of IL-10, IL-6, IL-12p40, TNF-α and LT from isolated B cells in vitro were measured by immunoassays. MG patients receiving immunosuppressive treatment had higher proportions of memory B cells compared with healthy controls and untreated patients. With CD40 stimulation MG patients produced significantly lower levels of IL-10, IL-6. With CD40 and B cell receptor stimulation of B cells, TNF-α production also decreased in addition to these cytokines. The lower levels of these cytokine productions were not related to treatment. Our results confirm a disturbance of B cell subpopulations in MG subgroups on immunosuppressive treatment. B cell derived IL-10, IL-6 and TNF-α are down-regulated in MG, irrespective of different antibody productions. Ineffective cytokine production by B cells may be a susceptibility factor in dysregulation of autoimmune Aab production.

  9. Regulatory T cells and IL10 suppress pulmonary host defense during early-life exposure to radical containing combustion derived ultrafine particulate matter.

    PubMed

    Jaligama, Sridhar; Saravia, Jordy; You, Dahui; Yadav, Nikki; Lee, Greg I; Shrestha, Bishwas; Cormier, Stephania A

    2017-01-13

    Exposure to elevated levels of particulate matter (PM) is associated with increased risk of morbidity and mortality due to respiratory tract viral infections in infants. Recent identification of environmentally persistent free radicals (EPFRs) in the PM from a variety of combustion sources suggests its role in the enhancement of disease severity of lower respiratory tract infections (LRTI). Our previous studies demonstrated that acute exposure to EPFRs induces pulmonary immunosuppression allowing for enhanced influenza disease severity. Here, we determine the mechanism of EPFR-induced immunosuppression and its impact on the immune response towards influenza infection. Neonatal mice (3 days old) were acutely exposed to DCB (combustion derived PM with chemisorbed EPFR) for seven consecutive days. Four days post-exposure (dpe), mice were infected with influenza virus. Pulmonary T cell phenotypes including regulatory T cells (Tregs) were analyzed by flow cytometry. The role of IL10 in EPFR-induced exacerbation of influenza disease severity was determined by administering recombinant IL10 (rIL10) to wild type mice or by using IL10 deficient (IL10 -/- ) neonatal mice. Mice were assessed for morbidity by measuring percent weight change and pulmonary viral load. Neonatal mice exposed to EPFRs had a significant increase in pulmonary Tregs and the immunosuppressive cytokine IL10 following influenza infection, which coincided with decreased protective T cell responses to influenza infection at 6 dpi. Depletion of Tregs in EPFR-exposed neonatal mice resulted in increased protective, adaptive T cell responses, whereas adoptive transfer of Tregs from EPFR-exposed neonates to air-exposed neonatal mice suppressed adaptive T cell responses towards influenza infection. Further, treatment with rIL10 could recapitulate EPFR-induced exacerbation of morbidity and pulmonary viral load compared to air exposed and influenza infected mice, whereas, EPFR-exposed IL10 -/- neonates exhibited

  10. Intraperitoneal prophylaxis with CpG oligodeoxynucleotides protects neutropenic mice against intracerebral Escherichia coli K1 infection.

    PubMed

    Ribes, Sandra; Meister, Tanja; Ott, Martina; Redlich, Sandra; Janova, Hana; Hanisch, Uwe-Karsten; Nessler, Stefan; Nau, Roland

    2014-01-23

    Prophylaxis with unmethylated cytosine phosphate guanidine (CpG) oligodeoxynucleotides (ODN) protects against several systemic experimental infections. Escherichia coli is a major cause of Gram-negative neonatal bacterial meningitis and also causes meningitis and meningoencephalitis in older and immunocompromised patients. Wild-type (wt) and Toll-like receptor 9 (TLR9)-deficient mice were rendered neutropenic by intraperitoneal administration of the anti-Ly-6G monoclonal antibody. Immunocompetent and neutropenic mice received intraperitoneal CpG ODN or vehicle 72 h prior to induction of E. coli K1 meningoencephalitis. Pre-treatment with CpG ODN significantly increased survival of neutropenic wt mice from 33% to 75% (P = 0.0003) but did not protect neutropenic TLR9-/- mice. The protective effect of CpG ODN was associated with an enhanced production of interleukin (IL)-12/IL-23p40 with sustained increased levels in serum and spleen at least for 17 days after conditioning compared to buffer-treated animals. CpG-treated neutropenic wt mice showed reduced bacterial concentrations and increased recruitment of Ly6ChighCCR2+ monocytes in brain and spleen 42 h after infection. The levels of macrophage inflammatory protein 1α (MIP-1α) and interferon gamma (IFN-γ) in spleen were higher 42 h after infection in CpG-treated compared to buffer-treated neutropenic animals. In immunocompetent mice, prophylaxis with CpG ODN did not significantly increase survival compared to the buffer group (60% vs. 45%, P = 0.2). These findings suggest that systemic administration of CpG ODN may help to prevent bacterial CNS infections in immunocompromised individuals.

  11. Synthetic triterpenoid induces 15-PGDH expression and suppresses inflammation-driven colon carcinogenesis.

    PubMed

    Choi, Sung Hee; Kim, Byung-Gyu; Robinson, Janet; Fink, Steve; Yan, Min; Sporn, Michael B; Markowitz, Sanford D; Letterio, John J

    2014-06-01

    Colitis-associated colon cancer (CAC) develops as a result of inflammation-induced epithelial transformation, which occurs in response to inflammatory cytokine-dependent downregulation of 15-hydroxyprostaglandin dehydrogenase (15-PGDH) and subsequent suppression of prostaglandin metabolism. Agents that both enhance 15-PGDH expression and suppress cyclooxygenase-2 (COX-2) production may more effectively prevent CAC. Synthetic triterpenoids are a class of small molecules that suppress COX-2 as well as inflammatory cytokine signaling. Here, we found that administration of the synthetic triterpenoid 2-cyano-3,12-dioxooleana-1,9(11)-dien-C28-methyl ester (CDDO-Me) suppresses CAC in mice. In a spontaneous, inflammation-driven intestinal neoplasia model, deletion of Smad4 specifically in T cells led to progressive production of inflammatory cytokines, including TNF-α, IFN-γ, iNOS, IL-6, IL-1β; as well as activation of STAT1 and STAT3; along with suppression of 15-PGDH expression. Oral administration of CDDO-Me to mice with SMAD4-deficient T cells increased survival and suppressed intestinal epithelial neoplasia by decreasing production of inflammatory mediators and increasing expression of 15-PGDH. Induction of 15-PGDH by CDDO-Me was dose dependent in epithelial cells and was abrogated following treatment with TGF-β signaling inhibitors in vitro. Furthermore, CDDO-Me-dependent 15-PGDH induction was not observed in Smad3-/- mice. Similarly, CDDO-Me suppressed azoxymethane plus dextran sodium sulfate-induced carcinogenesis in wild-type animals, highlighting the potential of small molecules of the triterpenoid family as effective agents for the chemoprevention of CAC in humans.

  12. Model Based Targeting of IL-6-Induced Inflammatory Responses in Cultured Primary Hepatocytes to Improve Application of the JAK Inhibitor Ruxolitinib

    PubMed Central

    Sobotta, Svantje; Raue, Andreas; Huang, Xiaoyun; Vanlier, Joep; Jünger, Anja; Bohl, Sebastian; Albrecht, Ute; Hahnel, Maximilian J.; Wolf, Stephanie; Mueller, Nikola S.; D'Alessandro, Lorenza A.; Mueller-Bohl, Stephanie; Boehm, Martin E.; Lucarelli, Philippe; Bonefas, Sandra; Damm, Georg; Seehofer, Daniel; Lehmann, Wolf D.; Rose-John, Stefan; van der Hoeven, Frank; Gretz, Norbert; Theis, Fabian J.; Ehlting, Christian; Bode, Johannes G.; Timmer, Jens; Schilling, Marcel; Klingmüller, Ursula

    2017-01-01

    IL-6 is a central mediator of the immediate induction of hepatic acute phase proteins (APP) in the liver during infection and after injury, but increased IL-6 activity has been associated with multiple pathological conditions. In hepatocytes, IL-6 activates JAK1-STAT3 signaling that induces the negative feedback regulator SOCS3 and expression of APPs. While different inhibitors of IL-6-induced JAK1-STAT3-signaling have been developed, understanding their precise impact on signaling dynamics requires a systems biology approach. Here we present a mathematical model of IL-6-induced JAK1-STAT3 signaling that quantitatively links physiological IL-6 concentrations to the dynamics of IL-6-induced signal transduction and expression of target genes in hepatocytes. The mathematical model consists of coupled ordinary differential equations (ODE) and the model parameters were estimated by a maximum likelihood approach, whereas identifiability of the dynamic model parameters was ensured by the Profile Likelihood. Using model simulations coupled with experimental validation we could optimize the long-term impact of the JAK-inhibitor Ruxolitinib, a therapeutic compound that is quickly metabolized. Model-predicted doses and timing of treatments helps to improve the reduction of inflammatory APP gene expression in primary mouse hepatocytes close to levels observed during regenerative conditions. The concept of improved efficacy of the inhibitor through multiple treatments at optimized time intervals was confirmed in primary human hepatocytes. Thus, combining quantitative data generation with mathematical modeling suggests that repetitive treatment with Ruxolitinib is required to effectively target excessive inflammatory responses without exceeding doses recommended by the clinical guidelines. PMID:29062282

  13. Analysis of IL-6, IL-10 and NF-κB Gene Polymorphisms in Aggressive and Chronic Periodontitis.

    PubMed

    Toker, Hülya; Görgün, Emine Pirim; Korkmaz, Ertan Mahir

    2017-06-01

    Pro-inflammatory cytokines, interleukin-6 (IL-6), demonstrated to be suppressed by interleukin-10 (IL-10) are known to be regulated by the transcription factor nuclear factor-κB(NF-κB). The aim of this study was to ascertain the association between genetic polymorphism of these genes (IL-6(-174), IL-10(-597) and NF-κB1-94ins/del)) and chronic/aggressive periodontitis. Forty-five patients with chronic periodontitis (CP), 58 patients with aggressive periodontitis (AP) and 38 periodontally healthy subjects were included in this study. Genomic DNA was isolated from whole blood samples. The NF-κB, IL-6, and IL-10 polymorphisms were determined by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Among subjects for the ins/ins genotypes of NF-κB1 gene, the AA genotypes of IL-10 presented a higher frequency in chronic periodontitis group than in healthy controls (p=0.023). A statistically significant difference in genotyping frequencies between AP group and healthy controls was observed for the IL-6 gene. The AA genotype of IL-10 was overrepresented in CP and AP groups compared to healthy controls (OR=9.93, 95% CI: 2.11-46.7, OR=5.7, 95% CI: 1.22-26.89, respectively). Within the limits of this study, it can be concluded that the IL-10 (-597) AA genotype is associated with susceptibility to chronic/aggressive periodontitis and IL-6 (-174) GG genotypes and G allele seems to be associated with aggressive periodontitis. Clinical relevance: The results of the current study indicate that IL-6 and IL-10 genotypes seem to be associated with aggressive periodontitis. Also, the AA genotypes of IL-10 presented a higher frequency in chronic periodontitis subjects with carrying NF-κB1 ins/ins genotypes. Copyright© by the National Institute of Public Health, Prague 2017

  14. Radiation-Induced Loss of Salivary Gland Function Is Driven by Cellular Senescence and Prevented by IL6 Modulation.

    PubMed

    Marmary, Yitzhak; Adar, Revital; Gaska, Svetlana; Wygoda, Annette; Maly, Alexander; Cohen, Jonathan; Eliashar, Ron; Mizrachi, Lina; Orfaig-Geva, Carmit; Baum, Bruce J; Rose-John, Stefan; Galun, Eithan; Axelrod, Jonathan H

    2016-03-01

    Head and neck cancer patients treated by radiation commonly suffer from a devastating side effect known as dry-mouth syndrome, which results from the irreversible loss of salivary gland function via mechanisms that are not completely understood. In this study, we used a mouse model of radiation-induced salivary hypofunction to investigate the outcomes of DNA damage in the head and neck region. We demonstrate that the loss of salivary function was closely accompanied by cellular senescence, as evidenced by a persistent DNA damage response (γH2AX and 53BP1) and the expression of senescence-associated markers (SA-βgal, p19ARF, and DcR2) and secretory phenotype (SASP) factors (PAI-1 and IL6). Notably, profound apoptosis or necrosis was not observed in irradiated regions. Signs of cellular senescence were also apparent in irradiated salivary glands surgically resected from human patients who underwent radiotherapy. Importantly, using IL6 knockout mice, we found that sustained expression of IL6 in the salivary gland long after initiation of radiation-induced DNA damage was required for both senescence and hypofunction. Additionally, we demonstrate that IL6 pretreatment prevented both senescence and salivary gland hypofunction via a mechanism involving enhanced DNA damage repair. Collectively, these results indicate that cellular senescence is a fundamental mechanism driving radiation-induced damage in the salivary gland and suggest that IL6 pretreatment may represent a promising therapeutic strategy to preserve salivary gland function in head and neck cancer patients undergoing radiotherapy. ©2016 American Association for Cancer Research.

  15. Curcumin suppresses the production of interleukin-6 in Prevotella intermedia lipopolysaccharide-activated RAW 264.7 cells

    PubMed Central

    2011-01-01

    Purpose Curcumin is known to exert numerous biological effects including anti-inflammatory activity. In this study, we investigated the effects of curcumin on the production of interleukin-6 (IL-6) by murine macrophage-like RAW 264.7 cells stimulated with lipopolysaccharide (LPS) from Prevotella intermedia, a major cause of inflammatory periodontal disease, and sought to determine the underlying mechanisms of action. Methods LPS was prepared from lyophilized P. intermedia ATCC 25611 cells by the standard hot phenol-water method. Culture supernatants were collected and assayed for IL-6. We used real-time polymerase chain reaction to detect IL-6 mRNA expression. IκB-α degradation, nuclear translocation of NF-κB subunits, and STAT1 phosphorylation were characterized via immunoblotting. DNA-binding of NF-κB was also analyzed. Results Curcumin strongly suppressed the production of IL-6 at both gene transcription and translation levels in P. intermedia LPS-activated RAW 264.7 cells. Curcumin did not inhibit the degradation of IκB-α induced by P. intermedia LPS. Curcumin blocked NF-κB signaling through the inhibition of nuclear translocation of NF-κB p50 subunit. Curcumin also attenuated DNA binding activity of p50 and p65 subunits and suppressed STAT1 phosphorylation. Conclusions Although further study is required to explore the detailed mechanism of action, curcumin may contribute to blockade of the host-destructive processes mediated by IL-6 and appears to have potential therapeutic values in the treatment of inflammatory periodontal disease. PMID:21811692

  16. Vitiligo-inducing phenols activate the unfolded protein response in melanocytes resulting in upregulation of IL6 and IL8.

    PubMed

    Toosi, Siavash; Orlow, Seth J; Manga, Prashiela

    2012-11-01

    Vitiligo is characterized by depigmented skin patches caused by loss of epidermal melanocytes. Oxidative stress may have a role in vitiligo onset, while autoimmunity contributes to disease progression. In this study, we sought to identify mechanisms that link disease triggers and spreading of lesions. A hallmark of melanocytes at the periphery of vitiligo lesions is dilation of the endoplasmic reticulum (ER). We hypothesized that oxidative stress results in redox disruptions that extend to the ER, causing accumulation of misfolded peptides, which activates the unfolded protein response (UPR). We used 4-tertiary butyl phenol and monobenzyl ether of hydroquinone, known triggers of vitiligo. We show that expression of key UPR components, including the transcription factor X-box-binding protein 1 (XBP1), is increased following exposure of melanocytes to phenols. XBP1 activation increases production of immune mediators IL6 and IL8. Co-treatment with XBP1 inhibitors reduced IL6 and IL8 production induced by phenols, while overexpression of XBP1 alone increased their expression. Thus, melanocytes themselves produce cytokines associated with activation of an immune response following exposure to chemical triggers of vitiligo. These results expand our understanding of the mechanisms underlying melanocyte loss in vitiligo and pathways linking environmental stressors and autoimmunity.

  17. Structural characterization and immunomodulatory effects of polysaccharides from Phellinus linteus and Phellinus igniarius on the IL-6/IL-10 cytokine balance of the mouse macrophage cell lines (RAW 264.7).

    PubMed

    Suabjakyong, Papawee; Nishimura, Kazuhiro; Toida, Toshihiko; Van Griensven, Leo J L D

    2015-08-01

    Phellinus linteus and igniarius (L.) Quel. have been used in traditional Asian medicine for over two centuries against a variety of diseases. Polysaccharides from their fruiting bodies show strong immunomodulatory activity. In this study we characterized the structure and composition of polysaccharides from Phellinus linteus and Phellinus igniarius by HPLC, GC-MS and NMR (1-H, 13-C, COSY, NOESY and TOCSY). The polysaccharides from P. linteus and P. igniarius mainly contained glucose with minor proportions of mannose, galactose, xylose, arabinose and rhamnose. Methylation analyses showed that the glycosidic linkages were mostly 1 → 3, 1 → 6 or 1 → 3,6. The two-dimensional COSY, NOESY and TOCSY confirmed that these polysaccharides have a main chain of →3)-β-D-Glcp-(1→ with →6)-β-D-Glcp-(1→ side chain. In vitro assays by RT-PCR and ELISA showed that (1 → 3; 1 → 6)-β-D-polysaccharides from P. linteus and P. igniarius decreased TNF-α in RAW 264.7 cells, suggesting an immuno-suppressive activity. Furthermore, these polysaccharides stimulated a high IL-10 response and induced strong suppression of transcription of IL-6. The results suggest that polysaccharides from P. linteus and P. igniarius could possibly find applications in restoring the IL-6/IL-10 balance, the disturbance of which is thought to be related to chronic inflammatory disease, obesity, diabetes type 2, and to mania and depression.

  18. Berberine ameliorates chronic relapsing dextran sulfate sodium-induced colitis in C57BL/6 mice by suppressing Th17 responses.

    PubMed

    Li, Yan-Hong; Xiao, Hai-Tao; Hu, Dong-Dong; Fatima, Sarwat; Lin, Cheng-Yuan; Mu, Huai-Xue; Lee, Nikki P; Bian, Zhao-Xiang

    2016-08-01

    Ulcerative colitis (UC) is an increasingly common condition particularly in developed countries. The lack of satisfactory treatment has fueled the search for alternative therapeutic strategies. In recent studies, berberine, a plant alkaloid with a long history of medicinal use in Chinese medicine, has shown beneficial effects against animal models of acute UC. However, UC usually presents as a chronic condition with frequent relapse in patients. How berberine will act on chronic UC remains unclear. In the present study, we adopted dextran sulfate sodium (DSS)-induced chronic relapsing colitis model to assess the ameliorating activity of berberine. Colitis was induced by two cycles of 2.0% DSS for five days followed by 14days of drinking water plus a third cycle consisting of DSS only for five days. The colitis mice were orally administered 20mg/kg berberine from day 13 onward for 30days and monitored daily. The body weight, stool consistency, and stool bleeding were recorded for determination of the disease activity index (DAI). At the end of treatment, animals were sacrificed and samples were collected and subjected to histological, RT-qPCR, Western blot, and LC-MS analyses. Lymphocytes were isolated from spleens and mesenteric lymph nodes (MLN) and cultured for flow cytometry analysis of IL-17 secretion from CD4(+) cells and the Th17 cell differentiation. Results showed that berberine significantly ameliorated the DAI, colon shortening, colon tissue injury, and reduction of colonic expression of tight junction (TJ) protein ZO-1 and occludin of colitis mice. Notably, berberine treatment pronouncedly reduced DSS-upregulated Th17-related cytokine (IL-17 and ROR-γt) mRNAs in the colon. Furthermore, the mRNA expression of IL-6 and IL-23, and the phosphorylation of STAT3 in colon tissues from DSS-treated mice were pronouncedly inhibited by berberine. Moreover, the up-regulation of IL-17 secretion from CD4(+) cells of spleens and MLNs caused by DSS were significantly

  19. Withaferin A Inhibits Helicobacter pylori-induced Production of IL-1β in Dendritic Cells by Regulating NF-κB and NLRP3 Inflammasome Activation.

    PubMed

    Kim, Jae-Eun; Lee, Jun-Young; Kang, Min-Jung; Jeong, Yu-Jin; Choi, Jin-A; Oh, Sang-Muk; Lee, Kyung-Bok; Park, Jong-Hwan

    2015-12-01

    Helicobacter pylori infection is associated with chronic gastritis, peptic ulcer, and gastric cancer. There is evidence that IL-1β is associated with the development of gastric cancer. Therefore, downregulation of H. pylori-mediated IL-1β production may be a way to prevent gastric cancer. Withaferin A (WA), a withanolide purified from Withania somnifera, is known to exert anti-inflammatory and anti-tumor effects. In the present study, we explored the inhibitory activity of WA on H. pylori-induced production of IL-1β in murine bone marrow-derived dendritic cells (BMDCs) and the underlying cellular mechanism. Co-treatment with WA decreased IL-1β production by H. pylori in BMDCs in a dose-dependent manner. H. pylori-induced gene expression of IL-1β and NLRP3 (NOD-like receptor family, pyrin domain containing 3) were also suppressed by WA treatment. Moreover, IκB-α phosphorylation by H. pylori infection was suppressed by WA in BMDCs. Western blot analysis revealed that H. pylori induced cleavage of caspase-1 and IL-1β, as well as increased procaspase-1 and pro IL-1β protein levels, and that both were suppressed by co-treatment with WA. Finally, we determined whether WA can directly inhibit ac tivation of the NLRP3 inflammasome. NLRP3 activators induced IL-1β secretion in LPS-primed macrophages, which was inhibited by WA in a dose-dependent manner, whereas IL-6 production was not affected by WA. Moreover, cleavage of IL-1β and caspase-1 by NLRP3 activators was also dose-dependently inhibited by WA. These findings suggest that WA can inhibit IL-1β production by H. pylori in dendritic cells and can be used as a new preventive and therapeutic agent for gastric cancer.

  20. Corticosteroids reduce IL-6 in ASM cells via up-regulation of MKP-1.

    PubMed

    Quante, Timo; Ng, Yee Ching; Ramsay, Emma E; Henness, Sheridan; Allen, Jodi C; Parmentier, Johannes; Ge, Qi; Ammit, Alaina J

    2008-08-01

    The mechanisms by which corticosteroids reduce airway inflammation are not completely understood. Traditionally, corticosteroids were thought to inhibit cytokines exclusively at the transcriptional level. Our recent evidence, obtained in airway smooth muscle (ASM), no longer supports this view. We have found that corticosteroids do not act at the transcriptional level to reduce TNF-alpha-induced IL-6 gene expression. Rather, corticosteroids inhibit TNF-alpha-induced IL-6 secretion by reducing the stability of the IL-6 mRNA transcript. TNF-alpha-induced IL-6 mRNA decays at a significantly faster rate in ASM cells pretreated with the corticosteroid dexamethasone (t(1/2) = 2.4 h), compared to vehicle (t(1/2) = 9.0 h; P < 0.05) (results are expressed as decay constants [k] [mean +/- SEM] and half-life [h]). Interestingly, the underlying mechanism of inhibition by corticosteroids is via the up-regulation of an endogenous mitogen-activated protein kinase (MAPK) inhibitor, MAPK phosphatase-1 (MKP-1). Corticosteroids rapidly up-regulate MKP-1 in a time-dependent manner (44.6 +/- 10.5-fold increase after 24 h treatment with dexamethasone; P < 0.05), and MKP-1 up-regulation was temporally related to the inhibition of TNF-alpha-induced p38 MAPK phosphorylation. Moreover, TNF-alpha acts via a p38 MAPK-dependent pathway to stabilize the IL-6 mRNA transcript (TNF-alpha, t(1/2) = 9.6 h; SB203580 + TNF-alpha, t(1/2) = 1.5 h), exogenous expression of MKP-1 significantly inhibits TNF-alpha-induced IL-6 secretion and MKP-1 siRNA reverses the inhibition of TNF-alpha-induced IL-6 secretion by dexamethasone. Taken together, these results suggest that corticosteroid-induced MKP-1 contributes to the repression of IL-6 secretion in ASM cells.

  1. Chronic Lymphocytic Leukemia-Derived IL-10 Suppresses Antitumor Immunity.

    PubMed

    Alhakeem, Sara S; McKenna, Mary K; Oben, Karine Z; Noothi, Sunil K; Rivas, Jacqueline R; Hildebrandt, Gerhard C; Fleischman, Roger A; Rangnekar, Vivek M; Muthusamy, Natarajan; Bondada, Subbarao

    2018-04-30

    Chronic lymphocytic leukemia (CLL) patients progressively develop an immunosuppressive state. CLL patients have more plasma IL-10, an anti-inflammatory cytokine, than healthy controls. In vitro human CLL cells produce IL-10 in response to BCR cross-linking. We used the transgenic Eμ-T cell leukemia oncogene-1 ( TCL1 ) mouse CLL model to study the role of IL-10 in CLL associated immunosuppression. Eμ-TCL mice spontaneously develop CLL because of a B cell-specific expression of the oncogene, TCL1. Eμ- TCL1 mouse CLL cells constitutively produce IL-10, which is further enhanced by BCR cross-linking, CLL-derived IL-10 did not directly affect survival of murine or human CLL cells in vitro. We tested the hypothesis that the CLL-derived IL-10 has a critical role in CLL disease in part by suppressing the host immune response to the CLL cells. In IL-10R -/- mice, wherein the host immune cells are unresponsive to IL-10-mediated suppressive effects, there was a significant reduction in CLL cell growth compared with wild type mice. IL-10 reduced the generation of effector CD4 and CD8 T cells. We also found that activation of BCR signaling regulated the production of IL-10 by both murine and human CLL cells. We identified the transcription factor, Sp1, as a novel regulator of IL-10 production by CLL cells and that it is regulated by BCR signaling via the Syk/MAPK pathway. Our results suggest that incorporation of IL-10 blocking agents may enhance current therapeutic regimens for CLL by potentiating host antitumor immune response. Copyright © 2018 by The American Association of Immunologists, Inc.

  2. HDAC2 Suppresses IL17A-Mediated Airway Remodeling in Human and Experimental Modeling of COPD.

    PubMed

    Lai, Tianwen; Tian, Baoping; Cao, Chao; Hu, Yue; Zhou, Jiesen; Wang, Yong; Wu, Yanping; Li, Zhouyang; Xu, Xuchen; Zhang, Min; Xu, Feng; Cao, Yuan; Chen, Min; Wu, Dong; Wu, Bin; Dong, Chen; Li, Wen; Ying, Songmin; Chen, Zhihua; Shen, Huahao

    2018-04-01

    Although airway remodeling is a central feature of COPD, the mechanisms underlying its development have not been fully elucidated. The goal of this study was to determine whether histone deacetylase (HDAC) 2 protects against cigarette smoke (CS)-induced airway remodeling through IL-17A-dependent mechanisms. Sputum samples and lung tissue specimens were obtained from control subjects and patients with COPD. The relationships between HDAC2, IL-17A, and airway remodeling were investigated. The effect of HDAC2 on IL-17A-mediated airway remodeling was assessed by using in vivo models of COPD induced by CS and in vitro culture of human bronchial epithelial cells and primary human fibroblasts exposed to CS extract, IL-17A, or both. HDAC2 and IL-17A expression in the sputum cells and lung tissue samples of patients with COPD were associated with bronchial wall thickening and collagen deposition. Il-17a deficiency (Il-17a -/- ) resulted in attenuation of, whereas Hdac2 deficiency (Hdac2 +/- ) exacerbated, CS-induced airway remodeling in mice. IL-17A deletion also attenuated airway remodeling in CS-exposed Hdac2 +/- mice. HDAC2 regulated IL-17A production partially through modulation of CD4 + T cells during T helper 17 cell differentiation and retinoid-related orphan nuclear receptor γt in airway epithelial cells. In vitro, IL-17A deficiency attenuated CS-induced mouse fibroblast activation from Hdac2 +/- mice. IL-17A-induced primary human fibroblast activation was at least partially mediated by autocrine production of transforming growth factor beta 1. These findings suggest that activation of HDAC2 and/or inhibition of IL-17A production could prevent the development of airway remodeling by suppressing airway inflammation and modulating fibroblast activation in COPD. Copyright © 2017. Published by Elsevier Inc.

  3. Targeting the IL-17/IL-6 axis can alter growth of Chronic Lymphocytic Leukemia in vivo/in vitro.

    PubMed

    Zhu, Fang; McCaw, Lindsay; Spaner, David E; Gorczynski, Reginald M

    2018-03-01

    The tumor microenvironment (TME) is critical to the longevity of tumor B cells in chronic lymphocytic leukemia (CLL). Bone marrow mesenchymal stem cells (BMMSCs) and the cytokines they produce including IL-6 are important components of the TME in CLL. We found BMMSCs supported the survival of CLL cells in vitro through an IL-6 dependent mechanism. IL-17 which induces IL-6 generation in a variety of cells increased production of IL-6 both in CLL cells and BMMSCs in vitro. In a xenograft CLL mouse model, BMMSCs and the culture supernatant of BMMSCs increased engraftment of CLL cells through an IL-6 mediated mechanism with human recombinant IL-6 showing similar effects in vivo. Human recombinant IL-17 treatment also increased CLL engraftment in mice through an IL-6 mediated mechanism. Plasma of CLL patients showed elevated levels of both IL-6 and IL-17 by ELISA compared with healthy controls, with levels of IL-6 linearly correlated with IL-17 levels. CLL patients requiring fludarabine based chemotherapy expressed higher levels of IL-6 and IL-17, while CLL patients with the lowest levels of IgA/IgM had higher levels of IL-6, but not IL-17. These data imply an important role for the IL-17/IL-6 axis in CLL which could be therapeutic targets. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. DHA suppresses Prevotella intermedia lipopolysaccharide-induced production of proinflammatory mediators in murine macrophages.

    PubMed

    Choi, Eun-Young; Jin, Ji-Young; Choi, Jeom-Il; Choi, In Soon; Kim, Sung-Jo

    2014-04-14

    Several reports have indicated that dietary intake of DHA is associated with lower prevalence of periodontitis. In the present study, we investigated the effect of DHA on the production of proinflammatory mediators in murine macrophage-like RAW264.7 cells stimulated with lipopolysaccharide (LPS) isolated from Prevotella intermedia, a pathogen implicated in inflammatory periodontal disease, and its mechanisms of action. LPS was isolated from lyophilised P. intermedia ATCC 25,611 cells using the standard hot-phenol-water protocol. Culture supernatants were collected and assayed for NO, IL-1β and IL-6. Real-time PCR analysis was carried out to detect the expression of inducible NO synthase (iNOS), IL-1β, IL-6 and haeme oxygenase-1 (HO-1) mRNA. Immunoblot analysis was carried out to quantify the expression of iNOS and HO-1 protein and concentrations of signalling proteins. DNA-binding activities of NF-κB subunits were determined using an ELISA-based assay kit. DHA significantly attenuated the production of NO, IL-1β and IL-6 at both gene transcription and translation levels in P. intermedia LPS-activated RAW264.7 cells. DHA induced the expression of HO-1 in cells treated with P. intermedia LPS. Selective inhibition of HO-1 activity by tin protoporphyrin IX significantly mitigated the inhibitory effects of DHA on LPS-induced NO production. DHA significantly attenuated the phosphorylation of c-Jun N-terminal kinase induced by LPS. In addition, DHA suppressed the transcriptional activity of NF-κB by regulating the nuclear translocation and DNA-binding activity of NF-κB p50 subunit and inhibited the phosphorylation of signal transducer and activator of transcription 1. Further in vivo studies are needed to better evaluate the potential of DHA in humans as a therapeutic agent to treat periodontal disease.

  5. Suppressor of cytokine signaling 3 inhibits LPS-induced IL-6 expression in osteoblasts by suppressing CCAAT/enhancer-binding protein ß activity

    USDA-ARS?s Scientific Manuscript database

    Suppressors of cytokine signaling 3 (SOCS3) is an important intracellular regulator of TLR4 signaling and has been implicated in several inflammatory diseases. Although SOCS3 seems to contribute to the balance between the pro-inflammatory effects of IL-6 and antiinflammatory signaling of IL-10 by ne...

  6. Interplay between YB-1 and IL-6 promotes the metastatic phenotype in breast cancer cells.

    PubMed

    Castellana, Bàrbara; Aasen, Trond; Moreno-Bueno, Gema; Dunn, Sandra E; Ramón y Cajal, Santiago

    2015-11-10

    Epithelial to mesenchymal transition (EMT) induces cell plasticity and promotes metastasis. The multifunctional oncoprotein Y-box binding protein-1 (YB-1) and the pleiotropic cytokine interleukin 6 (IL-6) have both been implicated in tumor cell metastasis and EMT, but via distinct pathways. Here, we show that direct interplay between YB-1 and IL-6 regulates breast cancer metastasis. Overexpression of YB-1 in breast cancer cell lines induced IL-6 production while stimulation with IL-6 increased YB-1 expression and YB-1 phosphorylation. Either approach was sufficient to induce EMT features, including increased cell migration and invasion. Silencing of YB-1 partially reverted the EMT and blocked the effect of IL-6 while inhibition of IL-6 signaling blocked the phenotype induced by YB-1 overexpression, demonstrating a clear YB-1/IL-6 interdependence. Our findings describe a novel signaling network in which YB-1 regulates IL-6, and vice versa, creating a positive feed-forward loop driving EMT-like metastatic features during breast cancer progression. Identification of signaling partners or pathways underlying this co-dependence may uncover novel therapeutic opportunities.

  7. Autocrine Regulation of UVA-Induced IL-6 Production via Release of ATP and Activation of P2Y Receptors

    PubMed Central

    Kawano, Ayumi; Kadomatsu, Remi; Ono, Miyu; Kojima, Shuji; Tsukimoto, Mitsutoshi; Sakamoto, Hikaru

    2015-01-01

    Extracellular nucleotides, such as ATP, are released from cells in response to various stimuli and act as intercellular signaling molecules through activation of P2 receptors. Exposure to the ultraviolet radiation A (UVA) component of sunlight causes molecular and cellular damage, and in this study, we investigated the involvement of extracellular nucleotides and P2 receptors in the UVA-induced cellular response. Human keratinocyte-derived HaCaT cells were irradiated with a single dose of UVA (2.5 J/cm2), and ATP release and interleukin (IL)-6 production were measured. ATP was released from cells in response to UVA irradiation, and the release was blocked by pretreatment with inhibitors of gap junction hemichannels or P2X7 receptor antagonist. IL-6 production was increased after UVA irradiation, and this increase was inhibited by ecto-nucleotidase or by antagonists of P2Y11 or P2Y13 receptor. These results suggest that UVA-induced IL-6 production is mediated by release of ATP through hemichannels and P2X7 receptor, followed by activation of P2Y11 and P2Y13 receptors. Interestingly, P2Y11 and P2Y13 were associated with the same pattern of IL-6 production, though they trigger different intracellular signaling cascades: Ca2+-dependent and PI3K-dependent, respectively. Thus, IL-6 production in response to UVA-induced ATP release involves at least two distinct pathways, mediated by activation of P2Y11 and P2Y13 receptors. PMID:26030257

  8. Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

    PubMed Central

    Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

    2014-01-01

    Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

  9. Catechol Groups Enable Reactive Oxygen Species Scavenging-Mediated Suppression of PKD-NFkappaB-IL-8 Signaling Pathway by Chlorogenic and Caffeic Acids in Human Intestinal Cells.

    PubMed

    Shin, Hee Soon; Satsu, Hideo; Bae, Min-Jung; Totsuka, Mamoru; Shimizu, Makoto

    2017-02-20

    Chlorogenic acid (CHA) and caffeic acid (CA) are phenolic compounds found in coffee, which inhibit oxidative stress-induced interleukin (IL)-8 production in intestinal epithelial cells, thereby suppressing serious cellular injury and inflammatory intestinal diseases. Therefore, we investigated the anti-inflammatory mechanism of CHA and CA, both of which inhibited hydrogen peroxide (H₂O₂)-induced IL-8 transcriptional activity. They also significantly suppressed nuclear factor kappa-light-chain-enhancer of activated B cells ( NF-κB ) transcriptional activity, nuclear translocation of the p65 subunit, and phosphorylation of IκB kinase (IKK). Additionally, upstream of IKK, protein kinase D (PKD) was also suppressed. Finally, we found that they scavenged H₂O₂-induced reactive oxygen species (ROS) and the functional moiety responsible for the anti-inflammatory effects of CHA and CA was the catechol group. Therefore, we conclude that the presence of catechol groups in CHA and CA allows scavenging of intracellular ROS, thereby inhibiting H₂O₂-induced IL-8 production via suppression of PKD-NF-κB signaling in human intestinal epithelial cells.

  10. Catechol Groups Enable Reactive Oxygen Species Scavenging-Mediated Suppression of PKD-NFkappaB-IL-8 Signaling Pathway by Chlorogenic and Caffeic Acids in Human Intestinal Cells

    PubMed Central

    Shin, Hee Soon; Satsu, Hideo; Bae, Min-Jung; Totsuka, Mamoru; Shimizu, Makoto

    2017-01-01

    Chlorogenic acid (CHA) and caffeic acid (CA) are phenolic compounds found in coffee, which inhibit oxidative stress-induced interleukin (IL)-8 production in intestinal epithelial cells, thereby suppressing serious cellular injury and inflammatory intestinal diseases. Therefore, we investigated the anti-inflammatory mechanism of CHA and CA, both of which inhibited hydrogen peroxide (H2O2)-induced IL-8 transcriptional activity. They also significantly suppressed nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) transcriptional activity, nuclear translocation of the p65 subunit, and phosphorylation of IκB kinase (IKK). Additionally, upstream of IKK, protein kinase D (PKD) was also suppressed. Finally, we found that they scavenged H2O2-induced reactive oxygen species (ROS) and the functional moiety responsible for the anti-inflammatory effects of CHA and CA was the catechol group. Therefore, we conclude that the presence of catechol groups in CHA and CA allows scavenging of intracellular ROS, thereby inhibiting H2O2-induced IL-8 production via suppression of PKD-NF-κB signaling in human intestinal epithelial cells. PMID:28230729

  11. HIV-1 gp120 Induces Expression of IL-6 through a Nuclear Factor-Kappa B-Dependent Mechanism: Suppression by gp120 Specific Small Interfering RNA

    PubMed Central

    Shah, Ankit; Verma, Ashish S.; Patel, Kalpeshkumar H.; Noel, Richard; Rivera-Amill, Vanessa; Silverstein, Peter S.; Chaudhary, Suman; Bhat, Hari K.; Stamatatos, Leonidas; Singh, Dhirendra P.; Buch, Shilpa; Kumar, Anil

    2011-01-01

    In addition to its role in virus entry, HIV-1 gp120 has also been implicated in HIV-associated neurocognitive disorders. However, the mechanism(s) responsible for gp120-mediated neuroinflammation remain undefined. In view of increased levels of IL-6 in HIV-positive individuals with neurological manifestations, we sought to address whether gp120 is involved in IL-6 over-expression in astrocytes. Transfection of a human astrocyte cell line with a plasmid encoding gp120 resulted in increased expression of IL-6 at the levels of mRNA and protein by 51.3±2.1 and 11.6±2.2 fold respectively; this effect of gp120 on IL-6 expression was also demonstrated using primary human fetal astrocytes. A similar effect on IL-6 expression was observed when primary astrocytes were treated with gp120 protein derived from different strains of X4 and R5 tropic HIV-1. The induction of IL-6 could be abrogated by use of gp120-specific siRNA. Furthermore, this study showed that the NF-κB pathway is involved in gp120-mediated IL-6 over-expression, as IKK-2 and IKKβ inhibitors inhibited IL-6 expression by 56.5% and 60.8%, respectively. These results were also confirmed through the use of NF-κB specific siRNA. We also showed that gp120 could increase the phosphorylation of IκBα. Furthermore, gp120 transfection in the SVGA cells increased translocation of NF-κB from cytoplasm to nucleus. These results demonstrate that HIV-1 gp120-mediated over-expression of IL-6 in astrocytes is one mechanism responsible for neuroinflammation in HIV-infected individuals and this is mediated by the NF-κB pathway. PMID:21712995

  12. Interleukin-10-induced gene expression and suppressive function are selectively modulated by the PI3K-Akt-GSK3 pathway

    PubMed Central

    Antoniv, Taras T; Ivashkiv, Lionel B

    2011-01-01

    Interleukin-10 (IL-10) is an immunosuppressive cytokine that inhibits inflammatory gene expression. Phosphatidylinositol 3-kinase (PI3K) -mediated signalling regulates inflammatory responses and can induce IL-10 production, but a role for PI3K signalling in cellular responses to IL-10 is not known. In this study we investigated the involvement of the PI3K-Akt-GSK3 signalling pathway in IL-10-induced gene expression and IL-10-mediated suppression of Toll-like receptor-induced gene expression in primary human macrophages. A combination of loss and gain of function approaches using kinase inhibitors, expression of constitutively active Akt, and RNA interference in primary human macrophages showed that expression of a subset of IL-10-inducible genes was dependent on PI3K-Akt signalling. The effects of PI3K-Akt signalling on IL-10 responses were mediated at least in part by glycogen synthase kinase 3 (GSK3). In accordance with a functional role for PI3K pathways in contributing to the suppressive actions of IL-10, PI3K signalling augmented IL-10-mediated inhibition of lipopolysaccharide-induced IL-1, IL-8 and cyclo-oxygenase-2 expression. The PI3K signalling selectively modulated IL-10 responses, as it was not required for inhibition of tumour necrosis factor expression or for induction of certain IL-10-inducible genes such as SOCS3. These findings identify a new mechanism by which PI3K-mediated signalling can suppress inflammation by regulating IL-10-mediated gene induction and anti-inflammatory function. PMID:21255011

  13. Peptide immunotherapy in allergic asthma generates IL-10–dependent immunological tolerance associated with linked epitope suppression

    PubMed Central

    Campbell, John D.; Buckland, Karen F.; McMillan, Sarah J.; Kearley, Jennifer; Oldfield, William L.G.; Stern, Lawrence J.; Grönlund, Hans; van Hage, Marianne; Reynolds, Catherine J.; Boyton, Rosemary J.; Cobbold, Stephen P.; Kay, A. Barry; Altmann, Daniel M.; Larché, Mark

    2009-01-01

    Treatment of patients with allergic asthma using low doses of peptides containing T cell epitopes from Fel d 1, the major cat allergen, reduces allergic sensitization and improves surrogate markers of disease. Here, we demonstrate a key immunological mechanism, linked epitope suppression, associated with this therapeutic effect. Treatment with selected epitopes from a single allergen resulted in suppression of responses to other (“linked”) epitopes within the same molecule. This phenomenon was induced after peptide immunotherapy in human asthmatic subjects and in a novel HLA-DR1 transgenic mouse model of asthma. Tracking of allergen-specific T cells using DR1 tetramers determined that suppression was associated with the induction of interleukin (IL)-10+ T cells that were more abundant than T cells specific for the single-treatment peptide and was reversed by anti–IL-10 receptor administration. Resolution of airway pathophysiology in this model was associated with reduced recruitment, proliferation, and effector function of allergen-specific Th2 cells. Our results provide, for the first time, in vivo evidence of linked epitope suppression and IL-10 induction in both human allergic disease and a mouse model designed to closely mimic peptide therapy in humans. PMID:19528258

  14. Cytokine-induced depression during IFN-α treatment: the role of IL-6 and sleep quality

    PubMed Central

    Prather, Aric A.; Rabinovitz, Mordechai; Pollock, Bruce G.; Lotrich, Francis E.

    2009-01-01

    Depressive symptoms, poor sleep quality, and systemic markers of inflammation (e.g. interleukin (IL)-6) are frequently associated. Interferon-alpha (IFN-α) therapy results in major depressive disorder (MDD) in some people, offering the possibility to elucidate the relationship of MDD to sleep and inflammation during treatment. In particular, delineating the temporal relations among these factors could help inform their causal relationships. To this end, a cohort of 95 non-depressed hepatitis C patients was followed prospectively for four consecutive months during IFN-α therapy. We found that higher pre-treatment levels of circulating IL-6 predicted incidence of MDD (X2(1)=7.7; p<0.05). Time-lagged mixed-effect analyses supported uni-directional associations in which IL-6 predicted next month’s PSQI scores (F(47, 11.6) = 78.4; p<0.0005), and PSQI scores predicted next month’s depressive Beck Depression Inventory-II (BDI) scores (F(16,22.6) = 3.4; p<0.005). In addition, on any given month of treatment, IL-6 levels predicted BDI symptoms the following month (F(16,97.5) = 7.3; p<0.0005), and conversely BDI predicted next month’s IL-6 (F(14,7.4) = 5.2; p<0.05) – providing evidence for a positive feedback relationship between depressive symptoms and systemic inflammation. These data provide further evidence that high levels of inflammation and poor sleep quality may be risk factors for IFN-α induced depression. Furthermore, these findings highlight the complex temporal relationships that exist among sleep, depression, and inflammation, and support the need for further prospective investigations to elucidate the dynamics that underlie depression during IFN-α treatment. PMID:19615438

  15. The secreted form of the p40 subunit of interleukin (IL)-12 inhibits IL-23 functions and abrogates IL-23-mediated antitumour effects

    PubMed Central

    Shimozato, Osamu; Ugai, Shin-ichi; Chiyo, Masako; Takenobu, Hisanori; Nagakawa, Hiroyasu; Wada, Akihiko; Kawamura, Kiyoko; Yamamoto, Hiroshi; Tagawa, Masatoshi

    2006-01-01

    Interleukin (IL)-23 is a heterodimeric cytokine consisting of a novel p19 molecule and the p40 subunit of IL-12. Since secreted p40 can act as an antagonist for IL-12, we investigated whether p40 also inhibited IL-23-mediated immunological functions. p40 did not induce interferon (IFN)-γ or IL-17 production from splenocytes but impaired IL-23-induced cytokine production by competitive binding to the IL-23 receptors. Furthermore, a mixed population of murine colon carcinoma Colon 26 cells transduced with the p40 gene and those transduced with the IL-23 gene developed tumours in syngenic mice, whereas the IL-23-expressing Colon 26 cells were completely rejected. p40 also suppressed IFN-γ production of antigen-stimulated splenocytes and IL-23-mediated cytotoxic T-lymphocyte activities in the mice that rejected Colon 26 cells expressing IL-23. p40 can thereby antagonize IL-23 and is a possible therapeutic agent for suppression of IL-23 functions. PMID:16423037

  16. In vitro effects of CpG oligodeoxynucleotides delivered by gelatin nanoparticles on canine peripheral blood mononuclear cells of atopic and healthy dogs - a pilot study.

    PubMed

    Prélaud, Ana Rostaher; Fuchs, Sebastian; Weber, Karin; Winter, Gerhard; Coester, Conrad; Mueller, Ralf S

    2013-10-01

    Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides offer a novel promising immunotherapeutic approach for atopic dermatitis (AD) both in humans and animals. Gelatin nanoparticles (GNP) enhance and prolong CpG-associated immunomodulatory effects and minimize adverse effects both in vitro and in vivo. Information about the effects of this combination in dogs is lacking. The aim of this study was to evaluate immunological effects of CpG coupled to GNP on canine peripheral blood mononuclear cells (PBMCs) in vitro. Eight dogs with AD, diagnosed by standard criteria and with a concurrent immediate hypersensitivity to house dust mites were included. Control samples were taken from eight healthy, age-matched control dogs without history or evidence of cutaneous or systemic illness. Peripheral blood mononuclear cells of healthy and allergic dogs were incubated with CpG-GNP and the uptake of CpG-GNP was demonstrated using confocal laser scanning microscopy. Cell culture supernatant concentrations of interferon gamma (IFN-γ), interleukin (IL)-4, IL-6 and IL-10 were measured by Canine Cytokine Milliplex. No significant changes in IFN-γ and IL-4 were found when comparing PBMCs incubated with CpG and CpG-GNP with the negative controls in atopic and healthy dogs. Interleukin-6 was not detected in any of the groups. However, a statistically significant increase in IL-10 concentration was found after 24 h stimulation with CpG-GNP compared with CpG alone both in atopic and healthy dogs. As IL-10 is considered an immunosuppressive cytokine playing a key role in peripheral tolerance; the reported CpG-GNP formulation could be a new approach in allergy treatment. © 2013 ESVD and ACVD.

  17. Inhibition of IL-6 Signaling Pathway by Curcumin in Uterine Decidual Cells

    PubMed Central

    Devi, Y. Sangeeta; DeVine, Majesta; DeKuiper, Justin; Ferguson, Susan; Fazleabas, Asgerally T.

    2015-01-01

    IL-6 is a multifunctional pro-inflammatory cytokine and has been implicated in many gestational disorders including preterm birth. Currently, there are no appropriate therapeutic interventions available to circumvent inflammatory-mediated gestational disorders. Therefore, the goal of this study was to identify a safe and effective pharmacological compound to counterbalance inflammatory responses in the uterus. Curcumin, a naturally-occuring polyphenolic compound, has been widely used in alternative medicine to treat inflammatory diseases. However, the anti-inflammatory effect of curcumin has not been explored in uterine decidual cells, a major source of IL-6. Therefore, we examined the effect of curcumin on IL-6 expression using two types of uterine decidual cells 1) HuF cells, primary human fibroblast cells obtained from the decidua parietalis; 2) UIII cells, a rodent non-transformed decidual cell line. Curcumin treatment completely abrogated the expression of IL-1β-induced IL-6 in these cells. Curcumin also strongly inhibited the expression of gp130, a critical molecule in IL-6 signaling, whereas expression of IL-6R and sIL-6R was not affected. Curcumin also inhibited phosphorylation and nuclear localization of STAT3, a well-known downstream mediator of IL-6 signaling. Furthermore, curcumin attenuated IL-1β-induced IL-6 promoter reporter activity suggesting transcriptional regulation. To further understand whether NF-ҡB is involved in this inhibition, we examined the effect of curcumin on the expression of p50 and p65 subunits of NF-ҡB in decidual cells. Expression of IL-1β-induced p50 mRNA was repressed by curcumin while p65 mRNA was not affected. However, curcumin treatment dramatically inhibited both p50 and p65 protein levels and prevented its nuclear localization. This effect is at least partly mediated through the deactivation of IKK, since IL-1β-induced IKKα/β phosphorylation is decreased upon curcumin treatment. Our results not only revealed

  18. Flavones Isolated from Scutellariae radix Suppress Propionibacterium Acnes-Induced Cytokine Production In Vitro and In Vivo.

    PubMed

    Tsai, Po-Jung; Huang, Wen-Cheng; Hsieh, Ming-Chi; Sung, Ping-Jyun; Kuo, Yueh-Hsiung; Wu, Wen-Huey

    2015-12-24

    Scutellariae radix, the root of Scutellaria baicalensis, has long been applied in traditional formulations and modern herbal medications. Propionibacterium acnes (P. acnes) in follicles can trigger inflammation and lead to the symptom of inflammatory acnes vulgaris. This study was aimed at evaluating the effect of Scutellariae radix extract and purified components isolated from it on inflammation induced by P. acnes in vitro and in vivo. The results showed the ethyl acetate (EA) soluble fraction from the partition of crude ethanolic extract from Scutellariae radix inhibited P. acnes-induced interleukin IL-8 and IL-1β production in human monocytic THP-1 cells. Seven flavones were isolated from the EA fraction by repeated chromatographies, and identified as 5,7-dihydroxy-6-methoxyflavone (FL1, oroxylin), 5,7-dihydroxy-8-methoxyflavone (FL2, wogonin), 5-hydroxy-7,8-dimethoxyflavone (FL3, 7-O-methylwogonin), 5,6'-dihydroxy-6,7,8,2'-tetramethoxy flavone (FL4, skullcapflavone II), 5,7,4'-trihydroxy-8-methoxyflavone (FL5), 5,2',6'-trihydroxy-7,8-dimethoxyflavone (FL6, viscidulin II), and 5,7,2',5'-tetrahydroxy-8,6'-dimethoxyflavone (FL7, ganhuangenin). They all significantly suppressed P. acnes-induced IL-8 and IL-1β production in THP-1 cells, and FL2 exerted the strongest effect with half maximal inhibition (IC50) values of 8.7 and 4.9 μM, respectively. Concomitant intradermal injection of each of the seven flavones (20 μg) with P. acnes effectively attenuated P. acnes-induced ear swelling, and decreased the production of IL-6 and tumor necrosis factor-α in ear homogenates. Our results suggested that all the seven flavones can be potential therapeutic agents against P. acnes-induced skin inflammation.

  19. Protein kinase CK2 modulates IL-6 expression in inflammatory breast cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Drygin, Denis, E-mail: ddrygin@cylenepharma.com; Ho, Caroline B.; Omori, Mayuko

    Highlights: Black-Right-Pointing-Pointer We examine the potential cross-talk between CK2 and IL-6. Black-Right-Pointing-Pointer Inhibition of CK2 by siRNA or CX-4945 inhibits expression of IL-6 in models of IBC. Black-Right-Pointing-Pointer Treatment of IBC patient in the clinic with CX-4945 reduces her IL-6 plasma levels. Black-Right-Pointing-Pointer We demonstrate that CK2 is a potential therapeutic target for IL-6 driven diseases. -- Abstract: Inflammatory breast cancer is driven by pro-angiogenic and pro-inflammatory cytokines. One of them Interleukin-6 (IL-6) is implicated in cancer cell proliferation and survival, and promotes angiogenesis, inflammation and metastasis. While IL-6 has been shown to be upregulated by several oncogenes, the mechanismmore » behind this phenomenon is not well characterized. Here we demonstrate that the pleotropic Serine/Threonine kinase CK2 is implicated in the regulation of IL-6 expression in a model of inflammatory breast cancer. We used siRNAs targeted toward CK2 and a selective small molecule inhibitor of CK2, CX-4945, to inhibit the expression and thus suppress the secretion of IL-6 in in vitro as well as in vivo models. Moreover, we report that in a clinical trial, CX-4945 was able to dramatically reduce IL-6 levels in plasma of an inflammatory breast cancer patient. Our data shed a new light on the regulation of IL-6 expression and position CX-4945 and potentially other inhibitors of CK2, for the treatment of IL-6-driven cancers and possibly other diseases where IL-6 is instrumental, including rheumatoid arthritis.« less

  20. Rice bran protein hydrolysates prevented interleukin-6- and high glucose-induced insulin resistance in HepG2 cells.

    PubMed

    Boonloh, Kampeebhorn; Kukongviriyapan, Upa; Pannangpetch, Patchareewan; Kongyingyoes, Bunkerd; Senggunprai, Laddawan; Prawan, Auemduan; Thawornchinsombut, Supawan; Kukongviriyapan, Veerapol

    2015-02-01

    Rice bran, which is a byproduct of rice milling process, contains various nutrients and biologically active compounds. Rice bran protein hydrolysates have various pharmacological activities such as antidiabetic and antidyslipidemic effects. However, there are limited studies about the mechanisms of rice bran protein hydrolysates (RBP) on insulin resistance and lipid metabolism. RBP used in this study were prepared from Thai Jasmine rice. When HepG2 cells were treated with IL-6, the IRS-1 expression and Akt phosphorylation were suppressed. This effect of IL-6 was prevented by RBP in association with inhibition of STAT3 phosphorylation and SOCS3 expression. RBP could increase the phospho-AMPK levels and inhibit IL-6- or high glucose-induced suppression of AMPK and Akt activation. High glucose-induced dysregulation of the expression of lipogenic genes, including SREBP-1c, FASN and CPT-1, was normalized by RBP treatment. Moreover, impaired glucose utilization in insulin resistant HepG2 cells was significantly alleviated by concurrent treatment with RBP. Our results suggested that RBP suppresses inflammatory cytokine signaling and activates AMPK, and thereby these effects may underlie the insulin sensitizing effect.

  1. NF-κB-Induced IL-6 Ensures STAT3 Activation and Tumor Aggressiveness in Glioblastoma

    PubMed Central

    McFarland, Braden C.; Hong, Suk W.; Rajbhandari, Rajani; Twitty, George B.; Gray, G. Kenneth; Yu, Hao; Benveniste, Etty N.; Nozell, Susan E.

    2013-01-01

    Glioblastoma (GBM) is the most aggressive, neurologically destructive and deadly tumor of the central nervous system (CNS). In GBM, the transcription factors NF-κB and STAT3 are aberrantly activated and associated with tumor cell proliferation, survival, invasion and chemoresistance. In addition, common activators of NF-κB and STAT3, including TNF-α and IL-6, respectively, are abundantly expressed in GBM tumors. Herein, we sought to elucidate the signaling crosstalk that occurs between the NF-κB and STAT3 pathways in GBM tumors. Using cultured GBM cell lines as well as primary human GBM xenografts, we elucidated the signaling crosstalk between the NF-κB and STAT3 pathways utilizing approaches that either a) reduce NF-κB p65 expression, b) inhibit NF-κB activation, c) interfere with IL-6 signaling, or d) inhibit STAT3 activation. Using the clinically relevant human GBM xenograft model, we assessed the efficacy of inhibiting NF-κB and/or STAT3 alone or in combination in mice bearing intracranial xenograft tumors in vivo. We demonstrate that TNF-α-induced activation of NF-κB is sufficient to induce IL-6 expression, activate STAT3, and elevate STAT3 target gene expression in GBM cell lines and human GBM xenografts in vitro. Moreover, the combined inhibition of NF-κB and STAT3 signaling significantly increases survival of mice bearing intracranial tumors. We propose that in GBM, the activation of NF-κB ensures subsequent STAT3 activation through the expression of IL-6. These data verify that pharmacological interventions to effectively inhibit the activity of both NF-κB and STAT3 transcription factors must be used in order to reduce glioma size and aggressiveness. PMID:24244348

  2. NF-κB-induced IL-6 ensures STAT3 activation and tumor aggressiveness in glioblastoma.

    PubMed

    McFarland, Braden C; Hong, Suk W; Rajbhandari, Rajani; Twitty, George B; Gray, G Kenneth; Yu, Hao; Benveniste, Etty N; Nozell, Susan E

    2013-01-01

    Glioblastoma (GBM) is the most aggressive, neurologically destructive and deadly tumor of the central nervous system (CNS). In GBM, the transcription factors NF-κB and STAT3 are aberrantly activated and associated with tumor cell proliferation, survival, invasion and chemoresistance. In addition, common activators of NF-κB and STAT3, including TNF-α and IL-6, respectively, are abundantly expressed in GBM tumors. Herein, we sought to elucidate the signaling crosstalk that occurs between the NF-κB and STAT3 pathways in GBM tumors. Using cultured GBM cell lines as well as primary human GBM xenografts, we elucidated the signaling crosstalk between the NF-κB and STAT3 pathways utilizing approaches that either a) reduce NF-κB p65 expression, b) inhibit NF-κB activation, c) interfere with IL-6 signaling, or d) inhibit STAT3 activation. Using the clinically relevant human GBM xenograft model, we assessed the efficacy of inhibiting NF-κB and/or STAT3 alone or in combination in mice bearing intracranial xenograft tumors in vivo. We demonstrate that TNF-α-induced activation of NF-κB is sufficient to induce IL-6 expression, activate STAT3, and elevate STAT3 target gene expression in GBM cell lines and human GBM xenografts in vitro. Moreover, the combined inhibition of NF-κB and STAT3 signaling significantly increases survival of mice bearing intracranial tumors. We propose that in GBM, the activation of NF-κB ensures subsequent STAT3 activation through the expression of IL-6. These data verify that pharmacological interventions to effectively inhibit the activity of both NF-κB and STAT3 transcription factors must be used in order to reduce glioma size and aggressiveness.

  3. The Akt1/IL-6/STAT3 pathway regulates growth of lung tumor initiating cells.

    PubMed

    Malanga, Donatella; De Marco, Carmela; Guerriero, Ilaria; Colelli, Fabiana; Rinaldo, Nicola; Scrima, Marianna; Mirante, Teresa; De Vitis, Claudia; Zoppoli, Pietro; Ceccarelli, Michele; Riccardi, Miriam; Ravo, Maria; Weisz, Alessandro; Federico, Antonella; Franco, Renato; Rocco, Gaetano; Mancini, Rita; Rizzuto, Antonia; Gulletta, Elio; Ciliberto, Gennaro; Viglietto, Giuseppe

    2015-12-15

    Here we report that the PI3K/Akt1/IL-6/STAT3 signalling pathway regulates generation and stem cell-like properties of Non-Small Cell Lung Cancer (NSCLC) tumor initiating cells (TICs). Mutant Akt1, mutant PIK3CA or PTEN loss enhances formation of lung cancer spheroids (LCS), self-renewal, expression of stemness markers and tumorigenic potential of human immortalized bronchial cells (BEAS-2B) whereas Akt inhibition suppresses these activities in established (NCI-H460) and primary NSCLC cells. Matched microarray analysis of Akt1-interfered cells and LCSs identified IL-6 as a critical target of Akt signalling in NSCLC TICs. Accordingly, suppression of Akt in NSCLC cells decreases IL-6 levels, phosphorylation of IkK and IkB, NF-kB transcriptional activity, phosphorylation and transcriptional activity of STAT3 whereas active Akt1 up-regulates them. Exposure of LCSs isolated from NSCLC cells to blocking anti-IL-6 mAbs, shRNA to IL-6 receptor or to STAT3 markedly reduces the capability to generate LCSs, to self-renew and to form tumors, whereas administration of IL-6 to Akt-interfered cells restores the capability to generate LCSs. Finally, immunohistochemical studies in NSCLC patients demonstrated a positive correlative trend between activated Akt, IL-6 expression and STAT3 phosphorylation (n = 94; p < 0.05). In conclusion, our data indicate that aberrant Akt signalling contributes to maintaining stemness in lung cancer TICs through a NF-kB/IL-6/STAT3 pathway and provide novel potential therapeutic targets for eliminating these malignant cells in NSCLC.

  4. Endogenous IL-6 of mesenchymal stem cell improves behavioral outcome of hypoxic-ischemic brain damage neonatal rats by supressing apoptosis in astrocyte

    PubMed Central

    Gu, Yan; He, Mulan; Zhou, Xiaoqin; Liu, Jinngjing; Hou, Nali; Bin, Tan; Zhang, Yun; Li, Tingyu; Chen, Jie

    2016-01-01

    Mesenchymal stem cell (MSC) transplantation reduces the neurological impairment caused by hypoxic-ischemic brain damage (HIBD) via immunomodulation. In the current study, we found that MSC transplantation improved learning and memory function and enhanced long-term potentiation in neonatal rats subjected to HIBD and the amount of IL-6 released from MSCs was far greater than that of other cytokines. However, the neuroprotective effect of MSCs infected with siIL-6-transduced recombinant lentivirus (siIL-6 MSCs) was significantly weakened in the behavioural tests and electrophysiological analysis. Meanwhile, the hippocampal IL-6 levels were decreased following siIL-6 MSC transplantation. In vitro, the levels of IL-6 release and the levels of IL-6R and STAT3 expression were increased in both primary neurons and astrocytes subjected to oxygen and glucose deprivation (OGD) following MSCs co-culture. The anti-apoptotic protein Bcl-2 was upregulated and the pro-apoptotic protein Bax was downregulated in OGD-injured astrocytes co-cultured with MSCs. However, the siIL-6 MSCs suppressed ratio of Bcl-2/Bax in the injured astrocytes and induced apoptosis number of the injured astrocytes. Taken together, these data suggest that the neuroprotective effect of MSC transplantation in neonatal HIBD rats is partly mediated by IL-6 to enhance anti-apoptosis of injured astrocytes via the IL-6/STAT3 signaling pathway. PMID:26766745

  5. Endogenous IL-6 of mesenchymal stem cell improves behavioral outcome of hypoxic-ischemic brain damage neonatal rats by supressing apoptosis in astrocyte.

    PubMed

    Gu, Yan; He, Mulan; Zhou, Xiaoqin; Liu, Jinngjing; Hou, Nali; Bin, Tan; Zhang, Yun; Li, Tingyu; Chen, Jie

    2016-01-14

    Mesenchymal stem cell (MSC) transplantation reduces the neurological impairment caused by hypoxic-ischemic brain damage (HIBD) via immunomodulation. In the current study, we found that MSC transplantation improved learning and memory function and enhanced long-term potentiation in neonatal rats subjected to HIBD and the amount of IL-6 released from MSCs was far greater than that of other cytokines. However, the neuroprotective effect of MSCs infected with siIL-6-transduced recombinant lentivirus (siIL-6 MSCs) was significantly weakened in the behavioural tests and electrophysiological analysis. Meanwhile, the hippocampal IL-6 levels were decreased following siIL-6 MSC transplantation. In vitro, the levels of IL-6 release and the levels of IL-6R and STAT3 expression were increased in both primary neurons and astrocytes subjected to oxygen and glucose deprivation (OGD) following MSCs co-culture. The anti-apoptotic protein Bcl-2 was upregulated and the pro-apoptotic protein Bax was downregulated in OGD-injured astrocytes co-cultured with MSCs. However, the siIL-6 MSCs suppressed ratio of Bcl-2/Bax in the injured astrocytes and induced apoptosis number of the injured astrocytes. Taken together, these data suggest that the neuroprotective effect of MSC transplantation in neonatal HIBD rats is partly mediated by IL-6 to enhance anti-apoptosis of injured astrocytes via the IL-6/STAT3 signaling pathway.

  6. TLR9-ERK-mTOR signaling is critical for autophagic cell death induced by CpG oligodeoxynucleotide 107 combined with irradiation in glioma cells

    PubMed Central

    Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong

    2016-01-01

    Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306

  7. [Effects of lipopolysaccharides extracted from Porphyromonas endodontalis on the expression of IL-1beta mRNA and IL-6 mRNA in osteoblasts].

    PubMed

    Yang, Di; Li, Ren; Qiu, Li-Hong; Li, Chen

    2009-04-01

    To quantify the IL-1 beta mRNA and IL-6 mRNA expression induced by lipopolysaccharides (LPS)extracted from Porphyromonas endodontalis(P.e) in osteoblasts, and to relate P.e-LPS to bone absorption pathogenesis in lesions of chronical apical periodontitis. MG63 was treated with different concentrations of P.e-LPS(0-50 microg/mL) for different hours(0-24h). The expression of IL-1 beta mRNA and IL-6 mRNA was detected by reverse transcription polymerase chain reaction (RT-PCR).Statistical analysis was performed using one- way ANOVA and Dunnett t test with SPSS11.0 software package. The level of IL-1 beta mRNA and IL-6 mRNA increased significantly after treatment with P.e-LPS at more than 5 microg/mL (P<0.01)and for more than 1 hour (P<0.01), which indicated that P.e-LPS induced osteoblasts to express IL-1 beta mRNA and IL-6 mRNA in dose and time dependent manners. P.e-LPS may promote bone resorption in lesions of chronical apical periodontitis by inducing IL-1 beta mRNA and IL-6 mRNA expression in osteoblasts.

  8. Cytokines TNF-α, IL-6, IL-17F, and IL-4 Differentially Affect Osteogenic Differentiation of Human Adipose Stem Cells

    PubMed Central

    Bravenboer, Nathalie

    2016-01-01

    During the initial stages of bone repair, proinflammatory cytokines are released within the injury site, quickly followed by a shift to anti-inflammatory cytokines. The effect of pro- and anti-inflammatory cytokines on osteogenic differentiation of mesenchymal stem cells is controversial. Here, we investigated the effect of the proinflammatory cytokines TNF-α, IL-6, IL-8, and IL-17F and the anti-inflammatory cytokine IL-4 on proliferation and osteogenic differentiation of human adipose stem cells (hASCs). hASCs were treated with TNF-α, IL-6, IL-8, IL-17F, or IL-4 (10 ng/mL) for 72 h mimicking bone repair. TNF-α reduced collagen type I gene expression but increased hASC proliferation and ALP activity. IL-6 also strongly enhanced ALP activity (18-fold), as well as bone nodule formation by hASCs. IL-8 did not affect proliferation or osteogenic gene expression but reduced bone nodule formation. IL-17F decreased hASC proliferation but enhanced ALP activity. IL-4 enhanced osteocalcin gene expression and ALP activity but reduced RUNX2 gene expression and bone nodule formation. In conclusion, all cytokines studied have both enhancing and reducing effects on osteogenic differentiation of hASCs, even when applied for 72 h only. Some cytokines, specifically IL-6, may be suitable to induce osteogenic differentiation of mesenchymal stem cells as a strategy for enhancing bone repair. PMID:27667999

  9. Early IL-6 signalling promotes IL-27 dependent maturation of regulatory T cells in the lungs and resolution of viral immunopathology.

    PubMed

    Pyle, Chloe J; Uwadiae, Faith I; Swieboda, David P; Harker, James A

    2017-09-01

    Interleukin-6 is a pleiotropic, pro-inflammatory cytokine that can promote both innate and adaptive immune responses. In humans with respiratory virus infections, such as Respiratory Syncytial Virus (RSV), elevated concentrations of IL-6 are associated with more severe disease. In contrast the polymorphisms in the Il6 promoter which favour lower IL-6 production are associated with increased risk of both RSV and Rhinovirus infections. To determine the precise contribution of IL-6 to protection and pathology we used murine models of respiratory virus infection. RSV infection resulted in increased IL-6 production both in the airways and systemically which remained heightened for at least 2 weeks. IL-6 depletion early, but not late, during RSV or Influenza A virus infection resulted in significantly increased disease associated with an influx of virus specific TH1 and cytotoxic CD8+ T cells, whilst not affecting viral clearance. IL-6 acted by driving production of the immunoregulatory cytokine IL-27 by macrophages and monocytes, which in turn promoted the local maturation of regulatory T cells. Concordantly IL-27 was necessary to regulate TH1 responses in the lungs, and sufficient to limit RSV induced disease. Overall we found that during respiratory virus infection the prototypic inflammatory cytokine IL-6 is a critical anti-inflammatory regulator of viral induced immunopathology in the respiratory tract through its induction of IL-27.

  10. Early IL-6 signalling promotes IL-27 dependent maturation of regulatory T cells in the lungs and resolution of viral immunopathology

    PubMed Central

    Swieboda, David P.

    2017-01-01

    Interleukin-6 is a pleiotropic, pro-inflammatory cytokine that can promote both innate and adaptive immune responses. In humans with respiratory virus infections, such as Respiratory Syncytial Virus (RSV), elevated concentrations of IL-6 are associated with more severe disease. In contrast the polymorphisms in the Il6 promoter which favour lower IL-6 production are associated with increased risk of both RSV and Rhinovirus infections. To determine the precise contribution of IL-6 to protection and pathology we used murine models of respiratory virus infection. RSV infection resulted in increased IL-6 production both in the airways and systemically which remained heightened for at least 2 weeks. IL-6 depletion early, but not late, during RSV or Influenza A virus infection resulted in significantly increased disease associated with an influx of virus specific TH1 and cytotoxic CD8+ T cells, whilst not affecting viral clearance. IL-6 acted by driving production of the immunoregulatory cytokine IL-27 by macrophages and monocytes, which in turn promoted the local maturation of regulatory T cells. Concordantly IL-27 was necessary to regulate TH1 responses in the lungs, and sufficient to limit RSV induced disease. Overall we found that during respiratory virus infection the prototypic inflammatory cytokine IL-6 is a critical anti-inflammatory regulator of viral induced immunopathology in the respiratory tract through its induction of IL-27. PMID:28953978

  11. Acidic environment augments FcεRI-mediated production of IL-6 and IL-13 in mast cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kamide, Yosuke, E-mail: m08702012@gunma-u.ac.jp; Clinical Research Center for Allergy and Rheumatology, Sagamihara National Hospital, Sagamihara; Ishizuka, Tamotsu

    Although blood pH is maintained in a narrow range of around pH 7.4 in living organisms, inflammatory loci are characterized by acidic conditions. Mast cells tend to reside close to the surface of the body in areas such as the mucosa and skin where they may be exposed to exogenous acids, and they play an important role in immune responses. However, little is known about the effects of extracellular acidification on the functions of mast cell. Here, we found that extracellular acidification increased the dinitrophenyl-conjugated human serum albumin (DNP-HSA)-induced production of interleukin (IL)-6 and IL-13 in MC/9 cells or bonemore » marrow-derived mouse mast cells sensitized with anti-DNP IgE. Extracellular acidification also inhibited migration of MC/9 cells toward DNP-HSA. In addition, acidic pH stimulated antigen-induced activation of p38 mitogen-activated protein kinase (MAPK) and protein kinase B (Akt). These findings suggest that extracellular acidification augmented antigen/IgE-induced and FcεRI-mediated production of IL-6 and IL-13 in mast cells, and that this was associated with the enhancement of p38 MAPK and Akt activation. - Highlights: • Antigen-induced IL-6 and IL-13 production was augmented by acidic pH in mast cells. • Acidic pH-induced actions were associated with activation of p38 MAPK and Akt. • Inhibition of p38 MAPK and Akt attenuated cytokine responses to acidic pH. • Acidic pH effects are not attributable to actions of known proton-sensing GPCRs.« less

  12. IL-7 treatment augments and prolongs sepsis-induced expansion of IL-10-producing B lymphocytes and myeloid-derived suppressor cells

    PubMed Central

    Win, Stephanie J.; Bauer, Michael

    2018-01-01

    Immunological dysregulation in sepsis is associated with often lethal secondary infections. Loss of effector cells and an expansion of immunoregulatory cell populations both contribute to sepsis-induced immunosuppression. The extent and duration of this immunosuppression are unknown. Interleukin 7 (IL-7) is important for the maintenance of lymphocytes and can accelerate the reconstitution of effector lymphocytes in sepsis. How IL-7 influences immunosuppressive cell populations is unknown. We have used the mouse model of peritoneal contamination and infection (PCI) to investigate the expansion of immunoregulatory cells as long-term sequelae of sepsis with or without IL-7 treatment. We analysed the frequencies and numbers of regulatory T cells (Tregs), double negative T cells, IL-10 producing B cells and myeloid-derived suppressor cells (MDSCs) for 3.5 months after sepsis induction. Sepsis induced an increase in IL-10+ B cells, which was enhanced and prolonged by IL-7 treatment. An increased frequency of MDSCs in the spleen was still detectable 3.5 months after sepsis induction and this was more pronounced in IL-7-treated mice. MDSCs from septic mice were more potent at suppressing T cell proliferation than MDSCs from control mice. Our data reveal that sepsis induces a long lasting increase in IL-10+ B cells and MDSCs. Late-onset IL-7 treatment augments this increase, which should be relevant for clinical interventions. PMID:29466409

  13. IL-7 treatment augments and prolongs sepsis-induced expansion of IL-10-producing B lymphocytes and myeloid-derived suppressor cells.

    PubMed

    Kulkarni, Upasana; Herrmenau, Christoph; Win, Stephanie J; Bauer, Michael; Kamradt, Thomas

    2018-01-01

    Immunological dysregulation in sepsis is associated with often lethal secondary infections. Loss of effector cells and an expansion of immunoregulatory cell populations both contribute to sepsis-induced immunosuppression. The extent and duration of this immunosuppression are unknown. Interleukin 7 (IL-7) is important for the maintenance of lymphocytes and can accelerate the reconstitution of effector lymphocytes in sepsis. How IL-7 influences immunosuppressive cell populations is unknown. We have used the mouse model of peritoneal contamination and infection (PCI) to investigate the expansion of immunoregulatory cells as long-term sequelae of sepsis with or without IL-7 treatment. We analysed the frequencies and numbers of regulatory T cells (Tregs), double negative T cells, IL-10 producing B cells and myeloid-derived suppressor cells (MDSCs) for 3.5 months after sepsis induction. Sepsis induced an increase in IL-10+ B cells, which was enhanced and prolonged by IL-7 treatment. An increased frequency of MDSCs in the spleen was still detectable 3.5 months after sepsis induction and this was more pronounced in IL-7-treated mice. MDSCs from septic mice were more potent at suppressing T cell proliferation than MDSCs from control mice. Our data reveal that sepsis induces a long lasting increase in IL-10+ B cells and MDSCs. Late-onset IL-7 treatment augments this increase, which should be relevant for clinical interventions.

  14. Cystine improves survival rates in a LPS-induced sepsis mouse model.

    PubMed

    Tanaka, Kenji A K; Kurihara, Shigekazu; Shibakusa, Tetsuro; Chiba, Yasumasa; Mikami, Takashi

    2015-12-01

    The control of inflammation is important for suppressing severe sepsis. Oral administration of cystine and theanine have been shown to suppress inflammatory responses due to invasion. Furthermore, the uptake of cystine into monocytes is promoted by exposure to lipopolysaccharide (LPS). In the present study, the effects of cystine were examined in the context of inflammatory responses. Cystine was orally administered to mice, and the levels of interleukin (IL)-6 in the blood and spleen and the survival rates were calculated after the administration of LPS. The effects of cystine as well as neutralising anti-IL-10 antibodies on the LPS-induced production of IL-6 and IL-10 were examined in a monocyte cell line. The oral administration of cystine reduced IL-6 levels in the blood and spleen after LPS stimulation and improved survival rates. The addition of cystine to monocytes suppressed LPS-induced IL-6 production but enhanced IL-10 production. A neutralising anti-IL-10 antibody eliminated the inhibitory effects of cystine on the LPS-induced production of IL-6. The oral administration of cystine suppressed IL-6 production following LPS stimulation and improved survival rates in mice with LPS-induced sepsis. The enhanced production of IL-10 by monocytes may be involved in this anti-inflammatory response. Copyright © 2014 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

  15. Colonization with Heligmosomoides polygyrus suppresses mucosal IL-17 production.

    PubMed

    Elliott, David E; Metwali, Ahmed; Leung, John; Setiawan, Tommy; Blum, Arthur M; Ince, M Nedim; Bazzone, Lindsey E; Stadecker, Miguel J; Urban, Joseph F; Weinstock, Joel V

    2008-08-15

    Helminth exposure appears to protect hosts from inappropriate inflammatory responses, such as those causing inflammatory bowel disease. A recently identified, strongly proinflammatory limb of the immune response is characterized by T cell IL-17 production. Many autoimmune type inflammatory diseases are associated with IL-17 release. Because helminths protect from these diseases, we examined IL-17 production in helminth-colonized mice. We colonized mice with Heligmosomoides polygyrus, an intestinal helminth, and analyzed IL-17 production by lamina propria mononuclear cells (LPMC) and mesenteric lymph node (MLN) cells. Colonization with H. polygyrus reduces IL-17A mRNA by MLN cells and inhibits IL-17 production by cultured LPMC and MLN cells. Helminth exposure augments IL-4 and IL-10 production. Blocking both IL-4 and IL-10, but not IL-10 alone, restores IL-17 production in vitro. Colonization of colitic IL-10-deficient mice with H. polygyrus suppresses LPMC IL-17 production and improves colitis. Ab-mediated blockade of IL-17 improves colitis in IL-10-deficient mice. Thus, helminth-associated inhibition of IL-17 production is most likely an important mechanism mediating protection from inappropriate intestinal inflammation.

  16. Essential role of Stat6 in IL-4 signalling.

    PubMed

    Takeda, K; Tanaka, T; Shi, W; Matsumoto, M; Minami, M; Kashiwamura, S; Nakanishi, K; Yoshida, N; Kishimoto, T; Akira, S

    1996-04-18

    Interleukin-4 (IL-4) is a pleiotropic lymphokine which plays an important role in the immune system. IL-4 activates two distinct signalling pathways through tyrosine phosphorylation of Stat6, a signal transducer and activator of transcription, and of a 170K protein called 4PS. To investigate the functional role of Stat6 in IL-4 signalling, we generated mice deficient in Stat6 by gene targeting. We report here that in the mutant mice, expression of CD23 and major histocompatibility complex (MHC) class II in resting B cells was not enhanced in response to IL-4. IL-4 induced B-cell proliferation costimulated by anti-IgM antibody was abolished. The T-cell proliferative response was also notably reduced. Furthermore, production of Th2 cytokines from T cells as well as IgE and IgG1 responses after nematode infection were profoundly reduced. These findings agreed with those obtained in IL-4 deficient mice or using antibodies to IL-4 and the IL-4 receptor. We conclude that Stat6 plays a central role in exerting IL-4 mediated biological responses.

  17. Lemongrass effects on IL-1beta and IL-6 production by macrophages.

    PubMed

    Sforcin, J M; Amaral, J T; Fernandes, A; Sousa, J P B; Bastos, J K

    2009-01-01

    Cymbopogon citratus has been widely recognised for its ethnobotanical and medicinal usefulness. Its insecticidal, antimicrobial and therapeutic properties have been reported, but little is known about its effect on the immune system. This work aimed to investigate the in vivo effect of a water extract of lemongrass on pro-inflammatory cytokine (IL-1beta and IL-6) production by macrophages of BALB/c mice. The action of lemongrass essential oil on cytokine production by macrophages was also analysed in vitro. The chemical composition of the extract and the oil was also investigated. Treatment of mice with water extract of lemongrass inhibited macrophages to produce IL-1beta but induced IL-6 production by these cells. Lemongrass essential oil inhibited the cytokine production in vitro. Linalool oxide and epoxy-linalool oxide were found to be the major components of lemongrass water extract, and neral and geranial were the major compounds of its essential oil. Taken together, these data suggest an anti-inflammatory action of this natural product.

  18. Sucrose, But Not Glucose, Blocks IL1-β-Induced Inflammatory Response in Human Chondrocytes by Inducing Autophagy via AKT/mTOR Pathway.

    PubMed

    Khan, Nazir M; Ansari, Mohammad Y; Haqqi, Tariq M

    2017-03-01

    Pathogenesis of osteoarthritis (OA) is multifactorial but interleukin-1β (IL-1β) is known to be an important mediator of cartilage degradation. Autophagy is an essential cellular homeostasis mechanism and has been proposed to protect against cartilage degradation and chondrocyte death under pathological conditions. We investigated the role of autophagy activated by sucrose, a natural disaccharide, in suppressing inflammatory mediator's expression and cell death under pathological conditions in human chondrocytes. Autophagy activation was investigated by Western blotting for LC3 and Beclin-1, immunofluorescence staining for LC3 puncta, and measuring autophagic flux. Activation of mTOR, AKT, and P70S6K was evaluated by Western blotting. Chondrocyte apoptosis was evaluated by propidium iodide (PI) staining using flowcytometry, expression of Bax by Western blotting, gene expression by TaqMan assays and caspase 3/7 activity was measured using a luminescence-based assay. We found that sucrose-induced active autophagy in OA chondrocytes in vitro was dependent on the activation of AKT/mTOR/P70S6K signaling pathways but was independent of reactive oxygen species (ROS) production. Sucrose activated autophagy blocked IL-1β-induced apoptosis and mRNA expression of MMP-13, COX-2, and IL-6 in human OA chondrocytes. Glucose or fructose, the two metabolites of sucrose, failed to induce autophagy indicating that autophagy was specifically mediated by sucrose. In conclusion, sucrose attenuated IL-1β induced apoptosis and the expression of catabolic mediators by inducing autophagy, and the autophagy in part was mediated through the activation of AKT/mTOR/P70S6K signaling pathway in human OA chondrocytes. J. Cell. Biochem. 118: 629-639, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  19. Tumor Necrosis Factor-α and Interleukin (IL)-1β, IL-6, and IL-8 Impair In Vitro Migration and Induce Apoptosis of Gingival Fibroblasts and Epithelial Cells, Delaying Wound Healing.

    PubMed

    Basso, Fernanda G; Pansani, Taisa N; Turrioni, Ana Paula S; Soares, Diana G; de Souza Costa, Carlos Alberto; Hebling, Josimeri

    2016-08-01

    Multiple factors affect oral mucosal healing, such as the persistence of an inflammatory reaction. The present study evaluates effects of tumor necrosis factor (TNF)-α and interleukin (IL)-1β, IL-6, and IL-8 on epithelial cells (ECs) and human gingival fibroblasts (GFs) in vitro. GFs and ECs were seeded in 96-well plates (1 × 10(4) cells/well) in plain culture medium (Dulbecco's modified Eagle's medium [DMEM]) containing 1% antibiotic/antimycotic solution and 10% fetal bovine serum, and incubated for 24 hours. Both cell lines were exposed for 24 hours to the following cytokines: 1) TNF-α (100 ng/mL); 2) IL-1β (1 ng/mL); 3) IL-6 (10 ng/mL); and 4) IL-8 (10 ng/mL). All cytokines were diluted in serum-free DMEM. Control cultures were exposed only to serum-free DMEM. Effects of exposure to inflammatory cytokines were determined by means of: 1) apoptosis (anexin V); 2) cell migration (wound healing assay); 3) inflammatory cytokine synthesis (enzyme-linked immunosorbent assay). Data were analyzed by Kruskal-Wallis and Mann-Whitney U tests (α = 0.05). Increased apoptosis rates were noted when cells were exposed to inflammatory cytokines, except ECs exposed to IL-1β. Cell migration was negatively affected by all inflammatory cytokines for both cell lines. ECs and GFs exposed to IL-6 and IL-8 significantly increased synthesis of TNF-α and IL-1β. Demonstrated results indicate negative effects of tested inflammatory cytokines on ECs and GFs, inducing apoptosis and impairing cell migration. These results can justify delayed oral mucosa healing in the presence of inflammatory reaction.

  20. Pirfenidone exerts a suppressive effect on CCL18 expression in U937-derived macrophages partly by inhibiting STAT6 phosphorylation.

    PubMed

    Saito, Yoshinobu; Azuma, Arata; Matsuda, Kuniko; Kamio, Koichiro; Abe, Shinji; Gemma, Akihiko

    2016-10-27

    CC chemokine ligand 18 (CCL18) is suggested to play a role in the development of pulmonary fibrosis. Macrophages are thought to be the main source of CCL18, and the effect of pirfenidone, an anti-fibrotic agent for idiopathic pulmonary fibrosis, on the expression of CCL18 in macrophages warrants investigation. The purpose of this study was to investigate the effect of pirfenidone on the expression of CCL18 in macrophages. U937 cells were differentiated into macrophages by phorbol myristate acetate and then stimulated with recombinant IL-4 to induce the production of CCL18. The cells were treated with pirfenidone, and the mRNA and protein levels for CCL18 were measured by a reverse transcription-polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. The effects of pirfenidone on the IL-4 receptor (IL-4R) expression and STAT6 activation were investigated and on the JAK kinase activity were measured using the Z'-LYTE™ kinase assay. Pirfenidone significantly suppressed the expression of CCL18 when the cells were treated with concentrations of 50-250 μg/mL. Pirfenidone did not affect the expression of the IL-4R components. The selective STAT6 inhibitor AS1517499 suppressed CCL18 expression. Both AS1517499 and pirfenidone suppressed STAT6 phosphorylation (p < .05), although the effect of pirfenidone was less marked than that of AS1517499. The Z'-LYTE™ kinase assay showed a reduction in the activities of JAK1, JAK3 and TYK2 by pirfenidone. Pirfenidone suppresses CCL18 expression in macrophages and this effect is thought to be attributed partly to the inhibition of STAT6 phosphorylation.

  1. Attenuated fever in rats during late pregnancy is linked to suppressed interleukin-6 production after localized inflammation with turpentine.

    PubMed

    Aguilar-Valles, Argel; Poole, Stephen; Mistry, Yogesh; Williams, Sylvain; Luheshi, Giamal N

    2007-08-15

    An attenuated fever response to pathogens during late pregnancy is a phenomenon that has been described in several mammalian species, and although mechanisms are not completely understood, decreased prostaglandin E2 (PGE2) synthesis has been implicated. Upstream of PGE2, there is evidence to suggest that anti-inflammatory cytokines such as interleukin-1 receptor antagonist (IL-1ra) could play a significant role. In the present study we addressed the role of pro-inflammatory cytokines during late pregnancy, specifically interleukin-6 (IL-6), an important circulating mediator in fever. Turpentine oil (TURP), a very potent pyrogen and activator of IL-6, was injected into the hind-limb muscle of rats at the 18th day of pregnancy (GD 18) or in non-pregnant (NP) age-matched female controls. As expected, TURP injection induced a highly significant fever in the NP animals, which peaked 11 h post-injection and lasted for over 24 h. This was accompanied by a significant rise in circulating IL-6 levels, which correlated with changes in PGE2 synthesizing enzymes expression in the hypothalamus. In complete contrast, TURP-induced fever was totally absent in GD 18 animals whose body temperature did not deviate from basal values. The lack of response was additionally reflected by the absence of change in IL-6 concentration and by the significant attenuation of PGE2 synthesizing enzymes expression, which correlated with the suppressed expression of SOCS3, a hypothalamic marker of IL-6 activity. Contrary to the changes in circulating IL-6 levels at GD 18, IL-1ra was induced to levels comparable to those of NP females, suggesting that the influence of this anti-inflammatory cytokine on the fever response to TURP is at best minimal. These data further confirm the importance of IL-6 in fever generation and provide evidence that it may be a key component of the attenuated fever response in late pregnancy.

  2. Attenuated fever in rats during late pregnancy is linked to suppressed interleukin-6 production after localized inflammation with turpentine

    PubMed Central

    Aguilar-Valles, Argel; Poole, Stephen; Mistry, Yogesh; Williams, Sylvain; Luheshi, Giamal N

    2007-01-01

    An attenuated fever response to pathogens during late pregnancy is a phenomenon that has been described in several mammalian species, and although mechanisms are not completely understood, decreased prostaglandin E2 (PGE2) synthesis has been implicated. Upstream of PGE2, there is evidence to suggest that anti-inflammatory cytokines such as interleukin-1 receptor antagonist (IL-1ra) could play a significant role. In the present study we addressed the role of pro-inflammatory cytokines during late pregnancy, specifically interleukin-6 (IL-6), an important circulating mediator in fever. Turpentine oil (TURP), a very potent pyrogen and activator of IL-6, was injected into the hind-limb muscle of rats at the 18th day of pregnancy (GD 18) or in non-pregnant (NP) age-matched female controls. As expected, TURP injection induced a highly significant fever in the NP animals, which peaked 11 h post-injection and lasted for over 24 h. This was accompanied by a significant rise in circulating IL-6 levels, which correlated with changes in PGE2 synthesizing enzymes expression in the hypothalamus. In complete contrast, TURP-induced fever was totally absent in GD 18 animals whose body temperature did not deviate from basal values. The lack of response was additionally reflected by the absence of change in IL-6 concentration and by the significant attenuation of PGE2 synthesizing enzymes expression, which correlated with the suppressed expression of SOCS3, a hypothalamic marker of IL-6 activity. Contrary to the changes in circulating IL-6 levels at GD 18, IL-1ra was induced to levels comparable to those of NP females, suggesting that the influence of this anti-inflammatory cytokine on the fever response to TURP is at best minimal. These data further confirm the importance of IL-6 in fever generation and provide evidence that it may be a key component of the attenuated fever response in late pregnancy. PMID:17556393

  3. IL-23 induces human osteoclastogenesis via IL-17 in vitro, and anti-IL-23 antibody attenuates collagen-induced arthritis in rats

    PubMed Central

    Yago, Toru; Nanke, Yuki; Kawamoto, Manabu; Furuya, Takefumi; Kobashigawa, Tsuyoshi; Kamatani, Naoyuki; Kotake, Shigeru

    2007-01-01

    This study demonstrates that IL-23 stimulates the differentiation of human osteoclasts from peripheral blood mononuclear cells (PBMC). Furthermore, in vivo blockade of endogenous IL-23 activity by treatment with anti-IL-23 antibody attenuates collagen-induced arthritis in rats by preventing both inflammation and bone destruction. IL-23 induced human osteoclastogenesis in cultures of PBMC in the absence of osteoblasts or exogenous soluble-receptor activator of NF-kappaB ligand (RANKL). This IL-23-induced osteoclastogenesis was inhibited by osteoprotegerin, anti-IL-17 antibody, and etanercept, suggesting that RANKL, IL-17, and TNF-alpha are involved. In addition, we found the ratio of production levels of IL-17 to those of IFN-gamma from activated human T cells was elevated at 1 to 10 ng/ml IL-23. The inductive effect of IL-17 and the inhibitory effect of IFN-gamma on osteoclastogenesis indicate that the balance of these two cytokines is particularly important. We also demonstrated that IL-23 administered at a later stage significantly reduced paw volume in rats with collagen-induced arthritis, in a dose-dependent manner. Furthermore, anti-IL-23 antibody reduced synovial tissue inflammation and bone destruction in these rats. These findings suggest that IL-23 is important in human osteoclastogenesis and that neutralizing IL-23 after onset of collagen-induced arthritis has therapeutic potential. Thus, controlling IL-23 production and function could be a strategy for preventing inflammation and bone destruction in patients with rheumatoid arthritis. PMID:17888176

  4. IL-23 induces human osteoclastogenesis via IL-17 in vitro, and anti-IL-23 antibody attenuates collagen-induced arthritis in rats.

    PubMed

    Yago, Toru; Nanke, Yuki; Kawamoto, Manabu; Furuya, Takefumi; Kobashigawa, Tsuyoshi; Kamatani, Naoyuki; Kotake, Shigeru

    2007-01-01

    This study demonstrates that IL-23 stimulates the differentiation of human osteoclasts from peripheral blood mononuclear cells (PBMC). Furthermore, in vivo blockade of endogenous IL-23 activity by treatment with anti-IL-23 antibody attenuates collagen-induced arthritis in rats by preventing both inflammation and bone destruction. IL-23 induced human osteoclastogenesis in cultures of PBMC in the absence of osteoblasts or exogenous soluble-receptor activator of NF-kappaB ligand (RANKL). This IL-23-induced osteoclastogenesis was inhibited by osteoprotegerin, anti-IL-17 antibody, and etanercept, suggesting that RANKL, IL-17, and TNF-alpha are involved. In addition, we found the ratio of production levels of IL-17 to those of IFN-gamma from activated human T cells was elevated at 1 to 10 ng/ml IL-23. The inductive effect of IL-17 and the inhibitory effect of IFN-gamma on osteoclastogenesis indicate that the balance of these two cytokines is particularly important. We also demonstrated that IL-23 administered at a later stage significantly reduced paw volume in rats with collagen-induced arthritis, in a dose-dependent manner. Furthermore, anti-IL-23 antibody reduced synovial tissue inflammation and bone destruction in these rats. These findings suggest that IL-23 is important in human osteoclastogenesis and that neutralizing IL-23 after onset of collagen-induced arthritis has therapeutic potential. Thus, controlling IL-23 production and function could be a strategy for preventing inflammation and bone destruction in patients with rheumatoid arthritis.

  5. The Akt1/IL-6/STAT3 pathway regulates growth of lung tumor initiating cells

    PubMed Central

    Malanga, Donatella; De Marco, Carmela; Guerriero, Ilaria; Colelli, Fabiana; Rinaldo, Nicola; Scrima, Marianna; Mirante, Teresa; De Vitis, Claudia; Zoppoli, Pietro; Ceccarelli, Michele; Riccardi, Miriam; Ravo, Maria; Weisz, Alessandro; Federico, Antonella; Franco, Renato; Rocco, Gaetano; Mancini, Rita; Rizzuto, Antonia; Gulletta, Elio; Ciliberto, Gennaro; Viglietto, Giuseppe

    2015-01-01

    Here we report that the PI3K/Akt1/IL-6/STAT3 signalling pathway regulates generation and stem cell-like properties of Non-Small Cell Lung Cancer (NSCLC) tumor initiating cells (TICs). Mutant Akt1, mutant PIK3CA or PTEN loss enhances formation of lung cancer spheroids (LCS), self-renewal, expression of stemness markers and tumorigenic potential of human immortalized bronchial cells (BEAS-2B) whereas Akt inhibition suppresses these activities in established (NCI-H460) and primary NSCLC cells. Matched microarray analysis of Akt1-interfered cells and LCSs identified IL-6 as a critical target of Akt signalling in NSCLC TICs. Accordingly, suppression of Akt in NSCLC cells decreases IL-6 levels, phosphorylation of IkK and IkB, NF-kB transcriptional activity, phosphorylation and transcriptional activity of STAT3 whereas active Akt1 up-regulates them. Exposure of LCSs isolated from NSCLC cells to blocking anti-IL-6 mAbs, shRNA to IL-6 receptor or to STAT3 markedly reduces the capability to generate LCSs, to self-renew and to form tumors, whereas administration of IL-6 to Akt-interfered cells restores the capability to generate LCSs. Finally, immunohistochemical studies in NSCLC patients demonstrated a positive correlative trend between activated Akt, IL-6 expression and STAT3 phosphorylation (n = 94; p < 0.05). In conclusion, our data indicate that aberrant Akt signalling contributes to maintaining stemness in lung cancer TICs through a NF-kB/IL-6/STAT3 pathway and provide novel potential therapeutic targets for eliminating these malignant cells in NSCLC. PMID:26486080

  6. CpG in Combination with an Inhibitor of Notch Signaling Suppresses Formalin-Inactivated Respiratory Syncytial Virus-Enhanced Airway Hyperresponsiveness and Inflammation by Inhibiting Th17 Memory Responses and Promoting Tissue-Resident Memory Cells in Lungs

    PubMed Central

    Zhang, Lei; Li, Hongyong; Hai, Yan; Yin, Wei; Li, Wenjian; Zheng, Boyang; Du, Xiaomin; Li, Na; Zhang, Zhengzheng; Deng, Yuqing

    2017-01-01

    ABSTRACT Respiratory syncytial virus (RSV) is the leading cause of childhood hospitalizations. The formalin-inactivated RSV (FI-RSV) vaccine-enhanced respiratory disease (ERD) has been an obstacle to the development of a safe and effective killed RSV vaccine. Agonists of Toll-like receptor (TLR) have been shown to regulate immune responses induced by FI-RSV. Notch signaling plays critical roles during the differentiation and effector function phases of innate and adaptive immune responses. Cross talk between TLR and Notch signaling pathways results in fine-tuning of TLR-triggered innate inflammatory responses. We evaluated the impact of TLR and Notch signaling on ERD in a murine model by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling during FI-RSV immunization. Activation with CpG or deficiency of MyD88-dependent TLR signaling did not alleviate airway inflammation in FI-RSV-immunized mice. Activation or inhibition of Notch signaling with Dll4, one of the Notch ligands, or L685,458 did not suppress FI-RSV-enhanced airway inflammation either. However, the CpG together with L685,458 markedly inhibited FI-RSV-enhanced airway hyperresponsiveness, weight loss, and lung inflammation. Interestingly, CpG plus L685,458 completely inhibited FI-RSV-associated Th17 and Th17-associated proinflammatory chemokine responses in lungs following RSV challenge but not Th1 or Th2, memory responses. In addition, FI-RSV plus CpG plus L685,458 promoted protective CD8+ lung tissue-resident memory (TRM) cells. These results indicate that activation of TLR signaling combined with inhibition of Notch signaling prevent FI-RSV ERD, and the mechanism appears to involve suppressing proinflammatory Th17 memory responses and promoting protective TRM in lungs. IMPORTANCE RSV is the most important cause of lower respiratory tract infections in infants. The FI-RSV-enhanced respiratory disease (ERD) is a major impediment to the development of a safe

  7. CpG in Combination with an Inhibitor of Notch Signaling Suppresses Formalin-Inactivated Respiratory Syncytial Virus-Enhanced Airway Hyperresponsiveness and Inflammation by Inhibiting Th17 Memory Responses and Promoting Tissue-Resident Memory Cells in Lungs.

    PubMed

    Zhang, Lei; Li, Hongyong; Hai, Yan; Yin, Wei; Li, Wenjian; Zheng, Boyang; Du, Xiaomin; Li, Na; Zhang, Zhengzheng; Deng, Yuqing; Zeng, Ruihong; Wei, Lin

    2017-05-15

    Respiratory syncytial virus (RSV) is the leading cause of childhood hospitalizations. The formalin-inactivated RSV (FI-RSV) vaccine-enhanced respiratory disease (ERD) has been an obstacle to the development of a safe and effective killed RSV vaccine. Agonists of Toll-like receptor (TLR) have been shown to regulate immune responses induced by FI-RSV. Notch signaling plays critical roles during the differentiation and effector function phases of innate and adaptive immune responses. Cross talk between TLR and Notch signaling pathways results in fine-tuning of TLR-triggered innate inflammatory responses. We evaluated the impact of TLR and Notch signaling on ERD in a murine model by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling during FI-RSV immunization. Activation with CpG or deficiency of MyD88-dependent TLR signaling did not alleviate airway inflammation in FI-RSV-immunized mice. Activation or inhibition of Notch signaling with Dll4, one of the Notch ligands, or L685,458 did not suppress FI-RSV-enhanced airway inflammation either. However, the CpG together with L685,458 markedly inhibited FI-RSV-enhanced airway hyperresponsiveness, weight loss, and lung inflammation. Interestingly, CpG plus L685,458 completely inhibited FI-RSV-associated Th17 and Th17-associated proinflammatory chemokine responses in lungs following RSV challenge but not Th1 or Th2, memory responses. In addition, FI-RSV plus CpG plus L685,458 promoted protective CD8 + lung tissue-resident memory (TRM) cells. These results indicate that activation of TLR signaling combined with inhibition of Notch signaling prevent FI-RSV ERD, and the mechanism appears to involve suppressing proinflammatory Th17 memory responses and promoting protective TRM in lungs. IMPORTANCE RSV is the most important cause of lower respiratory tract infections in infants. The FI-RSV-enhanced respiratory disease (ERD) is a major impediment to the development of a safe and

  8. Gelam Honey Inhibits the Production of Proinflammatory, Mediators NO, PGE2, TNF-α, and IL-6 in Carrageenan-Induced Acute Paw Edema in Rats

    PubMed Central

    Hussein, Saba Zuhair; Mohd Yusoff, Kamaruddin; Makpol, Suzana; Mohd Yusof, Yasmin Anum

    2012-01-01

    Natural honey is well known for its therapeutic value and has been used in traditional medicine of different cultures throughout the world. The aim of this study was to investigate the anti-inflammatory effect of Malaysian Gelam honey in inflammation-induced rats. Paw edema was induced by a subplantar injection of 1% carrageenan into the rat right hind paw. Rats were treated with the nonsteroidal anti-inflammatory drug (NSAID) Indomethacin (10 mg/kg, p.o.) or Gelam honey at different doses (1 or 2 g/kg, p.o.). The increase in footpad thickness was considered to be edema, which was measured using a dial caliper. Plasma and paw tissue were collected to analyze the production of inflammatory mediators, such as NO, PGE2, TNF-α, and IL-6, as well as iNOS and COX-2. The results showed that Gelam honey could reduce edema in a dose-dependent fashion in inflamed rat paws, decrease the production of NO, PGE2, TNF-α, and IL-6 in plasma, and suppress the expression of iNOS, COX-2, TNF-α, and IL-6 in paw tissue. Oral pretreatment of Gelam honey at 2 g/kg of body weight at two time points (1 and 7 days) showed a significantly decreased production of proinflammatory cytokines, which was similar to the effect of the anti-inflammatory drug Indomethacin (NSAID), both in plasma and tissue. Thus, our results suggest that Gelam honey has anti-inflammatory effects by reducing the rat paw edema size and inhibiting the production of proinflammatory mediators. Gelam honey is potentially useful for treating inflammatory conditions. PMID:22919407

  9. Inhibition of interleukin-1 suppresses angiotensin II-induced aortic inflammation and aneurysm formation.

    PubMed

    Isoda, Kikuo; Akita, Koji; Kitamura, Kenichi; Sato-Okabayashi, Yayoi; Kadoguchi, Tomoyasu; Isobe, Sarasa; Ohtomo, Fumie; Sano, Motoaki; Shimada, Kazunori; Iwakura, Yoichiro; Daida, Hiroyuki

    2018-06-05

    Angiotensin II (Ang II) activates components of the inflammatory cascade, which promotes hypertension and development of abdominal aortic aneurysm (AAA). This study aimed to elucidate the effects of an IL-1 receptor antagonist (IL-1Ra) and an anti-IL-1β antibody (01BSUR) on Ang II-induced AAA. Male wild-type (WT) and IL-1Ra-deficient (IL-1Ra - / - ) mice were infused with Ang II (1000 ng/kg/min) using subcutaneous osmotic pumps for 28 days. Fourteen days post-infusion, both systolic blood pressure (SBP) (Ang II-treated IL-1Ra - / - :149 ± 2 vs. Ang II-treated WT:126 ± 3 mm Hg, p < 0.001) and abdominal aortic width (0.94 ± 0.09 vs. 0.49 ± 0.03 mm, p < 0.001) were significantly higher in IL-1Ra - / - mice than in WT mice. Because 28-day infusion with Ang II in IL-1Ra -/- mice significantly increased the occurrence of fatal aortic rupture (89% vs. 6%, p < 0.0001), both types of mice were infused with Ang II for only 14 days, and histological analyses were performed at 28 days. Interestingly, AAA increased more significantly in IL-1Ra - / - mice than in WT mice (p < 0.001), although SBP did not differ at 28 days in IL-1Ra - / - and WT mice (117 ± 4 vs. 115 ± 3 mm Hg, p = 0.71 (after cessation of Ang II infusion)). Histological analyses showed numerous inflammatory cells around the abdominal aorta in IL-1Ra - / - mice, but not in WT mice. Finally, compared with IgG2a treatment, treatment with 01BSUR decreased Ang II-induced AAA in IL-1Ra - / - mice. The present study demonstrates that inhibition of IL-1β significantly suppresses AAA formation after Ang II infusion, suggesting that suppression of IL-1β may provide an additional strategy to protect against AAA in hypertensive patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. MAD ointment ameliorates Imiquimod-induced psoriasiform dermatitis by inhibiting the IL-23/IL-17 axis in mice.

    PubMed

    OuYang, Qiong; Pan, YaQian; Luo, HanQiong; Xuan, ChunXiao; Liu, JinE; Liu, Jun

    2016-10-01

    Psoriasis is a chronic auto-immune inflammation disease with skin lesions and abnormal keratinocyte proliferation. The IL-23/IL-17 axis plays an important role in the pathogenesis of psoriasis. Madecassoside (MAD) was the most important constituents isolated from Centella asiatica, which has long been used in dermatology, and it is supposed that MAD may have effects on psoriasis. In the present study, the BALB/c mice ear and back skin received IMQ for 6 consecutive days to induce psoriasis-like dermatitis. MAD ointment was applied 6h later after IMQ treatment, and the IL-23/IL-17 pathway was investigated. The HE staining, BrdU and Psoriasis Area and Severity Index (PASI) were used to score the severity of keratinocyte proliferation and inflammation of the skin. Real-time PCR and Western Blot were used to detect the IL-23/IL-17 related cytokines. Flow Cytometry were applied to observe the numbers of Th17 cells. Daily application of IMQ for 6days on mouse ear skin and back skin induced psoriasis-like dermatitis. Real-time PCR showed that mRNA level of IL-23, IL-22, IL-17A were significantly decreased by MAD ointment treatment in ear skin. HE staining and BrdU incorporation implied that MAD ointment reduced keratinocyte proliferation. Flow Cytometry results showed MAD ointment decreased the numbers of Th17 cells. Thus, MAD ointment ameliorates Imiquimod-induced skin inflammation and abnormal keratinocyte through regulate the IL-23/IL-17 axis. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. TNF-alpha and IL-6 inhibit apolipoprotein A-IV production induced by linoleic acid in human intestinal Caco2 cells.

    PubMed

    Li, Xiaoming; Xu, Min; Liu, Min; Ji, Yong; Li, Zongfang

    2015-01-01

    Apolipoprotein A-IV (apoA-IV) is a protein mainly synthesized by enterocytes in the intestine. Its gene expression is suppressed during fasting and stimulated during active fat absorption. Chronic feeding of a high-fat (HF) diet abolishes the differential expression between fasting and fat-feeding and therefore may contribute to diet-induced obesity since apoA-IV is a potent satiety factor. It is well established that the circulating pro-inflammatory cytokines TNF-α and IL-6 are increased by HF feeding. To determine whether pro-inflammatory cytokines are involved in the diminished response of apoA-IV gene expression to fat-feeding, different concentrations of linoleic acid (LA), an important dietary fatty acid, was used to stimulate apoA-IV expression in human intestinal Caco2 cells. Cells were pre-treated with or without human recombinant TNF-α, IL-6 or their combination before the addition of LA. Real-time PCR and ELISA were used to detect and quantify RNA transcripts and proteins of apoA-IV and the cytokines. LA stimulated gene and protein expression of apoA-IV in a dose and time dependent manner. Pre-treatment with the cytokines for 72 h significantly inhibited the increased expression of apoA-IV gene and protein induced by LA. Furthermore, the cytokines, especially TNF-α, also positively up-regulate the cytokine themselves in Caco2 cells. Our data indicate that the pro-inflammatory cytokines may be responsible for the reduced apoA-IV production in response to fat feeding. Because of apoA-IV's role in satiety, we propose the inhibitory effect of circulating pro-inflammatory cytokines on apoA-IV production contributes to diet-induced obesity.

  12. Increased Interleukin-23 in Hashimoto's Thyroiditis Disease Induces Autophagy Suppression and Reactive Oxygen Species Accumulation.

    PubMed

    Zheng, Tingting; Xu, Chengcheng; Mao, Chaoming; Mou, Xiao; Wu, Fei; Wang, Xuefeng; Bu, Ling; Zhou, Yuepeng; Luo, Xuan; Lu, Qingyan; Liu, Hongli; Yuan, Guoyue; Wang, Shengjun; Chen, Deyu; Xiao, Yichuan

    2018-01-01

    Hashimoto's thyroiditis (HT) represents the most common organ-specific autoimmune disease. Inflammatory factors and reactive oxygen species (ROS) play detrimental roles during the pathogenesis of HT. In this study, we found that thyroid follicular cells (TFCs) from HT patients expressed an elevated level of interleukin-23 (IL-23), which contributed to autophagy suppression and ROS accumulation. Additionally, IL-23-induced autophagy suppression and ROS accumulation in human TFCs was attributed to AKT/mTOR/NF-κB signaling pathway activation. Inhibition of either IL-23 by a specific neutralization antibody, or mTOR by rapamycin, or NF-κB by IKK-16, significantly reversed the autophagy suppression and ROS accumulation. These results demonstrate a key role for IL-23 in HT pathogenesis and provide a potential therapeutic strategy against IL-23 or its signaling pathway in HT.

  13. A wogonin-rich-fraction of Scutellaria baicalensis root extract exerts chondroprotective effects by suppressing IL-1β-induced activation of AP-1 in human OA chondrocytes

    PubMed Central

    Khan, Nazir M.; Haseeb, Abdul; Ansari, Mohammad Y.; Haqqi, Tariq M.

    2017-01-01

    Osteoarthritis (OA) is a common joint disorder with varying degrees of inflammation and sustained oxidative stress. The root extract of Scutellaria baicalensis (SBE) has been used for the treatment of inflammatory and other diseases. Here, we performed activity-guided HPLC-fractionation of SBE, identified the active ingredient(s) and investigated its chondroprotective potential. We found that the Wogonin containing fraction-4 (F4) was the most potent fraction based on its ability to inhibit ROS production and the suppression of catabolic markers including IL-6, COX-2, iNOS, MMP-3, MMP-9, MMP-13 and ADAMTS-4 in IL-1β-treated OA chondrocytes. OA chondrocytes treated with F4 in the presence of IL-1β showed significantly enhanced expression of anabolic genes ACAN and COL2A1. In an in vitro model of cartilage degradation treatment with F4 inhibited s-GAG release from IL-1β-treated human cartilage explants. The inhibitory effect of F4 was not mediated through the inhibition of MAPKs and NF-κB activation but was mediated through the suppression of c-Fos/AP-1 activity at transcriptional and post transcriptional levels in OA chondrocytes. Purified Wogonin mimicked the effects of F4 in IL-1β-stimulated OA chondrocytes. Our data demonstrates that a Wogonin-rich fraction of SBE exert chondroprotective effects through the suppression of c-Fos/AP-1 expression and activity in OA chondrocytes under pathological conditions. PMID:28256567

  14. Toll-like receptor 2 and 6 interdependency in the erosive stage of Staphylococcus aureus induced septic arthritis mediated by IFN-γ and IL-6--A possible involvement of IL-17 in the progression of the disease.

    PubMed

    Ghosh, Chandrayee; Bishayi, Biswadev

    2015-07-01

    Staphylococcus aureus induced septic arthritis has emerged as a potent disabling and life threatening disease; hence combating this malady has become an imperative need of medical science. Role of TLR-2 in innate recognition of S. aureus and activation of inflammatory cascade by the interplay of some proinflammatory cytokines, resulting in joint inflammation has been established. Variation in the reports suggesting both functional dependency and independency of TLR-2 on its heterodimeric partner TLR-6 in response to ligands exists, thus this study was postulated to observe the expression pattern of TLR-6 in synovial tissue and lymphoid organs after inducing septic arthritis by S. aureus in Swiss albino mouse model and the instigated cytokine profile could affirm its plausible role in SA. The functional relation of TLR-2 and 6 was verified by simulating an in vitro study design on synovial mononuclear cells, blocking TLR-2 and 6, and it was found that they are required to co-express for generating cytokine, NO and H2O2 on infection. IFN-γ, IL-6 and IL-17 were identified to play a distinguished role in SA from their secretion pattern in both in vivo and in vitro study. IFN-γ and IL-6 remained high throughout the infection possibly by the shift of response from Th1 to Th2 and Th17 and contribute in various converging pathways of inflammation. IL-17 increased with the onset of the disease but reduced on the late period. Hence IFN-γ, IL-6, IL-17 along with TLR-6 can be a potent target for therapeutic approach because of their significant contribution in SA. Copyright © 2015 Elsevier GmbH. All rights reserved.

  15. α-Hederin inhibits interleukin 6-induced epithelial-to-mesenchymal transition associated with disruption of JAK2/STAT3 signaling in colon cancer cells.

    PubMed

    Sun, Dongdong; Shen, Weixing; Zhang, Feng; Fan, Huisen; Xu, Changliang; Li, Liu; Tan, Jiani; Miao, Yunjie; Zhang, Haibin; Yang, Ye; Cheng, Haibo

    2018-05-01

    Colon cancer is the third most frequently diagnosed malignancy and has high morbidity worldwide. Epithelial-mesenchymal transition (EMT) has been increasingly implicated in colon cancer progression and metastasis. The present study was aimed to evaluate the potential antitumor activity of α-hederin, a monodesmosidic triterpenoid saponin isolated from Hedera helix, in human SW620 colon cancer cells stimulated with interleukin 6 (IL-6) for mimicking the tumor inflammatory microenvironment in vivo. Cell viability assay showed that IL-6 at 6.25 ng/ml significantly enhanced viability of SW620 cells, and thus this concentration was used to stimulate SW620 cells throughout this study. We observed that α-hederin concentration-dependently inhibited cell viability, migration and invasion in IL-6-treated SW620 cells. Moreover, α-hederin significantly restored IL-6-induced decrease in E-cadherin expression and abolished IL-6-induced increase in N-cadherin, vimentin, fibronectin, twist and snail at both mRNA and protein levels in SW620 cells. These data suggested that α-hederin suppressed IL-6-indcued EMT in colon cancer cells. Further molecular examinations showed that α-hederin inhibited phosphorylation of Janus Kinase 2 (JAK2) and Signal Transducer and Activator of Transcription 3(STAT3), and halted the nuclear translocation of phosphorylated STAT3 in IL-6-treated SW620 cells. In addition, JAK2/STAT3 signaling inhibitor AG490 not only produced similar inhibitory effects on EMT markers as α-hederin, but also synergistically enhanced α-hederin's inhibitory effects on EMT markers in IL-6-treated SW620 cells. Altogether, we demonstrated that α-hederin suppressed IL-6-induced EMT associated with disruption of JAK2/STAT3 signaling in colon cancer cells. Our data strongly suggested α-hederin as a promising candidate for intervention of colon cancer and metastasis. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  16. IL-1β-induced, matrix metalloproteinase-3-regulated proliferation of embryonic stem cell-derived odontoblastic cells is mediated by the Wnt5 signaling pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ozeki, Nobuaki; Hase, Naoko; Hiyama, Taiki

    2014-10-15

    We previously established a method for differentiating induced pluripotent stem cells and embryonic stem (ES) cells into α2 integrin-positive odontoblast-like cells. We also reported that interleukin (IL)-1β induces matrix metalloproteinase (MMP)-3-regulated cell proliferation and suppresses apoptosis in these cells, suggesting that MMP-3 plays a potentially unique physiological role in the regeneration of odontoblast-like cells. Here, we examined whether up-regulation of MMP-3 activity by IL-1β was mediated by Wnt signaling and led to increased proliferation of odontoblast-like cells. IL-1β increased mRNA and protein levels of Wnt5a, Wnt5b and the Wnt receptor Lrp5. Exogenous Wnt5a and Wnt5b were found to increase MMP-3more » mRNA, protein and activity, and interestingly the rate of proliferation in these cells. Treatment with siRNAs against Wnt5a, Wnt5b and Lrp5 suppressed the IL-1β-induced increase in MMP-3 expression and suppressed cell proliferation, an effect rescued by application of exogenous Wnt5. These results demonstrate the sequential involvement of Wnt5, Lrp5 and MMP-3 in effecting IL-1β-induced proliferation of ES cell-derived odontoblast-like cells. - Highlights: • IL-1β induces Wnt5, Lrp5/Fzd9 and MMP-3 in ES cell-derived odontoblast-like cells. • IL-1β-induced Wnt5 expression results in increased cell proliferation. • Exogenous Wnt5 increases MMP-3 activity and cell proliferation. • Exogenous Wnt5 rescues IL-1β-driven proliferation with anti-Wnt5 siRNA suppression. • IL-1β-induced cell proliferation involves Wnt5, Lrp5, and MMP-3 sequentially.« less

  17. Tangeretin Inhibits IL-12 Expression and NF-κB Activation in Dendritic Cells and Attenuates Colitis in Mice.

    PubMed

    Eun, Su-Hyeon; Woo, Je-Te; Kim, Dong-Hyun

    2017-04-01

    In the preliminary study, tangeretin (5,6,7,8,4'-pentamethoxy flavone), a major constituent of the pericarp of Citrus sp., inhibited TNF- α , IL-12, and IL-23 expression and nuclear factor kappa-B activation in lipopolysaccharide-stimulated dendritic cells; however, it did not affect IL-10 expression. Furthermore, tangeretin (5, 10, and 20 µM) suppressed the activation and translocation of nuclear factor kappa-B (p65) into the nuclei in vitro by inhibiting the binding of lipopolysaccharide on dendritic cells. Oral administration of tangeretin (10 and 20 mg/kg) suppressed the inflammatory responses, such as nuclear factor kappa-B and mitogen-activated protein kinase activation and myeloperoxidase activity, in the colon of mice with 2,4,6-trinitrobenzene sulfonic acid-induced colitis. Tangeretin increased 2,4,6-trinitrobenzene sulfonic acid-suppressed expression of tight junction proteins occludin, claudin-1, and ZO-1. Tangeretin also inhibited 2,4,6-trinitrobenzene sulfonic acid-induced differentiation of Th1 and Th17 cells as well as the expression of T-bet, ROR γ t, interferon- γ , IL-12, IL-17, and TNF- α . However, tangeretin increased 2,4,6-trinitrobenzene sulfonic acid-suppressed differentiation of regulatory T cells as well as the expression of Foxp3 and IL-10. These results suggest that oral administration of tangeretin may attenuate colitis by suppressing IL-12 and TNF- α expression and nuclear factor kappa-B activation through the inhibition of lipopolysaccharide binding on immune cells such as dendritic cells. Georg Thieme Verlag KG Stuttgart · New York.

  18. OM85-BV Induced the Productions of IL-1β, IL-6, and TNF-α via TLR4- and TLR2-Mediated ERK1/2/NF-κB Pathway in RAW264.7 Cells

    PubMed Central

    Luan, Hong; Zhang, Qian; Wang, Le; Wang, Chuanxiao; Zhang, Miao; Xu, Xiaoli; Zhou, Huan; Li, Xing'ai; Xu, Qing; He, Fan

    2014-01-01

    Broncho-Vaxom (OM85-BV) is an extract mixture from 8 strains of Gram+ and Gram− bacteria and plays an important role in anti-infection immune response by regulating macrophage activity and cytokine productions. However, the mechanism by which OM85-BV enhances the cytokine expression is still obscure. In this study, we evaluated the effects of OM85-BV on the productions of interleukin (IL)-1β, IL-6, and tumor necrosis factor-α (TNF-α) in RAW264.7 murine macrophages. Exposure of RAW264.7 cells to 100 μg/mL OM85-BV upregulated the expression of IL-1β, IL-6, and TNF-α at the mRNA and protein levels in a time- and dose-dependent manner. In addition, OM85-BV induced extracellular signal-regulated kinase (ERK) 1/2 and nuclear factor-kappa B (NF-κB) phosphorylation. Pretreatment with U0126 or Bay11-7082, respectively, could decrease IL-1β, IL-6, and TNF-α productions induced by OM85-BV. Application of Toll-like receptor (TLR) 4 or TLR2 small-interfering RNA (siRNA) into RAW264.7 cells could inhibit the productions of cytokines and ERK1/2 and NF-κB phosphorylation induced by OM85-BV. Consistent with this, downregulating either myeloid differentiation factor 88 (MyD88) or TRIF-related adaptor molecule (TRAM) gene with MyD88-siRNA or TRAM-siRNA separately could reduce the productions of cytokines and ERK1/2 and NF-κB phosphorylation induced by OM85-BV. Our study demonstrated that the productions of IL-1β, IL-6, and TNF-α induced by OM85-BV in RAW264.7 cells were through TLR4 and TLR2 signaling pathway-mediated activation of ERK1/2 and NF-κB. PMID:24605772

  19. Increased Parenchymal Damage and Steatohepatitis in Caucasian Nonalcoholic Fatty Liver Disease Patients with Common IL1B and IL6 Polymorphisms

    PubMed Central

    Nelson, James E.; Handa, Priya; Aouizerat, Bradley; Wilson, Laura; Vemulakonda, L Akhila; Yeh, Matthew M.; Kowdley, Kris V.

    2016-01-01

    Background Nonalcoholic fatty liver disease (NAFLD) is a complex, multifactorial disease affected by diet, lifestyle and genetics. Proinflammatory cytokines like IL-1β and IL-6 have been shown to be elevated in nonalcoholic steatohepatitis (NASH). The goal of this study was to investigate the relationship between IL1B and IL6 gene polymorphisms and histologic features of NAFLD in the NASH CRN cohort. Methods 604 adult (≥18 yrs) non-Hispanic Caucasians with biopsy-proven NAFLD were genotyped for the following SNPs: IL1B, rs16944, rs1143634; IL6, rs1800795, rs10499563. Logistic regression was used to examine the relationship between genotype and a definitive diagnosis and advanced histological features of NASH after controlling for the following variables selected a priori: age, sex, diabetes, obesity and HOMA-IR level. Results The IL6 rs10499563 C allele was independently associated with the presence of definitive NASH, and increased ballooning and Mallory bodies. The IL1B rs1143634 TT genotype was associated with advanced fibrosis and increased Mallory bodies. The IL6 rs1800795 C allele was associated with increased risk for severe steatosis, >66% but also decreased risk for advanced fibrosis and lobular inflammation and Mallory body formation. Conclusions These results suggest that common variants in the IL6 and IL1B genes may increase susceptibility for NASH and confer a higher risk of hepatic parenchymal damage including increased ballooning, increased Mallory bodies, and bridging fibrosis or cirrhosis. In contrast, the IL6 rs1800795 C allele may confer a higher risk for steatosis, but less parenchymal damage. Our findings support the development of therapeutics aimed at IL-1β and IL-6 suppression. PMID:27730688

  20. IL-33-induced alterations in murine intestinal function and cytokine responses are MyD88, STAT6, and IL-13-dependent

    USDA-ARS?s Scientific Manuscript database

    IL-33 is a recently identified cytokine member of the IL-1 family. The biological activities of IL-33 are associated with promotion of Th2 and inhibition of Th1/Th17 immune responses. Exogenous IL-33 induces a typical “type 2” immune response in the gastrointestinal tract, yet the underlying mechani...

  1. Early CALP2 expression and microglial activation are potential inducers of spinal IL-6 up-regulation and bilateral pain following motor nerve injury.

    PubMed

    Chen, Shao-Xia; Wang, Shao-Kun; Yao, Pei-Wen; Liao, Guang-Jie; Na, Xiao-Dong; Li, Yong-Yong; Zeng, Wei-An; Liu, Xian-Guo; Zang, Ying

    2018-04-01

    Previous work from our laboratory showed that motor nerve injury by lumbar 5 ventral root transection (L5-VRT) led to interleukin-6 (IL-6) over-expression in bilateral spinal cord, and that intrathecal administration of IL-6 neutralizing antibody delayed the induction of mechanical allodynia in bilateral hind paws. However, early events and upstream mechanisms underlying spinal IL-6 expression following L5-VRT require elucidation. The model of L5-VRT was used to induce neuropathic pain, which was assessed with von Frey hairs and the plantar tester in adult male Sprague-Dawley rats. Calpain-2 (CALP2, a calcium-dependent protease) knockdown or over-expression and microglia depletion were conducted intrathecally. Western blots and immunohistochemistry were performed to explore the possible mechanisms. Here, we provide the first evidence that both IL-6 and CALP2 levels are increased in lumbar spinal cord within 30 min following L5-VRT. IL-6 and CALP2 co-localized in both spinal dorsal horn (SDH) and spinal ventral horn. Post-operative (PO) increase in CALP2 in ipsilateral SDH was evident at 10 min PO, preceding increased IL-6 at 20 min PO. Knockdown of spinal CALP2 by intrathecal CALP2-shRNA administration prevented VRT-induced IL-6 overproduction in ipsilateral spinal cord and alleviated bilateral mechanical allodynia. Spinal microglia activation also played a role in early IL-6 up-regulation. Macrophage/microglia markers ED1/Iba1 were increased at 30 min PO, while glial fibrillary acidic protein (astrocyte) and CNPase (oligodendrocyte) markers were not. Increased Iba1 was detected as early as 20 min PO and peaked at 3 days. Morphology changed from a small soma with fine processes in resting cells to an activated ameboid shape. Depletion of microglia using Mac-1-saporin partially prevented IL-6 up-regulation and attenuated VRT-induced bilateral mechanical allodynia. Taken together, our findings provide evidence that increased spinal cord CALP2 and microglia cell

  2. Glucocorticoid inhibition of leptin- and lipopolysaccharide-induced interleukin-6 production in obesity.

    PubMed

    Huang, Chun-Jung; Acevedo, Edmund O; Mari, David C; Randazzo, Christopher; Shibata, Yoshimi

    2014-01-01

    Obesity is considered a chronic inflammatory condition that enhances the risk of numerous inflammatory diseases, including diabetes and cardiovascular disease. Glucocorticoids (GCs) and synthetic therapeutic GCs are anti-inflammatory agents, but the exact functions of GCs in obesity-related inflammation are unknown. Therefore, the objective of this study was to examine the inhibitory effect of an exogenous GC (dexamethasone, DEX) on leptin- and lipopolysaccharide (LPS)-induced IL-6 production by peripheral blood mononuclear cells (PBMCs) ex vivo in obese subjects compared to normal-weight subjects. Blood samples were drawn from 14 obese (BMI>30 kg/m(2)) and 14 normal-weight (BMI<25 kg/m(2)) subjects. Plasma cortisol, TNF-α and IL-6 levels, and insulin resistance (HOMA-IR) were quantified. Subjects' PBMCs (1×10(6) cells/mL) were isolated and cultured with leptin (18.75 and 250 ng/mL) or LPS (10ng/mL) in the presence of DEX (0, 10(-8), 10(-7), and 10(-6) M), a synthetic GC, for 24 h; IL-6 levels and GC sensitivity (IC50) were assessed in the cultured supernatants. No differences in the plasma cortisol levels were found between the two groups. We found that obese subjects showed greater leptin- and LPS-induced IL-6 production compared to normal-weight subjects. The suppressive effect of DEX on leptin- and LPS-induced IL-6 production (IC50) was not different between the two groups. However, the IC50 of DEX for LPS-induced was correlated with BMI, waist circumference, and hip circumference. These findings suggest that reduced GC sensitivity may be an important mechanism in the up-regulation of selected obese inflammation. Published by Elsevier Inc.

  3. Baicalein reduces lipopolysaccharide-induced inflammation via suppressing JAK/STATs activation and ROS production.

    PubMed

    Qi, Zhilin; Yin, Fei; Lu, Lina; Shen, Lei; Qi, Shimei; Lan, Lei; Luo, Lan; Yin, Zhimin

    2013-09-01

    To investigate the precise molecular mechanisms by which baicalein exerts beneficial biochemical activities in RAW264.7 macrophages treated with LPS. RAW264.7 cells were cultured in the absence or presence of baicalein together with or without LPS. iNOS and COX-2 expression were measured by western blot and RT-PCR analyses. TNF-α, IL-1β, and IL-6 were determined by using double-antibody sandwich ELISA. Phosphorylations of JAK1 and JAK2, and of STAT1 and STAT3 were detected by western blotting. Nuclear translocation of STAT1 and STAT3 was visualized by confocal microscopy. ROS production was detected by ROS assay. Baicalein significantly reduced the phosphorylation of STAT1 and STAT3 and the phosphorylation of JAK1 and JAK2, but without affecting MAPKs phosphorylation in LPS-stimulated RAW264.7 cells. Baicalein suppressed the nuclear translocation of STAT1 and STAT3 and inhibited production of iNOS upon LPS-stimulation, resulting in the inhibition of releases of NO and pro-inflammatory cytokines such as IL-1β, IL-6, and TNF-α, in a dose-dependent manner. In addition, we found that baicalein reduced the LPS-induced accumulation of ROS, confirming that baicalein serves as an antioxidant. Our results suggested that suppressing JAK/STATs activation and interfering with ROS production might contribute to the anti-inflammatory action of baicalein in macrophages.

  4. Lipoteichoic Acid of Probiotic Lactobacillus plantarum Attenuates Poly I:C-Induced IL-8 Production in Porcine Intestinal Epithelial Cells

    PubMed Central

    Kim, Kyoung Whun; Kang, Seok-Seong; Woo, Sun-Je; Park, Ok-Jin; Ahn, Ki Bum; Song, Ki-Duk; Lee, Hak-Kyo; Yun, Cheol-Heui; Han, Seung Hyun

    2017-01-01

    Probiotics in livestock feed supplements are considered a replacement for antibiotics that enhance gastrointestinal immunity. Although bacterial cell wall components have been proposed to be associated with probiotic function, little evidence demonstrates that they are responsible for probiotic functions in livestock. The present study demonstrated that lipoteichoic acid (LTA) of Lactobacillus plantarum (Lp.LTA) confers anti-inflammatory responses in porcine intestinal epithelial cell line, IPEC-J2. A synthetic analog of viral double-stranded RNA, poly I:C, dose-dependently induced IL-8 production at the mRNA and protein levels in IPEC-J2 cells. Lp.LTA, but not lipoprotein or peptidoglycan from L. plantarum, exclusively suppressed poly I:C-induced IL-8 production. Compared with LTAs from other probiotic Lactobacillus strains including L. delbrueckii, L. sakei, and L. rhamnosus GG, Lp.LTA had higher potential to suppress poly I:C-induced IL-8 production. Dealanylated or deacylated Lp.LTA did not suppress poly I:C-induced IL-8 production, suggesting that D-alanine and lipid moieties in the Lp.LTA structure were responsible for the inhibition. Furthermore, Lp.LTA attenuated the phosphorylation of ERK and p38 kinase as well as the activation of NF-κB, resulting in decreased IL-8 production. Taken together, these results suggest that Lp.LTA acts as an effector molecule to inhibit viral pathogen-induced inflammatory responses in porcine intestinal epithelial cells. PMID:28983294

  5. Recombinant Mycobacterium bovis BCG producing IL-18 reduces IL-5 production and bronchoalveolar eosinophilia induced by an allergic reaction.

    PubMed

    Biet, F; Duez, C; Kremer, L; Marquillies, P; Amniai, L; Tonnel, A-B; Locht, C; Pestel, J

    2005-08-01

    Allergic reactions occur through the exacerbated induction of a Th2 cell type expression profile and can be prevented by agents favoring a Th1 profile. Bacillus Calmette-Guérin (BCG) is able to induce high IFN-gamma levels and has been shown to decrease experimentally induced allergy. The induction of IFN-gamma is mediated by interleukin (IL)-12 known to be secreted upon mycobacterial infections and can be enhanced by IL-18 acting in synergy with IL-12. We evaluated the ability of a recombinant BCG strain producing IL-18 (rBCG) to modify the Th2 type responses in a murine model of ovalbumin (OVA)-dependent allergic reaction. Mice were injected intraperitoneally or intranasally with OVA at days 0 and 15 and exposed to an OVA aerosol challenge at days 29, 30, 31 and 34. At days 0 and 15, two additional groups of mice received OVA together with 5 x 10(6) colony forming units of either rBCG or nonrecombinant BCG. A time-course analysis of OVA-specific immunoglobulin (Ig)E, IgG1 and IgG2a levels indicated no significant difference between the three groups of mice. However, following in vitro stimulation with OVA, lymph node cells from rBCG-treated mice produced less IL-5 and more IFN-gamma than those of mice injected with nonrecombinant BCG. In addition, 48 h after the last OVA challenge, a strong reduction of bronchoalveolar eosinophilia was found in the rBCG-injected mice compared to the nontreated or nonrecombinant BCG-treated groups. These results indicate that the production of IL-18 by rBCG may enhance the immunomodulatory properties of BCG that suppress pulmonary Th2 responses and, in particular, decrease airway eosinophilia.

  6. Protective effect of Sesbania grandiflora on acetic acid induced ulcerative colitis in mice by inhibition of TNF-α and IL-6.

    PubMed

    Gupta, Rohit A; Motiwala, Meha N; Mahajan, Ujawala N; Sabre, Sapna G

    2018-06-12

    presence of quercetin in concentration of 81.7 µg/mg of HASG. HASG (200 mg/kg) and Prednisolone (2 mg/kg) significantly reduced DAI and macroscopic scores. The haematological changes in experimental animals were restored upon treatment with HASG and Prednisolone. HASG showed potent antioxidant activity (In-vivo) by restoring the levels of SOD, GSH, MPO, MDA and NO. HASG was found to inhibit FFA levels, which may indicate inhibition of TLR4 receptor mediated inflammation. The levels of serological biomarkers like TNF-α and IL-6 were found to be suppressed. Histopathological investigation reveals decrease signs of ulceration, necrosis, cellular infiltration, hyperaemia in HASG treated animals. The results of HASG (200 mg/kg) were found to be comparable with Prednisolone (2 mg/kg) significantly. The protective action of HASG against acetic acid induced UC is attributed to the antioxidant like action (In-vitro and In-vivo) of highly polymerized polyphenols and flavonoids especially quercetin. Also HASG was found to reduce the levels of TNF-α and IL-6, thereby suppressing their inflammatory response in UC. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Coriolus versicolor suppresses inflammatory bowel disease by Inhibiting the expression of STAT1 and STAT6 associated with IFN-γ and IL-4 expression.

    PubMed

    Lim, Beong Ou

    2011-08-01

    To investigate the effects of Coriolus versicolor extract (CVE) on infl ammatory bowel disease (IBD), ulcerative colitis was induced in male BALb/c mice by administering drinking water containing dextran-sulfate sodium (DSS). The mice were divided into the following four experimental groups: control, DSS-induced colitis, CVE treatment and CVE treatment + DSS-induced colitis. Mice receiving DSS treatment developed clinical and macroscopic signs of ulcerative colitis. However, treatment with CVE relieved the symptoms of IBD, including the decrease in body and organ weight. The levels of serum, spleen and mesenteric lymph node IgE in the CVE-treated groups was lower compared with the untreated groups. The antiinfl ammatory response upon CVE treatment correlated with the reduced expression of TNF-α, IL-1β and IL-6. Also, there was a significant reduction in the expression of STAT1 and STAT6 molecules, thereby leading to lower IFN-γ and IL-4 expression. Therefore, the antiinfl ammatory effects of Coriolus versicolor can be explained by its ability to inhibit certain proinflammatory cytokines. Copyright © 2011 John Wiley & Sons, Ltd.

  8. [Chromosome banding analysis of peripheral blood lymphocytes stimulated with IL2 and CpG oligonucleotide DSP30 in patients with chronic lymphocytic leukemia].

    PubMed

    Stěpanovská, K; Vaňková, G; Némethová, V; Tomášiková, L; Smuhařová, P; Divíšková, E; Vallová, V; Kuglík, P; Plevová, K; Oltová, A; Doubek, M; Pospíšilová, S; Mayer, J

    2013-01-01

    Chromosomal aberrations play an important role as prognostic factors in chronic lymphocytic leukemia (CLL). These aberrations are mostly detected by fluorescent in situ hybridization (FISH), as chromosomal banding analysis has been scarce due to low proliferative activity of malignant B-lymphocytes in vitro. In 2006, a new method using stimulation with IL-2 and CpG oligonucleotide DSP30 for metaphase generation in CLL was published [1]. The objective of our study was to verify the efficacy of stimulation and to evaluate if the method is suitable for routine diagnostics. In total, peripheral blood samples of 369 CLL patients were analyzed in parallel by chromosomal banding analysis and by FISH probes for 13q14, 11q22-23, CEP12 and 17p13. Out of 369 patients, 307 (83%) were successfully stimulated for metaphase generation. Chromosomal aberrations were detected in 243 (79%) out of 307 patients evaluated by chromosomal banding analysis. Other aberrations that are not included into standard FISH panel were detected in patients karyotypes, e.g. del(6q), del(14q), t(14;18)(q32;q21), t(11;14)(q13;q32) and t(18;22)(q21;q11). One hundred and three (42%) patients showed complex aberrant karyotype not detected by FISH analysis. Stimulation with IL-2 and oligonucleotide DSP30 is an efficient method how to induce proliferation of malignant B-lymphocytes and allows detection of a substantial number of chromosomal aberrations in addition to those detected by standard FISH panel. Using this method in routine diagnostics is helpful particularly in identification of patients with complex aberrant karyotype.

  9. The Matricellular Protein CCN1 Promotes Mucosal Healing in Murine Colitis through IL-6

    PubMed Central

    Choi, Jacob S.; Kim, Ki-Hyun; Lau, Lester F.

    2015-01-01

    The matricellular protein CCN1 (CYR61) is known to function in wound healing and is upregulated in colons of patients with Crohn’s disease and ulcerative colitis, yet its specific role in colitis is unknown. Here we have used Ccn1dm/dm knockin mice expressing a CCN1 mutant unable to bind integrins α6β1 and αMβ2 as a model to probe CCN1 function in dextran sodium sulfate (DSS)-induced colitis. Ccn1dm/dm mice exhibited high mortality, impaired mucosal healing, and diminished IL-6 expression during the repair phase of DSS-induced colitis compared to wild type mice, despite having comparable severity of initial inflammation and tissue injury. CCN1 induced IL-6 expression in macrophages through integrin αMβ2 and in fibroblasts through α6β1, and IL-6 promoted intestinal epithelial cell (IEC) proliferation. Administration of purified CCN1 protein fully rescued Ccn1dm/dm mice from DSS-induced mortality, restored IEC proliferation and enhanced mucosal healing, whereas delivery of IL-6 partially rectified these defects. CCN1 therapy accelerated mucosal healing and recovery from DSS-induced colitis even in wild type mice. These findings reveal a critical role for CCN1 in restoring mucosal homeostasis after intestinal injury in part through integrin-mediated induction of IL-6 expression, and suggest a therapeutic potential for activating the CCN1/IL-6 axis for treating inflammatory bowel disease. PMID:25807183

  10. ER stress upregulated PGE2/IFNγ-induced IL-6 expression and down-regulated iNOS expression in glial cells

    NASA Astrophysics Data System (ADS)

    Hosoi, Toru; Honda, Miya; Oba, Tatsuya; Ozawa, Koichiro

    2013-12-01

    The disruption of endoplasmic reticulum (ER) function can lead to neurodegenerative disorders, in which inflammation has also been implicated. We investigated the possible correlation between ER stress and immune function using glial cells. We demonstrated that ER stress synergistically enhanced prostaglandin (PG) E2 + interferon (IFN) γ-induced interleukin (IL)-6 production. This effect was mediated through cAMP. Immune-activated glial cells produced inducible nitric oxide synthase (iNOS). Interestingly, ER stress inhibited PGE2 + IFNγ-induced iNOS expression. Similar results were obtained when cells were treated with dbcAMP + IFNγ. Thus, cAMP has a dual effect on immune reactions; cAMP up-regulated IL-6 expression, but down-regulated iNOS expression under ER stress. Therefore, our results suggest a link between ER stress and immune reactions in neurodegenerative diseases.

  11. Interleukin-6 (IL-6) receptor/IL-6 fusion protein (Hyper IL-6) effects on the neonatal mouse brain: possible role for IL-6 trans-signaling in brain development and functional neurobehavioral outcomes.

    PubMed

    Brunssen, Susan H; Moy, Sheryl S; Toews, Arrel D; McPherson, Christopher A; Harry, G Jean

    2013-01-01

    Adverse neurodevelopmental outcomes are linked to perinatal production of inflammatory mediators, including interleukin 6 (IL-6). While a pivotal role for maternal elevation in IL-6 has been established in determining neurobehavioral outcomes in the offspring and considered the primary target mediating the fetal inflammatory response, questions remain as to the specific actions of IL-6 on the developing brain. CD-1 male mice received a subdural injection of the bioactive fusion protein, hyper IL-6 (HIL-6) on postnatal-day (PND)4 and assessed from preweaning until adulthood. Immunohistochemical evaluation of astrocytes and microglia and mRNA levels for pro-inflammatory cytokines and host response genes indicated no evidence of an acute neuroinflammatory injury response. HIL-6 accelerated motor development and increased reactivity to stimulation and number of entries in a light/dark chamber, decreased ability to learn to withhold a response in passive avoidance, and effected deficits in social novelty behavior. No changes were observed in motor activity, pre-pulse startle inhibition, or learning and memory in the Morris water maze or radial arm maze, as have been reported for models of more severe developmental neuroinflammation. In young animals, mRNA levels for MBP and PLP/DM20 decreased and less complexity of MBP processes in the cortex was evident by immunohistochemistry. The non-hydroxy cerebroside fraction of cerebral lipids was increased. These results provide evidence for selective effects of IL-6 signaling, particularly trans-signaling, in the developing brain in the absence of a general neuroinflammatory response. These data contribute to our further understanding of the multiple aspects of IL-6 signaling in the developing brain. Published by Elsevier Inc.

  12. Oleuropein inhibits the IL-1β-induced expression of inflammatory mediators by suppressing the activation of NF-κB and MAPKs in human osteoarthritis chondrocytes.

    PubMed

    Feng, Zhenhua; Li, Xiaobin; Lin, Jian; Zheng, Wenhao; Hu, Zhichao; Xuan, Jiangwei; Ni, Wenfei; Pan, Xiaoyun

    2017-10-18

    Osteoarthritis (OA) is the most common form of joint disease and is widespread in the elderly population and is characterized by erosion of articular cartilage, subchondral bone sclerosis and synovitis. Oleuropein (OL), a secoiridoid, is considered as the most prevalent phenolic component in olive leaves and seeds, pulp and peel of unripe olives and has been shown to have potent anti-inflammatory effects. However, its effects on OA have not been clearly elucidated. This study aimed to assess the effect of OL on human OA chondrocytes. Human OA chondrocytes were pretreated with OL (10, 50 and 100 μM) for 2 h and subsequently stimulated with IL-1β for 24 h. The production of NO, PGE2, MMP-1, MMP-13, and ADAMTS-5 was evaluated by the Griess reaction and ELISA assays. The messenger RNA (mRNA) expression of COX-2, iNOS, MMP-1, MMP13, ADAMTS-5, aggrecan, and collagen-II was measured by using real-time PCR. The protein expressions of COX-2, iNOS, p65, IκB-α, JNK, p-JNK, ERK, p-ERK, p38, and p-p38 were tested by using western blot. We found that OL significantly inhibited the IL-1β-induced production of NO and PGE2; expression of COX-2, iNOS, MMP-1, MMP-13, and ADAMTS-5; and degradation of aggrecan and collagen-II. Furthermore, OL dramatically suppressed IL-1β-stimulated NF-κB and MAPK activation. Immunofluorescence staining demonstrated that OL could suppress IL-1β-induced phosphorylation of p65 nuclear translocation. These results indicate that the therapeutic effect of OL on OA is accomplished through the inhibition of both NF-κB and MAPK signaling pathways. Altogether, our findings provide the evidence to develop OL as a potential therapeutic agent for patients with OA.

  13. Zinc deficiency enhanced inflammatory response by increasing immune cell activation and inducing IL6 promoter demethylation

    PubMed Central

    Wong, Carmen P.; Rinaldi, Nicole A.; Ho, Emily

    2015-01-01

    Scope Zinc deficiency results in immune dysfunction and promotes systemic inflammation. The objective of this study was to examine the effects of zinc deficiency on cellular immune activation and epigenetic mechanisms that promote inflammation. This work is potentially relevant to the aging population given that age-related immune defects, including chronic inflammation, coincide with declining zinc status. Methods and results An in vitro cell culture system and the aged mouse model were used to characterize immune activation and DNA methylation profiles that may contribute to the enhanced proinflammatory response mediated by zinc deficiency. Zinc deficiency up-regulated cell activation markers ICAM1, MHC class II, and CD86 in THP1 cells, that coincided with increased IL1β and IL6 responses following LPS stimulation. A decreased zinc status in aged mice was similarly associated with increased ICAM1 and IL6 gene expression. Reduced IL6 promoter methylation was observed in zinc deficient THP1 cells, as well as in aged mice and human lymphoblastoid cell lines derived from aged individuals. Conclusion Zinc deficiency induced inflammatory response in part by eliciting aberrant immune cell activation and altered promoter methylation. Our results suggested potential interactions between zinc status, epigenetics, and immune function, and how their dysregulation could contribute to chronic inflammation. PMID:25656040

  14. The Pathological and Physiological Roles of IL-6 Amplifier Activation

    PubMed Central

    Murakami, Masaaki; Hirano, Toshio

    2012-01-01

    The NFκB-triggered positive feedback loop for IL-6 signaling in type 1 collagen+ non-immune cells (IL-6 amplifier) was first discovered to be a synergistic signal that is activated following IL-17A and IL-6 stimulation in type 1 collagen+ non-immune cells. Subsequent disease models have shown that it can also be stimulated by the simultaneous activation of NFκB and STAT3, functions as a local chemokine inducer, and acts as a mechanism for local inflammation, particularly chronic ones like rheumatoid arthritis and a multiple sclerosis. Moreover, we have recently shown that hyper activation of the IL-6 amplifier via regional neural activation establishes a gateway for immune cells including autoreactive T cells to pass the blood-brain barrier at dorsal vessels in 5th lumbar cord. Here we review how the IL-6 amplifier is activated by neural activation and the physiological relevance of the gateway to the central nervous system. Accumulating evidences continues to suggest that the IL-6 amplifier offers a potential molecular mechanism for the relationship between neural activation and the development of inflammatory diseases, which could establish a new interdisciplinary field that fuses neurology and immunology. PMID:23136555

  15. Maternal serum but not breast milk IL-5, IL-6, and IL-13 immune markers are associated with scratching among infants.

    PubMed

    Soto-Ramírez, Nelís; Boyd, Keith; Zhang, Hongmei; Gangur, Venugopal; Goetzl, Laura; Karmaus, Wilfried

    2016-01-01

    Scratching in infants is considered to be related to early development of eczema. Little is known about the effects of maternal immune markers on scratching among infants. The objective is to compare the risks related to maternal serum immune markers (IMs) during pregnancy and IMs in breast milk for the occurrence of scratching in infants at 6 and 12 months of age. Pregnant women were recruited in Columbia and Charleston, South Carolina. Blood (median 3 weeks prepartum) and breast milk (3 weeks postpartum) samples were collected. The concentrations of interferon (IFN)-γ, IFN gamma-induced protein 10 (IP-10) (or CXCL10), CCL11, interleukin (IL) 1β, IL-4, IL-5, IL-6, IL-8 (CXCL8), IL-10, IL-12 (p70), IL-13, transforming growth factor (TGF)-β1, and immunoglobulin (Ig) A in both maternal serum and whey were assayed using optimized immunoassays. Scratching and skin manifestations were ascertained at 6 and 12 months. Generalized estimating equations were used to estimate relative risks (RRs) of IMs for repeated measurements of scratching, considering intra-individual correlations and adjusting for confounders. Of 178 women, 161 provided blood and 115 breast milk samples. IL-1β, IL-4, IL-10, IL-12, and CCL11 in maternal serum and whey were not analyzed due to a large proportion of non-detectable values. Infants in the highest tertile of IL-6 and IL-13 in maternal serum were at higher risk of scratching (RR 1.73 and 1.84, respectively; p ≤ 0.002) compared to infants in the first tertile; similarly, infants born to mothers with high (versus low) levels of serum IL-5 were also at increased risk (RR 1.60, p = 0.002). None of the breast milk IMs studied were associated with scratching. Scratching but not doctors diagnosed eczema was associated with higher levels of maternal IL-5, IL-6, and IL-13 during pregnancy. Further investigations are necessary to determine how maternal serum IMs influence infants scratching.

  16. Enhanced GITR/GITRL interactions augment IL-27 expression and induce IL-10-producing Tr-1 like cells.

    PubMed

    Carrier, Yijun; Whitters, Matthew J; Miyashiro, Joy S; LaBranche, Timothy P; Ramon, Hilda E; Benoit, Stephen E; Ryan, Mark S; Keegan, Sean P; Guay, Heath; Douhan, John; Collins, Mary; Dunussi-Joannopoulos, Kyri; Medley, Quintus G

    2012-06-01

    The glucocorticoid-induced TNFR-related (GITR) protein is a coactivating receptor that is constitutively expressed on Treg cells and induced on activated T cells. To better under-stand the role of long-term GITR signaling, we generated a mouse that constitutively expresses GITR ligand (GITRL) on APCs that mimics the physiological distribution of GITRL in vivo. Despite a five-fold expansion of the Treg-cell pool, there is increased activation and depletion of naive T cells in the transgenic (Tg) mice, suggesting that the increased number of Treg cells cannot fully suppress T-cell activation. Interestingly, GITRL Tg mice have multiorgan lymphocytic infiltrates yet display no overt autoimmunity, indicating the existence of a compensatory immunoregulatory mechanism(s). In the spleens and tissue infiltrates ofGITRL Tg mice, we found increased numbers of Foxp3(-) IL-10-producing type 1 regulatory T (Tr-1)-like cells that suppress naïve T-cell proliferation in an IL-10-dependent fashion. Increased IL-27 production from Tg APCs and activation of c-Maf in the Tr1-like cells suggest a possible mechanism for their induction. Our results demonstrate that enhanced GITR/GITRL interactions have a pleiotropic role on the regulation of T-cell responses, which includes promoting the differentiation of Tr-1-like cells, which contribute to the maintenance of peripheral T-cell tolerance. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Increased Interleukin-23 in Hashimoto’s Thyroiditis Disease Induces Autophagy Suppression and Reactive Oxygen Species Accumulation

    PubMed Central

    Zheng, Tingting; Xu, Chengcheng; Mao, Chaoming; Mou, Xiao; Wu, Fei; Wang, Xuefeng; Bu, Ling; Zhou, Yuepeng; Luo, Xuan; Lu, Qingyan; Liu, Hongli; Yuan, Guoyue; Wang, Shengjun; Chen, Deyu; Xiao, Yichuan

    2018-01-01

    Hashimoto’s thyroiditis (HT) represents the most common organ-specific autoimmune disease. Inflammatory factors and reactive oxygen species (ROS) play detrimental roles during the pathogenesis of HT. In this study, we found that thyroid follicular cells (TFCs) from HT patients expressed an elevated level of interleukin-23 (IL-23), which contributed to autophagy suppression and ROS accumulation. Additionally, IL-23-induced autophagy suppression and ROS accumulation in human TFCs was attributed to AKT/mTOR/NF-κB signaling pathway activation. Inhibition of either IL-23 by a specific neutralization antibody, or mTOR by rapamycin, or NF-κB by IKK-16, significantly reversed the autophagy suppression and ROS accumulation. These results demonstrate a key role for IL-23 in HT pathogenesis and provide a potential therapeutic strategy against IL-23 or its signaling pathway in HT. PMID:29434604

  18. Efficacy of anti-IL-23 monotherapy versus combination therapy with anti-IL-17 in estrogen deficiency induced bone loss conditions.

    PubMed

    Shukla, Priyanka; Mansoori, Mohd Nizam; Singh, Divya

    2018-05-01

    Recent studies have identified that Interleukin (IL)-23/IL-17 axis plays crucial role in pathogenesis of inflammation and bone destruction. IL-23 is thought to promote joint destruction in arthritis by stimulating Th17 cells. IL-23 directly mediates bone loss by inducing osteoclastogenesis and receptor activator of kappa B ligand (RANKL) expression in T cells. IL-23 also promotes tartrate-resistant acid phosphatase (TRAP) activity of osteoclast in osteoblast-osteoclast co-culture. The role of IL-23 has not been studied in estrogen deficiency induced bone loss. Here, we study the effect of IL-23 neutralization in ovariectomized (Ovx) estrogen deficient mice on various immune and skeletal parameters. We also determine whether the combination of anti-IL-23 and anti-IL17 has enhanced osteoprotective effects compared to monotherapies. Treatment of anti-IL-23 and its combination with anti-IL-17 suppressed Th17 cell differentiation and promoted development of T regulatory cells. Anti-IL-23 and its combination with anti-IL-17 prevented bone loss. However, the individual monotherapies of anti-IL-23 and anti-IL-17 were more effective than combination therapy. Treatment of IL-17 and IL-23 cytokines to bone marrow stromal cells led to increased differentiation towards osteoblast lineage. Double neutralization of IL-23 and IL-17 might be inhibiting this phenomenon thus producing less potent effects. Our studies thus support bone protective effects of anti-IL-23 and that the monotherapies of neutralizing antibodies against IL-17 and IL-23 may be a more accepted mode of treatment in management of post-menopausal bone loss rather than combination therapy. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. IDO-expressing Fibroblasts Suppress the Development of Imiquimod-induced Psoriasis-like Dermatitis.

    PubMed

    Elizei, Sanam Salimi; Pakyari, Mohammadreza; Ghoreishi, Mehraneh; Kilani, Ruhangiz; Mahmoudi, Sanaz; Ghahary, Aziz

    2018-01-01

    Psoriasis is a chronic skin condition whose pathogenesis is reported to be due to the activation of the interleukin-23/interleukin-17 (IL-23/IL-17) pathway. Here, we report that indoleamine 2,3-dioxygenase (IDO)-expressing fibroblasts reduce the activity of this pathway in activated immune cells. The findings showed that intralesional injection of IDO-expressing fibroblasts in imiquimod-induced psoriasis-like dermatitis on the back and ear (Pso. ear group) in mice significantly improves the clinical lesional appearance by reducing the number of skin-infiltrated IL-17+ CD4+ T cells (1.9% ± 0.3% vs. 6.9% ± 0.6%, n = 3, P value < 0.01), IL-17+ γδ+ T cells (2.8% ± 0.3% vs. 11.6% ± 1.2%, n = 3, P value < 0.01), IL-23+ activated dendritic cells (7.6% ± 0.9% vs. 14.0% ± 0.5%, n = 3, P < 0.01), macrophages (4.3% ± 0.1% vs. 11.3% ± 1.0%, n = 3, P value < 0.01), and granulocytes (2.5% ± 0.4% vs. 4.5% ± 0.3%, n = 3, P value < 0.01) as compared to untreated psoriatic mice. This finding suggests that IDO-expressing fibroblasts, and to a lesser extent, non-IDO primary fibroblasts suppress the psoriatic-like symptoms by inhibiting the infiltration of key immune cells involved in the development of psoriasis.

  20. [The effect of entrapment of CpG sequence with cationic PLG nanoparticles on the immune responses of mice to pig paratyphoid vaccine].

    PubMed

    Wu, Mei; Shi, Ling; Liu, Shigui; Li, Jiangling; Wu, Kaiyuan; Wang, Lihuan; Shen, Yi; Liu, Kun; Zheng, Yong; Zhang, Xinshen; Gao, Rong

    2005-10-01

    Cationic PLG nanoparticles and liposome were prepared and used as package molecules to pack up pUC18-CpG. The effects of the packed pUC18-CpG on the cellular and humoral immune responses were detected in the mice that were inoculated with pig paratyphoid vaccine. The results showed that compared with the control, the amount of IgG and the titre of specific antibody were significantly increased in the sera of mice immunized with the CpG plasmid entrapped by cationic PLG nanoparticles; the proliferation and induced IL-2 bioactivity of lymphocytes were significantly enhanced in the spleen of the immunized mice; the stimulatory effect of cationic PLG nanoparticles was similar to or stronger than that of cationic liposome. These indicated that cationic PLG nanoparticle could be employed as an effective package molecule to promote the immunostimulatory effect of pUC18-CpG.

  1. Fasting Induces IL-1 Resistance and Free-Fatty Acid-Mediated Up-Regulation of IL-1R2 and IL-1RA

    PubMed Central

    Joesting, Jennifer J.; Moon, Morgan L.; Gainey, Stephen J.; Tisza, Brittany L.; Blevins, Neil A.; Freund, Gregory G.

    2014-01-01

    Objective: Weight-loss is a near societal obsession and many diet programs use significant calorie restriction including fasting/short term starvation to generate rapid effects. Fasting is also a well-recognized cause of immunosuppression especially within the innate immune system. In this study, we sought to determine if the IL-1 arm of the neuroimmune system was down-regulated by a 24 h fast and how fasting might generate this effect. Design: Mice were allowed ad libitum access to food or had food withheld for 24 h. Expression of the endogenous IL-1 antagonists, IL-1 receptor type 2 (IL-1R2), and IL-1 receptor antagonist (IL-1RA) was determined as were sickness behaviors before and after IL-1β administration. Results: Fasting markedly increased gene expression of IL-1R2 (83-fold in adipose tissue, 9.5-fold in liver) and IL-1RA (68-fold in liver). Fasted mice were protected from IL-1β-induced weight-loss, hypoglycemia, loss of locomotor, and social anxiety. These protections were coupled to a large positive interaction of fasting and IL-1β on IL-1R2 gene expression in adipose tissue and liver (2.6- and 1.6-fold, respectively). Fasting not only increased IL-1RA and IL-1R2 protein 2.5- and 3.2-fold, respectively, in liver but also increased IL-1R2 1.8-fold in adipose tissue. Fasting, in turn, triggered a 2.4-fold increase in plasma free-fatty acids (FFAs) and a 2.1-fold increase in plasma corticosterone. Inhibition, of glucocorticoid action with mifepristone did not impact fasting-dependent IL-1R2 or IL-1RA gene expression. Administration of the FFA, palmitate, to mice increased liver IL-1R2 and IL-1RA gene expression by 14- and 11-fold, respectively. Conclusion: These findings indicate that fasting augments expression of endogenous IL-1 antagonists inducing IL-1 resistance. Fasting-induced increases in plasma FFAs appears to be a signal that drives immunosuppression during fasting/short term starvation. PMID:25071776

  2. Caspase-1 inhibitor regulates humoral responses in experimental autoimmune myasthenia gravis via IL-6- dependent inhibiton of STAT3.

    PubMed

    Wang, Cong-Cong; Zhang, Min; Li, Heng; Li, Xiao-Li; Yue, Long-Tao; Zhang, Peng; Liu, Ru-Tao; Chen, Hui; Li, Yan-Bin; Duan, Rui-Sheng

    2017-08-24

    We have previously demonstrated that Cysteinyl aspartate-specific proteinase-1 (caspase-1) inhibitor ameliorates experimental autoimmune myasthenia gravis (EAMG) by inhibited cellular immune response, via suppressing DC IL-1 β, CD4 + T and γdT cells IL-17 pathways. In this study, we investigated the effect of caspase-1 inhibitor on humoral immune response of EAMG and further explore the underlying mechanisms. An animal model of MG was induced by region 97-116 of the rat AChR α subunit (R97-116 peptide) in Lewis rats. Rats were treated with caspase-1 inhibitor Ac-YVAD-cmk intraperitoneally (i.p.) every second day from day 13 after the first immunization. Flow cytometry, western blot, immunofluorescence, and enzyme-linked immunosorbent assay (ELISA) were performed to evaluate the neuroprotective effect of caspase-1 inhibitor on humoral immune response of EAMG. The results showed that caspase-1 inhibitor reduced the relative affinity of anti-R97-116 IgG, suppressed germinal center response, decreased follicular helper T cells, and increased follicular regulatory T cells and regulatory B cells. In addition, we found that caspase-1 inhibitor inhibited humoral immunity response in EAMG rats via suppressing IL-6-STAT3-Bcl-6 pathways. These results suggest that caspase-1 inhibitor ameliorates EAMG by regulating humoral immune response, thus providing new insights into the development of myasthenia gravis and other autoimmune diseases therapies. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Josamycin suppresses Prevotella intermedia lipopolysaccharide-induced production of nitric oxide and interleukin-1β in murine macrophages.

    PubMed

    Choi, Eun-Young; Choe, So-Hui; Hyeon, Jin-Yi; Park, Hae Ryoun; Choi, In Soon; Kim, Sung-Jo

    2018-06-05

    Josamycin has immunomodulatory properties independent of its antibacterial actions. This study was designed to explore the influences and associated mechanisms of josamycin upon the generation of proinflammatory mediators in murine macrophages activated with lipopolysaccharide (LPS) from Prevotella intermedia, a pathogenic bacterium associated with periodontal disease. LPS was purified by employing phenol-water extraction protocol. Culture supernatants were analyzed for nitric oxide (NO) and interleukin (IL)-1β. Real-time PCR and immunoblotting were conducted to quantify mRNA and protein expression, respectively. The expression levels of IL-1β were analyzed by confocal laser scanning microscopy. NF-κB-dependent SEAP levels were estimated by reporter assay. Josamycin significantly attenuated NO production elicited by P. intermedia LPS as well as induction of iNOS protein and mRNA in RAW264.7 cells. While the release of IL-1β from cells stimulated by LPS was suppressed in the presence of josamycin, josamycin failed to reduce the degree of IL-1β mRNA expression. Josamycin did not reduce the stability of IL-1β mRNA induced by P. intermedia LPS, at the same time josamycin also failed to suppress the LPS-induced intracellular IL-1β expression. Josamycin augmented HO-1 induction in cells exposed to P. intermedia LPS, and SnPP, an inhibitor of HO-1 activity, reversed the suppressive impact of josamycin upon NO generation induced by LPS. Josamycin diminished NF-κB transcriptional activity induced by P. intermedia LPS. Further, josamycin enhanced SOCS1 mRNA level in cells activated with LPS. Josamycin suppressed P. intermedia LPS-induced generation of NO and IL-1β in RAW264.7 macrophages via the inhibition of NF-κB activation as well as HO-1 and SOCS1 induction. Josamycin may have benefits as a host modulatory agent in treating periodontal disease. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  4. Do the Changes in the Serum Levels of IL-2, IL-4, TNFα, and IL-6 Reflect the Inflammatory Activity in the Patients with Post-ERCP Pancreatitis?

    PubMed Central

    Kilciler, Guldem; Musabak, Ugur; Bagci, Sait; Yesilova, Zeki; Tuzun, Ahmet; Uygun, Ahmet; Gulsen, Mustafa; Oren, Sema; Oktenli, Cagatay; Karaeren, Necmettin

    2008-01-01

    Background. Acute pancreatitis is the major complication of endoscopic retrograde cholangiopancreatography (ERCP) procedure and there are some reports showing cytokine changes in ERCP-induced pancreatits. Goals. To investigate the association between early changes (within 24 hours) in the serum interleukin (IL)-2, IL-4, tumor necrosis factor (TNF)α, and IL-6 levels and the development of post-ERCP pancreatitis. Study. Forty five consecutive patients who underwent therapeutic ERCP and 10 patients with acute pancreatitis without ERCP were enrolled to the study. Serum concentrations of IL-2, IL-4, TNFα, and IL-6 were determined immediately before, 12 hours and 24 hours after ERCP. Results. Seven of the 45 patients (15.5%) developed post-ERCP pancreatitis. The levels of IL-4 at 24 hours after ERCP were significantly lower in the patients with post-ERCP pancreatitis than in those without pancreatitis, while TNFα levels at 12 hours after ERCP were higher in the complicated group than those of the uncomplicated group. The ratios of TNFα/IL-4 at 12 and 24 hours after ERCP were found significantly higher in the patients with post-ERCP pancreatitis than in those without pancreatitis. IL-6 in the complicated patients was found significantly increased at 24 hours after ERCP. Conclusions. The enhancement of serum TNFα and IL-6 levels in the patients with ERCP-induced pancreatitis reflects the inflammatory activity. Additionally, these cytokines together with IL-4 can be used in clinical laboratory monitoring of ERCP. PMID:18670651

  5. Rebamipide suppresses mite-induced asthmatic responses in NC/Nga mice.

    PubMed

    Murakami, Ikuo; Zhang, Ran; Kubo, Masayuki; Nagaoka, Kenjiro; Eguchi, Eri; Ogino, Keiki

    2015-10-15

    Allergic asthma caused by continuous allergen exposure evokes allergen-specific Th2 responses and is characterized by chronic airway inflammation and hyperresponsiveness. A previous report showed that rebamipide improved asthmatic symptoms in an ovalbumin/trypsin mice model. However, it is still unclear how rebamipide exerts its effects in asthma. In this study, rebamipide improved the asthmatic responses induced by mite exposure in NC/Nga mice, revealing the mechanism of this therapeutic effect. Rebamipide suppressed the infiltration of eosinophils into the airways and lung as well as attenuating the production of reactive oxygen species in tissues. In addition to these anti-inflammatory effects, rebamipide inhibited the production of IL-33, a member of the IL-1 family that drives the subsequent production of Th2-associated cytokines. These observations identify the point where rebamipide exerts its suppressive action on asthma and suggest that rebamipide has therapeutic potential in preventing mite-induced asthma. Copyright © 2015 the American Physiological Society.

  6. Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides

    PubMed Central

    Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655

  7. Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

    PubMed

    Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.

  8. FABP4 inhibition suppresses PPARγ activity and VLDL-induced foam cell formation in IL-4-polarized human macrophages.

    PubMed

    Boss, Marcel; Kemmerer, Marina; Brüne, Bernhard; Namgaladze, Dmitry

    2015-06-01

    Macrophages, converted to lipid-loaded foam cells, accumulate in atherosclerotic lesions. Macrophage lipid metabolism is transcriptionally regulated by peroxisome proliferator-activated receptor gamma (PPARγ), and its target gene fatty acid binding protein 4 (FABP4) accelerates the progression of atherosclerosis in mouse models. Since expression of PPARγ and FABP4 is increased upon interleukin-4 (IL-4)-induced macrophage polarization, we aimed to investigate the role of FABP4 in human IL-4-polarized macrophages. We investigated the impact of FABP4 on PPARγ-dependent gene expression in primary human monocytes differentiated to macrophages in the presence of IL-4. IL-4 increased PPARγ and its target genes lipoprotein lipase (LPL) and FABP4 compared to non-polarized or LPS/interferon γ-stimulated macrophages. LPL expression correlated with increased very low density lipoprotein (VLDL)-induced triglyceride accumulation in IL-4-polarized macrophages, which was sensitive to inhibition of lipolysis or PPARγ antagonism. Inhibition of FABP4 during differentiation using chemical inhibitors BMS309403 and HTS01037 or FABP4 siRNA decreased the expression of FABP4 and LPL, and reduced lipid accumulation in macrophages treated with VLDL. FABP4 or LPL inhibition also reduced the expression of inflammatory mediators chemokine (C-C motif) ligand 2 (CCL2) and IL-1β in response to VLDL in IL-4-polarized macrophages. PPARγ luciferase reporter assays confirmed that FABP4 supports fatty acid-induced PPARγ activation. Our findings suggest that IL-4 induces a lipid-accumulating macrophage phenotype by activating PPARγ and subsequent LPL expression. Inhibition of FABP4 decreases VLDL-induced foam cell formation, indicating that anti-atherosclerotic effects achieved by FABP4 inhibition in mouse models may be feasible in the human system as well. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  9. Metformin ameliorates IL-6-induced hepatic insulin resistance via induction of orphan nuclear receptor small heterodimer partner (SHP) in mouse models.

    PubMed

    Kim, Y D; Kim, Y H; Cho, Y M; Kim, D K; Ahn, S W; Lee, J M; Chanda, D; Shong, M; Lee, C H; Choi, H S

    2012-05-01

    IL-6 is a proinflammatory cytokine associated with the pathogenesis of hepatic diseases. Metformin is an anti-diabetic drug used for the treatment of type 2 diabetes, and orphan nuclear receptor small heterodimer partner (SHP, also known as NR0B2), a transcriptional co-repressor, plays an important role in maintaining metabolic homeostasis. Here, we demonstrate that metformin-mediated activation of AMP-activated protein kinase (AMPK) increases SHP protein production and regulates IL-6-induced hepatic insulin resistance. We investigated metformin-mediated SHP production improved insulin resistance through the regulation of an IL-6-dependent pathway (involving signal transducer and activator of transcription 3 [STAT3] and suppressor of cytokine signalling 3 [SOCS3]) in both Shp knockdown and Shp null mice. IL-6-induced STAT3 transactivation and SOCS3 production were significantly repressed by metformin, adenoviral constitutively active AMPK (Ad-CA-AMPK), and adenoviral SHP (Ad-SHP), but not in Shp knockdown, or with the adenoviral dominant negative form of AMPK (Ad-DN-AMPK). Chromatin immunoprecipitation (ChIP), co-immunoprecipitation (Co-IP) and protein localisation studies showed that SHP inhibits DNA binding of STAT3 on the Socs3 gene promoter via interaction and colocalisation within the nucleus. Upregulation of inflammatory genes and downregulation of hepatic insulin signalling by acute IL-6 treatment were observed in wild-type mice but not in Shp null mice. Finally, chronic IL-6 exposure caused hepatic insulin resistance, leading to impaired insulin tolerance and elevated gluconeogenesis, and these phenomena were aggravated in Shp null mice. Our results demonstrate that SHP upregulation by metformin may prevent hepatic disorders by regulating the IL-6-dependent pathway, and that this pathway can help to ameliorate the pathogenesis of cytokine-mediated metabolic dysfunction.

  10. Increased parenchymal damage and steatohepatitis in Caucasian non-alcoholic fatty liver disease patients with common IL1B and IL6 polymorphisms.

    PubMed

    Nelson, J E; Handa, P; Aouizerat, B; Wilson, L; Vemulakonda, L A; Yeh, M M; Kowdley, K V

    2016-12-01

    Non-alcoholic fatty liver disease (NAFLD) is a complex, multifactorial disease affected by diet, lifestyle and genetics. Proinflammatory cytokines like IL-1β and IL-6 have been shown to be elevated in non-alcoholic steatohepatitis (NASH). To investigate the relationship between IL1B and IL6 gene polymorphisms and histological features of NAFLD in the NASH CRN cohort. A total of 604 adult (≥18 years) non-Hispanic Caucasians with biopsy-proven NAFLD were genotyped for the following SNPs: IL1B, rs16944, rs1143634; IL6, rs1800795, rs10499563. Logistic regression was used to examine the relationship between genotype and a definitive diagnosis and advanced histological features of NASH after controlling for the following variables selected a priori: age, sex, diabetes, obesity and HOMA-IR level. The IL6 rs10499563 C allele was independently associated with the presence of definitive NASH, and increased ballooning and Mallory bodies. The IL1B rs1143634 TT genotype was associated with advanced fibrosis and increased Mallory bodies. The IL6 rs1800795 C allele was associated with not only increased risk for severe steatosis, >66% but also decreased risk for advanced fibrosis and lobular inflammation and Mallory body formation. These results suggest that common variants in the IL6 and IL1B genes may increase susceptibility for NASH and confer a higher risk of hepatic parenchymal damage including increased ballooning, increased Mallory bodies, and bridging fibrosis or cirrhosis. In contrast, the IL6 rs1800795 C allele may confer a higher risk for steatosis, but less parenchymal damage. Our findings support the development of therapeutics aimed at IL-1β and IL-6 suppression. © 2016 John Wiley & Sons Ltd.

  11. Low Oxygen Consumption is Related to a Hypomethylation and an Increased Secretion of IL-6 in Obese Subjects with Sleep Apnea-Hypopnea Syndrome.

    PubMed

    Lopez-Pascual, Amaya; Lasa, Arrate; Portillo, María P; Arós, Fernando; Mansego, María L; González-Muniesa, Pedro; Martinez, J Alfredo

    2017-01-01

    Deoxyribonucleic acid (DNA) methylation is an epigenetic modification involved in gene expression regulation, usually via gene silencing, which contributes to the risks of many multifactorial diseases. The aim of the present study was to analyze the influence of resting oxygen consumption on global and gene DNA methylation as well as protein secretion of inflammatory markers in blood cells from obese subjects with sleep apnea-hypopnea syndrome (SAHS). A total of 44 obese participants with SAHS were categorized in 2 groups according to their resting oxygen consumption. DNA methylation levels were evaluated using a methylation-sensitive high resolution melting approach. The analyzed interleukin 6 (IL6) gene cytosine phosphate guanine (CpG) islands showed a hypomethylation, while serum IL-6 was higher in the low compared to the high oxygen consumption group (p < 0.05). Moreover, an age-related loss of DNA methylation of tumor necrosis factor (B = -0.82, 95% CI -1.33 to -0.30) and long interspersed nucleotide element 1 (B = -0.46; 95% CI -0.87 to -0.04) gene CpGs were found. Finally, studied CpG methylation levels of serpin peptidase inhibitor, clade E member 1 (r = 0.43; p = 0.01), and IL6 (r = 0.41; p = 0.02) were positively associated with fat-free mass. These findings suggest a potential role of oxygen in the regulation of inflammatory genes. Oxygen consumption measurement at rest could be proposed as a clinical biomarker of metabolic health. © 2017 S. Karger AG, Basel.

  12. Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

    PubMed

    Najar, Hossain M; Dutz, Jan P

    2008-09-01

    Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

  13. Relaxin augments the inflammatory IL6 response in the choriodecidua

    PubMed Central

    JS, Horton; SY, Yamamoto; GD, Bryant-Greenwood

    2012-01-01

    Intrauterine infection frequently leads to preterm birth (PTB), with the pathophysiology involving activation of the innate immune system and its associated inflammatory response. The choriodecidua produces relaxin (RLN) and elevated levels are associated with preterm premature rupture of the fetal membranes. However, it is not increased in bacterially-mediated PTB, but may act as an endogenous sterile inflammatory mediator. Elevated systemic RLN levels from the corpus luteum are also associated with PTB, but the mechanism is unknown. In clinical obstetrics, intrauterine inflammation or infection can coexist with elevated RLN. Therefore, in this study, we further characterized the effects of RLN alone or together with an inflammatory mediator on the production of IL1B, CSF2 (GM-CSF), IL6, IL8 and TNF, from chorionic cytotrophoblasts (CyT), decidual fibroblasts (DF) and stromal cells (DSC), using interleukin-1 beta (IL1B) to mimic sterile inflammation or lipopolysaccharide (LPS) for bacterial infection. Endogenous differences between the cells showed that the CyT expressed more and the RXFP1, its receptor RXFP1 splice variant D. CyT also showed the most robust cAMP response to RLN with increased IL6 secreted after 4 h, preceded by increased transcription at 1 h, likely due to activation of RXFP1 and cAMP. When all cell types were treated with IL1B and RLN, RLN augmented secretion of IL6 and IL8 from CyT and DF, but not DSC. Similarly, RLN augmented LPS-induced IL6 secretion from CyT and DF. Despite the structural similarity between TLR4 and RXFP1, blocking TLR4 in CyT had no effect on RLN-induced IL6 secretion, suggesting specific activation of RXFP1. Thus, we have shown that in the presence of a low level of intrauterine inflammation/infection, elevated RLN could act on the CyT and DF to augment the inflammatory response, contributing to the pathophysiology of PTB. PMID:22386961

  14. Preventive effects of interleukin-6 in lipopolysaccharide/d-galactosamine induced acute liver injury via regulating inflammatory response in hepatic macrophages.

    PubMed

    Li, Long; Duan, Chaoli; Zhao, Yan; Zhang, Xiaofang; Yin, Hongyan; Wang, Tianxi; Huang, Caoxin; Liu, Suhuan; Yang, Shuyu; Li, Xuejun

    2017-10-01

    Lipopolysaccharide/d-Galactosamine (LPS/d-Gal)-induced acute liver injury is characterized by significant inflammatory responses including TNF-α and interleukin-6 (IL-6) and is a widely applied experimental model for inflammation research. TNF-α is critical in the progression of LPS/d-Gal-induced liver injury. However, the role of IL-6 in this model is still unknown. In the present study, we aim to elucidate the involvement of IL-6 in the pathogenesis of acute liver injury induced by LPS/d-Gal in mice and its underlying mechanism. To induce acute liver injury, LPS (50μg/kg body weight) and d-Gal (400mg/kg body weight) were injected intraperitoneally in the C57BL/6 mice. The vehicle (saline) or a single dose of recombinant IL-6 (200μg/kg body weight) was administered 2h prior to LPS/d-Gal injection. Mice were sacrificed 2h and 6h after LPS/d-Gal injection. The results indicated that IL-6 treatment could protect mice from LPS/d-Gal-induced tissue damage, alanine aminotransferase (ALT) and aspartate aminotransferase (AST) elevation, as well as hepatocyte apoptosis and inflammation. Furthermore, in vitro study showed that IL-6 treatment could significantly suppress LPS-triggered expression of proinflammatory cytokines and chemokines, TNF-α, RANTES and MCP-1 in macrophages while promoting the expression of M2 markers, such as Arg-1 and Mrc-1 in macrophages. Taken together, these findings revealed a novel and unexpected role of IL-6 in ameliorating LPS/d-Gal-induced acute liver injury via regulating inflammatory responses in hepatic macrophages. Copyright © 2017. Published by Elsevier B.V.

  15. Type 2 innate lymphoid cell suppression by regulatory T cells attenuates airway hyperreactivity and requires inducible T-cell costimulator-inducible T-cell costimulator ligand interaction.

    PubMed

    Rigas, Diamanda; Lewis, Gavin; Aron, Jennifer L; Wang, Bowen; Banie, Homayon; Sankaranarayanan, Ishwarya; Galle-Treger, Lauriane; Maazi, Hadi; Lo, Richard; Freeman, Gordon J; Sharpe, Arlene H; Soroosh, Pejman; Akbari, Omid

    2017-05-01

    Atopic diseases, including asthma, exacerbate type 2 immune responses and involve a number of immune cell types, including regulatory T (Treg) cells and the emerging type 2 innate lymphoid cells (ILC2s). Although ILC2s are potent producers of type 2 cytokines, the regulation of ILC2 activation and function is not well understood. In the present study, for the first time, we evaluate how Treg cells interact with pulmonary ILC2s and control their function. ILC2s and Treg cells were evaluated by using in vitro suppression assays, cell-contact assays, and gene expression panels. Also, human ILC2s and Treg cells were adoptively transferred into NOD SCID γC-deficient mice, which were given isotype or anti-inducible T-cell costimulator ligand (ICOSL) antibodies and then challenged with IL-33 and assessed for airway hyperreactivity. We show that induced Treg cells, but not natural Treg cells, effectively suppress the production of the ILC2-driven proinflammatory cytokines IL-5 and IL-13 both in vitro and in vivo. Mechanistically, our data reveal the necessity of inducible T-cell costimulator (ICOS)-ICOS ligand cell contact for Treg cell-mediated ILC2 suppression alongside the suppressive cytokines TGF-β and IL-10. Using a translational approach, we then demonstrate that human induced Treg cells suppress syngeneic human ILC2s through ICOSL to control airway inflammation in a humanized ILC2 mouse model. These findings suggest that peripheral expansion of induced Treg cells can serve as a promising therapeutic target against ILC2-dependent asthma. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  16. Effect of azithromycin on Prevotella intermedia lipopolysaccharide-induced production of interleukin-6 in murine macrophages.

    PubMed

    Choi, Eun-Young; Jin, Ji-Young; Choi, Jeom-Il; Choi, In Soon; Kim, Sung-Jo

    2014-04-15

    Interleukin-6 (IL-6) is a key proinflammatory cytokine which plays a central role in the pathogenesis of periodontal disease. Host modulatory agents targeting at inhibiting IL-6, therefore, appear to be beneficial in slowing the progression of periodontal disease and potentially reducing destructive aspects of the host response. The present study was designed to investigate the effect of the macrolide antibiotic azithromycin on IL-6 generation in murine macrophages treated with lipopolysaccharide (LPS) from Prevotella intermedia, a pathogen implicated in inflammatory periodontal disease, and its mechanisms of action. Azithromycin significantly suppressed IL-6 production as well as its mRNA expression in P. intermedia LPS-activated RAW264.7 cells. LPS-induced activation of JNK and p38 was not affected by azithromycin treatment. Azithromycin failed to prevent P. intermedia LPS from degrading IκB-α. Instead, azithromycin significantly diminished nuclear translocation and DNA binding activity of NF-κB p50 subunit induced with LPS. Azithromycin inhibited P. intermedia LPS-induced STAT1 and STAT3 phosphorylation. In addition, azithromycin up-regulated the mRNA level of SOCS1 in cells treated with LPS. In conclusion, azithromycin significantly attenuated P. intermedia LPS-induced production of IL-6 in murine macrophages via inhibition of NF-κB, STAT1 and STAT3 activation, which is possibly related to the activation of SOCS1 signaling. Further in vivo studies are required to better evaluate the potential of azithromycin in the treatment of periodontal disease. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Velutin reduces lipopolysaccharide-induced proinflammatory cytokine TNFa and IL-6 production by inhibiting NF-Kappa B activation

    USDA-ARS?s Scientific Manuscript database

    Recent studies have shown that some flavonoids are modulators of proinflammatory cytokine expression. Velutin, an uncommon flavone isolated from acai (Euterpe oleraceas) berry, was tested for the effects in reducing LPS-induced TNFa and IL-6 production in RAW 264.7 peripheral macrophages and periton...

  18. Cepharanthine attenuates lipopolysaccharide-induced mice mastitis by suppressing the NF-κB signaling pathway.

    PubMed

    Ershun, Zhou; Yunhe, Fu; Zhengkai, Wei; Yongguo, Cao; Naisheng, Zhang; Zhengtao, Yang

    2014-04-01

    Cepharanthine (CEP), a biscoclaurine alkaloid isolated from Stephania cepharantha Hayata, has been reported to have potent anti-inflammatory properties. However, the anti-inflammatory effects of CEP on a mouse model of lipopolysaccharide (LPS)-induced mastitis and its underlying molecular mechanisms remain to be elucidated. The purpose of the present study was to investigate the effects of CEP on LPS-induced mouse mastitis. The mouse model of mastitis was induced by inoculation of LPS through the canals of the mammary gland. CEP was administered intraperitoneally at 1 h before and 12 h after induction of LPS. The results show that CEP significantly attenuates the infiltration of neutrophils, suppresses myeloperoxidase activity, and reduces the levels of TNF-α, IL-1β, and IL-6 in LPS-induced mouse mastitis. Furthermore, CEP inhibited the phosphorylation of NF-κB p65 subunit and the degradation of its inhibitor IκBα. All the results suggest that CEP exerts potent anti-inflammatory effects on LPS-induced mouse mastitis. Accordingly, CEP might be a potential therapeutic agent for mastitis.

  19. Cytokine responses induced by diesel exhaust particles are suppressed by PAR-2 silencing and antioxidant treatment, and driven by polar and non-polar soluble constituents.

    PubMed

    Bach, Nicolai; Bølling, Anette Kocbach; Brinchmann, Bendik C; Totlandsdal, Annike I; Skuland, Tonje; Holme, Jørn A; Låg, Marit; Schwarze, Per E; Øvrevik, Johan

    2015-10-14

    Adsorbed soluble organics seem to be the main drivers of inflammatory responses induced by diesel exhaust particles (DEP). The specific compounds contributing to this process and the cellular mechanisms behind DEP-induced inflammation are not well known. We have assessed pro-inflammatory effects of DEP and various soluble DEP fractions, in human bronchial epithelial cells (BEAS-2B). DEP increased the expression of interleukin (IL)-6 and CXCL8. Silencing of the aryl hydrocarbon receptor (AhR) by siRNA or pretreatment with AhR-antagonists did not attenuate DEP-induced IL-6 and CXCL8 responses. However, the halogenated aromatic hydrocarbon (HAH)-selective AhR antagonist CH223191 caused a considerable reduction in DEP-induced CYP1A1 expression indicating that this response may be due to dioxin or dioxin-like constituents in DEP. Knock-down of protease activated receptor (PAR)-2 attenuated IL-6 responses without affecting CXCL8. Antioxidants did not affect IL-6 expression after 4h DEP-exposure and only partly reduced CXCL8 expression. However, after 24h exposure antioxidant treatment partly suppressed IL-6 protein release and completely blocked CXCL8 release. Furthermore, a heptane-soluble (non-polar) extract of DEP induced both IL-6 and CXCL8 release, whereas a PBS-soluble (highly polar) extract induced only IL-6. Thus, pro-inflammatory responses in DEP-exposed epithelial cells appear to be the result of both reactive oxygen species and receptor signaling, mediated through combinatorial effects between both non-polar and polar constituents adhered to the particle surface. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  20. Cancer cell-derived IL-1α induces CCL22 and the recruitment of regulatory T cells

    PubMed Central

    Wiedemann, Gabriela Maria; Knott, Max Martin Ludwig; Vetter, Viola Katharina; Rapp, Moritz; Haubner, Sascha; Fesseler, Julia; Kühnemuth, Benjamin; Layritz, Patrick; Thaler, Raffael; Kruger, Stephan; Ormanns, Steffen; Mayr, Doris; Endres, Stefan; Anz, David

    2016-01-01

    ABSTRACT In cancer patients, immunosuppression through regulatory T cells (Treg) is a crucial component of tumor immune evasion and contributes to disease progression. Tumor-infiltrating Treg in particular suppress local effector T cell responses and are associated with poor prognosis in tumors such as human pancreatic cancer or hepatocellular carcinoma (HCC). The chemokine CCL22 is known to recruit Treg into the tumor tissue and many types of human tumors are known to express high levels of CCL22. The mechanisms leading to intratumoral secretion of CCL22 are so far unknown. We demonstrate here that intratumoral CCL22 is induced in tumor-infiltrating immune cells through cancer cell-derived interleukin-1 (IL-1α). In pancreatic cancer and HCC, CCL22 is produced by intratumoral dendritic cells, while the cancer cells themselves do not secrete CCL22 in vitro and in vivo. Incubation of human peripheral blood mononuclear cells (PBMC) or murine splenocytes with tumor cells or tumor cell supernatants strongly induced CCL22 secretion in vitro. Tumor cell supernatants contained IL-1 and CCL22 induction in PBMC could be specifically prevented by the IL-1 receptor antagonist anakinra or by transfection of tumor cell lines with IL-1 siRNA, leading to a suppression of Treg migration. In conclusion, we identify here tumor cell-derived IL-1α as a major inducer of the Treg attracting chemokine CCL22 in human cancer cells. Therapeutic blockade of the IL-1 pathway could represent a promising strategy to inhibit tumor-induced immunosuppression. PMID:27757295

  1. Interleukin-1 receptor (IL-1R) mediates epilepsy-induced sleep disruption.

    PubMed

    Huang, Tzu-Rung; Jou, Shuo-Bin; Chou, Yu-Ju; Yi, Pei-Lu; Chen, Chun-Jen; Chang, Fang-Chia

    2016-11-22

    Sleep disruptions are common in epilepsy patients. Our previous study demonstrates that homeostatic factors and circadian rhythm may mediate epilepsy-induced sleep disturbances when epilepsy occurs at different zeitgeber hours. The proinflammatory cytokine, interleukin-1 (IL-1), is a somnogenic cytokine and may also be involved in epileptogenesis; however, few studies emphasize the effect of IL-1 in epilepsy-induced sleep disruption. We herein hypothesized that IL-1 receptor type 1 (IL-1R1) mediates the pathogenesis of epilepsy and epilepsy-induced sleep disturbances. We determined the role of IL-1R1 by using IL-1R1 knockout (IL-1R1 -/- KO) mice. Our results elucidated the decrease of non-rapid eye movement (NREM) sleep during the light period in IL-1R -/- mice and confirmed the somnogenic role of IL-1R1. Rapid electrical amygdala kindling was performed to induce epilepsy at the particular zeitgeber time (ZT) point, ZT13. Our results demonstrated that seizure thresholds induced by kindling stimuli, such as the after-discharge threshold and successful kindling rates, were not altered in IL-1R -/- mice when compared to those obtained from the wildtype mice (IL-1R +/+ mice). This result suggests that IL-1R1 is not involved in kindling-induced epileptogenesis. During sleep, ZT13 kindling stimulation significantly enhanced NREM sleep during the subsequent 6 h (ZT13-18) in wildtype mice, and sleep returned to the baseline the following day. However, the kindling-induced sleep alteration was absent in the IL-1R -/- KO mice. These results indicate that the IL-1 signal mediates epilepsy-induced sleep disturbance, but dose not participate in kindling-induced epileptogenesis.

  2. Muscle interleukin-6 and fasting-induced PDH regulation in mouse skeletal muscle.

    PubMed

    Gudiksen, Anders; Bertholdt, Laerke; Vingborg, Mikkel Birkkjaer; Hansen, Henriette Watson; Ringholm, Stine; Pilegaard, Henriette

    2017-03-01

    Fasting prompts a metabolic shift in substrate utilization from carbohydrate to predominant fat oxidation in skeletal muscle, and pyruvate dehydrogenase (PDH) is seen as a controlling link between the competitive oxidation of carbohydrate and fat during metabolic challenges like fasting. Interleukin (IL)-6 has been proposed to be released from muscle with concomitant effects on both glucose and fat utilization. The aim was to test the hypothesis that muscle IL-6 has a regulatory impact on fasting-induced suppression of skeletal muscle PDH. Skeletal muscle-specific IL-6 knockout (IL-6 MKO) mice and floxed littermate controls (control) were either fed or fasted for 6 or 18 h. Lack of muscle IL-6 elevated the respiratory exchange ratio in the fed and early fasting state, but not with prolonged fasting. Activity of PDH in the active form (PDHa) was higher in fed and fasted IL-6 MKO than in control mice at 18 h, but not at 6 h, whereas lack of muscle IL-6 did not prevent downregulation of PDHa activity in skeletal muscle or changes in plasma and muscle substrate levels in response to 18 h of fasting. Phosphorylation of three of four sites on PDH-E1α increased with 18 h of fasting, but was lower in IL-6 MKO mice than in control. In addition, both PDK4 mRNA and protein increased with 6 and 18 h of fasting in both genotypes, but PDK4 protein was lower in IL-6 MKO than in control. In conclusion, skeletal muscle IL-6 seems to regulate whole body substrate utilization in the fed, but not fasted, state and influence skeletal muscle PDHa activity in a circadian manner. However, skeletal muscle IL-6 is not required for maintaining metabolic flexibility in response to fasting. Copyright © 2017 the American Physiological Society.

  3. Anti-inflammatory effect of chlorogenic acid on the IL-8 production in Caco-2 cells and the dextran sulphate sodium-induced colitis symptoms in C57BL/6 mice.

    PubMed

    Shin, Hee Soon; Satsu, Hideo; Bae, Min-Jung; Zhao, Zhaohui; Ogiwara, Haru; Totsuka, Mamoru; Shimizu, Makoto

    2015-02-01

    Chlorogenic acid (CHA) is an antioxidant polyphenol prevalent in human diet, with coffee, fruits, and vegetables being its main source. Effects of CHA and CHA metabolites were evaluated on the IL-8 production in human intestinal Caco-2 cells induced by combined stimulation with tumour necrosis factor alpha (TNFα) and H2O2. CHA and caffeic acid (CA) inhibited TNFα- and H2O2-induced IL-8 production. We also examined the in vivo effects of CHA and CA using dextran sulphate sodium (DSS)-induced colitis in mice. CHA attenuated DSS-induced body weight loss, diarrhea, fecal blood, and shortening of colon and dramatically improved colitis histological scores. Furthermore, increases in the mRNA expression of colonic macrophage inflammatory protein 2 and IL-1β, which were induced by DSS, were significantly suppressed by CHA supplementation. These results suggest that dietary CHA use may aid in the prevention of intestinal inflammatory conditions. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Ribonucleic acid interference knockdown of interleukin 6 attenuates cold-induced hypertension.

    PubMed

    Crosswhite, Patrick; Sun, Zhongjie

    2010-06-01

    The purpose of this study was to determine the role of the proinflammatory cytokine interleukin (IL) 6 in cold-induced hypertension. Four groups of male Sprague-Dawley rats were used (6 rats per group). After blood pressure was stabilized, 3 groups received intravenous delivery of adenoassociated virus carrying IL-6 small hairpin RNA (shRNA), adenoassociated virus carrying scrambled shRNA, and PBS, respectively, before exposure to a cold environment (5 degrees C). The last group received PBS and was kept at room temperature (25 degrees C, warm) as a control. Adenoassociated virus delivery of IL-6 shRNA significantly attenuated cold-induced elevation of systolic blood pressure and kept it at the control level for < or =7 weeks (length of the study). Chronic exposure to cold upregulated IL-6 expression in aorta, heart, and kidneys and increased macrophage and T-cell infiltration in kidneys, suggesting that cold exposure increases inflammation. IL-6 shRNA delivery abolished the cold-induced upregulation of IL-6, indicating effective silence of IL-6. Interestingly, RNA interference knockdown of IL-6 prevented cold-induced inflammation, as evidenced by a complete inhibition of tumor necrosis factor-alpha expression and leukocyte infiltration by IL-6 shRNA. RNA interference knockdown of IL-6 significantly decreased the cold-induced increase in vascular superoxide production. It is noted that IL-6 shRNA abolished the cold-induced increase in collagen deposition in the heart, suggesting that inflammation is involved in cold-induced cardiac remodeling. Cold exposure caused glomerular collapses, which could be prevented by knockdown of IL-6, suggesting an important role of inflammation in cold-induced renal damage. In conclusion, cold exposure increased IL-6 expression and inflammation, which play critical roles in the pathogenesis of cold-induced hypertension and cardiac and renal damage.

  5. Regulation of IL-10 expression by upstream stimulating factor (USF-1) in glioma-associated microglia.

    PubMed

    Zhang, Leying; Handel, Michelle Van; Schartner, Jill M; Hagar, Aaron; Allen, Grant; Curet, Marjorie; Badie, Behnam

    2007-03-01

    Understanding the local CNS immune response to neoplasms is essential in the development of immune-based treatments for malignant brain tumors. Using rodent glioma models, we have recently found tumor-associated microglia/macrophages (MG/MP) to be less responsive to known MG/MP activators such as CpG, LPS and IFN-gamma. To understand the mechanism of MG/MP suppression, nuclear extracts from rodent intracranial C6 gliomas, C6 glioma-associated MG/MP, normal brain, and normal MG/MP were obtained and studied using Electrophoretic Mobility Shift Assay (EMSA). Among the nuclear factors studied (AP-1, IRF, USF-1 and Stat-1) only USF-1, which is constitutively expressed in most cells, was down-regulated in tumor-associated MG/MP, but not normal MG/MP. Because tumor-associated MG/MP had higher expression of IL-10 (but not TNF-alpha or TGF-beta), we evaluated the role of USF-1 on IL-10 expression. siRNA mediated inhibition of USF-1 expression in primary MG/MP cultures resulted in up-regulation of IL-10 mRNA but not TNF-alpha or TGF-beta. These findings suggest that USF-1 may play a role in IL-10 regulation in MG/MP in brain tumors.

  6. Increased serum IL-6, TNF-alpha and IL-10 levels in patients with bullous pemphigoid: relationships with disease activity.

    PubMed

    D'Auria, L; Mussi, A; Bonifati, C; Mastroianni, A; Giacalone, B; Ameglio, F

    1999-01-01

    The present report analyzes the serum levels of three cytokines, interleukin-6 (IL-6), tumor necrosis factor-alpha (TNF-alpha) and interleukin-10 (IL-10) in 15 patients with bullous pemphigoid (BP) (compared with 20 healthy controls) to evaluate a possible involvement of these biological modulators in the clinical expression of this disease. BP is a rare bullous disease of autoimmune origin with evidence of inflammatory processes that cause skin lesions with local increase of various pro-inflammatory mediators. Determination of cytokine concentrations were obtained employing commercially available ELISA kits. The sera of BP patients showed increased levels of these three cytokines (P < 0.01). When the number of skin lesions (blisters and/or erosion) of each patient, employed as a marker of disease activity, was correlated with the serum levels of IL-6 and TNF-alpha, significant correlations were found (IL-6: P < 0.01 and TNF-alpha: P < 0.01, respectively), suggesting a possible role of these mediators in the development of BP blisters. The serum levels of IL-6 also correlated (P = 0.01 with those of serum C reactive protein (CRP), an acute-phase protein induced by IL-6 in hepatocytes. In addition, serum TNF-alpha and sE-selectin (an adhesion molecule previously reported to be increased by this cytokine) levels were also correlated (P < 0.05). On the basis of these data, it may be indicated that at least IL-6 and TNF-alpha are associated with the clinical expression of BP and that the endothelial activation (possibly induced by the TNF-alpha activity), seems to be an important phase of this dermatosis.

  7. IL-10 Producing B Cells Ability to Induce Regulatory T Cells Is Maintained in Rheumatoid Arthritis

    PubMed Central

    Mielle, Julie; Audo, Rachel; Hahne, Michael; Macia, Laurence; Combe, Bernard; Morel, Jacques; Daien, Claire

    2018-01-01

    Despite growing evidence highlighting the relevance of increasing IL-10-producing B cells (B10+cells) in autoimmune diseases, their functions in patients are still unknown. The aim of this study was to evaluate the functions of CpG-induced B10+ cells isolated from healthy controls (HC) and rheumatoid arthritis (RA) patients, on naïve T cell differentiation. We demonstrated that CpG-induced B10+ cells from HC drove naïve T cell differentiation toward regulatory T cells (Treg cells) and IL-10-producing T cells (Tr1) through IL-10 secretion and cellular contacts. B10+ cells from HC did not decrease T helper 1 (Th1) nor and tumor necrosis factor α producing T cell (TNFα+ T cell) differentiation. We showed that in RA, B10+ cells could also induce Treg cells and Tr1 from naïve T cells. Contrary to HC, B10+ cells from RA patients increased naïve T cell conversion into Th1. Interestingly, PD-L2, a programmed death-1 (PD-1) ligand that inhibits PD-L1 and promotes Th1 differentiation, was overexpressed on RA B10+ cells compared to HC B10+ cells. Together, our findings showed that CpG-induced B10+ cells may be used to increase Treg cells in patients with RA. However, CpG may not be the most adequate stimuli as CpG-induced B10+ cells also increased inflammatory T cells in those patients. PMID:29774031

  8. IL-23 is required for the development of severe egg-induced immunopathology in schistosomiasis and for lesional expression of IL-17.

    PubMed

    Rutitzky, Laura I; Bazzone, Lindsey; Shainheit, Mara G; Joyce-Shaikh, Barbara; Cua, Daniel J; Stadecker, Miguel J

    2008-02-15

    In infection with the trematode helminth Schistosoma mansoni, the severity of CD4 T cell-mediated hepatic granulomatous and fibrosing inflammation against parasite eggs varies considerably in humans and among mouse strains. In mice, either the natural high pathology, or high pathology induced by concomitant immunization with schistosome egg Ags (SEA) in CFA (SEA/CFA), results from a failure to contain a net proinflammatory cytokine environment. We previously demonstrated that the induction of severe immunopathology was dependent on the IL-12/IL-23 common p40 subunit, and correlated with an increase in IL-17, thus implying IL-23 in the pathogenesis. We now show that mice lacking the IL-23-specific subunit p19 are impaired in developing severe immunopathology following immunization with SEA/CFA, which is associated with a marked drop of IL-17 in the granulomas, but not in the draining mesenteric lymph nodes, and with a markedly suppressed SEA-specific IFN-gamma response regulated by a striking increase in IL-10. The granulomas are characterized by a significant reduction in Gr-1(+) cell recruitment and by alternative macrophage activation. Taken together, these results demonstrate that IL-23 per se is not necessary for the generation of IL-17-producing T cells, but is essential for the development of severe schistosome egg-induced immunopathology, and its absence cannot be overcome with other possible compensatory mechanisms.

  9. IL-1β and IL-6 Upregulation in Children with H1N1 Influenza Virus Infection

    PubMed Central

    Chiaretti, Antonio; Pulitanò, Silvia; Barone, Giovanni; Ferrara, Pietro; Capozzi, Domenico; Riccardi, Riccardo

    2013-01-01

    The role of cytokines in relation to clinical manifestations, disease severity, and outcome of children with H1N1 virus infection remains thus far unclear. The aim of this study was to evaluate interleukin IL-1β and IL-6 plasma expressions and their association with clinical findings, disease severity, and outcome of children with H1N1 infection. We prospectively evaluated 15 children with H1N1 virus infection and 15 controls with lower respiratory tract infections (LRTI). Interleukin plasma levels were measured using immunoenzymatic assays. Significantly higher levels of IL-1β and IL-6 were detected in all patients with H1N1 virus infection compared to controls. It is noteworthy to mention that in H1N1 patients with more severe clinical manifestations of disease IL-1β and IL-6 expressions were significantly upregulated compared to H1N1 patients with mild clinical manifestations. In particular, IL-6 was significantly correlated with specific clinical findings, such as severity of respiratory compromise and fever. No correlation was found between interleukin expression and final outcome. In conclusion, H1N1 virus infection induces an early and significant upregulation of both interleukins IL1β and IL-6 plasma expressions. The upregulation of these cytokines is likely to play a proinflammatory role in H1N1 virus infection and may contribute to airway inflammation and bronchial hyperreactivity in these patients. PMID:23737648

  10. Intensive cytokine induction in pandemic H1N1 influenza virus infection accompanied by robust production of IL-10 and IL-6.

    PubMed

    Yu, Xuelian; Zhang, Xi; Zhao, Baihui; Wang, Jiayu; Zhu, Zhaokui; Teng, Zheng; Shao, Junjie; Shen, Jiaren; Gao, Ye; Yuan, Zhengan; Wu, Fan

    2011-01-01

    The innate immune system is the first line of defense against viruses by inducing expression of cytokines and chemokines. Many pandemic influenza H1N1 virus [P(H1N1)] infected severe cases occur in young adults under 18 years old who were rarely seriously affected by seasonal influenza. Results regarding host cytokine profiles of P(H1N1) are ambivalent. In the present study we investigated host cytokine profiles in P(H1N1) patients and identified cytokines related to disease severity. We retrieved 77, 59, 26 and 26 sera samples from P(H1N1) and non-flu influenza like illness (non-ILIs) cases with mild symptoms (mild patients), P(H1N1) vaccinees and healthy individuals, respectively. Nine and 16 sera were from hospitalized P(H1N1) and non-ILIs patients with severe symptoms (severe patients). Cytokines of IL-1, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12, IFN-γ and TNF-α were assayed by cytokine bead array, IL-17 and IL-23 measured with ELISA. Mild P(H1N1) patients produced significantly elevated IL-2, IL-12, IFN-γ, IL-6, TNF-α, IL-5, IL-10, IL-17 and IL-23 versus to healthy controls. While an overwhelming IL-6 and IL-10 production were observed in severe P(H1N1) patients. Higher IL-10 secretion in P(H1N1) vaccinees confirmed our observation that highly increased level of sera IL-6 and IL-10 in P(H1N1) patients may lead to disease progression. A comprehensive innate immune response was activated at the early stage of P(H1N1) infection with a combine Th1/Th2/Th3 cytokines production. As disease progression, a systemic production of IL-6 and IL-10 were observed in severe P(H1N1) patients. Further analysis found a strong correlation between IL-6 and IL-10 production in the severe P(H1N1) patients. IL-6 may be served as a mediator to induce IL-10 production. Highly elevated level of sera IL-6 and IL-10 in P(H1N1) patients may lead to disease progression, but the underlying mechanism awaits further detailed investigations.

  11. Intensive Cytokine induction in Pandemic H1N1 Influenza Virus Infection Accompanied by Robust Production of IL-10 and IL-6

    PubMed Central

    Yu, Xuelian; Zhang, Xi; Zhao, Baihui; Wang, Jiayu; Zhu, Zhaokui; Teng, Zheng; Shao, Junjie; Shen, Jiaren; Gao, Ye; Yuan, Zhengan; Wu, Fan

    2011-01-01

    Background The innate immune system is the first line of defense against viruses by inducing expression of cytokines and chemokines. Many pandemic influenza H1N1 virus [P(H1N1)] infected severe cases occur in young adults under 18 years old who were rarely seriously affected by seasonal influenza. Results regarding host cytokine profiles of P(H1N1) are ambivalent. In the present study we investigated host cytokine profiles in P(H1N1) patients and identified cytokines related to disease severity. Methods and Principal Findings We retrieved 77, 59, 26 and 26 sera samples from P(H1N1) and non-flu influenza like illness (non-ILIs) cases with mild symptoms (mild patients), P(H1N1) vaccinees and healthy individuals, respectively. Nine and 16 sera were from hospitalized P(H1N1) and non-ILIs patients with severe symptoms (severe patients). Cytokines of IL-1, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12, IFN-γ and TNF-α were assayed by cytokine bead array, IL-17 and IL-23 measured with ELISA. Mild P(H1N1) patients produced significantly elevated IL-2, IL-12, IFN-γ, IL-6, TNF-α, IL-5, IL-10, IL-17 and IL-23 versus to healthy controls. While an overwhelming IL-6 and IL-10 production were observed in severe P(H1N1) patients. Higher IL-10 secretion in P(H1N1) vaccinees confirmed our observation that highly increased level of sera IL-6 and IL-10 in P(H1N1) patients may lead to disease progression. Conclusion and Significance A comprehensive innate immune response was activated at the early stage of P(H1N1) infection with a combine Th1/Th2/Th3 cytokines production. As disease progression, a systemic production of IL-6 and IL-10 were observed in severe P(H1N1) patients. Further analysis found a strong correlation between IL-6 and IL-10 production in the severe P(H1N1) patients. IL-6 may be served as a mediator to induce IL-10 production. Highly elevated level of sera IL-6 and IL-10 in P(H1N1) patients may lead to disease progression, but the underlying mechanism awaits further

  12. Cloning and characterization of IL-10-related T cell-derived inducible factor (IL-TIF), a novel cytokine structurally related to IL-10 and inducible by IL-9.

    PubMed

    Dumoutier, L; Louahed, J; Renauld, J C

    2000-02-15

    IL-9 is a Th2 cytokine active on various cell types such as T and B lymphocytes, mast cells, and eosinophils, and potentially involved in allergy and asthma. To understand better the molecular mechanisms underlying the activity of this cytokine, we used a cDNA subtraction method to identify genes specifically induced by IL-9 in mouse T cells. One of the IL-9-regulated genes isolated by this approach turned out to encode a 180-amino acid long protein, including a potential signal peptide, and showing 22% amino acid identity with IL-10. This protein, designated IL-10-related T cell-derived inducible factor (IL-TIF), is induced by IL-9 in thymic lymphomas, T cells, and mast cells, and by lectins in freshly isolated splenocytes. Experiments concerning the mechanism regulating IL-TIF expression in T cells indicate that IL-9 induction is rapid (within 1 h), does not require protein synthesis, and depends on the activation of the Janus kinase (JAK)-STAT pathway. In vivo, constitutive expression of IL-TIF was detected by RT-PCR in thymus and brain, suggesting that the role of this new factor is not restricted to the immune system. Transfection of HEK293 cells with the IL-TIF cDNA resulted in the production of a glycosylated protein of about 25 kDa that was found to induce STAT activation in mesangial and neuronal cell lines. Further studies will have to address the possibility that some of the IL-9 activities may be mediated by IL-TIF.

  13. Development of Virus-Specific CD4+ and CD8+ Regulatory T Cells Induced by Human Herpesvirus 6 Infection

    PubMed Central

    Wang, Fang; Chi, Jing; Peng, Guangyong; Zhou, Feng; Wang, Jinfeng; Li, Lingyun; Feng, Dongju; Xie, Fangyi; Gu, Bin; Qin, Jian; Chen, Yun

    2014-01-01

    Human herpesvirus 6 (HHV-6) is an important immunosuppressive and immunomodulatory virus. The mechanisms by which HHV-6 establishes latency and immunosuppression in its host are not well understood. Here we characterized HHV-6-specific T cells in peripheral blood mononuclear cells (PBMCs) from HHV-6-infected donors. Our results showed that HHV-6 infection could induce both CD4+ and CD8+ HHV-6-specific regulatory T (Treg) cells. These HHV-6-specific Treg cells had potent suppressive activity and expressed high levels of Treg-associated molecules CD25, FoxP3, and GITR. Both CD4+ and CD8+ Treg cells secreted gamma interferon (IFN-γ) and interleukin-10 (IL-10) but little or no IL-2, IL-4, or transforming growth factor β (TGF-β). Furthermore, HHV-6-specifc Treg cells not only could suppress naive and HHV-6-specific CD4+ effector T cell immune responses but also could impair dendritic cell (DC) maturation and functions. In addition, the suppressive effects mediated by HHV-6-specific Treg cells were mainly through a cell-to-cell contact-dependent mechanism but not through the identified cytokines. These results suggest that HHV-6 may utilize the induction of Treg cells as a strategy to escape antivirus immune responses and maintain the latency and immunosuppression in infected hosts. PMID:24198406

  14. BMP2-Induced Inflammation Can Be Suppressed by the Osteoinductive Growth Factor NELL-1

    PubMed Central

    Shen, Jia; James, Aaron W.; Zara, Janette N.; Asatrian, Greg; Khadarian, Kevork; Zhang, James B.; Ho, Stephanie; Kim, Hyun Ju

    2013-01-01

    Bone-morphogenetic protein 2 (BMP2) is currently the only Food and Drug Administration-approved osteoinductive growth factor used in clinical settings for bone regeneration and repair. However, the use of BMP2 is encumbered by numerous clinical complications, including postoperative inflammation and life-threatening cervical swelling. Thus, methods to prevent BMP2-induced inflammation would have far-reaching clinical implications toward improving current BMP2-based methods for bone regeneration. For the first time, we investigate the potential role of the growth factor Nel-like molecule-1 (NELL-1) in inhibiting BMP2-induced inflammation. Adult rats underwent a femoral bone onlay procedure, treated with either BMP2 protein (4 mg/mL), NELL-1 protein (4 mg/mL), or both proteins combined. Animals were evaluated at 3, 7, and 14 days postoperatively by histology, histomorphometry, immunohistochemistry, and real-time PCR for markers of inflammation (TNFα, IL6). The relative levels of TNFα and IL6 in serum were also detected by ELISA. The mechanism for NELL-1's anti-inflammatory effect was further assessed through examining inflammatory markers and generation of reactive oxygen species (ROS) in the mouse embryonic fibroblast NIH3T3 cells. BMP2 significantly induced local inflammation, including an early and pronounced polymorphonuclear cell infiltration accompanied by increased expression of TNFα and IL6. Treatment with NELL-1 alone elicited no significant inflammatory response. However, NELL-1 significantly attenuated BMP2-induced inflammation by all markers and at all timepoints. These local findings were also confirmed using systemic serum inflammatory biomarkers (TNFα, IL6). In each case, NELL-1 fully reversed BMP2-induced systemic inflammation. Lastly, our findings were recapitulated in vitro, where NELL-1 suppressed BMP2 induced expression of inflammatory markers, as well as NF-κB transcriptional activity and generation of ROS. BMP2-induced inflammation is a

  15. Sphingosine kinase inhibitor suppresses IL-18-induced interferon-gamma production through inhibition of p38 MAPK activation in human NK cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cheon, Soyoung; Song, Seok Bean; Jung, Minkyung

    2008-09-12

    Natural killer (NK) cells play an important role in the innate immune response. Interleukin-18 (IL-18) is a well-known interferon-gamma (IFN-{gamma} inducing factor, which stimulates immune response in NK and T cells. Sphingosine kinase (SPHK) catalyzes the formation of sphingosine 1-phosphate (S1P), which acts as a second messenger to function as an anti-apoptotic factor and proliferation stimulator of immune cells. In this study, to elucidate whether SPHK is involved in IL-18-induced IFN-{gamma} production, we measured IL-18-induced IFN-{gamma} production after pre-treatment with SPHK inhibitor (SKI) in NK-92MI cells. We found that IL-18-induced IFN-{gamma} expression was blocked by SKI pre-treatment in both mRNAmore » and protein levels. In addition, the increased IFN-{gamma} production by stimulation with IL-18 is mediated through both SPHK and p38 MAPK. To determine the upstream signals of SKI and p38 MAPK in IL-18-induced IFN-{gamma} production, phosphorylation levels of p38 MAPK was measured after SKI pre-treatment. As a result, inhibition of SPHK by SKI blocked phosphorylation of p38 MAPK, showing that SPHK activation by IL-18 is an upstream signal of p38 MAPK activation. Inhibition of SPHK by SKI also inhibited IL-18-induced IFN-{gamma} production in human primary NK cells. In conclusion, SPHK activation is an essential factor for IL-18-induced IFN-{gamma} production via p38 MAPK.« less

  16. Evidence of substance P autocrine circuitry that involves TNF-α, IL-6, and PGE2 in endogenous pyrogen-induced fever.

    PubMed

    Brito, Haissa Oliveira; Barbosa, Felipe L; Reis, Renata Cristiane Dos; Fraga, Daniel; Borges, Beatriz S; Franco, Celia R C; Zampronio, Aleksander Roberto

    2016-04-15

    Substance P (SP) is involved in fever that is induced by lipopolysaccharide (LPS) but not by interleukin-1β or macrophage inflammatory protein-1α. Intracerebroventricular (i.c.v.) administration of the neurokinin-1 (NK1) receptor antagonist SR140333B in rats reduced fever that was induced by an i.c.v. injection of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), prostaglandin E2 (PGE2), corticotropin-releasing factor (CRF), endothelin-1 (ET-1), and morphine (MOR). Furthermore, an i.c.v. injection of SP induced a febrile response that was inhibited by indomethacin concomitant with an increase in PGE2 levels in cerebrospinal fluid. Lipopolysaccharide and PGE2 caused higher expression and internalization of NK1 receptors in the hypothalamus which were prevented by SR140333B. These data suggest that SP is an important mediator of fever, in which it induces a prostaglandin-dependent response and is released after TNF-α, IL-6, PGE2, CRF, endogenous opioids, and ET-1. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Botanical Extracts from Rosehip (Rosa canina), Willow Bark (Salix alba), and Nettle Leaf (Urtica dioica) Suppress IL-1β-Induced NF-κB Activation in Canine Articular Chondrocytes.

    PubMed

    Shakibaei, Mehdi; Allaway, David; Nebrich, Simone; Mobasheri, Ali

    2012-01-01

    The aim of this study was to characterize the anti-inflammatory mode of action of botanical extracts from rosehip (Rosa canina), willow bark (Salix alba), and nettle leaf (Urtica dioica) in an in vitro model of primary canine articular chondrocytes. Methods. The biological effects of the botanical extracts were studied in chondrocytes treated with IL-1β for up to 72 h. Expression of collagen type II, cartilage-specific proteoglycan (CSPG), β1-integrin, SOX-9, COX-2, and MMP-9 and MMP-13 was examined by western blotting. Results. The botanical extracts suppressed IL-1β-induced NF-κB activation by inhibition of IκBα phosphorylation, IκBα degradation, p65 phosphorylation, and p65 nuclear translocation. These events correlated with downregulation of NF-κB targets including COX-2 and MMPs. The extracts also reversed the IL-1β-induced downregulation of collagen type II, CSPG, β1-integrin, and cartilage-specific transcription factor SOX-9 protein expression. In high-density cultures botanical extracts stimulated new cartilage formation even in the presence of IL-1β. Conclusions. Botanical extracts exerted anti-inflammatory and anabolic effects on chondrocytes. The observed reduction of IL-1β-induced NF-κB activation suggests that further studies are warranted to demonstrate the effectiveness of plant extracts in the treatment of OA and other conditions in which NF-κB plays pathophysiological roles.

  18. Botanical Extracts from Rosehip (Rosa canina), Willow Bark (Salix alba), and Nettle Leaf (Urtica dioica) Suppress IL-1β-Induced NF-κB Activation in Canine Articular Chondrocytes

    PubMed Central

    Shakibaei, Mehdi; Allaway, David; Nebrich, Simone; Mobasheri, Ali

    2012-01-01

    The aim of this study was to characterize the anti-inflammatory mode of action of botanical extracts from rosehip (Rosa canina), willow bark (Salix alba), and nettle leaf (Urtica dioica) in an in vitro model of primary canine articular chondrocytes. Methods. The biological effects of the botanical extracts were studied in chondrocytes treated with IL-1β for up to 72 h. Expression of collagen type II, cartilage-specific proteoglycan (CSPG), β1-integrin, SOX-9, COX-2, and MMP-9 and MMP-13 was examined by western blotting. Results. The botanical extracts suppressed IL-1β-induced NF-κB activation by inhibition of IκBα phosphorylation, IκBα degradation, p65 phosphorylation, and p65 nuclear translocation. These events correlated with downregulation of NF-κB targets including COX-2 and MMPs. The extracts also reversed the IL-1β-induced downregulation of collagen type II, CSPG, β1-integrin, and cartilage-specific transcription factor SOX-9 protein expression. In high-density cultures botanical extracts stimulated new cartilage formation even in the presence of IL-1β. Conclusions. Botanical extracts exerted anti-inflammatory and anabolic effects on chondrocytes. The observed reduction of IL-1β-induced NF-κB activation suggests that further studies are warranted to demonstrate the effectiveness of plant extracts in the treatment of OA and other conditions in which NF-κB plays pathophysiological roles. PMID:22474508

  19. Low-dose γ-radiation inhibits IL-1β-induced dedifferentiation and inflammation of articular chondrocytes via blockage of catenin signaling

    PubMed Central

    Hong, Eun-Hee; Song, Jie-Young; Lee, Su-Jae; Park, In-Chul; Um, Hong-Duck; Park, Jong Kuk; Lee, Kee-Ho; Nam, Seon Young; Hwang, Sang-Gu

    2014-01-01

    Although low-dose radiation (LDR) regulates a wide range of biological processes, limited information is available on the effects of LDR on the chondrocyte phenotype. Here, we found that LDR, at doses of 0.5–2 centiGray (cGy), inhibited interleukin (IL)-1β-induced chondrocyte destruction without causing side effects, such as cell death and senescence. IL-1β treatment induced an increase in the expression of α-, β-, and γ-catenin proteins in chondrocytes via Akt signaling, thereby promoting dedifferentiation through catenin-dependent suppression of Sox-9 transcription factor expression and induction of inflammation through activation of the NF-κB pathway. Notably, LDR blocked cartilage disorders by inhibiting IL-1β-induced catenin signaling and subsequent catenin-dependent suppression of the Sox-9 pathway and activation of the NF-κB pathway, without directly altering catenin expression. LDR also inhibited chondrocyte destruction through the catenin pathway induced by epidermal growth factor, phorbol 12-myristate 13-acetate, and retinoic acid. Collectively, these results identify the molecular mechanisms by which LDR suppresses pathophysiological processes and establish LDR as a potentially valuable therapeutic tool for patients with cytokine- or soluble factors-mediated cartilage disorders. PMID:24604706

  20. Serum amyloid A is an endogenous ligand that differentially induces IL-12 and IL-23.

    PubMed

    He, Rong; Shepard, Larry W; Chen, Jia; Pan, Zhixing K; Ye, Richard D

    2006-09-15

    The acute-phase proteins, C-reactive protein and serum amyloid A (SAA), are biomarkers of infection and inflammation. However, their precise role in immunity and inflammation remains undefined. We report in this study a novel property of SAA in the differential induction of Th1-type immunomodulatory cytokines IL-12 and IL-23. In peripheral blood monocytes and the THP-1 monocytic cell line, SAA induces the expression of IL-12p40, a subunit shared by IL-12 and IL-23. SAA-stimulated expression of IL-12p40 was rapid (< or = 4 h), sustainable (> or = 20 h), potent (up to 3380 pg/ml/10(6) cells in 24 h), and insensitive to polymyxin B treatment. The SAA-stimulated IL-12p40 secretion required de novo protein synthesis and was accompanied by activation of the transcription factors NF-kappaB and C/EBP. Expression of IL-12p40 required activation of the p38 MAPK and PI3K. Interestingly, the SAA-induced IL-12p40 production was accompanied by a sustained expression of IL-23p19, but not IL-12p35, resulting in preferential secretion of IL-23, but not IL-12. These results identify SAA as an endogenous ligand that potentially activates the IL-23/IL-17 pathway and present a novel mechanism for regulation of inflammation and immunity by an acute-phase protein.

  1. MTOR Suppresses Cigarette Smoke-Induced Epithelial Cell Death and Airway Inflammation in Chronic Obstructive Pulmonary Disease.

    PubMed

    Wang, Yong; Liu, Juan; Zhou, Jie-Sen; Huang, Hua-Qiong; Li, Zhou-Yang; Xu, Xu-Chen; Lai, Tian-Wen; Hu, Yue; Zhou, Hong-Bin; Chen, Hai-Pin; Ying, Song-Min; Li, Wen; Shen, Hua-Hao; Chen, Zhi-Hua

    2018-04-15

    Airway epithelial cell death and inflammation are pathological features of chronic obstructive pulmonary disease (COPD). Mechanistic target of rapamycin (MTOR) is involved in inflammation and multiple cellular processes, e.g., autophagy and apoptosis, but little is known about its function in COPD pathogenesis. In this article, we illustrate how MTOR regulates cigarette smoke (CS)-induced cell death, airway inflammation, and emphysema. Expression of MTOR was significantly decreased and its suppressive signaling protein, tuberous sclerosis 2 (TSC2), was increased in the airway epithelium of human COPD and in mouse lungs with chronic CS exposure. In human bronchial epithelial cells, CS extract (CSE) activated TSC2, inhibited MTOR, and induced autophagy. The TSC2-MTOR axis orchestrated CSE-induced autophagy, apoptosis, and necroptosis in human bronchial epithelial cells; all of which cooperatively regulated CSE-induced inflammatory cytokines IL-6 and IL-8 through the NF-κB pathway. Mice with a specific knockdown of Mtor in bronchial or alveolar epithelial cells exhibited significantly augmented airway inflammation and airspace enlargement in response to CS exposure, accompanied with enhanced levels of autophagy, apoptosis, and necroptosis in the lungs. Taken together, these data demonstrate that MTOR suppresses CS-induced inflammation and emphysema-likely through modulation of autophagy, apoptosis, and necroptosis-and thus suggest that activation of MTOR may represent a novel therapeutic strategy for COPD. Copyright © 2018 by The American Association of Immunologists, Inc.

  2. A limited CpG-containing oligodeoxynucleotide therapy regimen induces sustained suppression of allergic airway inflammation in mice

    PubMed Central

    Kozy, Heather M.; Lum, Jeremy A.; Sweetwood, Rosemary; Chu, Mabel; Cunningham, Cameron R.; Salamon, Hugh; Lloyd, Clare M.; Coffman, Robert L.; Hessel, Edith M.

    2015-01-01

    Background CpG-containing oligodeoxynucleotides (CpG-ODN) are potent inhibitors of Th2-mediated allergic airway disease in sensitized mice challenged with allergen. A single treatment has transient effects but a limited series of treatments has potential to achieve clinically meaningful sustained inhibition of allergic airway disease. Objective To optimize the treatment regimen and determine the mechanisms of action in mice of an inhaled form of CpG-ODN being developed for human asthma treatment. Methods A limited series of weekly intranasal 1018 ISS (CpG-ODN; B-class) treatments were given to ragweed allergen-sensitized mice chronically exposed to allergen during and after the 1018 ISS treatment regimen. Treatment effects were evaluated by measuring effect on lung Th2 cytokines and eosinophilia as well as lung dendritic cell function and T cell responses. Results Twelve intranasal 1018 ISS treatments induced significant suppression of BAL eosinophilia and IL-4, IL-5, and IL-13 levels and suppression was maintained through 13 weekly ragweed exposures administered after treatment cessation. At least 5 treatments were required for lasting Th2 suppression. CpG-ODN induced moderate Th1 responses but Th2 suppression did not require IFN-γ. Th2 suppression was associated with induction of a regulatory T cell response. Conclusion A short series of CpG-ODN treatments results in sustained suppression of allergic lung inflammation induced by a clinically relevant allergen. PMID:24464743

  3. Patchouli alcohol ameliorates dextran sodium sulfate-induced experimental colitis and suppresses tryptophan catabolism.

    PubMed

    Qu, Chang; Yuan, Zhong-Wen; Yu, Xiu-Ting; Huang, Yan-Feng; Yang, Guang-Hua; Chen, Jian-Nan; Lai, Xiao-Ping; Su, Zi-Ren; Zeng, Hui-Fang; Xie, Ying; Zhang, Xiao-Jun

    2017-07-01

    Despite the increased morbidity of ulcerative colitis (UC) in recent years, available treatments remain unsatisfactory. Pogostemon cablin has been widely applied to treat a variety of gastrointestinal disorders in clinic for centuries, in which patchouli alcohol (PA, C 15 H 26 O) has been identified as the major active component. This study attempted to determine the bioactivity of PA on dextran sulfate sodium (DSS)-induced mice colitis and clarify the mechanism of action. Acute colitis was induced in mice by 3% DSS for 7 days. The mice were then given PA (10, 20 and 40mg/kg) or sulfasalazine (SASP, 200mg/kg) as positive control via oral administration for 7 days. At the end of study, animals were sacrificed and samples were collected for pathological and other analysis. In addition, a metabolite profiling and a targeted metabolite analysis, based on the Ultra-Performance Liquid Chromatography coupled with mass spectrometry (UPLC-MS) approach, were performed to characterize the metabolic changes in plasma. The results revealed that PA significantly reduced the disease activity index (DAI) and ameliorated the colonic injury of DSS mice. The levels of colonic MPO and cytokines involving TNF-α, IFN-γ, IL-1β, IL-6, IL-4 and IL-10 also declined. Furthermore, PA improved the intestinal epithelial barrier by enhancing the level of colonic expression of the tight junction (TJ) proteins, for instance ZO-1, ZO-2, claudin-1 and occludin, and by elevating the levels of mucin-1 and mucin-2 mRNA. The study also demonstrated that PA inhibited the DSS-induced cell death signaling by modulating the apoptosis related Bax and Bcl-2 proteins and down-regulating the necroptosis related RIP3 and MLKL proteins. By comparison, up-regulation of IDO-1 and TPH-1 protein expression in DSS group was suppressed by PA, which was in line with the declined levels of kynurenine (Kyn) and 5-hydroxytryptophan (5-HTP) in plasma. The therapeutic effect of PA was evidently reduced when Kyn was given

  4. TLR9 is required for MAPK/NF-κB activation but does not cooperate with TLR2 or TLR6 to induce host resistance to Brucella abortus.

    PubMed

    Gomes, Marco Túlio; Campos, Priscila Carneiro; Pereira, Guilherme de Sousa; Bartholomeu, Daniella Castanheira; Splitter, Gary; Oliveira, Sergio Costa

    2016-05-01

    Brucella abortus is a Gram-negative intracellular bacterial pathogen that causes a zoonosis of worldwide occurrence, leading to undulant fever in humans and abortion in domestic animals. B. abortus is recognized by several pattern-recognition receptors triggering pathways during the host innate immune response. Therefore, here, we determined the cooperative role of TLR9 with TLR2 or TLR6 receptors in sensing Brucella Furthermore, we deciphered the host innate immune response against B. abortus or its DNA, emphasizing the role of TLR9-MAPK/NF-κB signaling pathways in the production of proinflammatory cytokines. TLR9 is required for the initial host control of B. abortus, but this TLR was dispensable after 6 wk of infection. The susceptibility of TLR9(-/-)-infected animals to Brucella paralleled with lower levels of IFN-γ produced by mouse splenocytes stimulated with this pathogen compared with wild-type cells. However, no apparent cooperative interplay was observed between TLR2-TLR9 or TLR6-TLR9 receptors to control infection. Moreover, B. abortus or its DNA induced activation of MAPK/NF-κB pathways and production of IL-12 and TNF-α by macrophages partially dependent on TLR9 but completely dependent on MyD88. In addition, B. abortus-derived CpG oligonucleotides required TLR9 to promote IL-12 and TNF-α production by macrophages. By confocal microscopy, we demonstrated that TLR9 redistributed and colocalized with lysosomal-associated membrane protein-1 upon Brucella infection. Thus, B. abortus induced TLR9 traffic, leading to cell signaling activation and IL-12 and TNF-α production. Although TLR9 recognized Brucella CpG motifs, our results suggest a new pathway of B. abortus DNA-activating macrophages independent of TLR9. © Society for Leukocyte Biology.

  5. IL-22/STAT3-Induced Increases in SLURP1 Expression within Psoriatic Lesions Exerts Antimicrobial Effects against Staphylococcus aureus.

    PubMed

    Moriwaki, Yasuhiro; Takada, Kiyoko; Nagasaki, Toshinori; Kubo, Natsuki; Ishii, Tomohiro; Kose, Kazuaki; Kageyama, Taihei; Tsuji, Shoutaro; Kawashima, Koichiro; Misawa, Hidemi

    2015-01-01

    SLURP1 is the causal gene for Mal de Meleda (MDM), an autosomal recessive skin disorder characterized by diffuse palmoplantar keratoderma and transgressive keratosis. Moreover, although SLURP1 likely serves as an important proliferation/differentiation factor in keratinocytes, the possible relation between SLURP1 and other skin diseases, such as psoriasis and atopic dermatitis, has not been studied, and the pathophysiological control of SLURP1 expression in keratinocytes is largely unknown. Our aim was to examine the involvement of SLURP1 in the pathophysiology of psoriasis using an imiquimod (IMQ)-induced psoriasis model mice and normal human epidermal keratinocytes (NHEKs). SLURP1 expression was up-regulated in the skin of IMQ-induced psoriasis model mice. In NHEKs stimulated with the inflammatory cytokines IL-17, IL-22 and TNF-α, which are reportedly expressed in psoriatic lesions, SLURP1 mRNA expression was significantly up-regulated by IL-22 but not the other two cytokines. The stimulatory effect of IL-22 was completely suppressed in NHEKs treated with a STAT3 inhibitor or transfected with siRNA targeting STAT3. Because IL-22 induces production of antimicrobial proteins in epithelial cells, the antibacterial activity of SLURP1 was assessed against Staphylococcus aureus (S. aureus), which is known to be associated with disease severity in psoriasis. SLURP1 significantly suppressed the growth of S. aureus. These results indicate SLURP1 participates in pathophysiology of psoriasis by regulating keratinocyte proliferation and differentiation, and by suppressing the growth of S. aureus.

  6. IL-10 suppresses Th17 cells and promotes regulatory T cells in the CD4+ T cell population of rheumatoid arthritis patients.

    PubMed

    Heo, Yu-Jung; Joo, Young-Bin; Oh, Hye-Jwa; Park, Mi-Kyung; Heo, Yang-Mi; Cho, Mi-La; Kwok, Seung-Ki; Ju, Ji-Hyeon; Park, Kyung-Su; Cho, Seok Goo; Park, Sung-Hwan; Kim, Ho-Youn; Min, Jun-Ki

    2010-01-04

    Interleukin-17-producing CD4(+) T cells (Th17 cells) are the dominant pathogenic cellular component in autoimmune inflammatory diseases, including autoimmune arthritis. IL-10 promotes the generation of Foxp3(+) regulatory T cells via the IL-10 receptor signal. The objective of this study was to examine whether IL-10, which acts as an anti-inflammatory cytokine, has a suppressive effect on the activation of human Th17 cells. Expression of IL-17 and IL-10 was examined immunohistochemically in tissue obtained from rheumatoid arthritis patients. Human peripheral blood CD4(+) T cells were isolated and cultured under various stimulatory conditions. Th17 cells and regulatory T (Treg) cells were detected by flow cytometry. The gene expression of related cytokines and transcription factors were assessed by ELISA and RT-PCR. IL-17 was overexpressed in rheumatoid arthritis patients. IL-10 treatment significantly decreased the numbers of IL-17-producing and RORc-expressing cells among human CD4(+) T cells that had been activated in vitro by Th17-differentiating conditions in autoimmune arthritis patients. IL-10 induced Foxp3(+) regulatory T cells in the human CD4(+) T cell population. Our results demonstrate that IL-17 is overexpressed in autoimmune disease patients and that IL-10 suppresses IL-17 expression. IL-10 may be useful in the treatment of autoimmune diseases.

  7. The role of IL-6 on apical periodontitis: a systematic review.

    PubMed

    Azuma, M M; Samuel, R O; Gomes-Filho, J E; Dezan-Junior, E; Cintra, L T A

    2014-07-01

    The aim of this review was to examine current knowledge of the role of interleukin-6 (IL-6) in apical periodontitis (AP) pathogenesis as an inflammatory or pro-inflammatory cytokine. It also looked at whether IL-6 could serve as a measure for differential diagnosis or as a biomarker that can further predict the progression of bone resorption. A systematic review relating to AP and IL-6 was made via PubMed, BIOSIS, Cochrane, EMBASE and Web of Science databases using keywords and controlled vocabulary. Two independent reviewers first screened titles and abstracts and then the full texts. The reference lists of the identified publications were examined for additional titles. Eighteen papers were studied in total. In vitro studies (n = 6) revealed that IL-6 is present in AP, and its levels are proportional to the size of the periapical lesions. Neutrophils and macrophages resident in these lesions can produce IL-6 in vitro after a bacterial stimulus. Animal studies (n = 5) showed that IL-6 is present in AP and that osteoblasts can produce IL-6 in vivo. On the other hand, two studies using IL-6 knockout mice revealed larger periapical lesions when compared with control groups, demonstrating IL-6's role as an anti-inflammatory cytokine. In human studies (n = 7), IL-6 was identified in AP, and its levels were higher in symptomatic, epithelialized and large lesions than in asymptomatic and small lesions. These data lead to the conclusion that IL-6 may play a pro-inflammatory role, increasing its levels and reabsorbing bone in the presence of infections. When IL-6 is not present, other cytokines such as IL-1 and TNF-α induce bone resorption. Further studies about the relationship between AP development and the cytokine network must be performed to establish the exact role of each cytokine in the inflammatory process. © 2013 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  8. Zinc Deprivation Mediates Alcohol-Induced Hepatocyte IL-8 Analog Expression in Rodents via an Epigenetic Mechanism

    PubMed Central

    Zhao, Yantao; Zhong, Wei; Sun, Xiuhua; Song, Zhenyuan; Clemens, Dahn L.; Kang, Y. James; McClain, Craig J.; Zhou, Zhanxiang

    2011-01-01

    Neutrophil infiltration caused by IL-8 production is a central mechanism in alcohol-induced hepatitis. This study was performed to examine if an epigenetic mechanism is involved in alcohol-induced IL-8 production. Mice were pair-fed an alcohol-containing liquid diet for 4 weeks. Alcohol exposure induced hepatitis as indicated by increased expression of keratinocyte-derived cytokine (mouse IL-8) and neutrophil infiltration. Alcohol exposure induced histone 3 hyperacetylation owing to inhibition of histone deacetylase (HDAC) in association with NF-κB activation. Cell culture studies showed that alcohol exposure induced IL-8 and cytokine-induced neutrophil chemoattractant-1 (CINC-1, rat IL-8) production in human VL-17A cells and rat H4IIEC3 cells, respectively, dependent on acetaldehyde production, oxidative stress, and zinc release. Zinc deprivation alone induced CINC-1 production and acted synergistically with lipopolysaccharide or tumor necrosis factor-α on CINC-1 production. Zinc deprivation induced histone 3 hyperacetylation at lysine 9 through suppression of HDAC activity. Zinc deprivation caused nuclear translocation of NF-κB, and reduced HDAC binding to NF-κB. Chromatin immunoprecipitation (ChIP) showed that zinc deprivation caused histone 3 hyperacetylation as well as increased NF-κB binding to the CINC-1 promoter. In conclusion, inactivation of HDAC caused by zinc deprivation is a novel mechanism underlying IL-8 up-regulation in alcoholic hepatitis. PMID:21708112

  9. K6 linked polyubiquitylation of FADD by CHIP prevents death inducing signaling complex formation suppressing cell death.

    PubMed

    Seo, Jinho; Lee, Eun-Woo; Shin, Jihye; Seong, Daehyeon; Nam, Young Woo; Jeong, Manhyung; Lee, Seon-Hyeong; Lee, Cheolju; Song, Jaewhan

    2018-05-23

    Fas-associated death domain (FADD) is an adaptor protein recruiting complexes of caspase 8 to death ligand receptors to induce extrinsic apoptotic cell death in response to a TNF superfamily member. Although, formation of the complex of FADD and caspase 8 upon death stimuli has been studied in detail, posttranslational modifications fine-tuning these processes have yet to be identified. Here we revealed that K6-linked polyubiquitylation of FADD on lysines 149 and 153 mediated by C terminus HSC70-interacting protein (CHIP) plays an important role in preventing formation of the death inducing signaling complex (DISC), thus leading to the suppression of cell death. Cells depleted of CHIP showed higher sensitivity toward death ligands such as FasL and TRAIL, leading to upregulation of DISC formation composed of a death receptor, FADD, and caspase 8. CHIP was able to bind to FADD, induce K6-linked polyubiquitylation of FADD, and suppress DISC formation. By mass spectrometry, lysines 149 and 153 of FADD were found to be responsible for CHIP-mediated FADD ubiquitylation. FADD mutated at these sites was capable of more potent cell death induction as compared with the wild type and was no longer suppressed by CHIP. On the other hand, CHIP deficient in E3 ligase activity was not capable of suppressing FADD function and of FADD ubiquitylation. CHIP depletion in ME-180 cells induced significant sensitization of these cells toward TRAIL in xenograft analyses. These results imply that K6-linked ubiquitylation of FADD by CHIP is a crucial checkpoint in cytokine-dependent extrinsic apoptosis.

  10. From the Cover: Interplay Between IFN-γ and IL-6 Impacts the Inflammatory Response and Expression of Interferon-Regulated Genes in Environmental-Induced Autoimmunity.

    PubMed

    Cauvi, David M; Cauvi, Gabrielle; Toomey, Christopher B; Jacquinet, Eric; Pollard, Kenneth Michael

    2017-07-01

    IFN-γ has been found to be robustly important to disease pathogenesis in both idiopathic and induced models of murine lupus. In transgenic mice, over production of IFN-γ in the skin results in an inflammatory response and autoimmunity. This suggests that localized exposure to environmental factors that induce autoimmunity may be associated with expression of an IFN-γ-dependent inflammatory response. Using murine mercury-induced autoimmunity (mHgIA), the severity of inflammation and proinflammatory cytokine expression, including the cellular source of IFN-γ, were assessed at the site of subcutaneous exposure and in secondary lymphoid organs. Exposure induced a localized chronic inflammation comprising both innate and adaptive immune cells but only CD8+ T and NK cells were reduced in the absence of IFN-γ. IFN-γ+ cells began to appear as early as day 1 and comprised both resident (γδ T) and infiltrating cells (CD8+ T, NKT, CD11c+). The requirements for inflammation were examined in mice deficient in genes required (Ifng, Il6) or not required (Casp1) for mHgIA. None of these genes were essential for induction of inflammation, however IFN-γ and IL-6 were required for exacerbation of other proinflammatory cytokines. Additionally, lack of IFN-γ or IL-6 impacted expression of genes regulated by either IFN-γ or type I IFN. Significantly, both IFN-γ and IL-6 were required for increased expression of IRF-1 which regulates IFN stimulated genes and is required for mHgIA. Thus IRF-1 may be at the nexus of the interplay between IFN-γ and IL-6 in exacerbating a xenobiotic-induced inflammatory response, regulation of interferon responsive genes and autoimmunity. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  11. Tacrolimus potently inhibits human osteoclastogenesis induced by IL-17 from human monocytes alone and suppresses human Th17 differentiation.

    PubMed

    Yago, Toru; Nanke, Yuki; Kawamoto, Manabu; Yamanaka, Hisashi; Kotake, Shigeru

    2012-08-01

    Tacrolimus (FK506, Prograf®) is an orally available, T cell specific and anti-inflammatory agent that has been proposed as a therapeutic drug in rheumatoid arthritis (RA) patients. It has been known that T cells have a critical role in the pathogenesis of RA. Recent studies suggest that Th17 cells, which mainly produce IL-17, are involved in many autoimmune inflammatory disease including RA. The present study was undertaken to assess the effect of tacrolimus on IL-17-induced human osteoclastogenesis and human Th17 differentiation. Human CD14(+) monocytes were cultured in the presence of macrophage-colony stimulating factor (M-CSF) and IL-17. From day 4, tacrolimus was added to these cultures. Osteoclasts were immunohistologically stained for vitronectin receptor 10days later. IL-17 production from activated T cells stimulated with IL-23 was measured by enzyme-linked immunosorbent assay (ELISA). Th17 differentiation from naïve T cells was assayed by flow cytometry. Tacrolimus potently inhibited IL-17-induced osteoclastogenesis from human monocytes and osteoclast activation. Addition of tacrolimus also reduced production of IL-17 in human activated T cells stimulated with IL-23. Interestingly, the population of human IL-17(+)IFN-γ(-) CD4 T cells or IL-17(+)TNF-α(+) CD4 T cells were decreased by adding of tacrolimus. The present study demonstrates that the inhibitory effect of tacrolimus on IL-17-induced osteoclastogenesis from human monocytes. Tacrolimus also inhibited expression of IL-17 or TNF-α by reducing the proportion of Th17, suggesting that therapeutic effect on Th17-associated disease such as RA, inflammatory bowel disease, multiple sclerosis, psoriasis, or allograft rejection. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. Active suppression induced by repetitive self-epitopes protects against EAE development.

    PubMed

    Puentes, Fabiola; Dickhaut, Katharina; Hofstätter, Maria; Falk, Kirsten; Rötzschke, Olaf

    2013-01-01

    Autoimmune diseases result from a breakdown in self-tolerance to autoantigens. Self-tolerance is induced and sustained by central and peripheral mechanisms intended to deviate harmful immune responses and to maintain homeostasis, where regulatory T cells play a crucial role. The use of self-antigens in the study and treatment of a range of autoimmune diseases has been widely described; however, the mechanisms underlying the induced protection by these means are unclear. This study shows that protection of experimental autoimmune disease induced by T cell self-epitopes in a multimerized form (oligomers) is mediated by the induction of active suppression. The experimental autoimmune encephalomyelitis (EAE) animal model for multiple sclerosis was used to study the mechanisms of protection induced by the treatment of oligomerized T cell epitope of myelin proteolipid protein (PLP139-151). Disease protection attained by the administration of oligomers was shown to be antigen specific and effective in both prevention and treatment of ongoing EAE. Oligomer mediated tolerance was actively transferred by cells from treated mice into adoptive hosts. The induction of active suppression was correlated with the recruitment of cells in the periphery associated with increased production of IL-10 and reduction of the pro-inflammatory cytokine TNF-α. The role of suppressive cytokines was demonstrated by the reversion of oligomer-induced protection after in vivo blocking of either IL-10 or TGF-β cytokines. This study strongly supports an immunosuppressive role of repeat auto-antigens to control the development of EAE with potential applications in vaccination and antigen specific treatment of autoimmune diseases.

  13. Evidence for sustained elevation of IL-6 in the CNS as a key contributor of depressive-like phenotypes

    PubMed Central

    Sukoff Rizzo, S J; Neal, S J; Hughes, Z A; Beyna, M; Rosenzweig-Lipson, S; Moss, S J; Brandon, N J

    2012-01-01

    There is compelling clinical literature implicating a role for cytokines in the pathophysiology of major depressive disorder (MDD). Interleukin-6 (IL-6) and interleukin-1β (IL-1β) are pleiotropic inflammatory cytokines that have been reported to be elevated in patients with MDD. The present studies were undertaken to investigate the relationship between IL-6 and IL-1β in animal models of depressive-like behavior. Analysis of brain tissue homogenates in the cortex of rats subjected to chronic stress paradigms revealed elevated levels of IL-6 protein in the absence of elevations in IL-1β. Central administration of recombinant mouse IL-6 produced depressive-like phenotypes in mice, which were not accompanied by IL-1β-induced increases in the brain tissue or IL-1β-related sickness behavior typical of a general central nervous system inflammatory response. Systemic administration of fluoxetine in the presence of centrally administered IL-6 failed to produce the expected antidepressant-like response in mice relative to sham-infused controls. Further, administration of fluoxetine to mice with endogenous overexpression of brain IL-6 (MRL/MpJ-FasLPR/LPR (LPR mice)) failed to produce the expected antidepressant-like effect relative to fluoxetine-treated control mice (MRL/MpJ+/+). Interestingly, blockade of IL-6 trans-signaling by coadministration of a gp130/Fc monomer or an anti-mouse IL-6 antibody with IL-6 prevented the IL-6-induced increases in immobility time as well as attenuated IL-6-induced increases of protein in the cortex. Taken together, these data indicate that elevations in IL-6 may have a pathophysiological role underlying depression and more specifically resistance to current classes of antidepressant medications and suggest that modulation of the IL-6 signaling pathway may have therapeutic potential for treatment-resistant depression. PMID:23212583

  14. Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination.

    PubMed

    Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo

    2017-10-01

    Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.

  15. Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination

    PubMed Central

    Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye

    2017-01-01

    Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654

  16. Lipopolysaccharides upregulate hepcidin in neuron via microglia and the IL-6/STAT3 signaling pathway.

    PubMed

    Qian, Zhong-Ming; He, Xuan; Liang, Tuo; Wu, Ka-Chun; Yan, Yik-Chun; Lu, Li-Na; Yang, Guang; Luo, Qian Qian; Yung, Wing-Ho; Ke, Ya

    2014-12-01

    Neuroinflammation is closely related to brain iron homeostasis. Our previous study demonstrated that lipopolysaccharides (LPS) can regulate expression of iron-regulatory peptide hepcidin; however, the mechanism is undefined. Here, we demonstrated that intracerebroventricular injection of LPS in rat brain upregulated hepcidin and downregulated ferroportin 1 in the cortex and substantia nigra. LPS increased hepcidin expression in neurons only when they were co-cultured with BV-2 microglia, and the upregulation was suppressed by IL-6 neutralizing antibody in vitro. In addition, IL-6 but not IL-1α, IL-1β, or tumor necrosis factor-alpha increased hepcidin expression and signal transducer and activator of transcription 3 (STAT3) phosphorylation in cortical neurons and MES23.5 dopaminergic neurons. These effects were blocked by the STAT3 inhibitor, stattic. Our results show that neurons are the major source of increased hepcidin expression in response to LPS challenge but microglia play a key mediator role by releasing IL-6 and recruiting the STAT3 pathway. We conclude that LPS upregulates hepcidin expression in neurons via microglia and the IL-6/STAT3 signaling pathway.

  17. Genistein suppresses adhesion-induced protein tyrosine phosphorylation and invasion of B16-BL6 melanoma cells.

    PubMed

    Yan, C; Han, R

    1998-07-03

    Protein tyrosine phosphorylation occurs as one of the earlier events in cancer cell-extracellular matrix (ECM) interaction. With immunoblot analysis and immunofluorescence microscopy, genistein was found to suppress the tyrosine phosphorylation of proteins located at the cell periphery, including a 125 kDa protein, when B16-BL6 melanoma cells attached to and interacted with ECM. When accompanied by the suppression of adhesion-induced protein tyrosine phosphorylation, the invasive potential of B16-BL6 cells through reconstituted basement membrane was decreased significantly. However, neither adhesive capability nor cell growth was significantly affected by genistein. Therefore, the interruption of cancer cell-ECM interaction by suppression of protein tyrosine phosphorylation may contribute to invasion prevention of genistein.

  18. Frontline Science: Proliferation of Ly6C+ monocytes during urinary tract infections is regulated by IL-6 trans-signaling.

    PubMed

    Dixit, Akanksha; Bottek, Jenny; Beerlage, Anna-Lena; Schuettpelz, Jana; Thiebes, Stephanie; Brenzel, Alexandra; Garbers, Christoph; Rose-John, Stefan; Mittrücker, Hans-Willi; Squire, Anthony; Engel, Daniel R

    2018-01-01

    Ly6C + monocytes are important components of the innate immune defense against infections. These cells have been shown to proliferate in the bone marrow of mice with systemic infections. However, the proliferative capacity of Ly6C + monocytes in infected peripheral tissues as well as the associated regulatory mechanisms remain unclear. In this study, we analyzed the proliferative capacity of Ly6C + monocytes in the urinary bladder after infection with uropathogenic E. coli, one of the most prevalent pathogen worldwide, and in LPS-induced peritonitis. We show that Ly6C + monocytes proliferated in the bladder after infection with uropathogenic E. coli and in the peritoneum after intraperitoneal injection of LPS. We identified IL-6, a molecule that is highly expressed in infections, as a crucial regulator of Ly6C + monocyte proliferation. Inhibition of IL-6 via administration of antibodies against IL-6 or gp130 impeded Ly6C + monocyte proliferation. Furthermore, repression of IL-6 trans-signaling via administration of soluble gp130 markedly reduced the proliferation of Ly6C + monocytes. Overall, this study describes the proliferation of Ly6C + monocytes using models of urinary tract infection and LPS-induced peritonitis. IL-6 trans-signaling was identified as the regulator of Ly6C + monocyte proliferation. ©2017 Society for Leukocyte Biology.

  19. Moringa fruit inhibits LPS-induced NO/iNOS expression through suppressing the NF-κ B activation in RAW264.7 cells.

    PubMed

    Lee, Hyo-Jin; Jeong, Yun-Jeong; Lee, Tae-Sung; Park, Yoon-Yub; Chae, Whi-Gun; Chung, Il-Kyung; Chang, Hyeun-Wook; Kim, Cheorl-Ho; Choi, Yung-Hyun; Kim, Wun-Jae; Moon, Sung-Kwon; Chang, Young-Chae

    2013-01-01

    In this study, we evaluated the anti-inflammatory effects of moringa (Moringa oleifera Lam.), a natural biologically active substance, by determining its inhibitory effects on pro-inflammatory mediators in lipopolysaccharide (LPS)-stimulated macrophage RAW264.7 cells. Extracts from different parts of moringa (root, leaf, and fruit) reduced LPS-induced nitric oxide (NO) release in a dose-dependent manner. The moringa fruit extract most effectively inhibited LPS-induced NO production and levels of inducible nitric oxide synthase (iNOS). The moringa fruit extract also was shown to suppress the production of inflammatory cytokines including IL-1β, TNF-α, and IL-6. Furthermore, moringa fruit extract inhibited the cytoplasmic degradation of I κ B -α and the nuclear translocation of p65 proteins, resulting in lower levels of NF -κ B transactivation. Collectively, the results of this study demonstrate that moringa fruit extract reduces the levels of pro-inflammatory mediators including NO , IL-1β, TNF-α, and IL-6 via the inhibition of NF -κ B activation in RAW264.7 cells. These findings reveal, in part, the molecular basis underlying the anti-inflammatory properties of moringa fruit extract.

  20. Human papillomavirus type 16 E6 suppresses microRNA-23b expression in human cervical cancer cells through DNA methylation of the host gene C9orf3.

    PubMed

    Yeung, Chi Lam Au; Tsang, Tsun Yee; Yau, Pak Lun; Kwok, Tim Tak

    2017-02-14

    Oncogenic protein E6 of human papillomavirus type 16 (HPV-16) is believed to involve in the aberrant methylation in cervical cancer as it upregulates DNA methyltransferase 1 (DNMT1) through tumor suppressor p53. In addition, DNA demethylating agent induces the expression of one of the HPV-16 E6 regulated microRNAs (miRs), miR-23b, in human cervical carcinoma SiHa cells. Thus, the importance of DNA methylation and miR-23b in HPV-16 E6 associated cervical cancer development is investigated. In the present study, however, it is found that miR-23b is not embedded in any typical CpG island. Nevertheless, a functional CpG island is predicted in the promoter region of C9orf3, the host gene of miR-23b, and is validated by methylation-specific PCR and bisulfite genomic sequencing analyses. Besides, c-MET is confirmed to be a target gene of miR-23b. Silencing of HPV-16 E6 is found to increase the expression of miR-23b, decrease the expression of c-MET and thus induce the apoptosis of SiHa cells through the c-MET downstream signaling pathway. Taken together, the tumor suppressive miR-23b is epigenetically inactivated through its host gene C9orf3 and this is probably a critical pathway during HPV-16 E6 associated cervical cancer development.

  1. Ketamine inhibits tumor necrosis factor-{alpha} and interleukin-6 gene expressions in lipopolysaccharide-stimulated macrophages through suppression of toll-like receptor 4-mediated c-Jun N-terminal kinase phosphorylation and activator protein-1 activation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, G.-J.; Department of Anesthesiology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan; Graduate Institute of Clinical Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan

    2008-04-01

    Our previous study showed that ketamine, an intravenous anesthetic agent, has anti-inflammatory effects. In this study, we further evaluated the effects of ketamine on the regulation of tumor necrosis factor-{alpha} (TNF-{alpha}) and interlukin-6 (IL-6) gene expressions and its possible signal-transducing mechanisms in lipopolysaccharide (LPS)-activated macrophages. Exposure of macrophages to 1, 10, and 100 {mu}M ketamine, 100 ng/ml LPS, or a combination of ketamine and LPS for 1, 6, and 24 h was not cytotoxic to macrophages. A concentration of 1000 {mu}M of ketamine alone or in combined treatment with LPS caused significant cell death. Administration of LPS increased cellular TNF-{alpha}more » and IL-6 protein levels in concentration- and time-dependent manners. Meanwhile, treatment with ketamine concentration- and time-dependently alleviated the enhanced effects. LPS induced TNF-{alpha} and IL-6 mRNA syntheses. Administration of ketamine at a therapeutic concentration (100 {mu}M) significantly inhibited LPS-induced TNF-{alpha} and IL-6 mRNA expressions. Application of toll-like receptor 4 (TLR4) small interfering (si)RNA into macrophages decreased cellular TLR4 levels. Co-treatment of macrophages with ketamine and TLR4 siRNA decreased the LPS-induced TNF-{alpha} and IL-6 productions more than alone administration of TLR4 siRNA. LPS stimulated phosphorylation of c-Jun N-terminal kinase and translocation of c-Jun and c-Fos from the cytoplasm to nuclei. However, administration of ketamine significantly decreased LPS-induced activation of c-Jun N-terminal kinase and translocation of c-Jun and c-Fos. LPS increased the binding of nuclear extracts to activator protein-1 consensus DNA oligonucleotides. Administration of ketamine significantly ameliorated LPS-induced DNA binding activity of activator protein-1. Therefore, a clinically relevant concentration of ketamine can inhibit TNF-{alpha} and IL-6 gene expressions in LPS-activated macrophages. The suppressive

  2. Ketamine inhibits tumor necrosis factor-alpha and interleukin-6 gene expressions in lipopolysaccharide-stimulated macrophages through suppression of toll-like receptor 4-mediated c-Jun N-terminal kinase phosphorylation and activator protein-1 activation.

    PubMed

    Wu, Gone-Jhe; Chen, Ta-Liang; Ueng, Yune-Fang; Chen, Ruei-Ming

    2008-04-01

    Our previous study showed that ketamine, an intravenous anesthetic agent, has anti-inflammatory effects. In this study, we further evaluated the effects of ketamine on the regulation of tumor necrosis factor-alpha (TNF-alpha) and interlukin-6 (IL-6) gene expressions and its possible signal-transducing mechanisms in lipopolysaccharide (LPS)-activated macrophages. Exposure of macrophages to 1, 10, and 100 microM ketamine, 100 ng/ml LPS, or a combination of ketamine and LPS for 1, 6, and 24 h was not cytotoxic to macrophages. A concentration of 1000 microM of ketamine alone or in combined treatment with LPS caused significant cell death. Administration of LPS increased cellular TNF-alpha and IL-6 protein levels in concentration- and time-dependent manners. Meanwhile, treatment with ketamine concentration- and time-dependently alleviated the enhanced effects. LPS induced TNF-alpha and IL-6 mRNA syntheses. Administration of ketamine at a therapeutic concentration (100 microM) significantly inhibited LPS-induced TNF-alpha and IL-6 mRNA expressions. Application of toll-like receptor 4 (TLR4) small interfering (si)RNA into macrophages decreased cellular TLR4 levels. Co-treatment of macrophages with ketamine and TLR4 siRNA decreased the LPS-induced TNF-alpha and IL-6 productions more than alone administration of TLR4 siRNA. LPS stimulated phosphorylation of c-Jun N-terminal kinase and translocation of c-Jun and c-Fos from the cytoplasm to nuclei. However, administration of ketamine significantly decreased LPS-induced activation of c-Jun N-terminal kinase and translocation of c-Jun and c-Fos. LPS increased the binding of nuclear extracts to activator protein-1 consensus DNA oligonucleotides. Administration of ketamine significantly ameliorated LPS-induced DNA binding activity of activator protein-1. Therefore, a clinically relevant concentration of ketamine can inhibit TNF-alpha and IL-6 gene expressions in LPS-activated macrophages. The suppressive mechanisms occur through

  3. Nucleoside Reverse Transcriptase Inhibitors Suppress Laser-Induced Choroidal Neovascularization in Mice

    PubMed Central

    Mizutani, Takeshi; Fowler, Benjamin J.; Kim, Younghee; Yasuma, Reo; Krueger, Laura A.; Gelfand, Bradley D.; Ambati, Jayakrishna

    2015-01-01

    Purpose To evaluate the efficacy of nucleoside reverse transcriptase inhibitors (NRTIs) in the laser-induced mouse model of choroidal neovascularization (CNV). Methods We evaluated the NRTIs lamivudine (3TC), zidovudine (AZT), and abacavir (ABC) and the P2X7 antagonist A438079. Choroidal neovascularization was induced by laser injury in C57BL/6J wild-type, Nlrp3−/−, and P2rx7−/− mice, and CNV volume was measured after 7 days by confocal microscopy. Drugs were administered by intravitreous injection immediately after the laser injury. Vascular endothelial growth factor-A in RPE-choroid lysates was measured 3 days after laser injury by ELISA. HEK293 cells expressing human and mouse P2X7 were exposed to the selective P2X7 receptor agonist 2′, 3′-(benzoyl-4-benzoyl)-ATP (Bz-ATP) with or without 3TC, and VEGF-A levels in media were measured by ELISA. Results Intravitreous injection of 3TC, AZT, and ABC significantly suppressed laser-induced CNV in C57BL/6J wild-type and Nlrp3−/− mice (P < 0.05) but not in P2rx7−/− mice. Intravitreous injection of A438079 also suppressed the laser-induced CNV (P < 0.05). The NRTIs 3TC, AZT, and ABC blocked VEGF-A levels in the RPE/choroid after laser injury in wild-type (P < 0.05) but not P2rx7−/− mice. Moreover, there was no additive effect of 3TC on CNV inhibition when coadministered with a neutralizing VEGF-A antibody. Stimulation of human and mouse P2X7-expressing HEK293 cells with Bz-ATP increased VEGF secretion (P < 0.001), which was abrogated by 3TC (P < 0.001). Stimulation of primary human RPE cells with Bz-ATP increased VEGFA and IL6 mRNA levels, which were abrogated by 3TC. Conclusions Multiple clinically relevant NRTIs suppressed laser-induced CNV and downregulated VEGF-A, via P2X7. PMID:26529046

  4. [Suppression of murine EAE by triptolide is related to downregulation of INF-gamma and upregulation of IL-10 secretion in splenic lymphocytes].

    PubMed

    Fan, Hong-cui; Ren, Xiao-rong; Yu, Jie-zhong; Guo, Min-fang; Ji, Ning; Sun, Yong-sheng; Liang, Li-yun; Ma, Cun-gen

    2009-03-01

    To explore the therapeutic effectivity and the possible mechanism of triptolide (Tri) on experimental autoimmune encephalomyelitis (EAE). All female C57BL/6 mice were randomly divided into EAE group (28), Tri treated group (20) and adjuvant group (18). Mice in EAE and treated groups were immunized with myelin oligodendrocyte glycoprotein peptides 35-55 (MOG(35-55);), adjuvant group was injected at the same time, but instead of MOG(35-55); with normal saline. Tri was intraperitoneally injected in the dosage of 100 microg/(kg.d) in treated group on day 5 post-immunization (p.i.), and mice in EAE and adjuvant group injected with normal saline as control. The clinical feature and pathological changes were observed and the splenic lymphocytes were prepared on days 18-20 p.i. The cell cultures were divided into the control group (only 200 microL of cell suspension) and the experimental group (cell suspension in the presence of 10 mg/L MOG(35-55);). Then all of them were inoculated in 96-well flat-bottom plates under 37 degrees Celsius, 50 mL/L CO(2);. After 48 h, the proliferation assay was determined by MTT, and the supernatants were harvested for the detection of INF-gamma, IL-17, IL-10 and IL-4 by ELISA. Tri treatment showed an significantly protective action on EAE. After the intervention of Tri, the levels of IL-10 were increased (P<0.05), but the secretion of INF-gamma and proliferation response of splenic lymphocytes induced by MOG(35-55); were statistically significantly inhibited(P<0.05 and P<0.01, respectively). There were no influences on the amount of IL-17 and IL-4 by Tri. Tri is an effective drug in suppressing murine EAE. This suppression is supposed to be related to downregulation of INF-gamma and upregulation of IL-10 secretion in splenic lymphocytes.

  5. Berberine alleviates postoperative cognitive dysfunction by suppressing neuroinflammation in aged mice.

    PubMed

    Zhang, Zhijie; Li, Xiuhua; Li, Fayin; An, Lijun

    2016-09-01

    Postoperative cognitive dysfunction (POCD) is a significant cause of morbidity after surgery, especially for the elderly. Accumulating evidence has demonstrated that neuroinflammation plays a key role in the pathogenesis of POCD. Thus, we hypothesized that berberine, an isoquinoline alkaloid with anti-inflammatory effects, could improve surgery-induced cognitive impairment. Twenty-month-old male C57BL/6 mice were subjected to exploratory laparotomy with isoflurane anesthesia to mimic the clinical human abdominal surgery. For the interventional studies, mice received berberine (10mg/kg) or vehicle intraperitoneally. For the in vitro study, we examined the effects of berberine on lipopolysaccharide (LPS)-induced inflammatory mediators by cultured BV2 cells. Behavioral tests, expressions of IBA1, tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and IL-6 were performed at the indicated time points. In the present study, we showed that surgery impaired the contextual fear memory, as evidenced by the significantly decreased freezing time to the context. This behavioral change coincided with marked increases in IBA1, TNF-α, IL-1β, and IL-6 in the prefrontal cortex and hippocampus only at 24h but not 7 d after surgery. In BV2 cells, LPS induced significantly increased TNF-α and IL-1β expressions. Notably, berberine treatment rescued surgery-induced cognitive impairment and inhibited the release of IBA1, IL-1β, and IL-6 in the hippocampus. In line with the in vivo study, berberine treatment suppressed LPS-stimulated production of TNF-α and IL-1β in BV2 cells. In conclusion, our study suggests that berberine could alleviate POCD by suppressing neuroinflammation in aged mice. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Production of Mice Deficient in Genes for Interleukin (IL)-1α, IL-1β, IL-1α/β, and IL-1 Receptor Antagonist Shows that IL-1β Is Crucial in Turpentine-induced Fever Development and Glucocorticoid Secretion

    PubMed Central

    Horai, Reiko; Asano, Masahide; Sudo, Katsuko; Kanuka, Hirotaka; Suzuki, Masatoshi; Nishihara, Masugi; Takahashi, Michio; Iwakura, Yoichiro

    1998-01-01

    Interleukin (IL)-1 is a major mediator of inflammation and exerts pleiotropic effects on the neuro-immuno-endocrine system. To elucidate pathophysiological roles of IL-1, we have first produced IL-1α/β doubly deficient (KO) mice together with mice deficient in either the IL-1α, IL-1β, or IL-1 receptor antagonist (IL-1ra) genes. These mice were born healthy, and their growth was normal except for IL-1ra KO mice, which showed growth retardation after weaning. Fever development upon injection with turpentine was suppressed in IL-1β as well as IL-1α/β KO mice, but not in IL-1α KO mice, whereas IL-1ra KO mice showed an elevated response. At this time, expression of IL-1β mRNA in the diencephalon decreased 1.5-fold in IL-1α KO mice, whereas expression of IL-1α mRNA decreased >30-fold in IL-1β KO mice, suggesting mutual induction between IL-1α and IL-1β. This mutual induction was also suggested in peritoneal macrophages stimulated with lipopolysaccharide in vitro. In IL-1β KO mice treated with turpentine, the induction of cyclooxygenase-2 (EC 1.14.99.1) in the diencephalon was suppressed, whereas it was enhanced in IL-1ra KO mice. We also found that glucocorticoid induction 8 h after turpentine treatment was suppressed in IL-1β but not IL-1α KO mice. These observations suggest that IL-1β but not IL-1α is crucial in febrile and neuro-immuno-endocrine responses, and that this is because IL-1α expression in the brain is dependent on IL-1β. The importance of IL-1ra both in normal physiology and under stress is also suggested. PMID:9565638

  7. Production of mice deficient in genes for interleukin (IL)-1alpha, IL-1beta, IL-1alpha/beta, and IL-1 receptor antagonist shows that IL-1beta is crucial in turpentine-induced fever development and glucocorticoid secretion.

    PubMed

    Horai, R; Asano, M; Sudo, K; Kanuka, H; Suzuki, M; Nishihara, M; Takahashi, M; Iwakura, Y

    1998-05-04

    Interleukin (IL)-1 is a major mediator of inflammation and exerts pleiotropic effects on the neuro-immuno-endocrine system. To elucidate pathophysiological roles of IL-1, we have first produced IL-1alpha/beta doubly deficient (KO) mice together with mice deficient in either the IL-1alpha, IL-1beta, or IL-1 receptor antagonist (IL-1ra) genes. These mice were born healthy, and their growth was normal except for IL-1ra KO mice, which showed growth retardation after weaning. Fever development upon injection with turpentine was suppressed in IL-1beta as well as IL-1alpha/beta KO mice, but not in IL-1alpha KO mice, whereas IL-1ra KO mice showed an elevated response. At this time, expression of IL-1beta mRNA in the diencephalon decreased 1.5-fold in IL-1alpha KO mice, whereas expression of IL-1alpha mRNA decreased >30-fold in IL-1beta KO mice, suggesting mutual induction between IL-1alpha and IL-1beta. This mutual induction was also suggested in peritoneal macrophages stimulated with lipopolysaccharide in vitro. In IL-1beta KO mice treated with turpentine, the induction of cyclooxygenase-2 (EC 1.14.99.1) in the diencephalon was suppressed, whereas it was enhanced in IL-1ra KO mice. We also found that glucocorticoid induction 8 h after turpentine treatment was suppressed in IL-1beta but not IL-1alpha KO mice. These observations suggest that IL-1beta but not IL-1alpha is crucial in febrile and neuro-immuno-endocrine responses, and that this is because IL-1alpha expression in the brain is dependent on IL-1beta. The importance of IL-1ra both in normal physiology and under stress is also suggested.

  8. IL-6 Receptor Isoforms and Ovarian Cancer

    DTIC Science & Technology

    2013-01-01

    previously de- cribed.27 Groups of mice (n 6) were dministered acetyl salicylic acid (ASA; 00 mg/kg; Sigma, St Louis, MO), phos- hate-buffered saline...indicates P .05. SA, acetyl salicylic acid ; IL6R, interleukin-6 receptor. ath. IL-6 receptor in ovarian tumors. Am J Obstet Gynecol 2010. ause they are...tumor cell proper to increase this effect . Published studies examining IL6-/- and IL6R-/- mice demonstrated a complexity of IL6 signaling for wound

  9. Whole Blood Profiling of Bacillus Calmette–Guérin-Induced Trained Innate Immunity in Infants Identifies Epidermal Growth Factor, IL-6, Platelet-Derived Growth Factor-AB/BB, and Natural Killer Cell Activation

    PubMed Central

    Smith, Steven G.; Kleinnijenhuis, Johanneke; Netea, Mihai G.; Dockrell, Hazel M.

    2017-01-01

    Vaccination of infants with bacillus Calmette–Guérin (BCG) activates both the innate and adaptive arms of the immune response. The antimycobacterial effects of these responses most likely account for the ability of BCG to protect against childhood forms of tuberculosis (TB). There is also evidence for a heterologous protective effect of BCG vaccination against TB-unrelated mortality in low birth weight infants. A possible mechanism of action of this effect, the induction of trained innate immunity, has been demonstrated when cells from BCG-vaccinated adults are restimulated in vitro with non-related microbial stimuli. Our aim was to examine an extensive panel of secreted immune biomarkers to characterize the profile of trained innate immunity in infants. Stimulation of whole blood for 48 h was performed 4 months after BCG vaccination, or in control unvaccinated infants. Stimulants were lipopolysaccharide; Pam3Cys (P3C); heat-killed Candida albicans, Staphylococcus aureus, Escherichia coli, and a lysate of Mycobacterium tuberculosis. Culture supernatants were tested for secreted cytokines and chemokines by 42-plex bead array and monocytes and natural killer (NK) cells assessed for expression of activation markers by flow cytometry. BCG-vaccinated infants displayed increases in 11 cytokines and chemokines in response to different non-specific innate immunity stimuli: epidermal growth factor (EGF); eotaxin; IL-6; IL-7; IL-8; IL-10; IL-12p40; monocyte chemotactic protein-3; macrophage inflammatory protein-1α; soluble CD40 ligand and platelet-derived growth factor (PDGF)-AB/BB. Although each stimulant induced a distinct response profile, three analytes, EGF, IL-6, and PDGF-AB/BB, were commonly higher after stimulation with Pam3Cys, C. albicans, and S. aureus. Conversely, certain cytokines such as interferon gamma-inducible protein-10, IL-2, IL-13, IL-17, GM-CSF, and GRO were suppressed in BCG-vaccinated infants, while no increases in TNFα or IL-1β production

  10. Sensitization of dural afferents underlies migraine-related behavior following meningeal application of interleukin-6 (IL-6)

    PubMed Central

    2012-01-01

    Background Migraine headache is one of the most common neurological disorders, but the pathophysiology contributing to migraine is poorly understood. Intracranial interleukin-6 (IL-6) levels have been shown to be elevated during migraine attacks, suggesting that this cytokine may facilitate pain signaling from the meninges and contribute to the development of headache. Methods Cutaneous allodynia was measured in rats following stimulation of the dura with IL-6 alone or in combination with the MEK inhibitor, U0126. The number of action potentials and latency to the first action potential peak in response to a ramp current stimulus as well as current threshold were measured in retrogradely-labeled dural afferents using patch-clamp electrophysiology. These recordings were performed in the presence of IL-6 alone or in combination with U0126. Association between ERK1 and Nav1.7 following IL-6 treatment was also measured by co-immunoprecipitation. Results Here we report that in awake animals, direct application of IL-6 to the dura produced dose-dependent facial and hindpaw allodynia. The MEK inhibitor U0126 blocked IL-6-induced allodynia indicating that IL-6 produced this behavioral effect through the MAP kinase pathway. In trigeminal neurons retrogradely labeled from the dura, IL-6 application decreased the current threshold for action potential firing. In response to a ramp current stimulus, cells treated with IL-6 showed an increase in the numbers of action potentials and a decrease in latency to the first spike, an effect consistent with phosphorylation of the sodium channel Nav1.7. Pretreatment with U0126 reversed hyperexcitability following IL-6 treatment. Moreover, co-immunoprecipitation experiments demonstrated an increased association between ERK1 and Nav1.7 following IL-6 treatment. Conclusions Our results indicate that IL-6 enhances the excitability of dural afferents likely via ERK-mediated modulation of Nav1.7 and these responses contribute to migraine

  11. Activation of the Maternal Immune System Induces Endocrine Changes in the Placenta via IL-6

    PubMed Central

    Hsiao, Elaine Y.; Patterson, Paul H.

    2011-01-01

    Activation of the maternal immune system in rodent models sets in motion a cascade of molecular pathways that ultimately result in autism- and schizophrenia-related behaviors in offspring. The finding that interleukin-6 (IL-6) is a crucial mediator of these effects led us to examine the mechanism by which this cytokine influences fetal development in vivo. Here we focus on the placenta as the site of direct interaction between mother and fetus and as a principal modulator of fetal development. We find that maternal immune activation (MIA) with a viral mimic, synthetic double-stranded RNA (poly(I:C)), increases IL-6 mRNA as well as maternally-derived IL-6 protein in the placenta. Placentas from MIA mothers exhibit increases in CD69+ decidual macrophages, granulocytes and uterine NK cells, indicating elevated early immune activation. Maternally-derived IL-6 mediates activation of the JAK/STAT3 pathway specifically in the spongiotrophoblast layer of the placenta, which results in expression of acute phase genes. Importantly, this parallels an IL-6-dependent disruption of the growth hormone-insulin-like growth factor (GH-IGF) axis that is characterized by decreased GH, IGFI and IGFBP3 levels. In addition, we observe an IL-6-dependent induction in pro-lactin-like protein-K (PLP-K) expression as well as MIA-related alterations in other placental endocrine factors. Together, these IL-6-mediated effects of MIA on the placenta represent an indirect mechanism by which MIA can alter fetal development. PMID:21195166

  12. Ayanin, a non-selective phosphodiesterase 1-4 inhibitor, effectively suppresses ovalbumin-induced airway hyperresponsiveness without affecting xylazine/ketamine-induced anesthesia.

    PubMed

    Lee, Fei-Peng; Shih, Chwen-Ming; Shen, Hsin-Yi; Chen, Chien-Ming; Chen, Chi-Ming; Ko, Wun-Chang

    2010-06-10

    In recent in vitro reports, the IC(50) value of ayanin (quercetin-3,7,4'-O-trimethylether) was 2.2microM for inhibiting interleukin (IL)-4 production from purified basophils, and its therapeutic ratio was >19. Therefore, we were interested in investigating the effects on ovalbumin induced airway hyperresponsiveness in vivo, and to clarify its potential for treating asthma. Ayanin (30-100micromol/kg, orally (p.o.)) dose-dependently and significantly attenuated the enhanced pause (P(enh)) value induced by methacholine in sensitized and challenged mice. It also significantly suppressed the increases in total inflammatory cells, macrophages, lymphocytes, neutrophils, and eosinophils, and levels of cytokines, including IL-2, IL-4, IL-5, and tumor necrosis factor (TNF)-alpha in bronchoalveolar lavage fluid of these mice. However, at 100micromol/kg, it significantly enhanced the level of interferon (IFN)-gamma. In addition, ayanin (30-100micromol/kg, p.o.) dose-dependently and significantly suppressed total and OVA-specific immunoglobulin (Ig)E levels in the serum and bronchoalveolar lavage fluid, and enhanced the IgG(2a) level in serum of these mice. In the present results, ayanin did not affect xylazine/ketamine-induced anesthesia, suggesting that ayanin has few or no adverse effects, such as nausea, vomiting, and gastric hypersecretion. In conclusion, the above results suggest that ayanin may have the potential for use in treating allergic asthma.

  13. IL-6 pathway-driven investigation of response to IL-6 receptor inhibition in rheumatoid arthritis

    PubMed Central

    Wang, Jianmei; Platt, Adam; Upmanyu, Ruchi; Germer, Søren; Lei, Guiyuan; Rabe, Christina; Benayed, Ryma; Kenwright, Andrew; Hemmings, Andrew; Martin, Mitchell; Harari, Olivier

    2013-01-01

    Objectives To determine whether heterogeneity in interleukin-6 (IL-6), IL-6 receptor and other components of the IL-6 signalling pathway/network, at the gene, transcript and protein levels, correlate with disease activity in patients with rheumatoid arthritis (RA) and with clinical response to tocilizumab. Design Biomarker samples and clinical data for five phase 3 trials of tocilizumab were analysed using serum (3751 samples), genotype (927 samples) and transcript (217 samples) analyses. Linear regression was then used to assess the association between these markers and either baseline disease activity or treatment response. Results Higher baseline serum IL-6 levels were significantly associated (p<0.0001) with higher baseline DAS28, erythrocyte sedimentation rate, C reactive protein and Health Assessment Questionnaire in patients whose responses to disease-modifying antirheumatic drugs (DMARD-IR) and to antitumour necrosis factor (aTNF-IR) were inadequate and patients who were naive/responders to methotrexate (MTX). Higher baseline serum IL-6 levels were also significantly associated with better clinical response to tocilizumab (versus placebo) measured by cDAS28 in the pooled DMARD-IR (p<0.0001) and MTX-naive populations (p=0.04). However, the association with treatment response was weak. A threefold difference in baseline IL-6 level corresponded to only a 0.17-unit difference in DAS28 at week 16. IL-6 pathway single nucleotide polymorphisms and RNA levels also were not strongly associated with treatment response. Conclusions Our analyses illustrate that the biological activity of a disease-associated molecular pathway may impact the benefit of a therapy targeting that pathway. However, the variation in pathway activity, as measured in blood, may not be a strong predictor. These data suggest that the major contribution to variability in clinical responsiveness to therapeutics in RA remains unknown. PMID:23959753

  14. Zinc deprivation mediates alcohol-induced hepatocyte IL-8 analog expression in rodents via an epigenetic mechanism.

    PubMed

    Zhao, Yantao; Zhong, Wei; Sun, Xiuhua; Song, Zhenyuan; Clemens, Dahn L; Kang, Y James; McClain, Craig J; Zhou, Zhanxiang

    2011-08-01

    Neutrophil infiltration caused by IL-8 production is a central mechanism in alcohol-induced hepatitis. This study was performed to examine if an epigenetic mechanism is involved in alcohol-induced IL-8 production. Mice were pair-fed an alcohol-containing liquid diet for 4 weeks. Alcohol exposure induced hepatitis as indicated by increased expression of keratinocyte-derived cytokine (mouse IL-8) and neutrophil infiltration. Alcohol exposure induced histone 3 hyperacetylation owing to inhibition of histone deacetylase (HDAC) in association with NF-κB activation. Cell culture studies showed that alcohol exposure induced IL-8 and cytokine-induced neutrophil chemoattractant-1 (CINC-1, rat IL-8) production in human VL-17A cells and rat H4IIEC3 cells, respectively, dependent on acetaldehyde production, oxidative stress, and zinc release. Zinc deprivation alone induced CINC-1 production and acted synergistically with lipopolysaccharide or tumor necrosis factor-α on CINC-1 production. Zinc deprivation induced histone 3 hyperacetylation at lysine 9 through suppression of HDAC activity. Zinc deprivation caused nuclear translocation of NF-κB, and reduced HDAC binding to NF-κB. Chromatin immunoprecipitation (ChIP) showed that zinc deprivation caused histone 3 hyperacetylation as well as increased NF-κB binding to the CINC-1 promoter. In conclusion, inactivation of HDAC caused by zinc deprivation is a novel mechanism underlying IL-8 up-regulation in alcoholic hepatitis. Copyright © 2011 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  15. Lipopolysaccharide-Induced Acute Kidney Injury Is Dependent on an IL-18 Receptor Signaling Pathway

    PubMed Central

    Nozaki, Yuji; Hino, Shoichi; Ri, Jinhai; Sakai, Kenji; Nagare, Yasuaki; Kawanishi, Mai; Niki, Kaoru; Funauchi, Masanori; Matsumura, Itaru

    2017-01-01

    The proinflammatory cytokine interleukin (IL)-18 is an important mediator of the organ failure induced by endotoxemia. IL-18 (known as an interferon-gamma (IFN-γ) inducing factor), and other inflammatory cytokines have important roles in lipopolysaccharide (LPS)-induced acute kidney injury (AKI). We investigated the effect of inflammatory cytokines and Toll-like receptor 4 (TLR4) expression, an event that is accompanied by an influx of monocytes, including CD4+ T cells and antigen-presenting cells (APCs) in IL-18Rα knockout (KO) mice and wild-type (WT) mice after LPS injection. In the acute advanced phase, the IL-18Rα KO mice showed a higher survival rate and a suppressed increase of blood urea nitrogen, increased levels of proinflammatory cytokines such as IFN-γ and IL-18, the infiltration of CD4+ T cells and the expression of kidney injury molecule-1 as an AKI marker. In that phase, the renal mRNA expression of the M1 macrophage phenotype and C-C chemokine receptor type 7 as the maturation marker of dendritic cells (DCs) was also significantly decreased in the IL-18Rα KO mice, although there were small numbers of F4/80+ cells and DCs in the kidney. Conversely, there were no significant differences in the expressions of mRNA and protein TLR4 after LPS injection between the WT and IL-18Rα KO groups. Our results demonstrated that the IL-18Rα-mediated signaling pathway plays critical roles in CD4+ T cells and APCs and responded more quickly to IFN-γ and IL-18 than TLR4 stimulation in the pathogenesis of LPS-induced AKI. PMID:29261164

  16. Components of Streptococcus pneumoniae suppress allergic airways disease and NKT cells by inducing regulatory T cells.

    PubMed

    Thorburn, Alison N; Foster, Paul S; Gibson, Peter G; Hansbro, Philip M

    2012-05-01

    Asthma is an allergic airways disease (AAD) caused by dysregulated immune responses and characterized by eosinophilic inflammation, mucus hypersecretion, and airway hyperresponsiveness (AHR). NKT cells have been shown to contribute to AHR in some mouse models. Conversely, regulatory T cells (Tregs) control aberrant immune responses and maintain homeostasis. Recent evidence suggests that Streptococcus pneumoniae induces Tregs that have potential to be harnessed therapeutically for asthma. In this study, mouse models of AAD were used to identify the S. pneumoniae components that have suppressive properties, and the mechanisms underlying suppression were investigated. We tested the suppressive capacity of type-3-polysaccharide (T3P), isolated cell walls, pneumolysoid (Ply) and CpG. When coadministered, T3P + Ply suppressed the development of: eosinophilic inflammation, Th2 cytokine release, mucus hypersecretion, and AHR. Importantly, T3P + Ply also attenuated features of AAD when administered during established disease. We show that NKT cells contributed to the development of AAD and also were suppressed by T3P + Ply treatment. Furthermore, adoptive transfer of NKT cells induced AHR, which also could be reversed by T3P + Ply. T3P + Ply-induced Tregs were essential for the suppression of NKT cells and AAD, which was demonstrated by Treg depletion. Collectively, our results show that the S. pneumoniae components T3P + Ply suppress AAD through the induction of Tregs that blocked the activity of NKT cells. These data suggest that S. pneumoniae components may have potential as a therapeutic strategy for the suppression of allergic asthma through the induction of Tregs and suppression of NKT cells.

  17. Glycolipids from spinach suppress LPS-induced vascular inflammation through eNOS and NK-κB signaling.

    PubMed

    Ishii, Masakazu; Nakahara, Tatsuo; Araho, Daisuke; Murakami, Juri; Nishimura, Masahiro

    2017-07-01

    Glycolipids are the major constituent of the thylakoid membrane of higher plants and have a variety of biological and pharmacological activities. However, anti-inflammatory effects of glycolipids on vascular endothelial cells have not been elucidated. Here, we investigated the effect of glycolipids extracted from spinach on lipopolysaccharides (LPS)-induced endothelial inflammation and evaluated the underlying molecular mechanisms. Treatment with glycolipids from spinach had no cytotoxic effects on cultured human umbilical vein endothelial cells (HUVECs) and significantly blocked the expression of LPS-induced interleukin (IL)-6, monocyte chemoattractant protein-1 (MCP-1), vascular cell adhesion molecule-1 (VCAM-1), and intracellular adhesion molecule-1 (ICAM-1) in them. Glycolipids treatment also effectively suppressed monocyte adhesion to HUVECs. Treatment with glycolipids inhibited LPS-induced NF-κB phosphorylation and nuclear translocation. In addition, glycolipids treatment significantly promoted endothelial nitric oxide synthase (eNOS) activation and nitric oxide (NO) production in HUVECs. Furthermore, glycolipids treatment blocked LPS-induced inducible NOS (iNOS) expression in HUVECs. Pretreatment with a NOS inhibitor attenuated glycolipids-induced suppression of NF-κB activation and adhesion molecule expression, and abolished the glycolipids-mediated suppression of monocyte adhesion to HUVECs. These results indicate that glycolipids suppress LPS-induced vascular inflammation through attenuation of the NF-κB pathway by increasing NO production in endothelial cells. These findings suggest that glycolipids from spinach may have a potential therapeutic use for inflammatory vascular diseases. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  18. Oral Escherichia coli Colonization Factor Antigen I (CFA/I) Fimbriae Ameliorate Arthritis via IL-35, not IL-27

    PubMed Central

    Kochetkova, Irina; Thornburg, Theresa; Callis, Gayle; Holderness, Kathryn; Maddaloni, Massimo; Pascual, David W.

    2014-01-01

    A Salmonella therapeutic expressing enterotoxigenic E. coli colonization factor antigen I (CFA/I) fimbriae protects against collagen-induced arthritis (CIA) by eliciting two regulatory T cell (Treg) subsets: TGF-β-producing Foxp3−CD39+CD4+ and IL-10-producing Foxp3+CD39+CD4+ T cells. However, it is unclear if CFA/I fimbriae alone are protective, and if other regulatory cytokines are involved especially in the context for the EBI3-sharing cytokines, Treg-derived IL-35 and APC-derived IL-27, both capable of suppressing Th17 cells and regulating autoimmune diseases. Subsequent evaluation revealed that a single oral dose of purified, soluble CFA/I fimbriae protected against CIA as effectively as Salmonella-CFA/I, and found Foxp3+CD39+CD4+ T cells as the source of secreted IL-35, whereas IL-27 production by CD11c+ cells was inhibited. Inquiring into their relevance, CFA/I fimbriae-treated IL-27 receptor-deficient (WSX-1−/−) mice were equally protected against CIA as wild-type mice suggesting a limited role for IL-27. In contrast, CFA/I fimbriae-mediated protection was abated in EBI3−/− mice accompanied by the loss of TGF-β- and IL-10-producing Tregs. Adoptive transfer of B6 CD39+CD4+ T cells to EBI3−/− mice with concurrent CFA/I plus IL-35 treatment effectively stimulated Tregs suppressing proinflammatory CII-specific Th cells. Opposingly, recipients co-transferred with B6 and EBI3−/− CD39+CD4+ T cells and treated with CFA/I plus IL-35 failed in protecting mice implicating the importance for endogenous IL-35 to confer CFA/I-mediated protection. Thus, CFA/I fimbriae stimulate IL-35 required for the co-induction of TGF-β and IL-10. PMID:24337375

  19. Type I IFN gene delivery suppresses regulatory T cells within tumors.

    PubMed

    Hashimoto, H; Ueda, R; Narumi, K; Heike, Y; Yoshida, T; Aoki, K

    2014-12-01

    Type I interferon (IFN) is a pleiotropic cytokine regulating the cancer cell death and immune response. IFN-α can, as we have also reported, effectively induce an antitumor immunity by the activation of tumor-specific T cells and maturation of dendritic cells in various animal models. Unknown, however, is how the type I IFN alters the immunotolerant microenvironment in the tumors. Here, we found that intratumoral IFN-α gene transfer significantly decreased the frequency of regulatory T cells (Tregs) per CD4(+) T cells in tumors. The concentration of a Treg-inhibitory cytokine, interleukin (IL)-6, was correlated with the IFN-α expression level in tumors, and intratumoral CD11c(+) cells produced IL-6 in response to IFN-α stimulation. To confirm the role of IL-6 in the suppression of Tregs in tumors, an anti-IL-6 receptor antibody was administered in IFN-α-treated mice. The antibody increased the frequency of Tregs in the tumors, and attenuated systemic tumor-specific immunity induced by IFN-α. Furthermore, the IFN-α-mediated IL-6 production increased the frequency of Th17 cells in the tumors, which may be one of the mechanisms for the reduction of Tregs. The study demonstrated that IFN-α gene delivery creates an environment strongly supporting the enhancement of antitumor immunity through the suppression of Tregs.

  20. Grain dust induces IL-8 production from bronchial epithelial cells: effect on neutrophil recruitment.

    PubMed

    Park, H S; Suh, J H; Kim, S S; Kwon, O J

    2000-06-01

    There have been several investigations suggesting an involvement of activated neutrophils in the development of grain dust (GD)-induced occupational asthma. Interleukin-8 in the sputa from GD-induced asthmatic patients increased significantly after the exposure to GD. To confirm IL-8 production from bronchial epithelial cells when exposed to GD, and to evaluate the role of IL-8 on neutrophil recruitment. We cultured Beas-2B, a bronchial epithelial cell line. To observe GD-induced responses, four different concentrations ranging from 1 to 200 microg/mL of GD were incubated for 24 hours and compared with those without incubation of GD. To evaluate the effect of pro-inflammatory cytokines on IL-8 production and neutrophil chemotaxis, epithelial cells were incubated with peripheral blood mononuclear cell (PBMC) culture supernatant derived from subjects with GD-induced asthma exposed to 10 microg/mL of GD, and then compared with those without addition of PBMC supernatant. The level of released IL-8 in the supernatant was measured by enzyme-linked immunosorbent assay. Neutrophil chemotactic activity of the culture supernatant was determined by modified Boyden chamber method. Interleukin-8 production and neutrophil chemotactic activity from bronchial epithelial cells significantly increased with additions of GD in a dose-dependent manner (P < .05, respectively), and were significantly augmented with additions of PBMC supernatant (P < .05, respectively) at each concentration. Close correlation was noted between neutrophil chemotactic activity and IL-8 level (r = 0.87, P < .05). Compared with the untreated sample, pre-treatment of anti-IL-8 antibody induced a significant suppression (up to 67.2%) of neutrophil chemotactic activity in a dose-dependent manner. These results suggest that IL-8 produced from bronchial epithelial cells may be a major cytokine, which induces neutrophil migration into the airways when exposed to GD.

  1. 7α-Hydroxycholesterol Elicits TLR6-Mediated Expression of IL-23 in Monocytic Cells.

    PubMed

    Seo, Hyun Chul; Kim, Sun-Mi; Eo, Seong-Kug; Rhim, Byung-Yong; Kim, Koanhoi

    2015-01-01

    We investigated the question of whether 7-oxygenated cholesterol derivatives could affect inflammatory and/or immune responses in atherosclerosis by examining their effects on expression of IL-23 in monocytic cells. 7α-Hydroxycholesterol (7αOHChol) induced transcription of the TLR6 gene and elevated the level of cell surface TLR6 protein in THP-1 monocytic cells. Addition of an agonist of TLR6, FSL-1, to TLR6-expressing cells by treatment with 7αOHChol resulted in enhanced production of IL-23 and transcription of genes encoding the IL-23 subunit α (p19) and the IL-12 subunit β (p40). However, treatment with 7-ketocholesterol (7K) and 7β-hydroxycholesterol (7βOHChol) did not affect TLR6 expression, and addition of FSL-1 to cells treated with either 7K or 7βOHChol did not influence transcription of the genes. Pharmacological inhibition of ERK, Akt, or PI3K resulted in attenuated transcription of TLR6 induced by 7αOHChol as well as secretion of IL-23 enhanced by 7αOHChol plus FSL-1. Inhibition of p38 MAPK or JNK resulted in attenuated secretion of IL-23. These results indicate that a certain type of 7-oxygenated cholesterol like 7αOHChol can elicit TLR6-mediated expression of IL-23 by monocytic cells via PI3K/Akt and MAPKs pathways.

  2. 7α-Hydroxycholesterol Elicits TLR6-Mediated Expression of IL-23 in Monocytic Cells

    PubMed Central

    Seo, Hyun Chul; Kim, Sun-Mi; Eo, Seong-Kug; Rhim, Byung-Yong; Kim, Koanhoi

    2015-01-01

    We investigated the question of whether 7-oxygenated cholesterol derivatives could affect inflammatory and/or immune responses in atherosclerosis by examining their effects on expression of IL-23 in monocytic cells. 7α-Hydroxycholesterol (7αOHChol) induced transcription of the TLR6 gene and elevated the level of cell surface TLR6 protein in THP-1 monocytic cells. Addition of an agonist of TLR6, FSL-1, to TLR6-expressing cells by treatment with 7αOHChol resulted in enhanced production of IL-23 and transcription of genes encoding the IL-23 subunit α (p19) and the IL-12 subunit β (p40). However, treatment with 7-ketocholesterol (7K) and 7β-hydroxycholesterol (7βOHChol) did not affect TLR6 expression, and addition of FSL-1 to cells treated with either 7K or 7βOHChol did not influence transcription of the genes. Pharmacological inhibition of ERK, Akt, or PI3K resulted in attenuated transcription of TLR6 induced by 7αOHChol as well as secretion of IL-23 enhanced by 7αOHChol plus FSL-1. Inhibition of p38 MAPK or JNK resulted in attenuated secretion of IL-23. These results indicate that a certain type of 7-oxygenated cholesterol like 7αOHChol can elicit TLR6-mediated expression of IL-23 by monocytic cells via PI3K/Akt and MAPKs pathways. PMID:25593648

  3. Radiation Inhibits Interleukin-12 Production via Inhibition of C-Rel through the Interleukin-6/ Signal Transducer and Activator of Transcription 3 Signaling Pathway in Dendritic Cells

    PubMed Central

    Lee, Eun-Jung; Lee, Seo Jin; Kim, Ji-Hye; Kim, Kyoung-Jin; Yang, Seung-Hyun; Jeong, Keun-Yeong; Seong, Jinsil

    2016-01-01

    Radiotherapy (RT) is a potent anti-tumor modality. However, unwanted effects including increased recurrence and metastasis that involve factors such as cytokines, which induce complex molecular mechanisms, have also been reported. In a previous study, we showed that interleukin (IL)-12 and radiotherapy combination treatment suppressed tumor growth and metastasis in a hepatoma mouse model. In this study, we investigated the mechanism underlying the IL-12 anti-tumor effect during radiotherapy. In tumor-bearing mice, irradiation decreased IL-12 expression in the tumors and spleens. However, a number of dendritic cells infiltrated into the tumors in which IL-12 expression did not decrease. To further study the underlying detailed mechanism for this decrease in IL-12, LPS-stimulated bone marrow–derived dendritic cells (BMDCs) were irradiated, and then IL-12– and IL-6–associated molecules were examined in irradiated tumors and BMDCs. Irradiation resulted in IL-12 suppression and IL-6 increase. IL-6 and signal transducer and activator of transcription 3 (STAT3) inhibitors restored the irradiation-induced IL-12 decrease via suppression of C-Rel activation. Taken together, our study suggests that irradiation-induced IL-6 can decrease IL-12 production through the inhibition of C-Rel phosphorylation by the IL-6/STAT3 signaling pathway. PMID:26745884

  4. Vitamin D ameliorates impaired wound healing in streptozotocin-induced diabetic mice by suppressing NF-κB-mediated inflammatory genes.

    PubMed

    Yuan, YiFeng; Das, Sushant K; Li, MaoQuan

    2018-04-27

    Diabetic wounds are characterized by delayed wound healing due to persistent inflammation and excessive production of reactive oxygen species. Vitamin D, which is well acknowledged to enhance intestinal calcium absorption and increase in plasma calcium level, has recently been shown to display beneficial effects in various vascular diseases by promoting angiogenesis and inhibiting inflammatory responses. However, the role of Vitamin D in diabetic wound healing is still unclear. In the present study, we investigated the role of Vitamin D in cutaneous wound healing in streptozotocin (STZ)-induced diabetic mice. Four weeks after injection of STZ, a full thickness excisional wound was created with a 6-mm diameter sterile biopsy punch on the dorsum of the mice. Vitamin D was given consecutively for 14 days by intraperitoneal injection. Vitamin D supplementation significantly accelerated wound healing in diabetic mice and improved the healing quality as assessed by measuring the wound closure rate and histomorphometric analyses. By monitoring the level of pro-inflammatory cytokines tumor necrosis factor-α ( TNF-α ), interleukin (IL) 6 ( IL-6 ), IL-1β ) in the wounds, reduced inflammatory response was found in VD treatment group. Furthermore, nuclear factor κB (NF-κB) pathway was found to be involved in the process of diabetic wound healing by assessing the relative proteins in diabetic wounds. Vitamin D supplementation obviously suppressed NF-κB pathway activation. These results demonstrated that Vitamin D improves impaired wound healing in STZ-induced diabetic mice through suppressing NF-κB-mediated inflammatory gene expression. © 2018 The Author(s).

  5. The Protective Effect of Intrasplenic Transplantation of Ad-IL-18BP/IL-4 Gene-Modified Fetal Hepatocytes on ConA-Induced Hepatitis in Mice

    PubMed Central

    Xu, Chenhuai; Hong, Bo; Xu, Wanhong; Shen, Ling; Jin, Changzhong; Wu, Zhigang; Tong, Xiangmin; Yao, Hangping

    2013-01-01

    Background Concanavalin A (ConA)-induced hepatitis is an experimental murine model mirroring the pathology of human autoimmune hepatitis. Aim To investigate the effects of intrasplenically transplanted fetal hepatocytes (BNL.CL2) transfected with recombinant adenovirus vector expressing the IL-18 binding protein (IL-18BP) and IL-4 fusion protein on ConA-induced hepatitis in mice. Methods Ad-IL-18BP/IL-4 was used to infect BNL.CL2 cells. IL-4 and IL-18BP fusion protein expression were detected by ELISA and Western blotting. BNL.CL2 cells infected with Ad-IL-18BP/IL-4 were intrasplenically transplanted into mice. After 10 days, mice were injected with ConA (15 mg/kg), and sacrificed 18 hours later. Liver injury was assessed by serum transaminase and liver histology. TNF-α, IL-18, IL-4, IL-10, IL-12p70 and monocyte-chemoattracting protein (MCP)-1 levels in serum and liver homogenates were detected by ELISA. Signaling molecules in liver homogenates were analyzed by Western blotting. Results Ad-IL-18BP/IL-4 effectively expressed the IL-18BP/IL-4 fusion protein for more than 14 days in BNL.CL12 cells. Treatment of mice with Ad-IL-18BP/IL-4-BNL.CL2 before ConA injection significantly reduced the elevated plasma levels of transaminases compared with ConA control groups. TNF-α, IL-18, IL-12p70 and MCP-1 levels in serum and liver homogenates from mice transplanted with Ad-IL-18BP/IL-4-BNL.CL2 were lower and IL-4 and IL-10 levels were higher than control groups. Phosphorylation levels of NF-κB p65, AKT, p38 and JNK1/2 in liver homogenates were markedly suppressed by Ad-IL-18BP/IL-4. Conclusions Ad-IL-18BP/IL-4 was effectively transfected into mouse BNL.CL2 cells. Intrasplenic transplantation of Ad-IL-18BP/IL-4-BNL.CL12 cells alleviated the severity of inflammation in ConA-induced experimental hepatitis and provides a useful basis for the targeted gene therapy of liver disease. PMID:23516562

  6. The protective effect of intrasplenic transplantation of Ad-IL-18BP/IL-4 gene-modified fetal hepatocytes on ConA-induced hepatitis in mice.

    PubMed

    Shao, Xueting; Qian, Yun; Xu, Chenhuai; Hong, Bo; Xu, Wanhong; Shen, Ling; Jin, Changzhong; Wu, Zhigang; Tong, Xiangmin; Yao, Hangping

    2013-01-01

    Concanavalin A (ConA)-induced hepatitis is an experimental murine model mirroring the pathology of human autoimmune hepatitis. To investigate the effects of intrasplenically transplanted fetal hepatocytes (BNL.CL2) transfected with recombinant adenovirus vector expressing the IL-18 binding protein (IL-18BP) and IL-4 fusion protein on ConA-induced hepatitis in mice. Ad-IL-18BP/IL-4 was used to infect BNL.CL2 cells. IL-4 and IL-18BP fusion protein expression were detected by ELISA and Western blotting. BNL.CL2 cells infected with Ad-IL-18BP/IL-4 were intrasplenically transplanted into mice. After 10 days, mice were injected with ConA (15 mg/kg), and sacrificed 18 hours later. Liver injury was assessed by serum transaminase and liver histology. TNF-α, IL-18, IL-4, IL-10, IL-12p70 and monocyte-chemoattracting protein (MCP)-1 levels in serum and liver homogenates were detected by ELISA. Signaling molecules in liver homogenates were analyzed by Western blotting. Ad-IL-18BP/IL-4 effectively expressed the IL-18BP/IL-4 fusion protein for more than 14 days in BNL.CL12 cells. Treatment of mice with Ad-IL-18BP/IL-4-BNL.CL2 before ConA injection significantly reduced the elevated plasma levels of transaminases compared with ConA control groups. TNF-α, IL-18, IL-12p70 and MCP-1 levels in serum and liver homogenates from mice transplanted with Ad-IL-18BP/IL-4-BNL.CL2 were lower and IL-4 and IL-10 levels were higher than control groups. Phosphorylation levels of NF-κB p65, AKT, p38 and JNK1/2 in liver homogenates were markedly suppressed by Ad-IL-18BP/IL-4. Ad-IL-18BP/IL-4 was effectively transfected into mouse BNL.CL2 cells. Intrasplenic transplantation of Ad-IL-18BP/IL-4-BNL.CL12 cells alleviated the severity of inflammation in ConA-induced experimental hepatitis and provides a useful basis for the targeted gene therapy of liver disease.

  7. Inhibition of Signal Transducer and Activator of Transcription 3 (STAT3) Attenuates Interleukin-6 (IL-6)-induced Collagen Synthesis and Resultant Hypertrophy in Rat Heart

    PubMed Central

    Mir, Saiful Anam; Chatterjee, Arunachal; Mitra, Arkadeep; Pathak, Kanchan; Mahata, Sushil K.; Sarkar, Sagartirtha

    2012-01-01

    IL-6 has been shown to play a major role in collagen up-regulation process during cardiac hypertrophy, although the precise mechanism is still not known. In this study we have analyzed the mechanism by which IL-6 modulates cardiac hypertrophy. For the in vitro model, IL-6-treated cultured cardiac fibroblasts were used, whereas the in vivo cardiac hypertrophy model was generated by renal artery ligation in adult male Wistar rats (Rattus norvegicus). During induction of hypertrophy, increased phosphorylation of STAT1, STAT3, MAPK, and ERK proteins was observed both in vitro and in vivo. Treatment of fibroblasts with specific inhibitors for STAT1 (fludarabine, 50 μm), STAT3 (S31-201, 10 μm), p38 MAPK (SB203580, 10 μm), and ERK1/2 (U0126, 10 μm) resulted in down-regulation of IL-6-induced phosphorylation of specific proteins; however, only S31-201 and SB203580 inhibited collagen biosynthesis. In ligated rats in vivo, only STAT3 inhibitors resulted in significant decrease in collagen synthesis and hypertrophy markers such as atrial natriuretic factor and β-myosin heavy chain. In addition, decreased heart weight to body weight ratio and improved cardiac function as measured by echocardiography was evident in animals treated with STAT3 inhibitor or siRNA. Compared with IL-6 neutralization, more pronounced down-regulation of collagen synthesis and regression of hypertrophy was observed with STAT3 inhibition, suggesting that STAT3 is the major downstream signaling molecule and a potential therapeutic target for cardiac hypertrophy. PMID:22157761

  8. IL-4/IL-13 Heteroreceptor Influences Th17 Cell Conversion and Sensitivity to Regulatory T Cell Suppression To Restrain Experimental Allergic Encephalomyelitis.

    PubMed

    Barik, Subhasis; Ellis, Jason S; Cascio, Jason A; Miller, Mindy M; Ukah, Tobechukwu K; Cattin-Roy, Alexis N; Zaghouani, Habib

    2017-10-01

    IL-4 and IL-13 have been defined as anti-inflammatory cytokines that can counter myelin-reactive T cells and modulate experimental allergic encephalomyelitis. However, it is not known whether endogenous IL-4 and IL-13 contribute to the maintenance of peripheral tolerance and whether their function is coordinated with T regulatory cells (Tregs). In this study, we used mice in which the common cytokine receptor for IL-4 and IL-13, namely the IL-4Rα/IL-13Rα1 (13R) heteroreceptor (HR), is compromised and determined whether the lack of signaling by endogenous IL-4 and IL-13 through the HR influences the function of effector Th1 and Th17 cells in a Treg-dependent fashion. The findings indicate that mice-deficient for the HR (13R -/- ) are more susceptible to experimental allergic encephalomyelitis than mice sufficient for the HR (13R +/+ ) and develop early onset and more severe disease. Moreover, Th17 cells from 13R -/- mice had reduced ability to convert to Th1 cells and displayed reduced sensitivity to suppression by Tregs relative to Th17 effectors from 13R +/+ mice. These observations suggest that IL-4 and IL-13 likely operate through the HR and influence Th17 cells to convert to Th1 cells and to acquire increased sensitivity to suppression, leading to control of immune-mediated CNS inflammation. These previously unrecognized findings shed light on the intricacies underlying the contribution of cytokines to peripheral tolerance and control of autoimmunity. Copyright © 2017 by The American Association of Immunologists, Inc.

  9. Salmon cartilage proteoglycan suppresses mouse experimental colitis through induction of Foxp3{sup +} regulatory T cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mitsui, Toshihito; Department of Digestive Surgery, Hirosaki University Graduate School of Medicine, Hirosaki, Aomori 036-8562; Sashinami, Hiroshi

    Research highlights: {yields} Salmon proteoglycan suppresses IL-10{sup -/-} cell transfer-induced colitis progression. {yields} Salmon proteoglycan suppresses Th1- and Th17-related factors in colitis mice. {yields} Salmon proteoglycan enhances Foxp3 expression. -- Abstract: Proteoglycans (PGs) are complex glycohydrates which are widely distributed in extracellular matrix (ECM). PGs are involved in the construction of ECM, cell proliferation and differentiation. ECM components are involved in transduction of proinflammatory responses, but it is still unknown whether PGs are involved in inflammatory response. In this study, we investigated the effect of PG extracted from salmon cartilage on the progression of experimental colitis-induced in severe combined immunodeficiencymore » mice by cell transfer from interleukin-10 (IL-10){sup -/-} mice. IL-10{sup -/-} cell-transferred mice showed weight loss, colon shortening and histological appearance of mild colitis. Daily oral administration of PG attenuated the clinical progression of colitis in a dose-dependent manner. Colitis-induced mice showed the elevated expression of IFN-{gamma}, IL-12, TNF-{alpha}, IL-21, IL-23p19, IL-6, IL-17A and retinoic acid-related orphan receptor {gamma}t (ROR{gamma}t) in lamina propria mononuclear cells (LPMCs) and oral administration of PG suppressed the expression of these factors. Conversely, expression of Foxp3 that induces CD4{sup +}CD25{sup +} regulatory T cells in LPMCs was enhanced by PG administration. These findings suggested that salmon PG attenuated the progression of colitis due to suppression of inflammatory response by enhancement of regulatory T cell induction.« less

  10. Sex Differences in the Relationship of IL-6 Signaling to Cancer Cachexia Progression

    PubMed Central

    Hetzler, Kimbell L.; Hardee, Justin P.; Puppa, Melissa J.; Narsale, Aditi A.; Sato, Shuichi; Davis, J. Mark; Carson, James A.

    2015-01-01

    A devastating aspect of cancer cachexia is severe loss of muscle and fat mass. Though cachexia occurs in both sexes, it is not well-defined in the female. The Apc Min/+ mouse is genetically predisposed to develop intestinal tumors; circulating IL-6 is a critical regulator of cancer cachexia in the male Apc Min/+ mouse. The purpose of this study was to examine the relationship between IL-6 signaling and cachexia progression in the female Apc Min/+ mouse. Male and female Apc Min/+ mice were examined during the initiation and progression of cachexia. Another group of females had IL-6 overexpressed between 12-14 weeks or 15-18 weeks of age to determine whether IL-6 could induce cachexia. Cachectic female Apc Min/+ mice lost body weight, muscle mass, and fat mass; increased muscle IL-6 mRNA expression was associated with these changes, but circulating IL-6 levels were not. Circulating IL-6 levels did not correlate with downstream signaling in muscle in the female. Muscle IL-6r mRNA expression and SOCS3 mRNA expression as well as muscle IL-6r protein and STAT3 phosphorylation increased with severe cachexia in both sexes. Muscle SOCS3 protein increased in cachectic females but decreased in cachectic males. IL-6 overexpression did not affect cachexia progression in female Apc Min/+ mice. Our results indicate that female Apc Min/+ mice undergo cachexia progression that is at least initially IL-6-independent. Future studies in the female will need to determine mechanisms underlying regulation of IL-6 response and cachexia induction. PMID:25555992

  11. Suppression of experimental myasthenia gravis, a B cell-mediated autoimmune disease, by blockade of IL-18.

    PubMed

    Im, S H; Barchan, D; Maiti, P K; Raveh, L; Souroujon, M C; Fuchs, S

    2001-10-01

    Interleukin-18 (IL-18) is a pleiotropic proinflammatory cytokine that plays an important role in interferon gamma (IFN-gamma) production and IL-12-driven Th1 phenotype polarization. Increased expression of IL-18 has been observed in several autoimmune diseases. In this study we have analyzed the role of IL-18 in an antibody-mediated autoimmune disease and elucidated the mechanisms involved in disease suppression mediated by blockade of IL-18, using experimental autoimmune myasthenia gravis (EAMG) as a model. EAMG is a T cell-regulated, antibody-mediated autoimmune disease in which the nicotinic acetylcholine receptor (AChR) is the major autoantigen. Th1- and Th2-type responses are both implicated in EAMG development. We show that treatment by anti-IL-18 during ongoing EAMG suppresses disease progression. The protective effect can be adoptively transferred to naive recipients and is mediated by increased levels of the immunosuppressive Th3-type cytokine TGF-beta and decreased AChR-specific Th1-type cellular responses. Suppression of EAMG is accompanied by down-regulation of the costimulatory factor CD40L and up-regulation of CTLA-4, a key negative immunomodulator. Our results suggest that IL-18 blockade may potentially be applied for immunointervention in myasthenia gravis.

  12. A Common Variant of IL-6R is Associated with Elevated IL-6 Pathway Activity in Alzheimer's Disease Brains.

    PubMed

    Haddick, Patrick C G; Larson, Jessica L; Rathore, Nisha; Bhangale, Tushar R; Phung, Qui T; Srinivasan, Karpagam; Hansen, David V; Lill, Jennie R; Pericak-Vance, Margaret A; Haines, Jonathan; Farrer, Lindsay A; Kauwe, John S; Schellenberg, Gerard D; Cruchaga, Carlos; Goate, Alison M; Behrens, Timothy W; Watts, Ryan J; Graham, Robert R; Kaminker, Joshua S; van der Brug, Marcel

    2017-01-01

    The common p.D358A variant (rs2228145) in IL-6R is associated with risk for multiple diseases and with increased levels of soluble IL-6R in the periphery and central nervous system (CNS). Here, we show that the p.D358A allele leads to increased proteolysis of membrane bound IL-6R and demonstrate that IL-6R peptides with A358 are more susceptible to cleavage by ADAM10 and ADAM17. IL-6 responsive genes were identified in primary astrocytes and microglia and an IL-6 gene signature was increased in the CNS of late onset Alzheimer's disease subjects in an IL6R allele dependent manner. We conducted a screen to identify variants associated with the age of onset of Alzheimer's disease in APOE ɛ4 carriers. Across five datasets, p.D358A had a meta P = 3 ×10-4 and an odds ratio = 1.3, 95% confidence interval 1.12 -1.48. Our study suggests that a common coding region variant of the IL-6 receptor results in neuroinflammatory changes that may influence the age of onset of Alzheimer's disease in APOE ɛ4 carriers.

  13. Three-Dimensional Conformal Radiotherapy in Prostate Cancer Patients: Rise in Interleukin 6 (IL-6) but not IL-2, IL-4, IL-5, Tumor Necrosis Factor-{alpha}, MIP-1-{alpha}, and LIF Levels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oliveira Lopes, Carlos; Callera, Fernando, E-mail: fcallera@gmail.com

    Purpose: To investigate the effect of radiotherapy (RT) on serum levels of interleukin-2 (IL-2), IL-4, IL-5, IL-6, tumor necrosis factor alpha (TNF-{alpha}), macrophage inflammatory protein-1-alpha (MIP-1-{alpha}) and leukemia inhibitory factor (LIF) in patients with prostate cancer. Methods and Materials: Forty eight patients with prostate cancer received three-dimensional conformal blocking radiation therapy with a linear accelerator. IL-2, IL-4, IL-5, IL-6, TNF-{alpha}, MIP-1-{alpha}, and LIF levels were measured by the related immunoassay kit 1 day before the beginning of RT and during RT at days 15 and 30. Results: The mean IL-2 values were elevated before and during the RT in contrastmore » with those of IL-4, IL-5, IL-6, TNF-{alpha}, MIP-1-{alpha}, and LIF, which were within the normal range under the same conditions. Regarding markers IL-2, IL-4, IL-5, TNF-{alpha}, MIP-1-{alpha}, and LIF, comparisons among the three groups (before treatment and 15 and 30 days during RT) did not show significant differences. Although values were within the normal range, there was a significant rise in IL-6 levels at day 15 of RT (p = 0.0049) and a decline at day 30 to levels that were similar to those observed before RT. Conclusions: IL-6 appeared to peak after 15 days of RT before returning to pre-RT levels. In contrast, IL-2, IL-4, IL-5, TNF-{alpha}, MIP-1-{alpha}, and LIF levels were not sensitive to irradiation. The increased levels of IL-6 following RT without the concurrent elevation of other cytokines involved in the acute phase reaction did not suggest a classical inflammatory response to radiation exposure. Further studies should be designed to elucidate the role of IL-6 levels in patients with prostate cancer treated with RT.« less

  14. Association between Interlukin-6 (IL-6), Interlukin-10 (IL-10) and depression in patients undergoing Hematopoietic stem cell transplantation

    PubMed Central

    Tavakoli-Ardakani, Maria; Mehrpooya, Maryam; Mehdizadeh, Mahshid; Hajifathali, Abbas; Abdolahi, Alireza

    2015-01-01

    Background: The release of pro-inflammatory cytokines is responsible for the variety of behavioral, neuro-endocrine and neuro-chemical alterations in psychiatric condition. In this study we evaluate relation between depression and IL-6 and IL-10 in patients undergoing hematopoietic stem cell transplantation (HSCT). Materials and Methods: 66 patients in this cross-sectional study from July 2013 until August 2014 for HSCT interred the study and were assessed for depression using Hospital Anxiety and Depression Scale (HADS). Serum interleukin (IL)-6, (IL)-10 and high sensitive C-reactive protein (hs-CRP) were assessed on the same time. Association between these biomarkers with depression was evaluated using SPSS version 20. Results: A total of 66 patients with the mean age of 41.18+13.92 and 41.95+12.35 years old in non depressed and depressed group respectively were enrolled in this study. Patients with depression showed significantly higher levels of serum IL-6 and the IL-6-to-IL-10 ratio compared to patients without depression (p<0.001).There was no statistically significant association between IL-10 and hs-CRP with depression in this group of the patients. Conclusions: High IL-6 level has significant association with depression in patients undergoing HSCT. In conclusion, since IL-6 can affect the outcomes after HSCT and depression was associated with increased serum IL-6 level, early identification of depression can be beneficial in these patients. PMID:25922648

  15. Chlamydia abortus Pmp18.1 Induces IL-1β Secretion by TLR4 Activation through the MyD88, NF-κB, and Caspase-1 Signaling Pathways

    PubMed Central

    Pan, Qing; Zhang, Qiang; Chu, Jun; Pais, Roshan; Liu, Shanshan; He, Cheng; Eko, Francis O.

    2017-01-01

    The polymorphic membrane protein D (Pmp18D) is a 160-kDa outer membrane protein that is conserved and plays an important role in Chlamydia abortus pathogenesis. We have identified an N-terminal fragment of Pmp18D (designated Pmp18.1) as a possible subunit vaccine antigen. In this study, we evaluated the vaccine potential of Pmp18.1 by investigating its ability to induce innate immune responses in dendritic cells and the signaling pathway(s) involved in rPmp18.1-induced IL-1β secretion. We next investigated the immunomodulatory impact of VCG, in comparison with the more established Th1-promoting adjuvants, CpG and FL, on rPmp18.1-mediated innate immune activation. Finally, the effect of siRNA targeting TLR4, MyD88, NF-κB p50, and Caspase-1 mRNA in DCs on IL-1β cytokine secretion was also investigated. Bone marrow-derived dendritic cells (BMDCs) were stimulated with rPmp18.1 in the presence or absence of VCG or CpG or FL and the magnitude of cytokines produced was assessed using a multiplex cytokine ELISA assay. Expression of costimulatory molecules and Toll-like receptors (TLRs) was analyzed by flow cytometry. Quantitation of intracellular levels of myeloid differentiation factor 88 (MyD88), nuclear factor kappa beta (NF-κB p50/p65), and Caspase-1 was evaluated by Western immunoblotting analysis while NF-κB p65 nuclear translocation was assessed by confocal microscopy. The results showed DC stimulation with rPmp18.1 provoked the secretion of proinflammatory cytokines and upregulated expression of TLRs and co-stimulatory molecules associated with DC maturation. These responses were significantly (p ≤ 0.001) enhanced by VCG but not CpG or FL. In addition, rPmp18.1 activated the expression of MyD88, NF-κB p50, and Caspase-1 as well as the nuclear expression of NF-κB p65 in treated DCs. Furthermore, targeting TLR4, MyD88, NF-κB p50, and Caspase-1 mRNA in BMDCs with siRNA significantly reduced their expression levels, resulting in decreased IL-1β cytokine

  16. CYLD Enhances Severe Listeriosis by Impairing IL-6/STAT3-Dependent Fibrin Production

    PubMed Central

    Nishanth, Gopala; Deckert, Martina; Wex, Katharina; Massoumi, Ramin; Schweitzer, Katrin; Naumann, Michael; Schlüter, Dirk

    2013-01-01

    The facultative intracellular bacterium Listeria monocytogenes (Lm) may cause severe infection in humans and livestock. Control of acute listeriosis is primarily dependent on innate immune responses, which are strongly regulated by NF-κB, and tissue protective factors including fibrin. However, molecular pathways connecting NF-κB and fibrin production are poorly described. Here, we investigated whether the deubiquitinating enzyme CYLD, which is an inhibitor of NF-κB-dependent immune responses, regulated these protective host responses in murine listeriosis. Upon high dose systemic infection, all C57BL/6 Cyld−/− mice survived, whereas 100% of wildtype mice succumbed due to severe liver pathology with impaired pathogen control and hemorrhage within 6 days. Upon in vitro infection with Lm, CYLD reduced NF-κB-dependent production of reactive oxygen species, interleukin (IL)-6 secretion, and control of bacteria in macrophages. Furthermore, Western blot analyses showed that CYLD impaired STAT3-dependent fibrin production in cultivated hepatocytes. Immunoprecipitation experiments revealed that CYLD interacted with STAT3 in the cytoplasm and strongly reduced K63-ubiquitination of STAT3 in IL-6 stimulated hepatocytes. In addition, CYLD diminished IL-6-induced STAT3 activity by reducing nuclear accumulation of phosphorylated STAT3. In vivo, CYLD also reduced hepatic STAT3 K63-ubiquitination and activation, NF-κB activation, IL-6 and NOX2 mRNA production as well as fibrin production in murine listeriosis. In vivo neutralization of IL-6 by anti-IL-6 antibody, STAT3 by siRNA, and fibrin by warfarin treatment, respectively, demonstrated that IL-6-induced, STAT3-mediated fibrin production significantly contributed to protection in Cyld−/− mice. In addition, in vivo Cyld siRNA treatment increased STAT3 phosphorylation, fibrin production, pathogen control and survival of Lm-infected WT mice illustrating that therapeutic inhibition of CYLD augments the protective NF-κB/IL

  17. CYLD enhances severe listeriosis by impairing IL-6/STAT3-dependent fibrin production.

    PubMed

    Nishanth, Gopala; Deckert, Martina; Wex, Katharina; Massoumi, Ramin; Schweitzer, Katrin; Naumann, Michael; Schlüter, Dirk

    2013-01-01

    The facultative intracellular bacterium Listeria monocytogenes (Lm) may cause severe infection in humans and livestock. Control of acute listeriosis is primarily dependent on innate immune responses, which are strongly regulated by NF-κB, and tissue protective factors including fibrin. However, molecular pathways connecting NF-κB and fibrin production are poorly described. Here, we investigated whether the deubiquitinating enzyme CYLD, which is an inhibitor of NF-κB-dependent immune responses, regulated these protective host responses in murine listeriosis. Upon high dose systemic infection, all C57BL/6 Cyld(-/-) mice survived, whereas 100% of wildtype mice succumbed due to severe liver pathology with impaired pathogen control and hemorrhage within 6 days. Upon in vitro infection with Lm, CYLD reduced NF-κB-dependent production of reactive oxygen species, interleukin (IL)-6 secretion, and control of bacteria in macrophages. Furthermore, Western blot analyses showed that CYLD impaired STAT3-dependent fibrin production in cultivated hepatocytes. Immunoprecipitation experiments revealed that CYLD interacted with STAT3 in the cytoplasm and strongly reduced K63-ubiquitination of STAT3 in IL-6 stimulated hepatocytes. In addition, CYLD diminished IL-6-induced STAT3 activity by reducing nuclear accumulation of phosphorylated STAT3. In vivo, CYLD also reduced hepatic STAT3 K63-ubiquitination and activation, NF-κB activation, IL-6 and NOX2 mRNA production as well as fibrin production in murine listeriosis. In vivo neutralization of IL-6 by anti-IL-6 antibody, STAT3 by siRNA, and fibrin by warfarin treatment, respectively, demonstrated that IL-6-induced, STAT3-mediated fibrin production significantly contributed to protection in Cyld(-/-) mice. In addition, in vivo Cyld siRNA treatment increased STAT3 phosphorylation, fibrin production, pathogen control and survival of Lm-infected WT mice illustrating that therapeutic inhibition of CYLD augments the protective NF-κB/IL

  18. UP-REGULATION OF IL-6, IL-8 AND CCL2 GENE EXPRESSION AFTER ACUTE INFLAMMATION: CORRELATION TO CLINICAL PAIN

    PubMed Central

    Wang, Xiao-Min; Hamza, May; Wu, Tai-Xia; Dionne, Raymond A.

    2012-01-01

    Tissue injury initiates a cascade of inflammatory mediators and hyperalgesic substances including prostaglandins, cytokines and chemokines. Using microarray and qRT-PCR gene expression analyses, the present study evaluated changes in gene expression of a cascade of cytokines following acute inflammation and the correlation between the changes in the gene expression level and pain intensity in the oral surgery clinical model of acute inflammation. Tissue injury resulted in a significant up-regulation in the gene expression of Interleukin-6 (IL-6; 63.3-fold), IL-8 (8.1-fold), chemokine (C-C motif) ligand 2 (CCL2; 8.9-fold), chemokine (C-X-C motif) ligand 1 (CXCL1; 30.5-fold), chemokine (C-X-C motif) ligand 2 (CXCL2; 26-fold) and annexin A1 (ANXA1; 12-fold). The up-regulation of IL-6 gene expression was significantly correlated to the up-regulation on the gene expression of IL-8, CCL2, CXCL1 and CXCL2. Interestingly, the tissue injury induced up-regulation of IL-6 gene expression, IL-8 and CCL2 were positively correlated to pain intensity at 3 hours post-surgery, the onset of acute inflammatory pain. However, ketorolac treatment did not have a significant effect on the gene expression of IL-6, IL-8, CCL2, CXCL2 and ANXA1 at the same time point of acute inflammation. These results demonstrate that up-regulation of IL-6, IL-8 and CCL2 gene expression contributes to the development of acute inflammation and inflammatory pain. The lack of effect for ketorolac on the expression of these gene products may be related to the ceiling analgesic effects of non-steroidal anti-inflammatory drugs. PMID:19233564

  19. GLP-1 secretion is increased by inflammatory stimuli in an IL-6-dependent manner, leading to hyperinsulinemia and blood glucose lowering.

    PubMed

    Kahles, Florian; Meyer, Christina; Möllmann, Julia; Diebold, Sebastian; Findeisen, Hannes M; Lebherz, Corinna; Trautwein, Christian; Koch, Alexander; Tacke, Frank; Marx, Nikolaus; Lehrke, Michael

    2014-10-01

    Hypoglycemia and hyperglycemia are both predictors for adverse outcome in critically ill patients. Hyperinsulinemia is induced by inflammatory stimuli as a relevant mechanism for glucose lowering in the critically ill. The incretine hormone GLP-1 was currently found to be induced by endotoxin, leading to insulin secretion and glucose lowering under inflammatory conditions in mice. Here, we describe GLP-1 secretion to be increased by a variety of inflammatory stimuli, including endotoxin, interleukin-1β (IL-1β), and IL-6. Although abrogation of IL-1 signaling proved insufficient to prevent endotoxin-dependent GLP-1 induction, this was abolished in the absence of IL-6 in respective knockout animals. Hence, we found endotoxin-dependent GLP-1 secretion to be mediated by an inflammatory cascade, with IL-6 being necessary and sufficient for GLP-1 induction. Functionally, augmentation of the GLP-1 system by pharmacological inhibition of DPP-4 caused hyperinsulinemia, suppression of glucagon release, and glucose lowering under endotoxic conditions, whereas inhibition of the GLP-1 receptor led to the opposite effect. Furthermore, total GLP-1 plasma levels were profoundly increased in 155 critically ill patients presenting to the intensive care unit (ICU) in comparison with 134 healthy control subjects. In the ICU cohort, GLP-1 plasma levels correlated with markers of inflammation and disease severity. Consequently, GLP-1 provides a novel link between the immune system and the gut with strong relevance for metabolic regulation in context of inflammation. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  20. Antibody classes & subclasses induced by mucosal immunization of mice with Streptococcus pyogenes M6 protein & oligodeoxynucleotides containing CpG motifs.

    PubMed

    Teloni, R; von Hunolstein, C; Mariotti, S; Donati, S; Orefici, G; Nisini, R

    2004-05-01

    Type-specific antibodies against M protein are critical for human protection as they enhance phagocytosis and are protective. An ideal vaccine for the protection against Streptococcus pyogenes would warrant mucosal immunity, but mucosally administered M-protein has been shown to be poorly immunogenic in animals. We used a recombinant M type 6 protein to immunize mice in the presence of synthetic oligodeoxynucleotides containing CpG motifs (immunostimulatory sequences: ISS) or cholera toxin (CT) to explore its possible usage in a mucosal vaccine. Mice were immunized by intranasal (in) or intradermal (id) administration with four doses at weekly intervals of M6-protein (10 microg/mouse) with or without adjuvant (ISS, 10 microg/mouse or CT, 0,5 microg/mouse). M6 specific antibodies were measured by enzyme linked immunosorbent assay using class and subclass specific monoclonal antibodies. The use of ISS induced an impressive anti M-protein serum IgG response but when id administered was not detectable in the absence of adjuvant. When used in, M-protein in the presence of both ISS and CT induced anti M-protein IgA in the bronchoalveolar lavage, as well as specific IgG in the serum. IgG were able to react with serotype M6 strains of S. pyogenes. The level of antibodies obtained by immunizing mice in with M-protein and CT was higher in comparison to M-protein and ISS. The analysis of anti-M protein specific IgG subclasses showed high levels of IgG1, IgG2a and IgG2b, and low levels of IgG3 when ISS were used as adjuvant. Thus, in the presence of ISS, the ratio IgG2a/IgG1 and (IgG2a+IgG3)/IgG1 >1 indicated a type 1-like response obtained both in mucosally or systemically vaccinated mice. Our study offers a reproducible model of anti-M protein vaccination that could be applied to test new antigenic formulations to induce an anti-group A Streptococcus (GAS) vaccination suitable for protection against the different diseases caused by this bacterium.

  1. Cellular mechanisms of IL-17-induced blood-brain barrier disruption.

    PubMed

    Huppert, Jula; Closhen, Dorothea; Croxford, Andrew; White, Robin; Kulig, Paulina; Pietrowski, Eweline; Bechmann, Ingo; Becher, Burkhard; Luhmann, Heiko J; Waisman, Ari; Kuhlmann, Christoph R W

    2010-04-01

    Recently T-helper 17 (Th17) cells were demonstrated to disrupt the blood-brain barrier (BBB) by the action of IL-17A. The aim of the present study was to examine the mechanisms that underlie IL-17A-induced BBB breakdown. Barrier integrity was analyzed in the murine brain endothelial cell line bEnd.3 by measuring the electrical resistance values using electrical call impedance sensing technology. Furthermore, in-cell Western blots, fluorescence imaging, and monocyte adhesion and transendothelial migration assays were performed. Experimental autoimmune encephalomyelitis (EAE) was induced in C57BL/6 mice. IL-17A induced NADPH oxidase- or xanthine oxidase-dependent reactive oxygen species (ROS) production. The resulting oxidative stress activated the endothelial contractile machinery, which was accompanied by a down-regulation of the tight junction molecule occludin. Blocking either ROS formation or myosin light chain phosphorylation or applying IL-17A-neutralizing antibodies prevented IL-17A-induced BBB disruption. Treatment of mice with EAE using ML-7, an inhibitor of the myosin light chain kinase, resulted in less BBB disruption at the spinal cord and less infiltration of lymphocytes via the BBB and subsequently reduced the clinical characteristics of EAE. These observations indicate that IL-17A accounts for a crucial step in the development of EAE by impairing the integrity of the BBB, involving augmented production of ROS.-Huppert, J., Closhen, D., Croxford, A., White, R., Kulig, P., Pietrowski, E., Bechmann, I., Becher, B., Luhmann, H. J., Waisman, A., Kuhlmann, C. R. W. Cellular mechanisms of IL-17-induced blood-brain barrier disruption.

  2. Gene expression profiling of chicken cecal tonsils and ileum following oral exposure to soluble and PLGA-encapsulated CpG ODN, and lysate of Campylobacter jejuni.

    PubMed

    Taha-Abdelaziz, Khaled; Alkie, Tamiru Negash; Hodgins, Douglas C; Yitbarek, Alexander; Shojadoost, Bahram; Sharif, Shayan

    2017-12-01

    Campylobacter jejuni (C. jejuni) is a leading bacterial cause of food-borne illness in humans. Contaminated chicken meat is an important source of infection for humans. Chickens are not clinically affected by colonization, and immune responses following natural infection have limited effects on bacterial load in the gut. Induction of intestinal immune responses may possibly lead to a breakdown of the commensal relationship of chickens with Campylobacter. We have recently shown that soluble and poly D, L-lactic-co-glycolic acid (PLGA)-encapsulated CpG oligodeoxynucleotide (ODN) as well as C. jejuni lysate, are effective in reducing the intestinal burden of C. jejuni in chickens; however, the mechanisms behind this protection have yet to be determined. The present study was undertaken to investigate the mechanisms of host responses conferred by these treatments. Chickens were treated orally with soluble CpG ODN, or PLGA-encapsulated CpG ODN, or C. jejuni lysate, and expression of cytokines and antimicrobial peptides was evaluated in cecal tonsils and ileum using quantitative RT-PCR. Oral administration of soluble CpG ODN upregulated the expression of interferon (IFN)-γ, interleukin (IL)-1β, CXCLi2, transforming growth factor (TGF)-β4/1, IL-10 and IL-13, while treatment with PLGA-encapsulated CpG ODN upregulated the expression of IL-1β, CXCLi2, TGF-β4/1, IL-13, avian β-defensin (AvBD) 1, AvBD2 and cathelicidin 3 (CATHL-3). C. jejuni lysate upregulated the expression of IFN-γ, IL-1β, TGF-β4/1, IL-13, AvBD1, and CATHL-3. In conclusion, induction of cytokine and antimicrobial peptides expression in intestinal microenvironments may provide a means of reducing C. jejuni colonization in broiler chickens, a key step in reducing the incidence of campylobacteriosis in humans. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Differential production of immunoglobulin classes and subclasses by mucosal-type human B-lymphocytes exposed in vitro to CpG oligodeoxynucleotides.

    PubMed

    Cognasse, Fabrice; Acquart, Sophie; Beniguel, Lydie; Sabido, Odile; Chavarin, Patricia; Genin, Christian; Garraud, Olivier

    2005-01-01

    As B-lymphocytes play an important role in innate and adaptive immunity, we aimed to examine the effects of CpG oligodeoxynucleotides (ODNs) on purified tonsil-originating CD19+ B-cells, representing mucosal B-cells. We screened various K-type ODNs, reactive with human B-cells, and tested for the production of immunoglobulins in vitro. Using one CpG-ODN, DSP30, we observed that it could upregulate not only Toll-like receptor 9 (TLR9) mRNA expression in activated B-cells, but also the early expression of CD69 followed by the sequential expression of CD80, CD86 and the nuclear factor (NF)-kappaB pathway. Furthermore, mRNA expression of certain B-cell-derived cytokines was influenced by exposure to DSP30, with a strong upregulation of interleukin 6 (IL-6) and downregulation of IL1-beta. Stimulation of B-cells, co-stimulated with IL-2, IL-10 and soluble CD40 ligand (sCD40L) with different CpG-ODNs, had differing effects on the terminal differentiation in vitro of B-cells into immunoglobulin-secreting cells. TLR9 is involved in innate immunity and the recognition of bound CpG DNA from invading bacterial pathogens. As tonsillar B-cells are mucosal-type B-lymphocytes, this study suggests that CpG-ODNs show promise as mucosal adjuvants in modulating the local production of immunoglobulins of certain classes and subclasses, a crucial issue in vaccine perspectives.

  4. Association study of functional polymorphisms in interleukins and interleukin receptors genes: IL1A, IL1B, IL1RN, IL6, IL6R, IL10, IL10RA and TGFB1 in schizophrenia in Polish population.

    PubMed

    Kapelski, Pawel; Skibinska, Maria; Maciukiewicz, Malgorzata; Wilkosc, Monika; Frydecka, Dorota; Groszewska, Agata; Narozna, Beata; Dmitrzak-Weglarz, Monika; Czerski, Piotr; Pawlak, Joanna; Rajewska-Rager, Aleksandra; Leszczynska-Rodziewicz, Anna; Slopien, Agnieszka; Zaremba, Dorota; Twarowska-Hauser, Joanna

    2015-12-01

    Schizophrenia has been associated with a large range of autoimmune diseases, with a history of any autoimmune disease being associated with a 45% increase in risk for the illness. The inflammatory system may trigger or modulate the course of schizophrenia through complex mechanisms influencing neurodevelopment, neuroplasticity and neurotransmission. In particular, increases or imbalance in cytokine before birth or during the early stages of life may affect neurodevelopment and produce vulnerability to the disease. A total of 27 polymorphisms of IL1N gene: rs1800587, rs17561; IL1B gene: rs1143634, rs1143643, rs16944, rs4848306, rs1143623, rs1143633, rs1143627; IL1RN gene: rs419598, rs315952, rs9005, rs4251961; IL6 gene: rs1800795, rs1800797; IL6R gene: rs4537545, rs4845617, rs2228145, IL10 gene: rs1800896, rs1800871, rs1800872, rs1800890, rs6676671; IL10RA gene: rs2229113, rs3135932; TGF1B gene: rs1800469, rs1800470; each selected on the basis of molecular evidence for functionality, were investigated in this study. Analysis was performed on a group of 621 patients with diagnosis of schizophrenia and 531 healthy controls in Polish population. An association of rs4848306 in IL1B gene, rs4251961 in IL1RN gene, rs2228145 and rs4537545 in IL6R with schizophrenia have been observed. rs6676671 in IL10 was associated with early age of onset. Strong linkage disequilibrium was observed between analyzed polymorphisms in each gene, except of IL10RA. We observed that haplotypes composed of rs4537545 and rs2228145 in IL6R gene were associated with schizophrenia. Analyses with family history of schizophrenia, other psychiatric disorders and alcohol abuse/dependence did not show any positive findings. Further studies on larger groups along with correlation with circulating protein levels are needed. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Prevention of Hypovolemic Circulatory Collapse by IL-6 Activated Stat3

    PubMed Central

    Tsimelzon, Anna I.; Mastrangelo, Mary-Ann A.; Hilsenbeck, Susan G.; Poli, Valeria; Tweardy, David J.

    2008-01-01

    Half of trauma deaths are attributable to hypovolemic circulatory collapse (HCC). We established a model of HCC in rats involving minor trauma plus severe hemorrhagic shock (HS). HCC in this model was accompanied by a 50% reduction in peak acceleration of aortic blood flow and cardiomyocyte apoptosis. HCC and apoptosis increased with increasing duration of hypotension. Apoptosis required resuscitation, which provided an opportunity to intervene therapeutically. Administration of IL-6 completely reversed HCC, prevented cardiac dysfunction and cardiomyocyte apoptosis, reduced mortality 5-fold and activated intracardiac signal transducer and activator of transcription (STAT) 3. Pre-treatment of rats with a selective inhibitor of Stat3, T40214, reduced the IL-6-mediated increase in cardiac Stat3 activity, blocked successful resuscitation by IL-6 and reversed IL-6-mediated protection from cardiac apoptosis. The hearts of mice deficient in the naturally occurring dominant negative isoform of Stat3, Stat3β, were completely resistant to HS-induced apoptosis. Microarray analysis of hearts focusing on apoptosis related genes revealed that expression of 29% of apoptosis related genes was altered in HS vs. sham rats. IL-6 treatment normalized the expression of these genes, while T40214 pretreatment prevented IL-6-mediated normalization. Thus, cardiac dysfunction, cardiomyocyte apoptosis and induction of apoptosis pathway genes are important components of HCC; IL-6 administration prevented HCC by blocking cardiomyocyte apoptosis and induction of apoptosis pathway genes via Stat3 and warrants further study as a resuscitation adjuvant for prevention of HCC and death in trauma patients. PMID:18270592

  6. Deletion of interleukin-6 alleviated interstitial fibrosis in streptozotocin-induced diabetic cardiomyopathy of mice through affecting TGFβ1 and miR-29 pathways.

    PubMed

    Zhang, Yang; Wang, Jing-Hao; Zhang, Yi-Yuan; Wang, Ying-Zhe; Wang, Jin; Zhao, Yue; Jin, Xue-Xin; Xue, Gen-Long; Li, Peng-Hui; Sun, Yi-Lin; Huang, Qi-He; Song, Xiao-Tong; Zhang, Zhi-Ren; Gao, Xu; Yang, Bao-Feng; Du, Zhi-Min; Pan, Zhen-Wei

    2016-03-14

    Interleukin 6 (IL-6) has been shown to be an important regulator of cardiac interstitial fibrosis. In this study, we explored the role of interleukin-6 in the development of diabetic cardiomyopathy and the underlying mechanisms. Cardiac function of IL-6 knockout mice was significantly improved and interstitial fibrosis was apparently alleviated in comparison with wildtype (WT) diabetic mice induced by streptozotocin (STZ). Treatment with IL-6 significantly promoted the proliferation and collagen production of cultured cardiac fibroblasts (CFs). High glucose treatment increased collagen production, which were mitigated in CFs from IL-6 KO mice. Moreover, IL-6 knockout alleviated the up-regulation of TGFβ1 in diabetic hearts of mice and cultured CFs treated with high glucose or IL-6. Furthermore, the expression of miR-29 reduced upon IL-6 treatment, while increased in IL-6 KO hearts. Overexpression of miR-29 blocked the pro-fibrotic effects of IL-6 on cultured CFs. In summary, deletion of IL-6 is able to mitigate myocardial fibrosis and improve cardiac function of diabetic mice. The mechanism involves the regulation of IL-6 on TGFβ1 and miR-29 pathway. This study indicates the therapeutic potential of IL-6 suppression on diabetic cardiomyopathy disease associated with fibrosis.

  7. Curcumin Suppresses IL-1β Secretion and Prevents Inflammation through Inhibition of the NLRP3 Inflammasome.

    PubMed

    Yin, Haipeng; Guo, Qiang; Li, Xin; Tang, Tiantian; Li, Cuiling; Wang, Hengxiao; Sun, Yuanxin; Feng, Qi; Ma, Chunhong; Gao, Chengjiang; Yi, Fan; Peng, Jun

    2018-04-15

    Turmeric is traditionally used as a spice and coloring in foods. Curcumin is the primary active ingredient in the turmeric, and compelling evidence has shown that it has the ability to inhibit inflammation. However, the mechanism mediating its anti-inflammatory effects are not fully understood. We report that curcumin inhibited caspase-1 activation and IL-1β secretion through suppressing LPS priming and the inflammasome activation pathway in mouse bone marrow-derived macrophages. The inhibitory effect of curcumin on inflammasome activation was specific to the NLRP3, not to the NLRC4 or the AIM2 inflammasomes. Curcumin inhibited the NLRP3 inflammasome by preventing K + efflux and disturbing the downstream events, including the efficient spatial arrangement of mitochondria, ASC oligomerization, and speckle formation. Reactive oxygen species, autophagy, sirtuin-2, or acetylated α-tubulin was ruled out as the mechanism by which curcumin inhibits the inflammasome. Importantly, in vivo data show that curcumin attenuated IL-1β secretion and prevented high-fat diet-induced insulin resistance in wide-type C57BL/6 mice but not in Nlrp3 -deficient mice. Curcumin also repressed monosodium urate crystal-induced peritoneal inflammation in vivo. Taken together, we identified curcumin as a common NLRP3 inflammasome activation inhibitor. Our findings reveal a mechanism through which curcumin represses inflammation and suggest the potential clinical use of curcumin in NLRP3-driven diseases. Copyright © 2018 by The American Association of Immunologists, Inc.

  8. Expression and functional characterization of killer whale (Orcinus orca) interleukin-6 (IL-6) and development of a competitive immunoassay.

    PubMed

    Funke, Christina; King, Donald P; McBain, Jim F; Adelung, Dieter; Stott, Jeffrey L

    2003-05-30

    Interleukin-6 (IL-6) is a cytokine that can reach detectable systemic levels and is a major inducer of the acute phase response. As such, clinical assays to identify this cytokine in mammalian sera are of diagnostic value. A 558 base-pair (bp) fragment of killer whale IL-6 was cloned and expressed as a 21 kDa protein in Escherichia coli. Biological activity of the recombinant killer whale IL-6 (rkwIL-6) was demonstrated using the IL-6-dependent B9 mouse hybridoma cell line; acute phase sera from a killer whale and supernatants from lipopolysaccharide (LPS)-stimulated killer whale peripheral blood mononuclear cells (PBMCs) also supported the proliferation of the B9 hybridoma. Rat anti-mouse IL-6 receptor antibody effectively blocked biological activity of all three sources of IL-6. Polyclonal antisera, specific for the recombinant protein, were obtained by successive immunization of a rabbit with rkwIL-6. The polyclonal antibody was capable of neutralizing the biological activity of both recombinant and native kwIL-6. A competitive enzyme-linked immunosorbent assay (ELISA) was developed using the polyclonal rabbit anti-rkwIL-6 and the recombinant protein; sensitivity of the assay was in the range of 1 ng/ml. The ELISA was subsequently used to identify the presence of native IL-6 in acute phase sera of two species of delphinidae, a killer whale and a bottlenose dolphin. The application of quantitative cytokine assays as diagnostic tools for monitoring cetacean health are becoming feasible as many animals are now being trained for fluke presentation, making blood collection a routine procedure.

  9. The IL-6/JAK/Stat3 feed-forward loop drives tumorigenesis and metastasis.

    PubMed

    Chang, Qing; Bournazou, Eirini; Sansone, Pasquale; Berishaj, Marjan; Gao, Sizhi Paul; Daly, Laura; Wels, Jared; Theilen, Till; Granitto, Selena; Zhang, Xinmin; Cotari, Jesse; Alpaugh, Mary L; de Stanchina, Elisa; Manova, Katia; Li, Ming; Bonafe, Massimiliano; Ceccarelli, Claudio; Taffurelli, Mario; Santini, Donatella; Altan-Bonnet, Gregoire; Kaplan, Rosandra; Norton, Larry; Nishimoto, Norihiro; Huszar, Dennis; Lyden, David; Bromberg, Jacqueline

    2013-07-01

    We have investigated the importance of interleukin-6 (IL-6) in promoting tumor growth and metastasis. In human primary breast cancers, increased levels of IL-6 were found at the tumor leading edge and positively correlated with advanced stage, suggesting a mechanistic link between tumor cell production of IL-6 and invasion. In support of this hypothesis, we showed that the IL-6/Janus kinase (JAK)/signal transducer and activator of transcription 3 (Stat3) pathway drives tumor progression through the stroma and metastatic niche. Overexpression of IL-6 in tumor cell lines promoted myeloid cell recruitment, angiogenesis, and induced metastases. We demonstrated the therapeutic potential of interrupting this pathway with IL-6 receptor blockade or by inhibiting its downstream effectors JAK1/2 or Stat3. These clinically relevant interventions did not inhibit tumor cell proliferation in vitro but had profound effects in vivo on tumor progression, interfering broadly with tumor-supportive stromal functions, including angiogenesis, fibroblast infiltration, and myeloid suppressor cell recruitment in both the tumor and pre-metastatic niche. This study provides the first evidence for IL-6 expression at the leading edge of invasive human breast tumors and demonstrates mechanistically that IL-6/JAK/Stat3 signaling plays a critical and pharmacologically targetable role in orchestrating the composition of the tumor microenvironment that promotes growth, invasion, and metastasis.

  10. Decreased IL-10 production mediated by Toll-like receptor 9 in B cells in multiple sclerosis.

    PubMed

    Hirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Kikuchi, Seiji; Yabe, Ichiro; Hamada, Shinsuke; Tajima, Yasutaka; Sasaki, Hidenao

    2010-04-15

    The complexity of the roles of Toll-like receptors (TLRs) is attributable to their ability to promote or suppress autoimmune diseases. Recent studies have demonstrated that B cells regulate autoimmune diseases, including multiple sclerosis (MS), by producing interleukin (IL)-10. By using CpG DNA as a TLR9 agonist, we investigated the immunoregulatory functions of B cell via TLR9 in MS. Our results indicate that TLR9-mediated IL-10 production by B cells was significantly decreased in MS, and this decrease is likely due to decreased TLR9 expression in memory B cells, suggesting a role of TLR9 in immunoregulation in MS. Copyright 2010 Elsevier B.V. All rights reserved.

  11. Intranuclear interactomic inhibition of NF-κB suppresses LPS-induced severe sepsis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, Sung-Dong; Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749; Cheon, So Yeong

    Suppression of nuclear factor-κB (NF-κB) activation, which is best known as a major regulator of innate and adaptive immune responses, is a potent strategy for the treatment of endotoxic sepsis. To inhibit NF-κB functions, we designed the intra-nuclear transducible form of transcription modulation domain (TMD) of RelA (p65), called nt-p65-TMD, which can be delivered effectively into the nucleus without influencing the cell viability, and work as interactomic inhibitors via disruption of the endogenous p65-mediated transcription complex. nt-p65-TMD effectively inhibited the secretion of pro-inflammatory cytokines, including TNF-α, IL-1β, or IL-6 from BV2 microglia cells stimulated by lipopolysaccharide (LPS). nt-p65-TMD did notmore » inhibit tyrosine phosphorylation of signaling mediators such as ZAP-70, p38, JNK, or ERK involved in T cell activation, but was capable of suppressing the transcriptional activity of NF-κB without the functional effect on that of NFAT upon T-cell receptor (TCR) stimulation. The transduced nt-p65-TMD in T cell did not affect the expression of CD69, however significantly inhibited the secretion of T cell-specific cytokines such as IL-2, IFN-γ, IL-4, IL-17A, or IL-10. Systemic administration of nt-p65-TMD showed a significant therapeutic effect on LPS-induced sepsis model by inhibiting pro-inflammatory cytokines secretion. Therefore, nt-p65-TMD can be a novel therapeutics for the treatment of various inflammatory diseases, including sepsis, where a transcription factor has a key role in pathogenesis, and further allows us to discover new functions of p65 under normal physiological condition without genetic alteration. - Highlights: • The nt-p65-TMD is intra-nuclear interactomic inhibitor of endogenous p65. • The nt-p65-TMD effectively inhibited the secretion of pro-inflammatory cytokines. • The excellent therapeutic potential of nt-p65-TMD was confirmed in sepsis model.« less

  12. Suppressive effects of ketamine on macrophage functions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang Yi; Department of Anesthesiology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan; Chen, T.-L.

    2005-04-01

    Ketamine is an intravenous anesthetic agent. Clinically, induction of anesthesia with ketamine can cause immunosuppression. Macrophages play important roles in host defense. In this study, we attempted to evaluate the effects of ketamine on macrophage functions and its possible mechanism using mouse macrophage-like Raw 264.7 cells as the experimental model. Exposure of macrophages to 10 and 100 {mu}M ketamine, which correspond to 0.1 and 1 times the clinically relevant concentration, for 1, 6, and 24 h had no effect on cell viability or lactate dehydrogenase release. When the administered concentration reached 1000 {mu}M, ketamine caused a release of lactate dehydrogenasemore » and cell death. Ketamine, at 10 and 100 {mu}M, did not affect the chemotactic activity of macrophages. Administration of 1000 {mu}M ketamine in macrophages resulted in a decrease in cell migration. Treatment of macrophages with ketamine reduced phagocytic activities. The oxidative ability of macrophages was suppressed by ketamine. Treatment with lipopolysaccharide induced TNF-{alpha}, IL-1{beta}, and IL-6 mRNA in macrophages. Administration of ketamine alone did not influence TNF-{alpha}, IL-1{beta}, or IL-6 mRNA production. Meanwhile, cotreatment with ketamine and lipopolysaccharide significantly inhibited lipopolysaccharide-induced TNF-{alpha}, IL-1{beta}, and IL-6 mRNA levels. Exposure to ketamine led to a decrease in the mitochondrial membrane potential. However, the activity of mitochondrial complex I NADH dehydrogenase was not affected by ketamine. This study shows that a clinically relevant concentration of ketamine (100 {mu}M) can suppress macrophage function of phagocytosis, its oxidative ability, and inflammatory cytokine production possibly via reduction of the mitochondrial membrane potential instead of direct cellular toxicity.« less

  13. Single administration of recombinant IL-6 restores the gene expression of lipogenic enzymes in liver of fasting IL-6-deficient mice.

    PubMed

    Gavito, A L; Cabello, R; Suarez, J; Serrano, A; Pavón, F J; Vida, M; Romero, M; Pardo, V; Bautista, D; Arrabal, S; Decara, J; Cuesta, A L; Valverde, A M; Rodríguez de Fonseca, F; Baixeras, E

    2016-03-01

    Lipogenesis is intimately controlled by hormones and cytokines as well as nutritional conditions. IL-6 participates in the regulation of fatty acid metabolism in the liver. We investigated the role of IL-6 in mediating fasting/re-feeding changes in the expression of hepatic lipogenic enzymes. Gene and protein expression of lipogenic enzymes were examined in livers of wild-type (WT) and IL-6-deficient (IL-6(-/-) ) mice during fasting and re-feeding conditions. Effects of exogenous IL-6 administration on gene expression of these enzymes were evaluated in vivo. The involvement of STAT3 in mediating these IL-6 responses was investigated by using siRNA in human HepG2 cells. During feeding, the up-regulation in the hepatic expression of lipogenic genes presented similar time kinetics in WT and IL-6(-/-) mice. During fasting, expression of lipogenic genes decreased gradually over time in both strains, although the initial drop was more marked in IL-6(-/-) mice. Protein levels of hepatic lipogenic enzymes were lower in IL-6(-/-) than in WT mice at the end of the fasting period. In WT, circulating IL-6 levels paralleled gene expression of hepatic lipogenic enzymes. IL-6 administration in vivo and in vitro showed that IL-6-mediated signalling was associated with the up-regulation of hepatic lipogenic enzyme genes. Moreover, silencing STAT3 in HepG2 cells attenuated IL-6 mediated up-regulation of lipogenic gene transcription levels. IL-6 sustains levels of hepatic lipogenic enzymes during fasting through activation of STAT3. Our findings indicate that clinical use of STAT3-associated signalling cytokines, particularly against steatosis, should be undertaken with caution. © 2016 The British Pharmacological Society.

  14. Metformin Inhibits Advanced Glycation End Products-Induced Inflammatory Response in Murine Macrophages Partly through AMPK Activation and RAGE/NFκB Pathway Suppression

    PubMed Central

    Zhou, Zhong'e; Tang, Yong; Chen, Chengjun; Lu, Yi; Liu, Liang

    2016-01-01

    Advanced glycation end products (AGEs) are major inflammatory mediators in diabetes, affecting atherosclerosis progression via macrophages. Metformin slows diabetic atherosclerosis progression through mechanisms that remain to be fully elucidated. The present study of murine bone marrow derived macrophages showed that (1) AGEs enhanced proinflammatory cytokines (interleukin-1β (IL-1β), IL-6, and tumor necrosis factor-α (TNF-α)) mRNA expression, RAGE expression, and NFκB activation; (2) metformin pretreatment inhibited AGEs effects and AGEs-induced cluster designation 86 (CD86) (M1 marker) expression, while promoting CD206 (M2 marker) surface expression and anti-inflammatory cytokine (IL-10) mRNA expression; and (3) the AMPK inhibitor, Compound C, attenuated metformin effects. In conclusion, metformin inhibits AGEs-induced inflammatory response in murine macrophages partly through AMPK activation and RAGE/NFκB pathway suppression. PMID:27761470

  15. Anti-inflammatory activity of Pistacia lentiscus essential oil: involvement of IL-6 and TNF-alpha.

    PubMed

    Maxia, Andrea; Sanna, Cinzia; Frau, Maria Assunta; Piras, Alessandra; Karchuli, Manvendra Singh; Kasture, Veena

    2011-10-01

    The topical anti-inflammatory activity of essential oil of Pistacia lentiscus L. was studied using carrageenan induced rat paw edema and cotton pellet induced granuloma. The effect on serum tumor necrosis factor-alpha (TNF-alpha) and interleukin-6 (IL-6) in rats inserted with cotton pellet was also investigated. On topical application, the oil exhibited a significant decrease in paw edema. The oil also inhibited cotton pellet-induced granuloma, and reduced serum TNF-alpha and IL-6. It can be concluded that the essential oil of Pistacia lentiscus reduces leukocyte migration to the damaged tissue and exhibits anti-inflammatory activity.

  16. Structural impact of complete CpG methylation within target DNA on specific complex formation of the inducible transcription factor Egr-1.

    PubMed

    Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji

    2015-07-08

    The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  17. IL-17 suppresses immune effector functions in human papillomavirus-associated epithelial hyperplasia.

    PubMed

    Gosmann, Christina; Mattarollo, Stephen R; Bridge, Jennifer A; Frazer, Ian H; Blumenthal, Antje

    2014-09-01

    Persistent infection with high-risk human papillomaviruses (HPV) causes epithelial hyperplasia that can progress to cancer and is thought to depend on immunosuppressive mechanisms that prevent viral clearance by the host. IL-17 is a cytokine with diverse functions in host defense and in the pathology of autoimmune disorders, chronic inflammatory diseases, and cancer. We analyzed biopsies from patients with HPV-associated cervical intraepithelial neoplasia grade 2/3 and murine skin displaying HPV16 E7 protein-induced epithelial hyperplasia, which closely models hyperplasia in chronic HPV lesions. Expression of IL-17 and IL-23, a major inducer of IL-17, was elevated in both human HPV-infected and murine E7-expressing lesions. Using a skin-grafting model, we demonstrated that IL-17 in HPV16 E7 transgenic skin grafts inhibited effective host immune responses against the graft. IL-17 was produced by CD3(+) T cells, predominantly CD4(+) T cells in human, and CD4(+) and γδ T cells in mouse hyperplastic lesions. IL-23 and IL-1β, but not IL-18, induced IL-17 production in E7 transgenic skin. Together, these findings demonstrate an immunosuppressive role for IL-17 in HPV-associated epithelial hyperplasia and suggest that blocking IL-17 in persistent viral infection may promote antiviral immunity and prevent progression to cancer. Copyright © 2014 by The American Association of Immunologists, Inc.

  18. Haloperidol Suppresses NF-kappaB to Inhibit Lipopolysaccharide-Induced Pro-Inflammatory Response in RAW 264 Cells

    PubMed Central

    Yamamoto, Shunsuke; Ohta, Noriyuki; Matsumoto, Atsuhiro; Horiguchi, Yu; Koide, Moe; Fujino, Yuji

    2016-01-01

    Background Haloperidol, a tranquilizing agent, is administered both to treat symptoms of psychotic disorders and to sedate agitated and delirious patients. Notably, haloperidol has been suggested to inhibit the immune response through unknown mechanisms. We hypothesized that the sedative modulates the immune response via NF-κB. Material/Methods Using flow cytometry, we analyzed the effects of haloperidol on expression CD80 and CD86 in RAW 264 cells and in primary macrophages derived from bone marrow. Secretion of interleukin (IL)-1β, IL-6, and IL-12 p40 was measured by enzyme-linked immunosorbent assay. In addition, NF-κB activation was evaluated using a reporter assay based on secretory embryonic alkaline phosphatase. Finally, synthetic antagonists were used to identify the dopamine receptor that mediates the effects of haloperidol. Results Haloperidol inhibited NF-κB activation, and thereby suppressed expression of CD80, as well as secretion of IL-1β, IL-6, and IL-12 p40. CD80 and IL-6 levels were similarly attenuated by a D2-like receptor antagonist, but not by a D1-like receptor antagonist. Conclusions The data strongly suggest that haloperidol inhibits the immune response by suppressing NF-κB signaling via the dopamine D2 receptor. PMID:26842661

  19. Haloperidol Suppresses NF-kappaB to Inhibit Lipopolysaccharide-Induced Pro-Inflammatory Response in RAW 264 Cells.

    PubMed

    Yamamoto, Shunsuke; Ohta, Noriyuki; Matsumoto, Atsuhiro; Horiguchi, Yu; Koide, Moe; Fujino, Yuji

    2016-02-04

    BACKGROUND Haloperidol, a tranquilizing agent, is administered both to treat symptoms of psychotic disorders and to sedate agitated and delirious patients. Notably, haloperidol has been suggested to inhibit the immune response through unknown mechanisms. We hypothesized that the sedative modulates the immune response via NF-κB. MATERIAL AND METHODS Using flow cytometry, we analyzed the effects of haloperidol on expression CD80 and CD86 in RAW 264 cells and in primary macrophages derived from bone marrow. Secretion of interleukin (IL)-1β, IL-6, and IL-12 p40 was measured by enzyme-linked immunosorbent assay. In addition, NF-κB activation was evaluated using a reporter assay based on secretory embryonic alkaline phosphatase. Finally, synthetic antagonists were used to identify the dopamine receptor that mediates the effects of haloperidol. RESULTS Haloperidol inhibited NF-κB activation, and thereby suppressed expression of CD80, as well as secretion of IL-1β, IL-6, and IL-12 p40. CD80 and IL-6 levels were similarly attenuated by a D2-like receptor antagonist, but not by a D1-like receptor antagonist. CONCLUSIONS The data strongly suggest that haloperidol inhibits the immune response by suppressing NF-kB signaling via the dopamine D2 receptor.

  20. Differential Effects of IL6 and Activin A in the Development of Cancer-Associated Cachexia.

    PubMed

    Chen, Justin L; Walton, Kelly L; Qian, Hongwei; Colgan, Timothy D; Hagg, Adam; Watt, Matthew J; Harrison, Craig A; Gregorevic, Paul

    2016-09-15

    Cachexia is a life-threatening wasting syndrome lacking effective treatment, which arises in many cancer patients. Although ostensibly induced by multiple tumor-produced cytokines (tumorkines), their functional contribution to initiation and progression of this syndrome has proven difficult to determine. In this study, we used adeno-associated viral vectors to elevate circulating levels of the tumorkines IL6 and/or activin A in animals in the absence of tumors as a tactic to evaluate hypothesized roles in cachexia development. Mice with elevated levels of IL6 exhibited 8.1% weight loss after 9 weeks, whereas mice with elevated levels of activin A lost 11% of their body weight. Co-elevation of both tumorkines to levels approximating those observed in cancer cachexia models induced a more rapid and profound body weight loss of 15.4%. Analysis of body composition revealed that activin A primarily triggered loss of lean mass, whereas IL6 was a major mediator of fat loss. Histologic and transcriptional analysis of affected organs/tissues (skeletal muscle, fat, and liver) identified interactions between the activin A and IL6 signaling pathways. For example, IL6 exacerbated the detrimental effects of activin A in skeletal muscle, whereas activin A curbed the IL6-induced acute-phase response in liver. This study presents a useful model to deconstruct cachexia, opening a pathway to determining which tumorkines are best targeted to slow/reverse this devastating condition in cancer patients. Cancer Res; 76(18); 5372-82. ©2016 AACR. ©2016 American Association for Cancer Research.

  1. Suppressive Effect of the n-Hexane Extract of Litsea japonica Fruit Flesh on Monosodium-Iodoacetate-Induced Osteoarthritis in Rats.

    PubMed

    Kim, Seung-Hyung; Choi, Hye-Jin; Yang, Won-Kyung; Lee, Ji-Eun; Cho, Ju-Hyun; Park, In-Jae; Park, Sunyoung; Park, Bo-Kyung; Jin, Mirim

    2017-01-01

    We examined the antiosteoarthritic effect of the n-hexane extract of Litsea japonica fruit flesh (LJF-HE) in a rat model of monosodium-iodoacetate- (MIA-) induced osteoarthritis. LJF-HE significantly reduced the difference in weight-bearing capabilities of the hind paws between healthy and MIA-treated rats. Histological examination of the knee joints indicated that LJF-HE suppressed cartilage and bone destruction. Additionally, there were decreases in the expression of matrix metalloproteinase-2 and metalloproteinase-9 and cyclooxygenase-2 in the joints. The serum levels of deoxypyridinoline (DPD) and osteocalcin, which are markers of bone metabolism, also decreased. Furthermore, LJF-HE significantly suppressed infiltration of inflammatory cells into the synovium and inhibited the expression of proinflammatory cytokines such as tumor necrosis factor- (TNF-) α , interleukin- (IL-) 1, and IL-6 in the joints and serum. The serum levels of leukotriene B4 and lipoxygenase were also significantly lowered by LJF-HE. Finally, LJF-HE inhibited the production of nitric oxide, prostaglandin E2, IL-6, and TNF- α in lipopolysaccharide-activated macrophages, which might be associated with inhibited phosphorylation of p38 mitogen-activated protein kinase and c-Jun N-terminal kinase. Our data suggest that LJF-HE has an anti-inflammatory effect and may have potential as an antiosteoarthritic agent.

  2. Irisin-mediated protective effect on LPS-induced acute lung injury via suppressing inflammation and apoptosis of alveolar epithelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shao, Lei; Jinan Central Hospital Affiliated to Shandong University, Jinan 250012; Meng, Di

    It is considered that the essence of acute lung injury (ALI) is an excessive and uncontrolled inflammatory response in lung, of which mainly is attributed to the release of inflammatory mediators. Recent studies demonstrated that irisin, which is a metabolism associated factor after physical exercise could suppression of inflammation by regulating cellular signaling pathways, however, the underlying molecular mechanism remains to be determined. The present study aimed to reveal the potential mechanism responsible for the anti-inflammatory effects of irisin on LPS-induced acute lung injury in mice and in A549 cells. The results of histopathological changes showed that irisin ameliorated the lungmore » injury that was induced by LPS in time- and dose-dependent manner. QRT-PCR assays demonstrated that irisin suppressed the production of IL-1β, IL-6, MCP-1 and TNF-α, and western blot assays demonstrated that irisin suppressed apoptosis of ALI. The expression of caspase-3 and Bax were decreased and Bcl-2 was increased by irisin administration. Further study was conducted on nuclear factor (NF)-κB and mitogen-activated protein kinase (MAPK) using pathways using western blots. The results showed that irisin inhibited reduced LPS-induced activation of MAPK and NF-κB signaling. All results indicated that irisin has protective effect on LPS-induced ALI in mice and in A549 cells. Thus, irisn related with physical exercise may be a potential therapy for the treatment of pulmonary inflammation. - Highlights: • Irisin inhibited the inflammation reactivity of cells and pathological changes of LPS-induced lung injury in mice. • Irisin inhibited mRNA expression of inflammatory cytokines induced by LPS in A549 cells. • Irisin inhibited apoptosis induced by LPS in the injured lung. • Irisin reduced LPS-induced activation of MAPK and NF-κB signaling pathways.« less

  3. β-Glucans in food modify colonic microflora by inducing antimicrobial protein, calprotectin, in a Dectin-1-induced-IL-17F-dependent manner.

    PubMed

    Kamiya, T; Tang, C; Kadoki, M; Oshima, K; Hattori, M; Saijo, S; Adachi, Y; Ohno, N; Iwakura, Y

    2018-05-01

    Dectin-1 (gene symbol: Clec7a) is a receptor for β-glucans that play an important role for the host defense against fungi. Recently, we showed that Clec7a -/- mice are resistant against dextran sodium sulfate (DSS)-induced colitis because of regulatory T-cell population expansion in the colon. The regulatory T-cell expansion is caused by expansion of commensal Lactobacillus murinus whose growth is suppressed by an antimicrobial protein, calprotectin S100A8/A9. In this report, we showed that S100A8 was mainly produced by mouse colonic epithelial cells. S100A8 was not induced directly by Dectin-1 but by Dectin-1-induced cytokines, especially interleukin-17F (IL-17F), that were produced by several types of innate immune cells including CD11c + /CD11b + myeloid cells in colonic lamina propria. S100A8/A9 heterodimer preferentially suppressed the growth of L. murinus that was increased in both Clec7a -/- and Il17f -/- mice. Furthermore, similar expansion of L. murinus and DSS-colitis resistance were observed in mice fed with β-glucan-free food. These observations suggest that food-derived β-glucans control the specific commensal microbiota via the Dectin-1-IL-17F-calprotectin axis to maintain the intestinal homeostasis.

  4. Baicalin Attenuates IL-17-Mediated Acetaminophen-Induced Liver Injury in a Mouse Model

    PubMed Central

    Liao, Chia-Chih; Day, Yuan-Ji; Lee, Hung-Chen; Liou, Jiin-Tarng; Chou, An-Hsun; Liu, Fu-Chao

    2016-01-01

    Background IL-17 has been shown to be involved in liver inflammatory disorders in both mice and humans. Baicalin (BA), a major compound extracted from traditional herb medicine (Scutellariae radix), has potent hepatoprotective properties. Previous study showed that BA inhibits IL-17-mediated lymphocyte adhesion and downregulates joint inflammation. The aim of this study is to investigate the role of IL-17 in the hepatoprotective effects of BA in an acetaminophen (APAP)-induced liver injury mouse model. Methods Eight weeks male C57BL/6 (B6) mice were used for this study. Mice received intraperitoneal hepatotoxic injection of APAP (300 mg/kg) and after 30 min of injection, the mice were treated with BA at a concentration of 30 mg/kg. After 16 h of treatment, mice were killed. Blood samples and liver tissues were harvested for analysis of liver injury parameters. Results APAP overdose significantly increased the serum alanine transferase (ALT) levels, hepatic activities of myeloperoxidase (MPO), expression of cytokines (TNF-α, IL-6, and IL-17), and malondialdehyde (MDA) activity when compared with the control animals. BA treatment after APAP administration significantly attenuated the elevation of these parameters in APAP-induced liver injury mice. Furthermore, BA treatment could also decrease hepatic IL-17-producing γδT cells recruitment, which was induced after APAP overdose. Conclusion Our data suggested that baicalin treatment could effectively decrease APAP-induced liver injury in part through attenuation of hepatic IL-17 expression. These results indicate that baicalin is a potential hepatoprotective agent. PMID:27855209

  5. Effects of linear polarized infrared light irradiation on the transcriptional regulation of IL-8 expression in IL-1beta-stimulated human rheumatoid synoviocytes involves phosphorylation of the NF-kappaB RelA subunit.

    PubMed

    Shibata, Yasuko; Araki, Hidefumi; Oshitani, Toshiyuki; Imaoka, Asayo; Matsui, Masaru; Miyazawa, Keiji; Abiko, Yoshimitsu

    2009-03-03

    Although recent clinical studies have shown that laser therapy acts as an anti-inflammatory effector in the treatment of some diseases, little is known about the mechanism by which it acts in rheumatoid arthritis (RA) patients. The purpose of our work was to examine how irradiation with linear polarized infrared light (LPIL) suppresses inflammatory responses in the MH7A rheumatoid fibroblast-like synoviocyte cell line. We initially confirmed the effects of two disease-modifying anti-rheumatic treatments, LPIL irradiation and dexamethasone (Dex) administration, under experimental inflammatory conditions using gene chip technology. We found that LPIL exerted a smaller effect on gene transcription than Dex; however, IL-1beta-inducible target genes such as the CXCL type chemokines IL-8, IL-1beta and IL-6 were all clearly suppressed by LPIL to the same degree as by Dex. We also found that IL-1beta-induced release of IL-8 from MH7A cells was completely blocked by pretreatment with the (IL-8) inhibitor Bay11-7085, indicating that activation of NF-kappaB signaling plays an important role in the secretion of IL-8. Although the levels of NFKB1 and RELA transcription were unaffected by IL-1beta stimulation, phosphorylation of RelA S276 was suppressed by both LPIL and Dex. Thus LPIL likely exerts its anti-inflammatory effects by inhibiting the release of the inflammatory chemokine IL-8. A fuller understanding of the anti-inflammatory mechanism of LPIL in rheumatoid synoviocytes could serve as the basis for improved treatment of RA patients in the future.

  6. Th-17 regulatory cytokines IL-21, IL-23, and IL-6 enhance neutrophil production of IL-17 cytokines during asthma.

    PubMed

    Halwani, Rabih; Sultana, Asma; Vazquez-Tello, Alejandro; Jamhawi, Amer; Al-Masri, Abeer A; Al-Muhsen, Saleh

    2017-11-01

    In a subset of severe asthma patients, chronic airway inflammation is associated with infiltration of neutrophils, Th-17 cells and elevated expression of Th-17-derived cytokines (e.g., interleukin [IL]-17, IL-21, IL-22). Peripheral neutrophils from allergic asthmatics are known to express higher IL-17 cytokine levels than those from healthy subjects, but the regulatory mechanisms involved are not well understood. We hypothesize that Th-17 regulatory cytokines could modulate IL-17 expression in neutrophils. Peripheral blood neutrophils isolated from asthmatics were stimulated with IL-21, IL-23, and IL-6 cytokines and their ability to produce IL-17A and IL-17F was determined relative to healthy controls. Signal transducer and activator of transcription 3 (STAT3) phosphorylation levels were measured in stimulated neutrophil using flow cytometry. The requirement for STAT3 phosphorylation was determined by blocking its activation using a specific chemical inhibitor. Stimulating asthmatic neutrophils with IL-21, 23, and 6 enhanced the production of IL-17A and IL-17F at significantly higher levels comparatively to healthy controls. Stimulating neutrophils with IL-21, IL-23, and IL-6 cytokines enhanced STAT3 phosphorylation, in all cases. Interestingly, inhibiting STAT3 phosphorylation using a specific chemical inhibitor dramatically blocked the ability of neutrophils to produce IL-17, demonstrating that STAT3 activation is the major factor mediating IL-17 gene expression. These findings suggest that neutrophil infiltration in lungs of severe asthmatics may represent an important source of pro-inflammatory IL-17A and -F cytokines, a production enhanced by Th-17 regulatory cytokines, and thus providing a feedback mechanism that sustains inflammation. Our results suggest that STAT3 pathway could be a potential target for regulating neutrophilic inflammation during severe asthma.

  7. IL-6 modulates hepatocyte proliferation via induction of HGF/p21{sup cip1}: Regulation by SOCS3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun Rui; Jaruga, Barbara; Kulkarni, Shailin

    2005-12-30

    The precise role of IL-6 in liver regeneration and hepatocyte proliferation is controversial and the role of SOCS3 in liver regeneration remains unknown. Here we show that in vitro treatment with IL-6 inhibited primary mouse hepatocyte proliferation. IL-6 induced p21{sup cip1} protein expression in primary mouse hepatocytes. Disruption of the p21{sup cip1} gene abolished the inhibitory effect of IL-6 on cell proliferation. Co-culture with nonparenchymal liver cells diminished IL-6 inhibition of hepatocyte proliferation, which was likely due to IL-6 stimulation of nonparenchymal cells to produce HGF. Finally, IL-6 induced higher levels of p21{sup cip1} protein expression and a slightly strongermore » inhibition of cell proliferation in SOCS3{sup +/-} mouse hepatocytes compared to wild-type hepatocytes, while liver regeneration was enhanced and prolonged in SOCS3{sup +/-} mice. Our findings suggest that IL-6 directly inhibits hepatocyte proliferation via a p21{sup cip1}-dependent mechanism and indirectly enhances hepatocyte proliferation via stimulating nonparenchymal cells to produce HGF. SOCS3 negatively regulates liver regeneration.« less

  8. Fermented Herbal Formulas KIOM-MA128 Ameliorate IL-6-Induced Intestinal Barrier Dysfunction in Colon Cancer Cell Line

    PubMed Central

    Park, Kwang Il; Kim, Dong Gun; Lee, Bo Hyoung

    2016-01-01

    Inflammatory bowel disease (IBD) comprises Crohn's disease (CD) and ulcerative colitis (UC). IBD increases the risk of colorectal cancer (CRC), depending on the extent and duration of intestinal inflammation. Increased IL-6 expression has been reported in IBD patients, which may be associated with intestinal barrier function through discontinuous tight junction (TJ). KIOM-MA is a specific agent for allergic diseases and cancer, and it is composed of several plants; these herbs have been used in traditional oriental medicine. We fermented KIOM-MA, the product of KIOM-MA128, using probiotics to improve the therapeutic efficacy via the absorption and bioavailability of the active ingredients. In this study, we demonstrated that KIOM-MA/MA128 exhibited anticolitis effects via the modulation of TJ protein. Interleukin-6 resulted in a dose-dependent decrease in the TER and an increase in the FITC-dextran permeability; however, pretreatment with 400 µg/ml KIOM-MA/MA128 resulted in a significant increase in the TER and a decrease in the FITC-dextran permeability via IL-6 induction. Furthermore, protein and mRNA TJ levels remained stable after pretreatment with 400 µg/ml KIOM-MA/MA128. Moreover, KIOM-MA/MA128 suppressed the expression of PLCγ1 and PKC. Taken together, these findings suggest novel information and clue of the anticolitis effects of KIOM-MA128 via regulation of tight junction. PMID:27980357

  9. Minocycline Suppresses Interleukine-6, Its Receptor System and Signaling Pathways and Impairs Migration, Invasion and Adhesion Capacity of Ovarian Cancer Cells: In Vitro and In Vivo Studies

    PubMed Central

    Ataie-Kachoie, Parvin; Morris, David L.; Pourgholami, Mohammad H.

    2013-01-01

    Interleukin (IL)-6 has been shown to be a major contributing factor in growth and progression of ovarian cancer. The cytokine exerts pro-tumorigenic activity through activation of several signaling pathways in particular signal transducer and activator of transcription (STAT3) and extracellular signal-regulated kinase (ERK)1/2. Hence, targeting IL-6 is becoming increasingly attractive as a treatment option in ovarian cancer. Here, we investigated the effects of minocycline on IL-6 and its signaling pathways in ovarian cancer. In vitro, minocycline was found to significantly suppress both constitutive and IL-1β or 4-hydroxyestradiol (4-OH-E2)-stimulated IL-6 expression in human ovarian cancer cells; OVCAR-3, SKOV-3 and CAOV-3. Moreover, minocycline down-regulated two major components of IL-6 receptor system (IL-6Rα and gp130) and blocked the activation of STAT3 and ERK1/2 pathways leading to suppression of the downstream product MCL-1. In female nude mice bearing intraperitoneal OVCAR-3 tumors, acute administration (4 and 24 h) of minocycline (30 mg/kg) led to suppression of IL-6. Even single dose of minocycline was effective at significantly lowering plasma and tumor IL-6 levels. In line with this, tumoral expression of p-STAT3, p-ERK1/2 and MCL-1 were decreased in minocycline-treated mice. Evaluation of the functional implication of minocycline on metastatic activity revealed the capacity of minocycline to inhibit cellular migration, invasion and adhesion associated with down-regulation of matrix metalloproteinases (MMP)-2 and 9. Thus, the data suggest a potential role for minocycline in suppressing IL-6 expression and activity. These effects may prove to be an important attribute to the upcoming clinical trials of minocycline in ovarian cancer. PMID:23593315

  10. [Nano-ESI-MS/MS identification on differentiation-associated proteins in M1 mouse myeloid leukemia cells induced by IL-6].

    PubMed

    Xia, Qing; Wang, Hong-xia; Wang, Jie; Liu, Bing-yu; Hu, Mei-ru; Zhang, Xue-min; Shen, Bei-fen

    2004-10-01

    To identify two differentiation-associated proteins induced by rhIL-6 in M1 mouse myeloid leukemia cells. Protein spots were excised from 2-D gels and digested in-gel with trypsin. The trypsin lysis products were first analyzed by matrix-assisted laser desorption/ionization-time of flight-mass spectrometry (MALDI-TOF-MS) through peptide mass fingerprinting and then performed peptide sequencing by nano-electrospray ionization mass spectrometry/mass spectrometry (nano-ESI-MS/MS). The database search was finished with the Mascot search engine (http://www.matrixscience.co.uk) using the data processed through MaxEnt3 and MasSeq. The two proteins were not revealed by peptide mass fingerprint using MALDI-TOF-MS, while they were respectively identified as Destrin and Putative protein after the sequence of their trypic peptides were obtained by the nano-ESI-MS/MS techniques. Nano-ESI-MS/MS technique can successfully identify the two differentiation-associated proteins induced by rhIL-6 and has great advantage in protein analysis.

  11. CpG- and LPS-activated MAPK signaling in in vitro cultured salmon (Salmo salar) mononuclear phagocytes.

    PubMed

    Iliev, Dimitar B; Hansen, Tom; Jørgensen, Sven Martin; Krasnov, Aleksei; Jørgensen, Jorunn B

    2013-10-01

    The Mitogen-activated protein kinases (MAPK) are involved in transmitting intracellular signals downstream of diverse cell surface receptors and mediate the response to ligands such as growth factors, hormones and cytokines. In addition, MAPK are critically involved in the innate immune response to pathogen-derived substances, commonly referred to as pathogen-associated molecular patterns (PAMPs), such as bacterial lipopolysaccharide (LPS) and bacterial DNA rich in CpG dinucleotides. Currently, a great deal of knowledge is available about the involvement of MAPK in the innate immune response to PAMPs in mammals; however, little is known about the role of the different MAPK classes in the immune response to PAMPs in lower vertebrates. In the current study, p38 phosphorylation was induced by CpG oligonucleotides (ODNs) and LPS in primary salmon mononuclear phagocytes. Pre-treatment of the cells with a p38 inhibitor (SB203580) blocked the PAMP-induced p38 activity and suppressed the upregulation of most of the CpG- and LPS-induced transcripts highlighting the role of this kinase in the salmon innate immune response to PAMPs. In contrast to p38, the phosphorylation of extracellular signal-regulated kinase (ERK), a MAPK involved primarily in response to mitogens, was high in resting cells and, surprisingly, incubation with both CpG and control ODNs downregulated the phospho-ERK levels independently of p38 activation. The basal phospho-ERK level and the CpG-inducible p38 phosphorylation were greatly influenced by the length of in vitro incubation. The basal phospho-ERK level increased gradually throughout a 5-day culture period and was PI3K-dependent as demonstrated by its sensitivity to Wortmannin suggesting it is influenced by growth factors. Overall these data indicate that both basal and PAMP-induced activity of MAPKs might be greatly influenced by the differentiation status of salmon mononuclear phagocytes. Copyright © 2013. Published by Elsevier Ltd.

  12. Induced expression of mRNA for IL-5, IL-6, TNF-alpha, MIP-2 and IFN-gamma in immunologically activated rat peritoneal mast cells: inhibition by dexamethasone and cyclosporin A.

    PubMed

    Williams, C M; Coleman, J W

    1995-10-01

    We examined the capacity of purified rat peritoneal connective tissue-type mast cells (PMC) to express mRNA for several cytokines. Stimulation of PMC with anti-IgE for 4 hr induced the expression of mRNA encoding interleukin-5 (IL-5), IL-6, tumour necrosis factor-alpha (TNF-alpha), macrophage inflammatory protein-2 (MIP-2) and interferon-gamma (IFN-gamma). Unstimulated PMC expressed detectable mRNA for TNF-alpha but not for the other four cytokines. Incubation of PMC with cyclosporin A (CsA) or dexamethasone (DEX), each at 10(-6) M for 24 hr, significantly inhibited the induced expression of mRNA for each of the five cytokines, and also inhibited release of biologically active TNF-alpha. Throughout these experiments mRNA levels of the housekeeping gene G3PDH were not altered by stimulation with anti-IgE or incubation with CsA or DEX. We conclude that immunological activation of rat PMC induces gene expression of several cytokines and that expression of these genes can be inhibited by immunosuppressive drugs.

  13. Induced expression of mRNA for IL-5, IL-6, TNF-alpha, MIP-2 and IFN-gamma in immunologically activated rat peritoneal mast cells: inhibition by dexamethasone and cyclosporin A.

    PubMed Central

    Williams, C M; Coleman, J W

    1995-01-01

    We examined the capacity of purified rat peritoneal connective tissue-type mast cells (PMC) to express mRNA for several cytokines. Stimulation of PMC with anti-IgE for 4 hr induced the expression of mRNA encoding interleukin-5 (IL-5), IL-6, tumour necrosis factor-alpha (TNF-alpha), macrophage inflammatory protein-2 (MIP-2) and interferon-gamma (IFN-gamma). Unstimulated PMC expressed detectable mRNA for TNF-alpha but not for the other four cytokines. Incubation of PMC with cyclosporin A (CsA) or dexamethasone (DEX), each at 10(-6) M for 24 hr, significantly inhibited the induced expression of mRNA for each of the five cytokines, and also inhibited release of biologically active TNF-alpha. Throughout these experiments mRNA levels of the housekeeping gene G3PDH were not altered by stimulation with anti-IgE or incubation with CsA or DEX. We conclude that immunological activation of rat PMC induces gene expression of several cytokines and that expression of these genes can be inhibited by immunosuppressive drugs. Images Figure 1 Figure 2 Figure 3 PMID:7490125

  14. Benzoxazole derivatives suppress lipopolysaccharide-induced mast cell activation.

    PubMed

    Cho, Kyung-Ah; Park, Minhwa; Kim, Yu-Hee; Choo, Hea-Young Park; Lee, Kyung Ho

    2018-05-01

    Mast cells are central regulators of allergic inflammation that function by releasing various proallergic inflammatory mediators, including histamine, eicosanoids and proinflammatory cytokines. Occasionally, bacterial infections may initiate or worsen allergic inflammation. A number of studies have indicated that activation of lipoxygenase in mast cells positive regulates allergic inflammatory responses by generating leukotrienes and proinflammatory cytokines. In the present study, the effects of benzoxazole derivatives on the lipopolysaccharide (LPS)‑induced expression of proinflammatory cytokines, production of histamine and surface expression of co‑stimulatory molecules on bone marrow-derived mast cells (BMMCs) were studied. The benzoxazole derivatives significantly reduced the expression of interleukin (IL)‑1β, IL‑6, IL‑13, tumor necrosis factor‑α, perilipin (PLIN) 2, and PLIN3 in BMMCs treated with LPS. Furthermore, histamine production was suppressed in BMMCs treated with LPS, or treated with phorbol-12-myristate-13-acetate/ionomycin. Benzoxazole derivatives marginally affected the surface expression of cluster of differentiation (CD)80 and CD86 on BMMCs in the presence of LPS, although LPS alone did not increase the expression of those proteins. Therefore, benzoxazole derivatives inhibited the secretion of proinflammatory cytokines in mast cells and may be potential candidate anti‑allergic agents to suppress mast cell activation.

  15. The role of G-CSF and IL-6 in the granulopoiesis-stimulating activity of murine blood serum induced by perorally administered ultrafiltered pig leukocyte extract, IMUNOR.

    PubMed

    Vacek, Antonín; Hofer, Michal; Holá, Jirina; Weiterová, Lenka; Streitová, Denisa; Svoboda, Jaroslav

    2007-05-01

    IMUNOR, a low-molecular weight (< 12 kD) ultrafiltered pig leukocyte extract, has been previously found to have significant stimulatory effects on murine hematopoiesis supressed by ionizing radiation or cytotoxic drugs. This communication shows data on the mechanisms of these effects. Using ELISA assay, significantly increased levels of granulocyte colony-stimulating factor (G-CSF) and interleukin-6 (IL-6) were observed. On the contrary, no detectable levels of granulocyte-macrophage colony-stimulating factor (GM-CFC) and interleukin-3 (IL-3) have been found in blood serum of IMUNOR-treated mice. Incubation of the serum from IMUNOR-treated mice with antibodies against G-CSF caused abrogation of the ability of the sera to stimulate in vitro growth of colonies originating from granulocyte-macrophage progenitor cells (GM-CFC). In contrast, incubation of the serum with antibodies against IL-6 did not change its colony-stimulating activity. It may be inferred from these findings that G-CSF is probably the main cytokine responsible for the granulopoiesis-stimulating effects of IMUNOR. When the serum from IMUNOR-treated mice with G-CSF inactivated by anti-G-CSF antibodies (but with elevated IL-6) was added to cultures of bone marrow cells together with a suboptimum concentration of IL-3, a significant increase in the numbers of GM-CFC colonies was found. Moreover, conjoint inactivation of G-CSF and IL-6 significantly decreased the numbers of GM-CFC colonies in comparison with those observed when only G-CSF was inactivated. This observation strongly suggests that though IMUNOR-induced IL-6 is not able to induce the growth of GM-CFC colonies alone, it is able to potentiate the hematopoiesis-stimulating effect of IL-3. These findings represent a new knowledge concerning the hematopoiesis-stimulating action of IMUNOR, a promising immunomodulatory agent.

  16. Therapeutic dosages of aspirin counteract the IL-6 induced pro-tumorigenic effects by slowing down the ribosome biogenesis rate.

    PubMed

    Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo

    2016-09-27

    Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes.

  17. Therapeutic dosages of aspirin counteract the IL-6 induced pro-tumorigenic effects by slowing down the ribosome biogenesis rate

    PubMed Central

    Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo

    2016-01-01

    Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes. PMID:27557515

  18. TRAF6 and Src kinase activity regulates Cot activation by IL-1.

    PubMed

    Rodríguez, Cristina; Pozo, Maite; Nieto, Elvira; Fernández, Margarita; Alemany, Susana

    2006-09-01

    Cot is one of the MAP kinase kinase kinases that regulates the ERK1/ERK2 pathway under physiological conditions. Cot is activated by LPS, by inducing its dissociation from the inactive p105 NFkappaB-Cot complex in macrophages. Here, we show that IL-1 promotes a 10-fold increase in endogenous Cot activity and that Cot is the only MAP kinase kinase kinase that activates ERK1/ERK2 in response to this cytokine. Moreover, in cells where the expression of Cot is blocked, IL-1 fails to induce an increase in IL-8 and MIP-1betamRNA levels. The activation of Cot-MKK1-ERK1/ERK2 signalling pathway by IL-1 is dependent on the activity of the transducer protein TRAF6. Most important, IL-1-induced ERK1/ERK2 activation is inhibited by PP1, a known inhibitor of Src tyrosine kinases, but this tyrosine kinase activity is not required for IL-1 to activate other MAP kinases such as p38 and JNK. This Src kinases inhibitor does not block the dissociation and subsequently degradation of Cot in response to IL-1, indicating that other events besides Cot dissociation are required to activate Cot. All these data highlight the specific requirements for activation of the Cot-MKK1-ERK1/ERK2 pathway and provide evidence that Cot controls the functions of IL-1 that are mediated by ERK1/ERK2.

  19. S632A3, a new glutarimide antibiotic, suppresses lipopolysaccharide-induced pro-inflammatory responses via inhibiting the activation of glycogen synthase kinase 3β.

    PubMed

    Deng, Hongbin; Zhang, Na; Wang, Yan; Chen, Jinjing; Shen, Jiajia; Wang, Zhen; Xu, Rong; Zhang, Jingpu; Song, Danqing; Li, Diandong

    2012-12-10

    Inflammatory mediators including inducible nitric oxide (iNOS), cyclooxygenase-2 (COX-2), tumor necrosis factor-α (TNF-α) and Interleukin-6 (IL-6) contribute to the course of a variety of inflammatory diseases. S632A3 is a new member of the glutarimide antibiotics isolated from a cultured broth of Streptomyces hygroscopicus S632 with a potent NF-κB inhibitory activity. In the present study, we investigated the anti-inflammatory effects and the underlying molecular mechanism of S632A3 on lipopolysaccharide (LPS)-stimulated RAW264.7 macrophages. S632A3 concentration-dependently inhibited LPS-induced NO and prostaglandin E(2) (PGE(2)) production through the suppression of iNOS and COX-2 at gene transcription levels. In addition, S632A3 suppressed NF-κB-dependent inflammatory responses by inhibiting the activation of glycogen synthase kinase 3β (GSK-3β), while the activation of IκB kinase (IKK) complex was unaffected. S632A3 suppressed NF-κB activity by differentially affecting the CREB (cAMP response element-binding protein) and NF-κB p65 interacting with the coactivator CBP (CREB binding protein). S632A3 also inhibited GSK-3β-elicited iNOS and COX-2 expression. Moreover, S632A3 was shown to inhibit the activation of ASK1 (Apoptosis-signal regulating kinase 1) and p38 mitogen-activated protein kinase, therefore attenuated the LPS-induced NF-κB activity in macrophages. Furthermore, S632A3 significantly reduced the pro-inflammatory cytokines TNF-α and IL-6 production while increased the anti-inflammatory cytokine IL-10 production in LPS-stimulated RAW264.7 cells. Our study thus provides a molecular mechanism by which S632A3 inhibited LPS-induced pro-inflammatory response in macrophages through interfering with the activation of GSK-3β and ASK1-p38 signaling. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Chondroitin-6-sulfate attenuates inflammatory responses in murine macrophages via suppression of NF-κB nuclear translocation.

    PubMed

    Tan, Guak-Kim; Tabata, Yasuhiko

    2014-06-01

    Inflammation is a host protective response to noxious stimuli, and excessive production of pro-inflammatory mediators by macrophages (mφ) can lead to numerous pathological conditions. In this study, immunomodulatory effects of immobilized and soluble glycosaminoglycans (GAGs) on mouse-bone-marrow-derived mφ were compared by measuring nitric oxide (NO). We demonstrate here that all GAGs studied except for heparin were able to modulate interferon-γ/lipopolysaccharide (IFN-γ/LPS)-induced NO release by mφ to varying extents after 24h of incubation. In particular, the modulatory activities of soluble chondroitin-6-sulfate (C6S), hyaluronic acid and heparan sulfate altered markedly after covalent immobilization. Of these, soluble C6S exhibited the strongest NO inhibitory activity, and the inhibition was dose- and time-dependent. Moreover, C6S significantly reduced pro-inflammatory cytokines interleukin (IL)-6 and tumor necrosis factor (TNF)-α production by IFN-γ/LPS- or LPS-activated mφ. Specifically, the C6S-mediated suppression of mφ pro-inflammatory phenotype was accompanied by an increase in the IL-10 level, suggesting a possible switch towards anti-inflammatory/wound healing M2 state. In addition, the highest magnitude of inhibitory effects was obtained when cells were pre-treated with C6S prior to IFN-γ/LPS or LPS challenge, suggesting an additional role for C6S in protection against microbial infection. Further investigations reveal that the anti-inflammatory effects of C6S on activated mφ may be ascribed at least in part to suppression of NF-κB nuclear translocation. Copyright © 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  1. Curcumin suppresses JNK pathway to attenuate BPA-induced insulin resistance in LO2 cells.

    PubMed

    Geng, Shanshan; Wang, Shijia; Zhu, Weiwei; Xie, Chunfeng; Li, Xiaoting; Wu, Jieshu; Zhu, Jianyun; Jiang, Ye; Yang, Xue; Li, Yuan; Chen, Yue; Wang, Xiaoqian; Meng, Yu; Zhong, Caiyun

    2018-01-01

    To examine whether curcumin has protective effect on insulin resistance induced by bisphenol A (BPA) in LO2 cells and whether this effect was mediated by inhibiting the inflammatory mitogen-activated protein kinases (MAPKs) and nuclear factor-κB (NF-κB) pathways. LO2 cells were stimulated with BPA in the presence or absence of curcumin for 5 days. Glucose consumption, activation of insulin signaling, MAPKs and NF-κB pathways, levels of inflammatory cytokines and MDA production were analyzed. Curcumin prevented BPA-induced reduction of glucose consumption and suppression of insulin signaling pathway, indicating curcumin alleviated BPA-triggered insulin resistance in LO2 cells. mRNA and proteins levels of TNF-α and IL-6, as well as MDA level in LO2 cells treated with BPA were decreased by curcumin. Furthermore, curcumin downregulated the activation of p38, JNK, and NF-κB pathways upon stimulation with BPA. Inhibition of JNK pathway, but not p38 nor NF-κB pathway, improved glucose consumption and insulin signaling in BPA-treated LO2 cells. Curcumin inhibits BPA-induced insulin resistance by suppressing JNK pathway. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  2. Primate Neural Retina Upregulates IL-6 and IL-10 in Response to a Herpes Simplex Vector Suggesting the Presence of a Pro-/Anti-inflammatory Axis

    PubMed Central

    Sauter, Monica M.; Brandt, Curtis R.

    2016-01-01

    Injection of herpes simplex virus vectors into the vitreous of primate eyes induces an acute, transient uveitis. The purpose of this study was to characterize innate immune responses of macaque neural retina tissue to the herpes simplex virus type 1-based gene delivery vector hrR3. PCR array analysis demonstrated the induction of the pro-inflammatory cytokine IL-6, as well as the anti-inflammatory cytokine IL-10, following hrR3 exposure. Secretion of IL-6 was detected by ELISA and cone photoreceptors and Muller cells were the predominant IL-6 positive cell types. RNA in situ hybridization confirmed that IL-6 was expressed in photoreceptor and Muller cells. The IL-10 positive cells in the inner nuclear layer were identified as amacrine cells by immunofluorescence staining with calretinin antibody. hrR3 challenge resulted in activation of NFκB (p65) in Muller glial cells, but not in cone photoreceptors, suggesting a novel regulatory mechanism for IL-6 expression in cone cells. hrR3 replication was not required for IL-6 induction or NFκB (p65) activation. These data suggest a pro-inflammatory (IL-6)/anti-inflammatory (IL-10) axis exists in neural retina and the severity of acute posterior uveitis may be determined by this interaction. Further studies are needed to identify the trigger for IL-6 and IL-10 induction and the mechanism of IL-6 induction in cone cells. PMID:27170050

  3. Buthionine sulfoximine, a glutathione depletor, attenuates endotoxic fever and reduces IL-1β and IL-6 level in rats.

    PubMed

    Wrotek, Sylwia; Domagalski, Krzysztof; Jędrzejewski, Tomasz; Dec, Eliza; Kozak, Wiesław

    2017-02-01

    The aim of our study was to investigate the effect of buthionine sulfoximine (BSO) - a glutathione depletor - on a course of endotoxic fever and IL-1β and IL-6 production. Male Wistar rats were subjected to intraperitoneal injection of lipopolysaccharide (LPS) from E. coli (50μg/kg, ip) to provoke fever. The level of spleen glutathione, plasma interleukin (IL)-1β, IL-6, and deep body temperature (Tb) were measured. The LPS administration provoked fever (the average Tb was 38.14±0.05°C in NaCl/LPS-treated rats vs 37.10±0.03°C in control, not-treated rats; p<0.001). We observed that LPS injection induced a decrease in spleen glutathione level (7.67±0.92nM/g vs 13.27±0.47nM/g in not-treated rats; p<0.001). Furthermore, the injection of LPS provoked an elevation of plasma IL-1β and IL-6 concentration (from values below the lowest detectable standard in not-treated animals to 199.99±34.89pg/mL and 7500±542.21pg/mL, respectively; p<0.001). Pretreatment with BSO enhanced glutathione decrease in LPS-treated rats (5.05±0.49nM/g), and significantly affected fever (maximal Tb was 37.81±0.07°C in BSO/LPS-treated rats vs 38.76±0.11°C in NaCl/LPS-treated rats). BSO 4h after LPS injection decreased IL-1β and IL-6 gene expression (about 1.5 fold, and 2 fold, respectively). In a consequence we observed a decrease in plasma IL-6 concentration (4h after LPS injection plasma IL-6 was 4167.17±956.54pg/mL in BSO/LPS-treated rats vs 7500±542.21pg/mL in NaCl/LPS-treated rats; p<0.001), and later IL-1β (7h after LPS injection the IL-1β concentration was not detected). Based on these data, we conclude that BSO, in addition to well-known application as an inhibitor of glutathione synthesis, is an antipyretic agent which reduces both IL-1β and IL-6 concentration. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Structural Mimicry of Receptor Interaction by Antagonistic Interleukin-6 (IL-6) Antibodies*

    PubMed Central

    Blanchetot, Christophe; De Jonge, Natalie; Desmyter, Aline; Ongenae, Nico; Hofman, Erik; Klarenbeek, Alex; Sadi, Ava; Hultberg, Anna; Kretz-Rommel, Anke; Spinelli, Silvia; Loris, Remy; Cambillau, Christian; de Haard, Hans

    2016-01-01

    Interleukin 6 plays a key role in mediating inflammatory reactions in autoimmune diseases and cancer, where it is also involved in metastasis and tissue invasion. Neutralizing antibodies against IL-6 and its receptor have been approved for therapeutic intervention or are in advanced stages of clinical development. Here we describe the crystal structures of the complexes of IL-6 with two Fabs derived from conventional camelid antibodies that antagonize the interaction between the cytokine and its receptor. The x-ray structures of these complexes provide insights into the mechanism of neutralization by the two antibodies and explain the very high potency of one of the antibodies. It effectively competes for binding to the cytokine with IL-6 receptor (IL-6R) by using side chains of two CDR residues filling the site I cavities of IL-6, thus mimicking the interactions of Phe229 and Phe279 of IL-6R. In the first antibody, a HCDR3 tryptophan binds similarly to hot spot residue Phe279. Mutation of this HCDR3 Trp residue into any other residue except Tyr or Phe significantly weakens binding of the antibody to IL-6, as was also observed for IL-6R mutants of Phe279. In the second antibody, the side chain of HCDR3 valine ties into site I like IL-6R Phe279, whereas a LCDR1 tyrosine side chain occupies a second cavity within site I and mimics the interactions of IL-6R Phe229. PMID:27129274

  5. Structural Mimicry of Receptor Interaction by Antagonistic Interleukin-6 (IL-6) Antibodies.

    PubMed

    Blanchetot, Christophe; De Jonge, Natalie; Desmyter, Aline; Ongenae, Nico; Hofman, Erik; Klarenbeek, Alex; Sadi, Ava; Hultberg, Anna; Kretz-Rommel, Anke; Spinelli, Silvia; Loris, Remy; Cambillau, Christian; de Haard, Hans

    2016-06-24

    Interleukin 6 plays a key role in mediating inflammatory reactions in autoimmune diseases and cancer, where it is also involved in metastasis and tissue invasion. Neutralizing antibodies against IL-6 and its receptor have been approved for therapeutic intervention or are in advanced stages of clinical development. Here we describe the crystal structures of the complexes of IL-6 with two Fabs derived from conventional camelid antibodies that antagonize the interaction between the cytokine and its receptor. The x-ray structures of these complexes provide insights into the mechanism of neutralization by the two antibodies and explain the very high potency of one of the antibodies. It effectively competes for binding to the cytokine with IL-6 receptor (IL-6R) by using side chains of two CDR residues filling the site I cavities of IL-6, thus mimicking the interactions of Phe(229) and Phe(279) of IL-6R. In the first antibody, a HCDR3 tryptophan binds similarly to hot spot residue Phe(279) Mutation of this HCDR3 Trp residue into any other residue except Tyr or Phe significantly weakens binding of the antibody to IL-6, as was also observed for IL-6R mutants of Phe(279) In the second antibody, the side chain of HCDR3 valine ties into site I like IL-6R Phe(279), whereas a LCDR1 tyrosine side chain occupies a second cavity within site I and mimics the interactions of IL-6R Phe(229). © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Bilirubin prevents acute DSS-induced colitis by inhibiting leukocyte infiltration and suppressing upregulation of inducible nitric oxide synthase

    PubMed Central

    Vogel, Megan E.; Kindel, Tammy L.; Smith, Darcey L. H.; Idelman, Gila; Avissar, Uri; Kakarlapudi, Ganesh; Masnovi, Michelle E.

    2015-01-01

    Bilirubin is thought to exert anti-inflammatory effects by inhibiting vascular cell adhesion molecule-1 (VCAM-1)-dependent leukocyte migration and by suppressing the expression of inducible nitric oxide synthase (iNOS). As VCAM-1 and iNOS are important mediators of tissue injury in the dextran sodium sulfate (DSS) murine model of inflammatory colitis, we examined whether bilirubin prevents colonic injury in DSS-treated mice. Male C57BL/6 mice were administered 2.5% DSS in the drinking water for 7 days, while simultaneously receiving intraperitoneal injections of bilirubin (30 mg/kg) or potassium phosphate vehicle. Disease activity was monitored, peripheral blood counts and serum nitrate levels were determined, and intestinal specimens were analyzed for histological injury, leukocyte infiltration, and iNOS expression. The effect of bilirubin on IL-5 production by HSB-2 cells and on Jurkat cell transendothelial migration also was determined. DSS-treated mice that simultaneously received bilirubin lost less body weight, had lower serum nitrate levels, and exhibited reduced disease severity than vehicle-treated animals. Concordantly, histopathological analyses revealed that bilirubin-treated mice manifested significantly less colonic injury, including reduced infiltration of eosinophils, lymphocytes, and monocytes, and diminished iNOS expression. Bilirubin administration also was associated with decreased eosinophil and monocyte infiltration into the small intestine, with a corresponding increase in peripheral blood eosinophilia. Bilirubin prevented Jurkat migration but did not alter IL-5 production. In conclusion, bilirubin prevents DSS-induced colitis by inhibiting the migration of leukocytes across the vascular endothelium and by suppressing iNOS expression. PMID:26381705

  7. Bilirubin prevents acute DSS-induced colitis by inhibiting leukocyte infiltration and suppressing upregulation of inducible nitric oxide synthase.

    PubMed

    Zucker, Stephen D; Vogel, Megan E; Kindel, Tammy L; Smith, Darcey L H; Idelman, Gila; Avissar, Uri; Kakarlapudi, Ganesh; Masnovi, Michelle E

    2015-11-15

    Bilirubin is thought to exert anti-inflammatory effects by inhibiting vascular cell adhesion molecule-1 (VCAM-1)-dependent leukocyte migration and by suppressing the expression of inducible nitric oxide synthase (iNOS). As VCAM-1 and iNOS are important mediators of tissue injury in the dextran sodium sulfate (DSS) murine model of inflammatory colitis, we examined whether bilirubin prevents colonic injury in DSS-treated mice. Male C57BL/6 mice were administered 2.5% DSS in the drinking water for 7 days, while simultaneously receiving intraperitoneal injections of bilirubin (30 mg/kg) or potassium phosphate vehicle. Disease activity was monitored, peripheral blood counts and serum nitrate levels were determined, and intestinal specimens were analyzed for histological injury, leukocyte infiltration, and iNOS expression. The effect of bilirubin on IL-5 production by HSB-2 cells and on Jurkat cell transendothelial migration also was determined. DSS-treated mice that simultaneously received bilirubin lost less body weight, had lower serum nitrate levels, and exhibited reduced disease severity than vehicle-treated animals. Concordantly, histopathological analyses revealed that bilirubin-treated mice manifested significantly less colonic injury, including reduced infiltration of eosinophils, lymphocytes, and monocytes, and diminished iNOS expression. Bilirubin administration also was associated with decreased eosinophil and monocyte infiltration into the small intestine, with a corresponding increase in peripheral blood eosinophilia. Bilirubin prevented Jurkat migration but did not alter IL-5 production. In conclusion, bilirubin prevents DSS-induced colitis by inhibiting the migration of leukocytes across the vascular endothelium and by suppressing iNOS expression. Copyright © 2015 the American Physiological Society.

  8. TNFalpha and IL-6 are mediators in the blistering process of pemphigus.

    PubMed

    López-Robles, E; Avalos-Díaz, E; Vega-Memije, E; Hojyo-Tomoka, T; Villalobos, R; Fraire, S; Domíguez-Soto, L; Herrera-Esparza, R

    2001-03-01

    Pemphigus is an autoimmune disease characterized by intraepidermal blisters induced by pemphigus IgG. In addition to autoantibodies, molecular mechanisms involved in acantholysis remain largely unknown. For this reason, we address a possible role of the inflammatory cytokines IL-6 and TNFalpha in pemphigus lesions. Sixteen biopsies from patients with different types of pemphigus were studied by in situ hybridization using DNA fluorescent probes for IL-6 and TNFalpha mRNA. Fifty-six percent of lesional biopsies exhibited cytokine gene expression, which was poorly expressed in noninvolved skin. Deposits of TNFalpha and IL-6 were products of in situ transcription at the epidermal level. Inflammatory cytokine expression around the blister could play a mediator role in pemphigus lesions by increasing epithelial damage.

  9. Human periodontal ligament fibroblasts synthesize C-reactive protein and Th-related cytokines in response to interleukin (IL)-6 trans-signalling.

    PubMed

    Hernández-Caldera, A; Vernal, R; Paredes, R; Veloso-Matta, P; Astorga, J; Hernández, M

    2018-06-01

    To characterize the potential of human periodontal ligament fibroblasts (HPLF) to synthesize CRP and Th-related cytokines in response to IL-6 in periodontal health and apical inflammation. Primary HPLF stimulated with IL-6, soluble(s) IL-6 receptor (R) and controls were assayed for CRP, Th1, Th2, Th17 and Treg-related cytokines by quantitative real-time PCR and ELISA, respectively. IL-6R mRNA expression and its soluble protein levels were screened in HPLF cultures, and ex vivo samples of healthy periodontal ligaments (n = 5) and apical lesions (n = 13). Data were analysed with ANOVA or unpaired t-test. 0.5 ng mL -1 IL-6 plus 1 ng mL -1 of its soluble receptor (sIL-6R) for 24 h was effective in inducing CRP production. IL-6 alone had a mild dose-dependent effect; co-stimulation with sIL-6R significantly enhanced this effect, whereas it was completely abolished by the addition of IL-6R blocking antibody (P < 0.05). Similarly, higher mRNA expression and protein levels of Th1, Th17 and partially Treg-related cytokines were found for IL-6 combined with its soluble receptor versus the nonstimulated group and IL-6R antibody (P < 0.05). IL-6R mRNA expression was slightly induced by IL-6 compared to THP-1 cells, but sILR-6 protein could not be detected in HPLF. High sIL-6R levels were detected in apical lesions and were immunolocalized to mononuclear inflammatory cells and proliferating epithelium. IL-6 trans-signalling induced Th1 and Th17-related cytokines and represents an extra-hepatic mechanism for PCR synthesis in human periodontal ligament fibroblasts, contributing to explain the bone-destructive phenotype of apical lesions and eventually its systemic complications. © 2017 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  10. GENDER DIFFERENCES IN INJURY INDUCED MESENCHYMAL STEM CELL APOPTOSIS, EXPRESSION OF VEGF, TNF, AND IL-6 AND ABROGATION VIA TNFR1 ABLATION

    PubMed Central

    Crisostomo, Paul R.; Wang, Meijing; Herring, Christine M.; Markel, Troy A.; Meldrum, Kirstan K.; Lillemoe, Keith D.; Meldrum, Daniel R.

    2007-01-01

    Concomitant pro- and anti-inflammatory properties of bone marrow stem cells (BMSC) may be an important aspect of their ability to heal injured tissue. However, very few studies have examined whether gender differences exist in BMSC function. Indeed, it remains unknown whether gender differences exist in BMSC function and ability to resist apoptosis, and if so, whether TNF receptor 1 (TNFR1) plays a role in these differences. We hypothesized that TNFR1 ablation equalizes gender differences in bone marrow mesenchymal stem cell (MSC) apoptosis, as well as expression of vascular endothelial growth factor (VEGF), TNF, and interleukin (IL)-6. Mouse MSCs from male wildtype (WT), female WT, male TNFR1 knockouts (TNFR1KO), and female TNFR1KO were stressed by endotoxin 200 ng/ml or 1 hr hypoxia. MSC activation was determined by measuring VEGF, TNF, and IL-6 production (ELISA). Differences considered significant if p<0.05. LPS and hypoxia resulted in significant activation in all experimental groups compared to controls. Male WT demonstrated significantly greater TNF and IL-6 and significantly less VEGF release than female WT MSCs. However, release of TNF, IL-6, and VEGF in male TNFR1 knockouts differed from male WT, but was not different from female WT MSCs. Similarly apoptosis in hypoxic male TNFRIKO differed from male WT, but it was not different from apoptosis from WT female. Female WT did not differ in TNF, IL-6, and VEGF release compared to female TNFR1KO. Gender differences exist in injury induced BMSC VEGF, TNF, and IL-6 expression. TNFR1 may autoregulate VEGF, TNF, and IL-6 expression in males more than females. MSCs are novel therapeutic agents for organ protection, but further study of the disparate expression of VEGF, TNF, and IL-6 in males and females as well as the role of TNFR1 in these gender differences is necessary to maximize this protection. PMID:17070836

  11. Signal transducer and activator of transcription 3 is the dominant mediator of the anti-inflammatory effects of IL-10 in human macrophages.

    PubMed

    Williams, Lynn; Bradley, Laura; Smith, Alexandra; Foxwell, Brian

    2004-01-01

    The signaling mechanism by which the anti-inflammatory cytokine IL-10 mediates suppression of proinflammatory cytokine synthesis remains largely unknown. Macrophage-specific STAT3-null mice have demonstrated that STAT3 plays a critical role in the suppression of LPS-induced TNF-alpha release, although the mechanism by which STAT3 mediates this inhibition is still not clear. Using an adenoviral system, we have expressed a dominant negative (DN) STAT3 in human macrophages to broaden the investigation to determine the role of STAT3 in IL-10-mediated anti-inflammatory signaling and gene expression. Overexpression of STAT3 DN completely inhibited IL-10-induced suppressor of cytokine signaling 3, tissue inhibitor of MMP-1, TNF receptor expression, and the recently identified IL-10-inducible genes, T cell protein tyrosine phosphatase and signaling lymphocyte activation molecule. STAT3 DN also blocked IL-10-mediated inhibition of MHC class II and COX2 expression. In agreement with the studies in STAT3-null mice, overexpression of the STAT3 DN completely reversed the ability of IL-10 to inhibit LPS-mediated TNF-alpha and IL-6 production. However, real-time PCR analysis showed that STAT3 DN expression did not affect immediate suppression of TNF-alpha mRNA, but did reverse the suppression observed at later time points, suggesting a biphasic regulation of TNF-alpha mRNA levels by IL-10. In conclusion, although STAT3 does appear to be the dominant mediator of the majority of IL-10 functions, there are elements of its anti-inflammatory activity that are STAT3 independent.

  12. Inhibition of HIF-1α decreases expression of pro-inflammatory IL-6 and TNF-α in diabetic retinopathy.

    PubMed

    Gao, Xiuhua; Li, Yonghua; Wang, Hongxia; Li, Chuanbao; Ding, Jianguang

    2017-12-01

    Recent studies demonstrate that pro-inflammatory cytokines (PICs, i.e. IL-1β, IL-6 and TNF-α) in retinal tissues are likely involved in the development of diabetic retinopathy (DR). In this report, we particularly examined contributions of hypoxia inducible factor subtype 1α (HIF-1α) to the expression of PICs and their receptors in diabetic retina. Streptozotocin (STZ) was systemically injected to induce hyperglycaemia in rats. ELISA and Western blot analysis were employed to determine the levels of HIF-1α and PICs as well as PIC receptors in retinal tissues of control rats and STZ rats. The levels of retinal HIF-1α were significantly increased in STZ rats 4-10 weeks after induction of hyperglycaemia as compared with control animals. With increasing HIF-1α retinal PICs including IL-1β, IL-6 and TNF-α, their respective receptors, namely IL-1R, IL-6R and TNFR1, were also elevated in STZ rats. Moreover, inhibition of HIF-1α by injection of 2-methoxyestradiol (2-MET) significantly decreased the amplified expression IL-6, TNF-α, IL-6R and TNFR1 in diabetic retina, but did not modify IL-1β pathway. In addition, we examined protein expression of Caspase-3 indicating cell apoptosis in the retina of STZ rats after infusing 2-MET, demonstrating that 2-MET attenuated an increase in Caspase-3 evoked by STZ. Hypoxia inducible factor subtype 1α (HIF-1α) activated in diabetic retina is likely to play a role in regulating pathophysiological process via IL-6 and TNF-α mechanism. This has pharmacological implications to target specific HIF-1α, IL-6 and TNF-α signalling pathway for dysfunction and vulnerability related to DR. © 2016 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

  13. Quercetin abrogates IL-6/STAT3 signaling and inhibits glioblastoma cell line growth and migration

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Michaud-Levesque, Jonathan; Bousquet-Gagnon, Nathalie; Beliveau, Richard, E-mail: oncomol@nobel.si.uqam.ca

    Evidence has suggested that STAT3 functions as an oncogene in gliomagenesis. As a consequence, changes in the inflammatory microenvironment are thought to promote tumor development. Regardless of its origin, cancer-related inflammation has many tumor-promoting effects, such as the promotion of cell cycle progression, cell proliferation, cell migration and cell survival. Given that IL-6, a major cancer-related inflammatory cytokine, regulates STAT3 activation and is upregulated in glioblastoma, we sought to investigate the inhibitory effects of the chemopreventive flavonoid quercetin on glioblastoma cell proliferation and migration triggered by IL-6, and to determine the underlying mechanisms of action. In this study, we showmore » that quercetin is a potent inhibitor of the IL-6-induced STAT3 signaling pathway in T98G and U87 glioblastoma cells. Exposure to quercetin resulted in the reduction of GP130, JAK1 and STAT3 activation by IL-6, as well as a marked decrease of the proliferative and migratory properties of glioblastoma cells induced by IL-6. Interestingly, quercetin also modulated the expression of two target genes regulated by STAT3, i.e. cyclin D1 and matrix metalloproteinase-2 (MMP-2). Moreover, quercetin reduced the recruitment of STAT3 at the cyclin D1 promoter and inhibited Rb phosphorylation in the presence of IL-6. Overall, these results provide new insight into the role of quercetin as a blocker of the STAT3 activation pathway stimulated by IL-6, with a potential role in the prevention and treatment of glioblastoma.« less

  14. T cell-derived IL-10 determines leishmaniasis disease outcome and is suppressed by a dendritic cell based vaccine.

    PubMed

    Schwarz, Tobias; Remer, Katharina A; Nahrendorf, Wiebke; Masic, Anita; Siewe, Lisa; Müller, Werner; Roers, Axel; Moll, Heidrun

    2013-01-01

    In the murine model of Leishmania major infection, resistance or susceptibility to the parasite has been associated with the development of a Th1 or Th2 type of immune response. Recently, however, the immunosuppressive effects of IL-10 have been ascribed a crucial role in the development of the different clinical correlates of Leishmania infection in humans. Since T cells and professional APC are important cellular sources of IL-10, we compared leishmaniasis disease progression in T cell-specific, macrophage/neutrophil-specific and complete IL-10-deficient C57BL/6 as well as T cell-specific and complete IL-10-deficient BALB/c mice. As early as two weeks after infection of these mice with L. major, T cell-specific and complete IL-10-deficient animals showed significantly increased lesion development accompanied by a markedly elevated secretion of IFN-γ or IFN-γ and IL-4 in the lymph nodes draining the lesions of the C57BL/6 or BALB/c mutants, respectively. In contrast, macrophage/neutrophil-specific IL-10-deficient C57BL/6 mice did not show any altered phenotype. During the further course of disease, the T cell-specific as well as the complete IL-10-deficient BALB/c mice were able to control the infection. Furthermore, a dendritic cell-based vaccination against leishmaniasis efficiently suppresses the early secretion of IL-10, thus contributing to the control of parasite spread. Taken together, IL-10 secretion by T cells has an influence on immune activation early after infection and is sufficient to render BALB/c mice susceptible to an uncontrolled Leishmania major infection.

  15. Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.

    PubMed

    Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng

    2017-08-07

    were evaluated. Our results showed that in vitro, lipid modified class A CpG exhibited enhanced stimulatory activities toward TLR transfected reporter cells or bone-marrow derived dendritic cells, whereas lipid-modification of class B or C CpG reduces the activation of TLR9 by 2-3 fold, as compared with unmodified class B and class C CpG, respectively. However, in vivo coadministration of ovalbumin (OVA) protein antigen mixed with lipid-conjugated class B or C CpG ODNs, but not class A CpGs induced dramatically increased OVA-specific humoral and cytotoxic CD8 + T cells responses compared with OVA mixed with unmodified CpGs. Further, lipid-modification greatly reduces the toxicity associated with CpG by minimizing the systemic dissemination. Taken together, these results demonstrated that amphiphilic modification of three classes of CpG motifs differentially affected and modulated the immunostimulatory activities in vitro and in vivo. Our study highlights the importance of in vivo lymph node targeting of CpG ODNs in fulfilling their use as vaccine adjuvants, providing implications for the rational design of molecular adjuvant for subunit vaccines.

  16. Aspirin induces IL-4 production: augmented IL-4 production in aspirin-exacerbated respiratory disease

    PubMed Central

    Kong, Su-Kang; Soo Kim, Byung; Gi Uhm, Tae; Soo Chang, Hun; Sook Park, Jong; Woo Park, Sung; Park, Choon-Sik; Chung, Il Yup

    2016-01-01

    Aspirin hypersensitivity is a hallmark of aspirin-exacerbated respiratory disease (AERD), a clinical syndrome characterized by the severe inflammation of the respiratory tract after ingestion of cyclooxygenase-1 inhibitors. We investigated the capacity of aspirin to induce interleukin-4 (IL-4) production in inflammatory cells relevant to AERD pathogenesis and examined the associated biochemical and molecular pathways. We also compared IL-4 production in peripheral blood mononuclear cells (PBMCs) from patients with AERD vs aspirin-tolerant asthma (ATA) upon exposure to aspirin. Aspirin induced IL-4 expression and activated the IL-4 promoter in a report assay. The capacity of aspirin to induce IL-4 expression correlated with its activity to activate mitogen-activated protein kinases, to form DNA–protein complexes on P elements in the IL-4 promoter and to synthesize nuclear factor of activated T cells, critical transcription factors for IL-4 transcription. Of clinical importance, aspirin upregulated IL-4 production twice as much in PBMCs from patients with AERD compared with PBMCs from patients with ATA. Our results suggest that IL-4 is an inflammatory component mediating intolerance reactions to aspirin, and thus is crucial for AERD pathogenesis. PMID:27534531

  17. The IL-6/JAK/Stat3 Feed-Forward Loop Drives Tumorigenesis and Metastasis12

    PubMed Central

    Chang, Qing; Bournazou, Eirini; Sansone, Pasquale; Berishaj, Marjan; Gao, Sizhi Paul; Daly, Laura; Wels, Jared; Theilen, Till; Granitto, Selena; Zhang, Xinmin; Cotari, Jesse; Alpaugh, Mary L; de Stanchina, Elisa; Manova, Katia; Li, Ming; Bonafe, Massimiliano; Ceccarelli, Claudio; Taffurelli, Mario; Santini, Donatella; Altan-Bonnet, Gregoire; Kaplan, Rosandra; Norton, Larry; Nishimoto, Norihiro; Huszar, Dennis; Lyden, David; Bromberg, Jacqueline

    2013-01-01

    We have investigated the importance of interleukin-6 (IL-6) in promoting tumor growth and metastasis. In human primary breast cancers, increased levels of IL-6 were found at the tumor leading edge and positively correlated with advanced stage, suggesting a mechanistic link between tumor cell production of IL-6 and invasion. In support of this hypothesis, we showed that the IL-6/Janus kinase (JAK)/signal transducer and activator of transcription 3 (Stat3) pathway drives tumor progression through the stroma and metastatic niche. Overexpression of IL-6 in tumor cell lines promoted myeloid cell recruitment, angiogenesis, and induced metastases. We demonstrated the therapeutic potential of interrupting this pathway with IL-6 receptor blockade or by inhibiting its downstream effectors JAK1/2 or Stat3. These clinically relevant interventions did not inhibit tumor cell proliferation in vitro but had profound effects in vivo on tumor progression, interfering broadly with tumor-supportive stromal functions, including angiogenesis, fibroblast infiltration, and myeloid suppressor cell recruitment in both the tumor and pre-metastatic niche. This study provides the first evidence for IL-6 expression at the leading edge of invasive human breast tumors and demonstrates mechanistically that IL-6/JAK/Stat3 signaling plays a critical and pharmacologically targetable role in orchestrating the composition of the tumor microenvironment that promotes growth, invasion, and metastasis. PMID:23814496

  18. WISP1 mediates IL-6-dependent proliferation in primary human lung fibroblasts.

    PubMed

    Klee, S; Lehmann, M; Wagner, D E; Baarsma, H A; Königshoff, M

    2016-02-12

    Idiopathic pulmonary fibrosis (IPF) is a progressive and fatal interstitial lung disease. IPF is characterized by epithelial cell injury and reprogramming, increases in (myo)fibroblasts, and altered deposition of extracellular matrix. The Wnt1-inducible signaling protein 1 (WISP1) is involved in impaired epithelial-mesenchymal crosstalk in pulmonary fibrosis. Here, we aimed to further investigate WISP1 regulation and function in primary human lung fibroblasts (phLFs). We demonstrate that WISP1 is directly upregulated by Transforming growth factor β1 (TGFβ1) and Tumor necrosis factor α (TNFα) in phLFs, using a luciferase-based reporter system. WISP1 mRNA and protein secretion increased in a time- and concentration-dependent manner by TGFβ1 and TNFα in phLFs, as analysed by qPCR and ELISA, respectively. Notably, WISP1 is required for TGFβ1- and TNFα-dependent induction of interleukin 6 (IL-6), a mechanism that is conserved in IPF phLFs. The siRNA-mediated WISP1 knockdown led to a significant IL-6 reduction after TGFβ1 or TNFα stimulation. Furthermore, siRNA-mediated downregulation or antibody-mediated neutralization of WISP1 reduced phLFs proliferation, a process that was in part rescued by IL-6. Taken together, these results strongly indicate that WISP1-induced IL-6 expression contributes to the pro-proliferative effect on fibroblasts, which is likely orchestrated by a variety of profibrotic mediators, including Wnts, TGFβ1 and TNFα.

  19. IL-6 Mediates Macrophage Infiltration after Irradiation via Up-regulation of CCL2/CCL5 in Non-small Cell Lung Cancer.

    PubMed

    Wang, Xin; Yang, Xiaodong; Tsai, Ying; Yang, Li; Chuang, Kuang-Hsiang; Keng, Peter C; Lee, Soo Ok; Chen, Yuhchyau

    2017-01-01

    Radiotherapy is effective in reducing primary tumors, however, it may enhance macrophage infiltration to tumor sites, accelerating tumor progression in several ways. We investigated whether radiation can increase macrophage infiltration into non-small cell lung carcinoma (NSCLC) cells. Analysis of in vitro macrophage (differentiated THP-1 cells) migration to either nonirradiated or irradiated tumor cells showed increased migration to the irradiated tumor cells. Because the IL-6 levels in A549 and H157 cells were significantly increased after irradiation, we then investigated whether this increased IL-6 level contributes to radiation-induced macrophage migration. Radiation-induced macrophage infiltration was reduced when IL-6 was knocked down in tumor cells, indicating a positive IL-6 role in this process. To validate this in vitro result, an orthotopic mouse model was developed using a luciferase-tagged H157siIL-6/scramble control (sc) cell set. After tumors developed, the lungs were irradiated, and infiltration of endogenous macrophages and tail-vein injected fluorescent macrophages to tumor sites was investigated. In both groups, increased macrophage infiltration was observed in H157sc cell-derived xenografts compared to H157siIL-6 cell-derived xenografts, confirming the positive IL-6 role in the radiation-induced macrophage infiltration process. In mechanistic dissection studies, radiation-induced up-regulation of CCL2 and CCL5 by IL-6 was detected, and blocking the action of CCL2/CCL5 molecules significantly reduced the number of migrated macrophages to tumor cells after irradiation. These results demonstrate that targeting the IL-6 signaling or CCL2/CCL5 molecules in combination with conventional radiotherapy potentially blocks undesired radiation-induced macrophage infiltration.

  20. SUPPRESSION OF ALLERGIC UVEITIS BY 6-MERCAPTOPURINE

    PubMed Central

    Wirostko, E.; Halbert, S. P.

    1962-01-01

    Experimental uveitis in rabbits was induced by single intraocular antigen injection. Treatment with 6-MP for 14 days suppressed the allergic inflammation and antibody response. A good correlation was demonstrated between the degree of uveitis and the antibody titer. PMID:14001284

  1. Pirfenidone attenuates the IL-1β-induced hyaluronic acid increase in orbital fibroblasts from patients with thyroid-associated ophthalmopathy.

    PubMed

    Chung, Seung Ah; Jeon, Bo Kyung; Choi, Youn-Hee; Back, Keum Ok; Lee, Jong Bok; Kook, Koung Hoon

    2014-04-09

    This study aimed to investigate the effect of pirfenidone on the IL-1β-induced hyaluronic acid (HA) increase in orbital fibroblasts from patients with thyroid-associated ophthalmopathy (TAO). Primary cultured orbital fibroblasts were obtained from patients with TAO, and the excreted levels of HA from IL-1β-treated cells with or without pirfenidone were measured. The effect of pirfenidone on IL-1β-induced hyaluronic acid synthase (HAS) expression was evaluated. The relevance of the mitogen-activated protein kinase (MAPK)-mediated signaling pathway in IL-1β-induced HAS expression was assessed using specific inhibitors to p38, extracellular signal-regulated kinase (ERK), or c-Jun N-terminal kinase (JNK). The phosphorylation level of each MAPK in IL-1β-treated cells with or without pirfenidone and the level of AP-1 DNA binding were measured. The inhibitory potency of pirfenidone on HA production was evaluated using dexamethasone as a reference agent. Pirfenidone strongly attenuated the IL-1β-induced HA release in a dose-dependent manner. The IL-1β-induced HAS expression was decreased significantly following cotreatment with pirfenidone at the mRNA and protein levels. The production of mRNAs was halted by cotreatment with inhibitors of ERK and p38, but not by inhibitors of JNK. The IL-1β-induced ERK and p38 phosphorylation, and AP-1 DNA binding were attenuated in the presence of pirfenidone. Pirfenidone showed greater potency than dexamethasone in inhibiting increases in IL-1β-induced HA. Pirfenidone attenuates the IL-1β-induced HA production in orbital fibroblasts from patients with TAO, at least in part, through suppression of the MAPK-mediated HAS expression. These results support the potential use of pirfenidone for treatment of patients with TAO.

  2. Association of the IL6 rs1800796, but not of the IL6 rs1800795, IL6R rs4845617 and rs2228145 polymorphisms with hip fracture in elderly Mexican women.

    PubMed

    Ponce de León-Suárez, Valeria; Valdés-Flores, Margarita; Miranda-Duarte, Antonio; Ramírez-Pérez, Esperanza; Pérez-Ríos, Alin; Barredo-Prieto, Blanca; Hidalgo-Bravo, Alberto; Casas-Avila, Leonora

    2018-04-01

    Polymorphisms in Interleukin-6 (IL6) and its receptor (IL6R) have been associated with bone mineral density. In this work, the G-174C and G-572C polymorphisms in IL6, G-208A, and Asp358Ala in IL6R were analyzed in Mexican women with hip fracture. Postmenopausal Mexican women (60 years or over) with hip fragility fracture (77.97 ± 8 years) and without hip fracture (70.5 ± 7.02 years) were genotyped by real-time PCR. The rs1800796 GG genotype was associated with low risk of fracture (p = 0.05), while GC genotype was associated with high risk of fracture [p = 0.047, OR 2.3 (95% CI 1.013-5.2)]. The AA genotype of the rs2228145 SNP (IL6R) was significantly different [p = 0.033, OR 1.94 (95% CI 1.01-3.75)], but when data were adjusted by age and body mass index, there were no differences (p = 0.9). Our results suggest that the IL6 rs1800796 SNP is a good marker for hip fracture risk in Mexican women.

  3. Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

    PubMed Central

    Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

    2001-01-01

    Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

  4. Experimental murine fascioliasis derives early immune suppression with increased levels of TGF-β and IL-4.

    PubMed

    Chung, Joon-Yong; Bae, Young-An; Yun, Doo-Hee; Yang, Hyun-Jong; Kong, Yoon

    2012-12-01

    In fascioliasis, T-helper 2 (Th2) responses predominate, while little is known regarding early immune phenomenon. We herein analyzed early immunophenotype changes of BALB/c, C57BL/6, and C3H/He mice experimentally infected with 5 Fasciola hepatica metacercariae. A remarkable expansion of CD19(+) B cells was observed as early as week 1 post-infection while CD4(+)/CD8(+) T cells were down-regulated. Accumulation of Mac1(+) cells with time after infection correlated well with splenomegaly of all mice strains tested. The expression of tumor necrosis factor (TNF)-α mRNA in splenocytes significantly decreased while that of IL-4 up-regulated. IL-1β expression was down-modulated in BALB/c and C57BL/6 mice, but not in C3H/He. Serum levels of transforming growth factor (TGF)-β were considerably elevated in all mice during 3 weeks of infection period. These collective results suggest that experimental murine fascioliasis might derive immune suppression with elevated levels of TGF-β and IL-4 during the early stages of infection.

  5. Secreted Respiratory Syncytial Virus G Glycoprotein Induces Interleukin-5 (IL-5), IL-13, and Eosinophilia by an IL-4-Independent Mechanism

    PubMed Central

    Johnson, Teresa R.; Graham, Barney S.

    1999-01-01

    The attachment glycoprotein G of respiratory syncytial virus (RSV) is produced as both membrane-anchored and secreted forms by infected cells. Immunization with secreted RSV G (Gs) or formalin-inactivated alumprecipitated RSV (FI-RSV) predisposes mice to immune responses involving a Th2 cell phenotype which results in more severe illness and pathology, decreased viral clearance, and increased pulmonary eosinophilia upon subsequent RSV challenge. These responses are associated with increased interleukin-4 (IL-4) production in FI-RSV-primed mice, and the responses are IL-4 dependent. RNase protection assays demonstrated that similar levels of IL-4 mRNA were induced after RSV challenge in mice primed with vaccinia virus expressing Gs (vvGs) or a construct expressing only membrane-anchored G (vvGr). However, upon RSV challenge, vvGs-primed mice produced significantly greater levels of IL-5 and IL-13 mRNA and protein than vvGr-primed mice. Administration of neutralizing anti-IL-4 antibody 11.B11 during vaccinia virus priming did not alter the levels of vvGs-induced IL-5, IL-13, pulmonary eosinophilia, illness, or RSV titers upon RSV challenge, although immunoglobulin G (IgG) isotype profiles revealed that more IgG2a was produced. vvGs-priming of IL-4-deficient mice demonstrated that G-induced airway eosinophilia was not dependent on IL-4. In contrast, airway eosinophilia induced by FI-RSV priming was significantly reduced in IL-4-deficient mice. Thus we conclude that, in contrast to FI-RSV, the secreted form of RSV G can directly induce IL-5 and IL-13, producing pulmonary eosinophilia and enhanced illness in RSV-challenged mice by an IL-4-independent mechanism. PMID:10482601

  6. Ethanol extract of Angelica gigas inhibits croton oil-induced inflammation by suppressing the cyclooxygenase - prostaglandin pathway

    PubMed Central

    Shin, Sunhee; Joo, Seong Soo; Park, Dongsun; Jeon, Jeong Hee; Kim, Tae Kyun; Kim, Jeong Seon; Park, Sung Kyeong

    2010-01-01

    The anti-inflammatory effects of an ethanol extract of Angelica gigas (EAG) were investigated in vitro and in vivo using croton oil-induced inflammation models. Croton oil (20 µg/mL) up-regulated mRNA expression of cyclooxygenase (COX)-I and COX-II in the macrophage cell line, RAW 264.7, resulting in the release of high concentrations of prostaglandin E2 (PGE2). EAG (1~10 µg/mL) markedly suppressed croton oil-induced COX-II mRNA expression and PGE2 production. Application of croton oil (5% in acetone) to mouse ears caused severe local erythema, edema and vascular leakage, which were significantly attenuated by oral pre-treatment with EAG (50~500 mg/kg). Croton oil dramatically increased blood levels of interleukin (IL)-6 and PGE2 without affecting tumor-necrosis factor (TNF)-α and nitric oxide (NO) levels. EAG pre-treatment remarkably lowered IL-6 and PGE2, but did not alter TNF-α or NO concentrations. These results indicate that EAG attenuates inflammatory responses in part by blocking the COX-PGE2 pathway. Therefore, EAG could be a promising candidate for the treatment of inflammatory diseases. PMID:20195064

  7. Limitations of Using IL-17A and IFN-γ-Induced Protein 10 to Detect Bovine Tuberculosis

    PubMed Central

    Xin, Ting; Gao, Xintao; Yang, Hongjun; Li, Pingjun; Liang, Qianqian; Hou, Shaohua; Sui, Xiukun; Guo, Xiaoyu; Yuan, Weifeng; Zhu, Hongfei; Ding, Jiabo; Jia, Hong

    2018-01-01

    Bovine tuberculosis (bTB) is primarily caused by infection with Mycobacterium bovis, which belongs to the Mycobacterium tuberculosis complex. The airborne route is considered the most common for transmission of M. bovis, and more than 15% of cattle with bTB shed the Mycobacterium, which can be detect by nested PCR to amplify mycobacterial mpb70 from a nasal swab from a cow. To screen for cytokines fostering early and accurate detection of bTB, peripheral blood mononuclear cells were isolated from naturally M. bovis-infected, experimentally M. bovis 68002-infected, and uninfected cattle, then these cells were stimulated by PPD-B, CFP-10-ESAT-6 (CE), or phosphate-buffered saline (PBS) for 6 h. The levels of interferon gamma (IFN-γ), IFN-γ-induced protein 10 (IP-10), IL-6, IL-12, IL-17A, and tumor necrosis factor alpha mRNA were measured using real-time PCR. To explore the cytokines associated with different periods of M. bovis infection, cattle were divided into three groups: PCR-positive, PCR-negative, and uninfected using the tuberculin skin test, CFP-10/ESAT-6/TB10.4 protein cocktail-based skin test, IFN-γ release assay (IGRA), CFP-10/ESAT-6 (CE)-based IGRA, and nested PCR. The expression of IP-10, IL-17A, and IFN-γ proteins induced by PPD-B, CE, or PBS was detected by ELISA. The results showed that levels of PPD-B-stimulated IL-17A and IP-10 (mRNA and protein), and CE-induced IP-10 (mRNA and protein) were significantly higher in cattle naturally or experimentally infected with M. bovis than in those that were uninfected. The levels of PPD-B- or CE-induced IL-17A and IP-10 (protein) could be used to differentiate M. bovis-infected calves from uninfected ones for 6 to 30 weeks post-infection, whereas PPD-B- and CE-induced IP-10 and IL-17A mRNA expression could be used to differentiate M. bovis-infected calves from uninfected ones between 6 and 58 weeks post-infection. However, CE-induced IL-17A (protein) was not a reliable indicator of M. bovis infection

  8. Altered serum levels of TNF-α, IL-6, and IL-18 in depressive disorder patients.

    PubMed

    Fan, Ni; Luo, Yayan; Ou, Yufen; He, Hongbo

    2017-07-01

    Depressive disorder is associated with abnormal changes in cytokines levels. This study aimed to assess serum concentrations of tumor necrosis factor (TNF) α, interleukin (IL) 6, and IL-18 in depressive patients. The correlations between these three cytokine concentrations and the patients' clinical characteristics were also assessed. Serum TNF-α, IL-6, and IL-18 concentrations were assessed using enzyme-linked immunosorbent assay from 64 depressive patients and 80 healthy control subjects. Depressive symptoms of patients were assessed using Hamilton Depression Scale-17. Depressive patients had increased serum TNF-α and IL-6 concentrations but decreased IL-18 concentrations than controls. TNF-α and IL-6 concentrations were significantly positively associated with Hamilton Depression Scale-17 scores in depressive patients. These findings provided additional evidence that altered TNF-α, IL-6, and IL-18 activities may contribute to the pathophysiology of depressive disorder. Copyright © 2017 John Wiley & Sons, Ltd.

  9. Intravitreal injection of anti-Interleukin (IL)-6 antibody attenuates experimental autoimmune uveitis in mice.

    PubMed

    Tode, Jan; Richert, Elisabeth; Koinzer, Stefan; Klettner, Alexa; Pickhinke, Ute; Garbers, Christoph; Rose-John, Stefan; Nölle, Bernhard; Roider, Johann

    2017-08-01

    To evaluate the effect of an intravitreally applied anti-IL-6 antibody for the treatment of experimental autoimmune uveitis (EAU). EAU was induced in female B10.RIII mice by Inter-Photoreceptor-Binding-Protein (IRBP) in complete Freund's adjuvant, boosted by Pertussis toxin. Single blinded intravitreal injections of anti-IL-6 antibody were applied 5-7days as well as 8-10days (3day interval) after EAU induction into the randomized treatment eye and phosphate buffered saline (PBS) into the fellow control eye. Clinical and fluorescein angiography scoring (6 EAU grades) was done at each injection day and at enucleation day 14. Enucleated eyes were either scored histologically (6 EAU grades) or examined by ELISA for levels of IL-6, IL-17 and IL-6 soluble Receptor (sIL-6R). Uveitis developed in all 12 mice. Clinical uveitis score was significantly reduced (p=0.035) in treated eyes (median 2.0, range 0-4.0, n=12) compared to the fellow control eyes (median 3.0, range 1.0-4.0, n=12). Angiography scores were reduced in 9/12 treated eyes and histological scores in 3/4 treated eyes compared to the fellow control eyes. Cytokine levels were determined in 8 mice, of which 4 responded to anti-IL-6 treatment and 4 did not respond. All mice responding to treatment had a significant reduction of IL-6 (p<0.01) and IL-17 (p=0.01) levels in treated eyes compared to the fellow control eyes. This difference was not seen in non-responding mice. Intravitreal anti-IL-6 treatment significantly attenuates experimental autoimmune uveitis in mice. EAU activity correlates with ocular IL-6 and IL-17 levels. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Pre-activation with IL-12, IL-15, and IL-18 induces CD25 and a functional high affinity IL-2 receptor on human cytokine-induced memory-like NK cells

    PubMed Central

    Leong, Jeffrey W.; Chase, Julie M.; Romee, Rizwan; Schneider, Stephanie E.; Sullivan, Ryan P.; Cooper, Megan A.; Fehniger, Todd A.

    2014-01-01

    NK cells are effector lymphocytes that are under clinical investigation for the adoptive immunotherapy of hematologic malignancies, especially acute myeloid leukemia. Recent work in mice has identified innate memory-like properties of NK cells. Human NK cells also exhibit memory-like properties, and cytokine-induced memory-like (CIML) NK cells are generated via brief pre-activation with IL-12, IL-15, and IL-18, which later exhibit enhanced functionality upon restimulation. However, investigation of the optimal cytokine receptors and signals for maintenance of enhanced function and homeostasis following pre-activation remains unclear. Here, we show that IL-12, IL-15, and IL-18 pre-activation induces a rapid and prolonged expression of CD25, resulting in a functional high affinity IL-2 receptor (IL-2Rαβγ) that confers responsiveness to picomolar concentrations of IL-2. The expression of CD25 correlated with STAT5 phosphorylation in response to picomolar concentrations of IL-2, indicating the presence of a signal-competent IL-2Rαβγ. Furthermore, picomolar concentrations of IL-2 acted synergistically with IL-12 to co-stimulate IFN-γ production by pre-activated NK cells, an effect that was CD25-dependent. Picomolar concentrations of IL-2 also enhanced NK cell proliferation and cytotoxicity via the IL-2Rαβγ. Further, following adoptive transfer into immunodeficient NOD-SCID-γc−/− mice, human cytokine pre-activated NK cells expand preferentially in response to exogenous IL-2. Collectively, these data demonstrate that human CIML NK cells respond to IL-2 via IL-2Rαβγ with enhanced survival and functionality, and provide additional rationale for immunotherapeutic strategies that include brief cytokine pre-activation prior to adoptive NK cell transfer, followed by low dose IL-2 therapy. PMID:24434782

  11. Selective increase of cerebrospinal fluid IL-6 during experimental systemic inflammation in humans: association with depressive symptoms.

    PubMed

    Engler, H; Brendt, P; Wischermann, J; Wegner, A; Röhling, R; Schoemberg, T; Meyer, U; Gold, R; Peters, J; Benson, S; Schedlowski, M

    2017-10-01

    Systemic inflammation is accompanied by profound behavioral and mood changes that resemble symptoms of depression. Findings in animals suggest that pro-inflammatory cytokines released by activated immune cells in the periphery evoke these behavioral symptoms by driving inflammatory changes in the brain. However, experimental data in humans are lacking. Here we demonstrate in healthy male volunteers (10 endotoxin treated, 8 placebo treated) that intravenous administration of low-dose endotoxin (0.8 ng/kg body weight), a prototypical pathogen-associated molecular pattern that activates the innate immune system, not only induces a significant increase in peripheral blood cytokine concentrations (that is, tumor necrosis factor-α, interleukin (IL)-6, IL-10) but also results, with some latency, in a robust and selective increase of IL-6 in the cerebrospinal fluid (CSF). Moreover, we found a strong association between the endotoxin-induced increase of IL-6 in the CSF and the severity of mood impairment, with larger increases in CSF IL-6 concentration followed by a greater deterioration in mood. Taken together, these findings suggest that the appearance of depressive symptoms in inflammatory conditions might be primarily linked to an increase in central IL-6 concentration, identifying IL-6 as a potential therapeutic target in mood disorders.

  12. Acetaminophen-induced hepatotoxicity is associated with early changes in NF-kB and NF-IL6 DNA binding activity.

    PubMed

    Blazka, M E; Germolec, D R; Simeonova, P; Bruccoleri, A; Pennypacker, K R; Luster, M I

    Nuclear transcription factors, such as NF-kB and NF-IL6, are believed to play an important role in regulating the expression of genes that encode for products involved in tissue damage and inflammation and, thus, may represent early biomarkers for chemical toxicities. In the present study changes in DNA binding activity of these factors were examined in livers of mice administered hepatotoxic doses of acetaminophen (APAP). NF-kB and NF-IL6 DNA binding occurred constitutively in control mouse liver. However, within 4 hr following administration of hepatotoxic doses of APAP, their binding activities were transiently lost and is in contrast to AP-1 transcription factor where activation occurs under similar conditions. These changes corresponded with increased release of inflammatory mediators (IL-6, serum amyloid A) and increased levels of enzymatic markers of hepatocyte damage. Similarly, treatment of mice with gadolinium chloride, an inhibitor of Kupffer cell activation and known to protect against APAP-induced hepatotoxicity, reduced the observed pathophysiological response in the liver while altering the APAP-associated changes in NF-kB DNA binding activity. NF-kB was found predominantly in parenchymal and endothelial cells and was composed primarily of relatively inactive p50 homodimer subunits in control liver. Taken together, these studies suggest that hepatotoxicity is associated with early and complex changes in DNA binding activities of specific transcription factors. In particular, NF-kB and NF-IL6 may serve as negative regulators of hepatocyte-derived inflammatory mediators and is analogous to that previously observed in certain other cell systems such as B lymphocytes.

  13. Co-operative suppression of inflammatory responses in human dendritic cells by plant proanthocyanidins and products from the parasitic nematode Trichuris suis.

    PubMed

    Williams, Andrew R; Klaver, Elsenoor J; Laan, Lisa C; Ramsay, Aina; Fryganas, Christos; Difborg, Rolf; Kringel, Helene; Reed, Jess D; Mueller-Harvey, Irene; Skov, Søren; van Die, Irma; Thamsborg, Stig M

    2017-03-01

    Interactions between dendritic cells (DCs) and environmental, dietary and pathogen antigens play a key role in immune homeostasis and regulation of inflammation. Dietary polyphenols such as proanthocyanidins (PAC) may reduce inflammation, and we therefore hypothesized that PAC may suppress lipopolysaccharide (LPS) -induced responses in human DCs and subsequent T helper type 1 (Th1) -type responses in naive T cells. Moreover, we proposed that, because DCs are likely to be exposed to multiple stimuli, the activity of PAC may synergise with other bioactive molecules that have anti-inflammatory activity, e.g. soluble products from the helminth parasite Trichuris suis (TsSP). We show that PAC are endocytosed by monocyte-derived DCs and selectively induce CD86 expression. Subsequently, PAC suppress the LPS-induced secretion of interleukin-6 (IL-6) and IL-12p70, while enhancing secretion of IL-10. Incubation of DCs with PAC did not affect lymphocyte proliferation; however, subsequent interferon-γ production was markedly suppressed, while IL-4 production was unaffected. The activity of PAC was confined to oligomers (degree of polymerization ≥ 4). Co-pulsing DCs with TsSP and PAC synergistically reduced secretion of tumour necrosis factor-α, IL-6 and IL-12p70 while increasing IL-10 secretion. Moreover, both TsSP and PAC alone induced Th2-associated OX40L expression in DCs, and together synergized to up-regulate OX40L. These data suggest that PAC induce an anti-inflammatory phenotype in human DCs that selectively down-regulates Th1 response in naive T cells, and that they also act cooperatively with TsSP. Our results indicate a novel interaction between dietary compounds and parasite products to influence immune function, and may suggest that combinations of PAC and TsSP can have therapeutic potential for inflammatory disorders. © 2016 John Wiley & Sons Ltd.

  14. Deletion of Interleukin-6 Attenuates Pressure Overload-Induced Left Ventricular Hypertrophy and Dysfunction

    PubMed Central

    Afzal, Muhammad R.; Samanta, Anweshan; Xuan, Yu-Ting; Girgis, Magdy; Elias, Harold K; Zhu, Yanqing; Davani, Arash; Yang, Yanjuan; Chen, Xing; Ye, Sheng; Wang, Ou-Li; Chen, Lei; Hauptman, Jeryl; Vincent, Robert J.; Dawn, Buddhadeb

    2016-01-01

    Rationale The role of interleukin (IL)-6 in the pathogenesis of cardiac myocyte hypertrophy remains controversial. Objective To conclusively determine whether IL-6 signaling is essential for the development of pressure overload-induced left ventricular (LV) hypertrophy, and to elucidate the underlying molecular pathways. Methods and Results Wild-type (WT) and IL-6 knockout (IL-6−/−) mice underwent sham surgery or transverse aortic constriction (TAC) to induce pressure overload. Serial echocardiograms and terminal hemodynamic studies revealed attenuated LV hypertrophy and superior preservation of LV function in IL-6−/− mice after TAC. The extents of LV remodeling, fibrosis, and apoptosis were reduced in IL-6−/− hearts after TAC. Transcriptional and protein assays of myocardial tissue identified CaMKII and STAT3 activation as important underlying mechanisms during cardiac hypertrophy induced by TAC. The involvement of these pathways in myocyte hypertrophy was verified in isolated cardiac myocytes from WT and IL-6−/− mice exposed to pro-hypertrophy agents. Furthermore, overexpression of CaMKII in H9c2 cells increased STAT3 phosphorylation, and exposure of H9c2 cells to IL-6 resulted in STAT3 activation that was attenuated by CaMKII inhibition. Together these results identify the importance of CaMKII-dependent activation of STAT3 during cardiac myocyte hypertrophy via IL-6 signaling. Conclusions Genetic deletion of IL-6 attenuates TAC-induced LV hypertrophy and dysfunction, indicating a critical role played by IL-6 in the pathogenesis of LV hypertrophy in response to pressure overload. CaMKII plays an important role in IL-6-induced STAT3 activation and consequent cardiac myocyte hypertrophy. These findings may have significant therapeutic implications for LV hypertrophy and failure in patients with hypertension. PMID:27126808

  15. IL-3 Maintains Activation of the p90S6K/RPS6 Pathway and Increases Translation in Human Eosinophils.

    PubMed

    Esnault, Stephane; Kelly, Elizabeth A B; Shen, Zhong-Jian; Johansson, Mats W; Malter, James S; Jarjour, Nizar N

    2015-09-15

    IL-5 is a major therapeutic target to reduce eosinophilia. However, all of the eosinophil-activating cytokines, such as IL-5, IL-3, and GM-CSF, are typically present in atopic diseases, including allergic asthma. As a result of the functional redundancy of these three cytokines on eosinophils and the loss of IL-5R on airway eosinophils, it is important to take IL-3 and GM-CSF into account to efficiently reduce tissue eosinophil functions. Moreover, these three cytokines signal through a common β-chain receptor but yet differentially affect protein production in eosinophils. Notably, the increased ability of IL-3 to induce the production of proteins, such as semaphorin-7A, without affecting mRNA levels suggests a unique influence of IL-3 on translation. The purpose of this study was to identify the mechanisms by which IL-3 distinctively affects eosinophil function compared with IL-5 and GM-CSF, with a focus on protein translation. Peripheral blood eosinophils were used to study intracellular signaling and protein translation in cells activated with IL-3, GM-CSF, or IL-5. We establish that, unlike GM-CSF or IL-5, IL-3 triggers prolonged signaling through activation of ribosomal protein S6 (RPS6) and the upstream kinase 90-kDa ribosomal S6 kinase (p90S6K). Blockade of p90S6K activation inhibited phosphorylation of RPS6 and IL-3-enhanced semaphorin-7A translation. Furthermore, in an allergen-challenged environment, in vivo phosphorylation of RPS6 and p90S6K was enhanced in human airway compared with circulating eosinophils. Our findings provide new insights into the mechanisms underlying differential activation of eosinophils by IL-3, GM-CSF, and IL-5. These observations identify IL-3 and its downstream intracellular signals as novel targets that should be considered to modulate eosinophil functions. Copyright © 2015 by The American Association of Immunologists, Inc.

  16. Interleukin-6 mediates low-threshold mechanical allodynia induced by intrathecal HIV-1 envelope glycoprotein gp120

    PubMed Central

    Schoeniger-Skinner, Diana K.; Ledeboer, Annemarie; Frank, Matthew G.; Milligan, Erin D.; Poole, Stephen; Martin, David; Maier, Steven F.; Watkins, Linda R.

    2007-01-01

    Spinal cord glia (microglia and astrocytes) contribute to enhanced pain states. One model that has been used to study this phenomenon is intrathecal (i.t.) administration of gp120, an envelope glycoprotein of HIV-1 known to activate spinal cord glia and thereby induce low-threshold mechanical allodynia, a pain symptom where normally innocuous (non-painful) stimuli are perceived as painful. Previous studies have shown that i.t. gp120-induced allodynia is mediated via the release of the glial pro-inflammatory cytokines, tumor necrosis factor-α (TNF), and interleukin-1β (IL-1). As we have recently reported that i.t. gp120 induces the release of interleukin-6 (IL-6), in addition to IL-1 and TNF, the present study tested whether this IL-6 release in spinal cord contributes to gp120-induced mechanical allodynia and/or to gp120-induced increases in TNF and IL-1. An i.t. anti-rat IL-6 neutralizing antibody was used to block IL-6 actions upon its release by i.t. gp120. This IL-6 blockade abolished gp120-induced mechanical allodynia. While the literature predominantly documents the cascade of pro-inflammatory cytokines as beginning with TNF, followed by the stimulation of IL-1, and finally TNF plus IL-1 stimulating the release of IL-6, the present findings indicate that a blockade of IL-6 inhibits the gp120-induced elevations of TNF, IL-1, and IL-6 mRNA in dorsal spinal cord, elevation of IL-1 protein in lumbar dorsal spinal cord, and TNF and IL-1 protein release into the surrounding lumbosacral cerebrospinal fluid. These results would suggest that IL-6 induces pain facilitation, and may do so in part by stimulating the production and release of other proinflammatory cytokines. PMID:17204394

  17. Interleukin (IL)-18, cooperatively with IL-23, induces prominent inflammation and enhances psoriasis-like epidermal hyperplasia.

    PubMed

    Shimoura, Noriko; Nagai, Hiroshi; Fujiwara, Susumu; Jimbo, Haruki; Yoshimoto, Takayuki; Nishigori, Chikako

    2017-05-01

    The interleukin (IL)-23/IL-17 axis is strongly implicated in the pathogenesis of psoriasis. Previous studies showed that IL-18 was elevated in early active and progressive plaque-type psoriatic lesions and that serum or plasma levels of IL-18 correlated with the Psoriasis Area and Severity Index. However, the mechanism whereby IL-18 affects disease severity remains unknown. In this study, we investigated the effects of IL-18 on a psoriasis-like skin inflammation model induced by recombinant mouse IL-23. We found that IL-18, cooperatively with IL-23, induced prominent inflammation and enhanced psoriasis-like epidermal hyperplasia. In the skin of mice treated with IL-23 plus IL-18, the expression of interferon-γ was significantly upregulated and that of chemokine (C-X-C motif) ligand 9 (CXCL9) was synergistically increased. Histologically, strong positive signals of CXCL9 were observed around the infiltrating inflammatory cells. The current results suggest that IL-18 might synergize with IL-23 to induce a T helper 1 immune reaction, without inhibiting the IL-23/IL-17 axis, and thus may aggravate psoriatic inflammation.

  18. Metabotropic glutamate receptor 5 mediates the suppressive effect of 6-OHDA-induced model of Parkinson's disease on liver cancer.

    PubMed

    Xi, Shao-Song; Bai, Xiao-Xu; Gu, Li; Bao, Li-Hui; Yang, Hui-Min; An, Wei; Wang, Xiao-Min; Zhang, Hong

    2017-07-01

    Numerous epidemiological studies suggested that there is a variable cancer risk in patients with Parkinson's disease (PD). However, the underlying mechanisms remain unclear. In the present study, the role of metabotropic glutamate receptor 5 (mGluR5) has been investigated in 6-hydroxydopamine (6-OHDA)-induced PD combined with liver cancer both in vitro and in vivo. We found that PD cellular model from 6-OHDA-lesioned MN9D cells suppressed the growth, migration, and invasion of Hepa1-6 cells via down-regulation of mGluR5-mediated ERK and Akt pathway. The application of 2-methyl-6-(phenylethyl)-pyridine and knockdown of mGluR5 further decreased the effect on Hepa-1-6 cells when co-cultured with conditioned media. The effect was increased by (S)-3,5-dihydroxyphenylglycine and overexpression of mGluR5. Moreover, more release of glutamate from 6-OHDA-lesioned MN9D cells suppressed mGluR5-mediated effect of Hepa1-6 cells. Application of riluzole eliminated the increased glutamate release induced by 6-OHDA in MN9D cells and aggravated the suppressive effect on Hepa-1-6 cells. In addition, the growth of implanted liver cancer was inhibited in 6-OHDA induced PD-like rats, and was associated with increased glutamate release in the serum and down-regulation of mGluR5 in tumor tissue. Collectively, these results indicate that selective antagonism of glutamate and mGluR5 has a potentially beneficial effect in both liver cancer and PD, and thus may provide more understanding for the clinical investigation and further an additional therapeutic target for these two diseases. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. IL-18 Contributes to Bone Cancer Pain by Regulating Glia Cells and Neuron Interaction.

    PubMed

    Liu, Su; Liu, Yue-Peng; Lv, You; Yao, Jun-Li; Yue, Dong-Mei; Zhang, Mao-Yin; Qi, Dun-Yi; Liu, Gong-Jian

    2018-02-01

    Glial cell hyperactivity has been proposed to be responsible for chronic pain, however, the mechanisms remain unclear. Interleukin (IL)-18, released from glial cells, has been reported to be involved in neuropathic pain. In this study, we investigated the role of IL-18 in bone cancer pain. Bone cancer pain was mimicked by injecting Walker-256 mammary gland carcinoma cells into the intramedullary space of the tibia in rats. Expression and location of IL-18 and the IL-18 receptor were tested. To investigate the contribution of IL-18 signaling to bone cancer pain, IL-18 binding protein and recombinant IL-18 were used. To investigate the mechanisms of glial cells effects, MK801, N-methyl-D-aspartate (NMDA) receptor inhibitor, and Src kinase-specific inhibitor PP1 were used. Tumor cell implantation (TCI) treatment increased expression of IL-18 and IL-18 receptor in spinal cord. The time course of IL-18 upregulation was correlated with TCI-induced pain behaviors. Blocking the IL-18 signaling pathway prevented and reversed bone cancer-related pain behaviors. Meanwhile, blocking IL-18 signaling also suppressed TCI-induced glial cell hyperactivity, as well as activation of GluN2B and subsequent Ca 2+ -dependent signaling. Spinal administration of recombinant IL-18 in naive rat induced significant mechanical allodynia, as well as GluN2B activation. However, intrathecal injection of MK801 failed to suppress recombinant IL-18-induced GluN2B phosphorylation, whereas Src kinase inhibitor PP1 significantly inhibited IL-18-induced GluN2B activation. IL-18-mediated glial-glia and glial-neuron interaction may facilitate bone cancer pain. Blocking IL-18 signaling may effectively prevent and/or suppress bone cancer pain. IL-18 signaling may be a new target for cancer pain therapy. Copyright © 2017 The American Pain Society. Published by Elsevier Inc. All rights reserved.

  20. Fermented Herbal Formulas KIOM-MA128 Ameliorate IL-6-Induced Intestinal Barrier Dysfunction in Colon Cancer Cell Line.

    PubMed

    Park, Kwang Il; Kim, Dong Gun; Lee, Bo Hyoung; Ma, Jin Yeul

    2016-01-01

    Inflammatory bowel disease (IBD) comprises Crohn's disease (CD) and ulcerative colitis (UC). IBD increases the risk of colorectal cancer (CRC), depending on the extent and duration of intestinal inflammation. Increased IL-6 expression has been reported in IBD patients, which may be associated with intestinal barrier function through discontinuous tight junction (TJ). KIOM-MA is a specific agent for allergic diseases and cancer, and it is composed of several plants; these herbs have been used in traditional oriental medicine. We fermented KIOM-MA, the product of KIOM-MA128, using probiotics to improve the therapeutic efficacy via the absorption and bioavailability of the active ingredients. In this study, we demonstrated that KIOM-MA/MA128 exhibited anticolitis effects via the modulation of TJ protein. Interleukin-6 resulted in a dose-dependent decrease in the TER and an increase in the FITC-dextran permeability; however, pretreatment with 400  µ g/ml KIOM-MA/MA128 resulted in a significant increase in the TER and a decrease in the FITC-dextran permeability via IL-6 induction. Furthermore, protein and mRNA TJ levels remained stable after pretreatment with 400  µ g/ml KIOM-MA/MA128. Moreover, KIOM-MA/MA128 suppressed the expression of PLC γ 1 and PKC. Taken together, these findings suggest novel information and clue of the anticolitis effects of KIOM-MA128 via regulation of tight junction.

  1. [C1q/tumor necrosis factor related protein 6 (CTRP6) is involved in gentamicin-induced acute kidney injury in rats].

    PubMed

    Li, Rong; Yang, Xiaoxia; Yu, Yan; Zhou, Meilan; Tian, Xiujuan; Feng, Shidong; Wang, Hanmin

    2016-11-01

    Objective To explore the role of the anti-inflammatory cytokine C1q/tumor necrosis factor related protein 6 (CTRP6) in gentamicin-induced acute kidney injury in rats. Methods SD rats were divided into 5 groups including control group, model group and the other 3 experimental groups. The rats in model group and experimental groups were subcutaneously injected with gentamicin at the dose of 400 mg/(kg.d) for consecutive 2 days to induce acute renal injury. Two days before gentamicin injection, the rats in the 3 experimental groups were given pAd-CTRP6 at the doses of 0.5, 5 and 50 mg/kg, respectively. The serum levels of blood urea nitrogen (BUN) and creatinine (Cr) were respectively assayed with picric acid colorimetry and ultraviolet spectrophotometry; ELISA was used to detect serum CTRP6 content and the production of interleukin 1β (IL-1β) and tumor necrosis factor α (TNF-α) in the kidney homogenate; Western blotting was performed to detect the expressions of CTRP6, caspase-1 and pyrin domain containing 3 (NLRP3) proteins in the renal tissues of rats. Results Compared with control group, serum BUN and Cr contents increased in the model rats; the secretion of inflammatory factors IL-1β and TNF-α, as well as the expressions of caspase-1 and NLRP3 were also enhanced in the model group. Compared with the model group, serum BUN and Cr contents decreased in the experimental groups; the secretion of IL-1β and TNF-α, as well as the expressions of caspase-1 and NLRP3 were also attenuated in the experimental groups. Moreover, with the increase of the injection dosage of pAd-CTRP6, the suppressive effect was gradually strengthened. Conclusion CTRP6 can attenuate gentamicin-induced acute renal injury in rats in a dose-dependent manner.

  2. An Interleukin-33-Mast Cell-Interleukin-2 Axis Suppresses Papain-Induced Allergic Inflammation by Promoting Regulatory T Cell Numbers.

    PubMed

    Morita, Hideaki; Arae, Ken; Unno, Hirotoshi; Miyauchi, Kousuke; Toyama, Sumika; Nambu, Aya; Oboki, Keisuke; Ohno, Tatsukuni; Motomura, Kenichiro; Matsuda, Akira; Yamaguchi, Sachiko; Narushima, Seiko; Kajiwara, Naoki; Iikura, Motoyasu; Suto, Hajime; McKenzie, Andrew N J; Takahashi, Takao; Karasuyama, Hajime; Okumura, Ko; Azuma, Miyuki; Moro, Kazuyo; Akdis, Cezmi A; Galli, Stephen J; Koyasu, Shigeo; Kubo, Masato; Sudo, Katsuko; Saito, Hirohisa; Matsumoto, Kenji; Nakae, Susumu

    2015-07-21

    House dust mite-derived proteases contribute to allergic disorders in part by disrupting epithelial barrier function. Interleukin-33 (IL-33), produced by lung cells after exposure to protease allergens, can induce innate-type airway eosinophilia by activating natural helper (NH) cells, a member of group 2 innate lymphoid cells (ILC2), to secrete Th2 type-cytokines. Because IL-33 also can induce mast cells (MCs) to secrete Th2 type-cytokines, MCs are thought to cooperate with NH cells in enhancing protease or IL-33-mediated innate-type airway eosinophilia. However, we found that MC-deficient Kit(W-sh/W-sh) mice exhibited exacerbated protease-induced lung inflammation associated with reduced numbers of regulatory T (Treg) cells. Moreover, IL-2 produced by IL-33-stimulated MCs promoted expansion of numbers of Treg cells, thereby suppressing development of papain- or IL-33-induced airway eosinophilia. We have thus identified a unique anti-inflammatory pathway that can limit induction of innate-type allergic airway inflammation mediated by NH cells. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Polysaccharide isolated from Aloe vera gel suppresses ovalbumin-induced food allergy through inhibition of Th2 immunity in mice.

    PubMed

    Lee, Dajeong; Kim, Hyuk Soon; Shin, Eunju; Do, Seon-Gil; Lee, Chong-Kil; Kim, Young Mi; Lee, Min Bum; Min, Keun Young; Koo, Jimo; Kim, Su Jeong; Nam, Seung Taek; Kim, Hyun Woo; Park, Young Hwan; Choi, Wahn Soo

    2018-05-01

    An allergic reaction occurs when the immune system overreacts to harmless substance called allergen that gains access to the body. Food allergy is a hypersensitive immune reaction to food proteins and the number of patients with food allergy has recently increased. Aloe Vera is used for wellness and medicinal purposes. In particular, Aloe vera has been reported to enhance immunity. However, the effect of Aloe vera on food allergy is not yet known. In this study, we investigated the effects of processed Aloe vera gel (PAG) containing low molecular weight Aloe polysaccharide (AP) on ovalbumin (OVA)-induced food allergy in mice. Allergic symptoms, rectal temperature, and diarrhea were measured in OVA-induced food allergy mice. Other allergic parameters were also analyzed by RT-PCR, ELISA, flow cytometry, and other biochemical methods. As the results, PAG suppressed the decrease of body temperature, diarrhea, and allergic symptoms in OVA-induced food allergy mice. PAG also reduced serum concentrations of type 2 helper T cell (Th2) cytokines (Interleukin-(IL)-4, IL-5, and IL-13) as well as histamine, mast cell protease-1 (MCP-1), and immunoglobulin (Ig)E. PAG blocked the degranulation of mast cells and infiltration of eosinophils in intestine. Furthermore, PAG suppressed the population of Th2 cells in spleen and mesenteric lymph nodes. PAG also increased the production of IL-10 and population of type 1 regulatory T (Tr1) cells in mice with food allergy. Taken together, our findings suggest that PAG suppressed Th2 immune responses through, at least partially, stimulating the secretion of IL-10 in food allergy mice. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  4. Interleukin (IL)-1A and IL-6: Applications to the predictive diagnostic testing of radiation pneumonitis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen Yuhchyau; Hyrien, Ollivier; Williams, Jacqueline

    2005-05-01

    Purpose: To explore the application of interleukin (IL)-1{alpha} and IL-6 measurements in the predictive diagnostic testing for symptomatic radiation pneumonitis (RP). Methods and materials: In a prospective protocol investigating RP and cytokines, IL-1{alpha} and IL-6 values were analyzed by enzyme-linked immunosorbent assay from serial weekly blood samples of patients receiving chest radiation. We analyzed sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) over selected threshold values for both cytokines in the application to diagnostic testing. Results: The average coefficient of variation was 51% of the weekly mean IL-1{alpha} level and 39% of the weekly mean IL-6 value.more » Interleukin 1{alpha} and IL-6 became positively correlated with time. Specificity for both cytokines was better than sensitivity. IL-6 globally outperformed IL-1{alpha} in predicting RP, with higher PPV and NPV. Conclusions: Our data demonstrate the feasibility of applying IL-1{alpha} and IL-6 measurements of blood specimens to predict RP. Interleukin-6 measurements offer stronger positive predictive value than IL-1{alpha}. This application might be further explored in a larger sample of patients.« less

  5. The combinations of TNFalpha-308 and IL-6 -174 or IL-10 -1082 genes polymorphisms suggest an association with susceptibility to sporadic late-onset Alzheimer's disease.

    PubMed

    Vural, P; Değirmencioğlu, S; Parildar-Karpuzoğlu, H; Doğru-Abbasoğlu, S; Hanagasi, H A; Karadağ, B; Gürvit, H; Emre, M; Uysal, M

    2009-12-01

    Single nucleotide polymorphisms in the regulatory regions of the cytokine genes for tumor necrosis factor alpha (TNFalpha), interleukin (IL)-6 and IL-10 have been suggested to influence the risk of Alzheimer's disease (AD) with conflicting results. To investigate the TNFalpha-308, IL-6 -174 and IL-10 -1082 gene polymorphisms as susceptibility factors for AD. We analyzed genotype and allele distributions of these polymorphisms in 101 sporadic AD patients and 138 healthy controls. Heterozygotes (AG) or combined genotype (AG+AA) for IL-10 -1082 were associated with approximately two-fold increase in the risk of AD. Carriers of A alleles of both TNFalpha-308 and IL-10 -1082 had 6.5 times higher risk for AD in comparison with non-carriers. Concomitant presence of both mutant TNFalpha-308 A and IL-6 -174 C alleles raised three-fold the AD risk, whereas there was no notable risk for AD afflicted by IL-6 -174 polymorphism alone. Our results suggest that TNFalpha and IL-10 promoter polymorphism might be a risk factor for AD. The combined effects of TNFalpha-308, IL-6 -174 and IL-10 -1082 variant alleles may be more decisive to induce functional differences and modify the risk for AD.

  6. Kaempferol impedes IL-32-induced monocyte-macrophage differentiation.

    PubMed

    Nam, Sun-Young; Jeong, Hyun-Ja; Kim, Hyung-Min

    2017-08-25

    Kaempferol possesses a wide range of therapeutic properties, including antioxidant, anti-inflammatory, and anticancer properties. The present study sought to evaluate the effects and possible pharmacological mechanisms of kaempferol on interleukin (IL)-32-induced monocyte-macrophage differentiation. In this study, we performed flow cytometry assay, immunocytochemical staining, quantitative real-time PCR, enzyme-linked immuno sorbent assay, caspase-1 assay, and Western blotting to observe the effects and underlying mechanisms of kaempferol using the human monocyte cell line THP-1. The flow cytometry, immunocytochemical staining, and real-time PCR results show that kaempferol attenuated IL-32-induced monocyte differentiation to product macrophage-like cells. Kaempferol decreased the production and mRNA expression of pro-inflammatory cytokines, in this case thymic stromal lymphopoietin (TSLP), IL-1β, tumor necrosis factor (TNF)-α, and IL-8. Furthermore, kaempferol inhibited the IL-32-induced activation of p38 and nuclear factor-κB in a dose-dependent manner in THP-1 cells. Kaempferol also ameliorated the lipopolysaccharide-induced production of the inflammatory mediators TSLP, IL-1β, TNF-α, IL-8, and nitric oxide of macrophage-like cells differentiated by IL-32. In brief, our findings may provide new mechanistic insights into the anti-inflammatory effects of kaempferol. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. IL-1β and IL-6 activate inflammatory responses of astrocytes against Naegleria fowleri infection via the modulation of MAPKs and AP-1.

    PubMed

    Kim, J-H; Song, A-R; Sohn, H-J; Lee, J; Yoo, J-K; Kwon, D; Shin, H-J

    2013-01-01

    Naegleria fowleri, a free-living amoeba, has been found in diverse habitats throughout the world. It causes primary amoebic meningoencephalitis in children and young adults. The amoeba attaches to nasal mucosa, migrates along olfactory nerves and enters the brain. Astrocytes are involved in the defence against infection and produce inflammatory responses. In this study, we focus on the mechanism of immune responses in astrocytes. We showed, using RNase protection assay, RT-PCR and ELISA in an in vitro culture system, that N. fowleri lysates induce interleukin-1beta (IL-1β) and IL-6 expression of astrocytes. In addition, cytokine levels of astrocytes gradually decreased due to extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK) and p38 inhibitors. To determine the transcription factor, we used transcription inhibitor (AP-1 inhibitor), which downregulated IL-1β and IL-6 expression. These results show that AP-1 is related to IL-1β and IL-6 production. N. fowleri-mediated IL-1β and IL-6 expression requires ERK, JNK and p38 mitogen-activated protein kinases (MAPKs) activation in astrocytes. These findings show that N. fowleri-stimulated astrocytes in an in vitro culture system lead to AP-1 activation and the subsequent expressions of IL-1β and IL-6, which are dependent on ERK, JNK and p38 MAPKs activation. These results may imply that proinflammatory cytokines have important roles in inflammatory responses to N. fowleri infection. © 2012 Blackwell Publishing Ltd.

  8. Intracellular mature IL-37 suppresses tumor metastasis via inhibiting Rac1 activation.

    PubMed

    Li, Y; Zhao, M; Guo, C; Chu, H; Li, W; Chen, X; Wang, X; Li, Y; Jia, Y; Koussatidjoa, S; Zhu, F; Wang, J; Wang, X; Wang, Q; Zhao, W; Shi, Y; Chen, W; Zhang, L

    2018-02-22

    IL-37, a newly found anti-inflammatory cytokine of the IL-1 family, has both extracellular and intracellular functions. Accumulating evidences indicate that it is also involved in tumor progression. However, the mechanism and its intracellular target are unclear. In this study, clinical data from 84 patients showed that loss or reduced expression of IL-37 in lung adenocarcinoma tissues was significantly associated with tumor metastasis. We further provided evidence that IL-37 inhibited effectively tumor metastasis in vitro and in vivo. Moreover, we uncovered a novel mechanism by which IL-37 suppressed tumor cell migration via its intracellular mature form (amino acids 46-218). Intracellular mature form of IL-37, but not its extracellular form, markedly inhibited migration of multiple kinds of tumor cells through inhibiting Rac1 activation. Mechanistically, intracellular mature IL-37 directly bound to the CAAX motif in the C-terminal hypervariable region of Rac1, and then inhibited Rac1 membrane translocation and subsequent downstream signaling. Our research identifies intracellular mature IL-37 as a novel endogenous inhibitor of Rac1. Given the crucial roles of Rac1 in tumor angiogenesis and metastasis, intracellular mature IL-37 might serve as a potential strategy for the control of Rac1 activity and tumor progression.

  9. Norepinephrine upregulates VEGF, IL-8, and IL-6 expression in human melanoma tumor cell lines: implications for stress-related enhancement of tumor progression

    PubMed Central

    Yang, Eric V.; Kim, Seung-jae; Donovan, Elise L.; Chen, Min; Gross, Amy C.; Webster Marketon, Jeanette I.; Barsky, Sanford H.; Glaser, Ronald

    2009-01-01

    Studies suggest that stress can be a co-factor for the initiation and progression of cancer. The catecholamine stress hormone, norepinephrine (NE), may influence tumor progression by modulating the expression of factors implicated in angiogenesis and metastasis. The goal of this study was to examine the influence of NE on the expression of VEGF, IL-8, and IL-6 by the human melanoma cell lines, C8161, 1174MEL, and Me18105. Cells were treated with NE and levels of VEGF, IL-8, and IL-6 were measured using ELISA and real-time PCR. The expression of β-adrenergic receptors (β-ARs) mRNA and protein were also assessed. Finally, immunohistochemitry was utilized to examine the presence of β1- and β2-AR in primary and metastatic human melanoma biopsies. We show that NE treatment upregulated production of VEGF, IL-8, and IL-6 in C8161 cells and to a lesser extent 1174MEL and Me18105 cells. The upregulation was associated with induced gene expression. The effect on C8161 cells was mediated by both β1- and β2-ARs. Furthermore, 18 of 20 melanoma biopsies examined expressed β2-AR while 14 of 20 melanoma biopsies expressed β1-AR. Our data support the hypothesis that NE can stimulate the aggressive potential of melanoma tumor cells, in part, by inducing the production VEGF, IL-8, and IL-6. This line of research further suggests that interventions targeting components of the activated sympathetic-adrenal medullary (SAM) axis, or the utilization of β-AR blocking agents, may represent new strategies for slowing down the progression of malignant disease and improving cancer patients’ quality of life. PMID:18996182

  10. TNF-{alpha} similarly induces IL-6 and MCP-1 in fibroblasts from colorectal liver metastases and normal liver fibroblasts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mueller, Lars, E-mail: lars.mueller@uksh-kiel.de; Seggern, Lena von; Schumacher, Jennifer

    2010-07-02

    Cancer-associated fibroblasts (CAFs) represent the predominant cell type of the neoplastic stroma of solid tumors, yet their biology and functional specificity for cancer pathogenesis remain unclear. We show here that primary CAFs from colorectal liver metastases express several inflammatory, tumor-enhancing factors, including interleukin (IL)-6 and monocyte-chemoattractant protein (MCP)-1. Both molecules were intensely induced by TNF-{alpha} on the transcript and protein level, whereas PDGF-BB, TGF-{beta}1 and EGF showed no significant effects. To verify their potential specialization for metastasis progression, CAFs were compared to fibroblasts from non-tumor liver tissue. Interestingly, these liver fibroblasts (LFs) displayed similar functions. Further analyses revealed a comparablemore » up-regulation of intercellular adhesion molecule-1 (ICAM-1) by TNF-{alpha}, and of alpha-smooth muscle actin, by TGF-{beta}1. Moreover, the proliferation of both cell types was induced by PDGF-BB, and CAFs and LFs displayed an equivalent migration towards HT29 colon cancer cells in Boyden chamber assays. In conclusion, colorectal liver metastasis may be supported by CAFs and resident fibroblastic cells competent to generate a prometastatic microenvironment through inflammatory activation of IL-6 and MCP-1.« less

  11. β-cell-specific IL-2 therapy increases islet Foxp3+Treg and suppresses type 1 diabetes in NOD mice.

    PubMed

    Johnson, Mark C; Garland, Alaina L; Nicolson, Sarah C; Li, Chengwen; Samulski, R Jude; Wang, Bo; Tisch, Roland

    2013-11-01

    Interleukin-2 (IL-2) is a critical cytokine for the homeostasis and function of forkhead box p3-expressing regulatory T cells (Foxp3(+)Tregs). Dysregulation of the IL-2-IL-2 receptor axis is associated with aberrant Foxp3(+)Tregs and T cell-mediated autoimmune diseases such as type 1 diabetes. Treatment with recombinant IL-2 has been reported to enhance Foxp3(+)Tregs and suppress different models of autoimmunity. However, efficacy of IL-2 therapy is dependent on achieving sufficient levels of IL-2 to boost tissue-resident Foxp3(+)Tregs while avoiding the potential toxic effects of systemic IL-2. With this in mind, adeno-associated virus (AAV) vector gene delivery was used to localize IL-2 expression to the islets of NOD mice. Injection of a double-stranded AAV vector encoding IL-2 driven by a mouse insulin promoter (dsAAVmIP-IL2) increased Foxp3(+)Tregs in the islets but not the draining pancreatic lymph nodes. Islet Foxp3(+)Tregs in dsAAVmIP-IL2-treated NOD mice exhibited enhanced fitness marked by increased expression of Bcl-2, proliferation, and suppressor function. In contrast, ectopic IL-2 had no significant effect on conventional islet-infiltrating effector T cells. Notably, β-cell-specific IL-2 expression suppressed late preclinical type 1 diabetes in NOD mice. Collectively, these findings demonstrate that β-cell-specific IL-2 expands an islet-resident Foxp3(+)Tregs pool that effectively suppresses ongoing type 1 diabetes long term.

  12. Inhibition of cytokine response to TLR stimulation and alleviation of collagen-induced arthritis in mice by Schistosoma japonicum peptide SJMHE1.

    PubMed

    Wang, Xuefeng; Li, Li; Wang, Jun; Dong, Liyang; Shu, Yang; Liang, Yong; Shi, Liang; Xu, Chengcheng; Zhou, Yuepeng; Wang, Yi; Chen, Deyu; Mao, Chaoming

    2017-03-01

    Helminth-derived products have recently been shown to prevent the development of inflammatory diseases in mouse models. However, most identified immunomodulators from helminthes are mixtures or macromolecules with potentially immunogenic side effects. We previously identified an immunomodulatory peptide called SJMHE1 from the HSP60 protein of Schistosoma japonicum. In this study, we assessed the ability of SJMHE1 to affect murine splenocytes and human peripheral blood mononuclear cells (PBMCs) stimulated by toll-like receptor (TLR) ligands in vitro and its treatment effect on mice with collagen-induced arthritis (CIA). We show that SJMHE1 not only modulates the cytokine production of murine macrophage (MΦ) and dendritic cell but also affects cytokine production upon coculturing with allogeneic CD4 + T cell. SJMHE1 potently inhibits the cytokine response to TLR ligands lipopolysaccharide (LPS), CpG oligodeoxynucleotides (CpG) or resiquimod (R848) from mouse splenocytes, and human PBMCs stimulated by LPS. Furthermore, SJMHE1 suppressed clinical signs of CIA in mice and blocked joint erosion progression. This effect was mediated by downregulation of key cytokines involved in the pathogenesis of CIA, such as interferon-γ (IFN-γ), tumour necrosis factor-α (TNF-α), interleukin (IL)-6, IL-17, and IL-22 and up-regulation of the inhibitory cytokine IL-10, Tgf-β1 mRNA, and CD4 + CD25 + Foxp3 + Tregs. This study provides new evidence that the peptide from S. japonicum, which is the 'safe' selective generation of small molecule peptide that has evolved during host-parasite interactions, is of great value in the search for novel anti-inflammatory agents and therapeutic targets for autoimmune diseases. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  13. Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

    NASA Astrophysics Data System (ADS)

    Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

    1997-09-01

    Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

  14. Circulating blood levels of IL-6, IFN-γ, and IL-10 as potential diagnostic biomarkers in gastric cancer: a controlled study.

    PubMed

    Sánchez-Zauco, Norma; Torres, Javier; Gómez, Alejandro; Camorlinga-Ponce, Margarita; Muñoz-Pérez, Leopoldo; Herrera-Goepfert, Roberto; Medrano-Guzmán, Rafael; Giono-Cerezo, Silvia; Maldonado-Bernal, Carmen

    2017-05-30

    Gastric adenocarcinoma is the third most common cause of cancer-associated death worldwide. Helicobacter pylori infection activates a signaling cascade that induces production of cytokines and chemokines involved in the chronic inflammatory response that drives carcinogenesis. We evaluated circulating cytokines and chemokines as potential diagnostic biomarkers for gastric cancer. We included 201 healthy controls and 162 patients with distal gastric cancer who underwent primary surgical resection between 2009 and 2012 in Mexico City. The clinical and pathological data of patients were recorded by questionnaire, and the cancer subtype was classified as intestinal or diffuse. Pathological staging of cancer was based on the tumor-node-metastasis staging system of the International Union Against Cancer. Concentrations of IL-1β, IL-6, TNF-α, IL-10, and MCP-1 in serum were measured using multiplex analyte profiling technology and concentrations of IL-8, IFN-γ, and TGF-β in plasma were measured using enzyme-linked immunosorbent assay. Levels of IL-1β, IL-6, IFN-γ, and IL-10 were significantly higher and that of MCP-1 was lower in gastric cancer patients compared with controls. No differences in IL-8 or TNF-α levels were observed between gastric cancer and controls. IFN-γ and IL-10 were significantly higher in both intestinal and diffuse gastric cancer, whereas IL-1β and IL-6 were higher and TGF-β lower only in intestinal gastric cancer; MCP-1 was lower only in diffuse gastric cancer. IFN-γ and IL-10 levels were significantly higher in early (I/II) and late stage (III/IV) gastric cancer; IL-1β and IL-8 were higher and MCP-1 was lower only in late stage (IV) patients. Receiver-operating characteristic analysis showed that for diagnosis of GC, IL-6 had high specificity (0.97) and low sensitivity (0.39), IL-10 had moderate specificity (0.82) and low sensitivity (0.48), and IL-1β and IFN-γ showed low specificity (0.43 and 0.53, respectively) and moderate

  15. Interdependent and independent roles of type I interferons and IL-6 in innate immune, neuroinflammatory and sickness behaviour responses to systemic poly I:C

    PubMed Central

    Murray, Carol; Griffin, Éadaoin W.; O’Loughlin, Elaine; Lyons, Aoife; Sherwin, Eoin; Ahmed, Suaad; Stevenson, Nigel J; Harkin, Andrew; Cunningham, Colm

    2015-01-01

    Type I interferons (IFN-I) are expressed in the brain during many inflammatory and neurodegenerative conditions and have multiple effects on CNS function. IFN-I is readily induced in the brain by systemic administration of the viral mimetic, poly I:C (synthetic double-stranded RNA). We hypothesised that IFN-I contributes to systemically administered poly I:C-induced sickness behaviour, metabolic and neuroinflammatory changes. IFN-I receptor 1 deficient mice (IFNAR1−/−) displayed significantly attenuated poly I:C-induced hypothermia, hypoactivity and weight loss compared to WT C57BL/6 mice. This amelioration of sickness was associated with equivalent IL-1β and TNF-α responses but much reduced IL-6 responses in plasma, hypothalamus and hippocampus of IFNAR1−/− mice. IFN-β injection induced trivial IL-6 production and limited behavioural change and the poly I:C-induced IFN-β response did not preceed, and would not appear to mediate, IL-6 induction. Rather, IFNAR1−/− mice lack basal IFN-I activity, have lower STAT1 levels and show significantly lower levels of several inflammatory transcripts, including stat1. Basal IFN-I activity appears to play a facilitatory role in the full expression of the IL-6 response and activation of the tryptophan-kynurenine metabolism pathway. The deficient IL-6 response in IFNAR1−/− mice partially explains the observed incomplete sickness behaviour response. Reconstitution of circulating IL-6 revealed that the role of IFNAR in burrowing activity is mediated via IL-6, while IFN-I and IL-6 have additive effects on hypoactivity, but the role of IFN-I in anorexia is independent of IL-6. Hence, we have demonstrated both interdependent and independent roles for IFN-I and IL-6 in systemic inflammation-induced changes in brain function. PMID:25900439

  16. Interdependent and independent roles of type I interferons and IL-6 in innate immune, neuroinflammatory and sickness behaviour responses to systemic poly I:C.

    PubMed

    Murray, Carol; Griffin, Éadaoin W; O'Loughlin, Elaine; Lyons, Aoife; Sherwin, Eoin; Ahmed, Suaad; Stevenson, Nigel J; Harkin, Andrew; Cunningham, Colm

    2015-08-01

    Type I interferons (IFN-I) are expressed in the brain during many inflammatory and neurodegenerative conditions and have multiple effects on CNS function. IFN-I is readily induced in the brain by systemic administration of the viral mimetic, poly I:C (synthetic double-stranded RNA). We hypothesised that IFN-I contributes to systemically administered poly I:C-induced sickness behaviour, metabolic and neuroinflammatory changes. IFN-I receptor 1 deficient mice (IFNAR1(-/-)) displayed significantly attenuated poly I:C-induced hypothermia, hypoactivity and weight loss compared to WT C57BL/6 mice. This amelioration of sickness was associated with equivalent IL-1β and TNF-α responses but much reduced IL-6 responses in plasma, hypothalamus and hippocampus of IFNAR1(-/-) mice. IFN-β injection induced trivial IL-6 production and limited behavioural change and the poly I:C-induced IFN-β response did not preceed, and would not appear to mediate, IL-6 induction. Rather, IFNAR1(-/-) mice lack basal IFN-I activity, have lower STAT1 levels and show significantly lower levels of several inflammatory transcripts, including stat1. Basal IFN-I activity appears to play a facilitatory role in the full expression of the IL-6 response and activation of the tryptophan-kynurenine metabolism pathway. The deficient IL-6 response in IFNAR1(-/-) mice partially explains the observed incomplete sickness behaviour response. Reconstitution of circulating IL-6 revealed that the role of IFNAR in burrowing activity is mediated via IL-6, while IFN-I and IL-6 have additive effects on hypoactivity, but the role of IFN-I in anorexia is independent of IL-6. Hence, we have demonstrated both interdependent and independent roles for IFN-I and IL-6 in systemic inflammation-induced changes in brain function. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

    PubMed Central

    Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

    2013-01-01

    Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the

  18. HILIC quantification of oenotheralanosterol A and B from Oenothera biennis and their suppression of IL-6 and TNF-α expression in mouse macrophages.

    PubMed

    Singh, Rashmi; Trivedi, Priyanka; Bawankule, Dnyaneshwar Umrao; Ahmad, Ateeque; Shanker, Karuna

    2012-05-07

    Evening primrose (Oenothera biennis L.) is a wild medicinal herb of Central American origin that is now globally widespread. Its traditional uses include treatment of rheumatoid arthritis and premenopausal pain both of which have an inflammatory component. The present study demonstrates the in vitro anti-inflammatory activity of three Oenothera biennis compounds. Oenotheralanosterol A and B (Oen-A & Oen-B) along with gallic acid (GA) were isolated and characterized using column chromatography and NMR. The compounds were tested with LPS stimulated peritoneal mouse macrophages assaying for suppression of IL-6, TNF-α and NO synthesis. An HILIC method for the simultaneous quantitation of GA, Oen-A, and Oen-B in Oenothera biennis plant material was also developed as a means of monitoring quality of plant material. Significant inhibition of TNF-α and IL-6 by GA, Oen-A and Oen-B was observed (p<0.05). Inhibition was concentration dependent and no synergistic or antagonistic effect on pro-inflammatory cytokines was found when used in combination (1:1) (p>0.05). The HILIC analysis method was validated using Oenothera biennis root. The study demonstrates the anti-inflammatory activity of Oenothera biennis root compounds and supports its traditional use in arthritis management. Active anti-inflammatory compounds were identified and quantified by the HILIC method. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  19. Ceftriaxone attenuates acquisition and facilitates extinction of cocaine-induced suppression of saccharin intake in C57BL/6J mice

    PubMed Central

    Freet, Christopher S.; Lawrence, Antoneal L.

    2015-01-01

    Growing evidence implicates glutamate homeostasis in a number of behaviors observed in addiction such as acquisition of drug taking, motivation, and reinstatement. To date, however, the role of glutamate homeostasis in the avoidance of natural rewards due to exposure to drugs of abuse has received little attention. The aim of the current study was to evaluate the beta-lactam antibiotic, ceftriaxone, which has been shown to normalize disrupted glutamate homeostasis associated with exposure to drugs of abuse, in cocaine-induced suppression of saccharin intake in C57BL/6J mice. Briefly, C57BL/6J mice received daily injections of either 200 mg/kg ceftriaxone or saline. Mice were then given access to 0.15% saccharin for 1 hour and immediately injected intraperitoneally with either saline or 30 mg/kg cocaine; taste-drug pairings occurred every 24 hours for 5 trials followed by a final CS only trial. One week following taste-drug pairings, extinction was evaluated in a series of one- and two-bottle saccharin intake tests. Individual differences in cocaine-induced suppression were observed (i.e., low and high suppressors) with differential effects of ceftriaxone. Ceftriaxone delayed suppression of saccharin intake in high suppressors but prevented suppression in low suppressors. In addition, ceftriaxone history facilitated extinction in the high suppressors. These data suggest that changes in glutamate homeostasis may be involved in the formation and expression of cocaine-induced suppression of saccharin intake in mice. PMID:26066719

  20. Ceftriaxone attenuates acquisition and facilitates extinction of cocaine-induced suppression of saccharin intake in C57BL/6J mice.

    PubMed

    Freet, Christopher S; Lawrence, Antoneal L

    2015-10-01

    Growing evidence implicates glutamate homeostasis in a number of behaviors observed in addiction such as acquisition of drug taking, motivation, and reinstatement. To date, however, the role of glutamate homeostasis in the avoidance of natural rewards due to exposure to drugs of abuse has received little attention. The aim of the current study was to evaluate the beta-lactam antibiotic, ceftriaxone, which has been shown to normalize disrupted glutamate homeostasis associated with exposure to drugs of abuse, in cocaine-induced suppression of saccharin intake in C57BL/6J mice. Briefly, C57BL/6J mice received daily injections of either 200mg/kg ceftriaxone or saline. Mice were then given access to 0.15% saccharin for 1h and immediately injected intraperitoneally with either saline or 30 mg/kg cocaine; taste-drug pairings occurred every 24h for 5 trials followed by a final CS only trial. One week following taste-drug pairings, extinction was evaluated in a series of one- and two-bottle saccharin intake tests. Individual differences in cocaine-induced suppression were observed (i.e., low and high suppressors) with differential effects of ceftriaxone. Ceftriaxone delayed suppression of saccharin intake in high suppressors but prevented suppression in low suppressors. In addition, ceftriaxone history facilitated extinction in the high suppressors. These data suggest that changes in glutamate homeostasis may be involved in the formation and expression of cocaine-induced suppression of saccharin intake in mice. Copyright © 2015. Published by Elsevier Inc.